Lipid nanoparticle formulations of trems
LNP-formulated TREMs enhance the delivery and readthrough of premature termination codons, addressing genetic disorders by increasing protein expression and functional rescue.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- FLAGSHIP PIONEERING INNOVATIONS VI LLC
- Filing Date
- 2025-09-30
- Publication Date
- 2026-07-09
Smart Images

Figure IMGF000007_0001 
Figure IMGF000128_0001 
Figure IMGF000130_0001
Abstract
Description
[0001] LIPID NANOPARTICLE FORMULATIONS OF TREMS
[0002] CLAIM OF PRIORITY
[0003] This application claims priority to U.S. Provisional Application No. 63 / 701,485, filed on September 30, 2024; U.S. Provisional Application No. 63 / 701,488, filed on September 30, 2024; U.S. Provisional Application No. 63 / 728,031, filed on December 4, 2024; U.S. Provisional Application No. 63 / 728,036, filed on December 4, 2024; U.S. Provisional Application No.
[0004] 63 / 804,391, filed on May 12, 2025; U.S. Provisional Application No. 63 / 804,395, filed on May 12, 2025; U.S. Provisional Application No. 63 / 868,163, filed on August 21, 2025; U.S.
[0005] Provisional Application No. 63 / 868,160, filed on August 21, 2025; U.S. Provisional Application No. 63 / 884,859, filed on September 19, 2025; and U.S. Provisional Application No. 63 / 884,876, filed on September 19, 2025. The entire contents of each of the foregoing applications are incorporated herein by reference in their entirety.
[0006] BACKGROUND
[0007] Transfer RNAs (tRNAs) are complex, naturally occurring RNA molecules that possess a number of functions including initiation and elongation of proteins.
[0008] SUMMARY
[0009] The present disclosure features modified tRNA-based effector molecules (TREMs) formulated in lipid nanoparticles, as well as related compositions and uses thereof. TREMs are complex molecules which can mediate a variety of cellular processes. For example, the TREMs described herein may have the ability to: (i) support protein synthesis, (ii) be charged by a tRNA synthetase, (iii) be bound by an elongation factor, (iv) introduce an amino acid into a peptide chain, (v) support protein elongation, or (vi) support initiation of protein synthesis, e.g., in a cell.
[0010] BRIEF DESCRIPTION OF DRAWINGS FIG. 1 shows dose-dependent increase in p53 protein and downstream target p21 in Calu-6 cells following SEQ ID NO: 2 transfections. Calu-6 cells were transfected with increasing doses of SEQ ID NO: 2 and SEQ ID NO: 3 and p53 protein was measured after 24 hours. FIG.
[0011] 1A is an image of a Western blot for full-length p53 protein in cells transfected with SEQ IDNO: 2; a total protein stain was used as a loading control for normalization. FIG. IB is a graph showing quantification of p53 expression in response to 1.56-12.5 nM SEQ ID NO: 2 and SEQ ID NO: 3 delivery. p53 protein rescue is shown as signal intensity in Calu-6 cells relative to wildtype (WT) p53 signal in a positive control cell line. FIG. 1C is an image of a Western blot for full-length p21 protein in cells transfected with SEQ ID NO: 2 at 48 hours; a total protein stain was used as a loading control for normalization. FIG. ID is a graph showing quantification of p21 expression in response to 1.56-12.5 nM SEQ ID NO: 2 and SEQ ID NO: 3 delivery. p21 protein expression is shown as signal intensity in Calu-6 cells relative to WT p21 signal in a positive control cell line.
[0012] FIG. 2 shows readthrough of a premature termination codon (PTC) by SEQ ID NO: 2 in the phenylalanine hydroxylate (PAH) gene in human HepG2 cells. FIG. 2A is an image of a Western blot of PAH protein expression in PKU HepG2 cells transfected with 0.4-50 nM SEQ ID NO: 248 hours post-transfection. The WT Mock sample was diluted down and the equivalent of 10% of WT MMUT protein was loaded. FIG. 2B is a graph showing quantification of PAH protein (relative to WT Mock) at 48 hours post-transfection in cells transfected with 0.4-12.5 nM of SEQ ID NO: 2 and SEQ ID NO: 3.
[0013] FIG.3 shows premature termination codon (PTC) readthrough in the MMUT gene and functional rescue by SEQ ID NO: 2 in an in vitro MMA disease model (MMA HLCs). MMA HLCs were transfected with different doses of SEQ ID NO: 2 ranging from 0.4-100 nM using Lipofectamine 3000. SEQ ID NO: 3 was included at 50 nM as a benchmarking control; in addition, mock-transfected MMA HLCs were included as negative controls. Mock-transfected and SEQ ID NO: 3-transfected isogenic control HLCs were also included as positive (100% MMUT expression) and transfection controls. FIG.3A is an image of a Western blot for MMUT protein expression in transfected MMA HLCs at 96 hours post-transfection. FIG. 3B is a graph showing quantification of MMUT protein in cells transfected with 0.4-50 nM SEQ ID NO: 2 at 96 hours post -transfection as a percentage of WT MMUT protein. FIG.3C is a graph showing quantification of MMUT protein and MMA metabolite at 96 hours post-transfection at various SEQ ID NO: 2 doses.
[0014] FIG. 4 is a graph showing total SEQ ID NO: 3 and SEQ ID NO: 2 abundance in liver as measured by tRNA-Seq following a single administration of 3 mg / kg of SEQ ID NO: 3 or SEQ ID NO: 2 in a human / murine pharmacodynamic MMA mouse model. Adult transgenic MMAmice were dosed with LNP1 -formulated SEQ ID NO: 3 or SEQ ID NO: 2 (IV), and liver samples were collected at 96- and 336-hours post-dose. Each group contained 5 animals.
[0015] FIG. 5 is a graph showing human MMUT mRNA levels in liver following a single administration of 3 mg / kg of SEQ ID NO: 3 or SEQ ID NO: 2 in a human / murine pharmacodynamic MMA mouse model. Adult transgenic MMA mice were dosed with LNP1-formulated SEQ ID NO: 3 or SEQ ID NO: 2 (IV), and liver samples were collected at 96- and 336-hours post-dose. Each group contained 5 animals. Human MMUT mRNA levels in liver as measured by mRNAseq.
[0016] FIG. 6 is a graph showing human MMUT protein levels in liver following a single administration of 3 mg / kg of SEQ ID NO: 3 or SEQ ID NO: 2 in a human / murine pharmacodynamic MMA mouse model. Adult transgenic MMA mice were dosed with LNP1-formulated SEQ ID NO: 3 or SEQ ID NO: 2 (IV), and liver samples were collected at 96- and 336-hours post-dose. Each group contained 5 animals. LC-MS quantification of human MMUT protein in liver was determined using a human MMUT-specific peptide and expressed as fold change over SEQ ID NO: 3 treated group.
[0017] FIG. 7 is a graph showing human MMUT mRNA ribosome occupancy in liver following a single administration of 3 mg / kg of SEQ ID NO: 3 or SEQ ID NO: 2 in a human / murine pharmacodynamic MMA mouse model. Adult transgenic MMA mice were dosed with LNP1-formulated SEQ ID NO: 3 or SEQ ID NO: 2 (IV), and liver samples were collected at 96- and 336-hours post-dose. Each group contained 5 animals. Human MMUT mRNA ribosome occupancy in liver as measured by Ribo-Seq and expressed as reads per kilobase per million mapped reads (RPKM).
[0018] FIG. 8 is a graph showing human MMUT mRNA levels in liver following single administration of 3 mg / kg of SEQ ID NO: 3 or SEQ ID NO: 2 in a human / murine MMA pharmacodynamic mouse model. Adult transgenic MMA mice were dosed with LNP2-formulated SEQ ID NO: 3 or SEQ ID NO: 2 (IV), and liver samples were collected at 96- and 336-hours post-dose. Two different SEQ ID NO: 2 formulations were tested: SEQ ID NO: 2 in LNP2 N / P 6 and SEQ ID NO: 2 in LNP2 N / P 3. Each group contained 3-5 animals. Human MMUT mRNA levels in liver as measured by mRNAseq.FIG. 9 is a graph showing total SEQ ID NO: 3 concentration upon administration of an IV bolus dose of 5 mg / kg. SEQ ID NO: 3 encapsulated in LNP1 and LNP2 formulations of various N / P ratios were compared.
[0019] FIG. 10 is a graph showing a comparison of liver area under the curve from 0-72 hours (AUCo-72h) of TREM upon administration of an IV bolus dose of 5 mg / kg SEQ ID NO: 3 in LNP1 and LNP2 with various N / P ratios.
[0020] FIG. 11 is a schematic showing the chemical structure of SEQ ID NO: 2.
[0021] FIG. 12 is a graph showing murine PAH protein (mPAH) levels in the liver following administration of SEQ ID NO: 2 in LNP2 at an IV dose of 3 mg / kg.
[0022] FIG. 13 is a set of fluorescent microscopy images showing PAH mRNA in hepatocytes following administration of SEQ ID NO: 2 in LNP2 at an IV dose of 3 mg / kg. Yellow indicates PAH mRNA and blue indicates cell nuclei.
[0023] FIG. 14 is a graph showing murine PAH protein (mPAH) levels and plasma phenylalanine (Phe) levels following administration of SEQ ID NO: 2 in LNP2 at an IV dose of 3 mg / kg.
[0024] FIG. 15 is a set of graphs showing murine PAH protein levels and plasma phenylalanine (Phe) levels following administration of SEQ ID NO: 2 in LNP2 to mice at an IV dose of 1, 3, or 10 mg / kg. FIG. 15A shows PAH protein levels in the liver 24-240 hours post-administration.
[0025] FIG. 15B shows plasma Phe levels 8-240 hours post-administration.
[0026] FIG. 16 is a set of graphs showing human MMUT (hMMUT) protein levels and hMMut mRNA ribosome occupancy following administration of SEQ ID NO: 2 in LNP2 to mice at an IV dose of 1, 3, or 10 mg / kg. FIG. 16A shows hMMUT protein levels in the liver at 4, 14, and 21 days post-administration. FIG. 16B shows hMMut mRNA ribosome occupancy in the liver between 1 and 28 days post-administration.
[0027] FIG. 17 is a graph showing cytokine levels following administration of SEQ ID NO: 2 in LNP2 to non-human primates at an IV dose of 2 mg / kg.
[0028] FIG. 18 is a set of graphs showing plasma and liver concentrations of SEQ ID NO: 1 following administration to mice or non-human primates. FIG. 18A shows plasma concentrations of SEQ ID NO: 1 in mice at approximately 0.25, 0.5, 1, 4, 1024, 48, 72, and 168 hours after a single IV dose of 3 mg / kg. FIG. 18B shows naturally modified and total liver concentrations of SEQ ID NO: 1 in mice at approximately 1, 4, 24, and 168 hours after a singleIV dose of 3 mg / kg. FIG. 18C shows plasma concentrations of SEQ ID NO: 1 in non-human primates at approximately 0.25, 0.5, 1, 1.5, 2, 3, 4, 8, 1424, and 48 hours after a single IV dose of 2 mg / kg. FIG. 18D shows naturally modified and total liver concentrations of SEQ ID NO: 1 in non-human primates at approximately 1, 25, and 73 hours after a single IV dose of 2 mg / kg.
[0029] FIG. 19 is a set of graphs showing SEQ ID NO: 2 abundance, murine PAH (mPAH) protein levels in liver, and plasma phenylalanine (Phe) levels following administration of SEQ ID NO: 2 in LNP2 after 1, 2 or 4 weekly IV doses of 3 or 5 mg / kg in a murine pharmacodynamic and efficacy PKU mouse model. FIG. 19A shows total SEQ ID NO: 2 abundance in liver as measured by tRNA-Seq following 1, 2 or 4 weekly administrations. FIG. 19B shows naturally modified SEQ ID NO: 2 abundance in liver as measured by tRNA-Seq following 1, 2 or 4 weekly administrations. FIG. 19C shows mPAH protein levels in liver as measured by capillary electrophoresis following 1, 2 or 4 weekly administrations. FIG. 19D shows plasma Phe levels as measured by LC / MC following 1, 2 or 4 weekly administrations. Samples were taken at 72 or 96 hours post-dosing. Each group contained 3-5 animals.
[0030] DETAILED DESCRIPTION OF CERTAIN EMBODIMENTS
[0031] The present disclosure features lipid nanoparticle formulations of tRNA-based effector molecules (TREMs), as well as compositions and related methods. As disclosed herein, TREMs are complex molecules which can mediate a variety of cellular processes. The inventors have discovered that the delivery of a TREM to a cell or subject may be optimized by encapsulating the TREM in a particular lipid nanoparticle. In an embodiment, the lipid nanoparticle formulation of a TREM is used to provide improved readthrough of a premature termination codon (PTC), in a transcript. In another embodiment, the lipid nanoparticle formulation of a TREM is used to treat a subject having a PTC disease or disorder.
[0032] Lipid nanoparticle TREM compositions, e.g., the TREMs described herein, can be administered to a cell, a tissue, or to a subject to modulate certain cellular functions. Also disclosed herein are methods of modulating expression of a protein in a subject or cell, wherein the protein is encoded by a nucleic acid comprising an endogenous open reading frame (ORF) having a first sequence, e.g., a mutation, e.g., a premature termination codon (PTC), and methods of treating a subject having an endogenous open reading frame (ORF) which comprises apremature termination codon (PTC). Further disclosed herein are TREMs comprising a non-naturally occurring modification, methods of making the same and compositions thereof.
[0033] Definitions
[0034] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as is commonly understood by one of skill in the art to which this disclosure belongs. As used in the specification and claims, the singular form “a”, “an” and “the” include plural references unless the context clearly dictates otherwise.
[0035] “Acquire” or “acquiring” as the terms are used herein, refer to obtaining possession of a value, e.g., a numerical value, by “directly acquiring” or “indirectly acquiring” the physical entity or value. “Directly acquiring” refers to performing a process (e.g., performing an analytical method) to obtain the value. “Indirectly acquiring” refers to receiving the value from another party or source (e.g., a third party laboratory that directly acquired the value).
[0036] “Lipid nanoparticle,” as used herein, refers to a particle having at least one dimension on the order of nanometers (i.e., less than 1000 nm), and which comprises a lipid component. Nonlimiting examples of lipid nanoparticles include liposomes, micelles, and solid lipid nanoparticles. In preferred embodiments, lipid nanoparticle refers to a solid lipid nanoparticle.
[0037] In some embodiments, a lipid nanoparticle may further comprise non-lipid components. In some embodiments, a lipid nanoparticle comprises a therapeutic agent (e.g, a nucleic acid, e.g., a tRNA).
[0038] “Lipid component,” as used herein, refers to any lipid or mixtures thereof which are present in a lipid nanoparticle. The lipid component typically includes a combination of ionizable lipids, neutral lipids, pegylated lipids, and sterols.
[0039] “Non-lipid component,” as used herein, refers to any other additive to the lipid nanoparticle besides the lipid component. Non-limiting examples of non-lipid components include buffers, salts, carbohydrates, preservatives, surfactants, excipients, or emulsifiers.
[0040] “Ionizable lipid,” as used herein, refers to a lipid that can exist in a charged or neutral form depending on pH. Ionizable lipids may refer to a lipid comprising one or more charged moieties. In some embodiments, an ionizable lipid may be positively charged or negatively charged.“Cationic lipid,” as used herein, refers to an ionizable lipid that has a net positive formal charge. In some embodiments, the cationic lipid only has a net formal charge at a relevant pH (e.g., acidic pH, e.g., pH of a late endosome or lysosome), while having a formal charge of zero at another relevant pH (e.g., physiological pH). A cationic lipid may comprise one or more charged moieties.
[0041] “Neutral lipid,” as used herein, refers to a lipid species that exists either in an uncharged or neutral zwitterionic form at a relevant pH (e.g., physiological pH). Non-limiting examples of neutral lipids include phosphatidylcholine, phosphatidylethanolamine, phosphatidyl serine, phosphatidylinositol, phosphatidic acid, palmitoyloleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine, dipalmitoylphosphatidylcholine, dioleoylphosphatidylcholine, distearoylphosphatidylcholine, and dilinoleoylphosphatidylcholine, and derivatives thereof.
[0042] “Sterol,” as used herein, refers to an organic compound comprising the following core structure:
[0043] 15
[0044] 2 ^8
[0045] 9 10
[0046] 3 5
[0047]
[0048] , wherein substitution is allowed at any of positions 1 to 16. Non-limiting examples of sterols include cholesterol, campesterol, P-sitosterol, brassicasterol, ergosterol, dehydroergosterol, stigmasterol, fucosterol, and derivatives thereof. In some embodiments, sterol refers to cholesterol or a derivative thereof.
[0049] “Polymer-conjugated lipid,” as used herein, refers to a molecule comprising both a lipid portion and a polymer portion.
[0050] “Pegylated lipid,” as used herein, refers to a molecule comprising both a lipid portion and a polyethylene glycol (PEG) portion. Without wishing to be bound by theory, pegylated lipids may help to inhibit lipid nanoparticle aggregation, increase serum half-life, and decrease immune recognition of lipid nanoparticles. Non-limiting examples of pegylated lipids include PEG-diacylglycerol (PEG-DAG), PEG-dimyristoylglycerol (PEG-DMG), PEG-phosphatidylethanoloamine (PEG-PE), PEG-succinate diacylglycerol (PEG-S-DAG), and PEG-ceramide (PEG-CER).A “disease or disorder associated with a PTC” as that term is used herein includes, but is not limited to, a disease or disorder in which cells express, or at one time expressed, a polypeptide encoded by an ORF comprising a PTC. In some embodiments, a disease associated with a PTC is chosen from: a proliferative disorder (e.g., a cancer), a genetic disorder, a metabolic disorder, an immune disorder, an inflammatory disorder or a neurological disorder. Exemplary diseases or disorders associated with a PTC are provided in any one of Tables 10, 11 and 12. In an embodiment, the disease associated with a PTC is a cancer. In an embodiment, the disease associated with a PTC is a monogenic disease.
[0051] An “isoacceptor,” as that term is used herein, refers to a plurality of tRNA molecule or TREMs wherein each molecule of the plurality comprises a different naturally occurring anticodon sequence and each molecule of the plurality mediates the incorporation of the same amino acid and that amino acid is the amino acid that naturally corresponds to the anticodons of the plurality.
[0052] A “modification,” as that term is used herein in regard to a TREM, may refer to a sequence modification or a chemical modification of the TREM. As this term is used to in reference to a sequence modification, the modification may include a nucleotide addition, nucleotide deletion or nucleotide substitution. As this term is used in reference to a chemical modification, the modification may include a modification of the chemical structure, e.g., a covalent modification, of the subject nucleotide. The chemical modification can be naturally occurring or non-naturally occurring. In an embodiment, the modification is non-naturally occurring. In an embodiment, the modification is naturally occurring. In an embodiment, the modification is a synthetic modification. In an embodiment, the modification is a modification provided in Table 4.
[0053] A “naturally occurring nucleotide,” as that term is used herein, refers to a nucleotide that does not comprise a non-naturally occurring modification. In an embodiment, it includes a naturally occurring modification.
[0054] A “non-naturally occurring modification,” as that term is used herein with reference to a nucleotide, refers to a chemical modification that: (a) a cell, e.g., a human cell, does not make on an endogenous tRNA; or (b) a cell, e.g., a human cell, can make on an endogenous tRNA but wherein such modification is in a location in which it does not occur on a native tRNA, e.g., the modification is in a domain, linker or arm, or on a nucleotide and / or at a position within adomain, linker or arm, which does not have such modification in nature. In either case, the modification is added synthetically, e.g., in a cell free reaction, e.g., in a solid state or liquid phase synthetic reaction. In an embodiment, the non-naturally occurring modification is a modification that is not present (in identity, location or position) if a sequence of the TREM is expressed in a mammalian cell, e.g., a HEK293 cell line. Exemplary non-naturally occurring modifications are found in Table 4.
[0055] A “non-naturally modified nucleotide,” as that term is used herein, refers a nucleotide comprising a non-naturally occurring modification on or of a sugar, nucleobase, or phosphate moiety.
[0056] A “nucleotide,” as that term is used herein, refers to an entity comprising a sugar, typically a pentameric sugar; a nucleobase; and a phosphate linking group. In an embodiment, a nucleotide comprises a naturally occurring, e.g., naturally occurring in a human cell, nucleotide, e.g., an adenine, thymine, guanine, cytosine, or uracil nucleotide.
[0057] A “premature termination codon” or “PTC” as those terms are used herein, refer to a stop codon that occurs in an open reading frame (ORF) of a DNA or mRNA. In an embodiment, a PTC occurs at a position upstream of a naturally occurring stop codon in an ORF. In an embodiment, a PTC that occurs upstream of a naturally occurring stop codon, e.g., in an ORF, results in modulation of a production parameter of the corresponding mRNA or polypeptide encoded by the ORF. In an embodiment, a PTC can differ (or arise) from a pre-mutation sequence by a point mutation, e.g., a nonsense mutation. In an embodiment, a PTC can differ (or arise) from a pre-mutation sequence by a genetic change, e.g., abnormality, other than a point mutation, e.g., a frameshift, a deletion, an insertion, a rearrangement, an inversion, a translocation, a duplication, or a transversion. In an embodiment, a PTC results in the production of a truncated protein which lacks a native activity or which is associated with a mutant, disease, or other unwanted phenotype. In an embodiment, the ORF comprising the PTC is an ORF from a tumor suppressor gene. In an embodiment, the mutation giving rise to the PTC is a driver mutation, e.g., a mutation that provides a growth advantage to a tumor cell.
[0058] A “functional parameter,” refers to an expression parameter and / or a signaling parameter. In an embodiment a functional parameter is an expression parameter. An expression parameter includes an expression parameter of a polypeptide or protein encoded by the endogenous ORF having a first sequence or PTC; or an expression parameter of an RNA, e.g., messenger RNA,encoded by the endogenous ORF having a first sequence or PTC. In an embodiment, an expression parameter can include:
[0059] (a) protein translation;
[0060] (b) expression level (e.g., of polypeptide or protein, or mRNA);
[0061] (c) post-translational modification of polypeptide or protein;
[0062] (d) folding (e.g., of polypeptide or protein, or mRNA),
[0063] (e) structure e.g., of polypeptide or protein, or mRNA),
[0064] (f) transduction (e.g., of polypeptide or protein),
[0065] (g) compartmentalization (e.g., of polypeptide or protein, or mRNA),
[0066] (h) incorporation (e.g., of polypeptide or protein, or mRNA) into a supermolecular structure, e.g., incorporation into a membrane, proteasome, or ribosome,
[0067] (i) incorporation into a multimeric polypeptide, e.g., a homo or heterodimer, and / or (j) stability.
[0068] In an embodiment, a functional parameter is a signaling parameter. A signaling parameter can include:
[0069] (1) modulation of a signaling pathway, e.g., a cellular signaling pathway which is downstream or upstream of the protein encoded by the endogenous ORF having a first sequence or PTC;
[0070] (2) cell fate modulation;
[0071] (3) ribosome occupancy modulation;
[0072] (4) protein translation modulation;
[0073] (5) mRNA stability modulation;
[0074] (6) protein folding and structure modulation;
[0075] (7) protein transduction or compartmentalization modulation; and / or
[0076] (8) protein stability modulation.
[0077] An “ORF having a PTC” as that phrase is used herein, refers to an open reading frame (ORF) which comprises a premature termination codon (PTC). In an embodiment, the ORF having the PTC is associated with a disease or disorder associated with a PTC, e.g., as described herein, e.g., a disease or disorder listed in any one of Tables 9, 10, 11, and 12. In an embodiment, the ORF having the PTC is not associated with a disease or disorder associated with a PTC.
[0078] As used herein, the term “aqueous solution” refers to a composition comprising water.“Serum-stable” in relation to nucleic acid-lipid nanoparticles means that the nucleotide is not significantly degraded after exposure to a serum or nuclease assay that would significantly degrade free DNA or RNA. Suitable assays include, for example, a standard serum assay, a DNAse assay, or an RNAse assay.
[0079] “Systemic delivery,” as used herein, refers to delivery of a therapeutic product that can result in a broad exposure of an active agent within an organism. Some techniques of administration can lead to the systemic delivery of certain agents, but not others. Systemic delivery means that a useful, preferably therapeutic, amount of an agent is exposed to most parts of the body. Systemic delivery of lipid nanoparticles can be by any means known in the art including, for example, intravenous, intraarterial, subcutaneous, and intraperitoneal delivery. In some embodiments, systemic delivery of lipid nanoparticles is by intravenous delivery.
[0080] “Local delivery,” as used herein, refers to delivery of an active agent directly to a target site within an organism. For example, an agent can be locally delivered by direct injection into a disease site such as a tumor, other target site such as a site of inflammation, or a target organ such as the liver, heart, pancreas, kidney, and the like. Local delivery can also include topical applications or localized injection techniques such as intramuscular, subcutaneous, or intradermal injection. Local delivery does not preclude a systemic pharmacological effect.
[0081] A “stop codon” as that term is used herein, refers to a three nucleotide contiguous sequence within messenger RNA that specifies a termination of translation. For example, UAG, UAA, UGA (in RNA) and TAG, TAA or TGA (in DNA) are stop codons. The stop codons are also known as amber (UAG), ochre (UAA), and opal (UGA).
[0082] A “tRNA-based effector molecule” or “TREM,” as that term is used herein, refers to an RNA molecule comprising a structure or property from (a)-(v) below, and which is a recombinant TREM, a synthetic TREM, or a TREM expressed from a heterologous cell. TREMs are chemically distinct, e.g., in terms of primary sequence, type or location of modifications from the endogenous tRNA molecules made in cells, e.g., in mammalian cells, e.g., in human cells. A TREM can have a plurality (e.g., 2, 3, 4, 5, 6, 7, 8, 9) of the structures and functions of (a)-(v).
[0083] In an embodiment, a TREM is non-native, as evaluated by structure or the way in which it was made. In an embodiment, a TREM comprises one or more of the following structures or properties:(a’) an optional linker region of a consensus sequence provided in the “Consensus Sequence” section, e.g., a Linker 1 region;
[0084] (a) an amino acid attachment domain that binds an amino acid, e.g., an acceptor stem domain (AStD), wherein an AStD comprises sufficient RNA sequence to mediate, e.g., when present in an otherwise wildtype tRNA, acceptance of an amino acid, e.g., its cognate amino acid or a non-cognate amino acid, and transfer of the amino acid (AA) in the initiation or elongation of a polypeptide chain. Typically, the AStD comprises a 3 ’-end adenosine (CCA) for acceptor stem charging which is part of synthetase recognition.
[0085] (a’-l) a linker comprising residues Rs-R.9 of a consensus sequence provided in the “Consensus Sequence” section, e.g., a Linker 2 region;
[0086] (b) a dihydrouridine hairpin domain (DHD), wherein aDHD comprises sufficient RNA sequence to mediate, e.g., when present in an otherwise wildtype tRNA, recognition of aminoacyl-tRNA synthetase, e.g., acts as a recognition site for aminoacyl-tRNA synthetase for amino acid charging of the TREM.
[0087] (b’-l) a linker comprising residue R29 of a consensus sequence provided in the “Consensus Sequence” section, e.g., a Linker 3 region;
[0088] (c) an anticodon that binds a respective codon in an mRNA, e.g., an anticodon hairpin domain (ACHD), wherein an ACHD comprises sufficient sequence, e.g., an anticodon triplet, to mediate, e.g., when present in an otherwise wildtype tRNA, pairing (with or without wobble) with a codon.
[0089] (d) a variable loop domain (VLD), wherein a VLD comprises sufficient RNA sequence to mediate, e.g., when present in an otherwise wildtype tRNA, recognition of aminoacyl-tRNA synthetase, e.g., acts as a recognition site for aminoacyl-tRNA synthetase for amino acid charging of the TREM. In embodiments, a VLD mediates the stabilization of the TREM’s tertiary structure. In an embodiment, a VLD modulates, e.g., increases, the specificity of the TREM, e.g., for its cognate amino acid, e.g., the VLD modulates the TREM’s cognate adaptor function.
[0090] (e) a thymine hairpin domain (THD), wherein a THD comprises sufficient RNA sequence, to mediate, e.g., when present in an otherwise wildtype tRNA, recognition of the ribosome, e.g., acts as a recognition site for the ribosome to form a TREM-ribosome complex during translation.(e’l) a linker comprising residue R72 of a consensus sequence provided in the “Consensus Sequence” section, e.g., a Linker 4 region;
[0091] (f) under physiological conditions, it comprises a stem structure and one or a plurality of loop structures, e.g., 1, 2, or 3 loops. A loop can comprise a domain described herein, e.g., a domain selected from (a)-(e). A loop can comprise one or a plurality of domains.
[0092] (g) a tertiary structure, e.g., an L-shaped tertiary structure;
[0093] (h) adaptor function, i.e., the TREM mediates acceptance of an amino acid, e.g., its cognate amino acid and transfer of the AA in the initiation or elongation of a polypeptide chain;
[0094] (i) cognate adaptor function wherein the TREM mediates acceptance and incorporation of an amino acid (e.g., cognate amino acid) associated in nature with the anti-codon of the TREM to initiate or elongate a polypeptide chain;
[0095] (j) non-cognate adaptor function, wherein the TREM mediates acceptance and incorporation of an amino acid (e.g., non-cognate amino acid) other than the amino acid associated in nature with the anti -codon of the TREM in the initiation or elongation of a polypeptide chain;
[0096] (k) a regulatory function, e.g., an epigenetic function (e.g., gene silencing function or signaling pathway modulation function), cell fate modulation function, mRNA stability modulation function, protein stability modulation function, protein transduction modulation function, or protein compartmentalization function;
[0097] (l) a structure which allows for ribosome binding;
[0098] (m) a post-transcriptional modification, e.g., a naturally occurring post-transcriptional modification;
[0099] (n) the ability to inhibit a functional property of a tRNA, e.g., any of properties (h)-(k) possessed by a tRNA;
[0100] (o) the ability to modulate cell fate;
[0101] (p) the ability to modulate ribosome occupancy;
[0102] (q) the ability to modulate protein translation;
[0103] (r) the ability to modulate mRNA stability;
[0104] (s) the ability to modulate protein folding and structure and / or function;
[0105] (t) the ability to modulate protein transduction or compartmentalization;
[0106] (u) the ability to modulate protein stability; or(v) the ability to modulate a signaling pathway, e.g., a cellular signaling pathway.
[0107] In an embodiment, a TREM is 75-90 nucleotides in length. In embodiments, a TREM or a fragment or functional fragment thereof is between 10-90 nucleotides, between 10-80 nucleotides, between 10-70 nucleotides, between 10-60 nucleotides, between 10-50 nucleotides, between 10-40 nucleotides, between 10-30 nucleotides, between 10-20 nucleotides, between 20-90 nucleotides, between 20-80 nucleotides, 20-70 nucleotides, between 20-60 nucleotides, between 20-50 nucleotides, between 20-40 nucleotides, between 30-90 nucleotides, between 30-80 nucleotides, between 30-70 nucleotides, between 30-60 nucleotides, or between 30-50 nucleotides.
[0108] In an embodiment, a TREM is aminoacylated, e.g., charged, with an amino acid by an aminoacyl tRNA synthetase. In an embodiment, a TREM is not charged with an amino acid, e.g., an uncharged TREM.
[0109] “Decreased expression,” as that term is used herein, refers to a decrease in comparison to a reference, e.g., in the case where altered control region, or addition of an agent, results in a decreased expression of the subject product, it is decreased relative to an otherwise similar cell without the alteration or addition.
[0110] An “exogenous nucleic acid,” as that term is used herein, refers to a nucleic acid sequence that is not present in or differs by at least one nucleotide from the closest sequence in a reference cell, e.g., a cell into which the exogenous nucleic acid is introduced. In an embodiment, an exogenous nucleic acid comprises a nucleic acid that encodes a TREM.
[0111] An “exogenous TREM,” as that term is used herein, refers to a TREM that:
[0112] (a) differs by at least one nucleotide or one post transcriptional modification from the closest sequence tRNA in a reference cell, e.g., a cell into which the exogenous nucleic acid is introduced;
[0113] (b) has been introduced into a cell other than the cell in which it was transcribed;
[0114] (c) is present in a cell other than one in which it naturally occurs; or
[0115] (d) has an expression profile, e.g., level or distribution, that is non-wildtype, e.g., it is expressed at a higher level than wildtype. In an embodiment, the expression profile can be mediated by a change introduced into a nucleic acid that modulates expression or by addition of an agent that modulates expression of the RNA molecule. In an embodiment an exogenous TREM comprises 1, 2, 3 or 4 of properties (a)-(d).A “GMP-grade composition,” as that term is used herein, refers to a composition in compliance with current good manufacturing practice (cGMP) guidelines, or other similar requirements. In an embodiment, a GMP-grade composition can be used as a pharmaceutical product.
[0116] As used herein, the terms “increasing” and “decreasing” refer to modulating that results in, respectively, greater or lesser amounts of function, expression, or activity of a particular metric relative to a reference. For example, subsequent to administration to a cell, tissue or subject of a TREM described herein, the amount of a marker of a metric (e.g., protein translation, mRNA stability, protein folding) as described herein may be increased or decreased by at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or 98%, 2X, 3X, 5X, 10X or more relative to the amount of the marker prior to administration or relative to the effect of a negative control agent. The metric may be measured subsequent to administration at a time that the administration has had the recited effect, e.g., at least 12 hours, 24 hours, one week, one month, 3 months, or 6 months, after a treatment has begun.
[0117] “Increased expression,” as that term is used herein, refers to an increase in comparison to a reference, e.g., in the case where altered control region, or addition of an agent, results in an increased expression of the subject product, it is increased relative to an otherwise similar cell without the alteration or addition.
[0118] A “non-cognate adaptor function TREM,” as that term is used herein, refers to a TREM which mediates initiation or elongation with an AA (a non-cognate AA) other than the AA associated in nature with the anti -codon of the TREM. In an embodiment, a non-cognate adaptor function TREM is also referred to as a mischarged TREM (mTREM).
[0119] A “non-naturally occurring sequence,” as that term is used herein, refers to a sequence wherein an Adenine is replaced by a residue other than an analog of Adenine, a Cytosine is replaced by a residue other than an analog of Cytosine, a Guanine is replaced by a residue other than an analog of Guanine, and a Uracil is replaced by a residue other than an analog of Uracil. An analog refers to any possible derivative of the ribonucleotides, A, G, C or U. In an embodiment, a sequence having a derivative of any one of ribonucleotides A, G, C or U is a non-naturally occurring sequence.A “pharmaceutical TREM composition,” as that term is used herein, refers to a TREM composition that is suitable for pharmaceutical use. Typically, a pharmaceutical TREM composition comprises a pharmaceutical excipient. In an embodiment the TREM will be the only active ingredient in the pharmaceutical TREM composition. In embodiments the pharmaceutical TREM composition is free, substantially free, or has less than a pharmaceutically acceptable amount, of host cell proteins, DNA, e.g., host cell DNA, endotoxins, and bacteria.
[0120] A “post-transcriptional processing,” as that term is used herein, with respect to a subject molecule, e.g., a TREM, RNA or tRNAs, refers to a covalent modification of the subject molecule. In an embodiment, the covalent modification occurs post-transcriptionally. In an embodiment, the covalent modification occurs co-transcriptionally. In an embodiment the modification is made in vivo, e.g., in a cell used to produce a TREM. In an embodiment the modification is made ex vivo, e.g., it is made on a TREM isolated or obtained from the cell which produced the TREM. In an embodiment, the post-transcriptional modification is selected from a post-transcriptional modification listed in Table 4.
[0121] A “tRNA”, as that term is used herein, refers to a naturally occurring transfer ribonucleic acid in its native state.
[0122] A “TREM composition,” as that term is used herein, refers to a composition comprising a plurality of TREMs. A TREM composition can comprise one or more species of TREMs. In an embodiment, the composition comprises only a single species of TREM. In an embodiment, the TREM composition comprises a first TREM species; and a second TREM species. In an embodiment, the TREM composition comprises X TREM species, wherein X=2, 3, 4, 5, 6, 7, 8, 9, or 10. A TREM composition can comprise one or more species of TREMs. In an embodiment, the TREM composition is at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 95 or 99% dry weight TREMs (for a liquid composition dry weight refers to the weight after removal of substantially all liquid, e.g., after lyophilization). In an embodiment, the composition is a liquid. In an embodiment, the composition is dry, e.g., a lyophilized material. In an embodiment, the composition is a frozen composition. In an embodiment, the composition is sterile. In an embodiment, the composition comprises at least 0.5 g, 1.0 g, 5.0 g, 10 g, 15 g, 25 g, 50 g, 100 g, 200 g, 400 g, or 500 g (e.g., as determined by dry weight) of TREM. In an embodiment, at least X% of the TREMs in a TREM composition has a non-naturally occurring modification at a selected position, and X is 80, 90, 95, 96, 97, 98, 99, or 99.5.In an embodiment, at least X% of the TREMs in a TREM composition has a non-naturally occurring modification at a first position and a non-naturally occurring modification at a second position, and X, independently, is 80, 90, 95, 96, 97, 98, 99, or 99.5. In embodiments, the modification at the first and second position is the same. In embodiments, the modification at the first and second position are different. In embodiments, the nucleotide at the first and second position is the same, e.g., both are adenine. In embodiments, the nucleotide at the first and second position are different, e.g., one is adenine and one is thymine.
[0123] In an embodiment, at least X% of the TREMs in a TREM composition has a non-naturally occurring modification at a first position and less than Y% have a non-naturally occurring modification at a second position, wherein X is 80, 90, 95, 96, 97, 98, 99, or 99.5 and Y is 20, 20, 5, 2, 1, .1, or .01. In embodiments, the nucleotide at the first and second position is the same, e.g., both are adenine. In embodiments the nucleotide at the first and second position are different, e.g., one is adenine and one is thymine.
[0124] Chemical Definitions
[0125] “Alkyl” refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms that is saturated (i.e., contains no double and / or triple bonds), having from one to twenty-four carbon atoms (C1-C24 alkyl), one to sixteen carbon atoms (C1-C16 alkyl), one to twelve carbon atoms (C1-C12 alkyl), six to twenty-four carbon atoms (C6-C24 alkyl), one to eight carbon atoms (Ci-Cg alkyl) or one to six carbon atoms (Ci-Ce alkyl) and which is attached to the rest of the molecule by a single bond, e.g., methyl, ethyl, n-propyl, 1 -methylethyl (iso propyl), n-butyl, n-pentyl, 1,1 -dimethylethyl (t-butyl), 3 -methylhexyl, 2-methylhexyl, and the like. Unless stated otherwise specifically in the specification, an alkyl group is optionally substituted.
[0126] “Alkoxy” refers to a radical with a formula -ORawhere Rais an alkyl radical as defined above. Unless stated otherwise specifically in the specification, an alkoxy group is optionally substituted.
[0127] “Alkenyl” refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms that contains at least one carbon-carbon double, having from one to twenty-four carbon atoms (C2-C24 alkenyl), one to twelve carbon atoms (C2-C12 alkenyl), six to twenty-four carbon atoms (C6-C24 alkenyl), two to sixteen carbon atoms (C2-C16 alkenyl), four totwelve carbon atoms (C4-C12 alkenyl), one to eight carbon atoms (C2-C8 alkenyl) or one to six carbon atoms (C2-C6 alkenyl) and which is attached to the rest of the molecule by a single bond, e.g., ethenyl, n-propenyl, 1 -methylethenyl, n-butenyl, n-pentenyl, 1,1 -dimethylethenyl, 3-methylhexenyl, 2-methylhexenyl, and the like. Unless stated otherwise specifically in the specification, an alkenyl group is optionally substituted.
[0128] “Alkynyl” refers to a straight or branched hydrocarbon chain radical consisting solely of carbon and hydrogen atoms that contains at least one carbon-carbon triple bond, having from one to twenty -four carbon atoms (C2-C24 alkynyl), one to twelve carbon atoms (C2-C12 alkynyl), one to eight carbon atoms (C2-C8 alkynyl) or one to six carbon atoms (C2-C6 alkynyl) and which is attached to the rest of the molecule by a single bond, e.g., ethynyl, n-propynyl, 1-methylethynyl, n-butynyl, n-pentynyl, 1,1-dimethylethynyl, 3 -methylhexynyl, 2-methylhexynyl, and the like. Unless stated otherwise specifically in the specification, an alkynyl group is optionally substituted.
[0129] “Alkylene” or “alkylene chain” refers to a straight or branched divalent saturated hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen. In some embodiments, an alkylene chain has from one to twenty -four carbon atoms (C1-C24 alkylene), one to fifteen carbon atoms (C1-C15 alkylene), one to twelve carbon atoms (C1-C12 alkylene), one to eight carbon atoms (Ci-Cs alkylene), one to six carbon atoms (Ci-Ce alkylene), four to six carbon atoms (C4-C6 alkylene), two to four carbon atoms (C2-C4 alkylene), one to two carbon atoms (C1-C2 alkylene), e.g., methylene, ethylene, propylene, / / -butylene, and the like. The alkylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond. The points of attachment of the alkylene chain to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless stated otherwise specifically in the specification, an alkylene chain is optionally substituted.
