Conjugates

Abstract

The invention relates to conjugates, specifically conjugates capable of crossing the blood-brain barrier. Provided herein is a conjugate comprising a therapeutic and / or imaging moiety, a targeting moiety, a spacer and a lipid. Also provided herein is an intermediate conjugate further comprising a reactive moiety, and linker reagents. Pharmaceutical compositions, uses, methods of medical treatment and prophylaxis, methods of delivering a functional moiety, and compositions are also disclosed herein.

Description

[0001] Conjugates

[0002] This application claims priority from GB2414843.9 filed 09 October 2024, the contents and elements of which are herein incorporated by reference for all purposes

[0003] Technical Field

[0004] The present disclosure relates to the fields of molecular biology, more specifically conjugates capable of crossing the blood-brain barrier. The present invention also relates to methods of medical treatment and prophylaxis.

[0005] Background

[0006] The blood-brain barrier (BBB) is formed by tight junctions of epithelial cells, with limited and strictly controlled transport of molecules and cells across it.1The brain-to-blood ratio is a critical parameter in evaluating the ability of drugs, including antibody-small molecule conjugates and nucleic acids, to cross the BBB and reach the brain after systemic administration.

[0007] Conjugation strategies can enhance brain delivery. Reported brain-to-blood ratios for such conjugates vary depending on the nature of the antibody, the small molecule, and the targeting mechanism (e.g., receptor-mediated transcytosis), but typically are in the range of 0.01 to 0.1 .23This is because antibodies are large, hydrophilic molecules that do not easily cross the BBB. Conjugation to small molecules and targeting receptor-mediated transcytosis pathways effectively increases these ratios to 0.2 to 0.5.4 5

[0008] Nucleic acids, such as small interfering RNA (siRNA), antisense oligonucleotides (ASOs), and mRNA, face significant challenges in crossing the BBB.6Like antibodies, these molecules are typically large and hydrophilic, which limits their brain penetration and leads to brain-to-blood ratios below 0.01. Lipid Nanoparticles (LNPs) and other delivery systems designed to enhance BBB penetration can increase the B / P ratio of nucleic acids to the range of 0.01 to 0.05.78While this is an improvement, it still represents limited brain exposure relative to blood levels.

[0009] Aptamer technology is a promising way to increase BBB delivery for a wide range of compounds. Aptamers are short, single-stranded oligonucleotides (DNA or RNA) or peptides that can fold into specific three-dimensional shapes, allowing them to bind to a variety of target molecules with high affinity and specificity. They are often compared to antibodies in their ability to bind targets, but aptamers have an advantage of smaller size and easier synthesis compared to the antibodies. Aptamers can be designed to target and cross the BBB, either by binding to transport proteins naturally expressed on the BBB or by binding to receptors that mediate transcytosis (a process that shuttles molecules across BBB).9 10

[0010] Transferrin is a glycoprotein that binds and transports iron throughout the body. The transferrin receptor (TfR) is widely expressed on BBB11. Thus, compounds capable of binding to TfR on the surface of TfR- expressing cells and internalizing into the cell would be very useful for targeted delivery of such compounds. Provided herein are conjugates and methods addressing these and other needs in the art.

[0011] Summary

[0012] In a first aspect, the present disclosure provides a conjugate of the following formula: Lipid wherein r is 0 or 1 ;

[0013] MAis a functional moiety, wherein the functional moiety is selected from the group consisting of therapeutic moieties and imaging moieties;

[0014] MBis a targeting moiety; the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula: wherein each R is independently C1-24 alkyl or C2-24 alkenyl.

[0015] In some embodiments, r is 1.

[0016] In a second aspect, the present disclosure provides an intermediate conjugate of one of the following formulae: Spacer — Lipid or ;

[0017] RAand RBare independently a reactive moiety;

[0018] MAis a functional moiety, wherein the functional moiety is selected from the group consisting of therapeutic moieties and imaging moieties;

[0019] MBis a targeting moiety; the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula: wherein each R is independently C1-24 alkyl or C2-24 alkenyl. In some embodiments of the first or second aspect, the targeting moiety is an aptamer.

[0020] In some embodiments of the first or second aspect, the targeting moiety is an aptamer capable of binding to transferrin receptor (TfR).

[0021] In some embodiments of the first or second aspect, the targeting moiety is an aptamer capable of binding to TfR on a cell surface.

[0022] In some embodiments of the first or second aspect, the targeting moiety is an aptamer comprising or consisting of an RNA sequence having at least 90% sequence identity to SEQ ID NO:1 or SEQ ID NO: 40, wherein said RNA sequence has a length of 29 nucleotides or fewer.

[0023] In some embodiments of the first or second aspect, the aptamer has an RNA sequence has a length of 22 nucleotides of fewer.

[0024] In some embodiments of the first or second aspect, the targeting moiety is an aptamer comprising or consisting of an RNA sequence having at least 85% sequence identity to SEQ ID NO:5.

[0025] In some embodiments of the first or second aspect, the targeting moiety comprises a GalNAc residue.

[0026] In some embodiments of the first or second aspect, the functional moiety is a therapeutic moiety

[0027] In some embodiments of the first or second aspect, the therapeutic moiety is a nucleic acid moiety, a peptide moiety or a small molecule drug moiety.

[0028] In some embodiments of the first or second aspect, the therapeutic moiety is an antisense nucleic acid, a small interfering RNA (siRNA), a small activating RNA (saRNA), a micro-RNA (miRNA) or an aptamer.

[0029] In some embodiments of the first or second aspect, the therapeutic moiety is anti-miR 125b1 .

[0030] In some embodiments of the first or second aspect, the therapeutic moiety is a CCAAT / enhancer-binding protein (C / EBP ) siRNA.

[0031] In some embodiments of the first or second aspect, the functional moiety is an imaging moiety, optionally wherein the imaging moiety is a bioluminescent molecule, a photoactive molecule, a metal or a nanoparticle.

[0032] In a second aspect, the present disclosure provides a linker reagent of the formula: Spacer — Lipid wherein r is 0 or 1 ;

[0033] RAand RBare independently a reactive moiety; the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula: wherein each R is independently C1-24 alkyl or C2-24 alkenyl.

[0034] In some embodiments, r is 1.

[0035] In some embodiments of the second or third aspect, RAand RBare each a reactive moiety selected from the group consisting of: maleimide, thiol, azide, alkyne, and alkene.

[0036] In some embodiments of the second or third aspect, RAand RBare each a reactive moiety selected from the group consisting of: maleimide and azide.

[0037] In some embodiments of the first, second or third aspects, the spacer moiety is selected from one of the following formulae: a is 1-6; b is 1-6; n is 1-300;

[0038] L1and L2are each independently C1-6 alkylene; the one or two attachments to the left of -[CH2]a- are the attachment or attachments to RA, RB, MA, or MB; and the attachment to the right of L2is the attachment to the lipid moiety. In some embodiments of the first, second or third aspects, the spacer moiety is selected from one of the following formulae: wherein: a is 1-6; b is 1-6; n is 1-300;

[0039] L1and L2are each independently Ci-e alkylene; the one or two attachments to the left of -[CH2]a- are the attachment or attachments to RA, RB, MA, or MB; and the attachment to the right of L2is the attachment to the lipid moiety.

[0040] In some embodiments of the first, second or third aspects, the spacer moiety is: wherein: a is 1-6; n is 1-300;

[0041] L1and L2are each independently Ci-e alkylene; the two attachments to the left of -[CH2]a- are the attachments to RA, RB, MA, or MB; and the attachment to the right of L2is the attachment to the lipid moiety.

[0042] In some embodiments of the first, second or third aspects, the spacer moiety is: wherein: n is 1-300;

[0043] L1and L2are each independently Ci-e alkylene; the two attachments to the left of -[CH2]a- are the attachments to RA, RB, MA, or MB; and the attachment to the right of L2is the attachment to the lipid moiety. In some embodiments of the first, second or third aspects, L1is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C3 alkylene.

[0044] In some embodiments of the first, second or third aspects, L2is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C2 alkylene.

[0045] In some embodiments of the first, second or third aspects, the lipid moiety is:

[0046] In some embodiments of the first, second or third aspects, each R is independently C1-20 alkyl, such as C10-20 alkyl, such as C15-20 alkyl, such as C17 alkyl.

[0047] In some embodiments of the first or second aspect, the spacer-lipid moiety is: wherein the -S- attachment to the pyrrolidine-2, 5-dione moiety and the attachment to the 1 ,2,3-triazolyl group are the attachments to RA, RB, MAand MB; optionally wherein the -S- attachment to the pyrrolidine-2, 5-dione moiety is the attachment to RBor MB, and the attachment to the 1 ,2,3-triazolyl group is the attachment to RAor MA.

[0048] In some embodiments of the third aspect, the linker reagent is:

[0049] In some embodiments of the first, second or third aspects, n is 100-280, such as 150-260, such as 200- 250, such as about 230.

[0050] In some embodiments of the first, second or third aspects, n is 1-100, such as 1-50, such as 1-30, such as about 23 or about 22. In a further aspect is provided a pharmaceutical composition comprising the conjugate or the intermediate conjugate according to the first or second aspects, and a pharmaceutically acceptable excipient.

[0051] In a further aspect is provided a conjugate, intermediate conjugate, or a pharmaceutical composition according to aspects of the invention, for use in a method of treating or preventing a disease or disorder.

[0052] In a further aspect is provided the use of a conjugate, intermediate conjugate, or a pharmaceutical composition according to aspects of the invention, in the manufacture of a medicament for use in a method of treating or preventing a disease or disorder.

[0053] In a further aspect is provided a method of treating or preventing a disease or disorder, the method comprising administering to a subject in need thereof an effective amount of a conjugate, intermediate conjugate, or a pharmaceutical composition according to aspects of the invention,

[0054] In some embodiments, the disease or condition is a brain disease.

[0055] In some embodiments, the brain disease is a cancer of the brain or central nervous system, a neurodegenerative disease or an infection.

[0056] In a further aspect is provided a method of delivering a functional moiety to a cell, the method comprising: a. contacting a cell with the conjugate or a pharmaceutical composition as described herein; and b. allowing said conjugate to bind to a transferrin receptor on said cell and pass into said cell thereby delivering said functional moiety into said cell.

[0057] Description

[0058] The conjugates and compositions provided herein are, for example, useful for the delivery of therapeutic and imaging agents across the blood-brain barrier.

[0059] Conjugates

[0060] Provided herein is a conjugate comprising at least one oligonucleotide, a polyethylene glycol (PEG) spacer and a lipid moiety.

[0061] The conjugates described herein may be of the general formula (I): iv(

[0062] . , Spacer — Lipid w r (I), wherein r is 0 or 1 ; MAis a functional moiety, wherein the functional moiety is selected from the group consisting of therapeutic moieties and imaging moieties; and MBis a targeting moiety, wherein the targeting moiety is selected from the group consisting of an aptamer or an alternative targeting moiety. The linker

[0063] The linker is a moiety within the conjugates described herein attached to functional moiety MAand optionally a targeting moiety MB.

[0064] Accordingly, the linker moiety (sometimes referred to as a linker residue or spacer-lipid moiety herein) within the conjugate of formula (I) may be of the general formula (II):

[0065] Spacer — Lipid r(II), wherein r is 0 or 1 ; wherein the top-left attachment (;-) is attached to the functional moiety MA, and the bottom-left attachment (;-) is attached to the targeting moiety MB.

[0066] The linker is derived from conjugating the linker reagent to the functional moiety MAand optionally the targeting moiety MBto form the conjugate describe herein. The linker reagent may be of the general formula (III): Lipid (HI), wherein r is 0 or 1 ; RAand RBare independently a reactive moiety to react with the corresponding reactive moiety on the functional moiety MAand optionally the targeting moiety MB.

[0067] When the linker is attached to both a functional moiety MAand a targeting moiety MB(that is, r is 1 in formula (I) for the conjugate above), the conjugates described herein may be of the general formula (la):

[0068] Spacer — Lipid

[0069] (la), wherein r is 0 or 1 ; MAis a functional moiety and MBis a targeting moiety as defined for formula (I).

[0070] Accordingly, the linker moiety (sometimes referred to as a linker residue or spacer-lipid moiety herein) within the conjugate for formula (la) may be of the general formula (Ila):

[0071] Spacer — Lipid

[0072] (Ha), wherein one attachment (;-) to the spacer of the linker is attached to the functional moiety MAand the other attachment (;-) to the spacer of the linker is attached to the targeting moiety MB.

[0073] Each of the attachment(s) (;-) to the spacer of the linker present in the linker moiety (or spacer-lipid moiety) of formula (Ila) may be an unreacted reactive moiety (RAor RB), instead of being attached to the functional moiety MA(formula (IVa)) or the targeting moiety MB(formula (IVb)): B^Spacer — Lipid ^^Spacer — Lipid

[0074] M(IVa) orR(IVb).

[0075] These formulae (IVa) and (IVb) may be referred to as intermediate conjugates.

[0076] When the linker reagent is to be attached to both a functional moiety MAand a targeting moiety MB(that is, r is 1 in formula (III) for the linker reagent above), the linker reagent may be of the general formula (Illa): Lipid (Illa), wherein RAand RBare each reactive moieties to react with the corresponding reactive moiety on the functional moiety MAor the targeting moiety MB. The intermediate conjugates of formulae (IVa) and (IVb) are derived from a single reaction of the linker reagent of formula (Illa) with either the reactive moiety on the targeting moiety MB(for formula (IVa), or with the reactive moiety on the functional moiety MA(for formula (IVb)).

[0077] Lipid

[0078] The linker present in the conjugates, intermediate conjugates, and the linker reagents described herein comprise a lipid, such as a phospholipid, to increase lipophilicity. This lipid may be considered a lipophilicity-enhancing lipid. Without wishing to be bound by theory, the inventors have observed that the increased lipophilicity of the linker allows the conjugate comprising a functional moiety MAand optionally a targeting moiety MB(which may comprise, for example, aptamers and / or therapeutic oligonucleotides) to be delivered across the blood brain barrier (BBB). It is thought the presence of the lipid facilitates the delivery across the BBB by offsetting the hydrophilicity of the moieties MAand MB(such as RNA aptamers and / or therapeutic oligonucleotides), which is known to limit the ability of the moieties MAand MBat penetrating the brain. The choice of lipid can affect product properties such as stability and efficacy of BBB penetration and may be subjected to screening to find an optimal composition.

[0079] In some embodiments, the lipid moiety is of the formula: wherein each R is independently C1-24 alkyl (such as C1-20 alkyl, such as C10-20 alkyl, such as C15-20 alkyl, such as C17 alkyl) or C2-24 alkenyl (such as C10-20 alkenyl, such as C15-20 alkenyl, such as C17 alkenyl). Each R may be the same or different. In some embodiments, each R is independently C1-24 alkyl, such as C1-20 alkyl, such as C10-20 alkyl, such as C15-20 alkyl, such as C17 alkyl.

[0080] In some embodiments, the lipid moiety is a phospholipid moiety of the formula: wherein each R is independently C1-24 alkyl (such as C1-20 alkyl, such as C10-20 alkyl, such as C15- 20 alkyl, such as C17 alkyl) or C2-24 alkenyl (such as C10-20 alkenyl, such as C15-20 alkenyl, such as C17 alkenyl). Each R may be the same or different. In some embodiments, each R is independently C1-24 alkyl, such as C1-20 alkyl, such as C10-20 alkyl, such as C15-20 alkyl, such as C17 alkyl.

[0081] Where present, the counter cation in the lipid moiety may be any suitable counter cation, such as a proton (H+) or a sodium cation (Na+). Preferably, the counter cation is a sodium cation.

[0082] In some embodiments, the lipid moiety is of the formula:

[0083] In some embodiments, the lipid moiety is a phospholipid moiety of the formula:

[0084] . The counter cation may be any suitable counter cation, such as a proton (H+) a sodium cation (Na+). Preferably, the counter cation is a sodium cation.

[0085] Reactive moieties

[0086] The linker present in the intermediate conjugates and linker reagents described herein also comprise at least one reactive moiety (RAand RB) to allow for conjugation to a functional moiety MAand optionally a targeting moiety MBdescribed herein.

[0087] When the linker reagent is to be attached to both a functional moiety MAand a targeting moiety MB(that is, r is 1 in formula (I II) for the linker reagent), the linker reagent comprises two reactive moieties (RAand RB) to allow for conjugation to the moieties MAor MBdescribed herein. The two reactive moieties present on the linker are orthogonal, such as bioorthogonal, to allow for different MAand MBmoieties to be conjugated to specific parts of the linker. For example, one of the reactive moieties of the linker may be for use in a conjugate addition and the other reactive moiety of the linker may be for use in a ‘click’ reaction such as copper-catalyzed azide-alkyne cycloaddition (CuAAc) reaction. Alternatively, one of the reactive moieties of the linker may be for use in an alternative click such as a strain-promoted azidealkyne cycloaddition (SPAAC) reaction or a Diels-Alder reaction (such as a Tetrazine-frans-Cyclooctene Ligation).

[0088] In some embodiments, the linker may be attached to moieties MAor MBvia the conjugate addition of a nucleophilic group on the moieties MAor MBto a maleimide moiety. For example, the nucleophilic group may be a thiol group (-SH) present on the moieties MAor MB(which may be modified to include the thiol group). The maleimide moiety may be present on the linker reagent and is:

[0089] O^ O

[0090] . Alternatively, the thiol group may be present in the in the linker reagent, and the maleimide group may be present in the moieties MAor MB(which may be modified to include the maleimide group).

[0091] The maleimide-thiol conjugate addition reaction forms the following pyrrolidine-2, 5-dione moiety between the linker moiety and the moieties MAor MB: wherein the attachment to the sulfur atom is derived from the reactive thiol group and the attachment to the nitrogen is derived from the reactive maleimide group.

[0092] Such maleimide-thiol reactions are described in the art, for example, Shao et al., Anal. Chem. 2023, 95, 11124-11131 (ref

[0018] ), which is incorporated by reference in its entirety.

[0093] In some embodiments, the linker may be attached to moieties MAor MBvia a ‘click’ reaction such as copper-catalyzed azide-alkyne cycloaddition (CuAAc) reaction. For example, the alkyne (-C=CH, that is a terminal alkyne) group may be present in the moieties MAor MB(which may be modified to include the alkyne group), and the azide (-N3) group may be present in the linker reagent. Alternatively, the alkyne (- C=CH, that is a terminal alkyne) group may be present in the in the linker reagent, and the azide (-N3) group may be present in the moieties MAor MB(which may be modified to include the azide group). The CuAAc reaction forms the following 1 ,2,3-triazolyl moiety between the linker moiety and the moieties MAor MB: wherein the attachment to the nitrogen atom is derived from the azide reactive moiety and the attachment to the alkene is derived from the alkyne moiety. Such CuAAc reactions are described in the art, for example, Jorgensen et al., Chemical Communications 2013, 49, 10751-10753 (ref

[0019] ), which is incorporated by reference in its entirety.

[0094] In some embodiments, the linker may be attached to moieties MAor MBvia a ‘click’ reaction such as a strain-promoted azide-alkyne cycloaddition (SPAAC) reaction. For example, the strained alkyne (-C=C- within, for example, a cyclooctyne) group may be present in the moieties MAor MB(which may be modified to include the alkyne group), and the azide (-N3) group may be present in the linker reagent. Alternatively, the strained alkyne (-C=C- within, for example, a cyclooctyne) group may be present in the in the linker reagent, and the azide (-N3) group may be present in the moieties MAor MB(which may be modified to include the azide group). The SPAAC reaction forms the following 1 ,2,3-triazolyl moiety between the linker moiety and the moieties MAor MB: wherein the attachment to the nitrogen is derived from the azide reactive moiety and the two attachments to the alkene are derived from the strained alkyne moiety.

[0095] Such SPAAC reactions are described in the art.

[0096] In some embodiments, the linker may be attached to moieties MAor MBvia a ‘click’ reaction such as a Diels-Alder reaction, such as a Tetrazine-frans-Cyclooctene Ligation. For example, a strained alkene (- C=C- within, for example, a cyclooctene, preferably where the alkene is trans) group may be present in the moieties MAor MB(which may be modified to include the alkene group), and a tetrazinyl group may be present in the linker reagent. Alternatively, the strained alkene (-C=C- within, for example, a cyclooctene, preferably where the alkene is trans) group may be present in the in the linker reagent, and the tetrazinyl group may be present in the moieties MAor MB(which may be modified to include the tetrazinyl group).

[0097] The tetrazinyl group is: . The SPAAC reaction forms the following dihydropyridazinyl moiety

[0098] (and tautomers thereof) between the linker moiety and the moieties MAor MB: (which are tautomers of each other), wherein the two top and bottom attachments to the ring (that is, the attachments to the carbon atoms adjacent to the nitrogen atoms) are derived from the reactive tetrazinyl group and the two attachments to the left to the ring (that is, furthest away from the nitrogen atoms) are derived from the strained alkene moiety.

[0099] Such Diels-Alder reactions, such as a Tetrazine-frans-Cyclooctene Ligation, are described in the art. Accordingly, each reactive moiety (RAand RB) in the linker reagent or intermediate conjugate may be selected from consisting of: maleimide, thiol, azide, alkyne (such as a terminal alkyne or a strained alkyne), and alkene (such as a strained alkene). In some embodiments, each reactive moiety (RAand RB) in the linker reagent or intermediate conjugate may be selected from consisting of: maleimide, thiol, azide, and alkyne. In some embodiments wherein there are two reactive moieties (that is, r is 1 in the formula for the linker reagent), RAis a maleimide or thiol, and RBis an azide or an alkyne. Alternatively, RBis a maleimide or thiol, and RAis an azide or an alkyne. In some embodiments wherein there are two reactive moieties (that is, r is 1 in formula (III) for the linker reagent), RAand RBare each a reactive moiety selected from the group consisting of: maleimide and azide. In some embodiments, RAis a maleimide and RBis an azide. Alternatively, RBis a maleimide and RAis an azide.

[0100] Spacer

[0101] The linker present in the conjugates, intermediate conjugates, and the linker reagents described herein also comprise a spacer. The spacer provides a distance between the functional moiety MA(and optionally the targeting moiety MB) and the lipid moiety. The spacer may comprise a polyethylene glycol (PEG) chain (sometimes denoted -(OCFhCFhjn- or -(CFbCFhOjn- or -(CfWCFhjn-), an amide bond (-C(=O)NH- or -NHC(=O)-), an alkylene group (such as C1-6 alkylene group), a carbamate bond (-OC(=O)NH- or - NHC(=O)O-), and combinations thereof. In some embodiments, the spacer moiety comprises at least one (or at least two, or at least three) group(s) consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof. In some embodiments, the spacer moiety comprises at least one (or at least two, or at least three) group(s) consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, and combinations thereof. In some embodiments, the spacer moiety consists of at least one (or at least two, or at least three) group(s) selected from the group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof. In some embodiments, the spacer moiety consists of at least one (or at least two, or at least three) group(s) selected from the group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, and combinations thereof. In some embodiments, the spacer moiety consists of groups selected from: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof. In some embodiments, the spacer moiety consists of groups selected from: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, and combinations thereof. The at least one reactive moiety (RAand RBabove) is typically attached to one end of the spacer. When there are two reactive moieties (RAand RBabove; that is when r is 1 in formula (III) for the linker reagent), each reactive moiety may be attached to the same atom, or adjacent atoms (e.g., carbon atoms), or even further apart along the spacer. Preferably, the two reactive moieties are attached to the spacer on adjacent atoms, such as adjacent carbon atoms.

[0102] In some embodiments, the spacer may be one of the following formulae: wherein a is 1-6; b is 1-6; n is 1-300; L1and L2are each independently C1-6 alkylene; the two attachments to the left (of -[CH2]a-) are the attachments to the reactive moieties RAand RBin the linker reagent, or the attachments to the moieties MAor MBin the linker residue in the conjugate, or the attachments RAand MBin formula (IVa) or MAand RBin formula (IVb) of the intermediate conjugates; and the attachment to the right is the attachment to the lipid moiety. In some embodiments, a is 1-5, such as 1-4, such as 1-3, such as 1-2, such as 1. In some embodiments, n is 100-280, such as 150-260, such as 200-250, such as about

[0103] 230. In some embodiments, n is 1-100, such as 1-50, such as 1-30, such as about 23 or about 22. In some embodiments, L1is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C3 alkylene (such as n-propylene). In some embodiments, L2is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C2 alkylene (such as ethylene).

[0104] In some embodiments, the spacer may be of the formula: wherein n is 1-300; L1and L2are each independently C1-6 alkylene; the two attachments to the left are the attachments to the reactive moieties RAand RBin the linker reagent, or the attachments to the moieties MAor MBin the linker residue in the conjugate, or the attachments RAand MBin formula (IVa) or MAand RBin formula (IVb) of the intermediate conjugates; and the attachment to the right is the attachment to the lipid moiety. In some embodiments, n is 100-280, such as 150-260, such as 200-250, such as about 230. In some embodiments, n is 1-100, such as 1-50, such as 1-30, such as about 23 or about 22. In some embodiments, L1is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C3 alkylene (such as n-propylene). In some embodiments, L2is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C2 alkylene (such as ethylene).

[0105] In some embodiments, the spacer may be of the formula: wherein n is 1-300; L2is C1-6 alkylene; the two attachments to the left are the attachments to the reactive moieties RAand RBin the linker reagent, or the attachments to the moieties MAor MBin the linker residue in the conjugate, or the attachments RAand MBin formula (IVa) or MAand RBin formula (IVb) of the intermediate conjugates; and the attachment to the right is the attachment to the lipid moiety. In some embodiments, n is 100-280, such as 150-260, such as 200-250, such as about 230. In some embodiments, n is 1-100, such as 1-50, such as 1-30, such as about 23 or about 22. In some embodiments, L2is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C2 alkylene (such as ethylene).