[0130] “Alkenylene” or “alkenylene chain” refers to a straight or branched divalent hydrocarbon chain linking the rest of the molecule to a radical group, consisting solely of carbon and hydrogen and which comprises at least one carbon-carbon double bond. In some embodiments, an alkenylene chain has from two to twenty -four carbon atoms (C2-C24 alkenylene), two to fifteen carbon atoms (C2-C15 alkenylene), two to twelve carbon atoms (C2-C12 alkenylene), two to eight carbon atoms (C2-C8 alkenylene), two to six carbon atoms (C2-C6 alkenylene), four to sixcarbon atoms (C4-C6 alkenylene), two to four carbon atoms (C2-C4 alkenylene), e.g., ethenylene, propenylene, n-butenylene, and the like. The alkenylene chain is attached to the rest of the molecule through a single bond and to the radical group through a single bond. The points of attachment of the alkenylene chain to the rest of the molecule and to the radical group can be through one carbon or any two carbons within the chain. Unless stated otherwise specifically in the specification, an alkenylene chain is optionally substituted.
[0131] “Cycloalkyl” or “carbocyclic ring” refers to a stable non aromatic monocyclic or polycyclic hydrocarbon radical consisting solely of carbon and hydrogen atoms, which may include fused or bridged ring systems, having from three to fifteen ring carbon atoms (C3-C15), from three to ten ring carbon atoms (C3-C10) or from three to eight ring carbon atoms (Cs-Cs), and which is saturated or unsaturated and attached to the rest of the molecule by a single bond. Monocyclic radicals include, for example, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl. Polycyclic radicals include, for example, adamantyl, norbornyl, decalinyl, 7,7-dimethyl bicyclo[2.2.1]heptanyl, and the like. Unless otherwise stated specifically in the specification, a cycloalkyl group is optionally substituted.
[0132] “Aryl” refers to a carbocyclic ring system radical comprising hydrogen, 6 to 18 carbon atoms and at least one aromatic ring. For purposes of this disclosure, the aryl radical is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, which may include fused or bridged ring systems. Aryl radicals include, but are not limited to, aryl radicals derived from aceanthrylene, acenaphthylene, acephenanthrylene, anthracene, azulene, benzene, chrysene, fluoranthene, fluorene, c / .s-indaccnc, s-indacene, indane, indene, naphthalene, phenalene, phenanthrene, pleiadene, pyrene, and triphenylene.
[0133] “Arylalkyl” refers to a radical of the formula -Rb-Rc where Rb is an alkylene or alkenylene as defined above and Rcis one or more aryl radicals as defined above, for example, benzyl, diphenylmethyl and the like. Unless stated otherwise specifically in the specification, an arylalkyl group is optionally substituted.
[0134] “Heterocyclyl” or “heterocyclic ring” refers to a stable 3- to 18-membered non-aromatic ring radical having one to twelve ring carbon atoms (e.g., two to twelve) and from one to six ring heteroatoms selected from the group consisting of nitrogen, oxygen, and sulfur. Unless stated otherwise specifically in the specification, the heterocyclyl radical is a monocyclic, bicyclic, tricyclic, or tetracyclic ring system, which may include fused, spirocyclic (“spiro-heterocyclyl”)and / or bridged ring systems; and the nitrogen, carbon, or sulfur atoms in the heterocyclyl radical is optionally oxidized; the nitrogen atom is optionally quatemized; and the heterocyclyl radical is partially or fully saturated. Examples of such heterocyclyl radicals include, but are not limited to, dioxolanyl, thienylfl ,3]dithianyl, decahydroisoquinolyl, imidazolinyl, imidazolidinyl, isothiazolidinyl, isoxazolidinyl, morpholinyl, octahydroindolyl, octahydroisoindolyl,
[0135] 2-oxopiperazinyl, 2-oxopiperidinyl, 2-oxopyrrolidinyl, oxazolidinyl, piperidinyl, piperazinyl, 4-piperidonyl, pyrrolidinyl, pyrazolidinyl, quinuclidinyl, thiazolidinyl, tetrahydrofuryl, trithianyl, tetrahydropyranyl, thiomorpholinyl, thiamorpholinyl, 1-oxo-thiomorpholinyl, and
[0136] 1,1-dioxo-thiomorpholinyl. Unless stated otherwise specifically in the specification, a heterocyclyl group is optionally substituted.
[0137] The term “substituted” used herein means any of the above groups (e. ., alkyl, alkylhydroxyl, alkenyl, alkynyl, alkylene, cycloalkyl, aryl, aralkyl or heterocyclyl) wherein at least one hydrogen atom is replaced by a bond to a non-hydrogen atoms such as, but not limited to: a halogen atom such as F, Cl, Br, and I; oxo groups (=0); hydroxyl groups (-0H); alkoxy groups (-0Ra, where Rais C1-C12 alkyl or cycloalkyl); carboxyl groups (-0C(=0)Raor -C(=0)0Ra, where Rais H, C1-C12 alkyl or cycloalkyl); amine groups (-NRaRb, where Raand Rbare each independently H, C1-C12 alkyl or cycloalkyl); C1-C12 alkyl groups; and cycloalkyl groups. In some embodiments the substituent is a C1-C12 alkyl group. In other embodiments, the substituent is a cycloalkyl group. In other embodiments, the substituent is a halo group, such as fluoro. In other embodiments, the substituent is a oxo group. In other embodiments, the substituent is a hydroxyl group. In other embodiments, the substituent is an alkoxy group. In other embodiments, the substituent is a carboxyl group. In other embodiments, the substituent is an amine group.
[0138] “Optional” or “optionally” (e.g., optionally substituted) means that the subsequently described event of circumstances may or may not occur, and that the description includes instances where said event or circumstance occurs and instances in which it does not. For example, “optionally substituted alkyl” means that the alkyl radical may or may not be substituted and that the description includes both substituted alkyl radicals and alkyl radicals having no substitution. In some embodiments, “optionally substituted” means a particular radical is substituted with one or more substituents selected from the group consisting of halo (e.g., F, Cl, Br, and I), oxo (=0), hydroxyl (-0H), alkoxy (-0Ra, where Rais C1-C12 alkyl), cycloalkoxy(-0Ra, where Rais C3-C8 cycloalkyl), carboxyl (-OC(=O)Raor -C(=O)ORa, where Rais H, Ci-C12 alkyl, or C3-C8 cycloalkyl), amine (-NRaRb, where Raand Rbare each independently H, Ci-C12 alkyl, or C3-C8 cycloalkyl), C1-C12 alkyl, and C3-C8 cycloalkyl.
[0139] In some embodiments, “optionally substituted” means substituted with one or more halo substituents. In some embodiments, “optionally substituted” means substituted with one or more oxo substituents. In some embodiments, “optionally substituted” means substituted with one or more hydroxyl substituents. In certain embodiments, “optionally substituted” means substituted with one or more alkoxy substituents. In some embodiments, “optionally substituted” means substituted with one or more cycloalkoxy substituents. In certain embodiments, “optionally substituted” means substituted with one or more carboxy substituents. In some embodiments, “optionally substituted” means substituted with one or more amine substituents. In certain embodiments, “optionally substituted” means substituted with one or more C1-C12 alkyl substituents. In some embodiments, “optionally substituted” means substituted with one or more C3-C8 cycloalkyl substituents.
[0140] When a functional group is described as “optionally substituted,” and in turn, substituents on the functional group are also “optionally substituted” and so on, for the purposes of this disclosure, such iterations are limited to five, preferably such iterations are limited to two. In some embodiments, such iterations are limited to one. In some embodiments, such iterations are limited to zero.
[0141] This disclosure is also meant to encompass all pharmaceutically acceptable combinations of nucleic acids with LNPs comprising the compounds of Formula (I) being isotopically labelled by having one or more atoms replaced by an atom having a different atomic mass or mass number. Examples of isotopes that can be incorporated into the disclosed compounds include isotopes of hydrogen, carbon, nitrogen, oxygen, phosphorous, fluorine, chlorine, and iodine, such as2H,3H,nC,13C,14C,13N,15N,15O,17O,18O,31P,32P,35S,18F,36C1,123I, and125I, respectively. These radiolabeled compounds could be useful to help determine or measure the effectiveness of the compounds, by characterizing, for example, the site or mode of action, or binding affinity to pharmacologically important site of action. Certain isotopically labelled compounds of Formula (I), for example, those incorporating a radioactive isotope, are useful in drug and / or substrate tissue distribution studies. The radioactive isotopes tritium, z.e.,3H, and carbon-14, z.e.,14C, areparticularly useful for this purpose in view of their ease of incorporation and ready means of detection.
[0142] Substitution with heavier isotopes such as deuterium, z.e.,2H, may afford certain therapeutic advantages resulting from greater metabolic stability, for example, increased in vivo half-life or reduced dosage requirements, and hence may be preferred in some circumstances.
[0143] Substitution with positron emitting isotopes, such asnC,18F,15O, and13N, can be useful in Positron Emission Topography (PET) studies for examining substrate receptor occupancy. Isotopically labeled compounds of Formula (I) can generally be prepared by conventional techniques known to those skilled in the art or by processes analogous to those described in the Preparations and Examples as set out below using an appropriate isotopically labeled reagent in place of the non-labeled reagent previously employed.
[0144] This disclosure is also meant to encompass the in vivo metabolic products of the disclosed compounds. Such products may result from, for example, the oxidation, reduction, hydrolysis, amidation, esterification, and the like of the administered compound, primarily due to enzymatic processes. Accordingly, the disclosure includes compounds produced by a process comprising administering a compound of this disclosure to a mammal for a period sufficient to yield a metabolic product thereof. Such products are typically identified by administering a radiolabeled compound of the disclosure in a detectable dose to an animal, such as rat, mouse, guinea pig, monkey, or to human, allowing sufficient time for metabolism to occur, and isolating its conversion products from the urine, blood, or other biological samples.
[0145] “Stable compound” and “stable structure” are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent.
[0146] “Mammal” includes humans and both domestic animals such as laboratory animals and household pets (e.g., cats, dogs, swine, cattle, sheep, goats, horses, rabbits), and non-domestic animals such as wildlife and the like.
[0147] “Pharmaceutically acceptable carrier, diluent or excipient” includes without limitation any adjuvant, carrier, excipient, glidant, sweetening agent, diluent, preservative, dye / colorant, flavor enhancer, surfactant, wetting agent, dispersing agent, suspending agent, stabilizer, isotonic agent, solvent, or emulsifier which has been approved by the United States Food and Drug Administration as being acceptable for use in humans or domestic animals.“Pharmaceutically acceptable salt” includes both acid and base addition salts.
[0148] “Pharmaceutically acceptable acid addition salt” refers to those salts which retain the biological effectiveness and properties of the free bases, which are not biologically or otherwise undesirable, and which are formed with inorganic acids such as, but are not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid and the like, and organic acids such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, 4-acetamidobenzoic acid, camphoric acid, camphor- 10-sulfonic acid, capric acid, caproic acid, caprylic acid, carbonic acid, cinnamic acid, citric acid, cyclamic acid, dodecyl sulfuric acid, ethane-l,2-disulfonic acid, ethanesulfonic acid, 2-hydroxyethanesulfonic acid, formic acid, fumaric acid, galactaric acid, gentisic acid, glucoheptonic acid, gluconic acid, glucuronic acid, glutamic acid, glutaric acid, 2-oxo-glutaric acid, glycerophosphoric acid, glycolic acid, hippuric acid, isobutyric acid, lactic acid, lactobionic acid, lauric acid, maleic acid, malic acid, malonic acid, mandelic acid, methanesulfonic acid, mucic acid, naphthalene-l,5-disulfonic acid, naphthalene-2-sulfonic acid, l-hydroxy-2-naphthoic acid, nicotinic acid, oleic acid, orotic acid, oxalic acid, palmitic acid, pamoic acid, propionic acid, pyroglutamic acid, pyruvic acid, salicylic acid, 4-aminosalicylic acid, sebacic acid, stearic acid, succinic acid, tartaric acid, thiocyanic acid, p-toluenesulfonic acid, tri fluoroacetic acid, undecylenic acid, and the like.
[0149] “Pharmaceutically acceptable base addition salt” refers to those salts which retain the biological effectiveness and properties of the free acids, which are not biologically or otherwise undesirable. These salts are prepared from addition of an inorganic base or an organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, the sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Preferred inorganic salts are the ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as ammonia, isopropylamine, trimethylamine, diethylamine, tri ethyl amine, tripropylamine, diethanolamine, ethanolamine, deanol, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, benethamine, benzathine, ethylenediamine, glucosamine, methylglucamine, theobromine, triethanolamine,tromethamine, purines, piperazine, piperidine, A-ethylpiperidine, polyamine resins and the like. Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine.
[0150] Often crystallizations produce a solvate of the compound of the disclosure. As used herein, the term “solvate” refers to an aggregate that comprises one or more molecules of a compound of the disclosure with one or more molecules of solvent. The solvent may be water, in which case the solvate may be a hydrate. Alternatively, the solvent may be an organic solvent. Thus, the compounds of the present disclosure may exist as a hydrate, including a monohydrate, dihydrate, hemihydrate, sesquihydrate, trihydrate, tetrahydrate and the like, as well as the corresponding solvated forms. The compound of the disclosure may be true solvates, while in other cases, the compound of the disclosure may merely retain adventitious water or be a mixture of water plus some adventitious solvent.
[0151] A “pharmaceutical composition” refers to a formulation of a compound of the disclosure and a medium generally accepted in the art for the delivery of the biologically active compound to mammals, e.g., humans. Such a medium includes all pharmaceutically acceptable carriers, diluents, or excipients therefor.
[0152] “Effective amount” or “therapeutically effective amount” refers to that amount of a compound of the disclosure which, when administered to a mammal, preferably a human, is sufficient to effect treatment in the mammal, preferably a human. The amount of a lipid nanoparticle of the disclosure which constitutes a “therapeutically effective amount” will vary depending on the compound, the condition and its severity, the manner of administration, and the age of the mammal to be treated, but can be determined routinely by one of ordinary skill in the art having regard to his own knowledge and to this disclosure.
[0153] “Treating” or “treatment” as used herein covers the treatment of the disease or condition of interest in a mammal, preferably a human, having the disease or condition of interest, and includes:
[0154] (i) preventing the disease or condition from occurring in a mammal, in particular, when such mammal is predisposed to the condition but has not yet been diagnosed as having it;
[0155] (ii) inhibiting the disease or condition, i.e., arresting its development;
[0156] (iii) relieving the disease or condition, i.e., causing regression of the disease or condition; or(iv) relieving the symptoms resulting from the disease or condition, i.e., relieving pain without addressing the underlying disease or condition. As used herein, the terms “disease” and “condition” may be used interchangeably or may be different in that the malady or condition may not have a known causative agent (so that etiology has not yet been worked out) and it is therefore not yet recognized as a disease but only as an undesirable condition or syndrome, wherein a more or less specific set of symptoms have been identified by clinicians.
[0157] The compounds of the disclosure, or their pharmaceutically acceptable salts may contain one or more asymmetric centers and may thus give rise to enantiomers, diastereomers, and other stereoisomeric forms that may be defined, in terms of absolute stereochemistry, as (R)- or (S)- or, as (D)- or (L)- for amino acids. The present disclosure is meant to include all such possible isomers, as well as their racemic and optically pure forms. Optically active (+) and (-), (R)- and (S)-, or (D)- and (L)- isomers may be prepared using chiral synthons or chiral reagents, or resolved using conventional techniques, for example, chromatography and fractional crystallization. Conventional techniques for the preparation / isolation of individual enantiomers include chiral synthesis from a suitable optically pure precursor or resolution of the racemate (or the racemate of a salt or derivative) using, for example, chiral high-pressure liquid chromatography (HPLC). When the compounds described herein contain olefinic double bonds or other centers of geometric asymmetry, and unless specified otherwise, it is intended that the compounds include both E and Z geometric isomers. Likewise, all tautomeric forms are also intended to be included.
[0158] A “stereoisomer” refers to a compound made up of the same atoms bonded by the same bonds but having different three-dimensional structures, which are not interchangeable. The present disclosure contemplates various stereoisomers and mixtures thereof and includes “enantiomers,” which refers to two stereoisomers whose molecules are non-superimposable mirror images of one another.
[0159] A “tautomer” refers to a proton shift from one atom of a molecule to another atom of the same molecule. The present disclosure includes tautomers of any said compounds.
[0160] In an aspect, the disclosure provides a lipid nanoparticle (LNP) comprising:
[0161] (i) a cationic lipid;
[0162] (ii) a neutral lipid;
[0163] (iii) a polymer conjugated lipid (e.g., pegylated lipid);(iv) a sterol; and
[0164] (v) a TREM capable of suppressing the premature termination codon (PTC) in an open reading frame of a gene, wherein the TREM is encapsulated within the LNP.
[0165] TREMs
[0166] A “tRNA-based effector molecule” or “TREM” refers to an RNA molecule comprising one or more of the properties described herein. A TREM can comprise a non-naturally occurring modification, e.g., as provided in Table 4. A TREM may further comprise a nucleotide modification, for example, a nucleotide substitution, nucleotide deletion, or nucleotide addition, relative to a second TREM.
[0167] In an embodiment, a TREM comprises a sequence of Formula A: [Ll]-[ASt Domainl]- [L2]-[DH Domain]-[L3]-[ACH Domain]-[VL Domain]-[TH Domain]-[L4]-[ASt Domain2], In an embodiment, [VL Domain] is optional. In an embodiment, [LI] is optional. In an embodiment, a TREM comprises a non-naturally occurring modification in each of the [ASt Domainl], the [DH Domain], the [ACH Domain], the [VL Domain], the [TH Domain], and the [ASt Domain2],
[0168] In an embodiment, a TREM can be charged with an amino acid (e.g., a cognate amino acid); charged with a non-cognate amino acid (e.g., a mischarged TREM (mTREM)); or not charged with an amino acid (e.g., an uncharged TREM (uTREM)). In an embodiment, a TREM can be charged with an amino acid selected from alanine, arginine, asparagine, aspartate, cysteine, glutamine, glutamate, glycine, histidine, isoleucine, methionine, leucine, lysine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, or valine.
[0169] In some embodiments, a non-extended anticodon is an anticodon of no more than three nucleotides. In an embodiment, a non-extended codon pairs with no more than three codon nucleotides on a nucleic acid being translated.
[0170] In an embodiment, the TREM is a cognate TREM. In an embodiment, the TREM is a non-cognate TREM. In an embodiment, the TREM recognizes a codon provided in Table 1 or Table 2.
[0171] Table 1: List of codons
[0172] AAA AAU ACG AAC ACA ACU
[0173]
[0174] AAG
[0175]
[0176] ACC
[0177]
[0178] AGAAGC CUA GUL AGG cue UAA AGU CUG UAC AUA CUU UAG AUC GAA UAU AUG GAC UCA AUU GAG UCC CAA GAU UCG CAC GCA UCU CAG GCC UGA CAU GCG UGC CCA GCU UGG CCC GGA UGU CCG GGC UUA
[0179] ecu GGG UUC CGA GGU UUG CGC GUA
[0180]
[0181] UUU CGG GUC
[0182]
[0183] CGU
[0184]
[0185] GUG
[0186] Table 2: Amino acids and corresponding codons
[0187] Amino Acid mRNA codons
[0188] Alanine GCU, GCC, GCA, GCG
[0189] Arginine CGU, CGC, CGA, CGG, AGA, AGG
[0190] Asparagine AAU, AAC
[0191] Aspartate GAU, GAC
[0192] Cysteine UGU, UGC
[0193] Glutamate GAA, GAG
[0194] Glutamine CAA, CAG
[0195] Glycine GGU, GGC, GGA, GGG
[0196] Histidine CAU, CAC
[0197] Isoleucine AUU, AUC, AUA
[0198] Leucine UUA, UUG, CUU, CUC, CUA, CUG
[0199] Lysine AAA, AAG
[0200] Methionine AUG
[0201] Phenylalanine UUU, UUC
[0202] Proline CCU, CCC, CCA, CCG
[0203] Serine UCU, UCC, UCA, UCG, AGU, AGC
[0204] Stop UAA, UAG, UGA
[0205]
[0206] Threonine ACU, ACC, AC A, ACGTryptophan UGG
[0207] Tyrosine UAU, UAC
[0208]
[0209] Valine GUU, GUC, GUA, GUG
[0210] In an embodiment, a TREM comprises a sequence listed in Table 3, wherein * indicates a phosphorothioate linkage, m indicates a 2’-O-methyl modification, f indicates a 2’-fluoro modification, and r indicates a ribonucleotide.
[0211] Table 3. Exemplary TREM sequences.
[0212] SEQ ID
[0213] Sequence
[0214] NO.
[0215] mG*mG*rCrUrCrCrGrUrGrGrCrGrCrArArUrGrGrArUrArGrCrGrCrArUrUrGrGr 1 ArCfUrUrCrArArArUrUrCrArArArGrGrUrUrCrCrGrGmGrUrUrCrGrArGrUrCrC rCrGrGrCrGrGrArGrUrCrGrC*mC*mA mGAuGrCrUrCrCrGrUrGrGrCrGrCrArArUmGmGrArUrArGrCrGrCrArUrCrGrG 2 rUrCfUrUrCrArArArArUrCrGrArArGrGrUrUrCmCrGmGrGrUrU*rCrGrArGrUr CrCrCrGrGrCrGrGrArGrUrCmGrCrCrA mGrGrCrUrCrCrGrUrGrGrCrGrCrArArUmGmGrArUrArGrCrGrCrArUrUrGrGrA 3 rCrUrUrCrArArArUrUrCrArArArGrGrUrUrCmCrGmGrGrUrUrCrGrArGrUrCiGr CrGrGrCrGrGrArGrUrCmGrCrCrA mG*mC*rCrUrCrCrGrUrGrGrCrGrCrArArUrGrGrArUrArGrCrGrCrArGrUrGrGr 4 ArCrUrUrCrArAiArUrUrCrArCrArGrGrUrUrCrCrGrGrGrUrUrCrGrArGrUrCrCr CrGrGrCrGrGrArGrGrCrGrC*mCrA mG*mGrCrUrCrCrGrUrGrGrCrGrCrArArUmGmGrArUrArGrCrGrCrArUrUrGrG 5 rArCrUrUrCrArArArUrUrCrArArArGrGrUrUrCmCrGmGrGrUrUrCrGrArGrUrCr CrCrGrGrCrGrGrArGrUrCmGrCrCrA mGrGrCrUrCrCrGrUrGrGrCrGrCrArArUmGmGrArUrArGrCrGrCrAr / VCrCrGrU 6 rCrUrUrCrArArArArCrGrGrUrArGrGrUrUrCmCrGmGrGrUrLTrCrGrArGrUrCrCr CrGrGrCrGrGrArGrUrCmGrCrCrA mG*mGrCrUrCrCrGrUrGrGrCrGrCrArArUmGmGrArUrArGrCrGrCrArArCrCrG 7 rUrCfUrUrCrArArArArCrGrGrUrArGrGrUrUrCmCrGmGrGrUrU*rCrGrArGrUr CrCrCrGrGrCrGrGrArGiUrCmGrCrCrA mG*mGrCrUrCrCrGrUrGrGrCrGrCrArArUmGmGrArUrArGtCrGrCrArUrUrGrG 8 rArCfUrUrCrArArArUrUrCrArArArGrGrUrUrCmCrGmGrGrUrU*rCrGrArGrUr C rC rC rGrGrC rGrGr Ar GrUrC m GrC rC r A mG^mCrCrUrCrCrGrUrGrGrCrCrUrArArUmGmGrArUrArArGrGrCrArUrCrGrG 9 rCrCfUrUrCrArArArGrCrCrGrGrGrGrArUrUrGmCrGmGrGrUrU^rCrGrArGrUrC rCrCrGrUrCrGrGrArGrGrUmGrCrCrA
[0216] m G * mC rCrUrCrCrGrUrGrGrC rGrCrA r ArUrn GmGr ArUr ArGrC rGrC rArGrUrGrG 10 rArCfUrUrCrArArArUrUrCr.ArCrArGrGrUrUrCniCrGmGrGrUrU*rCrGrArGrUrC
[0217]
[0218] rCrCrGrGrCrGrGrArGrtirCmCrrCrCrAA TREM described herein may comprise a non-naturally occurring modification, e.g., a modification described in Table 3. A non-naturally occurring modification can be made according to methods known in the art. In an embodiment, a non-naturally occurring modification is a modification that a cell, e.g., a human cell, does not make on an endogenous tRNA. In an embodiment, a non-naturally occurring modification is a modification that a cell, e.g., a human cell, can make on an endogenous tRNA, but wherein such modification is in a location in which it does not occur on a native tRNA. In an embodiment, the non-naturally occurring modification is in a domain, linker or arm which does not have such modification in nature. In an embodiment, the non-naturally occurring modification is at a position within a domain, linker or arm, which does not have such modification in nature. In an embodiment, the non-naturally occurring modification is on a nucleotide which does not have such modification in nature. In an embodiment, the non-naturally occurring modification is on a nucleotide at a position within a domain, linker or arm, which does not have such modification in nature.
[0219] The TREMs described herein may comprise a nucleotide sequence of one the TREMs provided in Table 3, or may comprise a nucleotide sequence having at least about 60 to at least about 99.9% sequence identity, e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9% sequence identity, to a TREM provided in Table 3. In one embodiment, a TREM described herein comprises the nucleotide sequence of SEQ ID NO: 11: GGCUCCG UGGCGCAAUGGAUAGCGCAUUGGACUUCAAAUUCAAAGGUUCCGGGUUCGAGUC CCGGCGGAGUCGCCA, or a sequence having at least about 60 to at least about 99.9% sequence identity, e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9% identity, to SEQ ID NO: 11. In another embodiment, a TREM described herein comprises the nucleotide sequence of SEQ ID NO: 12: GCCUCCGUGGCGCAAUGGAUA GCGCAGUGGACUUCAAAUUCACAGGUUCCGGGUUCGAGUCCCGGCGGAGGCGCCA
[0220] , or a sequence having at least about 60 to at least about 99.9% sequence identity, e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9% identity, to SEQ ID NO: 12. In an embodiment, a TREM described herein comprises the nucleotide sequence of SEQ ID NO: 13: GGCUCCGUGGCGCAAUGGAUAGCGCAACCGUCUUCAAAACGGUAGGUU CCGGGUUCGAGUCCCGGCGGAGUCGCCA, or a sequence having at least about 60 to at least about 99.9% sequence identity, e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9% identity, to SEQ ID NO: 13. In an embodiment, a TREM describedherein comprises the nucleotide sequence of SEQ ID NO: 14: GCCUCCGUGGCCUAAU GGAUAAGGCAUCGGCCUUCAAAGCCGGGGAUUGCGGGUUCGAGUCCCGUCGGAG GUGCCA, or a sequence having at least about 60 to at least about 99.9% sequence identity, e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9% identity, to SEQ ID NO: 14. In an embodiment, a TREM described herein comprises the nucleotide sequence of SEQ ID NO: 15: GGCUCCGUGGCGCAAUGGAUAGCGCAUCGGUCUUCAAA AUCGAAGGUUCCGGGUUCGAGUCCCGGCGGAGUCGCCA, or a sequence having at least about 60 to at least about 99.9% sequence identity, e.g., at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 99.5%, or 99.9% identity, to SEQ ID NO: 15.
[0221] In one embodiment, the TREM described herein has at least 1-30 nucleotide mutations, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide mutations relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-20 nucleotide mutations relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-10 nucleotide mutations relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 10-20 nucleotide mutations relative to a TREM provided in Table 3. A nucleotide mutation, as described herein, refers to a substitution, insertion, or deletion of a nucleotide. In an embodiment, the TREM described herein has at least 1-30 nucleotide deletions, e.g, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide deletions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-20 nucleotide deletions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-10 nucleotide deletions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 10-20 nucleotide deletions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-30 nucleotide insertions, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide insertions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-20 nucleotide insertions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-10 nucleotide insertions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 10-20 nucleotide insertions relative to a TREM provided in Table 3. In an embodiment, the TREMdescribed herein has at least 1-30 nucleotide substitutions, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotide substitutions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-20 nucleotide substitutions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 1-10 nucleotide substitutions relative to a TREM provided in Table 3. In an embodiment, the TREM described herein has at least 10-20 nucleotide substitutions relative to a TREM provided in Table 3.
[0222] In an embodiment, a TREM described herein comprises at least 1-10 phosphorothioate modifications, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, phosphorothioate modifications. In an embodiment, the TREM described herein comprises at least 2-8 phosphorothioate modifications. In an embodiment, the TREM described herein comprises at least 3-5 phosphorothioate modifications. In an embodiment, the TREM described herein comprises at least 1-3 phosphorothioate modifications. In an embodiment, the TREM described herein comprises at least 1-10, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, additional phosphorothioate modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 1-5 additional phosphorothioate modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 5-10 additional phosphorothioate modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 3-5 additional phosphorothioate modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at about 1-4, e.g., about 1, 2, 3, or 4, fewer phosphorothioate modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises about 1-3 fewer phosphorothioate modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises about 1-2 fewer phosphorothioate modifications relative to a TREM provided in Table 3.
[0223] In an embodiment, a TREM described herein comprises at least 1-102’-O-methyl modifications, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, 2’-O-methyl modifications. In an embodiment, the TREM described herein comprises at least 2-82’-O-methyl modifications. In an embodiment, the TREM described herein comprises at least 3-5 2’-O-methyl modifications. In an embodiment, the TREM described herein comprises at least 1-32’-O-methyl modifications. In an embodiment, the TREM described herein comprises at least 1-10, e.g., about1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, additional 2’-O-methyl modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 1-5 additional 2’-O-methyl modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 5-10 additional 2’-O-methyl modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 3-5 additional 2’-O-methyl modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at about 1-7, e.g., about 1, 2, 3, 4, 5, 6, or 7, fewer 2’-O-methyl modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises about 2-6 fewer 2’-O-methyl modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises about 3-5 fewer 2’-O-methyl modifications relative to a TREM provided in Table 3.
[0224] In an embodiment, a TREM described herein comprises at least 1-102’-fluoro modifications, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, 2’-fluoro modifications. In an embodiment, the TREM described herein comprises at least 2-82’ -fluoro modifications. In an embodiment, the TREM described herein comprises at least 3-52’-fluoro modifications. In an embodiment, the TREM described herein comprises at least 1-32’ -fluoro modifications. In an embodiment, the TREM described herein comprises at least 1-10, e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10, additional 2’-fluoro modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 1-5 additional 2’-fluoro modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 5-10 additional 2’-fluoro modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at least 3-5 additional 2’-fluoro modifications relative to a TREM provided in Table 3. In an embodiment, the TREM described herein comprises at about 1 fewer 2’ -fluoro modifications relative to a TREM provided in Table 3.
[0225] In another embodiment, a TREM described herein comprises a modification not present on a TREM provided in Table 3. For example, the modification not present on a TREM provided in Table 3 may be a modification present on the 2’ position of a nucleotide sugar, e.g., 2’ -deoxy, 2’-methyoxyethyl (2’ -MOE), 2’ -chloro, or within an intemucleotide region, e.g., a backbone modification. In an embodiment, a TREM described herein comprises a 2’ -deoxy modification.In an embodiment, a TREM described herein comprises a 2’-M0E modification. In an embodiment, a TREM described herein comprises a 2’ -chloro modification.
[0226] Corresponding Nucleotide Positions
[0227] To determine if a selected nucleotide position in a candidate sequence corresponds to a selected position in a reference sequence (e.g., SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3), one or more of the following Evaluations is performed.
[0228] Evaluation A:
[0229] 1.The candidate sequence is aligned with each of the consensus sequences in Table 5. The consensus sequence(s) having the most positions aligned (and which has at least 60% of the positions of the candidate sequence aligned) is selected.
[0230] The alignment is performed as follows. The candidate sequence and an isodecoder consensus sequence from Table 5 are aligned based on a global pairwise alignment calculated with the Needleman-Wunsch algorithm when run with match scores from Table 6, a mismatch penalty of -1, a gap opening penalty of -1, and a gap extension penalty of -0.5, and no penalty for end gaps. The alignment with the highest overall alignment score is then used to determine the percent similarity between the candidate and the consensus sequence by counting the number of matched positions in the alignment, dividing it by the larger of the number of non-N bases in the candidate sequence or the consensus sequence, and multiplying the result by 100. In cases where multiple alignments (of the candidate and a single consensus sequence) tie for the same score, the percent similarity is the largest percent similarity calculated from the tied alignments. This process is repeated for the candidate sequence with each of the remaining isodecoder consensus sequences in Table 5, and the alignment resulting in the greatest percent similarity is selected. If this alignment has a percent similarity equal to or greater than 60%, it is considered a valid alignment and used to relate positions in the candidate sequence to those in the consensus sequence, otherwise the candidate sequence is considered to have not aligned to any of the isodecoder consensus sequences. If there is a tie at this point, all tied consensus sequences are taken forward to step 2 in the analysis.
[0231] 2. Using the selected consensus sequence(s) from step 1, one determines the consensus sequence position number that aligns with the selected position (e.g., a modified position) in the candidate sequence. One then assigns the position number of the aligned position in theconsensus sequence to the selected position in the candidate sequence, in other words, the selected position in the candidate sequence is numbered according to the numbering of the consensus sequence. If there were tied consensus sequences from step one, and they give different position numbers in this step 2, then all such position numbers are taken forward to step 5.
[0232] 3. The reference sequence is aligned with the consensus sequence chosen in step 1. The alignment is performed as described in step 1.
[0233] 4. From the alignment in step 3, one determines the consensus sequence position number that aligns with the selected position (e.g., a modified position) in the reference sequence. One then assigns the position number of the aligned position in the consensus sequence to the selected position in the reference sequence, in other words, the selected position in the reference sequence is numbered according to the numbering of the consensus sequence. If there is a tie at this point, all tied consensus sequences are taken forward to step 5 in the analysis.
[0234] 5. If a value for a position number determined for the reference sequence in step 2 is the same as the value for the position number determined for the candidate sequence in step 4, the positions are defined as corresponding.
[0235] Evaluation B:
[0236] The reference sequence (e.g., a TREM sequence described herein) and the candidate sequence are aligned with one another. The alignment is performed as follows.
[0237] The reference sequence and the candidate sequence are aligned based on a global pairwise alignment calculated with the Needleman-Wunsch algorithm when run with match scores from Table 6, a mismatch penalty of -1, a gap opening penalty of -1, and a gap extension penalty of -0.5, and no penalty for end gaps. The alignment with the highest overall alignment score is then used to determine the percent similarity between the candidate and reference sequence by counting the number of matched based in the alignment, dividing it by the larger of the number of non-N bases in the candidate or reference sequence, and multiplying the result by 100. In cases where multiple alignments tie for the same score, the percent similarity is the largest percent similarity calculated from the tied alignments. If this alignment has a percent similarity equal to or greater than 60%, it is considered a valid alignment and used to relate positions in the candidate sequence to those in the reference sequence, otherwise the candidate sequence is considered to have not aligned to the reference sequence.If the selected nucleotide position in the reference sequence (e.g., a modified position) is paired with a selected nucleotide position (e.g., a modified position) in the candidate sequence, the positions are defined as corresponding.
[0238] Evaluation C:
[0239] The candidate sequence is assigned a nucleotide position number according to the comprehensive tRNA numbering system (CtNS), also referred to as the tRNAviz method (e.g, as described in Lin et al., Nucleic Acids Research, 47:W1, pages W542-W547, 2 July 2019), which serves as a global numbering system for tRNA molecules. The alignment is performed as follows.
[0240] 1. The candidate sequence is assigned a nucleotide position according to the tRNAviz method. For a novel sequence not present in the tRNAviz database, the numbering for the sequence in the database with the highest sequence similarity to the novel sequence is obtained. For example, if a TREM differs at any given nucleotide position from a sequence in the database, the numbering for the tRNA having the wildtype sequence at said given nucleotide position is used.
[0241] 2. The reference sequence is assigned a nucleotide position according to the method described in 1.
[0242] 3. If a value for a position number determined for the reference sequence in step 1 is the same as the value for the position number determined for the candidate sequence in step 2, the positions are defined as corresponding.
[0243] If the selected position in the reference sequence and the candidate sequence are found to be corresponding in at least one of Evaluations A, B, and C, the positions correspond. For example, if two positions are found to be corresponding under Evaluation A, but do not correspond under Evaluation B or Evaluation C, the positions are defined as corresponding. Similarly, if two positions are found to be corresponding under Evaluation B, but do not correspond under Evaluation A or Evaluation C, the positions are defined as corresponding. In addition, if two positions are found to be corresponding under Evaluation C, but do not correspond under Evaluation A or Evaluation B, the positions are defined as corresponding The numbering given above is used for ease of presentation and does not imply a required sequence. If more than one Evaluation is performed, they can be performed in any order.Table 5. Consensus sequence computationally generated for each isodecoder by aligning members of the isodecoder family
[0244] SEQ ID Amino
[0245] NO. Acid Anticodon Consensus sequence GGGGAATTAGCTCAAGTGGTAGAGCGCTTG CTTAGCATGCAAGAGGTAGTGGGATCGATG
[0246] 56 Ala AGC CCCACATTCTCCA GGGGATGTAGCTCAGTGGTAGAGCGCATGC TTCGCATGTATGAGGTCCCGGGTTCGATCCC
[0247] 57 Ala CGC CGGCATCTCCA GGGGGTGTAGCTCAGTGGTAGAGCGCATGC TTTGCATGTATGAGGCCCCGGGTTCGATCCC
[0248] 58 Ala TGC CGGCACCTCCA GGGCCAGTGGCGCAATGGATAACGCGTCTG ACTACGGATCAGAAGATTCCAGGTTCGACTC
[0249] 59 Arg ACG CTGGCTGGCTCG GGCCGCGTGGCCTAATGGATAAGGCGTCTG ATTCCGGATCAGAAGATTGAGGGTTCGAGTC
[0250] 60 Arg CCG CCTTCGTGGTCG GCCCCAGTGGCCTAATGGATAAGGCACTGG CCTCCTAAGCCAGGGATTGTGGGTTCGAGTC
[0251] 16 Arg CCT CCACCTGGGGTA GACCGCGTGGCCTAATGGATAAGGCGTCTG ACTTCGGATCAGAAGATTGAGGGTTCGAGTC
[0252] 17 Arg TCG CCTCCGTGGTCG GGCTCTGTGGCGCAATGGATNAGCGCATTG GACTTCTAATTCAAAGGTTGCGGGTTCGAGT
[0253] 18 Arg TCT CCCNCCAGAGTCG GTCTCTGTGGCGCAATCGGTTAGCGCGTTCG GCTGTTAACCGNAAAGGTTGGTGGTTCGAGC
[0254] 19 Asn GTT CCACCCAGGGACG TCCTCGTTAGTATAGTGGTGAGTATCCCCGC CTGTCACGCGGGAGACCGGGGTTCGATTCCC
[0255] 20 Asp GTC CGACGGGGAG GGGGGTATAGCTCAGNGGGTAGAGCATTTG ACTGCAGATCAAGAGGTCCCCGGTTCAAATC
[0256] 21 Cys GCA CGGGTGCCCCCT GGTTCCATGGTGTAATGGTNAGCACTCTGGA CTCTGAATCCAGCGATCCGAGTTCAAGTCTC
[0257] 22 Gin CTG GGTGGAACCT GGTCCCATGGTGTAATGGTTAGCACTCTGGA CTTTGAATCCAGCGATCCGAGTTCAAATCTC
[0258]
[0259] 23 Gin TTG GGTGGGACCTTCCCTGGTGGTCTAGTGGTTAGGATTCGGCG CTCTCACCGCCGCGGCCCGGGTTCGATTCCC
[0260] Glu CTC GGTCAGGGAA TCCCTGGTGGTCTAGTGGCTAGGATTCGGCG CTTTCACCGCNGCGGCCCGGGTTCGATTCCC
[0261] Glu TTC GGTCAGGGAA GCATTGGTGGTTCAGTGGTAGAATTCTCGCC TCCCACGCNGGAGACCCGGGTTCGATTCCCG
[0262] Gly CCC GCCAATGCA GCATTGGTGGTTCAGTGGTAGAATTCTCGCC TGCCACGCGGGAGGCCCGGGTTCGATTCCCG
[0263] Gly GCC GCCAATGCA GCGTTGGTGGTATAGTGGTGAGCATAGCTGC CTTCCAAGCAGTTGACCCGGGTTCGATTCCC
[0264] Gly TCC GGCCAACGCA GGCCGGTTAGCTCAGTTGGTTAGAGCGTGGT GCTAATAACGCCAAGGTCGCGGGTTCGATCC
[0265] He AAT CCGTACGGGCCA GCTCCAGTGGCGCAATCGGTTAGCGCGCGGT ACTTATAATGCCGAGGTTGTGAGTTCGAGCC
[0266] He TAT TCACCTGGAGCA GGTAGCGTGGCCGAGCGGTCTAAGGCGCTG GATTAAGGCTCCAGTCTCTTCGGGGGCGTGG
[0267] Leu AAG GTTCGAATCCCACCGCTGCCA GTCAGGATGGCCGAGTGGTCNTAAGGCGCC AGACTCAAGTTCTGGTCTCCGNATGGAGGCG
[0268] Leu CAA TGGGTTCGAATCCCACTTCTGACA GTCAGGATGGCCGAGCGGTCTAAGGCGCTG CGTTCAGGTCGCAGTCTCCCCTGGAGGCGTG
[0269] Leu CAG GGTTCGAATCCCACTCCTGACA ACCAGGATGGCCGAGTGGTTAAGGCGTTGG ACTTAAGATCCAATGGACAGATGTCCGCGTG
[0270] Leu TAA GGTTCGAACCCCACTCCTGGTA GGTAGCGTGGCCGAGCGGTCTAAGGCGCTG GATTTAGGCTCCAGTCTCTTCGGNGGCGTGG
[0271] Leu TAG GTTCGAATCCCACCGCTGCCA GCCCGGCTAGCTCAGTCGGTAGAGCATGAG ACTCTTAATCTCAGGGTCGTGGGTTCGAGCC
[0272] Lys CTT CCACGTTGGGCGNNN GCCTGGATAGCTCAGTCGGTAGAGCATCAG ACTTTTAATCTGAGGGTCCAGGGTTCAAGTC
[0273] Lys TTT CCTGTTCAGGCG GCCCTCTTAGCGCAGTNGGCAGCGCGTCAGT CTCATAATCTGAAGGTCCTGAGTTCGAGCCT
[0274]
[0275] Met CAT CAGAGAGGGCAGCCGAAATAGCTCAGTTGGGAGAGCGTTAG ACTGAAGATCNTAAAGGTCCCTGGTTCAATC
[0276] Phe GAA CCGGGTTTCGGCA GGCTCGTTGGTCTAGGGGTATGATTCTCGCT TAGGATGCGAGAGGTCCCGGGTTCAAATCC
[0277] Pro AGG CGGACGAGCCC GGCTCGTTGGTCTAGGGGTATGATTCTCGCT TCGGGTGCGAGAGGTCCCGGGTTCAAATCCC
[0278] Pro CGG GGACGAGCCC GGCTCGTTGGTCTAGGGGTATGATTCTCGCT TTGGGTGCGAGAGGTCCCGGGTTCAAATCCC
[0279] Pro TGG GGACGAGCCC GTAGTCGTGGCCGAGTGGTTAAGGCGATGG ACTAGAAATCCATTGGGGTTTCCCCGCGCAG
[0280] Ser AGA GTTCGAATCCTGCCGACTACG GCTGTGATGGCCGAGTGGTTAAGGCGTTGG ACTCGAAATCCAATGGGGTCTCCCCGCGCAG
[0281] Ser CGA GTTCGAATCCTGCTCACAGCG GACGAGGNNTGGCCGAGTGGTTAAGGCGAT GGACTGCTAATCCATTGTGCTCTGCACGCGT
[0282] Ser GCT GGGTTCGAATCCCATCCTCGTCG GTAGTCGTGGCCGAGTGGTTAAGGCGATGG ACTTGAAATCCATTGGGGTCTCCCCGCGCAG
[0283] Ser TGA GTTCGAATCCTGCCGGCTACG GGCTCCGTGGCTTAGCTGGTTAAAGCGCCTG TCTAGTAAACAGGAGATCCTGGGTTCGAATC
[0284] Thr AGT CCAGCGGGGCCT GGCNCTGTGGCTNAGTNGGNTAAAGCGCCG GTCTCGTAAACCNGGAGATCNTGGGTTCGA
[0285] Thr CGT ATCCCANCNGGGCCT GGCTCCATAGCTCAGNGGGTTAGAGCACTG GTCTTGTAAACCAGGGGTCGCGAGTTCAAAT
[0286] Thr TGT CTCGCTGGGGCCT GACCTCGTGGCGCAACGGTAGCGCGTCTGA CTCCAGATCAGAAGGTTGCGTGTTCAAATCA
[0287] Trp CCA CGTCGGGGTCA CCTTCGATAGCTCAGCTGGTAGAGCGGAGG ACTGTAGATCCTTAGGTCGCTGGTTCGATTC
[0288] Tyr GTA CGGCTCGAAGGA GTTTCCGTAGTGTAGTGGTTATCACGTTCGC CTAACACGCGAAAGGTCCCCGGTTCGAAAC
[0289] Vai AAC CGGGCGGAAACA GTTTCCGTAGTGTAGTGGTTATCACGTTCGC CTCACACGCGAAAGGTCCCCGGTTCGAAAC
[0290]
[0291] Vai CAC CGGGCGGAAACAGGTTCCATAGTGTAGTGGTTATCACGTCTGC TTTACACGCAGAAGGTCCTGGGTTCGAGCCC
[0292] 54 Vai TAC CAGTGGAACCA AGCAGAGTGGCGCAGCGGAAGCGTGCTGGG CCCATAACCCAGAGGTCGATGGATCGAAAC
[0293]
[0294] 55 iMet CAT CATCCTCTGCTA
[0295] Table 6: Score values alignment
[0296] Candidate Reference Match
[0297] Row nucleotide nucleotide score
[0298] 1 A A 1
[0299] 2 T T 1
[0300] 3 U T 1
[0301] 4 C C 1
[0302] 5 G G 1
[0303] 6 A N 0
[0304] 7 T N 0
[0305] 8 C N 0
[0306] 9 G N 0
[0307] 10 N A 0
[0308] 11 N T 0
[0309] 12 N C 0
[0310] 13 N G 0
[0311]
[0312] 14 N N 0
[0313] Premature termination codons (PTC) and ORFs comprising PTCs
[0314] Mutations underlie many diseases. For example, a point mutation in the open reading frame (ORF) of a gene which creates a premature stop codon (PTC) can result in altered expression and / or activity of a polypeptide encoded by the gene. Table 7 provides single mutations in codons encoding amino acids which can result in a stop codon. In an embodiment, a PTC disclosed herein comprises a mutation disclosed in Table 7.
[0315] In an embodiment, the codon having the first sequence or the PTC comprises a mutation disclosed in Table 7. In an embodiment, the non-mutated, e.g., wildtype, codon sequence of the codon having the first sequence or the PTC is an original codon sequence provided in Table 7 and the amino acid corresponding to the non-mutated codon is an original AA provided in Table 7.In an embodiment, the TREM, TREM core fragment or TREM fragment recognizes a stop codon and mediates incorporation of the original AA provided in Table 7 at the position of the stop codon. In an embodiment, the TREM, TREM core fragment or TREM fragment recognizes a stop codon and mediates incorporation of an amino acid belonging to the same group as the original AA, e.g., as provided in Table 8. Other genetic abnormalities, such as insertions and / or deletions can also result in a PTC in an ORF.
[0316] Table 7. Select amino acids and stop codons
[0317] Original AA Original codon One mutation to stop codon LYS AAA UAA LYS AAG UAG ARG AGA UGA GLN CAA UAA GLN CAG UAG ARG CGA UGA GLU GAA UAA GLU GAG UAG GLY GGA UGA SER UCA UAA SER UCA UGA SER UCG UAG LEU LUA UAA LEU LUA UGA LEU L EG UAG TYR UAC UAA TYR UAC UAG TYR UAU UAA TYR UAU UAG CYS UGC UGA CYS UGU UGA TRP UGG UAG
[0318]
[0319] TRP UGG UGA
[0320] Table 8: Amino acids and amino acid groupings
[0321] Group Amino acid
[0322] Nonpolar, aliphatic R group leucine
[0323] methionine
[0324] isoleucine
[0325] glycine
[0326] alanine
[0327] valine
[0328]
[0329] Polar, uncharged R group serinethreonine
[0330] cysteine
[0331] proline
[0332] asparagine
[0333] glutamine
[0334] positively charged r group lysine
[0335] arginine
[0336] histidine
[0337] Negatively charged R group aspartate
[0338] glutamate
[0339] Nonpolar, aromatic R group phenylalanine
[0340] tyrosine
[0341]
[0342] tryptophan
[0343] Disclosed herein, inter alia, are endogenous ORFs comprising a codon having a first sequence, e.g., a mutation, e.g., a PTC. An ORF having a PTC, e.g., as described herein, can be present, or part of in any gene. As an example, the ORF can be present or be part of any gene in the human genome.
[0344] In an embodiment, a PTC disclosed herein is present in a gene disclosed in any one of Tables 9, 10, or 12. Exemplary genes having ORFs comprising a PTC are provided in Table 9. Table 9: Exemplary genes with ORFs having a PTC
[0345] A2ML1 ARFGEF1 CACNA1G CNOT1 DLG4 AARS1 ARFGEF2 CACNA1S COG1 DLL1 AARS2 ARHGAP21 CACNA2D1 COL11A2 DNA2 ABCA13 ARHGEF9 CACNA2D2 COL13A1 DNM1L CACNB2,
[0346] ABCB11 ARMC4 NSUN6 COL4A1 DNMT1 ABCG5 ARV1 CAD COL4A2 DNMT3A ABHD5 ARX CAMTAI COL4A4 DNMT3B ACAD8 ASCC3 CARS2 COL9A1 DPH1 ACADL ASH1L CCDC140 COQ4 DPYD-AS1 ACSF3 ASPH CCDC8 COQ6 DSEL ACTA2 ASXL2 CCM2 COX14 DSPP ACTC1, ATAD3A CD40LG CPE DUOXA1 ACTN2 ATP2A2 CDAN1 CPEB1-AS1 DUOXA2 ACVR1 ATP6V1B1 CDH15 CREBBP DVL1 ADAR ATP8A2 CDK11A CRELD1 EARS2 ADAT3 AUH CEBPA CSNK2A1 EBF3 ADCY5 AUTS2 CELF5 CSNK2B EBP
[0347]
[0348] ADIPOQ AVPR2 CELSR2 CSTA EDARADIP0Q-AS1 B3GLCT CEP135 CTNND2 EFHC1 ADIPOR1 B4GAT1 CEP 164 CTSA EFNB1 AFF2 BCAP31 CEP83 CTSC EFTUD2 ALG11 BCL11A CETP CUL3 EIF2B5 ALG14 BCL11B CFI CYLD ELANE ALG6 BCORL1 CHAMP 1 CYP11A1 EMC1 ALOXE3 BEND2 CHAT DAG1 EMC1-AS1 AMER1 BGN CHD1 DARS2 ENO3 AMH BMP4 CHD4 DCX ENTPD5 AMMECR1 BRD4 CHD8 DDHD2 EP300 AMN BRPF1 CHRM2 DDR2 EPM2A ANK2 BRSK2 CHRNB1 DEAF1 ERLIN2 ANK3 BUB1B CIC DENND5A EVC ANKS6 BUB1B-PAK6 CLCN7 DGAT1 EZH2 ANOS1 C8G CLTC DHFR FAM111A AP1S1 CACNA1E CNGA3 DIAPH3 FAM126A AP3B2 CACNA1F CNKSR2 DISP1 FAN1 FANCD2 GJB6 ISLR2 LOCI 10673972 MTR FANCE GJC2 ITGA3 LOCI 12997540 MYCBP2 FASTKD2 GK ITGA8 LOCI 13788297 MYCNOS FAT1 GLI2 ITGB6 LOC349160 MYH7B FBN2 GNAI1 JMJD1C LONP1 MYL3 FBP1 GNB1L KANK1 LORICRIN MYOMI FDXR GNE KANSL1 LPIN1 MYPN FGA GNRIII KBTBD13 LPIN2 MYT1L FGD1 GNS KCNA2 LRP2 NAA15 FGF10 GPAA1 KCNB1 LRRTM4 NAGA FGFR1 GPD1L KCND2 MAB21L2 NARS2 FGFR2 GRIN2A KCNE3 MAF NAXE FIBP GTPBP3 KCNMA1 MARS1 NCAPH2 FL ADI HACE1 KCNQ5 MARS2 NCF2 FLG-AS1 HADH KCTD7 MASP1 NDP FLVCR1 HADHB KIDINS220 MBOAT7 NDP-AS1 FLVCR2 HDAC4 KIF21B MCM3AP NDRG1 NDUFA2, FMN2 HERC1 KIF6 MCM3AP-AS1 TMCO6 FOXA2 HESX1 KIT MED 13 NDUFAF1 FOXCI HIBCH KLHL40 MED 17 NDUFAF5 FOXC2 HNF4A KLHL41 MEGF10 NDUFAF6
[0349]
[0350] FOXC2-AS1 HNRNPH2 KNL1 MET NDUFAF7F0XP2 HPRT1 KRAS MGAT2 NDUFS1 FREM1 HRG LAMB1 MIBI NDUFS3 FRYE HUWE1 LAMB2 MICU1 NEFH FTL IARS1 LAMC3 MIR302CHG NEK8 FUS IBA57 LARP7 MIR5004 NEXMIF GABRG2 IDH2 LARS1 MIR6501 NFIA GAN IFNAR1 LCT MITD1 NFKB1 GATA2 IFT122 LEMD3 MMP13 NHEJ1 GATA4 IFT80 LGI4 MMP21 NICN1 GAT ADI IGF2 LIAS MNX1 NIDI GDF5 ILDR1 LINS1 MNX1-AS2 NKX2-1 GDF5-AS1 ILK, TAF10 LIPC MPDU1 NLRP1 GFM1 INF2 LIPT1 MRPS22 NLRP3 GH-LCR INS-IGF2 LOC101448202 MSL3 NOD2 LOC106804612,
[0351] GHRHR INSR HBA2 MSRB3 NONO GHSR IRAKI BPI LOC107303338 MT-ND2 NOTCH3 GJ Al IRAK3 RARS2 SETD1B SPTLC1 NPHP4 PLEKHG5 RAX SETD2 SRD5A3 NPR2 PLEKHM2 RBM10 SETX SRPX2 NR2F2 PLK4 RELN SFTA3 SSBP2 NR5A1 PLPBP RERE SHANK2 ST3GAL3 NRL, PCK2 PNKD RFT1 SHH ST3GAL5 NRXN1 PNPLA1 RMND1 SIN3A STAMBP NT5DC1 POC1A RNASEH1 SIX3 STAT3 NTRK2 POLG2, MILR1 RNF17 SKI STIL NUBPL POMGNT2 ROR2 SLC13A5 STX11 NUS1 PPM1D RP2 SLC16A1 STX1B OCRL PPP3CA RPL11 SLC16A2 SUCLA2 OPTN PRDM1 RPS19 SLC17A8 SYN1 P4HA1 PRDM12 RRM2B SLC18A3 SYN2 PAK6 PREPL RSI SLC20A2 SYNJ1 PBX1 PRICKLEI RUNX2 SLC25A4 TAB2 PCARE PRKAG2 RXYLT1 SLC25A46 TACR3 PCDH12 PRO SI S100PBP SLC2A1 TBCD PDCD10 PRPF31 SALL4 SLC39A8 TBL1XR1 PDE11A-AS1 PRPF8 SAMD9 SLC52A2 TBX1 PDE4D PRPS1 SAR1B SLC6A3 TBX18 PDE6A PRSS1, TRB SASH3 SLC6A8 TCIRG1
[0352]
[0353] PDHX PS ATI SBF2 SLC6A9 TELO2PDLIM3 PSMD12 SBF2-AS1 SLC7A9 TFAP2A PDP1 PSTPIP1 SCAMP4 SMAD2 TFG PDSS1 PTCHD1 SCLT1 SMAD9 TGIF1 PEX5 PTF1A SCN10A SMARCA2 THAP1 PHF21A PTPN23 SCN11A SMC3 TINF2 PHF8 PTPRQ SCN1B SMOC2 TLK2 PHKA2 PTRH2 SCN3A SNTA1 TMEM43 PHKB PUS1 SCN4A SNX14 TMIE PIEZO 1 PYCR2 SCN4B SNX22 TMPO PIGG QARS1 SCN8A SOCS1 TMPRSS15 RAB3GAP1,
[0354] PIGL ZRANB3 SCO2 SOX11 TMTC3 PIGM RAB3GAP2 SCYL1 SOX17 TNFAIP3 PIGP RAC1 SEMA4A SPATA5 TNFRSF11A PIK3CA RAFI SEPTIN9 SPATA7 TOE1 PIN4, ERCC6L RAG1 SET SPRED1 TOR1AIP1 PLAT RARB SETD1A SPTBN2 TPK1 TPM1 UTP14C ZEB1
[0355] TRAPPC9 VPS53 ZFHX4
[0356] TRI M37 WDR19 ZFPM2
[0357] TRIM59-IFT80 WDR26 ZFPM2-AS1
[0358] TRIO WDR62 ZIC1
[0359] TRIP 12 WDR81 ZIC2
[0360] TRIP4 WNT1 ZMYND11
[0361] TRPM1 WNT10A ZNF335
[0362] TSEN54 WRAP53 ZNF423
[0363] TUBA4A WWOX ZNF469
[0364] TUBGCP4 YARS1
[0365] TUBGCP6 YARS2
[0366] TWNK YY1
[0367] TXNRD2 ZAP70
[0368] UBA2 ZBTB20
[0369] UBA5 ZBTB24
[0370] UMOD ZC4H2
[0371]
[0372] UNC5B ZDHHC9
[0373] Additional exemplary genes containing a PTC include FVIII, FIX, CFTR, MeCP2, NAGLU, DMD, GAA, RP1, RP2, ABCA4, PCDH15, REP1, GLA, MUT, TP53, and ATM. In an embodiment, the PTC is present within the FVIII gene and comprises an R mutation, e.g., anR2228X mutation. In an embodiment, the PTC is present within the FIX gene and comprises an R mutation, e.g., an R29X mutation, an R116X mutation, an R248X mutation, an R252X mutation, an R333X mutation, and / or an R338X mutation. In an embodiment, the PTC is present within the CFTR gene and comprises an R mutation, e.g., an R553X mutation. In an embodiment, the PTC is present within the MeCP2 gene and comprises an R mutation, e.g., an R168X mutation. In an embodiment, the PTC is present within the NAGLU gene and comprises an R mutation, e.g., an R626X mutation. In an embodiment, the PTC is present within the DMD gene and comprises an R mutation, e.g., an R3881X mutation. In an embodiment, the PTC is present within the GAA gene and comprises an R mutation, e.g., an R854X mutation. In an embodiment, the PTC is present within the RP1 gene and comprises an R mutation, e.g., an R667X mutation. In an embodiment, the PTC is present within the RP2 gene and comprises an R mutation, e.g., an R120X mutation. In an embodiment, the PTC is present within the ABCA4 gene and comprises an R mutation, e.g., an R2030X mutation. In an embodiment, the PTC is present within the PCD gene and comprises an R mutation, e.g., an R245X mutation. In an embodiment, the PTC is present within the REP1 gene and comprises an R mutation, e.g., an R270X mutation. In an embodiment, the PTC is a mutation in the GLA gene, e.g., an R220X mutation and / or an R227X mutation. In an embodiment, the PTC is present within the MUT gene and comprises an R mutation, e.g., an R228X mutation, an R403X mutation, an R467X mutation, and / or an R727X mutation. In an embodiment, the PTC is present within the TP53 gene and comprises an R mutation, e.g., an R578X mutation. In an embodiment the PTC is present within the ATM gene and comprises an R mutation, e.g., an R35X mutation.
[0374] Diseases or disorders associated with a PTC
[0375] A TREM composition disclosed herein can be used treat a disorder or disease associated with a PTC, e.g., as described herein. Exemplary diseases or disorders associated with a PTC are listed in Tables 10, 11, and 12.
[0376] In an embodiment, the subject has a disease or disorder provided in any one of Tables 10-12. In an embodiment, the cell is associated with, e.g., is obtained from a subject who has, a disorder or disease listed in any one of Tables 10-12.
[0377] For example, the disorder or disease can be chosen from the left column of Table 10. As another example, the disorder or disease is chosen from the left column of Table 10 and, inembodiments the PTC is in a gene chosen from the right column of Table 10, e.g., any one of the genes provided in the right column of Table 10. In some embodiments, the PTC is in a gene corresponding to the disorder or disease provided in the left column of Table 10. As a further non-limiting example, the PTC can be at a position provided in Table 10.
[0378] As another example, the disorder or symptom is chosen from a disorder or disease provided in Table 11.
[0379] As yet another example, the disorder or symptom is chosen from a disorder or disease provided in Table 12. In an embodiment, the disorder or symptom is chosen from a disorder or disease provided in Table 12 and, in embodiments, the PTC is in any gene provided in Table 12. In an embodiment, the disorder or symptom is chosen from a disorder or disease provided in Table 12 and the PTC is in a corresponding gene provided in Table 12, e.g., a gene corresponding to the disease or disorder. In an embodiment, the disorder or symptom is chosen from a disorder or disease provided in Table 12 and the PTC is not in a gene provided in Table 12.
[0380] In an embodiment of any of the methods disclosed herein, the PTC is at any position within the ORF of the gene, e.g., upstream of the naturally occurring stop codon.
[0381] Table 10: Exemplary diseases or disorders
[0382] Disease / disorder or protein Exemplary Point Mutation
[0383] G to A point mutations
[0384] Dihydropyrimidine dehydrogenase NM 000110.3(DPYD):c.l905+lG>A deficiency
[0385] Noonan syndrome NM 005633.3(SOSl):c.2536G> A (p.Glu846Lys)
[0386] Lynch syndrome NM 000251.2(MSH2):c.212-lG>A Breast-ovarian cancer, familial 1 NM 007294.3(BRCAl):c.963G>A (p.Trp321Ter)
[0387] Cystic fibrosis NM 000492.3(CFTR):c.57G>A (p.Trpl9Ter) Anemia, due to G6PD deficiency NM 000402.4(G6PD):c.292G> A (p.Val98Met)
[0388] AVPR2 NM 000054.4(AVPR2):c.878G> A Nephrogenic diabetes insipidus, X-linked (p.Trp293Ter)
[0389] FANCC NM 000054.4(AVPR2):c.878G> A Fanconi anemia, complementation group C (p.Trp293Ter)
[0390] FANCC NM 000136.2(FANCC):c.1517G>A Fanconi anemia, complementation group C (p.Trp506Ter)
[0391] IL2RG NM 000206.2(IL2RG):c.710G>A
[0392] X-linked severe combined (p.Trp237Ter)
[0393]
[0394] immunodeficiencyF8 Hereditary factor VIII deficiency NM 000132.3(F8):c.3144G>A disease (p.TrplO48Ter)
[0395] LDLR NM 000527.4(LDLR):c.l449G> A Familial hypercholesterolemia (p.Trp483Ter)
[0396] CBS NM 000071.2(CBS):c.l62G>A Homocystinuria due to CBS deficiency (p.Trp54Ter)
[0397] HBB NM 000518.4(HBB):c.114G>A beta Thalassemia (p.Trp38Ter)
[0398] ALDOB NM 000035.3(ALDOB):c.888G>A Hereditary fructosuriaa (p.Trp296Ter)
[0399] DMD NM 004006.2(DMD):c.3747G> A Duchenne muscular dystrophy (p.Trpl249Ter)
[0400] SMAD4 NM 005359.5(SMAD4):c.906G>A Juvenile polyposis syndrome (p.Trp302Ter)
[0401] BRCA2
[0402] Breast-ovarian NM 000059.3(BRCA2):c.582G>A cancer, familial 2 (p.Trpl94Ter)
[0403] GRIN2A
[0404] Epilepsy, focal, with speech disorder and NM 000833.4(GRIN2A):c.3813G> A with or without mental retardation (p.Trpl271Ter)
[0405] SCN9A
[0406] Indifference to pain, congenital, NM 002977.3(SCN9A):c.2691G>A autosomal recessive (p.Trp897Ter)
[0407] TARDBP NM 007375.3(TARDBP):c.943G>A Amyotrophic lateral sclerosis type 10 (p.Ala315Thr)
[0408] CFTR
[0409] Cystic fibrosis and hereditary NM 000492.3(CFTR):c.3846G>A pancreatitis (p.Trpl282Ter)
[0410] UBE3A NM 130838. l(UBE3A):c.2304G>A Angelman syndrome (p.Trp768Ter)
[0411] SMPD1 NM 000543.4(SMPDl):c.l68G>A Niemann-Pick disease, type A (p.Trp56Ter)
[0412] USH2A NM 206933.2(USH2A):c.9390G>A Usher syndrome, type 2 A (p.Trp3130Ter)
[0413] MEN1 NM 130799.2(MENl):c.l269G>A Hereditary cancer-predisposing syndrome (p.Trp423Ter)
[0414] C8orf37 NM 177965.3(C8orf37):c.555G>A Retinitis pigmentosa 64 (p.Trpl85Ter)
[0415] MLH1 NM 000249.3(MLHl):c.1998G>A Lynch syndrome (p.Trp666Ter)
[0416] TSC2 NM 000548.4(TSC2):c.2108G>A Tuberous sclerosis (p.Trp703Ter)
[0417] NF1 NM 000267.3(NFl):c.7044G>A Neurofibromatosis, type 1 (p.Trp2348Ter)
[0418]
[0419] MSH6 NM 000179.2(MSH6):c.3020G>ALynch syndrome (p.Trpl007Ter)
[0420] SMN1
[0421] Spinal muscular atrophy, type III NM 000344.3(SMNl):c.305G>A Kugelberg- Welander disease (p.TrplO2Ter)
[0422] SH3TC2 NM 024577.3(SH3TC2):c.920G>A Charcot-Marie-Tooth disease, type 4C (p.Trp307Ter)
[0423] DNAH5 NM 001369.2(DNAH5):c.8465G> A Primary ciliary dyskinesia (p.Trp2822Ter)
[0424] MECP2 NM 004992.3(MECP2):c.311G>A Rett syndrome (p.TrplO4Ter)
[0425] ADGRV1 NM 032119.3(ADGRVl):c.7406G>A Usher syndrome, type 2C (p.Trp2469Ter)
[0426] AHil NM 017651.4(AHIl):c.2174G>A Joubert syndrome 3 (p.Trp725Ter)
[0427] PRKN NM 004562.2(PRKN):c.1358G>A Parkinson disease 2 (p.Trp453Ter)
[0428] COL3A1 NM 000090.3(COL3Al):c.3833G>A Ehlers-Danlos syndrome, type 4 (p.Trpl278Ter)
[0429] BRCA1 NM 007294.3 (BRC A 1 ) : c.5511 G> A Breast-ovarian (p.Trpl837Ter)
[0430] cancer, familial 1
[0431] MYBPC3 NM 000256.3(MYBPC3):c.3293G> A Primary familial hypertrophic (p.TrplO98Ter)
[0432] cardiomyopathy
[0433] APC NM 000038.5(APC):c.1262G> A Familial adenomatous polyposis 1 (p.Trp421Ter)
[0434] BMPR2 NM 001204.6(BMPR2):c.893G> A Primary pulmonary hypertension (P.W298*)
[0435] T to C point mutations
[0436] Wilson disease NM_000053.3(ATP7B):c.3443T>C (p ile 11
[0437] 48Thr)
[0438] Leukodystrophy, hypomyelinating, 2 NM_020435.3 (GJC2) : c.857T>C (p.Met286Thr)
[0439] Alport syndrome, X-linked recessive NM_000495.4(COL4A5):c.438+2T>C Leigh disease NC 012920. l:m.9478T>C
[0440] Gaucher disease, type 1 NM_001005741.2(GBA):c.751T>C (p.Tyr251His)
[0441] Renal dysplasia, retinal pigmentary NM_014714.3(IFT140):c.4078T>C dystrophy, cerebellar ataxia and skeletal (p.Cysl360Arg)
[0442] dysplasia
[0443] Marfan syndrome NM_000138.4(FBN 1 ) : c.3793 T>C (p.Cysl265Arg)
[0444] Deficiency of UDPglucose-hexose- 1 - NM_000155.3(GALT):c.482T>C phosphate uridylyltransferase (p.Leul61Pro)
[0445]
[0446] Familial hypercholesterolemia NM_000527.4(LDLR):c.694+2T>C Episodic pain syndrome, familial, 3 NM_001287223.1(SCNllA):c.l 142T>C (p.Ile381Thr)
[0447] Navajo neurohepatopathy NM_002437.4(MP V 17) : c.186+2T>C Congenital muscular dystrophy, LMNA- NM_1 70707.3(LMNA):c.ll39T>C related (p.Leu380Ser)
[0448] Hereditary factor VIII deficiency disease NM_000132.3(F8):c.5372T>C (p.Metl 791Thr)
[0449] Insulin-dependent diabetes mellitus NM_014009.3(FOXP3):c.970T>C secretory diarrhea syndrome (p.Phe324Leu)
[0450] Hereditary factor IX deficiency disease NM_000133.3(F9):c.l328T>C (p.Ile443Thr) Familial cancer of breast, Breast-ovarian NM_000059.3 (BRC A2) : c.316+2T>C cancer, familial 2, Hereditary cancer
[0451] predisposing syndrome
[0452] Cardiac arrhythmia NM 000238.3 (KCNH2) : c.1945 +6T>C Tangier disease NM 005502.3(ABCAl):c.4429T>C (p.Cysl477Arg)
[0453] Dilated cardiomyopathy 1AA NM_001103.3(ACTN2):c.683T>C (p.Met228Thr)
[0454] Mental retardation 3, X-linked NM_005334.2(HCFCl):c.-970T>C Limb-girdle muscular dystrophy, type 2B NM_003494.3(DYSF):c.l284+2T>C Macular dystrophy, vitelliform, 5 NM 016247.3 (IMPG2) : c.370T>C (p.Phel24Leu)
[0455] Retinitis pigmentosa NM_000322.4(PRPH2):c.736T>C
[0456]
[0457] (p.Trp246Arg)
[0458] Table 11: Additional exemplary disorders
[0459] 5q-syndrome Holt-Oram syndrome
[0460] Adams-Oliver syndrome- 1 Hypoparathyroidism
[0461] Adams-Oliver syndrome-3 Intellectual disability
[0462] Adams-Oliver syndrome-5 Kleefstra syndrome 1
[0463] Adams-Oliver syndrome-6 Klippel-Trenaunay syndrome (AAGF -related) Alagille syndrome- 1 Marfan syndrome
[0464] Autoimmune lymphoproliferative syndrome
[0465] Mental retardation
[0466] type IA
[0467] Autoimmune lymphoproliferative syndrome
[0468] Mental retardation
[0469] type V
[0470] Autosomal dominant deafness-2A Mental retardation
[0471] Mental retardation and distinctive facial Brain malformations with or without urinary
[0472] features with or without cardiac defects tract defects (BRMUTD)
[0473] (MRFACD)
[0474] Carney complex type 1 Nail-patella syndrome (NPS)
[0475]
[0476] CHARGE syndrome ObesityCleidocranial dysplasia Phelan-McDermid syndrome
[0477] Currarino syndrome Pitt-Hopkins syndrome
[0478] Denys-Drash syndrome / Frasier syndrome Primary pulmonary hypertension- 1 Developmental delay Rett syndrome (congenital variant) DiGeorge syndrome (TBXl-associated) Sensorineural deafness
[0479] Dravet syndrome Smith-Magenis syndrome (RAI1 -associated) Duane-radial ray syndrome Sotos syndrome- 1
[0480] Ehlers-Danlos syndrome (classic-like) Sotos syndrome-2
[0481] Ehlers-Danlos syndrome (vascular type) Stickler syndrome type I
[0482] Feingold syndrome-1 Supravalvular aortic stenosis
[0483] Feri-Weill dyschondrosteosis SYNGAP1 -related intellectual disability Frontotemporal lobar degeneration with
[0484] Treacher Collins syndrome
[0485] TDP43 inclusions (FTFD-TDP)
[0486] GFUT1 deficiency syndrome Trichorhinophalangeal syndrome type I Greig cephalopolysyndactyly syndrome Ulnar-mammary syndrome
[0487] Hereditary hemorrhagic telangiectasia type 1 van der Woude syndrome-1 Holoprosencephaly-3 Waardenburg syndrome type 1 Holoprosencephaly-4 Waardenburg syndrome type 2 A
[0488]
[0489] Holoprosencephaly-5 Waardenburg syndrome type 4C
[0490] Table 12: Exemplary genes with ORFs comprising a PTC and exemplary disorders
[0491] Gene Disease / Disorder
[0492] AAAS Glucocorticoid deficiency with achalasia
[0493] AAGAB Keratosis palmoplantaris papulosa
[0494] AASS Hyperlysinemia
[0495] ABCA1 Tangier disease
[0496] ABC Al 2,
[0497] SNHG31 Autosomal recessive congenital ichthyosis-4B
[0498] ABCA3 Surfactant metabolism dysfunction-3
[0499] Bietti crystalline corneoretinal dystrophy; Cone-rod degeneration; Cone-rod dystrophy-3; Macular dystrophy; Retinal dystrophy; Retinitis pigmentosa; ABCA4 Retinitis pigmentosa- 19; Stargardt disease; Stargardt disease type 1
[0500] Intrahepatic cholestasis of pregnancy -3; Progressive familial intrahepatic ABCB4 cholestasis-3
[0501] ABCC2 Dubin-Johnson syndrome
[0502] Cutis laxa; Generalized arterial calcification of infancy-2; Papule;
[0503] ABCC6 Pseudoxanthoma elasticum forme fruste
[0504] ABCC8 Familial hyperinsulinism;Familial hyperinsulinemic hypoglycemia- 1
[0505] Arrhythmogenic right ventricular cardiomyopathy; Cardiomyopathy;
[0506] Cardiovascular phenotype; Dilated cardiomyopathy-10; Primary dilated ABCC9 cardiomyopathy
[0507]
[0508] ABCD1 Adrenoleukodystrophy; Spastic gait; Spastic paraplegiaABHD12 Polyneuropathy; Cataract; Ataxia; Hearing loss; Retinitis pigmentosa ABRAXAS 1 Hereditary breast and ovarian cancer syndrome
[0509] ACAD9 Deficiency of acyl-CoA dehydrogenase family member 9
[0510] ACADM Medium-chain acyl-coenzyme A dehydrogenase deficiency
[0511] ACADS Deficiency of butyryl-CoA dehydrogenase
[0512] ACADVL Very long chain acyl-CoA dehydrogenase deficiency
[0513] ACAN Osteochondritis dissecans; Kimberly type spondyloepiphyseal dysplasia AC ATI Deficiency of acetyl-CoA acetyltransferase
[0514] ACBD5 Retinal dystrophy with leukodystrophy
[0515] ACBD6, LHX4,
[0516] LHX4-AS1 Short stature; Pituitary and cerebellar defects; Small sella turcica syndrome ACE Renal dysplasia
[0517] AC0X1 Peroxisomal acyl-CoA oxidase deficiency
[0518] ACP5 Spondyloenchondrodysplasia with immune dysregulation
[0519] ACP5, ZNF627 Spondyloenchondrodysplasia with immune dysregulation
[0520] ACTA1 Congenital myopathy with excess of thin filaments
[0521] ACTB Baraitser-Winter syndrome
[0522] Hereditary hemorrhagic telangiectasia type 1; Primary pulmonary hypertension; Pulmonary arterial hypertension related to hereditary ACVRL1 hemorrhagic telangiectasia; ; Hereditary hemorrhagic; Telangiectasia type 2 ACY1 Neurological conditions associated with aminoacylase-1 deficiency Severe combined immunodeficiency disease; Severe combined
[0523] ADA immunodeficiency due to ADA deficiency
[0524] ADAMI 0 Reticulate acropigmentation of Kitamura
[0525] ADAMTS17 Weill-Marchesani syndrome type 4
[0526] ADAMTS2 Dermatosparaxis-type Ehlers-Danlos syndrome
[0527] Ectopia lentis; Ectopia lentis et pupillae; Isolated autosomal recessive ADAMTSL4 ectopia lentis-2
[0528] ADCY3 Body mass index quantitative trait locus- 19
[0529] ADCY3,
[0530] CENPO Body mass index quantitative trait locus- 19
[0531] ADGRG1 Bilateral frontoparietal polymicrogyria
[0532] Congenital bilateral aplasia of vas deferens from CFTR mutation; X-linked ADGRG2 congenital bilateral aplasia of vas deferens
[0533] Arthrogryposis multiplex congenita; Lethal congenital contracture ADGRG6 syndrome-9
[0534] Familial febrile seizures-4; Rare genetic deafness; Retinal dystrophy; Usher ADGRV1 syndrome type 2C
[0535] Helsmoortel-Van der Aa Syndrome; History of neurodevelopmental ADNP disorder; Inborn genetic diseases
[0536] AEBP1 Classic-like Ehlers-Danlos syndrome-2
[0537]
[0538] AGA AspartylglucosaminuriaAGK Sengers syndrome
[0539] AGK,
[0540] DENND11 Congenital autosomal recessive cataract-5; Sengers syndrome Glycogen storage disease; Glycogen storage disease type Illa; Glycogen AGL storage disease type Illb; Glycogen storage disease type III AGPAT2 Congenital generalized lipodystrophy type 1
[0541] AGRN Congenital myasthenic syndrome
[0542] AGT Renal dysplasia
[0543] AGTR1 Renal dysplasia
[0544] AGXT Primary hyperoxaluria type I
[0545] Delayed speech and language development; Global developmental delay; Intellectual disability; Muscular hypotonia; Neonatal hypotonia; Sleep AHDC1 apnea; Xia-Gibbs syndrome
[0546] Joubert syndrome; Joubert syndrome-3; Retinal dystrophy; Retinitis AHI1 pigmentosa
[0547] AHR Retinitis pigmentosa-85
[0548] Autoimmune polyglandular syndrome type 1; Autoimmune polyglandular AIRE syndrome type 1 with reversible metaphyseal dysplasia
[0549] ALB Analbuminemia
[0550] ALDH18A1 Cutis laxa; Corneal clouding; Oligophrenia syndrome
[0551] ALDH3A2 Sjogren-Larsson syndrome
[0552] ALDH5A1 Succinate-semialdehyde dehydrogenase deficiency
[0553] ALDH7A1 Pyridoxine-dependent epilepsy; Seizures
[0554] ALDOB Hereditary fructosuria
[0555] ALG1 Congenital disorder of glycosylation
[0556] ALG3 Congenital disorder of glycosylation
[0557] ALMS1 Al strom syndrome
[0558] ALOX12B Autosomal recessive congenital ichthyosis-2
[0559] ALPK3 Familial hypertrophic cardiomyopathy-27; Hypertrophic cardiomyopathy ALPL Hypophosphatasia; Infantile hypophosphatasia
[0560] Amyotrophic lateral sclerosis type 2; Infantile-onset ascending hereditary ALS2 spastic paralysis; Juvenile primary lateral sclerosis
[0561] ALX4 Parietal foramina-2
[0562] AMPD2 Pontocerebellar hypoplasia type 9
[0563] AMT Non-ketotic hyperglycinemia
[0564] ANAPC1 Rothmund-Thomson syndrome type 1
[0565] ANGPTL3,
[0566] DOCK7 Familial h;ypobetalipoproteinemia-2
[0567] ANKRD1 -related dilated cardiomyopathy; Cardiovascular phenotype;
[0568]
[0569] ANKRD1 Primary dilated cardiomyopathyAbnormal facial shape; Clinodactyly of the 5th finger; Conductive hearing impairment; Delayed speech and language development; Global developmental delay; Inborn genetic diseases; Intellectual disability; KBG syndrome; Ptosis; Seizures; Short foot; Short palm; Unilateral ANKRD1 1 cryptorchidism
[0570] Autosomal recessive cerebellar ataxia; Autosomal recessive spinocerebellar ANO 10 ataxia- 10
[0571] ANO5-related disorders; Achilles tendon contracture; Elevated serum creatine phosphokinase; Gnathodiaphyseal dysplasia; Limb-girdle muscular dystrophy; Lower limb amyotrophy; Lower limb muscle weakness; Miyoshi muscular dystrophy-3; Muscular diseases; Polycystic kidney dysplasia type ANO5 2L
[0572] ANTXR1 Odontotrichomelic syndrome
[0573] AP1B1 Autosomal recessive keratitis-ichthyosis-deafness syndrome
[0574] AP3B1 Hermansky-Pudlak syndrome type 2
[0575] AP4B1, AP4B1- AS1 Inborn genetic diseases; Autosomal recessive spastic paraplegia-47 AP4M1 Autosomal recessive spastic paraplegia-50
[0576] AP5Z1 Autosomal recessive spastic paraplegia-48
[0577] Adenomatous colonic polyposis; Adenomatous polyposis coli with congenital cholesteatoma; Brain tumor-polyposis syndrome-2; Carcinoma of colon; Colon adenocarcinoma; Colorectal cancer; Craniopharyngioma; Desmoid disease; Desmoid tumors; Duodenal polyposis; Familial adenomatous polyposis; Familial adenomatous polyposis-1; Familial multiple polyposis syndrome; Gardner syndrome; Gastric polyposis;
[0578] Hepatocellular carcinoma; Hereditary cancer-predisposing syndrome;
[0579] Hyperplastic colonic polyposis; Intestinal polyp; Malignant colorectal neoplasm; Neoplasm of stomach; Neoplasm of the large intestine;
[0580] APC Periampullary adenoma
[0581] APOA1,
[0582] APO Al -AS Familial hypoalphalipoproteinemia
[0583] Familial hypobetalipoproteinemia-1; Normotriglyceridemic familial APOB hypobetalipoproteinemia
[0584] APOC2 Nijmegen apolipoprotein C-II deficiency; Apolipoprotein C2 deficiency APOC2,
[0585] APOC4-APOC2 Padova apolipoprotein C-II deficiency; Apolipoprotein C2 deficiency APTX Ataxia-oculomotor apraxia type 1
[0586] Androgen resistance syndrome; X-linked bulbo-spinal atrophy; Partial AR androgen insensitivity syndrome
[0587] Rhizolemic short stature, micrognathia, and developmental delay with ARCN1 microcephaly
[0588] ARG1, MED23 Arginase deficiency
[0589] ARHGEF18 Retinitis pigmentosa-78
[0590]
[0591] ARID! A Autosomal dominant mental retardation- 14Absent speech; Blepharophimosis; Coffin-Siris syndrome-1; Constipation;
[0592] Decreased body weight; Failure to thrive; Inborn genetic diseases;
[0593] Intellectual disability; Long eyelashes; Microcephaly; Recurrent respiratory infections; Seizures; Short stature; Thick lower lip vermilion; Thin upper lip ARIDIB vermilion
[0594] ARID2 Coffin-Siris syndrome type 6
[0595] ARL2BP Retinitis pigmentosa-82 with or without situs inversus
[0596] Male infertility with teratozoospermia due to single gene mutation;
[0597] ARMC2 Spermatogenic failure-38; Sperm tail anomaly
[0598] ARMC2, Male infertility with teratozoospermia due to single gene mutation;
[0599] ARMC2-AS1 Spermatogenic failure-38
[0600] ARMC5 Acth-independent macronodular adrenal hyperplasia-2
[0601] Late infantile metachromatic leukodystrophy; Pseudoarylsulfatase A ARSA deficiency
[0602] ARSB Metachromatic leukodystrophy; Mucopolysaccharidosis type 6
[0603] ART4 Dombrock blood group system
[0604] Farber disease; Spinal muscular atrophy-progressive myoclonic epilepsy ASAHI syndrome
[0605] ASL Argininosuccinate lyase deficiency
[0606] ASP A,
[0607] SPATA22 Canavan disease; Familial spongy degeneration of central nervous system Microcephaly; Primary autosomal recessive microcephaly; Primary autosomal recessive microcephaly-1; Primary autosomal recessive ASPM microcephaly -5
[0608] ASS1 Citrullinemia type I
[0609] ASXL1 Bohring-Opitz syndrome; Inborn genetic diseases
[0610] ASXL3 Bainbridge-Ropers syndrome
[0611] ATF6 Achromatopsia; Achromatopsia-7
[0612] ATL1 Hereditary spastic paraplegia-3A
[0613] Ataxia-telangiectasia syndrome; Familial cancer of breast; Hereditary breast and ovarian cancer syndrome; Hereditary cancer-predisposing syndrome; ATM Ovarian neoplasms
[0614] Ataxia-telangiectasia syndrome; Ataxia-telangiectasia without immunodeficiency; Breast cancer; Familial cancer of breast; Hereditary ATM, Cllorf65, breast and ovarian cancer syndrome; Hereditary cancer-predisposing ATP13A2 syndrome; Neoplasm of the breast; Susceptibility to Kufor-Rakeb syndrome Abnormality of neuronal migration; Arthrogryposis multiplex congenita; ATP1A2 Epilepsy; Hydrops fetalis
[0615] ATP2A1 Brody myopathy
[0616] ATP2C1 Familial benign pemphigus
[0617] ATP6V0A2 ALG9 congenital disorder of glycosylation; Cutis laxa with osteodystrophy ATP6V0A4 Autosomal recessive distal renal tubular acidosis
[0618]
[0619] ATP7A Cutis laxa; X-linked Menkes kinky -hair syndromeATP7B Inborn genetic diseases; Wilson disease
[0620] Alpha thalassemia-X-linked intellectual disability syndrome; Intellectual disability; Mental retardation-hypotonic facies syndrome; X-linked mental ATRX retardation-hypotonic facies syndrome- 1
[0621] AXIN2 Oligodontia-colorectal cancer syndrome
[0622] B3GALNT1 P-blood group phenotype
[0623] Congenital muscular dystrophy-dystroglycanopathy type A-l 1 with brain B3GALNT2 and eye anomalies
[0624] B3GALT6 Spondylo-epi-metaphyseal dysplasia
[0625] B4GALNT1 Hereditary spastic paraplegia-26; Inborn genetic diseases
[0626] B4GALT7 Progeroid type Ehlers-Danlos syndrome
[0627] B9D1 Joubert syndrome; Meckel syndrome; Meckel-Gruber syndrome type 9 B9D2 Joubert syndrome
[0628] BAG3-related cardiovascular phenotype; Dilated cardiomyopathy- 1HH; Inborn genetic diseases; Myofibrillar myopathy; Primary dilated BAG3 cardiomyopathy
[0629] Hereditary cancer-predisposing syndrome; Tumor susceptibility linked to BAP1 germline BAP1 mutations
[0630] Breast cancer; Familial cancer of breast; Hereditary breast and ovarian cancer syndrome; Hereditary cancer-predisposing syndrome; TripleBARD1 negative breast cancer
[0631] BBS1 Bardet-Biedl syndrome
[0632] BBS1,
[0633] ZDHHC24 Bardet-Biedl syndrome; Bardet-Biedl syndrome- 1
[0634] Bardet-Biedl syndrome; Bardet-Biedl syndrome- 1; Bardet-Biedl syndrome- 10; Digenic Bardet-biedl syndrome-6 / 10; Inborn genetic diseases; Retinal BBS10 dystrophy; Retinitis pigmentosa
[0635] Bardet-Biedl syndrome; Bardet-Biedl syndrome-2; Digenic Bardet-Biedl syndrome- 1 / 2; Digenic Bardet-biedl syndrome-2 / 6; Retinal dystrophy; BBS2 Retinitis pigmentosa; Retinitis pigmentosa-74
[0636] BBS5 Bardet-Biedl syndrome-5
[0637] BBS9 Bardet-Biedl syndrome
[0638] BCKDHA Maple syrup urine disease; Maple syrup urine disease type-1 A Classic; maple syrup urine disease type IB; Maple syrup urine disease; BCKDHB Maple syrup urine disease type IB
[0639] BCOR Oculofaciocardiodental syndrome
[0640] BCSIL-related disorders; Gracile syndrome; Leigh syndrome;
[0641] Mitochondrial complex III deficiency nuclear type 1; Pili torti-deafness BCS1L syndrome
[0642] Autosomal recessive bestrophinopathy; Retinal dystrophy; Vitelliform BEST1 macular dystrophy type 2
[0643] BET1 Progressive muscle weakness; Seizures
[0644]
[0645] BFSP1 Cataract-33 (multiple types)Bloom syndrome; Hereditary breast and ovarian cancer syndrome;
[0646] BLM Hereditary cancer-predisposing syndrome
[0647] BMP! Osteogenesis imperfecta type XIII
[0648] Skeletal anomalies with or without cardiac anomalies; Facial dysmorphism; BMP2 Short stature
[0649] BMPR1A Hereditary cancer-predisposing syndrome; Juvenile polyposis syndrome BMPR2 Primary pulmonary hypertension
[0650] BNC1 Premature ovarian failure- 16
[0651] B0LA3 Multiple mitochondrial dysfunctions syndrome-2
[0652] BPNT2 GPAPP type chondrodysplasia with joint dislocations Neurodevelopmental disorder with dysmorphic facies and distal limb BPTF anomalies
[0653] Inborn genetic diseases; Neurodevelopmental disorder with cerebellar atrophy and with or without seizures; Lethal neonatal rigidity and BRAT1 multifocal seizure syndrome
[0654] Breast and / or ovarian cancer; Breast carcinoma; Familial breast-ovarian cancer-1; Dysgerminoma; Complementation group S Fanconi anemia; Familial cancer of breast; Hereditary breast and ovarian cancer syndrome; Hereditary cancer-predisposing syndrome; Infiltrating duct carcinoma of breast; Neoplasm of ovary; Neoplasm of the breast; Ovarian neoplasms; Ovarian serous surface papillary adenocarcinoma; Ovarian cancer;