[0106] In some embodiments, the spacer may be of the formula: wherein n is 1-300; L1is C1-6 alkylene; the two attachments to the left are the attachments to the reactive moieties RAand RBin the linker reagent, or the attachments to the moieties MAor MBin the linker residue in the conjugate, or the attachments RAand MBin formula (IVa) or MAand RBin formula (IVb) of the intermediate conjugates; and the attachment to the right is the attachment to the lipid moiety. In some embodiments, n is 100-280, such as 150-260, such as 200-250, such as about 230. In some embodiments, n is 1-100, such as 1-50, such as 1-30, such as about 23 or about 22. In some embodiments, L1is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C3 alkylene (such as n-propylene). and residues

[0107] In some embodiments, the linker residue (or spacer-lipid moiety) present in the conjugate or intermediate conjugate is: wherein n is 1-300; L1and L2are each independently C1-6 alkylene; each R is independently C1-24 alkyl or C2-24 alkenyl; and the two attachments to the left are the attachments to the reactive moieties RAand RBin the linker reagent, or the attachments to the moieties MAor MBin the linker residue in the conjugate, or the attachments RAand MBin formula (IVa) or MAand RBin formula (IVb) of the intermediate conjugates. The -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of one of the moieties MAor MBwith the maleimide moiety of the linker reagent. The 1 , 2 , 3-triazoly I group is derived from the CuAAc reaction of an alkyne of one of the moieties MAor MBwith an azide group of the linker reagent. In some embodiments, the -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of MBwith the maleimide moiety of the linker reagent, and the 1 ,2,3- triazolyl group is derived from the CuAAc reaction of an alkyne of MAwith an azide group of the linker reagent. In some embodiments, the -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of MAwith the maleimide moiety of the linker reagent, and the 1 ,2, 3-triazolyl group is derived from the CuAAc reaction of an alkyne of MBwith an azide group of the linker reagent. Said linker residue is derived from the linker reagent: wherein n is 1-300; L1and L2are each independently C1-6 alkylene; each R is independently C1-24 alkyl or C2-24 alkenyl; and the maleimide and the azide group are the reactive moieties RAand RB. In some embodiments, n is 100-280, such as 150-260, such as 200-250, such as about 230. In some embodiments, n is 1-100, such as 1-50, such as 1-30, such as about 23 or about 22. In some embodiments, L1is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C3 alkylene (such as n-propylene). In some embodiments, L2is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C2 alkylene (such as ethylene). In some embodiments, each R is independently C1-20 alkyl, such as C10-20 alkyl, such as C15-20 alkyl, such as C17 alkyl. The counter cation may be any suitable counter cation, such as a proton (H+) a sodium cation (Na+). Preferably, the counter cation is a sodium cation.

[0108] In some embodiments, the linker residue (or spacer-lipid moiety) present in the conjugate or intermediate conjugate is: wherein n is 1-300; L1is Ci-e alkylene; each R is independently C1-24 alkyl or C2-24 alkenyl; and the two attachments to the left are the attachments to the reactive moieties RAand RBin the linker reagent, or the attachments to the moieties MAor MBin the linker residue in the conjugate, or the attachments RAand MBin formula (IVa) or MAand RBin formula (IVb) of the intermediate conjugates. The -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of one of the moieties MAor MBwith the maleimide moiety of the linker reagent. The 1 ,2,3-triazolyl group is derived from the CuAAc reaction of an alkyne of the one of the moieties MAor MBwith an azide group of the linker reagent. In some embodiments, the -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of MBwith the maleimide moiety of the linker reagent, and the 1 ,2,3-triazolyl group is derived from the CuAAc reaction of an alkyne of MAwith an azide group of the linker reagent. In some embodiments, the -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of MAwith the maleimide moiety of the linker reagent, and the 1 ,2,3-triazolyl group is derived from the CuAAc reaction of an alkyne of MBwith an azide group of the linker reagent.

[0109] Said linker residue is derived from the linker reagent: wherein n is 1-300; L1is C1-6 alkylene; each R is independently C1-24 alkyl or C2-24 alkenyl; and the maleimide and the azide group are the reactive moieties RAand RB. In some embodiments, n is 100-280, such as 150-260, such as 200-250, such as about 230. In some embodiments, n is 1-100, such as 1-50, such as 1-30, such as about 23 or about 22. In some embodiments, L1is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C3 alkylene (such as n-propylene). In some embodiments, each R is independently C1-20 alkyl, such as C10-20 alkyl, such as C15-20 alkyl, such as C17 alkyl. The counter cation may be any suitable counter cation, such as a proton (H+) a sodium cation (Na+). Preferably, the counter cation is a sodium cation.

[0110] In some embodiments, the linker residue (or spacer-lipid moiety) present in the conjugate or intermediate conjugate is: wherein n is 1-300; L2is Ci-e alkylene; each R is independently C1-24 alkyl or C2-24 alkenyl; and the two attachments to the left are the attachments to the reactive moieties RAand RBin the linker reagent, or the attachments to the moieties MAor MBin the linker residue in the conjugate, or the attachments RAand MBin formula (IVa) or MAand RBin formula (IVb) of the intermediate conjugates. The -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of one of the moieties MAor MBwith the maleimide moiety of the linker reagent. The 1 ,2, 3-triazolyl group is derived from the CuAAc reaction of an alkyne of one of the moieties MAor MBwith an azide group of the linker reagent. In some embodiments, the -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of MBwith the maleimide moiety of the linker reagent, and the 1 ,2, 3-triazolyl group is derived from the CuAAc reaction of an alkyne of MAwith an azide group of the linker reagent. In some embodiments, the -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of MAwith the maleimide moiety of the linker reagent, and the 1 ,2, 3-triazolyl group is derived from the CuAAc reaction of an alkyne of MBwith an azide group of the linker reagent.

[0111] Said linker residue is derived from the linker reagent: wherein n is 1-300; L2is C1-6 alkylene; each R is independently C1-24 alkyl or C2-24 alkenyl; and the maleimide and the azide group are the reactive moieties RAand RB. In some embodiments, n is 100-280, such as 150-260, such as 200-250, such as about 230. In some embodiments, n is 1-100, such as 1-50, such as 1-30, such as about 23 or about 22. In some embodiments, L2is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C2 alkylene (such as ethylene). In some embodiments, each R is independently C1-20 alkyl, such as C10-20 alkyl, such as C15-20 alkyl, such as C17 alkyl. The counter cation may be any suitable counter cation, such as a proton (H+) a sodium cation (Na+). Preferably, the counter cation is a sodium cation.

[0112] In some embodiments, the linker residue (or spacer-lipid moiety) present in the conjugate or intermediate conjugate is: wherein n is 1-300; each R is independently C1-24 alkyl or C2-24 alkenyl; and the two attachments to the left are the attachments to the reactive moieties RAand RBin the linker reagent, or the attachments to the moieties MAor MBin the linker residue in the conjugate, or the attachments RAand MBin formula (IVa) or MAand RBin formula (IVb) of the intermediate conjugates. The -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of the one of the moieties MAor MBwith the maleimide moiety of the linker reagent. The 1 ,2,3-triazolyl group is derived from the CuAAc reaction of an alkyne of the one of the moieties MAor MBwith an azide group of the linker reagent. In some embodiments, the -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of MBwith the maleimide moiety of the linker reagent, and the 1 ,2,3-triazolyl group is derived from the CuAAc reaction of an alkyne of MAwith an azide group of the linker reagent. In some embodiments, the -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of MAwith the maleimide moiety of the linker reagent, and the 1 ,2,3-triazolyl group is derived from the CuAAc reaction of an alkyne of MBwith an azide group of the linker reagent.

[0113] Said linker residue is derived from the linker reagent: wherein n is 1-300; each R is independently C1-24 alkyl or C2-24 alkenyl; and the maleimide and the azide group are the reactive moieties RAand RB. In some embodiments, n is 100-280, such as 150-260, such as 200-250, such as about 230. In some embodiments, n is 1-100, such as 1-50, such as 1-30, such as about 23 or about 22. In some embodiments, L2is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C2 alkylene (such as ethylene). In some embodiments, each R is independently C1-20 alkyl, such as C10-20 alkyl, such as C15-20 alkyl, such as C17 alkyl. The counter cation may be any suitable counter cation, such as a proton (H+) a sodium cation (Na+). Preferably, the counter cation is a sodium cation.

[0114] In some embodiments, the linker residue (or spacer-lipid moiety) present in the conjugate or intermediate conjugate is: wherein n is about 230 or about 23 or about 22. The -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of one of the moieties MAor MBwith the maleimide moiety of the linker reagent. The 1 ,2,3-triazolyl group is derived from the CuAAc reaction of an alkyne of one of the moieties MAor MBwith an azide group of the linker reagent. In some embodiments, the -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of MBwith the maleimide moiety of the linker reagent, and the 1 ,2,3-triazolyl group is derived from the CuAAc reaction of an alkyne of MAwith an azide group of the linker reagent. In some embodiments, the -S- attachment to the pyrrolidine-2, 5-dione moiety is derived from the reaction of a thiol group of MAwith the maleimide moiety of the linker reagent, and the 1 ,2,3-triazolyl group is derived from the CuAAc reaction of an alkyne of MBwith an azide group of the linker reagent.

[0115] Said linker residue is derived from the linker reagent: wherein n is about 230 or about 23 or about 22. When n is about 230, this linker reagent may sometimes be referred to as ‘maleimide-DSPE-PEG reagent’. When n is about 23 or about 22, this linker reagent may sometimes be referred to as ‘azido-DSPE-PEG 1 k maleimide reagent’ (see compound 7 herein). The counter cation may be any suitable counter cation, such as a proton (H+) a sodium cation (Na+). Preferably, the counter cation is a sodium cation.

[0116] Method of synthesising conjugates

[0117] Provided herein are also methods to synthesise the conjugates described herein (such as conjugates of formula (I)).

[0118] The method to synthesise a conjugate of formula (I) may comprise the step of reacting a linker reagent of formula (III), using its reactive moiety RA, with a corresponding reactive moiety present on functional moiety MA. If RBis present, RBmay then react with a corresponding reactive moiety present on targeting moiety MB. These steps may be performed in either order - that is, RAmay react with MAbefore RBreacts with MB, or RBmay react with MBbefore RAreacts with MA.

[0119] In some embodiments, the method may be to synthesise a conjugate of formula (la). The method may comprise a step of reacting a linker reagent of formula (III), using its reactive moiety RA, with a corresponding reactive moiety present on functional moiety MAto form an intermediate conjugate of formula (IVb). The method may then further comprise the step of reacting the intermediate conjugate of formula (IVb), using its reactive moiety RB, with a corresponding reactive moiety present on targeting moiety MBto form a conjugate of formula (la).

[0120] Alternatively, the method may comprise a step of reacting a linker reagent of formula (III), using its reactive moiety RB, with a corresponding reactive moiety present on targeting moiety MBto form an intermediate conjugate of formula (IVa). The method may then further comprise the step of reacting the intermediate conjugate of formula (IVa), using its reactive moiety RA, with a corresponding reactive moiety present on functional moiety MAto form a conjugate of formula (la).

[0121] In the methods to synthesise a conjugate as described herein, each reaction may be a conjugate addition (for example, a maleimide-thiol conjugate addition - wherein the reactive moieties are a maleimide or a thiol) or a ‘click’ reaction (for example, a copper-catalyzed azide-alkyne cycloaddition (CuAAc) reaction - wherein the reactive moieties are an azide and an alkyne) as described herein.

[0122] Chemical Definitions

[0123] The term “alkyl” as provided herein is a hydrocarbon radical substituent derived from an alkane by removal of a hydrogen atom, often further defined by the number of carbon atoms present. For example, C1-24 alkyl groups are alkyl groups containing 1 to 24 carbon atoms, and Ci-e alkyl groups are alkyl groups containing 1 to 6 carbon atoms. The alkyl group may be linear or branched, preferably linear. Each alkyl group may have one or more deuterium (D) substituents. Ci-e alkyl includes C1-5 alkyl, C1-4 alkyl, C1-3 alkyl, C1-2 alkyl, and Ci alkyl. Ci-e alkyl includes Ce alkyl, C5 alkyl, C4 alkyl, C3 alkyl, C2 alkyl, and Ci alkyl. Nonlimiting examples of alkyl groups are as follows. Ce alkyl may be 1-hexyl (n-hexyl). C5 alkyl may be 1- pentyl (n-pentyl). C4 alkyl may be 1 -butyl (n-butyl or n-Bu), isobutyl ( / -butyl or / -Bu), sec-butyl (s-butyl or s- Bu), or fert-butyl (f-butyl or f-Bu). C3 alkyl may be 1-propyl (n-propyl, n-Pr, or -CH2CH2CH3), or 2-propyl (isopropyl, / -Pr, or -CH(CH3)2). C2 alkyl may be ethyl (Et or -CI-ECHs). Ci alkyl may be methyl (Me or -CH3).