[0655] Pancreatic cancer; Pancreatic cancer-4; Porokeratosis punctata palmaris et BRCA1 plantaris; Rhabdomyosarcoma; Bilateral breast cancer; Breast cancer Asthma; BRCA2-related disorders; Breast and / or ovarian cancer; Breast carcinoma; Breast-ovarian cancer; Cancer of the pancreas; Colorectal cancer; Diffuse intrinsic pontine glioma; Ectopic ossification; Familial cancer of breast; Complementation group DI Fanconi anemia; Focal seizures; Genetic non-acquired premature ovarian failure; Glioma susceptibility-3; Headache; Hereditary cancer syndrome; Hereditary breast and ovarian cancer syndrome; Hereditary cancer-predisposing syndrome; Inborn genetic diseases; Malignant tumor of prostate; Medulloblastoma; Migraine; Muscle weakness; Neoplasm of the breast; Nephrolithiasis; Obesity; Ovarian neoplasms; Ovarian cancer; Pancreatic cancer-2;
[0656] Polydactyly; Short attention span; Striae distensae; Tracheoesophageal fistula; Tumor susceptibility linked to germline BAP1 mutations; Wilms BRCA2 tumor- 1
[0657] BRIPl-related disorders; Breast cancer; Carcinoma of colon; Familial cancer of breast; Complementation group J Fanconi anemia; Hereditary breast and ovarian cancer syndrome; Hereditary cancer-predisposing syndrome; Neoplasm of ovary; Neoplasm of the breast; Ovarian Cancers; BRIPI Ovarian Neoplasms; Tracheoesophageal fistula
[0658] BRWD3 X-linked mental retardation-93
[0659] BSND Bartter disease type 4A
[0660]
[0661] BTD Biotinidase deficiencyNon-Bruton agammaglobulinemia; X-linked agammaglobulinemia; X- BTK linked agammaglobulinemia with growth hormone deficiency
[0662] Ataxia-telangiectasia syndrome; Hereditary breast and ovarian cancer Cllorf65, ATM syndrome; Hereditary cancer-predisposing syndrome
[0663] Autosomal recessive mental retardation-66; Attention deficit hyperactivity C12orf4 disorder; Intellectual disability; Muscular hypotonia
[0664] C12orf65 Combined oxidative phosphorylation deficiency-7; Spastic paraplegia Neurodegeneration with brain iron accumulation -4; Autosomal recessive C19orfl2 spastic paraplegia-43
[0665] C1QB Clq deficiency
[0666] CIS Complement component Cis deficiency
[0667] C2 Complement component 2 deficiency
[0668] C2CD3 Orofaciodigital syndrome-XIV
[0669] C5 Leiner disease
[0670] Complement component 6 deficiency; Immunodeficiency due to a late C6 component of complement deficiency
[0671] C7 Complement component 7 deficiency
[0672] Complement component 6 deficiency; Type II complement component 8 C8B deficiency
[0673] C8orf37 Cone-rod dystrophy- 16
[0674] C8orf37 Retinitis pigmentosa-64
[0675] CA2 Osteopetrosis with renal tubular acidosis
[0676] CABP4 Congenital stationary night blindness type 2B
[0677] Bulbar palsy; early infantile epileptic encephalopathy-42; Episodic ataxia; CACNA1A Episodic ataxia type 2; Recurrent respiratory infections and epilepsy CACNA1C Long QT syndrome
[0678] CACNA2D4 Abnormality of the eye; Retinal cone dystrophy-4
[0679] CAPN1 Autosomal recessive spastic paraplegia-76;
[0680] Absent Achilles reflex; Absent muscle fiber calpain-3; Arrhythmia; Calf muscle hypertrophy; Congenital muscular dystrophy; Contractures of the joints of the lower limbs; Difficulty walking; EMG: myopathic abnormalities; EMG: neuropathic changes; Elbow flexion contracture; Elevated serum creatine phosphokinase; Recessive limb-girdle muscular dystrophy type 2A; Limb-girdle muscle weakness; Limb-girdle muscular dystrophy; Migraine; Muscle weakness; Muscular diseases; Muscular dystrophy; Eosinophilic myositis; Paresthesia; Positive Romberg sign; CAPN3 Progressive spinal muscular atrophy; Shoulder girdle muscle weakness CASK Mental retardation and microcephaly with pontine and cerebellar hypoplasia CASP14 Congenital autosomal recessive ichthyosis-12
[0681] CASQ2 Catecholaminergic polymorphic ventricular tachycardia-2
[0682] CASR Familial hypocalciuric hypercalcemia type 1; Inborn genetic diseases Peeling skin with leukonychia, acral punctate keratoses, and knuckle pads;
[0683]
[0684] CAST CheilitisPeeling skin with leukonychia, acral punctate keratoses, and knuckle pads; CAST, ERAP1 Cheilitis
[0685] CAT Acatalasemia; Japanese type acatalasia
[0686] CATSPER1 Spermatogenic failure-7
[0687] CAV1 Congenital generalized lipodystrophy type 3
[0688] CAV3, SSUH2 Long QT syndrome
[0689] Noonan syndrome-like disorder with or without juvenile myelomonocytic CBL leukemia
[0690] Cystathionine beta-synthetase polymorphism; Classic homocystinuria; CBS Homocystinuria
[0691] CC2D1A Psychosocial mental retardation; Autosomal recessive mental retardation-3
[0692] Joubert syndrome; Joubert syndrome-9; Meckel syndrome type 6; Meckel- CC2D2A Gruber syndrome
[0693] CCBE1 Hennekam lymphangiectasia-lymphedema syndrome- 1
[0694] CCDC103 Primary ciliary dyskinesia
[0695] CCDC28B Bardet-Biedl syndrome; Bardet-Biedl syndrome- 1
[0696] CCDC39 Primary ciliary dyskinesia- 14; Primary ciliary dyskinesia
[0697] CCDC40 Primary ciliary dyskinesia-15; Primary ciliary dyskinesia
[0698] Global developmental delay with dysmorphic features, woolly hair, liver CCDC47 dysfunction, and pruritus; Trichohepatoneurodevelopmental syndrome Primary ciliary dyskinesia-27; Kartagener syndrome; Primary ciliary CCDC65 dyskinesia
[0699] CCDC78 Centronuclear myopathy -4
[0700] CCDC88C Congenital hydrocephalus- 1
[0701] CCN6 Progressive pseudorheumatoid dysplasia
[0702] CCNH, RASA1 Capillary malformation; Arteriovenous malformation
[0703] Primary ciliary dyskinesia-29; Kartagener syndrome; Primary ciliary CCNO dyskinesia
[0704] CCNQ Syndactyly-telecanthus-anogenital and renal malformations syndrome CD19 Common variable immunodeficiency-3
[0705] CD247 Immunodeficiency due to defect in CD3-zeta
[0706] CD36 Susceptibility to malaria; Platelet glycoprotein IV deficiency
[0707] CD46 Atypical hemolytic-uremic syndrome-2
[0708] CD55 Cromer blood group system Dr(a-) phenotype; Protein-losing enteropathy CDC14A Autosomal recessive deafness-32; Rare genetic deafness
[0709] CDC73 Parathyroid adenoma; Parathyroid carcinoma
[0710] Blepharocheilodontic syndrome- 1; Lobular breast cancer; Endometrial carcinoma; Familial cancer of breast; Hereditary cancer-predisposing syndrome; Hereditary diffuse gastric cancer; Malignant tumor of prostate; CDH1 Neoplasm of ovary
[0711]
[0712] CDH11 Brachioskeletogenital syndromeAutosomal recessive deafness- 12; Inborn genetic diseases; Pituitary adenoma-5 (multiple types); Rare genetic deafness; Usher syndrome type CDH23 ID
[0713] CDH23,
[0714] C10orfl05 Rare genetic deafness
[0715] CDH23, Digenic Usher syndrome type 1D / F; Usher syndrome type 1; Usher CDH23-AS1 syndrome type ID
[0716] Congenital hypotrichosis with juvenile macular dystrophy; EEM syndrome; CDH3 Hypotrichosis with juvenile macular dystrophy; Macular dystrophy Cone-rod dystrophy- 15; Leber congenital amaurosis; Retinal dystrophy; CDHR1 Retinitis pigmentosa-65
[0717] CDK10 Al Kaissi syndrome
[0718] Congenital heart defects, intellectual developmental disorder, and CDK13 dysmorphic facial features
[0719] CDK5RAP2 Primary autosomal recessive microcephaly -3
[0720] Angelman syndrome-like; Atypical Rett syndrome; Early infantile epileptic CDKL5 encephalopathy-2; Epileptic encephalopathy; Inborn genetic diseases Hereditary cancer-predisposing syndrome; Hereditary cutaneous melanoma; CDKN2A Melanoma-pancreatic cancer syndrome; Neoplasm
[0721] CDSN,
[0722] PSORS1C1 Peeling skin syndrome- 1
[0723] CEL Maturity-onset diabetes of the young type 8
[0724] Coronary artery disease; Diabetes; Familial partial lipodystrophy -6;
[0725] CELA2A Hypertensive disorder; Hypertriglyceridemia
[0726] CENPF Stromme syndrome
[0727] Congenital microcephaly; Intellectual disability; Perisylvian polymicrogyria; Primary autosomal recessive microcephaly; Primary autosomal recessive microcephaly-1; Primary autosomal recessive CENPJ microcephaly-6; Seckel syndrome-4; Type III lissencephaly
[0728] CEP 120 Joubert syndrome-31
[0729] CEP152 Seckel syndrome
[0730] Abnormality of the kidney; Bardet-Biedl syndrome-14; Blindness; CEP290- related disorders; Cerebellar cyst; Cerebellar vermis hypoplasia; Global developmental delay; Hyperechogenic kidneys; Joubert syndrome; Joubert syndrome-5; Leber congenital amaurosis-10; Meckel syndrome type 4; Meckel-Gruber syndrome; Nephron op hthi sis; Polycystic kidney dysplasia; CEP290 Retinal dystrophy; Senior-Loken syndrome-6
[0731] CEP290, Bardet-Biedl syndrome-14; Joubert syndrome; Joubert syndrome-5;
[0732] C12orf29 Meckel-Gruber syndrome; Nephronophthisis
[0733] CEP41 Joubert syndrome-15
[0734] Cone-rod degeneration; Cone-rod dystrophy and hearing loss-1;
[0735]
[0736] CEP78 Sensorineural hearing lossMale infertility with teratozoospermia due to single gene mutation; Non- syndromic male infertility due to sperm motility disorder; Spermatogenic failure-18; Spermatogenic failure-33; Asthenozoospermia; Dysplasia of the mitochondrial sheath; Multiple morphologic abnormalities of the sperm CFAP251 flagellum
[0737] Axial spondylometaphyseal dysplasia; Retinal dystrophy with or without CFAP410 macular staphyloma
[0738] CFAP43 Spermatogenic failure- 19
[0739] CFAP44 Spermatogenic failure-20
[0740] CFHR5 CFHR5 deficiency
[0741] Bronchiectasis with or without elevated sweat chloride-1; CFTR-related disorders; Congenital bilateral aplasia of vas deferens from CFTR mutation; Cystic fibrosis; Hereditary pancreatitis; Inborn genetic diseases; Ataluren CFTR response
[0742] CFTR, CFTR- CFTR-related disorders; Congenital bilateral aplasia of vas deferens from AS1 CFTR mutation; Cystic fibrosis
[0743] Bronchiectasis with or without elevated sweat chloride-1; CFTR-related CFTR, disorders; Congenital bilateral aplasia of vas deferens from CFTR mutation; LOCI 11674472 Cystic fibrosis; Hereditary pancreatitis
[0744] Bronchiectasis with or without elevated sweat chloride-1; CFTR-related disorders; Congenital bilateral aplasia of vas deferens from CFTR mutation; CFTR, Cystic fibrosis; Hereditary pancreatitis; Inborn genetic diseases; ataluren LOCI 11674475 response
[0745] CFTR,
[0746] LOCI 11674477 Cystic fibrosis
[0747] Bronchiectasis with or without elevated sweat chloride-1; CFTR-related CFTR, disorders; Congenital bilateral aplasia of vas deferens from CFTR mutation; LOC113633877 Cystic fibrosis; Hereditary pancreatitis
[0748] Bronchiectasis with or without elevated sweat chloride-1; Congenital CFTR, bilateral aplasia of vas deferens from CFTR mutation; Cystic fibrosis;
[0749] LOCI 13664106 Hereditary pancreatitis
[0750] CHD2-related disorder; Childhood-onset epileptic encephalopathy; History CHD2 of neurodevelopmental disorder
[0751] CHARGE association; Hypogonadism with anosmia; Hypogonadotropic CHD7 hypogonadism-5 with or without anosmia
[0752] Astrocytoma; B Lymphoblastic leukemia / lymphoma; Breast and colorectal cancer; Breast cancer; CHEK2-related cancer susceptibility; Colitis;
[0753] Congenital heart defects; Diffuse intrinsic pontine glioma; Familial cancer of breast; Hematochezia; Hereditary breast and ovarian cancer syndrome; Hereditary cancer; Hereditary cancer-predisposing syndrome; Inflammation of the large intestine; Leiomyosarcoma; Li-Fraumeni syndrome; Li- Fraumeni syndrome-2; Malignant tumor of prostate; Neoplasm of the breast; Osteosarcoma; Ovarian neoplasms; Prostate cancer;
[0754] CHEK2 Thromb ocy topeni a
[0755]
[0756] CHM Retinal dystrophyCHRDL1 Megalocornea
[0757] CHRNA1 Congenital myasthenic syndrome
[0758] CHRNA2 Autosomal dominant nocturnal frontal lobe epilepsy
[0759] CHRNA3 CHRNA3 -related condition
[0760] CHRND Lethal multiple pterygium syndrome
[0761] Slow-channel congenital myasthenic syndrome-4A; Congenital myasthenic CHRNE syndrome-4C; Congenital slow-channel myasthenic syndrome CHRNE, Slow-channel congenital myasthenic syndrome-4A; Congenital myasthenic C17orfl07 syndrome-4C; Fast-channel congenital myasthenic syndrome-4B Autosomal recessive multiple pterygium syndrome; CHRNG-related CHRNG disorders; Inborn genetic diseases; Lethal multiple pterygium syndrome CHST14 Musculocontractural type Ehlers-Danlos syndrome
[0762] CHST3 Spondyloepiphyseal dysplasia with congenital joint dislocations CHSY1 Temtamy preaxial brachydactyly syndrome
[0763] CIBI Susceptibility to epidermodysplasia verruciformis-3
[0764] CIITA Bare lymphocyte syndrome-2
[0765] CKAP2L Filippi syndrome
[0766] Autosomal dominant intermediate Charcot-Marie-Tooth disease; Congenital myotonia; EMG: myopathic abnormalities; Muscular diseases; Autosomal CLCN1 dominant myotonia congenita; Autosomal recessive myotonia congenita CLCN2 Leukoencephalopathy with ataxia; Juvenile myoclonic epilepsy-8
[0767] X-linked recessive nephrolithiasis; X-linked recessive nephrolithiasis with CLCN5 renal failure
[0768] CLDN1,
[0769] CLDN16 Neonatal ichthyosis-sclerosing cholangitis syndrome
[0770] CLIC5 Autosomal recessive deafness
[0771] CLN3 Juvenile neuronal ceroid lipofuscinosis; Neuronal ceroid lipofuscinosis CLN5, FBXL3 Neuronal ceroid lipofuscinosis; Neuronal ceroid lipofuscinosis-5
[0772] Rare genetic deafness; Retinal dystrophy; Retinitis pigmentosa; Usher CLRN1 syndrome type 3 A
[0773] CNGA1,
[0774] LOC101927157 Retinal dystrophy; Retinitis pigmentosa-49
[0775] CNGB1 Retinal dystrophy; Retinitis pigmentosa; Retinitis pigmentosa-45
[0776] Abnormality of the eye; Achromatopsia; Achromatopsia-3; CNGB3-related disorders; Cone-rod dystrophy; Leber congenital amaurosis; Retinal CNGB3 dystrophy; Retinitis pigmentosa; Stargardt Disease
[0777] CNNM2 Renal hypomagnesemia-6
[0778] CNNM4 Jalili syndrome
[0779] CNTNAP1 Lethal congenital contracture syndrome-7
[0780] CNTNAP2 Pitt-Hopkins-like syndrome- 1
[0781] COASY Neurodegeneration with brain iron accumulation-6
[0782]
[0783] COG4 Congenital disorder of glycosylation type 2JC0G5 Congenital disorder of glycosylation type 21
[0784] C0G5, DUS4L,
[0785] DUS4L- BCAP29 Congenital disorder of glycosylation type 21
[0786] COL10A1 Schmid type metaphyseal chondrodysplasia
[0787] COL11A1 Fibrochondrogenesis- 1
[0788] COL12A1 Ullrich congenital muscular dystrophy-2
[0789] Junctional epidermolysis bullosa non-Herlitz type; Junctional epidermolysis COL17A1 bullosa local isata variant
[0790] COL18A1 Primary closed-angle glaucoma; Knobloch syndrome- 1
[0791] COL18A1, Knobloch syndrome-1; Macular dystrophy; Retinal dystrophy; Retinitis SLC19A1 pigmentosa
[0792] Procollagen proteinase deficient Ehlers-Danlos syndrome; Infantile cortical hyperostosis; Recessive perinatal lethal osteogenesis imperfecta;
[0793] Osteogenesis imperfecta type I; Osteogenesis imperfecta type III; Dominant form osteogenesis imperfecta with normal sclerae; Postmenopausal COL1A1 osteoporosis
[0794] COLlA2-related disorder; Autosomal recessive cardiac valvular form Ehlers-Danlos syndrome; Inborn genetic diseases; Osteogenesis imperfecta COL1A2 type I (classic type)
[0795] Spondyloperipheral dysplasia-short ulna syndrome; Stickler syndrome type COL2A1 1
[0796] COL3A1 Ehlers-Danlos syndrome; type 4
[0797] COL4A3, MFF- DT Autosomal recessive Alport syndrome
[0798] COL4A5 X-linked recessive Alport syndrome- 1
[0799] COL5A1 Classic type Ehlers-Danlos syndrome
[0800] Classic type Ehlers-Danlos syndrome; Ehlers-Danlos syndrome classic COL5A2 type-2
[0801] COL6A1 Bethlem myopathy- 1
[0802] COL6A2 Bethlem myopathy- 1; Ullrich congenital muscular dystrophy- 1 COL6A3 Bethlem myopathy- 1
[0803] Autosomal dominant dystrophic epidermolysis bullosa; Epidermolysis bullosa pruriginosa; Recessive dystrophic epidermolysis bullosa; Transient COL7A1 bullous dermolysis of the newborn
[0804] COL9A2 Stickler syndrome type 5
[0805] COLECIO 3MC syndrome-3
[0806] COLECIO,
[0807] LOC 101927513 3MC syndrome-3
[0808] COLQ Congenital myasthenic syndrome; Endplate acetylcholinesterase deficiency COQ2 Primary coenzyme Q10 deficiency- 1
[0809] COQ8A ADCK3-related disorders; Primary coenzyme Q10 deficiency -4
[0810]
[0811] COQ9 Primary coenzyme Q10 deficiency-5Fatal infantile cardioencephalomyopathy due to cytochrome c oxidase deficiency-2; Leigh syndrome; Leigh syndrome due to mitochondrial C0X15 complex IV deficiency
[0812] Ceruloplasmin belfast; Deficiency of ferroxidase; Systemic hemosiderosis CP due to aceruloplasminemia
[0813] CPAMD8 Anterior segment dysgenesis-8
[0814] Global developmental delay; Jaundice; Joubert syndrome; Joubert syndrome-1; Joubert syndrome-17; Orofaciodigital syndrome type 6;
[0815] CPLANE1 Typical Joubert syndrome MRI findings
[0816] CPOX Coproporphyria
[0817] CPS1 Congenital hyperammonemia type I
[0818] CPSF1 Myopia-27
[0819] Infantile carnitine palmitoyltransferase II deficiency; Lethal neonatal carnitine palmitoyltransferase II deficiency; Myopathic stress-induced CPT2 carnitine palmitoyltransferase II deficiency
[0820] CRB1 Leber congenital amaurosis-8
[0821] CRB2 Focal segmental glomerulosclerosis-9; Steroid-resistant nephrotic syndrome CRIPT Ateleiotic dwarfism; Short stature with microcephaly and distinctive facies Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies type A7; Limb-girdle muscular dystrophy-dystroglycanopathy CRPPA type C7
[0822] CRTAP Osteogenesis imperfecta type 7
[0823] CRX Leber congenital amaurosis-7
[0824] CRYAB Alpha-B crystallinopathy; Dilated cardiomyopathy- III
[0825] CRYBA4,
[0826] CRYBB1 Autosomal recessive congenital nuclear cataract-3
[0827] CRYBB2 Cataract-3; Congenital cataract
[0828] CSGALNACT1 Mild skeletal dysplasia with joint laxity and advanced bone age CSPP1 Joubert syndrome-21; Meckel-Gruber syndrome
[0829] CSRP3 Cardiovascular phenotype
[0830] Inborn genetic diseases; Progressive myoclonic epilepsy; Unverricht- CSTB Lundborg syndrome
[0831] Cerebroretinal microangiopathy with calcifications and cysts;
[0832] Cerebroretinal microangiopathy with calcifications and cysts-1;
[0833] CTC1 Dyskeratosis congenita
[0834] CTCF Autosomal dominant mental retardation-21
[0835] Exudative vitreoretinopathy-7; Exudative vitreoretinopathy- 1 ;
[0836] Hepatocellular carcinoma; Inborn genetic diseases; Autosomal dominant CTNNB1 mental retardati on- 19
[0837] CTNND1,
[0838] TMX2- CTNND1 Blepharocheilodontic syndrome-2
[0839] Cystinosis; Juvenile nephropathic cystinosis; Nephropathic cystinosis;
[0840]
[0841] CTNS Ocular cystinosisCTSD Neuronal ceroid lipofuscinosis- 10
[0842] CTSH Variant of unknown significance
[0843] Microcephaly, facial dysmorphism, renal agenesis, and ambiguous genitalia CTU2 syndrome
[0844] CUBN Megaloblastic anemia due to inborn errors of metabolism
[0845] CUL4B Cabezas type syndromic X -linked mental retardation
[0846] CUL7 Three M syndrome- 1
[0847] CWC27 Retinitis pigmentosa with or without skeletal anomalies
[0848] CWF19L1 Autosomal recessive spinocerebellar ataxia-17
[0849] CYB5R3 Methemoglobinemia type 2
[0850] CYBB X-linked chronic granulomatous disease
[0851] CYP11B1,
[0852] LOC 106799833 Deficiency of steroid 11 -beta-monooxygenase
[0853] Combined partial 17-alpha-hydroxylase / 17 / 20-lyase deficiency; Complete combined 17-alpha-hydroxylase / 17 / 20-lyase deficiency; Deficiency of CYP17A1 steroid 17-alpha-monooxygenase
[0854] Anterior segment dysgenesis-6; CYP IB 1 -related disorders; Congenital glaucoma; Congenital ocular coloboma; Primary congenital glaucoma-3 A; CYP1B1 Primary infantile glaucoma-3B; Irido-corneo-trabecular dysgenesis CYP21A2,
[0855] LOC106780800 Classic congenital adrenal hyperplasia due to 21 -hydroxylase deficiency CYP21A2,
[0856] TNXB,
[0857] LOC 106780800 Classic congenital adrenal hyperplasia due to 21 -hydroxylase deficiency CYP24A1 Infantile hypercalcemia- 1
[0858] CYP26C1 Optic nerve hypoplasia
[0859] CYP27A1 Cholestanol storage disease
[0860] CYP27B1 Vitamin D-dependent rickets type 1
[0861] CYP2C19-related poor metabolism of clopidogrel, mephenytoin, proguanil, CYP2C19 amitriptyline, citalopram, clomipramine, and clopidogrel
[0862] CYP2D6-related poor metabolism of debrisoquine, deutetrabenazine, tamoxifen, tramadol, amitriptyline, antidepressants, clomipramine, desipramine, doxepin, imipramine, nortriptyline, tamoxifen, and CYP2D6 trimi pramine
[0863] CYP2U1 Autosomal recessive spastic paraplegia-56
[0864] CYP4F22 Autosomal recessive congenital ichthyosis-5
[0865] CZ1P-ASNS,
[0866] ASNS Asparagine synthetase deficiency
[0867] DBH Orthostatic hypotension- 1
[0868] DBT Maple syrup urine disease; Maple syrup urine disease type 2
[0869] Hypogonadism, alopecia, diabetes mellitus, mental retardation, and
[0870]
[0871] DCAF17 electrocardiographic abnormalitiesPartial severe combined immunodeficiency; Severe combined DCLRE1C immunodeficiency due to DCLRE1C deficiency
[0872] DCN Congenital stromal corneal dystrophy
[0873] DDHD1 Autosomal recessive spastic paraplegia-28
[0874] DDRGK1 Shohat type spondyloepimetaphyseal dysplasia
[0875] Delayed speech and language development; Global developmental delay; History of neurodevel opmental disorder; X-linked mental retardation- 102; DDX3X Microcephaly
[0876] Acute myeloid leukemia; Susceptibility to familial myeloproliferative, DDX41 lymphoproliferative neoplasms
[0877] DEPDC5 DEPDC5-related disorder; Familial focal epilepsy with variable foci Limb-girdle muscular dystrophy type 2R; Myofibrillar myopathy-1;
[0878] DES Neuromuscular disease; Primary dilated cardiomyopathy
[0879] DGKE Nephrotic syndrome type 7
[0880] Hepatocerebral form mitochondrial DNA depletion syndrome due to DGUOK deficiency; Hepatocerebral mitochondrial DNA depletion syndrome-3; Autosomal recessive progressive external ophthalmoplegia DGUOK with mitochondrial DNA deletions-4
[0881] 2-3 toe syndactyly; Congenital microcephaly; Elevated 7- dehydrocholesterol; History of neurodevel opmental disorder; Inborn genetic DHCR7 diseases; Small for gestational age; Smith-Lemli-Opitz syndrome DHH 46, XY sex reversal type 7
[0882] DHTKD1 2-aminoadipic 2-oxoadipic aciduria
[0883] DIAPH1 Seizures, cortical blindness, and microcephaly syndrome
[0884] DICER1 -related pleuropulmonary blastoma cancer predisposition DICER1 syndrome; Hereditary cancer-predisposing syndrome
[0885] DIPK1A, RPL5 Diamond-Blackfan anemia-6
[0886] DLD Maple syrup urine disease type 3
[0887] DLG3 X-Linked mental retardation-90
[0888] DLL3, Leukodystrophy and acquired microcephaly with or without dystonia; PLEKHG2 Autosomal recessive spondylocostal dysostosis- 1
[0889] DLX3 Amelogenesis imperfecta type IV; Tricho-dento-osseous syndrome DLX4 Orofacial cleft- 15
[0890] DMD Becker muscular dystrophy; Duchenne muscular dystrophy
[0891] DMP1 Autosomal recessive hypophosphatemic vitamin D refractory rickets DNAAF2 Primary ciliary dyskinesia
[0892] DNAAF4,
[0893] DNAAF4- CCPG1 Primary ciliary dyskinesia
[0894] Non-syndromic male infertility due to sperm motility disorder;
[0895] DNAH1 Spermatogenic failure-18
[0896] DNAH11 Primary ciliary dyskinesia-7; Primary ciliary dyskinesia
[0897]
[0898] DNAH17 Spermatogenic failure-39DNAH5 Primary ciliary dyskinesia-3; Primary ciliary dyskinesia
[0899] DNAI1 Kartagener syndrome; Primary ciliary dyskinesia
[0900] DNAI2 Primary ciliary dyskinesia-9; Primary ciliary dyskinesia
[0901] Charcot-Marie-Tooth disease; Autosomal recessive distal spinal muscular DNAJB2 atrophy-5
[0902] DNAJC12 Mild non-BH4-deficient hyperphenylalaninemia
[0903] DNAL1 Primary ciliary dyskinesia- 16; Primary ciliary dyskinesia
[0904] DNM2 Intermediate dominant Charcot-Mari e-Tooth disease-B
[0905] DNMBP Cataract-48
[0906] D0CK6 Adams-Oliver syndrome-2
[0907] D0CK6,
[0908] LOC 105372273 Adams-Oliver syndrome; Adams-Oliver syndrome-2
[0909] Autosomal recessive hyperimmunoglobulin E recurrent infection syndrome; DOCK8 Inborn genetic diseases
[0910] Congenital myasthenic syndrome; Inborn genetic diseases; Familial limbDOK7 girdle myasthenia; Pena-Shokeir syndrome type I
[0911] DOLK Congenital disorder of glycosylation type IM
[0912] Microcephaly short stature and limb abnormalities; MicrocephalyDONSON micromelia syndrome
[0913] DPY19L2 Spermatogenic failure-9
[0914] DPYD Dihydropyrimidine dehydrogenase deficiency; Fluorouracil response DRAM2 Cone-rod dystrophy 21; Retinal dystrophy
[0915] Primary ciliary dyskinesia-21; Kartagener syndrome; Primary ciliary DRCI dyskinesia
[0916] Arrhythmogenic right ventricular cardiomyopathy with mild palmoplantar keratoderma and woolly hair; Familial arrhythmogenic right ventricular DSC2 dysplasia type 11
[0917] DSC2, DSCAS Arrhythmogenic right ventricular cardiomyopathy type 11
[0918] DSG1 Focal, striate, or diffuse palmoplantar keratoderma-I
[0919] DSG1, DSG1- Congenital erythroderma with palmoplantar keratoderma, hypotrichosis, AS1 and hyper-Ige
[0920] Arrhythmogenic right ventricular cardiomyopathy type 10; Cardiac arrest; Cardiomyopathy; Cardiovascular phenotype; Dilated cardiomyopathy; DSG2 Hypertrophic cardiomyopathy
[0921] DSG2, DSG2- AS1 Dilated cardiomyopathy-IBB
[0922] DSG4, DSG1- AS1 Hypotrichosis-6
[0923] Arrhythmogenic right ventricular cardiomyopathy type 8; Arrhythmogenic right ventricular dysplasia, cardiomyopathy; Cardiac arrest; Dilated cardiomyopathy with woolly hair, keratoderma, and tooth agenesis;
[0924] Cardiovascular phenotype; DSP-related disorders; Dilated cardiomyopathy with woolly hair and keratoderma; Keratosis palmoplantaris striata-II; Left
[0925]
[0926] DSP ventricular noncompaction cardiomyopathy; Lethal acantholyticepidermolysis bullosa; Long QT syndrome-1; Primary dilated cardiomyopathy; Skin fragility-woolly hair-palmoplantar keratoderma syndrome; Ventricular tachycardia
[0927] Autosomal recessive epidermolysis bullosa simplex-2; Hereditary sensory DST and autonomic neuropathy type VI
[0928] Congenital hypothyroidism; Familial thyroid dyshormonogenesis; Inborn genetic diseases; Nongoitrous euthyroid hyperthyrotropinemia; Thyroid DU0X2 dyshormonogenesis-6
[0929] Autosomal dominant Robinow syndrome- 1; Autosomal dominant Robinow DVL3 syndrome-3
[0930] Jeune thoracic dystrophy; Short-rib polydactyly syndrome; Short-rib polydactyly syndrome type III; Short-rib thoracic dysplasia-3 with or DYNC2H1 without polydactyly
[0931] DYNC2I1 Short-rib thoracic dysplasia-8 with or without polydactyly
[0932] Jeune thoracic dystrophy; Short-rib thoracic dysplasia-11 with or without DYNC2I2 polydactyly
[0933] DYNC2LI1 Short-rib thoracic dysplasia-15 with polydactyly
[0934] DYRK1A Autosomal dominant mental retardation-7
[0935] Autosomal recessive limb-girdle muscular dystrophy type 2B; Miyoshi muscular dystrophy-1; Distal myopathy with anterior tibial onset;
[0936] DYSF Qualitative or quantitative defects of dysferlin
[0937] ECEL1 Distal arthrogryposis type 5D; Inborn genetic diseases
[0938] Inborn genetic diseases; Mitochondrial short-chain enoyl-CoA hydratase 1 ECHS1 deficiency
[0939] ECM1 Lipid proteinosis
[0940] EDA Hypohidrotic X-linked ectodermal dysplasia
[0941] EDARADD Autosomal recessive hypohidrotic / hair / tooth type Ectodermal dysplasia-1 lb Congenital central hypoventilation; Dominant Hirschsprung disease;
[0942] Hirschsprung disease; Waardenburg syndrome; Waardenburg syndrome EDN3 type 4B
[0943] EDNRB,
[0944] EDNRB-AS1 Rare genetic deafness
[0945] Autosomal recessive cutis laxa type IB; Autosomal recessive cutis laxa EFEMP2 type IA
[0946] EHMT1 Kleefstra syndrome- 1
[0947] EIF2AK3 Wolcott-Rallison dysplasia
[0948] EIF2AK4 Autosomal recessive pulmonary venoocclusive disease-2
[0949] EIF2B2 Leukoencephalopathy with vanishing white matter; Ovarioleukodystrophy EIF2S3 MEHMO syndrome
[0950] ELN Inborn genetic diseases; Supravalvar aortic stenosis
[0951]
[0952] EL0VL4 Retinal dystrophy; Stargardt Disease-3ELP1 Familial dysautonomia
[0953] ELP2 ELP2-related disorders; Autosomal recessive mental retardation-58
[0954] Cardiovascular phenotype; X-linked Emery-Dreifuss muscular dystrophy- 1; EMD Neuromuscular disease
[0955] Amelogenesis imperfecta type IC; Autosomal dominant hypoplastic local ENAM amelogenesis imperfecta
[0956] Hereditary hemorrhagic telangiectasia; Hereditary hemorrhagic
[0957] ENG telangiectasia type 1
[0958] ENG,
[0959] LOCI 02723566 Hereditary hemorrhagic telangiectasia type 1
[0960] EOGT Adams-Oliver syndrome; Adams-Oliver syndrome-4
[0961] EPB42 Spherocytosis type 5
[0962] EPCAM Congenital diarrhea with tufting enteropathy-5
[0963] EPG5 Vici syndrome
[0964] EPHB4 Capillary malformation-arteriovenous malformation-2
[0965] EPHB4,
[0966] SLC12A9 Capillary malformation-arteriovenous malformation-2
[0967] EPOR Primary familial polycythemia due to EPO receptor mutation Metachromatic leukodystrophy variant; Photosensitive trichothiodystrophy- ERCC2 1 ; Xeroderma pigmentosum group D
[0968] ERCC3 Complementation group B Xeroderma pigmentosum
[0969] Cockayne syndrome; Complementation group Q Fanconi anemia;
[0970] Hutchinson-Gilford syndrome; Pre-B-cell acute lymphoblastic leukemia; ERCC4 XFE progeroid syndrome; Xeroderma pigmentosum group F
[0971] ERCC5, BIVM- ERCC5 Xeroderma pigmentosum; group G
[0972] Cerebrooculofacioskeletal syndrome-1; Cockayne syndrome-B; De Sanctis- ERCC6 Cacchione syndrome
[0973] ERCC8 Cockayne syndrome type A
[0974] ERCC8,
[0975] ERCC8-AS1 Cockayne syndrome type A
[0976] ERCC8, Cockayne syndrome type A; Nuclear type 10 mitochondrial complex I NDUFAF2 deficiency
[0977] ERF Craniosynostosis-1; Craniosynostosis-4
[0978] Abnormality of finger; Coarse facial features; Global developmental delay; ER II Unilateral renal agenesis
[0979] ESCO2 Roberts-SC phocomelia syndrome
[0980] ESRP1 Autosomal recessive deafness- 109
[0981] ESRRB Rare genetic deafness
[0982] ETFDH Multiple acyl-CoA dehydrogenase deficiency
[0983] ETHE1 Ethylmalonic encephalopathy
[0984] EVC2 Curry-Hall syndrome; Ellis-van Creveld syndrome
[0985]
[0986] EXOSC3 Pontocerebellar hypoplasia type lbEXPH5 Autosomal recessive nonspecific epidermolysis bullosa
[0987] Sporadic chondrosarcoma; Multiple congenital exostosis; Multiple EXT1 exostoses type 1
[0988] EXT2 Multiple exostoses type 2
[0989] EYA1 Branchiootic syndrome; Melnick-Fraser syndrome; Rare genetic deafness Autosomal dominant deafness-10; Dilated cardiomyopathy- 1 J; Rare genetic EYA4 deafness
[0990] EYA4, TARID EYA4-related disorders
[0991] EYS Retinal dystrophy; Retinitis pigmentosa; Retinitis pigmentosa-25 F13A1 Factor XIII subunit A deficiency
[0992] F13B Factor XIII subunit B deficiency
[0993] F2 Congenital prothrombin deficiency
[0994] F5 Factor V deficiency
[0995] F8 Hereditary factor VIII deficiency disease
[0996] Hereditary factor IX deficiency disease; X-linked thrombophilia due to F9 factor IX defect
[0997] FA2H Spastic paraplegia-35
[0998] FAH Tyrosinemia type I
[0999] FAM161A Retinal dystrophy; Retinitis pigmentosa; Retinitis pigmentosa-28 FAM20A Amelogenesis imperfecta type 1G
[1000] FANCA Complementation group A Fanconi anemia
[1001] FANCB Complementation group B Fanconi anemia
[1002] Complementation group C Fanconi anemia; Hereditary cancer-predisposing FANCC syndrome
[1003] FANCC, Complementation group C Fanconi anemia; Hereditary cancer-predisposing AOPEP syndrome; Tracheoesophageal fistula
[1004] FANCF Complementation group F Fanconi anemia
[1005] Fanconi anemia; Malignant germ cell tumor of ovary; Spermatogenic FANCM failure-28
[1006] FARS2 Combined oxidative phosphorylation deficiency-14
[1007] Interstitial lung and liver disease; Rajab interstitial lung disease with brain FARSB calcifications
[1008] FAS Autoimmune lymphoproliferative syndrome
[1009] FAT4 Van Maldergem syndrome
[1010] Acromicric dysplasia; Acute aortic dissection; Cardiovascular phenotype; Autosomal dominant isolated ectopia lentis; Familial thoracic aortic aneurysm; Familial thoracic aortic aneurysm and aortic dissection;
[1011] Geleophysic dysplasia-2; Inborn genetic diseases; MASS syndrome; Marfan syndrome, Loeys-Dietz syndrome, Familial thoracic aortic aneurysms and dissections; Marfan lipodystrophy syndrome; Marfan syndrome; Stiff skin FBN1 syndrome; Weill-Marchesani syndrome-2
[1012] FBN1, Marfan syndrome; Loeys-Dietz syndrome; Familial thoracic aortic
[1013]
[1014] LOCI 13939944 aneurysms and dissections; Marfan syndromeInborn genetic diseases; Mitochondrial DNA depletion syndrome;
[1015] FBXL4 Encephalomyopathic type mitochondrial DNA depletion syndrome- 13 FERMT1 Kindler’s syndrome
[1016] FEZF1-AS1,
[1017] FEZF1 Hypogonadotropic hypogonadism-22 with anosmia
[1018] FGD4 Charcot-Marie-Tooth disease; Charcot-Marie-Tooth disease type 4 FGF16 Metacarpal 4-5 fusion
[1019] FGF3 Deafness with labyrinthine aplasia microtia and microdontia (LAMM) FGG Congenital afibrinogenemia; Hypofibrinogenemia
[1020] Fumarase deficiency; Hereditary cancer-predisposing syndrome; Hereditary FH leiomyomatosis and renal cell cancer
[1021] Charcot-Marie-Tooth disease type 4J; Charcot-Marie-Tooth disease type 4; FIG4 Yunis-Varon syndrome
[1022] FKBP10 Bruck syndrome-1; Osteogenesis imperfecta type 12
[1023] Congenital muscular dystrophy; Ehlers-Danlos syndrome with progressive FKBP14, kyphoscoliosis, hearing loss, myopathy; Inborn genetic diseases; Joint FKBP14-AS1 hypermobility; Muscular hypotonia; Pes valgus; Thoracolumbar scoliosis FKRP Limb-girdle muscular dystrophy-dystroglycanopathy type C5
[1024] Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies type A4; Congenital muscular dystrophy-dystroglycanopathy without mental retardation type B4; FKTN-related disorders; Fukuyama congenital muscular dystrophy; Limb-girdle muscular dystrophy- dystroglycanopathy type C4; Walker- Warburg congenital muscular FKTN dystrophy
[1025] Hereditary cancer-predisposing syndrome; Multiple fibrofolliculomas; FLCN Primary spontaneous pneumothorax
[1026] FLG Atopic dermatitis-2; FLG-related disorder; Ichthyosis vulgaris
[1027] FLNA Periventricular nodular heterotopia- 1
[1028] FLNB Spondylocarpotarsal synostosis syndrome
[1029] Familial hypertrophic cardiomyopathy-26; Dilated Cardiomyopathy;
[1030] FLNC Dominant filamin C-related myofibrillar myopathy; Distal myopathy-4 FLNC, FLNC- Familial hypertrophic cardiomyopathy-26; Dilated Cardiomyopathy;
[1031] AS1 Dominant filamin C-related myofibrillar myopathy; Distal myopathy-4 FLT4 Congenital heart defects-7
[1032] FMRI Intellectual disability
[1033] FOXF1 Persistent fetal circulation syndrome
[1034] FOXG1 History of neurodevelopmental disorder; Congenital variant Rett syndrome FOXL2 Blepharophimosis, ptosis, epicanthus inversus type 1
[1035] Autosomal dominant infantile T-cell lymphopenia with or without nail dystrophy; T-cell immunodeficiency, congenital alopecia, and nail FOXN1 dystrophy
[1036] Mental retardation with language impairment and with or without autistic
[1037]
[1038] FOXP1 featuresF0XRED1 Leigh syndrome; Nuclear type 1 mitochondrial complex I deficiency FRAS1 Fraser syndrome- 1
[1039] Isolated unilateral or bilateral cryptophthalmos; Fraser syndrome-2; Fraser FREM2 syndrome- 1
[1040] FSHB Hypogonadotropic hypogonadism-24 without anosmia
[1041] FSIP2 Spermatogenic failure-34
[1042] FSIP2, FSIP2- AS1 Spermatogenic failure-34
[1043] FTCD Glutamate formiminotransferase deficiency
[1044] FTSJ1 X-linked mental retardation-9
[1045] FUCA1 Fucosidosis
[1046] FYCO1 Cataract- 18
[1047] FZD4, PRSS23 Exudative retinopathy; Familial exudative vitreoretinopathy Glycogen storage disease; Glycogen storage disease due to glucose-6- G6PC phosphatase deficiency type IA
[1048] GAA Glycogen storage disease type II; Pompe disease
[1049] GABRA1 Juvenile myoclonic epilepsy-5; Early infantile epileptic encephalopathy- 19 GABRA6 GABRA6-related disorder
[1050] GALC Galactosylceramide beta-galactosidase deficiency
[1051] GALM Galactosemia-IV
[1052] GALNS MPS-IV-A mucopolysaccharidosis; Morquio syndrome
[1053] GALT Deficiency of UDPglucose-hexose-1 -phosphate uridylyltransferase Cerebral creatine deficiency syndrome; Deficiency of guanidinoacetate GAMT methyltransferase
[1054] GAREM2, Long-chain 3-hydroxyacyl-CoA dehydrogenase deficiency; Mitochondrial HADHA trifunctional protein deficiency
[1055] GATA1 Acute megakaryoblastic leukemia
[1056] GATA3 Hypoparathyroidism-deafness-renal disease syndrome
[1057] Abnormality of cardiovascular system morphology; Congenital diaphragmatic hernia; Pancreatic agenesis and congenital heart disease; GATA6 Persistent truncus arteriosus
[1058] Deafness, enamel hypoplasia, and nail defects; Zellweger peroxisome GATAD1, PEX1 biogenesis disorder 1A
[1059] GATAD2B GAT AD2B -related disorder; Autosomal dominant mental retardation- 18
[1060] Acute neuronopathic Gaucher’s disease; Gaucher disease; Gaucher disease type 3C; Gaucher’s disease type 1; Subacute neuronopathic Gaucher’s GBA disease
[1061] GBA,
[1062] LOCI 06627981 Gaucher disease type 1; Perinatal lethal Gaucher’s disease
[1063] Classic hepatic glycogen storage disease type IV; Fatal perinatal GBE1 neuromuscular glycogen storage disease-IV
[1064] GCDH Glutaric aciduria type 1
[1065]
[1066] GCH1 Dystonia-5Maturity onset diabetes mellitus in young; Maturity -onset diabetes of the GCK young type 2
[1067] GDAP1 Recessive intermediate Charcot-Marie-Tooth disease type 4A
[1068] GDF1, CERS1 Heterotaxi a
[1069] GDF9 Premature ovarian failure- 14
[1070] GFER Mitochondrial diseases
[1071] Laron syndrome with elevated serum GH-binding protein; Laron-type GHR isolated somatotropin defect
[1072] GJB1 Charcot-Marie-Tooth Neuropathy-X; Charcot-Marie-Tooth disease Bilateral conductive hearing impairment; Bilateral sensorineural hearing impairment; GJB2-related disorders; Dominant digenic deafness- GJB2 / GJB3; Digenic deafness-GJB2 / GJB6; Hearing impairment;
[1073] Autosomal dominant hearing loss-3 A; Hystrix-like ichthyosis with deafness; Inborn genetic diseases; Autosomal dominant keratitis ichthyosis and deafness syndrome; Recessive keratitis-ichthyosis-deafness syndrome; Knuckle pads, deafness, and leukonychia syndrome; Mutilating keratoderma; Autosomal recessive nonsyndromic hearing loss-lA;
[1074] Nonsyndromic hearing loss and deafness; Palmoplantar keratoderma- GJB2 deafness syndrome; Rare genetic deafness
[1075] GJB3 Autosomal dominant deafness-2B
[1076] GLA, RPL36A- HNRNPH2 Fabry disease
[1077] GLBl-related disorders; GM1 gangliosidosis; GM1 gangliosidosis type 2; GM1 gangliosidosis type 3; GM1 -gangliosidosis type I with cardiac involvement; Infantile GM1 gangliosidosis; MPS-IV- GLB1 Bmucopolysaccharidosis
[1078] GLDC Non-ketotic hyperglycinemia
[1079] GLDN Lethal congenital contracture syndrome- 11
[1080] Greig cephalopolysyndactyly syndrome; Pallister-Hall syndrome; Postaxial GLI3 polydactyly type Al, B; Preaxial polydactyly-4
[1081] GLIS3 Neonatal diabetes mellitus with congenital hypothyroidism
[1082] GLMN Glomuvenous malformations
[1083] GLRA1 Hyperekplexia-1
[1084] Progressive osseous heteroplasia; Pseudohypoparathyroidism;
[1085] GNAS Pseudopseudohypoparathyroidism
[1086] GNAT2 Achromatopsia-4
[1087] Intellectual developmental disorder with cardiac arrhythmia; Language delay and attention deficit-hyperactivity disorder, cognitive impairment GNB5 with or without cardiac arrhythmia
[1088] GNPAT Rhizomelic chondrodysplasia punctata type 2
[1089] GNPTAB-related disorders; Inborn genetic diseases; Mucolipidosis-III Alpha, Beta; Mucolipidosis; Mucolipidosis type II; Pseudo-Hurler GNPTAB polydystrophy
[1090]
[1091] GNPTG Mucolipidosis; Mucolipidosis type III GammaGORAB Geroderma osteodysplastica
[1092] GOSR2,
[1093] LRRC37A2 Progressive myoclonic epilepsy
[1094] GPC3 Simpson-Golabi-Behmel syndrome; Wilms tumor- 1
[1095] GPC4 Keipert syndrome
[1096] GPC6 Autosomal recessive omodysplasia
[1097] GPC6, GPC6- AS2 Autosomal recessive omodysplasia
[1098] Nonspherocytic hemolytic anemia due to glucose phosphate isomerase GPI deficiency
[1099] GPNMB Primary localized cutaneous amyloidosis-3
[1100] GPR143 Ocular albinism type I
[1101] GPR179 Congenital stationary night blindness type IE; Retinal dystrophy Chudley-McCullough syndrome; GPSM2 -related disorders; Rare genetic GPSM2 deafness
[1102] GRHL2 Autosomal dominant deafness-28
[1103] GRHL3 Van der Woude syndrome-2
[1104] GRHPR Nephrocalcinosis; Nephrolithiasis; Primary hyperoxaluria type II GRIN2B Autosomal dominant mental retardation-6
[1105] GRIP! Fraser syndrome-3
[1106] GRN Frontotemporal dementia
[1107] GRXCR1 Autosomal recessive deafness-25; Rare genetic deafness
[1108] GSDME Autosomal dominant deafness-5
[1109] GUCY2C,
[1110] C12orf60 Meconium ileus
[1111] GUSB Mucopolysaccharidosis type 6; Mucopolysaccharidosis type 7 GYG1 Glycogen storage disease XV; Polyglucosan body myopathy-2 GYSI Muscle glycogen storage disease-0
[1112] Glycogen storage disease; Glycogen storage disease due to hepatic GYS2 glycogen synthase deficiency
[1113] GZF1 Joint laxity, short stature, and myopia
[1114] Hl-4 Inborn genetic diseases; Rahman syndrome
[1115] H6PD Cortisone reductase deficiency- 1
[1116] HADHA-related disorders; Long-chain 3 -hydroxy acyl-CoA dehydrogenase HADHA deficiency; Mitochondrial trifunctional protein deficiency
[1117] HADHA-related disorders; Inborn genetic diseases; LCHAD deficiency; LCHAD deficiency with maternal acute fatty liver of pregnancy; Long- HADHA, chain 3-hydroxyacyl-CoA dehydrogenase deficiency; Mitochondrial GAREM2 trifunctional protein deficiency
[1118] HAX1 Autosomal recessive severe congenital neutropenia-3
[1119] HBA2,
[1120]
[1121] LOCI 06804612 Alpha plus thalassemiaAnemia; Beta thalassemia major; Beta-plus-thalassemia; Beta-thalassemia;
[1122] Familial erythrocytosis-6; Fetal hemoglobin quantitative trait locus 1; HBB- related disorders; Hb SS disease; Heinz body anemia; Hemoglobin E;
[1123] Hemoglobin E disease; Hemoglobin E, Beta thalassemia disease;
[1124] HBB, Hemoglobin M disease; Hemoglobinopathy; Resistance to malaria;
[1125] LOCI 06099062, Susceptibility to malaria; Alpha thalassemia; Dominant inclusion body type LOC107133510 beta thalassemia
[1126] HBB,
[1127] LOC107133510,
[1128] LOCI 10006319 Beta thalassemia
[1129] HCN4 Brugada syndrome-8; Autosomal dominant sick sinus syndrome-2 HEXA Inborn genetic diseases; Tay-Sachs disease
[1130] HEXB Infantile Sandhoff disease
[1131] HFMI Premature ovarian failure-9
[1132] HGD Alkaptonuria
[1133] MPS-III-C mucopolysaccharidosis; Retinitis pigmentosa-73; Sanfilippo HGSNAT syndrome
[1134] HIVEP2 Angelman syndrome-like; Autosomal dominant mental retardation-43 HJV Hemochromatosis type 2 A
[1135] HLCS Holocarboxylase synthetase deficiency
[1136] HMCN1 Age-related macular degeneration-1
[1137] HMGB3 Syndromic microphthalmia- 13
[1138] HMGCL Deficiency of hydroxymethylglutaryl-CoA lyase
[1139] Clear cell carcinoma of kidney; Insulin-dependent diabetes mellitus; Type 1 diabetes mellitus-20; Familial hepatic adenomas; Maturity onset diabetes HNFIA mellitus in young; Maturity-onset diabetes of the young type 3
[1140] Familial hypoplastic renal cysts and diabetes syndrome; Glomerulocystic HNF1B kidney
[1141] HNRNPK Au-Kline syndrome
[1142] HNRNPU Epileptic encephalopathy
[1143] Athabaskan brainstem dysgenesis syndrome; Bosley-Salih-Alorainy HOXA1 syndrome
[1144] HOXA11 Radioulnar synostosis with amegakaryocytic thrombocytopenia- 1 HOXD13 Synpolydactyly-1
[1145] HPGD-related disorders; Autosomal recessive primary hypertrophic HPGD osteoarthropathy- 1
[1146] HPS1 Hermansky-Pudlak syndrome; Hermansky-Pudlak syndrome-1
[1147] HPS5 Hermansky-Pudlak syndrome; Hermansky-Pudlak syndrome-5
[1148] HPS6 Hermansky-Pudlak syndrome; Hermansky-Pudlak syndrome-6 HPSE2 Urofacial syndrome- 1
[1149] HR Atrichia with papular lesions
[1150] HSD17B10 HSD10 disease
[1151] HSD17B4 Bifunctional peroxisomal enzyme deficiency; Perrault syndrome
[1152]
[1153] HSPA9 Even-plus syndrome; Sideroblastic anemia-4Charcot-Marie-Tooth disease; Charcot-Marie-Tooth disease axonal type 2F; HSPB1 Distal hereditary motor neuronopathy type 2B
[1154] HSPG2 Lethal Kniest-like syndrome; Schwartz-Jampel syndrome
[1155] HYAL1 Deficiency of hyaluronoglucosaminidase
[1156] HYDIN Primary ciliary dyskinesia-5
[1157] ICAM4 Landsteiner-Wiener phenotype
[1158] IDS MPS-II mucopolysaccharidosis
[1159] IDS,
[1160] LGC106050102 MPS-II mucopolysaccharidosis
[1161] Hurler syndrome; MPS-I-H / S mucopolysaccharidosis; MPS-I-S
[1162] IDUA mucopolysaccharidosis type 1
[1163] IDUA, Hurler syndrome; MPS-I-H / S mucopolysaccharidosis; MPS-I-S SLC26A1 mucopolysaccharidosis type 1
[1164] IFIH1 Aicardi-Goutieres syndrome-7; Singleton-Merten syndrome- 1
[1165] Disseminated atypical mycobacterial infection; IFN-gamma receptor 1 IFNGR1 deficiency; Immunodeficiency-27B; Inherited immunodeficiency diseases IFNGR2 Immunodefi ci ency -28
[1166] IFT140 Retinitis pigmentosa-80
[1167] Jeune thoracic dystrophy; Joubert syndrome with Jeune asphyxiating IFT140, thoracic dystrophy; Renal dysplasia, cerebellar ataxia, skeletal dysplasia, LOC105371046 and retinal pigmentary dystrophy
[1168] IFT172 Short-rib thoracic dysplasia- 10 with or without polydactyly
[1169] Short Rib Polydactyly Syndrome; Short-rib thoracic dysplasia- 16 with or IFT52 without polydactyly
[1170] IGF1 Growth delay due to insulin-like growth factor type 1 deficiency
[1171] IGF1R Inborn genetic diseases
[1172] IGFALS Acid-labile subunit deficiency
[1173] IGHM Non-Bruton type agammaglobulinemia
[1174] Autosomal dominant distal hereditary motor neuropathy; Charcot-Marie- Tooth disease axonal type 2S; Distal spinal muscular atrophy; Inborn IGHMBP2 genetic diseases; Autosomal recessive distal spinal muscular atrophy-1 IGLL1 Autosomal recessive agammaglobulinemia-2
[1175] IGSF1 Central hypothyroidism and testicular enlargement
[1176] IGSF3 Lacrimal duct defect
[1177] Ectodermal dysplasia and immunodeficiency- 1; Immunodeficiency without IKBKG anhidrotic ectodermal dysplasia; Incontinentia pigmenti
[1178] IL12B Immunodefi ci ency -29
[1179] 1L12RBI Immunodefi ci ency -30
[1180] IL2RB Ichthyosis
[1181] X-linked combined immunodeficiency; X-linked severe combined IL2RG immunodeficiency
[1182] IL36RN Generalized pustular psoriasis
[1183] Autosomal recessive T cell-negative, B cell -positive, NK cell-positive
[1184]
[1185] IL7R severe combined immunodeficiencyINPP5E Retinal dystrophy
[1186] INPPL1 Opsismodysplasia
[1187] INTU Mohr syndrome; Orofaciodigital syndrome- 17
[1188] IQCB1 Renal dysplasia and retinal aplasia
[1189] IQCE Postaxial polydactyly type A7
[1190] IQSEC2 Mental retardation; X-linked severe intellectual deficiency- 1
[1191] Immunodeficiency due to interleukin- 1 receptor-associated kinase-4 IRAK4 deficiency
[1192] Neurodevelopmental disorder; Neurodevelopmental disorder with IRF2BPL regression, abnormal movements, loss of speech, and seizures
[1193] IRF6 Van der Woude syndrome
[1194] IRS4 Congenital nongoitrous hypothyroidism-9
[1195] ISCA2 Multiple mitochondrial dysfunctions syndrome-4
[1196] ISG15 Immunodeficiency -38 with basal ganglia calcification
[1197] ITGA7 Congenital muscular dystrophy due to integrin alpha-7 deficiency ITGB2 Leukocyte adhesion deficiency
[1198] ITGB4 Epidermolysis bullosa junctionalis with pyloric atresia
[1199] Early infantile epileptic encephalopathy-35; Inosine triphosphatase ITPA deficiency
[1200] ITPR1 Gillespie syndrome
[1201] IVD Isovaleric acidemia; Isovaleryl-CoA dehydrogenase deficiency type III JAG1 Alagille syndrome-1; Arteriohepatic dysplasia; Malformation of heart Autosomal recessive T cell-negative, B cell -positive, NK cell-negative severe combined immunodeficiency; Severe combined immunodeficiency JAK3 disease
[1202] History of neurodevelopmental disorder; Autosomal dominant mental KAT6A retardation-32
[1203] KAT6B SBBYS type blepharophimosis-intellectual disability syndrome SBBYS type blepharophimosis-intellectual disability syndrome;
[1204] KAT6B, DUPD1 Genitopatellar syndrome; Inborn genetic diseases
[1205] KATNIP Joubert syndrome-26
[1206] KCNA1 Episodic ataxia type 1
[1207] KCNA5 Familial atrial fibrillation-7
[1208] KCNC1 Progressive myoclonic epilepsy-7
[1209] KCNE1 Long QT syndrome
[1210] Cardiac arrhythmia; Cardiovascular phenotype; Congenital long QT syndrome; Long QT syndrome; Digenic long QT syndrome- 1 / 2; Long QT KCNH2 syndrome-2
[1211] KCNK18 Migraine with or without aura- 13
[1212] Cardiac arrhythmia; Cardiovascular phenotype; Congenital long QT syndrome; Jervell and Lange-Nielsen syndrome; Jervell and Lange-Nielsen syndrome-1; KCNQl-related disorders; Long QT syndrome LQT1 subtype;
[1213]
[1214] KCNQ1 Long QT syndrome- 1; Rare genetic deafness; Romano-Ward syndromeKCNQ1-AS1,
[1215] KCNQ1 Jervell and Lange-Nielsen syndrome-1
[1216] KCNQ1,
[1217] KCNQ1-AS1 Cardiovascular phenotype; Long QT syndrome; Long QT syndrome- 1 KCNQ1,
[1218] KCNQ10T1 Congenital long QT syndrome; Long QT syndrome LQT1 subtype Benign familial neonatal seizures-1; Early infantile epileptic encephalopathy; Early infantile epileptic encephalopathy-7; Epileptic KCNQ2 encephalopathy; Inborn genetic diseases; Seizures
[1219] KCNQ3 Intellectual disability; Seizures
[1220] KCNQ4 Autosomal dominant nonsyndromic deafness-2A
[1221] Early infantile epileptic encephalopathy- 14; Nocturnal frontal lobe KCNT1 epilepsy-5
[1222] Cone dystrophy with supernormal rod response; Progressive cone dystrophy KCNV2 without rod involvement; Retinal dystrophy; Stargardt disease KDM5B Autosomal recessive intellectual disability-65
[1223] KDM5C X-linked Claes-Jensen type syndromic mental retardation
[1224] KDM6A Kabuki syndrome-2
[1225] KERA Cornea plana-2
[1226] KHDC3L Recurrent hydatidiform mole-2
[1227] Congenital cerebellar hypoplasia; Intellectual disability; Joubert syndrome; Joubert syndrome-23; Retinal dystrophy; Rod-cone dystrophy; Short-rib KIAA0586 thoracic dysplasia- 14 with polydactyly
[1228] KIAA0753 Orofaciodigital syndrome-XV
[1229] KIAA0825 Postaxial polydactyly type A 10; Postaxial polydactyly type Al KIAA1549 Retinitis pigmentosa-86
[1230] Microcephaly with or without chorioretinopathy, lymphedema, and mental KIF11 retardation
[1231] KIF7 Acrocallosal syndrome; Joubert syndrome- 12
[1232] KIFBP Goldberg-Shprintzen megacolon syndrome
[1233] KISS1R Hypogonadotropic hypogonadism-8 without anosmia
[1234] KIZ Retinitis pigmentosa-69
[1235] KMT2A Wiedemann-Steiner syndrome
[1236] KMT2B Childhood-onset dystonia-28
[1237] KMT2C Kleefstra syndrome due to a point mutation
[1238] KMT2D CHARGE association; Kabuki syndrome; Kabuki syndrome- 1
[1239] Epilepsy; Leukoencephalopathy; Macrocephalus; O’Donnell-Luria-Rodan KMT2E syndrome; Intellectual deficiency
[1240] KPTN Autosomal recessive mental retardation-41
[1241] Cavernous malformations of CNS and retina; Cerebral cavernous KRIT1 malformation; Cerebral cavernous malformations- 1
[1242] KRT1 Curth-Macklin type ichthyosis histrix;
[1243]
[1244] KRT10 Bullous ichthyosiform erythrodermaKRT10,
[1245] TMEM99 Bullous ichthyosiform erythroderma
[1246] KRT14 Autosomal recessive epidermolysis bullosa simplex
[1247] KRT5 Dowling-Degos disease- 1
[1248] KRT6A Pachyonychia congenita-3
[1249] KRT85 ‘Pure’ hair-nail type ectodermal dysplasia
[1250] Congenital NAD deficiency disorder; Vertebral, cardiac, renal, and limb KYNU defects syndrome-2
[1251] LI CAM MASA syndrome; Spastic paraplegia
[1252] L2HGDH L-2-hydroxyglutaric aciduria
[1253] LACC1 Juvenile arthritis
[1254] Inborn genetic diseases; Laminin alpha 2-related dystrophy; Merosin LAMA2 deficient congenital muscular dystrophy
[1255] LAMA3 Junctional epidermolysis bullosa gravis of Herlitz
[1256] LAMA4 Dilated cardiomyopathy- 1JJ
[1257] Amelogenesis imperfecta type 1A; Non-Herlitz type junctional LAMB3 epidermolysis bullosa; Junctional epidermolysis bullosa gravis of Herlitz Non-Herlitz type junctional epidermolysis bullosa; Junctional epidermolysis LAMC2 bullosa gravis of Herlitz
[1258] Cardiomyopathy; Danon disease; Hypertrophic cardiomyopathy; Primary LAMP2 dilated cardiomyopathy
[1259] Congenital muscular dystrophy-dystroglycanopathy with mental retardation LARGE 1 type B6
[1260] Disproportionate short stature; Femoral bowing; Pelger-Huet anomaly; Regressive spondylometaphyseal dysplasia; Retrognathia; Rhizomelic arm LBR shortening; Rhizomelic leg shortening; Short long bone
[1261] LDB3 Cardiomyopathy; ZASP-related myofibrillar myopathy
[1262] Familial hypercholesterolemia; Familial hypercholesterolemia- 1;
[1263] LDLR Homozygous familial hypercholesterolemia
[1264] LDLRAP1 Familial hypercholesterolemia-4
[1265] LEP Leptin deficiency or dysfunction
[1266] LFNG Autosomal recessive spondylocostal dysostosis-3
[1267] LGI1 Familial temporal lobe epilepsy-1
[1268] LHFPL5 Rare genetic deafness
[1269] Non-acquired combined pituitary hormone deficiency with spine LHX3 abnormalities
[1270] LIFR Stuve-Wiedemann syndrome
[1271] LIG4 LIG4-related disorders; Lig4 syndrome
[1272] LIPA Lysosomal acid lipase deficiency
[1273] LIPE Familial partial lipodystrophy-6
[1274] LIPE, LIPE- AS1,
[1275]
[1276] LOC1Q1930071 Familial partial lipodystrophy-6Hypotrichosis-7; Autosomal recessive woolly hair-2 with or without LIPH hypotrichosis
[1277] LIPN Autosomal recessive congenital ichthyosis-8
[1278] LMBR1 Acheiropodia
[1279] Inborn genetic diseases; Methylmalonic aciduria and homocystinuria type LMBRD1 cblF
[1280] Cardiovascular phenotype; Charcot-Marie-Tooth disease type 2; Primary LMNA dilated cardiomyopathy
[1281] LM0D3 Nemaline myopathy- 10
[1282] LMX1B Nail-patella syndrome
[1283] LOC 100507346,
[1284] PTCHI Gorlin syndrome; Medulloblastoma
[1285] LOC101927055, Dilated cardiomyopathy 1G; Limb-girdle muscular dystrophy type 2J; TTN Primary dilated cardiomyopathy
[1286] LOC 101927157,
[1287] CNGA1 Retinitis pigmentosa; Retinitis pigmentosa-49
[1288] LOC101927188,
[1289] LAMA1 Poretti-Boltshauser syndrome
[1290] LOC 102723566,
[1291] ENG Hereditary hemorrhagic telangiectasia type 1
[1292] LOC 106694316,
[1293] MPO Myeloperoxidase deficiency
[1294] LOC 110006319,
[1295] I IBB,
[1296] LOC107133510 Beta thalassemia
[1297] LOXHD1 Autosomal recessive deafness-77; Rare genetic deafness
[1298] LPL Hyperlipoproteinemia type I
[1299] Leber congenital amaurosis; Leber congenital amaurosis-14; Early-onset LRAT severe retinal dystrophy; Juvenile LRAT -related retinitis pigmentosa LRBA Common variable immunodeficiency-8 with autoimmunity
[1300] LRIT3 Congenital stationary night blindness type IF
[1301] LRP4 Cenani-Lenz syndactyly syndrome
[1302] Exudative vitreoretinopathy-4; Autosomal dominant familial exudative LRP5 vitreoretinopathy
[1303] LRP6 Selective tooth agenesis-7
[1304] LRPAP1 Autosomal recessive myopia-23; Rare isolated myopia
[1305] LRPPRC Saguenay-Lac-Saint-Jean type congenital lactic acidosis
[1306] LRSAM1 Charcot-Marie-Tooth disease type 2P
[1307] LRTOMT Autosomal recessive deafness-63; Rare genetic deafness
[1308] LTBP2 Congenital glaucoma; Microspherophakia
[1309] LTBP3 Dental anomalies and short stature
[1310] Cutis laxa with severe pulmonary, gastrointestinal, and urinary LTBP4 abnormalities
[1311]
[1312] LYRM7 Nuclear type 8 Mitochondrial complex III deficiencyLZTFL1 Bardet-Biedl syndrome-17
[1313] LZTR1 Noonan syndrome-2; Schwannomatosis-2
[1314] MAB21L1,
[1315] NBEA Cerebellar, ocular, craniofacial, and genital syndrome
[1316] Duane retraction syndrome-2; Duane retraction syndrome-3 with or without MAFB deafness; Duane syndrome type 1 ; Duane syndrome type 3 MAGED2 Transient antenatal Bartter syndrome type 5
[1317] MAGEL2 Inborn genetic diseases; Schaaf-Yang syndrome
[1318] X-Linked immunodeficiency with magnesium defect, Epstein-Barr virus MAGT1 infection, and neoplasia
[1319] MAK Retinal dystrophy
[1320] MAN2B1 Deficiency of alpha-mannosidase
[1321] MANBA Beta-D-mannosidosis
[1322] MAP2K2 Rasopathy
[1323] MAPRE2 Congenital symmetric circumferential skin creases-2
[1324] MARVELD2 Autosomal recessive neurosensory deafness-49; Rare genetic deafness MAX Hereditary cancer-predisposing syndrome
[1325] MBD5 Autosomal dominant mental retardation- 1
[1326] MC2R ACTH resistance
[1327] MC4R Monogenic diabetes; Obesity; Schizophrenia
[1328] MCCC1 Methyl crotonyl-CoA carboxylase 1 deficiency-3
[1329] MCCC2 Methyl crotonyl CoA carboxylase 2 deficiency-3
[1330] MCM5 Meier-Gorlin syndrome-8
[1331] MCM8 Premature ovarian failure- 10
[1332] MC0LN1 Mucolipidosis type IV
[1333] Abnormality of brain morphology; Primary autosomal recessive MCPH1 microcephaly- 1
[1334] Angelman syndrome; Atypical Rett syndrome; X-linked susceptibility to autism-3; Delayed gross motor development; Delayed speech and language development; Developmental regression; Encephalopathy; Global developmental delay; History of neurodevelopmental disorder; Inborn genetic diseases; Intellectual disability; Loss of ability to walk; X-linked syndromic mental retardation-13; Rett syndrome; Severe neonatal-onset encephalopathy with microcephaly; Smith-Magenis Syndrome-like; Lubs type syndromic X-linked intellectual disability; Neonatal severe mental MECP2 retardation; Syndromic Rett syndrome- 13
[1335] Cardiovascular phenotype; FG syndrome-1; History of neurodevelopmental MED 12 disorder
[1336] Mental retardation and distinctive facial features with or without cardiac MED13L defects
[1337] Broad-based gait; Charcot-Marie-Tooth disease type 2; Decreased body weight; Failure to thrive; Generalized hypotonia; Impaired distal proprioception; Sensory ataxia; Sensory ataxic neuropathy; Sensory
[1338]
[1339] MED25 neuropathyMEF2C-related disorder; Mental retardation, epilepsy, and stereotypic MEF2C movements and / or cerebral malformations
[1340] MEFV Familial Mediterranean fever
[1341] Hereditary cancer-predisposing syndrome; Somatic lipoma; Multiple MEN1 endocrine neoplasia type 1
[1342] MERTK Retinitis pigmentosa-38
[1343] MESD Osteogenesis imperfecta type XX
[1344] METTL23 Inborn genetic diseases; Autosomal recessive mental retardation-44 MFN2 Charcot-Marie-Tooth disease type 2
[1345] MFRP,
[1346] C1QTNF5 Isolated microphthalmia-5; Nanophthalmos-2
[1347] MFSD8 Neuronal ceroid lipofuscinosis-7
[1348] MIP Cataract- 15 (multiple types)
[1349] MIR6886, Familial hypercholesterolemia; Familial hypercholesterolemia- 1;
[1350] LDLR Homozygous familial hypercholesterolemia
[1351] Coloboma, osteopetrosis, microphthalmia, macrocephaly, albinism, and MITF deafness; Rare genetic deafness; Waardenburg syndrome type 2A MKRN3 Central precocious puberty -2
[1352] Joubert syndrome; Joubert syndrome-28; Meckel syndrome type 1; Meckel- MKS1 Gruber syndrome
[1353] MLCI Megalencephalic leukoencephalopathy with subcortical cysts- 1
[1354] Carcinoma of colon; Colon cancer; Hereditary cancer-predisposing syndrome; Hereditary nonpolyposis colon cancer; Lynch syndrome; Lynch MLHI syndrome-I; Lynch syndrome-II; Muir-Torre syndrome; Turcot syndrome MLH3 Hereditary nonpolyposis colorectal cancer type 7
[1355] MLYCD Deficiency of malonyl-CoA decarboxylase
[1356] Methylmalonic acidemia; Vitamin Bl 2-responsive methylmalonic acidemia MMAA type cblA
[1357] Methylmalonic acidemia; Vitamin Bl 2-responsive methylmalonic acidemia MM AB type cblB
[1358] Disorders of intracellular cobalamin metabolism; Digenic methylmalonic aciduria and homocystinuria clbC type; Methylmalonic acidemia with homocystinuria; Methylmalonic aciduria due to methylmalonyl-CoA MMACHC mutase deficiency
[1359] Charcot-Marie-Tooth disease axonal type 2T; Congenital membranous nephropathy due to fetomaternal anti-neutral endopeptidase
[1360] MME alloimmunization
[1361] Methylmalonic acidemia; Methylmalonic aciduria due to methylmalonyl- MMUT CoA mutase deficiency
[1362] M0CS2 Complementation group B molybdenum cofactor deficiency Congenital hydrocephalus; Congenital hydrocephalus-2 with or without MPDZ brain or eye anomalies
[1363] MPL Congenital amegakaryocytic thrombocytopenia; Essential thrombocytemia MPLKIP Nonphotosensitive trichothiodystrophy- 1
[1364]
[1365] MPO Myeloperoxidase deficiencyMPV17 Navajo neurohepatopathy
[1366] MPZ Charcot-Marie-Tooth disease
[1367] MPZL2 Autosomal recessive deafness- 111
[1368] MRE11 Hereditary cancer-predisposing syndrome
[1369] Carcinoma of colon; Colon cancer; Glioblastoma; Hereditary cancerpredisposing syndrome; Hereditary nonpolyposis colon cancer; Lynch syndrome; Lynch syndrome-I; Malignant tumor of ascending colon;
[1370] Malignant tumor of sigmoid colon; Muir-Torre syndrome; Ovarian MSH2 neoplasms; Turcot syndrome
[1371] Endometrial carcinoma; Hereditary cancer-predisposing syndrome;
[1372] Hereditary nonpolyposis colon cancer; Hereditary nonpolyposis colorectal cancer type 5; Hereditary nonpolyposis colorectal carcinoma; Lynch MSH6 syndrome; Lynch syndrome-I; Turcot syndrome
[1373] Mitochondrial myopathy-cerebellar ataxia-pigmentary retinopathy MST01 syndrome
[1374] MSX2 Parietal foramina- 1
[1375] Abnormal facial shape; Combined oxidative phosphorylation deficiency- 15; Cytochrome C oxidase-negative muscle fibers; Decreased activity of mitochondrial complex I; Inability to walk by childhood / adolescence; Leigh syndrome; Nuclear type 27 Mitochondrial complex I deficiency;
[1376] Mitochondrial oxidative phosphorylation disorder; Poor speech; Short MTFMT stature
[1377] Combined immunodeficiency and megaloblastic anemia with or without MTHFD1 hyperhomocysteinemia
[1378] MTM1 Severe X-linked myotubular myopathy
[1379] Disorders of intracellular cobalamin metabolism; Homocystinuria without methylmalonic aciduria; CblE complementation type homocystinuria- MTRR megaloblastic anemia due to defect in cobalamin metabolism
[1380] MTTP Abetalipoproteinaemia
[1381] Carcinoma of colon; Colon cancer; Familial colorectal cancer; Hereditary cancer-predisposing syndrome; MUTYH-associated polyposis; MYH- MUTYH associated polyposis; Neoplasm of stomach; Pilomatrixoma Hyperimmunoglobulin D with periodic fever; Mevalonic aciduria;
[1382] MVK Disseminated superficial actinic type porokeratosis-3
[1383] Asymmetric septal hypertrophy; Cardiomyopathy; Cardiovascular phenotype; Dyspnea; Familial dilated cardiomyopathy; Familial hypertrophic cardiomyopathy- 1; Familial hypertrophic cardiomyopathy -4; Heart block; Hypertrophic cardiomyopathy; Inborn genetic diseases; Left ventricular hypertrophy; Left ventricular noncompaction; Left ventricular noncompaction- 10; Long QT syndrome; MYBPC3 -related disorders;
[1384] Noncompaction cardiomyopathy; Primary dilated cardiomyopathy; Primary familial hypertrophic cardiomyopathy; Tachycardia; Ventricular MYBPC3 extrasystoles
[1385]
[1386] MYCN Inborn genetic diseasesMYEF2,
[1387] SLC24A5 Oculocutaneous albinism type VI
[1388] Abnormality of the ribs; External ophthalmoplegia with rib and vertebral MYF5 anomalies; External ophthalmoplegia; Scoliosis
[1389] MYH11, NDEI Familial aortopathy
[1390] MYH2, MYHAS Proximal myopathy and ophthalmoplegia
[1391] Contractures, pterygia, and variable skeletal fusions syndrome 1A;
[1392] MYH3 Spondylocarpotarsal synostosis syndrome
[1393] MYH6 Familial hypertrophic cardiomyopathy- 1
[1394] MYH7 Hypertrophic cardiomyopathy; Primary dilated cardiomyopathy Cardiomyopathy; Cardiovascular phenotype; Hypertrophic
[1395] MYH7, MHRT cardiomyopathy; MYH7-related disorders
[1396] MYL2,
[1397] LOCI 14827850 Familial hypertrophic cardiomyopathy- 10
[1398] MYLK Visceral myopathy
[1399] Congenital sensorineural hearing impairment; Autosomal recessive MY015A deafness-3; Nonsyndromic hearing loss and deafness; Rare genetic deafness MY03A Autosomal recessive deafness-30
[1400] MYO5B Congenital microvillous atrophy
[1401] Deafness; Autosomal dominant nonsyndromic hearing loss and deafness- MY06 22; Rare genetic deafness
[1402] MYO7A-related disorders; Rare genetic deafness; Retinal dystrophy;
[1403] Retinitis pigmentosa; Usher syndrome type IB; Usher syndrome type 1; MY07A Autosomal dominant deafness-11; Autosomal recessive deafness-2 MYOCD Congenital megabladder; Prune belly syndrome
[1404] MYRF Cardiac-urogenital syndrome
[1405] Vertebral, cardiac, renal and limb defects syndrome-3; Congenital NAD NADSYN1 deficiency disorder
[1406] Charcot-Marie-Tooth disease axonal type 2V; MPS-III-B NAGLU mucopolysaccharidosis; Sanfilippo syndrome
[1407] NALCN Infantile hypotonia with psychomotor retardation and characteristic facies- 1
[1408] Fever-associated acute infantile liver failure syndrome; Infantile liver NBAS failure syndrome-2
[1409] Acute lymphoid leukemia; Aplastic anemia; Breast-ovarian cancer; Familial cancer of breast; Hereditary breast and ovarian cancer syndrome; Hereditary cancer-predisposing syndrome; Lissencephaly; Microcephaly with normal NBN intelligence and immunodeficiency; Ovarian neoplasms
[1410] Autosomal recessive cytochrome b-positive chronic granulomatous disease type 1; Chronic granulomatous disease due to deficiency of NCF-1;
[1411] NCF1, Autosomal recessive cytochrome b-positive chronic granulomatous disease LOC 106029312 type III
[1412] NCR1, NLRP7 Recurrent hydatidiform mole-1
[1413] NCSTN Familial acne inversa-1
[1414] NDEI Lissencephaly-4
[1415]
[1416] NDNF Hypogonadotropic hypogonadism-25 with anosmiaNDUFA12 Leigh syndrome
[1417] Inborn genetic diseases; Leigh syndrome; Nuclear type 10 mitochondrial complex I deficiency; Nuclear type 1 mitochondrial complex I deficiency; NDUFAF2 NDUFAF2-related disorders
[1418] NDUFAF3 Mitochondrial complex I deficiency
[1419] NDUFB11 Linear skin defects with multiple congenital anomalies-3
[1420] NDUFS4 Leigh syndrome; Nuclear type 1 mitochondrial complex I deficiency NDUFS6 Nuclear type 9 mitochondrial complex I deficiency
[1421] Nuclear type 4 mitochondrial complex I deficiency; Nuclear type 1 NDUFV1 mitochondrial complex I deficiency
[1422] Inborn genetic diseases; Nemaline myopathy; Nemaline myopathy-2; Non- NEB immune hydrops fetalis
[1423] NEB, RIF1 Nemaline myopathy; Nemaline myopathy-2
[1424] Hypertrophic cardiomyopathy; Long QT syndrome; Primary dilated cardiomyopathy; Primary familial hypertrophic cardiomyopathy; Sudden NEBL unexplained death
[1425] NEFL Charcot-Marie-Tooth disease type 2E
[1426] Susceptibility to amyotrophic lateral sclerosis-24; Majewski type; Short rib- poly dactyly syndrome; Short-rib thoracic dysplasia-3 with or without NEK1 polydactyly
[1427] NEURODI Maturity-onset diabetes of the young type 6
[1428] NEXN Dilated cardiomyopathy- ICC; Familial hypertrophic cardiomyopathy-20 Axillary freckling; Cafe-au-lait macules with pulmonary stenosis; Focal T2 hyperintense basal ganglia lesion; Ganglioglioma; Hereditary cancerpredisposing syndrome; Inborn genetic diseases; Juvenile myelomonocytic leukemia; Multiple cafe-au-lait spots; Familial spinal neurofibroma;