[0124] The term “alkenyl” as provided herein is a hydrocarbon group formed when a hydrogen atom is removed from an alkene (or olefin) group. An alkene group is an unsaturated hydrocarbon or alkyl group containing at least one carbon-carbon double bond. The alkenyl group may be further defined by the number of carbon atoms present. Each alkenyl group may have one or more deuterium (D) substituents. For example, C2-24 alkenyl groups are alkyl groups containing 2 to 24 carbon atoms, and C2-6 alkenyl groups are alkenyl groups containing 2 to 6 carbon atoms. The alkenyl group may be linear or branched. C2-6 alkenyl includes C2-5 alkenyl, C2-4 alkenyl, C2-3 alkenyl, and C2 alkenyl. C2-6 alkenyl includes Ce alkenyl, C5 alkenyl, C4 alkenyl, C3 alkenyl, and C2 alkenyl. Non-limiting examples of alkenyl groups are as follows. Ce alkenyl may be 1 -hexenyl, 2-hexenyl, 3-hexenyl, 2-methyl-1 -pentenyl, 3-methyl-1 -pentenyl, 4- methyl-1 -pentenyl, 2-methyl-2-pentenyl, 3-methyl-2-pentenyl, 4-methyl-2-pentenyl, 2,3-dimethyl-1- butenyl, 3,3-dimethyl-1-butenyl, 2,3-dimethyl-2-butenyl, or 2-ethyl-1-butenyl. C5 alkenyl may be 1- pentenyl, 2-pentenyl, 2-methyl-1-butenyl, 3-methyl-1-butenyl, or 2-methyl-2-butenyl. C4 alkenyl may be 1- butenyl, 2-butenyl, or isobutylenyl. C3 alkenyl may be propylenyl (-CH2CH=CH2). C2 alkenyl may be ethylenyl (vinyl or -CH=CH2).

[0125] The term “alkylene” as provided herein is a divalent alkyl (or hydrocarbon) radical, often further defined by the number of carbon atoms present. For example, C1-6 alkylene groups are alkylene groups containing 1 to 6 carbon atoms. The alkylene group may be linear or branched, preferably linear. Linear alkylenes may be denoted -(CH2)n-, where n is the number of carbon atoms in the alkylene group. C1-6 alkylene includes C1-5 alkylene, C1-4 alkylene, C1-3 alkylene, C1-2 alkylene, and Ci alkylene. C1-6 alkylene includes Ce alkylene, C5 alkylene, C4 alkylene, C3 alkylene, C2 alkylene, and Ci alkylene. Non-limiting examples of alkylene groups are as follows. Ce alkylene may be -(CH2)e- (hexylene). C5 alkylene may be -(CH2)e- (pentylene). C4 alkylene may be -(CH2)4- (butylene), 2,2-dimethylethylene, or 2-methylpropylene. C3 alkylene may be -(CH2)3- (propylene). C2 alkylene may be -(CH2)2- (ethylene). Ci alkylene may be -CH2- (methylene). Preferably, alkylene groups are C1-4 alkylene, such as C1-3 alkylene, such as C1-2 alkylene.

[0126] Targeting Moiety

[0127] The conjugates of the present invention may comprise a targeting moiety. The targeting moiety may be an aptamer or an alternative targeting moiety.

[0128] Accordingly, in some embodiments is provided a conjugate of the following formulae: Spacer — Lipid wherein r is 1 ;

[0129] MAis a functional moiety, wherein the functional moiety is selected from the group consisting of therapeutic moieties and imaging moieties;

[0130] MBis a targeting moiety, wherein the targeting moiety is an aptamer or an alternative targeting moiety; the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula: or wherein each R is independently C1-24 alkyl or C2-24 alkenyl. Aptamers

[0131] In some preferred embodiments, the targeting moiety is an aptamer, e.g. a ribonucleic acid aptamer.

[0132] In some embodiments is a conjugate of the following formulae: Lipid wherein r is 1 ;

[0133] MAis a functional moiety, wherein the functional moiety is selected from the group consisting of therapeutic moieties and imaging moieties;

[0134] MBis an aptamer; the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula: wherein each R is independently C1-24 alkyl or C2-24 alkenyl.

[0135] The term "aptamer" as provided herein refers to oligonucleotides (e.g. short oligonucleotides or deoxyribonucleotides), that bind (e.g. with high affinity and specificity) to proteins, peptides, and small molecules. Aptamers typically have defined secondary or tertiary structure owing to their propensity to form complementary base pairs and, thus, are often able to fold into diverse and intricate molecular structures. The three-dimensional structures are essential for aptamer binding affinity and specificity, and specific three-dimensional interactions drives the formation of aptamer-target complexes. Aptamers can be selected in vitro from very large libraries of randomized sequences by the process of systemic evolution of ligands by exponential enrichment (SELEX as described in Ellington AD, Szostak JW (1990) In vitro selection of RNA molecules that bind specific ligands. Nature 346:818-822; Tuerk C, Gold L (1990) Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249:505-510) or by developing SOMAmers (slow off-rate modified aptamers) (Gold L et al. (2010) Aptamer-based multiplexed proteomic technology for biomarker discovery. PLoS ONE 5(12):e15004) . Applying the SELEX and the SOMAmer technology includes for instance adding functional groups that mimic amino acid side chains to expand the aptamer's chemical diversity. As a result high affinity aptamers for almost any protein target are enriched and identified. Aptamers exhibit many desirable properties for targeted drug delivery, such as ease of selection and synthesis, high binding affinity and specificity, flexible structure, low immunogenicity, and versatile synthetic accessibility. Accordingly, in some embodiments, the present invention relates to conjugates comprising an aptamer, a spacer moiety comprising at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and a lipid moiety of the formula: wherein each R is independently C1-24 alkyl or C2-24 alkenyl.

[0136] In some embodiments, an RNA aptamer conjugated to DSPE lipid e.g. a spacer-lipid moiety as described herein) is provided as an intermediate conjugate having an unreacted reactive moiety (RA). Such intermediate conjugates may be used for the subsequent attachment of a functional moiety, such as a therapeutic or imaging moiety.

[0137] Accordingly, provided herein is an intermediate conjugate of the formula:

[0138] Spacer — Lipid (IVa);

[0139] RAis a reactive moiety (e.g. to allow for conjugation to a functional moiety);

[0140] MBis an aptamer; the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula: wherein each R is independently C1-24 alkyl or C2-24 alkenyl.

[0141] Transferrin Receptor

[0142] In some embodiments, the aptamer is capable of binding to transferrin receptor (TfR). The transferrin receptor (TfR) is a membrane glycoprotein expressed on the cellular surface and mediates cellular uptake of iron from the plasma glycoprotein transferrin. Iron uptake from transferrin involves the binding of transferrin to TfR. The bound transferrin is then internalized through receptor-mediated endocytosis in an endocytic vesicle. The release of transferrin from TfR is induced by a decrease in the pH within the endocytic vescile. TfR is expressed on a broad variety of cells at varying levels. For example, TfR is highly expressed on brain endothelial cells, immature erythroid cells, placental tissue, and rapidly dividing cells, both normal and malignant. The term "TfR" as provided herein includes any of the transferrin receptor (TfR) protein naturally occurring forms, homologs or variants that maintain the activity of TfR (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein). In some embodiments, variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form. In embodiments, the TfR protein is the protein as identified by the NCBI sequence reference Gl:189458817 (NCBI Reference Sequence: NP_003225.2; SEQ ID NO:6). In embodiments, the TfR protein is the protein as encoded by the nucleotide sequence identified by the NCBI sequence reference Gl:189458816 (NCBI Reference Sequence: NM_003234.3). In embodiments, the TfR protein is the protein as encoded by the nucleotide sequence identified by the NCBI sequence reference Gl:189458818 (NCBI Reference Sequence: NM_001128148.2). In embodiments, the TfR protein is the protein as identified by the NCBI sequence reference Gl:189458817 (NCBI Reference Sequence: NP_003225.2; SEQ ID NO:6), homolog or functional fragment thereof. In embodiments, the TfR protein is the protein as encoded by the nucleotide sequence identified by the NCBI sequence reference Gl:189458816 (NCBI Reference Sequence: NM_003234.3), homolog or functional fragment thereof. In embodiments, the TfR protein is the protein as encoded by the nucleotide sequence identified by the NCBI sequence reference Gl:189458818 (NCBI Reference Sequence: NM_001128148.2), homolog or functional fragment thereof. In embodiments, the TfR protein is encoded by a nucleic acid sequence corresponding to NCBI Gene ID: 7037.

[0143] TfR is expressed at low levels on normal cells. TfR is expressed at high levels on brain endothelial cells. Cells with high-proliferation rates, such as activated immune cells and cancers, also present upregulated expression of TfR. The conjugates of the present invention thus provide a mechanism to deliver therapeutic moieties across the blood-brain barrier and to a broad variety of cells via TfR binding through the aptamer portion. The conjugates may be internalised into TfR-expressing cells, thus providing an efficient mechanism for targeted intracellular delivery.

[0144] The present invention provides conjugates comprising: (i) an aptamer capable of binding to transferrin receptor (TfR), and (ii) a spacer-lipid moiety as described herein. The conjugates are inter alia capable of binding a transferrin receptor (TfR). In preferred embodiments, the TfR is on a cell and, in some cases, the conjugates are internalised into the cell.

[0145] WO 2016 / 061386 describes ribonucleic acid compounds that are capable of binding TfR. The ribonucleic acid compounds in WO 2016 / 061386 comprise RNA sequences having at least 30 nucleotides and are exemplified by compounds comprising RNA sequences that are 87 or 43 nucleotides in length. The three- dimensional structure of a ribonucleic acid compound, e.g. an aptamer, is essential for determining binding affinity and specificity.

[0146] Thus, the conjugates of the present invention provide highly specific and efficient means for targeted delivery of functional moieties across the blood brain barrier, as shown herein. In some aspects, aptamer capable of binding TfR comprises, or consists of, an RNA sequence having at least 80% sequence identity to SEQ ID NO: 1 or 40, and wherein the RNA sequence has a length of 29 nucleotides or fewer. SEQ ID NO:40 corresponds to a 2’ ESC substituted variant of SEQ ID NO:1 . Where “SEQ ID NO:1” is referred to throughout this description, unless otherwise stated it may be substituted for “SEQ ID NQ:40”.

[0147] In some embodiments the aptamer RNA sequence has at least 80% sequence identity to a nucleic acid that hybridises to SEQ ID NO:1 or 40. In some cases the aptamer RNA sequence has at least 85%, at least 87%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or at least 100% sequence identity to a nucleic acid that hybridises to SEQ ID NO:1 or 40. In some embodiments, the aptamer RNA sequence consists of SEQ ID NO:1 or 40. In some embodiments, the aptamer RNA sequence binds to a transferrin receptor (TfR) . In some embodiments, the TfR is on a cell surface. In some embodiments, the nucleic acid compound is capable of being internalised into a cell. In some cases, the cell is a TfR-expressing cell.

[0148] Accordingly, in some embodiments is provided a conjugate of the following formulae: Lipid wherein r is 1 ;

[0149] MAis a functional moiety, wherein the functional moiety is selected from the group consisting of therapeutic moieties and imaging moieties;

[0150] MBis an aptamer comprising an RNA sequence having at least 80% sequence identity to SEQ ID NO:1 or 40; the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula: or wherein each R is independently C1-24 alkyl or C2-24 alkenyl.

[0151] In some aspects, the aptamer capable of binding TfR comprises, or consists of, an aptamer RNA sequence having at least 80% sequence identity to SEQ ID NO:5, and wherein the aptamer RNA sequence has a length of 29 nucleotides or fewer.

[0152] In some embodiments the aptamer RNA sequence has at least 85%, at least 87%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:5. In some embodiments, the aptamer RNA sequence has at least 90% sequence identity to SEQ ID NO:5. In some embodiments, the aptamer RNA sequence has 100% sequence identity to SEQ ID NO:5.

[0153] In some embodiments an aptamer RNA sequence provided herein has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer. In some cases the aptamer RNA sequence has a length of 22 nucleotides or fewer. In some embodiments the aptamer RNA sequence is between 16 and 29 nucleotides in length. In some embodiments the aptamer RNA sequence is between 16 and 22 nucleotides in length.

[0154] In some embodiments the aptamer RNA sequence is 16 nucleotides in length. In some embodiments the aptamer RNA sequence is 17 nucleotides in length. In some embodiments the aptamer RNA sequence is 18 nucleotides in length. In some embodiments the aptamer RNA sequence is 19 nucleotides in length. In some embodiments the aptamer RNA sequence is 20 nucleotides in length. In some embodiments the aptamer RNA sequence is 21 nucleotides in length. In some embodiments the aptamer RNA sequence is 22 nucleotides in length. In some embodiments the aptamer RNA sequence is 23 nucleotides in length. In some embodiments the aptamer RNA sequence is 24 nucleotides in length. In some embodiments the aptamer RNA sequence is 25 nucleotides in length. In some embodiments the aptamer RNA sequence is 26 nucleotides in length. In some embodiments the aptamer RNA sequence is 27 nucleotides in length. In some embodiments the aptamer RNA sequence is 28 nucleotides in length. In some embodiments the aptamer RNA sequence is 29 nucleotides in length.