[1429] Neurofibromas; Neurofibromatosis type 1; Neurofibromatosis-Noonan syndrome; Optic nerve glioma; Pilocytic astrocytoma; Tibial
[1430] NF1 pseudoarthrosis
[1431] NF1,
[1432] LOC111811965 Hereditary cancer-predisposing syndrome; Neurofibromatosis type 1 NF2 Meningioma; Neurofibromatosis type 2
[1433] Acquired macrocephaly with impaired intellectual development; Intellectual NFIB disability; Macrocephaly; Macrocephalus
[1434] INFIX Marshall-Smith syndrome
[1435] Congenital disorder of deglycosylation; Intellectual disability; Neuromotor NGLY1 delay; Peripheral neuropathy
[1436] NHLRC1 Lafora disease; Progressive myoclonic epilepsy-2
[1437] NHLRC2 Fibrosis, neurodegeneration, and cerebral angiomatosis
[1438] NHS Nance-Horan syndrome
[1439] NIPAL4 Autosomal recessive congenital ichthyosis-6
[1440] NIPBL Cornelia de Lange syndrome- 1
[1441] Abnormality of cardiovascular system morphology; Atrial septal defect-7
[1442]
[1443] NKX2-5 with or without atrioventricular conduction defectsNKX3-2 Spondylo-megaepiphyseal -metaphyseal dysplasia
[1444] NKX6-2 Autosomal recessive spastic ataxia-8 with hypomyelinating leukodystrophy Susceptibility to X-linked autism-2; Non-syndromic X-linked intellectual NLGN4X disability
[1445] NLRP7 Recurrent hydatidiform mole-1
[1446] NOTCH 1 Adams-Oliver syndrome-5; Aortic valve disorder; Congenital heart defect NPC1 Niemann-Pick disease type C; Niemann-Pick disease type Cl
[1447] NPHP1 Nephronop hthi si s; Nephronophthi si s- 1
[1448] NPHP3, NPHP3- ACAD11 Meckel syndrome type 7
[1449] NPHS1 Finnish congenital nephrotic syndrome
[1450] Idiopathic nephrotic syndrome; Idiopathic steroid-resistant nephrotic NPHS2 syndrome
[1451] NPHS2, Idiopathic nephrotic syndrome; Nephrotic range proteinuria; Idiopathic AXDNDI steroid-resistant nephrotic syndrome
[1452] NPRL3, HBA- LCR Familial focal epilepsy with variable foci-3
[1453] NR0B1 X-linked congenital adrenal hypoplasia
[1454] Abnormality of color vision; Cone-rod dystrophy; Enhanced s-cone syndrome; Horizontal nystagmus; NR2E3-related disorders; Retinal dystrophy; Retinitis pigmentosa; Retinitis pigmentosa-37; Visual NR2E3 impairment
[1455] NR3C2 Autosomal dominant pseudohypoaldosteronism type 1
[1456] Beckwith-Wiedemann syndrome; Inborn genetic diseases; Sotos syndrome- NSD1 1
[1457] NSD2 4p partial monosomy syndrome; Wolf-Hirschhorn like syndrome NSMCE2 Seckel syndrome- 10
[1458] NSMF Hypogonadotropic hypogonadism-9 with or without anosmia
[1459] NSUN2 Autosomal recessive mental retardation-5
[1460] NT5E Calcification of joints and arteries
[1461] Familial adenomatous polyposis-3; Hereditary cancer-predisposing NTHL1 syndrome
[1462] NTRK1 Hereditary insensitivity to pain with anhidrosis
[1463] OAT Ornithine aminotransferase deficiency
[1464] OBSL1 Three M syndrome-2
[1465] Variation in skin / hair / eye pigmentation-1; Tyrosinase-positive
[1466] OCA2 oculocutaneous albinism
[1467] OCLN Pseudo-TORCH syndrome- 1
[1468] Joubert syndrome; Orofaciodigital syndrome I; Simpson-Golabi-Behmel OFD1 syndrome type 2
[1469] Abortive cerebellar ataxia; Dominant hereditary optic atrophy; Inborn OP Al genetic diseases; Mitochondrial diseases; Retinal dystrophy
[1470] Mental retardation X-linked with cerebellar hypoplasia and distinctive facial
[1471]
[1472] OPHN1 appearance0PN1LW Cone monochromatism
[1473] ORC6 Meier-Gorlin syndrome-3
[1474] Hereditary cancer-predisposing syndrome; Microcephaly with normal OSGIN2, NBN intelligence and immunodeficiency
[1475] Abnormality of ornithine metabolism; Hyperammonemia; Ornithine OTC carbamoyltransferase deficiency; Protein avoidance
[1476] OTOA Autosomal recessive deafness-22; Rare genetic deafness
[1477] OTOF Autosomal recessive deafness-9; Rare genetic deafness
[1478] Autosomal recessive deafness-18B; Intellectual disability; Rare genetic OTOG deafness; Seizures
[1479] OTOGL Rare genetic deafness
[1480] Dysmorphic features; Epilepsy; Intellectual developmental disorder with dysmorphic facies, seizures, and distal limb anomalies; Intellectual OTUD6B disability
[1481] OTX2 Syndromic microphthalmia type 5
[1482] P2RY12,
[1483] MED12L Platelet-type bleeding disorder-8
[1484] P3H1 Osteogenesis imperfecta type 8
[1485] P3H2 High myopia with cataract and vitreoretinal degeneration
[1486] P4HA2 Autosomal dominant myopia-25
[1487] PAFAH1B1 Inborn genetic diseases; Lissencephaly due to LISI mutation
[1488] PAH Phenylketonuria
[1489] Basal cell carcinoma; Breast cancer; Cancer of the pancreas; Familial cancer of breast; Complementation group N Fanconi anemia; Generalized hypopigmentation; Hereditary breast and ovarian cancer syndrome;
[1490] Hereditary cancer; Hereditary cancer-predisposing syndrome; Neoplasm of the breast; Ovarian neoplasms; PALB2-related disorders; Susceptibility to pancreatic cancer-3; Pre-B-cell acute lymphoblastic leukemia;
[1491] Tracheoesophageal fistula; Tumor susceptibility linked to germline BAP1 PALB2 mutations
[1492] PANK2 Pigmentary pallidal degeneration
[1493] PAPSS2 Pakistani type spondyloepimetaphyseal dysplasia
[1494] PARN Autosomal recessive dyskeratosis congenita-6
[1495] PATL2 Oocyte maturation defect-4
[1496] PAX2 Focal segmental glomerulosclerosis-7; Renal coloboma syndrome Rare genetic deafness; Waardenburg syndrome; Waardenburg syndrome PAX3 type 1
[1497] PAX6 Aniridia-1; Autosomal dominant keratitis
[1498] PAX9 Selective tooth agenesis-3
[1499] PC Pyruvate carboxylase deficiency
[1500] PCCA Propionic acidemia
[1501]
[1502] PCCB Propionic acidemiaDeafness; Autosomal dominant nonsyndromic deafness-23; Rare genetic deafness; Retinal dystrophy; Digenic Usher syndrome type ID / F; Usher syndrome type 1G; Usher syndrome type 1; Usher syndrome type ID; PCDH15 Usher syndrome type IF
[1503] Absence seizures; Delayed speech and language development; Early infantile epileptic encephalopathy-9; Frontal cortical atrophy; Generalized seizures; Generalized tonic-clonic seizures; Global developmental delay; Hand tremor; Long palpebral fissure; Prominent fingertip pads; Strabismus; PCDH19 Temporal cortical atrophy
[1504] PCLO Pontocerebellar hypoplasia type 3
[1505] PCNT Microcephalic osteodysplastic primordial dwarfism type II
[1506] PCSK1,
[1507] LOC101929710 Proprotein convertase 1 / 3 deficiency
[1508] Familial hypercholesterolemia; Familial hypercholesterolemia- 1; Low PCSK9 density lipoprotein cholesterol level quantitative trait locus 1
[1509] PCYT1A Spondylometaphyseal dysplasia-cone-rod dystrophy syndrome PDE11A Primary pigmented nodular adrenocortical disease-2
[1510] PDE6B Retinal dystrophy; Retinitis pigmentosa; Retinitis pigmentosa-40 PDE6C Achromatopsia-5
[1511] PDE8B Autosomal dominant striatal degeneration- 1
[1512] PDHA1 Inborn genetic diseases; Pyruvate dehydrogenase El-alpha deficiency Permanent neonatal diabetes mellitus-1; Maturity-onset diabetes of the PDX1 young type 4; Pancreatic agenesis- 1
[1513] Autosomal recessive deafness-57; Rare genetic deafness; Usher syndrome PDZD7 type 2A
[1514] PEPD Prolidase deficiency
[1515] Deafness enamel hypoplasia nail defects; Zellwegar peroxisome biogenesis disorder-lA; Peroxisome biogenesis disorder-lB; Peroxisome biogenesis PEX1 disorders; Retinal dystrophy; Zellweger syndrome spectrum Deafness / enamel hypoplasia / nail defects; Zellweger peroxisome biogenesis disorder 1 A; Peroxisome biogenesis disorder IB; Peroxisome biogenesis PEX1, GAT ADI disorders; Zellweger syndrome spectrum
[1516] Complementation group 7 peroxisome biogenesis disorder; Peroxisome biogenesis disorder-6A; Peroxisome biogenesis disorder-6B; Peroxisome PEX10 biogenesis disorders; Zellweger syndrome spectrum
[1517] PEX10, PLCH2 Peroxisome biogenesis disorder-6B
[1518] Infantile Refsum’s disease; Peroxisome biogenesis disorder-3 A;
[1519] PEX12 Peroxisome biogenesis disorders; Zellweger syndrome spectrum Peroxisome biogenesis disorder-5B; Zellweger peroxisome biogenesis disorder-5 A; Peroxisome biogenesis disorders; Zellweger syndrome PEX2 spectrum
[1520] Peroxisome biogenesis disorder-7A; Peroxisome biogenesis disorder-7B;
[1521]
[1522] PEX26 Peroxisome biogenesis disorders; Zellweger syndrome spectrumHeimler syndrome-2; Peroxisome biogenesis disorder-4B; Zellweger peroxisome biogenesis disorder-4A; Peroxisome biogenesis disorders; PEX6 Retinal dystrophy; Zellweger syndrome spectrum
[1523] PEX7-related disorders; Peroxisome biogenesis disorder-9B; Phytanic acid PEX7 storage disease; Rhizomelic chondrodysplasia punctata type 1 PGAM2, DBNL Glycogen storage disease type X
[1524] PGAP1 Autosomal recessive mental retardation-42
[1525] PGAP3 Hyperphosphatasia with mental retardation syndrome-4
[1526] PGM3, D0P1A Immunodefi ci ency -23
[1527] PHEX Familial X-linked hypophosphatemic vitamin D refractory rickets PHEX,
[1528] PTCHD1-AS Familial X-linked hypophosphatemic vitamin D refractory rickets PHF3, EYS Retinal dystrophy; Retinitis pigmentosa-25
[1529] PHF6 Borjeson-Forssman -Lehmann syndrome
[1530] PHGDH Phosphoglycerate dehydrogenase deficiency
[1531] Developmental delay, intellectual disability, obesity, and dysmorphic PHIP features
[1532] PIIYII Phytanic acid storage disease; Adult refsum disease-1
[1533] PI4KA Perisylvian polymicrogyria with cerebellar hypoplasia and arthrogryposis P1GA Paroxysmal nocturnal hemoglobinuria- 1
[1534] PIGN Multiple congenital anomalies-hypotonia-seizures syndrome- 1
[1535] Hyperphosphatasia with mental retardation syndrome-2;
[1536] PIGO Hyperphosphatasia-intellectual disability syndrome
[1537] Multiple congenital anomalies-hypotonia-seizures syndrome-3; PIGT- PIGT related disorder
[1538] PIK3R1 SHORT syndrome
[1539] PINK1 Autosomal recessive early-onset Parkinson disease-6
[1540] PIRC66,
[1541] MIR4713HG,
[1542] CYP19A1 Aromatase deficiency
[1543] PITX3 Anterior segment mesenchymal dysgenesis; Cataract- 11
[1544] PJVK Autosomal recessive deafness-59; Rare genetic deafness Autosomal recessive polycystic kidney disease; Adult type polycystic PKD1 kidney disease
[1545] PKD1,
[1546] LOC105371049 Adult type polycystic kidney disease
[1547] Autosomal recessive polycystic kidney disease; Polycystic kidney PKHD1 dysplasia; Polycystic liver disease
[1548] PKP1 Epidermolysis bullosa simplex due to plakophilin deficiency Arrhythmogenic right ventricular cardiomyopathy; Arrhythmogenic right ventricular dysplasia / cardiomyopathy; Arrhythmogenic ventricular cardiomyopathy type 9; Cardiac arrhythmia; Cardiomyopathy;
[1549] PKP2 Cardiovascular phenotype; Sudden unexplained death
[1550]
[1551] PLA2G5 Familial benign fleck retinaInfantile neuroaxonal dystrophy; Iron accumulation in brain; Neurodegeneration with brain iron accumulation-2B; PLA2G6-associated PLA2G6 neurodegenerati on
[1552] PLCB1 Early infantile epileptic encephalopathy- 12
[1553] PLCB4 Auriculocondylar syndrome-2
[1554] PLCD1 Leukonychia totalis
[1555] PLD1 Developmental cardiac valvular defect
[1556] PLD3, PRX Charcot-Marie-Tooth disease; Spinocerebellar ataxia-46
[1557] PLEC Epidermolysis bullosa simplex with muscular dystrophy
[1558] Cardiac arrest; Cardiomyopathy; Cardiovascular phenotype; Dilated cardiomyopathy-lP; Familial hypertrophic cardiomyopathy- 18;
[1559] Hypertrophic cardiomyopathy; Primary dilated cardiomyopathy; Sudden PLN, CEP85L cardiac death
[1560] Cardiovascular phenotype; Hydroxylysine-deficient Ehlers-Danlos PL0D1 syndrome
[1561] PLOD2 Bruck syndrome-2
[1562] PLP1, RAB9B Hereditary spastic paraplegia-2
[1563] PLS3 Bone mineral density quantitative trait locus 18
[1564] PMFBP1 Spermatogenic failure-31
[1565] PMM2 Congenital disorder of glycosylation type IA
[1566] PMP22 Charcot-Marie-Tooth disease
[1567] Acute lymphoid leukemia; Burkitt lymphoma; Colorectal cancer;
[1568] Glioblastoma; Hereditary cancer; Hereditary cancer-predisposing syndrome; Hereditary nonpolyposis colon cancer; Hereditary nonpolyposis colorectal cancer type 4; Lymphoma; Lynch syndrome; Lynch syndrome-I; Pulmonary arterial hypertension; Pulmonary insufficiency; Respiratory insufficiency; Tumor susceptibility linked to germline BAP1 mutations; PMS2 Turcot syndrome
[1569] PNKD, CATIP- AS2 Paroxysmal nonkinesigenic dyskinesia- 1
[1570] Ataxia-oculomotor apraxia-4; Early infantile epileptic encephalopathy- 10; Early infantile epileptic encephalopathy- 12; History of neurodevelopmental PNKP disorder
[1571] PNPLA2 Neutral lipid storage myopathy
[1572] Hereditary spastic paraplegia-39; Laurence-Moon syndrome; PNPLA6- related disorders; Trichomegaly-retina pigmentary degeneration-dwarfism PNPLA6 syndrome
[1573] PNPLA8 Mitochondrial myopathy -lactic acidosis-deafness syndrome
[1574] PNPO Pyridoxal phosphate-responsive seizures
[1575] POC5 Retinitis pigmentosa; Syndromic retinitis pigmentosa
[1576] POGLUT1 Dowling-degos disease-4
[1577] Global developmental delay; Speech apraxia; White-sutton syndrome; POGZ Dysmorphy; Intellectual deficiency
[1578] Van Esch-O’Driscoll syndrome; Van Esch type X-linked intellectual
[1579]
[1580] POLA1 disabilityColorectal cancer- 10; Hereditary cancer-predisposing syndrome;
[1581] Mandibular hypoplasia, deafness, progeroid features and lipodystrophy POLDI syndrome
[1582] Susceptibility to colorectal cancer- 12; Hereditary cancer-predisposing syndrome; Intrauterine growth retardation, metaphyseal dysplasia, adrenal POLE hypoplasia congenita, genital anomalies, and immunodeficiency Generalized epilepsy; Global developmental delay; Obesity; Progressive POLG sclerosing poliodystrophy; Seizures
[1583] POLH Variant type xeroderma pigmentosum
[1584] POLR1A Cincinnati type acrofacial dysostosis
[1585] POLR1C Treacher Collins syndrome-3
[1586] POLR1D Treacher Collins syndrome-2
[1587] POLR2F,
[1588] SOXIO Rare genetic deafness; Waardenburg syndrome type 4C Hypomyelinating leukodystrophy-7; Neonatal pseudo-hydrocephalic POLR3A progeroid syndrome
[1589] Cerebellar hypoplasia with endosteal sclerosis; Hypogonadotropic hypogonadism-7 with or without anosmia; Hypomyelinating leukodystrophy-7; Hypomyelinating leukodystrophy-8 with or without POLR3B oligodontia and / or hypogonadotropic hypogonadism
[1590] POMK Limb-girdle muscular dystrophy-dystroglycanopathy type C-12
[1591] Congenital muscular dystrophy-dystroglycanopathy with mental retardation type Bl; Limb-girdle muscular dystrophy-dystroglycanopathy type Cl; Congenital muscular dystrophy-dystroglycanopathy type Al with brain and eye anomalies; POMT1 -related disorders; Walker-Warburg congenital POMT1 muscular dystrophy
[1592] Congenital muscular dystrophy-dystroglycanopathy with brain and eye anomalies type A2; Limb-girdle muscular dystrophy-dystroglycanopathy POMT2 type C2
[1593] POP1 Anauxetic dysplasia-2
[1594] Antley-Bixler syndrome with genital anomalies and disordered steroidogenesis; Disordered steroidogenesis due to cytochrome p450 POR oxidoreductase deficiency
[1595] PORCN Focal dermal hypoplasia
[1596] Hereditary cancer-predisposing syndrome; Susceptibility to cutaneous POTI malignant melanoma-10
[1597] POU3F4 X-linked deafness-2; Rare genetic deafness
[1598] POU4F3 Rare genetic deafness
[1599] Type II diabetes mellitus; Digenic noninsulin-dependent diabetes mellitus PPARG with acanthosis nigricans and hypertension
[1600] PPIB Osteogenesis imperfecta type 9
[1601] PPOX Variegate porphyria
[1602] PPP1R12A Genitourinary and / or brain malformation syndrome
[1603] History of neurodevelopmental disorder; Neuronal ceroid-lipofuscinosis;
[1604]
[1605] PPT1 Recessive neuronal ceroid lipofuscinosis; Neuronal ceroid lipofuscinosis- 1Delayed speech and language development; Hyperactivity; Inborn genetic PQBP1 diseases; Intellectual disability; Microcephaly; Renpenning syndrome- 1 PRDM16 Left ventricular noncompaction-8
[1606] PRDM5 Brittle cornea syndrome-2
[1607] PRDX1,
[1608] MMACHC Digenic cblC type methylmalonic aciduria and homocystinuria Familial hemophagocytic lymphohistiocytosis; Familial hemophagocytic PRF1 lymphohi stiocy tosi s-2
[1609] PRE ARI A Carney complex type 1
[1610] PRKAR1A,
[1611] FAM20A Amelogenesis imperfecta type 1G
[1612] PRKAR1B,
[1613] DNAAF5 Primary ciliary dyskinesia-18
[1614] PRKCSH Polycystic liver disease- 1
[1615] PRKN Parkinson disease-2
[1616] Short stature, brachydactyly, intellectual developmental disability, and PRMT7 seizures
[1617] PR0K2 Hypogonadotropic hypogonadism-4 with or without anosmia PR0KR2 Inborn genetic diseases; Kallmann syndrome-3
[1618] Cone-rod dystrophy-12; PROMl-related disorders; Retinal dystrophy; PROMI Retinitis pigmentosa; Retinitis pigmentosa-41
[1619] PROP1 Combined pituitary hormone deficiency-2
[1620] Adult-onset vitelliform macular dystrophy; Retinal dystrophy; Retinitis PRPH2 pigmentosa-7; Retinitis punctata albescens
[1621] Episodic kinesigenic dyskinesia-1; History of neurodevelopmental disorder; Infantile convulsions and choreoathetosis; Paroxysmal kinesigenic dyskinesia; Paroxysmal nonkinesigenic dyskinesia-1; Benign familial PRRT2 infantile seizures-2
[1622] PRSS12 Autosomal recessive mental retardation- 1
[1623] PRSS56 Isolated microphthalmia-6
[1624] PRX Demyelinating Charcot-Marie-Tooth disease type 4F
[1625] PSAP Combined saposin deficiency
[1626] PSEN1 Familial acne inversa-3
[1627] PSENEN Familial acne inversa-2
[1628] PTCHI Gorlin syndrome; Hereditary cancer-predisposing syndrome
[1629] PTCH2 Gorlin syndrome; Medulloblastoma
[1630] Cowden syndrome; Cowden syndrome-1; Glioblastoma; Glioma susceptibility-2; Hemangioma; Hereditary cancer-predisposing syndrome; Inborn genetic diseases; Macrocephaly / autism syndrome; Malignant tumor of prostate; Familial meningioma; Neoplasm of brain; Neoplasm of the breast; Neoplasm of the large intestine; Non-small cell lung cancer; Ovarian neoplasms; PTEN hamartoma tumor syndrome; PTEN-related disorder; PTEN Proteus-like syndrome; VACTERL association with hydrocephalus
[1631]
[1632] PTH1R Blomstrand type chondrodysplasiaPTPN11 Metachondromatosis
[1633] PTPRF Aplasia or hypoplasia of breasts and / or nipples-2
[1634] PTPRO Nephrotic syndrome type 6
[1635] BH4-deficient hyperphenylalaninemia-A; BH4-deficient PTS hyperphenylalaninemia due to partial PTS deficiency
[1636] PUF60 Verheij syndrome
[1637] Apnea; Generalized hypotonia; Autosomal dominant intellectual disability- 31; Limb dystonia; Mental retardation; PURA Syndrome; PURA-related severe neonatal hypotonia-seizures-encephalopathy syndrome due to a point PURA mutation
[1638] Intellectual developmental disorder with abnormal behavior, microcephaly, PUS7 and short stature
[1639] PXDN Anterior segment dysgenesis-7
[1640] PYCR1 Autosomal recessive cutis laxa type 2B
[1641] PYGL Glycogen storage disease type VI
[1642] PYGM Glycogen storage disease type V
[1643] RAB23 Carpenter syndrome; Carpenter syndrome- 1
[1644] RAB27A Griscelli syndrome; Griscelli syndrome type 2
[1645] RAB33B Smith-McCort dysplasia-2
[1646] RAB3GAP1 Warburg micro syndrome- 1
[1647] RABL3 Susceptibility to pancreatic cancer-5
[1648] Hereditary cancer-predisposing syndrome; Nijmegen breakage syndromeRAD50 like disorder
[1649] Familial breast-ovarian cancer-3; Complementation group 0 Fanconi anemia; Hereditary breast and ovarian cancer syndrome; Hereditary cancerRAD51C predisposing syndrome; Ovarian neoplasms; RAD51C-related disorders RAD51D, Familial breast-ovarian cancer-4; Hereditary breast and ovarian cancer RAD51L3-RFFL syndrome; Hereditary cancer-predisposing syndrome; Ovarian neoplasms RAD51L3- RFFL, RAD51D Familial breast-ovarian cancer-4; Hereditary cancer-predisposing syndrome RAH Smith-Magenis syndrome
[1650] Congenital myasthenic syndrome- 11 associated with acetylcholine receptor RAPSN deficiency
[1651] RARS1 Hypomyelinating leukodystrophy-9
[1652] Capillary malformation-arteriovenous malformation; Capillary RASA1 m al f orm ati on - arteri oven ou s m al form ati on - 1
[1653] Hereditary cancer-predisposing syndrome; Neoplasm; Osteosarcoma;
[1654] RBI Trilateral retinoblastoma; Small cell lung cancer; Urinary bladder cancer RBBP8 Microcephaly with mental retardation and digital anomalies Cardiovascular phenotype; Dilated cardiomyopathy-IDD; Primary dilated RBM20 cardiomyopathy
[1655] RBP3 Retinitis pigmentosa-66
[1656] RD3 Leber congenital amaurosis-12
[1657]
[1658] RDH12 Retinitis pigmentosa-53RDH5,
[1659] BL0C1S1- RDH5 Fundus albipunctatus; Pigmentary retinal dystrophy
[1660] RECQL Hereditary cancer-predisposing syndrome
[1661] RECQL,
[1662] PYR0XD1 Hereditary cancer-predisposing syndrome
[1663] B lymphoblastic leukemia with t(12;21)(pl3;q22); Baller-Gerold syndrome; High grade surface osteosarcoma; Rapadilino syndrome; Rothmund- RECQL4 Thomson syndrome; Rothmund-Thomson syndrome type 2
[1664] REEP6 Retinitis pigmentosa-77
[1665] RELT Amelogenesis imperfecta type IIIC
[1666] REN Familial hyperproreninemia
[1667] RET Hirschsprung disease- 1; Sensorineural hearing loss
[1668] RFX5 Complementation group C bare lymphocyte syndrome type II RFXANK Complementation group B bare lymphocyte syndrome type II Complementation group D bare lymphocyte syndrome type II; Bare RFXAP lymphocyte syndrome-2
[1669] RHAG Regulatory type Rh-null disease
[1670] RHCE Amorph type Rh-null disease
[1671] RHO Autosomal dominant retinitis pigmentosa
[1672] RIF1, NEB Nemaline myopathy; Nemaline myopathy-2
[1673] RIN2 Macrocephaly, alopecia, cutis laxa, and scoliosis
[1674] RIPK1 Immunodeficiency-57 with autoinflammation
[1675] RIPK4 Bartsocas-Papas syndrome
[1676] RNASEH2A Aicardi Goutieres syndrome-4
[1677] RNASEH2B Aicardi Goutieres syndrome-2
[1678] RNF113A Nonphotosensitive trichothiodystrophy-5
[1679] RNF216 Gordon Holmes syndrome
[1680] ROBO3 Familial horizontal gaze palsy with progressive scoliosis-1
[1681] RORA, RORA- Intellectual developmental disorder with or without epilepsy or cerebellar AS1 ataxia
[1682] RP1 Retinal dystrophy; Retinitis pigmentosa; Retinitis pigmentosa-1 RP1L1 Retinitis pigmentosa-88
[1683] Leber congenital amaurosis-2; Retinitis pigmentosa-87 with choroidal involvement; RPE65-related disorders; Retinal dystrophy; Retinitis RPE65 pigmentosa-20
[1684] Inborn genetic diseases; Retinal dystrophy; X-linked retinitis pigmentosa RPGR and sinorespiratory infections with deafness; Retinitis pigmentosa-15 RPGRIPI Leber congenital amaurosis-6
[1685] RPGRIPIL Joubert syndrome; Joubert syndrome-7
[1686] RPL36A- HNRNPH2,
[1687] GLA Fabry disease
[1688]
[1689] RPL5, DIPK1A Diamond-Blackfan anemia; Diamond-Blackfan anemia-1RPS10, RPS10- NUDT3 Diamond-Blackfan anemia-9
[1690] RPS27 Diamond-Blackfan anemia- 17
[1691] RPS6KA3 Coffin-Lowry syndrome; X-linked mental retardation- 19
[1692] Kartagener syndrome; Primary ciliary dyskinesia; Primary ciliary RSPH1 dyskinesia-24
[1693] Primary ciliary dyskinesia-11; Kartagener syndrome; Primary ciliary RSPH4A dyskinesia
[1694] RSPO2 Tetraamelia syndrome-2
[1695] Autosomal recessive dyskeratosis congenita-5; Chronic form idiopathic RTEL1, RTEL1- fibrosing alveolitis; Telomere-related pulmonary fibrosis and / or bone TNFRSF6B marrow failure-3; Autosomal dominant dyskeratosis congenita-4 RTN2 Hereditary spastic paraplegia-12
[1696] Congenital microcephaly; Microcephaly, short stature, and polymicrogyria RTTN with or without seizures
[1697] Acute myeloid leukemia; Familial platelet disorder with associated myeloid RUNX1 malignancy
[1698] Central core myopathy; Susceptibility to malignant hyperthermia- 1;
[1699] Mini core myopathy; Multi-minicore disease and atypical periodic paralysis; RYR1 Neuromuscular disease; RYR1 -related disorders
[1700] Autosomal recessive spastic ataxia; Charlevoix-Saguenay spastic ataxia; SACS Spastic paraplegia
[1701] SAG Oguchi’s disease; Retinitis pigmentosa-47; SAG-related disorders SALL1 Townes syndrome
[1702] SAMD9L Ataxia-pancytopenia syndrome
[1703] SAMHD1 Aicardi Goutieres syndrome-5
[1704] SASH1 Dyschromatosis universalis hereditarian-1
[1705] SATB2 SATB2-related disorder
[1706] SBDS Inborn genetic diseases; Shwachman-Diamond syndrome-1
[1707] SBF1 Charcot-Marie-Tooth disease type 4
[1708] Attention deficit hyperactivity disorder; Intellectual developmental disorder SCAPER and retinitis pigmentosa; Intellectual disability; Rod-cone dystrophy SCARB2 Progressive myoclonic epilepsy-4 with or without renal failure SCARF2 Van den Ende-Gupta syndrome
[1709] Autosomal dominant epilepsy; Early infantile epileptic encephalopathy; Familial hemiplegic migraine type 3; Generalized epilepsy with febrile seizures plus type 2; History of neurodevelopmental disorder; Severe SCN1A myoclonic epilepsy in infancy; Dravet syndrome
[1710] Autosomal dominant epilepsy; Early infantile epileptic encephalopathy; SCN1A, Epileptic encephalopathy; Generalized epilepsy with febrile seizures plus LOC 102724058 type 2; Seizures; Severe myoclonic epilepsy in infancy
[1711] SCN2A SCN2A-related disorder
[1712] Brugada syndrome; Brugada syndrome with shorter-than-normal QT interval; Brugada syndrome- 1; Cardiovascular phenotype; Dilated
[1713]
[1714] SCN5A cardiomyopathy-lE; Nonprogressive heart block; Long QT syndrome-1SCN5A, Brugada syndrome; Brugada syndrome with shorter-than-normal QT LOC110121269 interval
[1715] Generalized epilepsy with febrile seizures plus type 7; Hereditary sensory SCN9A, and autonomic neuropathy type IIA; Autosomal recessive congenital SCN1A-AS1 indifference to pain
[1716] Autosomal recessive pseudohypoaldosteronism type 1; Idiopathic SCNN1A bronchiectasis
[1717] SCNN1B Liddle syndrome- 1
[1718] SCNN1G Autosomal recessive pseudohypoaldosteronism type 1; Liddle syndrome-2 SC01 Mitochondrial complex IV deficiency
[1719] SCP2 Leukoencephalopathy with dystonia and motor neuropathy
[1720] Bardet-Biedl syndrome; Bardet-Biedl syndrome- 16; Senior-Loken SDCCAG8 syndrome-7
[1721] Carney triad; Dilated cardiomyopathy- 1GG; Hereditary cancer-predisposing syndrome; Leigh syndrome; Mitochondrial complex II deficiency;
[1722] SDHA Paragangliomas-5; Pilocytic astrocytoma
[1723] SDHAF2 Hereditary paraganglioma-pheochromocytoma syndromes
[1724] Camey-Stratakis syndrome; Gastrointestinal stromal tumor; Hereditary paraganglioma-pheochromocytoma syndromes; Hereditary cancerSDHB predisposing syndrome; Paragangliomas-4; Pheochromocytoma Gastrointestinal stromal tumor; Hereditary paragangliomapheochromocytoma syndromes; Hereditary cancer-predisposing syndrome; SDHC Paragangliomas-3
[1725] Carney-Stratakis syndrome; Cowden syndrome-3; Hereditary paraganglioma-pheochromocytoma syndromes; Hereditary cancerpredisposing syndrome; Paragangliomas- 1; Paragangliomas- 1 with SDHD sensorineural hearing loss; Pheochromocytoma
[1726] SDR9C7 Autosomal recessive congenital ichthyosis-13
[1727] SEC23B Congenital dyserythropoietic anemia
[1728] SEC24D Cole-Carpenter syndrome-2
[1729] SECISBP2 Anormal thyroid hormone metabolism
[1730] Extraoral halitosis due to methanethiol oxidase deficiency; Extraoral SELENBP1 halitosis
[1731] SELENON Eichsfeld type congenital muscular dystrophy
[1732] SEMA3A Hypogonadotropic hypogonadism- 16 with or without anosmia SEPSECS Pontocerebellar hypoplasia type 2D
[1733] SEPTIN 12 Spermatogenic failure-10
[1734] 3-methylglutaconic aciduria with deafness, encephalopathy, and Leigh-like SERAC 1 syndrome; Mitochondrial oxidative phosphorylation disorder SERPINA6 Corticosteroid-binding globulin deficiency
[1735] SERPINA7 Thyroxine-binding globulin quantitative trait locus
[1736] SERPINB6 Rare genetic deafness
[1737] SERPINB7 Nagashima type palmoplantar keratoderma
[1738]
[1739] SERPINC1 Antithrombin III deficiencySERPINF1 Osteogenesis imperfecta type VI
[1740] SERPING1 Hereditary angioedema type 1
[1741] SERPINH1 Osteogenesis imperfecta type 10
[1742] SETBP 1 SETBP 1 -related disorder
[1743] SETD5 Inborn genetic diseases; Autosomal dominant mental retardation -23
[1744] Hereditary hearing loss and deafness; Inborn genetic diseases; Nager SF3B4 syndrome
[1745] SFRP4 Pyle metaphyseal dysplasia
[1746] SFTPA1 Respiratory distress associated with prematurity
[1747] SFTPB Pulmonary surfactant metabolism dysfunction-1
[1748] SGCA Autosomal recessive limb-girdle muscular dystrophy type 2D
[1749] SGCD Neuromuscular disease
[1750] SGCE, CASD1 Myoclonic dystonia
[1751] North African type severe autosomal recessive muscular dystrophy of SGCG childhood
[1752] Developmental regression; Diarrhea; Gastrointestinal dysmotility; Global developmental delay; MPS-III-A mucopolysaccharidosis; Nystagmus; SGSH Retinal dystrophy; Sanfilippo syndrome; Severe visual impairment
[1753] X-linked lymphoproliferative syndrome-1; X-Linked Lymphoproliferative SH2D1A Syndrome
[1754] SH3PXD2B Frank-Ter Haar syndrome
[1755] Charcot-Marie-Tooth disease type 4C; Charcot-Marie-Tooth disease type 4; Inborn genetic diseases; Mild mononeuropathy of the median nerve;
[1756] SH3TC2 SH3TC2-related disorders
[1757] 22ql3.3 deletion syndrome; Autism spectrum disorder; History of neurodevelopmental disorder; Inborn genetic diseases; SHANK3 -related SHANK3 disorder
[1758] SHOX Leri-Weill dyschondrosteosis
[1759] SI Sucrase-isomaltase deficiency
[1760] SIX6 Colobomatous optic disc-macular atrophy-chorioretinopathy syndrome SK1V2L Trichohepatoenteric syndrome-2
[1761] SLC10A7 Amelogenesis imperfecta, short stature, and skeletal dysplasia with scoliosis SLC12A1 Antenatal Bartter syndrome type 1
[1762] SLC12A3 Familial hypokalemia-hypomagnesemia
[1763] Agenesis of the corpus callosum with peripheral neuropathy; Charcot- SLC12A6 Marie-Tooth disease
[1764] SLC17A5 Salla disease; Severe infantile type sialic acid storage disease SLC19A1,
[1765] COL18A1 Knobloch syndrome- 1
[1766] Thiamine-responsive megaloblastic anemia with diabetes mellitus and SLC19A2 sensorineural deafness
[1767] SLC19A3 Biotin-responsive basal ganglia disease
[1768] SLC22A5 Renal carnitine transport defect
[1769]
[1770] SLC25A20 Carnitine acylcarnitine translocase deficiency3MC syndrome-2; Achondrogenesis type IB; Atelosteogenesis type II;
[1771] Diastrophic dysplasia; Multiple epiphyseal dysplasia type 4;
[1772] SLC26A2 Osteochondrodysplasia; SLC26A2-related disorders
[1773] SLC26A3 Congenital chloride type secretory diarrhea
[1774] SLC26A4 Enlarged vestibular aqueduct; Pendred syndrome; Rare genetic deafness SLC2A10 Arterial tortuosity syndrome; Cardiovascular phenotype
[1775] SLC2A2 Fanconi -Bickel syndrome
[1776] SLC30A8 Diabetes mellitus type 2
[1777] SLC33A1 Autosomal dominant spastic paraplegia; Spastic paraplegia-42 SLC34A3 Autosomal recessive hypophosphatemic bone disease
[1778] SLC35A2 Congenital disorder of glycosylation type UM
[1779] SLC35D1 Schneckenbecken dysplasia
[1780] Glucose-6-phosphate transport defect; Glycogen storage disease; Inborn SLC37A4 genetic diseases; Phosphate transport defect
[1781] Foveal hypoplasia-2 with optic nerve misrouting and anterior segment SLC38A8 dysgenesis
[1782] SLC39A4 Hereditary acrodermatitis enteropathica
[1783] SLC45A2 Oculocutaneous albinism type 4
[1784] SLC4A1 Autosomal dominant distal renal tubular acidosis
[1785] SLC4A11 Comeal endothelial dystrophy; Fuchs endothelial corneal dystrophy-4 SLC52A3 Brown-Vialetto-Van Laere syndrome- 1
[1786] SLC6A1 Myoclonic-atonic epilepsy; SLC6A1 -related disorder
[1787] SLC9A3 Congenital secretory sodium diarrhea-8
[1788] SLC9A3,
[1789] SLC9A3-AS1 Congenital secretory sodium diarrhea-8
[1790] Gastrostomy tube feeding in infancy; Global developmental delay;
[1791] SLC9A6 Recurrent respiratory infections; Scoliosis; Seizures; Sleep disturbance SLC02A1 Autosomal recessive primary hypertrophic osteoarthropathy-2 SLITRK1 Tourette Syndrome; Trichotillomania
[1792] SLURP 1 Acroerythrokeratoderma
[1793] SMAD3 Familial thoracic aortic aneurysm and aortic dissection
[1794] Carcinoma of pancreas; Hereditary cancer-predisposing syndrome; Juvenile polyposis syndrome; Juvenile polyposis / hereditary hemorrhagic SMAD4 telangiectasia syndrome; Myhre syndrome
[1795] Aortic valve disease-2; Aortic valve disorder; Susceptibility to SMAD6 craniosynostosis-7
[1796] SMARCA4 Neuroblastoma
[1797] SMARCALI Schimke immuno-osseous dysplasia
[1798] SMARCB1 Atypical teratoid tumor
[1799] SMARCE1 Familial meningioma
[1800] Congenital muscular hypertrophy -cerebral syndrome; Early infantile SMC1A epileptic encephalopathy-85 with or without midline brain defects
[1801]
[1802] SMN1 Werdnig-Hoffmann diseaseNiemann-Pick disease type A; Niemann-Pick disease type B;
[1803] SMPD1 Sphingomyelin / cholesterol lipidosis
[1804] SNAP29 CEDNIK syndrome; Hypomyelinating leukodystrophy -2
[1805] SNRPB Cerebro-costo-mandibular syndrome
[1806] S0HLH1 Nonsyndromic hypergonadotropic hypogonadism; Ovarian dysgenesis-5 SON Inborn genetic diseases; ZTTK syndrome
[1807] SOS1 Gingival fibromatosis- 1
[1808] SOX2, SOX2- OT Anophthalmia / microphthalmia-esophageal atresia syndrome
[1809] SOX9 Campomelic dysplasia with autosomal sex reversal; Camptomelic dysplasia SOX9,
[1810] LOCI 08021846 Campomelic dysplasia with autosomal sex reversal
[1811] SP110, SP140 Hepatic veno-occlusive disease-immunodeficiency syndrome
[1812] SP7 Osteogenesis imperfecta type 12
[1813] SPART Troyer syndrome
[1814] SPAST Autosomal dominant spastic paraplegia-4
[1815] SPEF2 Primary ciliary dyskinesia; Spermatogenic failure-43
[1816] SPEG Centronuclear myopathy-5
[1817] SPEG, ASIC4- AS1 Centronuclear myopathy-5
[1818] Amyotrophic lateral sclerosis type 5; Autosomal recessive hereditary SPG11 spastic paraplegia; Spastic paraplegia- 11
[1819] Hereditary spastic paraplegia; Hereditary spastic paraplegia-7;
[1820] SPG7 Mitochondrial diseases
[1821] SPINK2 Spermatogenic failure-29
[1822] SPINK5 Netherton syndrome
[1823] SPNS2 Autosomal recessive deafness-115; Inborn genetic diseases
[1824] SPRTN Ruijs-Aalfs syndrome
[1825] SPTA1 Elliptocytosis-2; Hereditary pyropoikilocytosis
[1826] SPTB Hereditary spherocytosis; Spherocytosis type 2
[1827] Amyotrophic lateral sclerosis and / or frontotemporal dementia- 1; Early- SQSTM1 onset Paget disease of bone-2; SQ STM 1 -related disorder
[1828] SRCAP Floating-Harbor syndrome
[1829] SRY 46, XY sex reversal type 1
[1830] STM Autosomal recessive congenital ichthyosis-11
[1831] STAG1 Autosomal dominant mental retardation-47
[1832] Abnormality of the ovary; Female infertility; Premature ovarian failure-8; STAG3 Premature ovarian insufficiency
[1833] STAT1 Autosomal recessive susceptibility to mycobacterial and viral infections Combined immunodeficiency due to STIM1 deficiency; Tubular aggregate STIM1 myopathy- 1; Storm orken syndrome
[1834] STK11 Hereditary cancer-predisposing syndrome; Peutz-Jeghers syndrome STRA6 Microphthalmia syndromic-9
[1835]
[1836] STRC Autosomal recessive deafness- 16; Rare genetic deafnessEarly infantile epileptic encephalopathy; Early infantile epileptic STXBP1 encephalopathy-4; Epileptic encephalopathy
[1837] STXBP2 Familial hemophagocytic lymphohistiocytosis-5
[1838] Encephalomyopathic mitochondrial DNA depletion syndrome-9 with SUCLG1 methylmalonic aciduria
[1839] Gorlin syndrome; Desmoplastic medulloblastoma; Medulloblastoma with SUFU extensive nodularity
[1840] Autosomal recessive congenital ichthyosis-14; Autosomal recessive SULT2B1 congenital ichthyosis-2
[1841] SUMF1 Multiple sulfatase deficiency
[1842] SUN5 Spermatogenic failure- 16
[1843] Abnormal pyramidal signs; Cerebellar ataxia; Charcot-Marie-Tooth disease type 4K; Dysarthria; Inborn genetic diseases; Leigh syndrome; Leigh syndrome due to COX IV deficiency; Leigh syndrome due to mitochondrial complex IV deficiency; Mitochondrial complex IV deficiency; Muscle SLRFI weakness
[1844] SUZ12 Imagawa-Matsumoto syndrome
[1845] Cryptozoospermia; Early spermatogenesis maturation arrest; Oligosynaptic SYCP2 infertility
[1846] SYCP3 Spermatogenic failure-4
[1847] Myogenic type arthrogryposis multiplex congenita; Cerebellar ataxia;
[1848] Autosomal dominant Emery -Dreifuss muscular dystrophy-4; Autosomal SYNE1 recessive spinocerebellar ataxia-8
[1849] SYNE4 Rare genetic deafness
[1850] SYNGAP1 Inborn genetic diseases; Autosomal dominant mental retardation-5 SZT2 Early infantile epileptic encephalopathy- 18
[1851] TAC3 Hypogonadotropic hypogonadism- 10 with or without anosmia TAC01 Mitochondrial complex IV deficiency
[1852] TALDO1 Deficiency of transaldolase
[1853] Acute rhabdomyolysis; Cardiac arrhythmia; Episodic flaccid weakness; Intellectual functioning disability; Seizures; Recurrent metabolic crises with TANGO2 rhabdomyolysis, cardiac arrhythmias, and neurodegeneration
[1854] TAPI Bare lymphocyte syndrome type 1
[1855] TAP2 Bare lymphocyte syndrome type 1; Peptide transporter PSF2 polymorphism TAZ 3-Methylglutaconic aciduria type 2
[1856] TBC1D20 Warburg micro syndrome-4
[1857] DOORS syndrome caused by mutation in the TBC1 domain family member 24; Early infantile epileptic encephalopathy-1; Inborn genetic diseases; TBC1D24 Autosomal dominant deafness-65
[1858] Inborn genetic diseases; Syndromic infantile encephalopathy; Infantile TBCK hypotonia with psychomotor retardation and characteristic facies-3
[1859] Susceptibility to autism-5; Autistic behavior; Intellectual disability;
[1860] Moderate global developmental delay; Neurodevelopmental disorder;
[1861] TBR1 Severe global developmental delay
[1862]
[1863] TBX19 Adrenocorticotropic hormone deficiencyTBX22 Cleft palate with ankyloglossia
[1864] TBX3 Ulnar-mammary syndrome
[1865] TBX4 Coxopodopatellar syndrome
[1866] TBX5 Variable congenital heart disease; Holt-Oram syndrome
[1867] TBXAS1 Ghosal hematodiaphyseal dysplasia; Thromboxane synthetase deficiency Autosomal recessive limb-girdle muscular dystrophy type 2G; Dilated TCAP cardiomyopathy-lN; Primary familial hypertrophic cardiomyopathy TCF12 Craniosynostosis-3
[1868] TCF20 Neurodevelopmental abnormality
[1869] TCF4 Intellectual disability; Pitt-Hopkins syndrome
[1870] TCN2 Inborn genetic diseases; Transcobalamin II deficiency
[1871] TC0F1 Treacher Collins syndrome- 1
[1872] TCTEX1D2 Short-rib thoracic dysplasia-17 with or without polydactyly TCTEX1D2,
[1873] TM4SF19- TCTEX1D2 Short-rib thoracic dysplasia- 17 with or without polydactyly
[1874] TCTN2 Joubert syndrome; Meckel syndrome type 8
[1875] TCTN3 Orofacial-digital syndrome-IV
[1876] TD02 Familial hypertryptophanemia
[1877] TDRD7 Autosomal recessive congenital cataract -4
[1878] TDRD9 Spermatogenic failure-30
[1879] TECPR2 Autosomal recessive spastic paraplegia-49
[1880] Autosomal dominant nonsyndromic hearing loss and deafness- 12; Rare genetic deafness; Autosomal recessive deafness-21; Neurosensory TECTA autosomal recessive deafness-21
[1881] TENM3 Syndromic microphthalmia- 15
[1882] TENT5A Osteogenesis imperfecta type 18
[1883] TEX 14 Spermatogenic failure-23
[1884] TEX 15 Spermatogenic failure-25
[1885] TFAP2B Patent ductus arteriosus-2
[1886] TFR2 Hemochromatosis type 3
[1887] TG lodotyrosyl coupling defect
[1888] TGFB2 Cardiovascular phenotype; Holt-Oram syndrome; Loeys-Dietz syndrome-4 TGFB3 Cardiovascular phenotype; Loeys-Dietz syndrome-5
[1889] TGFBR1 Familial thoracic aortic aneurysm and aortic dissection
[1890] Familial thoracic aortic aneurysm and aortic dissection; Hereditary nonpolyposis colorectal cancer type 6; Loeys-Dietz syndrome; Loeys-Dietz TGFBR2 syndrome-2; Malignant tumor of esophagus
[1891] TGM1 Autosomal recessive congenital ichthyosis-1; Ichthyosis
[1892] TGM5 Peeling skin syndrome-2
[1893] TH Autosomal recessive Segawa syndrome
[1894] THRB Autosomal dominant generalized thyroid hormone resistance
[1895]
[1896] TIC AMI Susceptibility to herpes simplex encephalitis-4TIMM8A Deafness dystonia syndrome
[1897] TIM MIX' ! Leigh syndrome
[1898] TJP2 Progressive familial intrahepatic cholestasis-4
[1899] TK2 Mitochondrial DNA depletion syndrome-2
[1900] Legionellosis; Melioidosis; Susceptibility to systemic lupus erythematosus- TLR5 1
[1901] TM4SF20 Specific language impairment-5
[1902] TMC1 Rare genetic deafness; Autosomal recessive nonsyndromic hearing loss-7
[1903] Craniofacial dysmorphism, skeletal anomalies, and mental retardation TMC01 syndrome
[1904] TMCO6,
[1905] NDUFA2 Cystic leukoencephalopathy
[1906] Hereditary paraganglioma-pheochromocytoma syndromes; Hereditary TMEM127 cancer-predisposing syndrome; Pheochromocytoma
[1907] Joubert syndrome; Joubert syndrome-2; Meckel syndrome type 2;
[1908] TMEM216 TMEM216-related disorders
[1909] TMEM237 Joubert syndrome
[1910] TMEM260 Structural heart defects and renal anomalies syndrome
[1911] Cerebellar vermis hypoplasia; Generalized hypotonia; Iris coloboma;
[1912] Joubert syndrome; Joubert syndrome-6; Meckel syndrome type 3; Meckel- TMEM67 Gruber syndrome; Nystagmus; TMEM67-related disorders Mitochondrial proton-transporting ATP synthase complex deficiency;
[1913] TMEM70 Nuclearly-encoded mitochondrial complex V (ATP synthase) deficiency-2
[1914] Intellectual developmental disorder with cardiac defects and dysmorphic TMEM94 facies
[1915] TMEM99,
[1916] KRT10 Bullous ichthyosiform erythroderma
[1917] Inborn genetic diseases; Rare genetic deafness; Autosomal recessive TMPRSS3 deafness-8
[1918] TNFRSF1OB Squamous cell carcinoma of the head and neck
[1919] TNFRSF11B Hyperphosphatasemia with bone disease
[1920] Absent epiphyses; Chronic lung disease; Cleft palate; Clubfoot; Coat hanger sign of ribs; Common variable immune deficiency; Common variable immunodeficiency-2; Hemivertebrae; Immunoglobulin A deficiency-2; Interstitial pulmonary abnormality; Micrognathia; Patent ductus arteriosus; Preaxial foot polydactyly; Pseudoarthrosis; Respiratory failure; Short femur; Skeletal dysplasia; Vertebral hypoplasia; Vertebral segmentation TNFRSF13B defect
[1921] TNFRSF1A Familial Periodic Fever; Susceptibility to multiple sclerosis-5 TNFSF11 Autosomal recessive osteopetrosis-2
[1922] TNN13 Cardiovascular phenotype
[1923] TNNI3K, FPGT-
[1924]
[1925] TNNI3K Cardiac conduction disease with or without dilated cardiomyopathyCardiomyopathy; Cardiovascular phenotype; Familial hypertrophic cardiomyopathy -2; Familial restrictive cardiomyopathy-3; Hypertrophic cardiomyopathy; Left ventricular noncompaction-6; Primary familial TNNT2 hypertrophic cardiomyopathy
[1926] TNPO3 Limb-girdle muscular dystrophy type IF
[1927] Classic-like Ehlers-Danlos syndrome-1; Ehlers-Danlos syndrome due to TNXB tenascin-X deficiency
[1928] TONSL Sponastrime dysplasia
[1929] TONSL,
[1930] TONSL-AS1 Sponastrime dysplasia
[1931] Microcephaly, growth restriction, and increased sister chromatid exchange- TOP3A 2
[1932] TOPORS Retinal dystrophy; Retinitis pigmentosa
[1933] Head and neck neoplasms; Hereditary cancer-predisposing syndrome; Li- Fraumeni syndrome; Li-Fraumeni syndrome- 1; Li-Fraumeni-like syndrome; TP53 Multiple myeloma; Neoplasm of the large intestine; Ovarian neoplasms Ectrodactyly, ectodermal dysplasia, and cleft lip / palate syndrome-3;
[1934] TP63 Orofacial cleft-8
[1935] TPI1 Triosephosphate isomerase deficiency
[1936] TPM2 Distal arthrogryposis type 2B4
[1937] TPO Deficiency of iodide peroxidase
[1938] Ceroid lipofuscinosis neuronal-2; Childhood-onset autosomal recessive slowly progressive spinocerebellar ataxia; Inborn genetic diseases;
[1939] TPP1 Neuronal ceroid lipofuscinosis
[1940] TPRN Autosomal recessive deafness-79
[1941] TRAPPC11 Limb-girdle muscular dystrophy type 2S
[1942] TRAPPC2 Spondyloepiphyseal dysplasia tarda
[1943] Catecholaminergic polymorphic ventricular tachycardia-5;
[1944] Catecholaminergic polymorphic ventricular tachycardia with or without TRDN muscle weakness
[1945] Aicardi Goutieres syndrome-1; Chilblain lupus; Retinal vasculopathy with TREX1, ATRIP, cerebral leukoencephalopathy and systemic manifestations; TREX1 -related ATRIP-TREX1 disorders
[1946] TRIM 14, NANS Genevieve type spondyloepimetaphyseal dysplasia
[1947] TRIM32,
[1948] ASTN2 Limb-girdle muscular dystrophy
[1949] TRIOBP Nonsyndromic hearing loss and deafness
[1950] TRIP 11 Achondrogenesis type IA; Goldblatt hypertension; Osteochondrodysplasia Acute infantile liver failure due to synthesis defect of mtDNA-encoded TRMU proteins
[1951] Retinitis pigmentosa and erythrocytic microcytosis; Sideroblastic anemia TRNT1 with B-cell immunodeficiency, periodic fevers, and developmental delay Cardiomyopathy; Progressive familial heart block type IB; TRPM4-related TRPM4 disorders
[1952]
[1953] TRPS1 Trichorhinophalangeal dysplasia type ITRPV4 Charcot-Marie-Tooth disease axonal type 2C
[1954] TRPV6 Transient neonatal hyperparathyroidism
[1955] Cortical dysplasia; Cortical tubers; Focal cortical dysplasia type II;
[1956] Hereditary cancer-predisposing syndrome; Lymphangiomyomatosis;
[1957] Multiple renal cysts; Renal cortical cysts; Renal insufficiency; Seizures; TSC1 Tuberous sclerosis-1; Tuberous sclerosis syndrome; Urinary bladder cancer Focal cortical dysplasia type 11; Lymphangiomyomatosis; Tuberous TSC2 sclerosis-2; Tuberous sclerosis syndrome
[1958] Combined oxidative phosphorylation deficiency-3; Primary dilated TSFM cardiomyopathy
[1959] TSHB Secondary hypothyroidism
[1960] TSHR Congenital nongoitrous hypothyroidism-1
[1961] TSHZ1 Congenital aural atresia
[1962] Congenital muscular alpha-dystroglycanopathy with brain and eye anomalies; Congenital muscular dystrophy-dystroglycanopathy with mental retardation type B3; Limb-girdle muscular dystrophy-dystroglycanopathy TSPAN1, type C3; Muscle eye brain disease; POMGNT1 -related disorders; Retinitis POMGNT1 pigmentosa-76
[1963] TSPAN12 Exudative vitreoretinopathy-5
[1964] TSPAN7 X-linked mental retardation-58
[1965] TSPEAR Hair / tooth type ectodermal dysplasia-14 with hypohidrosis
[1966] TSPEAR-AS1, Hair / tooth type ectodermal dysplasia-14 with hypohidrosis; Autosomal TSPEAR recessive deafness-98
[1967] TTC19 Nuclear type 2 mitochondrial complex III deficiency
[1968] TTC21A Spermatogenic failure-37
[1969] TTC21B,
[1970] TTC21B-AS1 Short-rib thoracic dysplasia-4 with polydactyly
[1971] TTC29 Spermatogenic failure-42
[1972] TTC37 Trichohepatoenteric syndrome; Trichohepatoenteric syndrome-1 TTC7A Multiple gastrointestinal atresias
[1973] TTLL5 Cone-rod dystrophy- 19
[1974] Cardiomyopathy; Cardiovascular phenotype; Dilated cardiomyopathy-1 G; Limb-girdle muscular dystrophy type 2J; Myotubular myopathy; Primary TTN dilated cardiomyopathy; Tibial muscular dystrophy
[1975] Cardiovascular phenotype; Dilated cardiomyopathy- 1G; Limb-girdle muscular dystrophy type 2J; Primary dilated cardiomyopathy; TTN-related TTN-AS1, TTN disorders
[1976] TTN,
[1977]
[1978] LOC101927055 Primary dilated cardiomyopathyBroad-based gait; Cardiomyopathy; Cardiovascular phenotype; Congenital muscular dystrophy; Decreased patellar reflex; Delayed gross motor development; Dilated cardiomyopathy- 1G; Dilated cardiomyopathy-1 S; Distal muscle weakness; Familial dilated cardiomyopathy; Familial hypertrophic cardiomyopathy-9; Gowers sign; Heart murmur; Limb-girdle muscular dystrophy type 2J; Muscular dystrophy; Myofibrillar myopathy-9 with early respiratory failure; Primary dilated cardiomyopathy; Proximal lower limb amyotrophy; Scoliosis; Severe muscular hypotonia; TTN-related disorder; Tibial muscular dystrophy; Waddling gait; Early-onset myopathy TTN, TTN-AS1 with fatal cardiomyopathy
[1979] Familial isolated deficiency of vitamin E; Friedreich-like ataxia with TTPA isolated vitamin E deficiency
[1980] TUB, RIC3 Retinal dystrophy and obesity
[1981] TUBA3D,
[1982] MZT2A Keratoconus-9
[1983] TUBB8 Oocyte maturation defect-2
[1984] TULP1 Leber congenital amaurosis; Retinitis pigmentosa
[1985] TWIST 1 Craniosynostosis-1; Robinow-Sorauf syndrome; Saethre-Chotzen syndrome TXNL4A Bum-McKeown syndrome
[1986] TYK2 Tyrosine kinase 2 deficiency
[1987] Ocular albinism with sensorineural deafness; Inborn genetic diseases; Myopia; Nonsyndromic oculocutaneous albinism; Nystagmus;
[1988] Oculocutaneous albinism; Oculocutaneous albinism type IB; Variation in TYR skin / hair / eye pigmentation-3; Tyrosinase-negative oculocutaneous albinism TYRP1,
[1989] LURAP1L-AS1 Oculocutaneous albinism type 3
[1990] LB AP I Autosomal dominant spastic paraplegia-80
[1991] UBE3A, Angelman syndrome; History of neurodev el opmental disorder; Inborn SNHG14 genetic diseases
[1992] UBE3B Kaufman oculocerebrofacial syndrome
[1993] UBR1 Johanson-Blizzard syndrome
[1994] UCP3 Severe obesity and type II diabetes
[1995] UGT1A,
[1996] UGT1A10,
[1997] UGT1A8,
[1998] UGT1A7,
[1999] UGT1A6,
[2000] UGT1A5,
[2001] UGT1A9,
[2002] UGT1A4,
[2003] UGT1A1,
[2004] UGT1A3 Crigler-Najjar syndrome type II; Crigler-Najjar syndrome type 1 UNCI 3D Familial hemophagocytic lymphohistiocytosis-3
[2005] Hypotonia-speech impairment-severe cognitive delay syndrome; Infantile
[2006]
[2007] UNC8O hypotonia with psychomotor retardation and characteristic facies-2UNG Hyper-IgM syndrome type 5
[2008] UPF3B X-linked syndromic mental retardation- 14
[2009] Autosomal recessive deafness- 18; Rare genetic deafness; Retinal dystrophy; USH1C Retinitis pigmentosa; Usher syndrome type 1C; Usher syndrome type 1 Abnormality of the upper limb; Abnormality of upper limb bone;
[2010] Abnormality of upper limb joint; Anxiety; Brisk reflexes; Chronic pain; Cognitive impairment; Cone-rod dystrophy; Congenital sensorineural hearing impairment; Congenital stationary night blindness; Dislocated radial head; Distal arthrogryposis; Dysautonomia; Hearing impairment; High palate; Inborn genetic diseases; Macular dystrophy; Multiple joint contractures; Rare genetic deafness; Retinal dystrophy; Retinitis pigmentosa; Retinitis pigmentosa-39; Short stature; USH2A-related USH2A disorders; Usher syndrome type 2 A; Usher syndrome type 2
[2011] USH2A, Rare genetic deafness; Retinal dystrophy; Retinitis pigmentosa-39; USH2A- USH2A-AS1 related disorders; Usher syndrome type 2A
[2012] USH2A,
[2013] USH2A-AS2 Rare genetic deafness; Retinitis pigmentosa-39; Usher syndrome type 2A USP18 Pseudo-TORCH syndrome-2
[2014] USP27X X-linked mental retardation- 105
[2015] USP9X related disorders; X-linked female-restricted syndromic mental USP9X retardation-99
[2016] Dilated cardiomyopathy-lW; Familial hypertrophic cardiomyopathy- 15; VCL Primary dilated cardiomyopathy
[2017] Familial erythrocytosis-2; Hereditary cancer-predisposing syndrome; Von VHL Hippel -Lindau syndrome
[2018] VHL, Familial erythrocytosis-2; Hereditary cancer-predisposing syndrome;
[2019] LGC107303340 Papillary renal cell carcinoma-1; Von Hippel -Lindau syndrome
[2020] VIM, VIM-AS1 Cataract-30; Congenital cataract
[2021] VIPAS39 Arthrogryposis, renal dysfunction, and cholestasis-2
[2022] VPS13A Choreoacanthocy tosi s
[2023] Abnormality of the eye; Cohen syndrome; Inborn genetic diseases;
[2024] Intellectual disability; Microcephaly; Neutropenia; Progressive visual loss; Recurrent aphthous stomatitis; Retinal dystrophy; Short foot; Short stature; VPS13B Small hand
[2025] Arthrogryposis, renal dysfunction, and cholestasis- 1; Inborn genetic VPS33B diseases
[2026] Complementation group A Fanconi anemia; Complementation group L VRK2, FANCL Fanconi anemia
[2027] VWF von Willebrand disorder
[2028] WAC Desanto-Shinawi syndrome
[2029] Wiskott-Aldrich syndrome; X-linked severe congenital neutropenia; X- WAS linked thrombocytopenia with normal platelets
[2030] Cranioectodermal dysplasia; Cranioectodermal dysplasia-2; Jeune thoracic
[2031]
[2032] WDR35 dystrophy; Short-rib thoracic dysplasia-7 without polydactyly; Short ribpolydactyly syndrome; Short rib polydactyly syndrome-5; Digenic short-rib thoracic dysplasia-7 / 20 with polydactyly; WDR35-related disorders Neurodegeneration with brain iron accumulation; Neurodegeneration with WDR45 brain iron accumulation-5
[2033] WDR72 Amelogenesis imperfecta
[2034] WDR73 Galloway -Mowat syndrome- 1
[2035] WEE2-AS1,
[2036] WEE2 Oocyte maturation defect-5
[2037] Autosomal dominant nonsyndromic deafness-6; Diabetes mellitus and insipidus with optic atrophy and deafness; WFSl-related spectrum WFS1 disorders; Wolfram-like syndrome
[2038] Autosomal recessive deafness-31; Rare genetic deafness; Usher syndrome WHRN type 2D
[2039] WRN Medulloblastoma; Werner syndrome
[2040] Drash syndrome; Frasier syndrome; Wilms tumor, aniridia, genitourinary WT1 anomalies, and mental retardation syndrome; Wilms tumor-1
[2041] Drash syndrome; Frasier syndrome; Pre-B-cell acute lymphoblastic WT1, leukemia; Wilms tumor, aniridia, genitourinary anomalies, and mental LOG 107982234 retardation syndrome; Wilms tumor- 1
[2042] XDH Deficiency of xanthine oxidase
[2043] XIAP X-linked lymphoproliferative syndrome-2
[2044] XK McLeod neuroacanthocytosis syndrome
[2045] XPA Xeroderma pigmentosum; Xeroderma pigmentosum group A
[2046] XPC Xeroderma pigmentosum group C
[2047] Complementation group U Fanconi anemia; Hereditary cancer syndrome; Hereditary breast and ovarian cancer syndrome; Hereditary cancerXRCC2 predisposing syndrome; Ovarian neoplasms
[2048] XRCC4 Short stature, microcephaly, and endocrine dysfunction
[2049] XYLT1 Desbuquois dysplasia-2
[2050] XYLT1,
[2051] LOG 102723692 Desbuquois dysplasia-2
[2052] XYLT2 Inborn genetic diseases; Autosomal recessive spondyloocular syndrome YY1AP1 Grange syndrome
[2053] ZBTB18 Autosomal dominant mental retardation-22
[2054] ZDBF2 Nasopalpebral lipoma-coloboma syndrome
[2055] ZEB2 Mowat-Wilson syndrome
[2056] ZFYVE26 Hereditary spastic paraplegia- 15; Spastic paraplegia
[2057] ZFYVE26, Abnormality of the eye; Leber congenital amaurosis-13; RDH12-related RDH12 disorders; Retinal dystrophy; Retinitis pigmentosa
[2058] Lethal tight skin contracture syndrome; Mandibuloacral dysplasia with type ZMPSTE24 B lipodystrophy; ZMPSTE24 -related disorders
[2059] ZNF408 Retinitis pigmentosa-72
[2060]
[2061] ZNF462 Craniosynostosis; Mental retardation; Weiss-Kruszka syndromeZNF711 ZNF711 -related X-linked mental retardation
[2062] ZP1 Oocyte maturation defect- 1
[2063]
[2064] ZP2 Oocyte maturation defect-6
[2065] In an embodiment, the disease or disorder associated with a PTC is a lysosomal storage disease (e.g., Fabry disease, Gaucher disease, or Niemann-Pick disease). In some embodiments, the disease or disorder associated with a PTC is Fabry disease. In an embodiment, upon administration of a TREM e.g., a TREM described herein) to a cell or subject, the level of a GLA protein in the cell or subject is modulated, e.g., increased, by about 0.1%, 0.5%, 1%, 2%, 3%, 4% 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, e.g., compared with a reference value (e.g., level of a GLA protein in a healthy, non-Fabry disease fibroblast).
[2066] In some embodiments, the disease or disorder associated with a PTC is a blood clotting disorder, e.g., Hemophilia B. In an embodiment, upon administration of a TREM (e.g., a TREM described herein) to a cell or subject, the level of a Factor IX (FIX) protein in the cell or subject is modulated, e.g., increased, by about 0.1%, 0.5%, 1%, 2%, 3%, 4% 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, e.g., compared with a reference value (e.g., level of a FIX protein in a healthy, non-disease cell).
[2067] In some embodiments, the disease or disorder associated with a PTC is an autosomal recessive disorder, such as neuronal ceroid lipofuscinosis type 2 (CNL2). In an embodiment, upon administration of a TREM (e.g., a TREM described herein) to a cell or subject, the level of a tripeptidyl peptidase 1 (TPP1) protein in the cell or subject is modulated, e.g., increased, by about 0.1%, 0.5%, 1%, 2%, 3%, 4% 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more, e.g., compared with a reference value (e.g., level of a TPP1 protein in a healthy, non-disease cell).
[2068] In some embodiments, the disease or disorder associated with a PTC is a disease or disorder associated with hearing loss, such as Usher syndrome (e.g., Usher syndrome type IF). In an embodiment, upon administration of a TREM (e.g., a TREM described herein) to a cell or subject, the level of a protocadherin 15 precursor (PCDH15) protein in the cell or subject is modulated, e.g., increased, by about 0.1%, 0.5%, 1%, 2%, 3%, 4% 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%,95%, or more, e.g, compared with a reference value (e.g., level of a PCDH15 protein in a healthy, non-disease cell).
[2069] In an embodiment, the disease or disorder associated with a PTC is a proliferative disease, such as a benign neoplasm or a cancer. In an embodiment, the proliferative disease is associated with a benign neoplasm. For example, a benign neoplasm may include adenoma, fibroma, hemangioma, tuberous sclerosis, and lipoma. All types of benign neoplasms disclosed herein or known in the art are contemplated as being within the scope of the disclosure.
[2070] In an embodiment, the proliferative disease is a cancer. As used herein, the term “cancer” refers to a malignant neoplasm (Stedman’s Medical Dictionary, 25th ed.; Hensyl ed.; Williams & Wilkins: Philadelphia, 1990). All types of cancers disclosed herein or known in the art are contemplated as being within the scope of the disclosure. Exemplary cancers include, but are not limited to, acoustic neuroma; adenocarcinoma; adrenal gland cancer; anal cancer; angiosarcoma (e.g., lymphangiosarcoma, lymphangioendotheliosarcoma, hemangiosarcoma); appendix cancer; benign monoclonal gammopathy; biliary cancer (e.g., cholangiocarcinoma); bladder cancer; breast cancer (e.g., adenocarcinoma of the breast, papillary carcinoma of the breast, mammary cancer, medullary carcinoma of the breast); brain cancer (e.g., meningioma, glioblastomas, glioma (e.g., astrocytoma, oligodendroglioma), medulloblastoma); bronchus cancer; carcinoid tumor; cervical cancer (e.g., cervical adenocarcinoma); choriocarcinoma; chordoma; craniopharyngioma; colorectal cancer (e.g., colon cancer, rectal cancer, colorectal adenocarcinoma); connective tissue cancer; epithelial carcinoma; ependymoma; endotheliosarcoma (e.g., Kaposi’s sarcoma, multiple idiopathic hemorrhagic sarcoma); endometrial cancer (e.g., uterine cancer, uterine sarcoma); esophageal cancer (e.g., adenocarcinoma of the esophagus, Barrett’s adenocarcinoma); Ewing’s sarcoma; eye cancer (e.g., intraocular melanoma, retinoblastoma); familiar hypereosinophilia; gall bladder cancer; gastric cancer (e.g., stomach adenocarcinoma); gastrointestinal stromal tumor (GIST); germ cell cancer; head and neck cancer (e.g., head and neck squamous cell carcinoma, oral cancer (e.g., oral squamous cell carcinoma), throat cancer (e.g., laryngeal cancer, pharyngeal cancer, nasopharyngeal cancer, oropharyngeal cancer), e.g., adenoid cystic carcinoma (ACC)); hematopoietic cancers (e.g., leukemia such as acute lymphocytic leukemia (ALL) (e.g., B-cell ALL, T-cell ALL), acute myelocytic leukemia (AML) (e.g., B-cell AML, T-cell AML), chronic myelocytic leukemia (CML) (e.g., B-cell CML, T-cell CML), and chronic lymphocytic leukemia(CLL) (e.g., B-cell CLL, T-cell CLL)); lymphoma such as Hodgkin lymphoma (HL) (e.g., B-cell HL, T-cell HL) and non-Hodgkin lymphoma (NHL) (e.g., B-cell NHL such as diffuse large cell lymphoma (DLCL) (e.g, diffuse large B-cell lymphoma), follicular lymphoma, chronic lymphocytic leukemia / small lymphocytic lymphoma (CLL / SLL), mantle cell lymphoma (MCL), marginal zone B-cell lymphomas (e.g., mucosa-associated lymphoid tissue (MALT) lymphomas, nodal marginal zone B-cell lymphoma, splenic marginal zone B-cell lymphoma), primary mediastinal B-cell lymphoma, Burkitt lymphoma, lymphoplasmacytic lymphoma (i.e., Waldenstrom’s macroglobulinemia), hairy cell leukemia (HCL), immunoblastic large cell lymphoma, precursor B-lymphoblastic lymphoma and primary central nervous system (CNS) lymphoma; and T-cell NHL such as precursor T-lymphoblastic lymphoma / leukemia, peripheral T-cell lymphoma (PTCL) (e.g., cutaneous T-cell lymphoma (CTCL) (e.g., mycosis fungoides, Sezary syndrome), angioimmunoblastic T-cell lymphoma, extranodal natural killer T-cell lymphoma, enteropathy type T-cell lymphoma, subcutaneous panniculitis-like T-cell lymphoma, and anaplastic large cell lymphoma); a mixture of one or more leukemia / lymphoma as described above; and multiple myeloma (MM)), heavy chain disease (e.g., alpha chain disease, gamma chain disease, mu chain disease); hemangioblastoma; hypopharynx cancer; inflammatory myofibroblastic tumors; immunocytic amyloidosis; kidney cancer (e.g., nephroblastoma a.k.a. Wilms’ tumor, renal cell carcinoma); liver cancer (e.g., hepatocellular cancer (HCC), malignant hepatoma); lung cancer (e.g, bronchogenic carcinoma, small cell lung cancer (SCLC), non-small cell lung cancer (NSCLC), adenocarcinoma of the lung); leiomyosarcoma (LMS); mastocytosis (e.g., systemic mastocytosis); muscle cancer; myelodysplastic syndrome (MDS); mesothelioma; myeloproliferative disorder (MPD) (e.g, polycythemia vera (PV), essential thrombocytosis (ET), agnogenic myeloid metaplasia (AMM) a.k.a. myelofibrosis (MF), chronic idiopathic myelofibrosis, chronic myelocytic leukemia (CML), chronic neutrophilic leukemia (CNL), hypereosinophilic syndrome (HES)); neuroblastoma; neurofibroma (e.g, neurofibromatosis (NF) type 1 or type 2, schwannomatosis); neuroendocrine cancer (e.g, gastroenteropancreatic neuroendocrine tumor (GEP-NET), carcinoid tumor); osteosarcoma (e.g., bone cancer); ovarian cancer (e.g, cystadenocarcinoma, ovarian embryonal carcinoma, ovarian adenocarcinoma); papillary adenocarcinoma; pancreatic cancer (e.g., pancreatic adenocarcinoma, intraductal papillary mucinous neoplasm (IPMN), Islet cell tumors); penile cancer (e.g, Paget’s disease of the penis and scrotum); pinealoma; primitive neuroectodermal tumor (PNT); plasma cellneoplasia; paraneoplastic syndromes; intraepithelial neoplasms; prostate cancer (e.g, prostate adenocarcinoma); rectal cancer; rhabdomyosarcoma; salivary gland cancer; skin cancer (e.g., squamous cell carcinoma (SCC), keratoacanthoma (KA), melanoma, basal cell carcinoma (BCC)); small bowel cancer (e.g., appendix cancer); soft tissue sarcoma (e.g., malignant fibrous histiocytoma (MFH), liposarcoma, malignant peripheral nerve sheath tumor (MPNST), chondrosarcoma, fibrosarcoma, myxosarcoma); sebaceous gland carcinoma; small intestine cancer; sweat gland carcinoma; synovioma; testicular cancer (e.g., seminoma, testicular embryonal carcinoma); thyroid cancer (e.g., papillary carcinoma of the thyroid, papillary thyroid carcinoma (PTC), medullary thyroid cancer); urethral cancer; vaginal cancer; and vulvar cancer (e.g., Paget’s disease of the vulva). In some embodiments, the cancer is a solid tumor, such as a sarcoma or a carcinoma (e.g., lung cancer, brain cancer, breast cancer, bladder cancer, prostate cancer, colon cancer, rectal cancer).
[2071] In another aspect, the present disclosure features methods of treating a disease or disorder in a cell or subject by administration of a TREM (e.g., a TREM described herein) to the cell or subject. Exemplary diseases or disorders include hemophilias, aminoacidopathies, metal storage disorders, peroxisome biogenesis disorder, progressive rare lung disease, diseases related to lipid metabolism, diseases related to galactose metabolism, systemic organic acidemias, urea cycle disorders, cholestastis disorders, bilirubin metabolism disorders, lysososomal storage disorders, glycogen storage diseases, and oxalate metabolism disorders. In an embodiment, the disease or disorder is a hemophilia, e.g., hemophilia A or hemophilia B. In an embodiment, the disease or disorder is an aminoacidopathy, e.g., tyrosinemia type 1, tyrosinemia type 2, tyrosinemia type 3, maple syrup urine disease, alkaptonuria, or phenylketonuria. In an embodiment, the disease or disorder is a systemic organic acidemia, e.g., methylmalonic acidemia (MMUT), methylmalonic acidemia (non-MMUT), propionic acidemia type A, propionic acidemia type B, or isovaleric acidemia. In an embodiment, the disease or disorder is a urea cycle disorder, e.g, argininosuccinate lyase deficiency, argininosuccinate lyase deficiency-D, citrullinemia type 1, citrullinemia type 2, carbamoyl phosphate synthetase-D, ornithine transcarbamylase, arginemia, or hyperomithinemia-hyperammonemia-homocitrullinuria (HUH) syndrome. In an embodiment, the disease or disorder is lysosomal storage disorder, e.g., mucopolysaccharidosis 1, mucopolysaccharidosis 2, Fabry disease, lysosomal acid lipase deficiency, Pompe disease, Gaucher disease, Niemann Pick A, or Niemann Pick B. In an embodiment, the disease ordisorder is a bilirubin metabolism disorder, e.g., Crigler-Najjar syndrome. In an embodiment, the disease or disorder is a cholestastis disorder, e.g., progressive familial intrahepatic cholestasis (PFIC) type 1, PFIC type 2, or PFIC type 3. In an embodiment, the disease or disorder is a disease related to lipid metabolism, e.g., sitosterolemia (ABCG5) or sitosterolemia (ABCG8). In an embodiment, the disease or disorder is a glycogen storage disease, e.g., glycogen storage disease la, glycogen storage disease lb, or glycogen storage disease 3a. In an embodiment, the disease or disorder is a metal storage disorder, e.g., Wilson disease or hereditary hemochromatosis. In an embodiment, the disease or disorder is a progressive rare lung disease, e.g., alpha- 1 antitrypsin deficiency. In an embodiment, the disease or disorder is a peroxisome biogenesis disorder, e.g., PBD RCDP1. In an embodiment, the disease or disorder is an oxalate metabolism disorder, e.g, primary hyperoxaluria type 1, primary hyperoxaluria type 2, or primary hyperoxaluria type 3. In an embodiment, the disease or disorder is a congenital disorder related to Notch signaling, e.g., Alagille syndrome. In an embodiment, the disease or disorder is an amyloidosis, e.g., familial amyloid polyneuropathy. In an embodiment, the disease or disorder is a neurodevelopment disorder, e.g., Rett syndrome, atypical Rett syndrome, Smith-Magenis syndrome. In an embodiment, the disease or disorder is a muscular dystrophy, e.g., Duchenne muscular dystrophy, congenital muscular dystrophy, Limb-girdle muscular dystrophy.