[0155] In some cases, the aptamer RNA sequence has at least 80% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer.

[0156] In some cases, the aptamer RNA sequence has at least 85% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer.

[0157] In some cases, the aptamer RNA sequence has at least 87% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer. In some cases, the aptamer RNA sequence has at least 90% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer.

[0158] In some cases, the aptamer RNA sequence has at least 91% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer.

[0159] In some cases, the aptamer RNA sequence has at least 92% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer.

[0160] In some cases, the aptamer RNA sequence has at least 93% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer.

[0161] In some cases, the aptamer RNA sequence has at least 94% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer.

[0162] In some cases, the aptamer RNA sequence has at least 95% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer.

[0163] In some cases, the aptamer RNA sequence has at least 96% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer. In some cases, the aptamer RNA sequence has at least 97% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer.

[0164] In some cases, the aptamer RNA sequence has at least 98% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer.

[0165] In some cases, the aptamer RNA sequence has at least 99% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer.

[0166] In some cases, the aptamer RNA sequence has at least 100% sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and has a length of 29 nucleotides or fewer, 28 nucleotides or fewer, 27 nucleotides or fewer, 26 nucleotides or fewer, 25 nucleotides or fewer, 24 nucleotides or fewer, 23 nucleotides or fewer, 22 nucleotides or fewer, 21 nucleotides or fewer, 20 nucleotides or fewer, 19 nucleotides or fewer, 18 nucleotides or fewer, 17 nucleotides or fewer, or 16 nucleotides or fewer.

[0167] In some embodiments, an aptamer RNA sequence provided herein comprises or consists of SEQ ID NO:1 and further comprises 1 , 2, 3, 4 or more nucleotide modifications to SEQ ID NO:1 . Such modifications may be nucleotide additions, substitutions, and / or deletions.

[0168] In some cases, an aptamer RNA sequence provided herein differs by 1, 2, 3, or 4 nucleotides compared to SEQ ID NO:1.

[0169] In some embodiments, an aptamer RNA sequence comprises SEQ ID NO:1 wherein one or more of positions 1 , 2, 3, 20, 21 and / or 22 are substituted for alternative nucleic acid residues, for example AMP, GMP, UMP, CMP, dAMP, dGMP, dTMP, and / or dCMP. That is, in some embodiments, the aptamer RNA sequence comprises SEQ ID NO:5 and 3 additional nucleotides at each of the 5’ end and 3’ end.

[0170] In some embodiments, the aptamer RNA sequence comprises or consists of SEQ ID NO:5 and further comprises 1 , 2, 3, 4 or more nucleotide modifications to SEQ ID NO:5. Such modifications may be nucleotide additions, substitutions, and / or deletions.

[0171] In some cases, an aptamer RNA sequence provided herein differs by 1, 2, 3, or 4 nucleotides compared to SEQ ID NO:5. Nucleotide positions 4 to 8 of SEQ ID NO:1 are predicted to form base pairing with nucleotide positions 15 to 19. Nucleotide positions 1 to 5 of SEQ ID NO:5 are predicted to form base pairing with nucleotide positions 12 to 16. In some embodiments, an aptamer RNA sequence comprises SEQ ID NO:1 , wherein nucleotides at any i.e. one or more of positions 4 to 8 and / or 15 to 19 are substituted with nucleotide residues that result in non-canonical base pairing. In some embodiments, an aptamer RNA sequence comprises SEQ ID NO:5, wherein nucleotides at any i.e. one or more of positions 1 to 5 and / or 12 to 16 are substituted with nucleotide residues that result in non-canonical base pairing. For example, A or U / T may be replaced with C or G and vice versa. In some cases, an U-A pairing may be replaced with U-G.

[0172] In some embodiments, the aptamer RNA sequence has at least 85% sequence identity to any of SEQ ID NOs 1 , 2, 3, 4 or 5. In some embodiments, the nucleic acid sequence has 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to any of SEQ ID NOs 1 , 2, 3, 4 or 5.

[0173] In some aspects, an aptamer capable of binding TfR comprises, or consists of, an aptamer RNA sequence having at least 85% sequence identity to SEQ ID NQ:20, wherein said nucleic acid sequence is at least 30 nucleotides in length and at most 50 nucleotides in length. In some embodiments, an aptamer capable of binding TfR comprises, or consists of a acid sequence according to SEQ ID NO: 19 or 20.

[0174] In some embodiments, the aptamer RNA sequence has 100% sequence identity to SEQ ID NO:19. In some embodiments, the aptamer RNA sequence has at least 85% sequence identity to SEQ ID NQ:20, wherein said aptamer RNA sequence is at least 30 nucleotides in length and at most 42 nucleotides in length.

[0175] In some embodiments, the aptamer RNA sequence is 32 nucleotides in length and preferably has at least 85% sequence identity to SEQ ID NQ:20. In some embodiments, the aptamer RNA sequence has 100% sequence identity to SEQ ID NQ:20.

[0176] In some embodiments, the nucleic acid sequence has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:19. In some embodiments, the nucleic acid sequence has 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:19. In some embodiments, the nucleic acid sequence consists of SEQ ID NO:19.

[0177] In some embodiments, the nucleic acid sequence has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NQ:20. In some embodiments, the nucleic acid sequence has 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NQ:20. In some embodiments, the nucleic acid sequence consists of SEQ ID NQ:20. In some embodiments, the nucleic acid sequence hybridises with a SEQ ID NQ:20. In some embodiments, the nucleic acid sequence hybridises with a sequence which has at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98% or at least 99% sequence identity to SEQ ID NO:20. In some embodiments, the nucleic acid sequence hybridises with a sequence which has 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NQ:20.

[0178] In some embodiments, the nucleic acid sequence is 30, 31 , 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, or 42 nucleotides in length. In some embodiments, the nucleic acid sequence is 44, 45, 46, 47, 48, 49 or 50 nucleotides in length. In some embodiments, the nucleic acid sequence is less than 43 nucleotides in length. In some embodiments, the nucleic acid sequence is more than 43 nucleotides in length.

[0179] In some embodiments, the aptamer comprises, or consists of a nucleic acid sequence that is at least 30 and at most 46 nucleotides in length. In some embodiments, the aptamer comprises, or consists of a nucleic acid sequence that is at least 44 and at most 50 nucleotides in length. In some embodiments, the aptamer comprises, or consists of a nucleic acid sequence that is at least 44 and at most 46 nucleotides in length. In some embodiments, the aptamer comprises, or consists of a nucleic acid sequence having a length of 46 nucleotides. In some embodiments, the aptamer comprises, or consists of a nucleic acid sequence that is at least 30 and at most 40 nucleotides in length. In some embodiments, the aptamer comprises, or consists of a nucleic acid sequence that is at least 32 and at most 40 nucleotides in length. In some embodiments, the aptamer comprises, or consists of a nucleic acid sequence that is at least 35 and at most 40 nucleotides in length. In some embodiments, the aptamer comprises, or consists of a nucleic acid sequence that is at least 30 and at most 35 nucleotides in length. In some embodiments, the aptamer comprises, or consists of a nucleic acid sequence that is at least 30 and at most 32 nucleotides in length. In some embodiments, the aptamer comprises, or consists of a nucleic acid sequence having a length of 40 nucleotides. In some embodiments, the aptamer comprises, or consists of a nucleic acid sequence having a length of 32 nucleotides.

[0180] In some embodiments, the nucleic acid sequence is from 23 to 50, from 23 to 46, from 23 to 42, from 23 to 32, from 30 to 50, from 30 to 46, from 30 to 42, from 30 to 35, from 32 to 42, from 32 to 46, from 32 to 50, from 40 to 42, from 44 to 46, from 44 to 50, or from 46 to 50 nucleotides in length.

[0181] In some embodiments, an aptamer RNA sequence provided herein comprises or consists of SEQ ID NO: 19 or 20, and further comprises 1 , 2, 3, 4 or more nucleotide modifications to SEQ ID NO: 19 or 20. Such modifications may be nucleotide additions, substitutions, and / or deletions.

[0182] In some cases, an aptamer RNA sequence provided herein differs by 1, 2, 3, or 4 nucleotides compared to SEQ ID NO: 19 or 20. In some embodiments, an aptamer RNA sequence comprises SEQ ID NO: 19 or 20 wherein one or more of positions 1, 2, 3, 20, 21 and / or 22 are substituted for alternative nucleic acid residues, for example AMP, GMP, UMP, CMP, dAMP, dGMP, dTMP, and / or dCMP. That is, in some embodiments, the aptamer RNA sequence comprises SEQ ID NO:5 and 3 additional nucleotides at each of the 5’ end and 3’ end.

[0183] In some aspects, the aptamer capable of binding TfR comprises, or consists of, an aptamer RNA sequence having at least 80% sequence identity to SEQ ID NO:2, 3, 21 or 22, and wherein the aptamer RNA sequence is at least 40 nucleotides in length. In embodiments, the aptamer capable of binding TfR comprises, or consists of, an aptamer RNA sequence having at least 80% sequence identity to SEQ ID NO:2, or 3, and wherein the aptamer RNA sequence is at least 40 nucleotides in length. In embodiments, the aptamer capable of binding TfR comprises, or consists of, an aptamer RNA sequence having at least 80% sequence identity to SEQ ID NO:2, 3 or 22, and wherein the aptamer RNA sequence is at least 40 nucleotides in length. In embodiments, the aptamer capable of binding TfR comprises, or consists of, an aptamer RNA sequence having at least 80% sequence identity to SEQ ID NO:2 or 3. and wherein the aptamer RNA sequence is at least 40 nucleotides in length.

[0184] Where the aptamer RNA sequence has at least 80% (80% or more) sequence identity to SEQ ID NO:2, 3, 21 or 22, the aptamer RNA sequence may have 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:2, 3, 21 or 22.

[0185] In some embodiments, the aptamer RNA sequence has at least 80% (80% or more) sequence identity to a nucleic acid that hybridizes to a sequence selected from SEQ ID NO:2, 3, 21 or 22, and is at least 40 nucleotides in length. In some embodiments, the aptamer RNA sequence has 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to a nucleic acid that hybridises to a sequence selected from SEQ ID NO:2, 3, 21 or 22. In some embodiments, the aptamer RNA sequence hybridizes to a sequence that has 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:2, 3, 21 or 22 and which is at least 40 nucleotides in length.

[0186] Where the aptamer RNA sequence is at least 50 (50 nucleotides or more) nucleotides in length, the aptamer RNA sequence may be at least 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 nucleotides in length. In some embodiments, the aptamer RNA sequence is at least 50 nucleotides in length. Where the aptamer RNA sequence is at least 40 (40 nucleotides or more) nucleotides in length, the aptamer RNA sequence is at least 40, 41 , 42, 43, 44, 45, 45, 47, 48, 49, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190 or 200 nucleotides in length. Thus, in some embodiments, the aptamer RNA sequence is about 43 nucleotides in length.

[0187] In some embodiments, an aptamer RNA sequence provided herein comprises or consists of SEQ ID NO: 2, 3 or 21 , and further comprises 1 , 2, 3, 4 or more nucleotide modifications to SEQ ID NO: 2, 3 or 21 . Such modifications may be nucleotide additions, substitutions, and / or deletions. In some cases, an aptamer RNA sequence provided herein differs by 1, 2, 3, or 4 nucleotides compared to SEQ ID NO: 2, 3 or 21.

[0188] In some embodiments, an aptamer RNA sequence comprises SEQ ID NO: 2, 3 or 21 wherein one or more of positions 1, 2, 3, 20, 21 and / or 22 are substituted for alternative nucleic acid residues, for example AMP, GMP, UMP, CMP, dAMP, dGMP, dTMP, and / or dCMP. That is, in some embodiments, the aptamer RNA sequence comprises SEQ ID NO:5 and 3 additional nucleotides at each of the 5’ end and 3’ end.

[0189] Any RNA sequence as described herein may further comprise additional nucleotides. Additional nucleotides may be added onto the 5’ end, the 3’ end, or both the 5’ and 3’ ends of the RNA sequence. In some embodiments, an aptamer RNA sequence comprising SEQ ID NO:1 , 2, 3, 5, 20 or 21 as described herein comprises a total of 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or more additional nucleotides. Where an aptamer RNA sequence comprises SEQ ID NO:1 , the aptamer RNA sequence may comprise a total of 7 or fewer additional nucleotides. Where an aptamer RNA sequence comprises SEQ ID NO:5, the aptamer RNA sequence may comprise a total of 13 or fewer additional nucleotides.

[0190] In embodiments described hereinabove, the aptamer RNA sequence may be capable of binding to a transferrin receptor (TfR). Thus, an aptamer RNA sequence provided herein may have at least 80% (at least 85% etc, as described hereinabove) sequence identity to SEQ ID NO:1 or SEQ ID NO:5 and a length of 16 to 29 nucleotides (as described hereinabove), and wherein the aptamer RNA sequence is capable of binding to a transferrin receptor (TfR). In any embodiment, the nucleic acid compound binds to TfR. In any embodiment, the aptamer RNA sequence binds to TfR. In any embodiment, the TfR is on a cell surface. In any embodiment, the nucleic acid compound is capable of being internalised into a cell. In any embodiment, the cell is a TfR-expressing cell.

[0191] In some embodiments, the conjugate has a 5’-GGG motif at the 5’ end of the aptamer RNA sequence. Without wishing to be bound by theory, a 5’-GGG motif at the 5’ end of the aptamer RNA sequence may increase the extent to which the conjugate is internalised into a cell. A 5’-GGG motif may be sufficient, if not necessary, for internalisation into a cell. In some embodiments, the conjugate does not have a 5’- GGG motif at the 5’ end of the aptamer RNA sequence.

[0192] In embodiments of any of the aspects of the invention, the conjugate is capable of binding to a transferrin receptor (TfR) via the aptamer RNA sequence. In some embodiments, the aptamer RNA sequence binds to a transferrin receptor (TfR). In some embodiments, the TfR is on a cell surface. In some embodiments, the conjugate is capable of being internalised into a cell. In some cases, the cell is a TfR-expressing cell.

[0193] The term “on a cell surface” as used herein refers to the location of a molecule, e.g. transferrin receptor protein, on the surface of a cell. The molecule may be associated in some way with the cell membrane. For example, the molecule may be an integral or transmembrane protein which spans the cell membrane and comprises a cytosolic domain and an extracellular domain, the molecule may be lipid anchored i.e. covalently bound to single or multiple lipid molecules in the cell membrane, or the molecule may be attached to an integral membrane protein.

[0194] The term “capable of being internalised into a cell” as used herein refers to the ability of a nucleic molecule of the present invention to be transported from the outside of a cell into a cell. This may be performed by cellular mechanisms such as endocytosis or phagocytosis. In some cases, the nucleic acids are internalised after they bind to TfR, for example by clathrin-mediated endocytosis of a TfR-nucleic acid complex (see e.g. Qian ZM et al., Pharmacol Rev. 2002, 54(4) :561-587).

[0195] A “TfR-expressing cell” is a cell which produces TfR and displays TfR on the cell surface, e.g. as a membrane protein.

[0196] In some embodiments, the aptamer RNA sequence has an equilibrium dissociation constant (KD) for TfR of less than about 1x10-8, 1x10-9, 1x10-10, 1x10-11, or less than 1x10-12M. In some embodiments, the aptamer RNA sequence has KDfor TfR of between 1x10-8and 1x10-13M, between 1x10-9and 1x10-13M, between 1x10-10and 1x10-13M, between 1x10-11and 1x10-13M, or between 1x10-12and 1x10-13M. In some embodiments, the aptamer RNA sequence has a KDfor TfR of between 1 and 5 x10‘10M, of between 1 and 5 x10-11M, or of between 5 x10-13and 1 x10-12M. In some embodiments, the aptamer RNA sequence has a KDfor TfR of between 1 x10’9and 1 x10‘10M, 1 x10‘10and 1 x10‘11M, or of 1 x10‘12and 1 x10-13M. In some embodiments, the aptamer RNA sequence has a higher affinity for TfR than TR14.

[0197] Two transferrin receptors, transferrin receptor 1 (TfR1 ) and transferrin receptor 2 (TfR2), have been characterized in humans. Both are cell membrane proteins, however their expression differs within the body. TfR1 is expressed throughout the body, but is highly (>100,000X) upregulated in cancer compared to normal cells. TfR1 is also capable of facilitating transport traversing the blood-brain barrier. TfR2 meanwhile is expressed only in hepatocytes. Aptamers which preferentially, or exclusively, bind to different forms of TfR therefore can be used for differential trafficking of cargo to different destinations.

[0198] In some embodiments, the aptamer is capable of binding (e.g. preferentially or exclusively binding) to TfR2. Such a conjugate may be particularly useful for preferentially delivering the functional moiety to liver cells. The 43nt truncation TR14 S2 (SEQ ID NO:3 or 43) preferentially binds TfR2 and may find use in such embodiments. In some embodiments, the nucleic acid sequence has 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:3 or SEQ ID NO:43.

[0199] In some embodiments, the aptamer RNA sequence is capable of binding to both TfR1 and TfR2.

[0200] In some embodiments, the aptamer is capable of binding to TfR1 and TfR2. Such a conjugate may be particularly useful for preferentially delivering the functional moiety to cancerous liver cells compared to non-liver and / or non-cancerous cells. It may be especially useful for preferentially delivering a therapeutic moiety (e.g. siRNA) to cancerous liver cells compared to non-cancerous liver cells. Exemplary aptamers capable of binding both TfR1 and TfR2 comprise or consist of the 87nt TR14 (SEQ ID NO:2), the 46nt TR14 S1 (SEQ ID NO:22), or RNA sequences having at least 90% identity and more than 43 nucleotides thereof. In some embodiments, the nucleic acid sequence has 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO:2 or SEQ ID NO:22.

[0201] Whilst binding to TfR1 and TfR2 may be advantageous, it is not necessary for a single aptamer to posses both properties. Instead, it may be preferred to combine an aptamer which exclusively or preferentially binds TfR1 and an aptamer which exclusively or preferentially binds TfR2 within a single retargeting moiety of the invention. This may have several advantages, including easier synthesis, shorter total length, and better specificity for either or both TfRs when compared to a bispecific aptamer.

[0202] In some embodiments, the conjugate comprises two or more aptamers. For example, two or more aptamers capable of binding to transferrin receptor, preferably two different transferrin receptors. Suitable first and second aptamers are provided above. Preferably, the first aptamer may comprise or consist of an RNA sequence having at least 90% sequence identity to SEQ ID NO:1 or SEQ ID NQ:40, where said RNA sequence has a length of 29 nucleotides or fewer, and may comprise or consist of SEQ ID NO:1 or SEQ ID NQ:40. The second aptamer may comprise or consist of SEQ ID NO: 3 or 43.

[0203] Accordingly, provided herein is a conjugate of the following formulae: Lipid wherein r is 2;

[0204] MAis a functional moiety, wherein the functional moiety is selected from the group consisting of therapeutic moieties and imaging moieties; each MBis independently an aptamer (e.g. a first aptamer capable of binding TfR1 and a second aptamer capable of binding TfR2); the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula: wherein each R is independently C1-24 alkyl or C2-24 alkenyl.

[0205] Alternative targeting moieties

[0206] Disclosed herein are conjugates which differ from those as outlined above by replacing the aptamer portion with an alternative targeting moiety. As used herein, an “alternative targeting moiety” is any moiety capable of selectively binding to one or more surface proteins on a cell. In some embodiments, a targeting moiety is internalised into the cell after binding the surface protein. In some embodiments, the surface protein is differentially expressed (i.e. is present or disproportionately expressed, preferably exclusively present) on one or more cell types. In some embodiments, the surface protein is differentially expressed on cancerous cells compared to healthy cells. In some embodiments, the surface protein is differentially expressed on hepatocytes.

[0207] In some embodiments, an alternative targeting moiety is an antibody or antigen-binding fragment thereof. For example, in some embodiments the targeting moiety is an antibody which can specifically bind to cell surface receptors, thus facilitating targeted delivery of the conjugate.

[0208] A further exemplary alternative targeting moiety comprises one or more N-Acetylgalactosamine (GalNAc) residue. GalNAc is an amino sugar derivative of galactose, capable of binding to asialoglycoprotein receptors on hepatocytes (Nair et al). As such, GalNAc finds use as a targeting ligand for siRNA in the context of treating cancers of the liver. In some embodiments, a conjugate according to the present disclosure comprises a targeting moiety comprising 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10 or more GalNAc residues.

[0209] Functional Moieties

[0210] The conjugates or intermediate conjugates of the present invention may comprise a functional moiety.

[0211] The functional moiety may comprise a therapeutic moiety or an imaging moiety.

[0212] :ic Moieties

[0213] In some embodiments, the functional moiety is a therapeutic moiety. The therapeutic moiety may be a nucleic acid moiety, a peptide or polypeptide moiety or a small molecule drug moiety.

[0214] Accordingly, provided herein is a conjugate of the following formula: Spacer —Lipid wherein r is 0 or 1 ;

[0215] MAis a therapeutic moiety;

[0216] MBis a targeting moiety (e.g. an aptamer capable of binding to TfR); the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula: wherein each R is independently C1-24 alkyl or C2-24 alkenyl. In some embodiments, a therapeutic moiety conjugated to DSPE lipid is provided as an intermediate conjugate having an unreacted reactive moiety (RB). Such intermediate conjugates may be used for the subsequent attachment of a targeting moiety, such as an aptamer capable of binding to TfR.

[0217] Accordingly, provided herein is an intermediate conjugate of the formula:

[0218] Spacer — Lipid (IVb);

[0219] MAis a therapeutic moiety;

[0220] RBis a reactive moiety (e.g. to allow for conjugation to a targeting moiety e.g. an aptamer); the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula: wherein each R is independently C1-24 alkyl or C2-24 alkenyl.

[0221] In some embodiments, the therapeutic moiety is a nucleic acid moiety (sometimes referred to herein as “oligonucleotides”). For example, the therapeutic moiety may be an antisense nucleic acid, a small interfering RNA (siRNA), a small activating RNA (saRNA), a micro-RNA (miRNA) or an aptamer.

[0222] In some embodiments, the therapeutic moiety is an antisense nucleic acid. An "antisense nucleic acid" as referred to herein is a nucleic acid (e.g. DNA or RNA molecule) that is complementary to at least a portion of a specific target nucleic acid (e.g. an mRNA translatable into a protein) and is capable of reducing transcription of the target nucleic acid (e.g. mRNA from DNA) or reducing the translation of the target nucleic acid (e.g. mRNA) or altering transcript splicing (e.g. single stranded morpholino oligo). See, e.g., Weintraub, Scientific American, 262:40 (1990). Typically, synthetic antisense nucleic acids (e.g. oligonucleotides) are generally between 15 and 25 bases in length. Thus, antisense nucleic acids are capable of hybridizing to (e.g. selectively hybridizing to) a target nucleic acid (e.g. target mRNA). In embodiments, the antisense nucleic acid hybridizes to the target nucleic acid sequence (e.g. mRNA) under stringent hybridization conditions. In embodiments, the antisense nucleic acid hybridizes to the target nucleic acid (e.g. mRNA) under moderately stringent hybridization conditions. Antisense nucleic acids may comprise naturally occurring nucleotides or modified nucleotides such as, e.g., phosphoroth ioate, methylphosphonate, and -anomeric sugar-phosphate, backbone modified nucleotides.

[0223] In the cell, the antisense nucleic acids hybridize to the corresponding mRNA, forming a double-stranded molecule. The antisense nucleic acids interfere with the translation of the mRNA, since the cell will not translate an mRNA that is double-stranded. The use of antisense methods to inhibit the in vitro translation of genes is well known in the art (Marcus-Sakura, Anal. Biochem., 172:289 (1988)). Further, antisense molecules which bind directly to the DNA may be used. Antisense nucleic acids may be single or double stranded nucleic acids. Non-limiting examples of antisense nucleic acids include siRNAs (including their derivatives or pre-cursors, such as nucleotide analogs), short hairpin RNAs (shRNA), micro RNAs (miRNA), saRNAs (small activating RNAs) and small nucleolar RNAs (snoRNA) or certain of their derivatives or pre-cursors.

[0224] In some embodiments, the therapeutic moiety is an siRNA. As used herein, a "siRNA," "small interfering RNA," "small RNA," or "RNAi", refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when expressed in the same cell as the gene or target gene. The complementary portions of the nucleic acid that hybridize to form the double stranded molecule typically have substantial or complete identity. Typically, the siRNA technique uses a synthetic double-stranded nucleic acid duplex, in which each strand is from 19-23 nucleotides in length, with 2 nucleotides in each strand forming a 3’ overhang. These 3’ overhangs may be RNA or DNA whereas the double-stranded region is entirely RNA. Typically, the 3’ overhangs are symmetrical and have the sequence 5’-UU-3’ or 5’-UG-3’ (5’-TT-3’ or 5’-TG-3’ if the 3’ overhang is DNA) . In one embodiment, a siRNA or RNAi is a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded siRNA. In embodiments, the siRNA inhibits gene expression by interacting with a complementary cellular mRNA thereby interfering with the expression of the complementary mRNA. Typically, the nucleic acid is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length). In other embodiments, the length is 20-30 base nucleotides, preferably about 20-25 or about 24-30 nucleotides in length, e.g., 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length. The processes for the generation of siRNAs is well-known to the skilled person.