[2072] In one aspect, the present disclosure features a method of treating a disease or disorder in a subject, the method comprising administering to the subject a TREM comprising the nucleotide sequence of any one of the TREMs described herein. In an embodiment, the disease or disorder is selected from a hemophilia, aminoacidopathy, metal storage disorder, peroxisome biogenesis disorder, progressive rare lung disease, disease related to lipid metabolism, disease related to galactose metabolism, systemic organic acidemia, urea cycle disorder, cholestastis disorder, bilirubin metabolism disorder, lysososomal storage disorder, glycogen storage disease, and oxalate metabolism disorder. In an embodiment, the TREM comprises the sequence of any one of SEQ ID NO: 1 or 2, or a fragment or variant thereof.
[2073] A TREM described herein may read-through a premature termination codon (PTC) in the open reading frame of a gene, resulting in an increase in levels of the protein encoded by gene, e.g., a full-length protein, e.g., a functional protein. For example, a TREM having the sequence of SEQ ID NO: 2 or SEQ ID NO: 3 may increase production of a full-length protein comprising a PTC.In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, can increase production of a full-length protein encoded by an ORF comprising a PTC, e.g., a full-length p53 protein encoded by an ORF comprising a PTC. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length p53 relative to full-length p53 levels present in the absence of the TREM, e.g., SEQ ID NO: 2, as shown in FIG. 1A. In an embodiment, a TREM, e.g., SEQ ID NO: 3, can increase production of full-length p53 to be about 0.25, about 0.5, or about 2 relative to wildtype p53 levels, e.g., as shown in FIG. IB. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length p53 to be about 0.25, about 2, about 4, about 6, or about 6.5 relative to wildtype p53 levels, e.g., as shown in FIG. IB.
[2074] In an embodiment, the increase in production of a full-length protein encoded by an ORF comprising a PTC results in an increase in levels of a downstream target of the protein encoded by an ORF comprising the PTC, e.g., increases levels of a functional full-length protein encoded by an ORF comprising a PTC. For example, an increase in levels of full-length p53 by a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, may result in an increase in levels of the downstream target of p53, e.g., p21. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase levels of p21 relative to p21 levels in the absence of the TREM, e.g., as shown in FIG. 1C. In an embodiment, a TREM, e.g., SEQ ID NO: 3, can increase levels of p21 to be about 1 or about 4 relative to wildtype p21 levels, e.g., as shown in FIG. ID. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase levels of p21 to be about 1, about 2.5, about 9, or about 12.5 relative to wildtype p21 levels, e.g., as shown in FIG. ID.
[2075] In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, can increase production of a full-length protein encoded by an ORF comprising a PTC, e.g., a full-length phenylalanine hydroxylate (PAH) protein encoded by an ORF comprising a PTC. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length PAH relative to full-length PAH levels in the absence of the TREM, e.g., SEQ ID NO: 2, as shown in FIG. 2A. In an embodiment, a TREM, e.g., SEQ ID NO: 3, can increase production of full-length PAH to be about 2.5 or about 7.5 relative to wildtype PAH levels, e.g., as shown in FIG. 2B. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length PAH to be about 2, about 4, about 9, about 19, or about 20 relative to wildtype PAH levels, e.g., as shown in FIG. 2B.In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, can increase production of a full-length protein encoded by an ORF comprising a PTC, e.g., a full-length methyl malonyl CoA mutase (MMUT) protein encoded by an ORF comprising a PTC. In an embodiment, a TREM, e.g., SEQ ID NO: 3, can increase production of full-length MMUT relative to full-length MMUT levels in the absence of the TREM, e.g., SEQ ID NO: 3, as shown in FIG. 3 A. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length MMUT relative to full-length MMUT levels in the absence of the TREM, e.g., SEQ ID NO: 2, as shown in FIGs. 3 A and 3C. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length MMUT to be about 0.25%, about 0.3%, about 0.5%, about 1%, about 1.5%, about 2.5%, about 3%, or about 3.5% relative to wildtype MMUT levels, e.g., as shown in FIG. 3B. In an embodiment, a TREM, e.g., SEQ ID NO: 2, can increase production of full-length MMUT to be about 1.5% or about 3% relative to full-length MMUT levels in the absence of the TREM, e.g., SEQ ID NO: 2, e.g., as shown in FIG. 3C.
[2076] In an embodiment, the increase in production of a full-length protein encoded by an ORF comprising a PTC results in a decrease in levels of a metabolite of the protein encoded by an ORF comprising the PTC, e.g., increases levels of a functional full-length protein encoded by an ORF comprising a PTC. For example, an increase in levels of full-length MMUT by a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, may result in a decrease in levels of a metabolite of MMUT, e.g., methylmalonic acid (MMA). In an embodiment, a TREM, e.g., SEQ ID NO: 2, can decrease levels of MMA to be about 50% or about 60% relative to MMA levels in the absence of the TREM, e.g., SEQ ID NO: 2, e.g., as shown in FIG. 3C.
[2077] In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, delivered to a subject in a lipid nanoparticle (LNP) can be detected in the liver of the subject. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in an LNP to a subject results in about 4xl0'14mol / mg of TREM, e.g., SEQ ID NO: 3, in the liver of the subject after 96 hours, e.g., as shown in FIG.
[2078] 4A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject results in about 8xl0'14mol / mg of TREM, e.g., SEQ ID NO: 2, in the liver of the subject after 96 hours, e.g., as shown in FIG. 4A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject results in about 2xl0’14mol / mg of TREM, e.g., SEQ ID NO: 2, in the liver of the subject after 336 hours, e.g., as shown in FIG. 4 A.In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, delivered to a subject in a lipid nanoparticle (LNP) can increase levels of full-length messenger RNA (mRNA) transcribed from an ORF comprising a PTC, e.g., full-length methyl malonyl CoA mutase (MMUT) mRNA encoded by an ORF comprising a PTC. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT mRNA levels relative to full-length MMUT mRNA levels in the absence of the TREM after 96 hours, e.g., as shown in FIG. 5. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT mRNA levels relative to full-length MMUT mRNA levels in the absence of the TREM after 96 or 336 hours, e.g., as shown in FIG. 5. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT mRNA levels to be about 1.5 times greater than full-length MMUT mRNA levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 5. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT mRNA levels to be about 3 times greater than full-length MMUT mRNA levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 5.
[2079] In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, delivered to a subject in a lipid nanoparticle (LNP) can increase levels of a full-length protein encoded by an ORF comprising a PTC, e.g., full-length methyl malonyl CoA mutase (MMUT) encoded by an ORF comprising a PTC. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT levels relative to full-length MMUT levels in the absence of the TREM after 96 hours, e.g., as shown in FIG. 6. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT levels relative to full-length MMUT levels in the absence of the TREM after 96 or 336 hours, e.g., as shown in FIG. 6. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT levels to be about equal to full-length MMUT levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 6. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase full-length MMUT levels to be about 7times greater than full-length MMUT levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 6.
[2080] In an embodiment, a TREM, e.g., SEQ ID NO: 2 or SEQ ID NO: 3, delivered to a subject in a lipid nanoparticle (LNP) can increase ribosome occupancy on full-length mRNA encoded by an ORF comprising a PTC, e.g., increase ribosome occupancy on full-length methyl malonyl CoA mutase (MMUT) mRNA encoded by an ORF comprising a PTC. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in an LNP to a subject having an MMUT ORF comprising a PTC can increase ribosome occupancy on full-length MMUT mRNA relative to ribosome occupancy on full-length MMUT mRNA in the absence of the TREM after 96 hours, e.g., as shown in FIG. 7. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase ribosome occupancy on full-length MMUT mRNA relative to ribosome occupancy on full-length MMUT mRNA in the absence of the TREM after 96 or 336 hours, e.g., as shown in FIG. 7. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in an LNP to a subject having an MMUT ORF comprising a PTC can increase ribosome occupancy on full-length MMUT mRNA to be about 20 RPKM after 96 hours, e.g., as shown in FIG. 7. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase ribosome occupancy on full-length MMUT mRNA to be about 70 RPKM after 96 hours, e.g., as shown in FIG. 7. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC can increase ribosome occupancy on full-length MMUT mRNA to be about 20 RPKM after 336 hours, e.g., as shown in FIG. 7.
[2081] In an embodiment, the ratio of ionizable lipid, e.g., cationic lipid, to RNA phosphate (N / P ratio) of an LNP can modulate the activity of a TREM delivered to a subject in the LNP. For example, the levels of full-length mRNA encoded by an ORF comprising a PTC, e.g., full-length methyl malonyl CoA mutase (MMUT) mRNA encoded by an ORF comprising a PTC, can be modulated by the N / P ratio of an LNP comprising the TREM. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP having an N / P ratio of 6 to a subject having an MMUT ORF comprising a PTC can result in full-length MMUT mRNA levels about 2 times greater than full-length MMUT mRNA levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 8. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP having an N / P ratio of 6 to a subject having an MMUT ORF comprising a PTC can result infull-length MMUT mRNA levels about equal to full-length MMUT mRNA levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 8. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP having an N / P ratio of 3 to a subject having an MMUT ORF comprising a PTC can result in full-length MMUT mRNA levels about 1.3 times greater than full-length MMUT mRNA levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 8. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP having an N / P ratio of 3 to a subject having an MMUT ORF comprising a PTC can result in full-length MMUT mRNA levels about equal to full-length MMUT mRNA levels resulting from delivery of a different TREM, e.g., SEQ ID NO: 3, e.g., as shown in FIG. 8.
[2082] In an embodiment, the ratio of ionizable lipid, e.g., cationic lipid, to RNA phosphate (N / P ratio) of an LNP comprising a TREM does not affect the levels of the TREM in the liver of a subject following delivery of the TREM in the LNP to the subject. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP1 having an N / P ratio of 3 can result in TREM levels of about 0.8 to about 10 pg / g in the liver of the subject, e.g., as shown in FIG. 9. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP1 having an N / P ratio of 4.5 can result in TREM levels of about 2 to about 80 pg / g in the liver of the subject, e.g., as shown in FIG. 9. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP2 having an N / P ratio of 3 can result in TREM levels of about 1 to about 70 pg / g in the liver of the subject, e.g., as shown in FIG. 9. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP2 having an N / P ratio of 4.5 can result in TREM levels of about 0.5 to about 10 pg / g in the liver of the subject, e.g., as shown in FIG. 9. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP2 having an N / P ratio of 6 can result in TREM levels of about 2 to about 20 pg / g in the liver of the subject, e.g., as shown in FIG. 9.
[2083] In an embodiment, the ratio of ionizable lipid, e.g., cationic lipid, to RNA phosphate (N / P ratio) of an LNP comprising a TREM does not affect the total amount of TREM in the liver of a subject over time, e.g., the area under the curve (AUC) of the amount of TREM over time, following delivery of the TREM in an LNP to the subject. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP1 having an N / P ratio of 3 can result in an AUC of TREM from 0-72 hours in the liver of a subject of about 220 hr*pg / g, e.g., as shown in FIG. 10. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP1 having an N / P ratio of 4.5 can result in an AUC of TREM from 0-72 hours in the liver of a subject of about 360 hr* pg / g, e.g.,as shown in FTG. 10. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP2 having an N / P ratio of 3 can result in an AUC of TREM from 0-72 hours in the liver of a subject of about 210 hr*pg / g, e.g., as shown in FIG. 10. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP2 having an N / P ratio of 4.5 can result in an AUC of TREM from 0-72 hours in the liver of a subject of about 100 hr*pg / g, e.g., as shown in FIG. 10. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 3, in LNP2 having an N / P ratio of 6 can result in an AUC of TREM from 0-72 hours in the liver of a subject of about 230 hr*pg / g, e.g., as shown in FIG.
[2084] 10.
[2085] In an embodiment, a TREM, e.g., SEQ ID NO: 2, delivered to a subject in a lipid nanoparticle (LNP) increases levels of a protein encoded by an ORF comprising a PTC, e.g., phenylalanine hydroxylase (PAH) encoded by an ORF comprising a PTC. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC increases PAH levels relative to PAH levels in the absence of the TREM after 24-240 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 1 mg / kg increases PAH levels to about 1%, e.g., relative to wildtype levels, e.g., after 24 hours, e.g., as shown in FIG. 15A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 3 mg / kg increases PAH levels to about 1%, e.g., relative to wildtype levels, e.g., after 72 hours, e.g., as shown in FIG. 15A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 3 mg / kg increases PAH levels to about 5%, e.g., relative to wildtype levels, e.g., after 24 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 3 mg / kg increases PAH levels to about 4%, e.g., relative to wildtype levels, e.g., after 72 hours, e.g., as shown in FIG. 15A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 3 mg / kg increases PAH levels to about 2.5%, e.g., relative to wildtype levels, e.g., after 96 hours, e.g., as shown in FIG. 15A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 3 mg / kg increases PAH levels to about 1.5%, e.g., relative to wildtype levels, e.g., after 168 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAHORF comprising a PTC at a dose of 10 mg / kg increases PAH levels to about 5%, e.g., relative to wildtype levels, e.g., after 24 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 10 mg / kg increases PAH levels to about 7.5%, e.g., relative to wildtype levels, e.g., after 72 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 10 mg / kg increases PAH levels to about 6%, e.g., relative to wildtype levels, e.g., after 96 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 10 mg / kg increases PAH levels to about 4%, e.g., relative to wildtype levels, e.g., after 168 hours, e.g., as shown in FIG. 15 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having a PAH ORF comprising a PTC at a dose of 10 mg / kg increases PAH levels to about 3%, e.g., relative to wildtype levels, e.g., after 240 hours, e.g., as shown in FIG. 15 A.
[2086] In an embodiment, a TREM, e.g., SEQ ID NO: 2, delivered to a subject having phenylketonuria (PKU) in a lipid nanoparticle (LNP) decreases plasma phenylalanine levels. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU decreases plasma phenylalanine levels after 8-240 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 1 mg / kg decreases plasma phenylalanine levels to about 1,500 pM, e.g., after 8 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 1 mg / kg decreases plasma phenylalanine levels to about 1,700 pM, e.g., after 24 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 1 mg / kg decreases plasma phenylalanine levels to about 1,800 pM, e.g., after 72 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 3 mg / kg decreases plasma phenylalanine levels to about 1,400 pM, e.g., after 8 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 3 mg / kg decreases plasma phenylalanine levels to about 700 pM, e.g., after 24 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 3 mg / kg decreases plasma phenylalanine levels to about 600 pM, e.g., after 48 hours, e.g., as shown in FIG. 15B. Inan embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 3 mg / kg decreases plasma phenylalanine levels to about 500 pM, e.g., after 72 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 3 mg / kg decreases plasma phenylalanine levels to about 900 pM, e.g., after 96 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 3 mg / kg decreases plasma phenylalanine levels to about 1,800 pM, e.g., after 168 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 10 mg / kg decreases plasma phenylalanine levels to about 1,700 pM, e.g., after 8 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 10 mg / kg decreases plasma phenylalanine levels to about 1,000 pM, e.g., after 24 hours, e.g., as shown in FIG. 1 B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 10 mg / kg decreases plasma phenylalanine levels to about 300 pM, e.g., after 72 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 10 mg / kg decreases plasma phenylalanine levels to about 150 pM, e.g., after 96 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 10 mg / kg decreases plasma phenylalanine levels to about 800 pM, e.g., after 168 hours, e.g., as shown in FIG. 15B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having PKU at a dose of 10 mg / kg decreases plasma phenylalanine levels to about 1,200 pM, e.g., after 240 hours, e.g., as shown in FIG. 15B.
[2087] In an embodiment, a TREM, e.g., SEQ ID NO: 2, delivered to a subject in a lipid nanoparticle (LNP) increases levels of a protein encoded by an ORF comprising a PTC, e.g., methyl malonyl CoA mutase (MMUT) encoded by an ORF comprising a PTC. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC increases MMUT levels relative to MMUT levels in the absence of the TREM after 4-21 days, e.g., as shown in FIG. 16 A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 1 mg / kg increases MMUT levels to about 5%, e.g., relative to wildtype levels, e.g., after 4 days, e.g., as shown in FIG. 16A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in anLNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases MMUT levels to about 37%, e.g., relative to wildtype levels, e.g., after 4 days, e.g., as shown in FIG. 16A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases MMUT levels to about 8%, e.g., relative to wildtype levels, e.g., after 14 days, e.g., as shown in FIG. 16A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases MMUT levels to about 35%, e.g., relative to wildtype levels, e.g., after 4 days, e.g., as shown in FIG. 16A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases MMUT levels to about 25%, e.g., relative to wildtype levels, e.g., after 14 days, e.g., as shown in FIG. 16A. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases MMUT levels to about 5%, e.g., relative to wildtype levels, e.g., after 21 days, e.g., as shown in FIG. 16A.
[2088] In an embodiment, a TREM, e.g., SEQ ID NO: 2, delivered to a subject in a lipid nanoparticle (LNP) increases ribosome occupancy on mRNA encoded by an ORF comprising a PTC, e.g., increase ribosome occupancy on methyl malonyl CoA mutase (MMUT) mRNA encoded by an ORF comprising a PTC. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC increases ribosome occupancy on full-length MMUT mRNA relative to ribosome occupancy on MMUT mRNA in the absence of the TREM after 1 to 28 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases ribosome occupancy on MMUT mRNA to about 125 RPKM, e.g., after 1 day, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases ribosome occupancy on MMUT mRNA to about 85 RPKM, e.g., after 2 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases ribosome occupancy on MMUT mRNA to about 80 RPKM, e.g., after 4 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases ribosomeoccupancy on MMUT mRNA to about 25 RPKM, e.g., after 14 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 3 mg / kg increases ribosome occupancy on MMUT mRNA to about 10 RPKM, e.g., after 21 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases ribosome occupancy on MMUT mRNA to about 90 RPKM, e.g., after 1 day, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases ribosome occupancy on MMUT mRNA to about 80 RPKM, e.g., after 2 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases ribosome occupancy on MMUT mRNA to about 95 RPKM, e.g., after 4 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases ribosome occupancy on MMUT mRNA to about 30 RPKM, e.g,. after 14 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases ribosome occupancy on MMUT mRNA to about 10 RPKM, e.g., after 21 days, e.g., as shown in FIG. 16B. In an embodiment, delivery of a TREM, e.g., SEQ ID NO: 2, in an LNP to a subject having an MMUT ORF comprising a PTC at a dose of 10 mg / kg increases ribosome occupancy on MMUT mRNA to about 5 RPKM, e.g., after 28 days, e.g., as shown in FIG. 16B.
[2089] In one aspect, a TREM has pharmacokinetic characteristics, e.g., plasma concentration, liver concentration, half-life, or area under the curve (AUC), upon administration to a subject. In an embodiment, the TREM has a plasma concentration between about 0.1 pg / mL and about 1 pg / mL, e.g., at 0.25 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18A. In an embodiment, the TREM has a plasma concentration between about 0.1 pg / mL and about 1 pg / mL, e.g., at 0.5 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18A. In an embodiment, the TREM has a plasma concentration between about 0.1 pg / mL and about 1 pg / mL, e.g., at 1 hour post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18 A. In an embodiment, the TREM has a plasma concentration between about 0.01 pg / mL and about 0.1 pg / mL, e.g., at 4 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18 A. In anembodiment, the TREM has a plasma concentration between about 0.01 pg / mL and about 0.1 pg / mL, e.g., at 6 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18 A. In an embodiment, the TREM has a plasma concentration between about 0.001 pg / mL and about 0.01 pg / mL, e.g., at 24 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18 A. In an embodiment, the TREM has a plasma concentration between about 0.001 pg / mL and about 0.01 pg / mL, e.g., at 48 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18 A. In an embodiment, the TREM has a plasma concentration between about 0.0001 pg / mL and about 0.001 pg / mL, e.g., at 72 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18A. In an embodiment, the TREM has a total liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 1 hour post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a total liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 4 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a total liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 24 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a total liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 168 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a naturally modified liver concentration between about 0.1 pg / g and about 1 pg / g, e.g., at 1 hour post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a naturally modified liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 4 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a naturally modified liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 24 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a naturally modified liver concentration between about 1 pg / g and about 10 pg / g, e.g., at 168 hours post-delivery, e.g., in a mouse, e.g., as shown in FIG. 18B. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 0.25 hours post-delivery, e.g., in a nonhuman primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 0.5 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 10 pg / mL and about 100 pg / mL, e.g., at 1 hour post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 1.5 hours post-delivery, e.g.,in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 2 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 3 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 4 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 1 pg / mL and about 10 pg / mL, e.g., at 8 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 0.1 pg / mL and about 1 pg / mL, e.g., at 14 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 0.1 pg / mL and about 1 pg / mL, e.g., at 24 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a plasma concentration between about 0.1 pg / mL and about 1 pg / mL, e.g., at 48 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18C. In an embodiment, the TREM has a total liver concentration between about 10 pg / g and about 100 pg / g, e.g., at 1 hour post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18D. In an embodiment, the TREM has a total liver concentration between about 0.1 pg / g and about 1 pg / g, e.g., at 25 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18D. In an embodiment, the TREM has a total liver concentration between about 0.01 pg / g and about 0.1 pg / g, e.g., at 73 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18D. In an embodiment, the TREM has a naturally modified liver concentration between about 0.01 pg / g and about 0.1 pg / g, e.g., at 25 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18D. In an embodiment, the TREM has a naturally modified liver concentration between about 0.01 pg / g and about 0.1 pg / g, e.g., at 73 hours post-delivery, e.g., in a non-human primate, e.g., as shown in FIG. 18D. In an embodiment, the TREM has a half-life of between about 20 hours and about 40 hours, e.g., in plasma, e.g., 1 day post-delivery, e.g., in a mouse. In an embodiment, the TREM has a half-life of between about 10 hours and about 30 hours, e.g., in plasma, e.g., 22 days post-delivery, e.g., in a mouse. In an embodiment, the TREM, e.g., naturally modified TREM, has a half-life of between about 50 hours and about 70 hours, e.g., in the liver, e.g., 1 day post-delivery, e.g., in a mouse. In an embodiment, the TREM, e.g., naturally modified TREM,has a half-life of between about 50 hours and about 70 hours, e.g., in the liver, e.g., 22 days postdelivery, e.g., in a mouse. In an embodiment, the TREM, e.g., total TREM, has a half-life of between about 40 hours and about 60 hours, e.g., in the liver, e.g., 1 day post-delivery, e.g., in a mouse. In an embodiment, the TREM, e.g., total TREM, has a half-life of between about 40 hours and about 60 hours, e.g., in the liver, e.g., 22 days post-delivery, e.g., in a mouse. In an embodiment, the TREM has a half-life of between about 1 hour and about 20 hours, e.g., in plasma, e.g., in a non-human primate. In an embodiment, the TREM has a plasma area under the curve (AUCiast) of between about 1 h*pg / mL and about 5 h*pg / mL, e.g., 1 day post-delivery, e.g., in a mouse. In an embodiment, the TREM has a plasma area under the curve (AUCiast) of between about 5 h*pg / mL and about 10 h*pg / mL, e.g., 22 days post-delivery, e.g., in a mouse. In an embodiment, the TREM has a plasma area under the curve (AUCiast) of between about 30 h*pg / mL and about 60 h*pg / mL, e.g., in a non-human primate. In an embodiment, the TREM, e.g., naturally modified TREM, has a liver area under the curve (AUCiast) of between about 120 h*pg / mL and about 140 h*pg / mL, e.g., 1 day post-delivery, e.g., in a mouse. In an embodiment, the TREM, e.g., naturally modified TREM, has a liver area under the curve (AUCiast) of between about 150 h*pg / mL and about 190 h*p.g / mL, e.g., 22 days post-delivery, e.g., in a mouse. In an embodiment, the TREM, e.g., total TREM, has a liver area under the curve (AUCiast) of between about 200 h*pg / mL and about 230 h*pg / mL, e.g., 1 day post-delivery, e.g., in a mouse. In an embodiment, the TREM, e.g., total TREM, has a liver area under the curve (AUCiast) of between about 230 h*pg / mL and about 250 h*pg / mL, e.g., 22 days post-delivery, e.g., in a mouse.
[2090] Method of making TREMs
[2091] In vitro methods for synthesizing TREMs are known in the art and can be used to make a TREM disclosed herein. For example, a TREM can be synthesized using solid state synthesis or liquid phase synthesis.
[2092] In an embodiment, a TREM made according to an in vitro synthesis method disclosed herein has a different modification profile compared to a TREM expressed and isolated from a cell, or compared to a naturally occurring tRNA.
[2093] An exemplary method for making a modified TREM is provided in Example 1.
[2094] Additional synthetic methods are disclosed in Hartsei SA et al., (2005) Oligonucleotide Synthesis, 033-050, the entire contents of which are hereby incorporated by reference.TREM composition
[2095] In an embodiment, a TREM composition, e.g., a TREM pharmaceutical composition, comprises a pharmaceutically acceptable excipient. Exemplary excipients include those provided in the FDA Inactive Ingredient Database (https: / / www.accessdata.fda.gov / scripts / cder / iig / index. Cfm).
[2096] In an embodiment, a TREM composition, e.g., a TREM pharmaceutical composition, comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or 150 grams of TREM. In an embodiment, a TREM composition, e.g., a TREM pharmaceutical composition, comprises at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50 or 100 milligrams of TREM.
[2097] In an embodiment, a TREM composition, e.g., a TREM pharmaceutical composition, is at least 10, 20, 30, 40, 50, 60, 70, 80, 90, 95 or 99% dry weight TREMs.
[2098] In an embodiment, a TREM composition comprises at least 1 x 106TREM molecules, at least 1 x 107TREM molecules, at least 1 x 108TREM molecules or at least 1 x 109TREM molecules.
[2099] In an embodiment, a TREM composition produced by any of the methods of making disclosed herein can be charged with an amino acid using an in vitro charging reaction as known in the art.
[2100] In an embodiment, a TREM composition comprise one or more species of TREMs. In an embodiment, a TREM composition comprises a single species of TREM. In an embodiment, a TREM composition comprises a first TREM species and a second TREM species. In an embodiment, the TREM composition comprises X TREM species, wherein X=2, 3, 4, 5, 6, 7, 8, 9, or 10.
[2101] In an embodiment, the TREM has at least 70, 75, 80, 85, 90, or 95, or has 100%, identity with a sequence encoded by a nucleic acid in Table 3.
[2102] In an embodiment, the TREM comprises a consensus sequence provided herein.
[2103] A TREM composition can be formulated as a liquid composition, as a lyophilized composition or as a frozen composition.
[2104] In some embodiments, a TREM composition can be formulated to be suitable for pharmaceutical use, e.g., a pharmaceutical TREM composition. In an embodiment, apharmaceutical TREM composition is substantially free of materials and / or reagents used to separate and / or purify a TREM.
[2105] In some embodiments, a TREM composition can be formulated with water for injection. In some embodiments, a TREM composition formulated with water for injection is suitable for pharmaceutical use, e.g., comprises a pharmaceutical TREM composition.
[2106] TREM characterization
[2107] A TREM, or a TREM composition, e.g., a pharmaceutical TREM composition, produced by any of the methods disclosed herein can be assessed for a characteristic associated with the TREM or the TREM composition, such as purity, sterility, concentration, structure, or functional activity of the TREM. Any of the above-mentioned characteristics can be evaluated by providing a value for the characteristic, e.g., by evaluating or testing the TREM, or the TREM composition, or an intermediate in the production of the TREM composition. The value can also be compared with a standard or a reference value. Responsive to the evaluation, the TREM composition can be classified, e.g., as ready for release, meets production standard for human trials, complies with ISO standards, complies with cGMP standards, or complies with other pharmaceutical standards. Responsive to the evaluation, the TREM composition can be subjected to further processing, e.g., it can be divided into aliquots, e.g., into single or multi -dosage amounts, disposed in a container, e.g., an end-use vial, packaged, shipped, or put into commerce. In embodiments, in response to the evaluation, one or more of the characteristics can be modulated, processed or reprocessed to optimize the TREM composition. For example, the TREM composition can be modulated, processed or re-processed to (i) increase the purity of the TREM composition; (ii) decrease the amount of fragments in the composition; (iii) decrease the amount of endotoxins in the composition; (iv) increase the in vitro translation activity of the composition; (v) increase the TREM concentration of the composition; or (vi) inactivate or remove any viral contaminants present in the composition, e.g., by reducing the pH of the composition or by filtration.
[2108] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) has a purity of at least 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, i.e., by mass.In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) has less than 0.1%, 0,5%, 1%, 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 15%, 20%, 25% TREM fragments relative to full length TREMs.
[2109] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) has low levels or absence of endotoxins, e.g., a negative result as measured by the Limulus amebocyte lysate (LAL) test.
[2110] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) has in-vitro translation activity, e.g., as measured by an assay described in Examples 12-13.
[2111] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) has a TREM concentration of at least 0.1 ng / mL, 0.5 ng / mL, 1 ng / mL, 5 ng / mL, 10 ng / mL, 50 ng / mL, 0.1 ug / mL, 0.5 ug / mL,l ug / mL, 2 ug / mL, 5 ug / mL, 10 ug / mL, 20 ug / mL, 30 ug / mL, 40 ug / mL, 50 ug / mL, 60 ug / mL, 70 ug / mL, 80 ug / mL, 100 ug / mL, 200 ug / mL, 300 ug / mL, 500 ug / mL, 1000 ug / mL, 5000 ug / mL, 10,000 ug / mL, or 100,000 ug / mL.
[2112] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) is sterile, e.g., the composition or preparation supports the growth of fewer than 100 viable microorganisms as tested under aseptic conditions, the composition or preparation meets the standard of USP <71>, and / or the composition or preparation meets the standard of USP <85>.
[2113] In an embodiment, the TREM (e.g., TREM composition or an intermediate in the production of the TREM composition) has an undetectable level of viral contaminants, e.g., no viral contaminants. In an embodiment, any viral contaminant, e.g., residual virus, present in the composition is inactivated or removed. In an embodiment, any viral contaminant, e.g., residual virus, is inactivated, e.g., by reducing the pH of the composition. In an embodiment, any viral contaminant, e.g., residual virus, is removed, e.g., by filtration or other methods known in the field.
[2114] Lipid Nanoparticles
[2115] Any TREM composition or pharmaceutical composition described herein can be administered to a cell, tissue or subject, e.g., by direct administration to a cell, tissue and / or anorgan in vitro, ex-vivo or in vivo, by administration in a lipid nanoparticle. In-vivo administration may be via, e.g., by local, systemic and / or parenteral routes, for example intravenous, subcutaneous, intraperitoneal, intrathecal, intramuscular, ocular, nasal, urogenital, intradermal, dermal, enteral, intravitreal, intracerebral, intrathecal, or epidural.
[2116] Lipid nanoparticles (LNPs) typically comprise (i) an ionizable lipid (e.g., a cationic lipid); (ii) a neutral lipid; (iii) a pegylated lipid; and (iv) a sterol. Ionizable lipid is included in an LNP to establish an electrostatic interaction with a negatively charged nucleic acid (e.g., an RNA molecule, e.g., a tRNA molecule, e.g., a TREM), allowing for efficient encapsulation and delivery of the nucleic acid. Pegylated lipids serve to stabilize the particle formulation and to protect against immune recognition by the host. Other lipids such as neutral lipids and sterols allow for additional tuning of LNP properties.
[2117] Ionizable Lipid
[2118] The lipid nanoparticles described herein comprise one or more ionizable lipids (e.g., cationic lipids). The formal electronic charge of an ionizable lipid may change with the environmental conditions (e.g., changes in pH). Without wishing to be bound by theory, ionizable lipids (e.g., cationic lipids) may help to ensure both adequate nucleic acid encapsulation and intracellular delivery of the encapsulated nucleic acid in a lipid nanoparticle.
[2119] In some embodiments, the ionizable lipid comprises an amino group (i.e. an ionizable amino lipid). In some embodiments, the ionizable lipid comprises a tertiary amine group.
[2120] In some embodiments, the ionizable lipid is a compound of Formula (I):
[2121]
[2122] (I), wherein R1is alkyl, alkenyl, alkynyl, or heteroalkyl, wherein each of alkyl, alkenyl, alkynyl, and heteroalkyl is optionally substituted by one or more R8; each of R2and R3is independently hydrogen or Ci-Ce alkyl; n is an integer from 1 to 15; X is -C(O)O-, -OC(O) -, -C(O)N(R')-, -N(R’)C(O)-, -C(O)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O)2-, or -S-S-; R4is hydrogen, Ci-Ce alkyl, or Ci-Ce alkenyl; each of R5and R6is independently alkyl or alkenyl, each of which is optionally substituted with one or more R9; R7is alkyl, alkenyl, alkynyl, heteroalkyl, or R’YR”, wherein each of alkyl, alkenyl, alkynyl, and heteroalkyl is optionally substituted by one or more R10; Y is X is -C(O)O-, -OC(O) -, -C(O)N(R')-, -N(R’)C(O)-, -C(0)-, -C(S)-, -C(S)S-, -SC(S)-, -CH(OH)-, -P(O)(OR’)O-, -S(O)2-, or -S-S-; each of R’ and R” is independently alkyl or alkenyl, optionally substituted with one or more R11; each of R8, R9, R10, and R11is independently
[2123] In some embodiments of Formula (I), R1is alkyl or heteroalkyl, each of which is optionally substituted with one or more R8. In some embodiments of Formula (I), R1is heteroalkyl, optionally substituted with one or more R8. In some embodiments of Formula (I), R1is C2-C6 heteroalkyl, optionally substituted with one or more R8. In some embodiments of Formula (I), R1is -CH2CH2OH or -CH2CH2CH2OH.
[2124] In some embodiments of Formula (I), each of R2and R3is independently hydrogen or Ci-C3 alkyl. In some embodiments of Formula (I), each of R2and R3is C1-C3 alkyl. In some embodiments of Formula (I), each of R2and R3is independently hydrogen.
[2125] In some embodiments of Formula (I), each of X and Y is independently -C(O)O-, -OC(O) -, or -C(O)-. In some embodiments of Formula (I), each of X and Y is independently -C(O)-. In some embodiments of Formula (I), X is -C(O)-. In some embodiments of Formula (I), Y is -C(O)-.
[2126] In some embodiments of Formula (I), R4is hydrogen, C1-C3 alkyl, or C2-C3 alkenyl. In some embodiments of Formula (I), R4is hydrogen or C1-C3 alkyl. In some embodiments of Formula (I), R4is C2-C3 alkenyl. In some embodiments of Formula (I), R4is hydrogen.
[2127] In some embodiments of Formula (I), R7is alkyl or R’YR”. In some embodiments of Formula (I), R7is Ci-Ce alkyl or R’YR”. In some embodiments of Formula (I), R7is Ci-Ce alkyl. In some embodiments of Formula (I), R7is R’YR”.
[2128] In some embodiments of Formula (I), R’ is alkyl or alkenyl. In some embodiments of Formula (I), R’ is C1-C10 alkyl, or C2-C10 alkenyl. In some embodiments of Formula (I), R’ is C3-Cs alkyl, or C3-C8 alkenyl. In some embodiments of Formula (I), R’ is C3-C8 alkyl. In some embodiments of Formula (I), R’ is C3-C8 alkenyl.
[2129] In some embodiments of Formula (I), R” is alkyl or alkenyl. In some embodiments of Formula (I), R” is C5-C20 alkyl, or C5-C20 alkenyl. In some embodiments of Formula (I), R” is C7-C12 alkyl, or C7-C 12 alkenyl. In some embodiments of Formul...
Claims
AMENDED CLAIMSreceived by the International Bureau on 16 March 2026 (16.03.2026) CLAIMS1. A lipid nanoparticle (LNP) comprising:(i) 47.5 mol % of Structure 1-45;(ii) 10 mol % of l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC);(iii) 2.5 mol % of Compound 42-6;(iv) 40 mol % cholesterol; and(v) a tRNA-based effector molecule (TREM) comprising the nucleotide sequence selected from of one of SEQ ID NOs: 1-15,wherein the mol % is based on total moles of lipid components in the LNP.
2. The LNP of claim 1, wherein the ratio of (i) to the TREM (N / P ratio) is between 3 to 9.
3. The LNP of any one of claims 1-2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 1.
4. The LNP of any one of claims 1 -2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 2.
5. The LNP of any one of claims 1-2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 3.
6. The LNP of any one of claims 1 -2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 4.
7. The LNP of any one of claims 1-2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 5.
8. The LNP of any one of claims 1-2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 6.
9. The LNP of any one of claims 1-2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 7.
10. The LNP of any one of claims 1-2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 8.
11. The LNP of any one of claims 1 -2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 9.
12. The LNP of any one of claims 1-2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 10.
13. The LNP of any one of claims 1-2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 11.
14. The LNP of any one of claims 1-2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 12.
15. The LNP of any one of claims 1-2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 13.
16. The LNP of any one of claims 1-2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 14.
17. The LNP of any one of claims 1-2, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 15.
18. The LNP of any one of claims 1-17, wherein the LNP is dosed between about 0.5 mg / kg to about 10 mg / kg with respect to the TREM.
19. The LNP of any one of claims 1-18, wherein the LNP has a size of between 50 nm to 100 nm.
20. A composition comprising a tRNA-based effector molecule (TREM) comprising a nucleotide sequence selected from one of SEQ ID NOs: 1-15 formulated in a lipid nanoparticle, wherein the lipid nanoparticle comprises:(i) 47.5 mol % of Structure 1-45;(ii) 10 mol % of l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC);(iii) 2.5 mol % of Compound 42-6; and(iv) 40 mol % cholesterol.
21. The composition of claim 20, wherein the ratio of (i) to the TREM (N / P ratio) is between 3 to 9.
22. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 1.
23. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 2.
24. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 3.
25. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 4.
26. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 5.
27. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 6.
28. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 7.
29. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 8.
30. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 9.
31. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 10.
32. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 11.
33. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 12.
34. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 13.
35. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 14.
36. The composition of any one of claims 20-21, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 15.
37. The composition of any one of claims 20-36, wherein the LNP has a size of between 50 nm to 100 nm.
38. The composition of any one of claims 20-37, wherein the wherein the LNP is dosed between about 0.5 mg / kg to about 10 mg / kg with respect to the TREM.
39. The composition of any one of claims 20-38, wherein the composition further comprises a buffering component.
40. A method for delivering to a subject a composition comprising a tRNA-based effector molecule (TREM) formulated in a lipid nanoparticle, wherein the TREM comprises a nucleotide sequence selected from one of SEQ ID NOs: 1-15 and the lipid nanoparticle comprises:(i) 47.5 mol % of Structure 1-45;(ii) 10 mol % of l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC);(iii) 2.5 mol % of Compound 42-6; and(iv) 40 mol % cholesterol,thereby delivering the composition comprising the TREM formulated in the lipid nanoparticle to the subject.
41. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 1.
42. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 2.
43. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 3.
44. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 4.
45. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 5.
46. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 6.
47. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 7.
48. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 8.
49. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 9.
50. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 10.
51. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 11.
52. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 12.
53. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 13.
54. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 14.
55. The method of claim 40, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 15.
56. A method of treating a subject having a disease or disorder associated with a premature termination codon (PTC) in an open reading frame of a gene encoding a full length polypeptide, comprising administering to the subject a composition comprising a tRNA-based effector molecule (TREM) formulated in a lipid nanoparticle to the subject, wherein the TREM comprises a nucleotide sequence selected from one of SEQ ID NOs: 1-15 and the lipid nanoparticle comprises:(i) 47.5 mol % of Structure 1-45;(ii) 10 mol % of l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC);(iii) 2.5 mol % of Compound 42-6; and(iv) 40 mol % cholesterol,thereby treating the subject.
57. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 1.
58. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 2.
59. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 3.
60. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 4.
61. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 5.
62. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 6.
63. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 7.
64. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 8.
65. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 9.
66. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 10.
67. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 11.
68. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 12.
69. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 13.
70. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 14.
71. The method of claim 56, wherein the TREM comprises the nucleotide sequence of SEQ ID NO: 15.
72. The method of any one of claims 56-71, wherein the administering of the composition results in one or more of:(a) suppression of the PTC in an open reading frame of a gene; and(b) an increase in expression of the full length polypeptide in the subject,thereby treating the subject.
73. The method of claim 72, wherein the increase in expression of the full length polypeptide is detectable in serum at least 72 hours after administration of the composition relative to a reference sequence.