[0225] In some embodiments, the conjugates of the invention comprise a CCAAT / enhancer-binding protein (C / EBP ) siRNA. The term "C / EBPb", “C / EBP ” or "C / EBPbeta" as provided herein includes any of the CCAAT (cytosine-cytosine-adenosine-adensoine-thymidine) / enhancer-binding protein beta (C / EBPb) naturally occurring forms, homologs or variants that maintain the transcription factor activity of C / EBPbeta (e.g., within at least 50%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% activity compared to the native protein) . In some embodiments, variants or homologs have at least 90%, 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity across the whole sequence or a portion of the sequence (e.g. a 50, 100, 150 or 200 continuous amino acid portion) compared to a naturally occurring form. In embodiments, the C / EBPbeta protein is the protein as identified by the NCBI sequence reference NP_001272807.1 , NP_001272807.1 , Gl: 6753404 (NP_034013.1 ), Gl: 567757572 (NP_001274668.1 ) , Gl: 567757569 (NP_001274667.1 ) , or homolog or functional fragment thereof. In embodiments, the C / EBPbeta protein is encoded by a nucleic acid sequence corresponding to Gene ID: 1051 .

[0226] A C / EBPp siRNA is able to bind and suppress the expression and / or expression of a C / EBPp mRNA. The C / EBPp mRNA may comprise or consist of a sequence having 70%, 80%, 90%, 95% or 100% sequence identity to SEQ ID NO:23. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence with at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to a sequence selected from SEQ ID NOs 7, 9, 11 and 13, and which is capable of reducing or inhibiting expression of C / EBPp mRNA within a cell. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence comprising no more than 3, 2 or 1 substitutions relative to SEQ ID NOs: 7, 9, 11 and 13. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence having a continuous 18, 19 or 20 amino acids of any one of SEQ ID NOs: 7, 9, 11 and 13. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence having amino acids 1-18 of any one of SEQ ID NOs: 7, 9, 11 and 13. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence having amino acids 1-19 of any one of SEQ ID NOs: 7, 9, 11 and 13. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence selected from SEQ ID NOs 7, 9, 11 and 13.

[0227] In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence with at least 80%, at least 85%, at least 90%, or at least 95% sequence identity to a sequence selected from SEQ ID NOs 7, and 9, and which is capable of reducing or inhibiting expression of C / EBPp mRNA within a cell. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence comprising no more than 3, 2 or 1 substitutions relative to SEQ ID NOs: 7, and 9. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence having a continuous 18, 19 or 20 amino acids of any one of SEQ ID NOs: 7, and 9. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence having amino acids 1-18 of any one of SEQ ID NOs: 7, and 9. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence having amino acids 1-19 of any one of SEQ ID NOs: 7, and 9. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence having amino acids 1-20 of any one of SEQ ID NOs: 7, and 9. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence selected from SEQ ID NOs 7, and 9.

[0228] In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence which hybridises to one of SEQ ID NOs 8, 10, 12 and 14. In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence which hybridises to one of SEQ ID NOs 8 or 10.

[0229] In some embodiments, the C / EBPp siRNA comprises a nucleic acid sequence which binds a region of C / EBPp mRNA which at least partially overlaps with the binding site of one of SEQ ID NOs 8, 10, 12 and 14. A partially overlapping binding site may comprise 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13, 14, 15, 16, 17, 18, 19, 20 or more overlapping residues. The overlap may be total i.e. the binding site of the siRNA may comprise or consist of that of SEQ ID NOs: 8, 10, 12 or 14 in its entirety. In some embodiments, the C / EBPp siRNA competes with one of SEQ ID NOs 8, 10, 12 or 10 for binding to C / EBPp mRNA.

[0230] In some embodiments, the therapeutic moiety is a saRNA. As used herein, a "saRNA," or "small activating RNA" refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to increase or activate expression of a gene or target gene when expressed in the same cell as the gene or target gene. The complementary portions of the nucleic acid that hybridize to form the double stranded molecule typically have substantial or complete identity. In one embodiment, a saRNA is a nucleic acid that has substantial or complete identity to a target gene and forms a double stranded saRNA. Typically, the nucleic acid is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded saRNA is 15-50 nucleotides in length, and the double stranded saRNA is about 15-50 base pairs in length). In other embodiments, the length is 20-30 base nucleotides, preferably about 20-25 or about 24-29 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

[0231] In some embodiments, the therapeutic moiety is a SIRT1 saRNA moiety, or a HNF saRNA moiety.

[0232] In some embodiments, the therapeutic moiety is a sirtuin saRNA moiety. A ‘‘sirtuin saRNA” as provided herein is a saRNA capable of activating and / or increasing the expression of a sirtuin gene, e.g. SIRT1, SIRT2, SIRT3, SIRT4, SIRT5, SIRT6 or SIRT7. In some embodiments, the therapeutic moiety is a SIRT1 saRNA moiety. A “SIRT1 saRNA” as provided herein is a saRNA capable of activating and / or increasing the expression of a SIRT1 gene and / or a Sirtl protein. In some cases, for example, the saRNA sequence comprises SEQ ID NO:7 and / or SEQ ID NO:8.

[0233] In some embodiments, the therapeutic moiety is a HNF saRNA moiety. A ‘‘HNF saRNA” as provided herein is a saRNA capable of activating and / or increasing the expression of a HNF gene and / or protein, for example HNF4 (including isoforms and variants thereof). The term ‘‘HNF” refers to one or more hepatocyte nuclear factors. Hepatocyte nuclear factors are a group of transcription factors expressed predominantly in the liver which regulate gene expression. HNF may refer to hepatocyte nuclear factor 4 (HNF4), a nuclear receptor protein expressed mostly in the liver, gut, kidney and pancreatic beta cells. An HNF saRNA may be an HNF4 saRNA. That is, an HNF saRNA may be one that modulates the expression, e.g. activates and / or increases the expression, of a HNF4 gene and / or protein.

[0234] In some embodiments, the therapeutic moiety is a miRNA. The term "miRNA" is used in accordance with its plain ordinary meaning and refers to a small non-coding RNA molecule capable of post- transcriptionally regulating gene expression. In one embodiment, a miRNA is a nucleic acid that has substantial or complete identity to a target gene. In some embodiments, the miRNA inhibits gene expression by interacting with a complementary cellular mRNA thereby interfering with the expression of the complementary mRNA. Typically, the miRNA is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the miRNA is 15-50 nucleotides in length, and the miRNA is about 15-50 base pairs in length). In other embodiments, the length is 20-30 base nucleotides, preferably about 20-25 or about 24-29 nucleotides in length, e.g., 20, 21 , 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.

[0235] In some embodiments, the functional moiety is anti-miR-125b1 . miR-125b1 is upregulated in neurogenerative diseases such as Alzheimer’s disease. In some embodiments, the therapeutic moiety is an anti-miR-125b1 having a nucleic acid sequence having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 47 or 48. In some embodiments, the therapeutic moiety is an anti-miR-125b1 having a nucleic acid sequence according to SEQ ID NO: 47 or 48. In some embodiments, the therapeutic moiety is an aptamer. For example, an aptamer capable of binding to transferrin receptor (TfR) as described herein. In some embodiments, the therapeutic moiety is an aptamer having a therapeutic effect in the brain, liver, kidney or lung.

[0236] Moieties

[0237] The functional moiety provided herein may be an imaging moiety. An “imaging moiety” as provided herein is a monovalent compound detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means.

[0238] Accordingly, provided herein is a conjugate of the following formula:

[0239] Ml Spacer — Lipid w r wherein r is 0 or 1 ;

[0240] MAis an imaging moiety;

[0241] MBis a targeting moiety (e.g. an aptamer capable of binding to TfR); the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula: wherein each R is independently C1-24 alkyl or C2-24 alkenyl.

[0242] In embodiments, the imaging moiety is covalently attached to the linker. Exemplary imaging moieties are without limitation 32P, radionuclides, positron-emitting isotopes, fluorescent dyes (e.g. Cy7), fluorophores, antibodies, bioluminescent molecules, chemoluminescent molecules, photoactive molecules, metals, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), magnetic contrast agents, quantum dots, nanoparticles, biotin, digoxigenin, haptens and proteins or other entities which can be made detectable, e.g., by incorporating a radiolabel into a peptide or antibody specifically reactive with a target peptide. Any method known in the art for conjugating an antibody to the moiety may be employed, e.g., using methods described in Hermanson, Bioconjugate Techniques 1996, Academic Press, Inc., San Diego. Exemplary fluorophores include fluorescein, rhodamine, GFP, coumarin, FITC, AIExa fluor, Cy3, Cy5, Cy7, BODIPY, and cyanine dyes. Exemplary radionuclides include Fluorine-18, Gallium-68, and Copper-64. Exemplary magnetic contrast agents include gadolinium, iron oxide and iron platinum, and manganese. In embodiments, the imaging moiety is a bioluminescent molecule. In embodiments, the imaging moiety is a photoactive molecule. In embodiments, the imaging moiety is a metal. In embodiments, the imaging moiety is a nanoparticle. In some embodiments, the imaging moiety is Cy7. Exemplary Conjugates

[0243] In some embodiments, the conjugate is of the formula: wherein n is 1-300, such as about 23 or about 22 or about 230 (preferably about 23 or about 22); MAis Cy7; and MBis an aptamer capable of binding to transferrin receptor (TfR). The counter cation may be any suitable counter cation, such as a proton (H+) a sodium cation (Na+). Preferably, the counter cation is a sodium cation. An example of this conjugate may be referred to herein as conjugate “C1-Cy7”.

[0244] In some embodiments, the conjugate is of the formula: wherein n is 1-300, such as about 23 or about 22 or about 230; MAis an anti-miR125b1 ; and MBis an aptamer capable of binding to transferrin receptor (TfR). The counter cation may be any suitable counter cation, such as a proton (H+) a sodium cation (Na+). Preferably, the counter cation is a sodium cation. An example of this conjugate may be referred to herein as conjugate “C2”.

[0245] Modifications

[0246] The nucleic acids (e.g. aptamers and therapeutic nucleic acids) described herein may contain chemical modifications, e.g. as defined herein, to enhance their functional characteristics, such as nuclease resistance or binding affinity. The modifications may be present in a ribonucleic acid compound, a RNA sequence and / or in a nucleotide-based compound moiety or compound, e.g. a saRNA, siRNA, miRNA, mRNA or aptamer.

[0247] In some cases, modifications may be made to the base, sugar ring, or phosphate group of one or more nucleotides.

[0248] In some cases, the nucleic acids described herein comprise one or more modified nucleobases. In some cases, the nucleobases are modified at the 2’ position, the 3’ position, the 5’ position or the 6’ position. For example, the ribonucleic acid compounds may comprise one or more ribo / deoxyribo nucleobases modified at the 2’ position with a fluoro (F), amino (NH2) or O-methyl (OMe) group. In some cases, the ribonucleic acid compounds may comprise one or more 2’-aminopyrimidines, 2’-fluoropyrimidines, 2'-O- methyl nucleotides and / or ‘locked’ nucleotides (LNA) (see e.g. Lin, Y et al., Nucleic Acids Res. 1994 22, 5229-5234 (1994) ; Ruckman, J. et al.. J. Biol. Chem. 1998 273, 20556-20567; Burmeister, PE et al., Chem. Biol. 2005 12, 25-33; Kuwahara, M. & Obika, S. Artif. DNA PNA XNA 20134, 39-48; Veedu, R.

[0249] N. & Wengel, J. Mol. Biosyst. 2009 5,787-792). This may be denoted in a sequence as described herein with a plus (“+”) before a locked nucleic acid (e.g. +T+C, indicating T and C are LNA).

[0250] In some cases, the nucleic acids comprise one or more L-form nucleic acids (see e.g. Maasch, C et aL, Nucleic Acids Symp. Ser. (Oxf.) 2008 52, 61-62). Other suitable nucleic acid modifications will be apparent to those skilled in the art (see, e.g. Ni S et al., Int. J. Mol. Sci 2017 18, 1683, hereby incorporated by reference in its entirety). A modified version of SEQ ID NO:1 is SEQ ID NO:40. An unmodified amino acid may be denoted by a preceding “r”, for example “C(F)G(OMe)rA” indicates a 2’fluorpyrimidine modified C residue, a 2’-O-methyl modified G residue, and an unmodified A residue.

[0251] In some embodiments, the nucleic acids comprise one or more ribo / deoxyribo nucleobases with a phosphoroth ioate (PS) backbone modification. This may be denoted in a sequence as described herein with an asterisk (“*”) between two residues (e.g. AG*CU, indicating a PS modification between G and C). A PS modification may be combined with further modifications, for example a 2’ substitution.

[0252] In some cases, a sense and / or antisense strand of a the nucleic acids moiety, e.g., mRNA, miRNA, siRNA or saRNA, may comprise a nucleotide overhang. For example, said overhang may be a 2- nucleotide (ULI) overhang. Said overhang may be on the 3’ end of one or both strands. An overhang may favour Dicer recognition of the nucleotide compound moiety.

[0253] In some cases, the nucleic acids described herein comprise an inverted thymidine cap on the 3’ end, or comprise 3’-biotin. In some cases, the phosphodiester linkage in the ribonucleic acid compounds in replaced with methylphosphonate or phosphorothioate analogue, or triazole linkages (see Ni S et al., supra).

[0254] The conjugates described herein may comprise spacer or nucleic acid linker sequences between the targeting or functional moiety portion and the linker moiety. Suitable spacer or nucleic acid linker sequences will be readily apparent to one skilled in the art.

[0255] Pharmaceutical formulations

[0256] The present disclosure provides a composition comprising a conjugate according to the present disclosure.

[0257] The conjugates described herein may be formulated as pharmaceutical compositions or medicaments for clinical use and may comprise a pharmaceutically-acceptable carrier, diluent, excipient or adjuvant. Thus, the present disclosure provides a pharmaceutical composition / medicament comprising a conjugate described herein. The term ‘pharmaceutically-acceptable’ as used herein pertains to compounds, ingredients, materials, compositions, dosage forms, etc., which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of the subject in question (e.g. a human subject) without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio. Each carrier, diluent, excipient, adjuvant, filler, buffer, preservative, anti-oxidant, lubricant, binder, stabiliser, solubiliser, surfactant, masking agent, colouring agent, flavouring agent or sweetening agent of a composition according to the present disclosure must also be ‘acceptable’ in the sense of being compatible with the other ingredients of the formulation. Suitable carriers, diluents, excipients, adjuvants, fillers, buffers, preservatives, anti-oxidants, lubricants, binders, stabilisers, solubilisers, surfactants, masking agents, colouring agents, flavouring agents or sweetening agents can be found in standard pharmaceutical texts, for example, Remington’s ‘The Science and Practice of Pharmacy’ (Ed. A. Adejare), 23rd Edition (2020), Academic Press.

[0258] Compositions may be formulated for topical, parenteral, systemic, intravenous, intra-arterial, intramuscular, intracavitary, intrathecal, intraocular, intravitreal, intraconjunctival, subretinal, suprachoroidal, subcutaneous, intradermal, intrathecal, oral, nasal, topical or transdermal routes of administration. In some embodiments, a pharmaceutical composition / medicament may be formulated for administration by injection or infusion, or administration by ingestion. In some embodiments, compositions comprising a conjugate according to the present disclosure are formulated for administration by injection.

[0259] Non-limiting examples of pharmaceutically acceptable excipients include water, NaCI, normal saline solutions, lactated Ringer's, normal sucrose, normal glucose, binders, fillers, disintegrants, lubricants, coatings, sweeteners, flavours, salt solutions (such as Ringer's solution), alcohols, oils, gelatins, carbohydrates such as lactose, amylose or starch, fatty acid esters, hydroxymethycellulose, polyvinyl pyrrolidine, and colours, and the like. Such preparations can be sterilized and, if desired, mixed with auxiliary agents such as lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure, buffers, colouring, and / or aromatic substances and the like that do not deleteriously react with the compounds of the invention. One of skill in the art will recognize that other pharmaceutical excipients are useful in the present invention.

[0260] Suitable formulations may comprise the relevant article in a sterile or isotonic medium. Medicaments and pharmaceutical compositions may be formulated in fluid, including gel, form. Fluid formulations may be formulated for administration by injection or infusion (e.g. via catheter) to a selected region of the human or animal body.

[0261] Functional characteristics

[0262] The conjugates described herein may be characterised by reference to certain functional properties.

[0263] In some embodiments, any conjugate described herein may possess one or more of the following properties:

[0264] Capable of traversing the blood-brain barrier; Capable of being transported into the brain;

[0265] Capable of delivering a payload, e.g. an siRNA, into the brain;

[0266] Binds to transferrin receptor (TfR);

[0267] Capable of binding to TfR;

[0268] Binds specifically to TfR;

[0269] Capable of binding specifically to TfR;

[0270] Binds to TfR on the surface of a cell;

[0271] Capable of binding to TfR on the surface of a cell;

[0272] Capable of being internalised by a cell;

[0273] Capable of delivering a payload, e.g. an siRNA, into a cell.

[0274] The binding of a conjugate to a transferrin receptor can be determined by, e.g., surface plasmon resonance technology, as illustrated herein and described in Drescher et al., Methods Mol Biol. 2009; 493: 323-343.

[0275] The term "internalised," "internalising," or "internalisation" as provided herein refers to a composition (e.g., a conjugate, a therapeutic agent, an imaging agent) being drawn into the cytoplasm of a cell (e.g. after being engulfed by a cell membrane).

[0276] Therapeutic and prophylactic applications

[0277] The present invention provides conjugates and compositions described herein for use in a method of medical treatment or prophylaxis. The invention also provides the use of conjugates and compositions described herein in the manufacture of medicaments for treating or preventing a disease or disorder. The invention described herein also provides methods of treating or preventing a disease or disorder, comprising administering to a subject in need thereof a therapeutically or prophylactically effective amount of a conjugate or composition described herein.

[0278] As used herein, "treatment" or "treating," or "palliating" or "ameliorating" are used interchangeably herein. These terms refer to an approach for obtaining beneficial or desired results including but not limited to therapeutic benefit and / or a prophylactic benefit. By therapeutic benefit is meant eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit is achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder such that an improvement is observed in the patient, notwithstanding that the patient may still be afflicted with the underlying disorder. For prophylactic benefit, the compositions may be administered to a patient at risk of developing a particular disease, or to a patient reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made. Treatment includes preventing the disease, that is, causing the clinical symptoms of the disease not to develop by administration of a protective composition prior to the induction of the disease; suppressing the disease, that is, causing the clinical symptoms of the disease not to develop by administration of a protective composition after the inductive event but prior to the clinical appearance or reappearance of the disease; inhibiting the disease, that is, arresting the development of clinical symptoms by administration of a protective composition after their initial appearance; preventing re-occurring of the disease and / or relieving the disease, that is, causing the regression of clinical symptoms by administration of a protective composition after their initial appearance.

[0279] In some embodiments, the conjugates described herein find use in the treatment or prevention of any disease / disorder which would benefit from the delivery of said conjugates, and / or associated therapeutic or imaging moieties, to cells expressing TfR. It will be appreciated that the therapeutic and prophylactic utility of such embodiments extends to the treatment of any subject that would benefit from the delivery of a compound moiety or compound into a cell expressing TfR.

[0280] For example, in some embodiments, certain methods described herein treat cancer (e.g. liver cancer (e.g. hepatocellular carcinoma) , pancreatic cancer, pancreatic liver metastases, prostate cancer, renal cancer, metastatic cancer, melanoma, castration-resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus) , colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma) . For example certain methods herein treat cancer by decreasing or reducing or preventing the occurrence, growth, metastasis, or progression of cancer; or treat cancer by decreasing a symptom of cancer. Symptoms of cancer (e.g. liver cancer (e.g. hepatocellular carcinoma) , pancreatic cancer, pancreatic liver metastases, prostate cancer, renal cancer, metastatic cancer, melanoma, castration-resistant prostate cancer, breast cancer, triple negative breast cancer, glioblastoma, ovarian cancer, lung cancer, squamous cell carcinoma (e.g., head, neck, or esophagus) , colorectal cancer, leukemia, acute myeloid leukemia, lymphoma, B cell lymphoma, or multiple myeloma) would be known or may be determined by a person of ordinary skill in the art.

[0281] The conjugates of the present invention find particular utility in crossing the blood-brain barrier and delivery to the kidney, liver and lung. Accordingly, in some embodiments, the cancer is a brain cancer, a liver cancer e.g. hepatocellular carcinoma, a kidney cancer (renal cancer), a lung cancer, or a metastatic cancer.

[0282] In some embodiments, the cancer is a TfR expressing cancer. As used herein, a TfR expressing cancer is one where TfR is expressed on the cancer cell’s surface. In some embodiments, TfR is expressed on the cancer cell’s surface at a level higher than on non-cancerous cell.

[0283] In some cases, the cancer is one in which activation of a Sirtuin gene / protein e.g. SIRT1, activation of a C / EBPalpha gene / protein, and / or activation of a HNF gene / protein has a therapeutic or prophylactic effect.

[0284] In some embodiments, the cancer is a cancer which would benefit from treatment with a CEBPb inhibitor. A cancer which would benefit from treatment with a CEBPb inhibitor as used herein refers to a cancer sensitive to CEBPb inhibition. A cancer sensitive to CEBPb inhibition may exhibit aberrant CEBPb expression or activity, for example increased CEBPb expression or activity, relative to a non-cancerous cell. Without wishing to be bound by theory, as CEBPb suppresses p53 (Ewing et al, 2008) alongside regulating multiple factors critical to the survival and proliferation of cancer cells (Pal et al, 2009), by suppressing CEBPb the cancer may be effectively treated.

[0285] Brain diseases

[0286] In some preferred embodiments, the disease or condition is a brain disease. In some embodiments, the brain disease is a cancer of the brain or central nervous system, a neurodegenerative disease or an infection

[0287] In some embodiments, the brain disease may be a cancer of the brain or central nervous system. For example, the cancer may be astrocytoma, low grade astrocytoma, high grade astrocytoma, anaplastic astrocytoma, glioblastoma multiforme or brain lower grade glioma.

[0288] In some cases, the conjugates and compositions of the present invention find use in the treatment or prevention of, i.e. reduction of or protection against, a neurodegenerative disease (also called neurodegeneration). In some embodiments, the neurodegenerative disease is Alzheimer’s disease.

[0289] In some embodiments, the disease / disorder is a neurological disorder. For example, the neurological disorder may be Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), motor neuron disease, Parkinson’s disease, Huntington’s disease, spinal and bulbar muscular atrophy (SBMA). In some cases, the neurological disorder is one in which activation of a Sirtuin gene / protein, activation of a C / EBPalpha gene / protein, and / or activation of a HNF gene / protein has a therapeutic or prophylactic effect.

[0290] In some embodiments, the brain disease may be an infection.

[0291] Methods of delivery to cells

[0292] As described above the conjugates, e.g. aptamer-linker conjugates provided herein, including embodiments thereof, may be used to deliver a functional moiety (e.g., therapeutic agents or imaging agents) into a cell. In some embodiments when the targeting moiety is an aptamer capable of binding to TfR, upon binding of the aptamer to TfR on a cell, the functional moiety may be internalized by the cell while being covalently attached to the conjugate. Thus, in one aspect, a method of delivering a functional moiety into a cell is provided. The method includes, (i) contacting a cell with the conjugate, or composition, as provided herein including embodiments thereof and (ii) allowing the targeting moiety to bind to a TfR on the cell and pass into the cell thereby delivering the functional moiety into the cell.

[0293] As described above, the functional moieties delivered may be imaging agents useful for cell detections. Thus, in one aspect, a method of detecting a cell is provided. The method includes (i) contacting a cell with the conjugate, or composition, as provided herein including embodiments thereof, wherein the conjugate comprises an imaging moiety, (ii) the conjugate, or composition, is allowed to pass into the cell (e.g. by binding to a transferrin receptor on the cell and to passing into the cell, (iii) the imaging moiety is detected, thereby detecting the cell. In some cases, the cell is a brain cell. In some cases, the cell is a kidney cell. In some cases, the cell is a liver cell. In some cases, the cell is a lung cell. In some cases, the cell forms part of an organism. In some cases, the organism is a mammal. In some cases, the cell forms part of a cell culture. In some cases, the cell is a non-malignant cell. In some cases, the cell is a malignant cell. In some cases, the cell is a brain cancer cell. In some cases, the cell is a liver cancer cell. In some cases, the cell is a kidney cancer cell. In some cases, the cell is a lung cancer cell.

[0294] The methods may be performed in vitro, ex vivo, or in vivo. In some cases, the methods comprise delivering the compound moiety or compound across the blood-brain barrier into the brain.

[0295] Sequence identity

[0296] As used herein, ‘sequence identity’ refers to the percent of nucleotides / amino acid residues in a subject sequence that are identical to nucleotides / amino acid residues in a reference sequence, after aligning the sequences and, if necessary, introducing gaps, to achieve the maximum percent sequence identity between the sequences. Pairwise and multiple sequence alignment for the purposes of determining percent sequence identity between two or more amino acid or nucleic acid sequences can be achieved in various ways known to a person of skill in the art, for instance, using publicly available computer software such as ClustalOmega (Soding, J., Bioinformatics (2005) 21, 951-960), T-coffee (Notredame et al., J.

[0297] Mol. Biol. (2000) 302, 205-217), Kalign (Lassmann and Sonnhammer, BMC Bioinformatics (2005) 6,298) and MAFFT (Katoh and Standley, Molecular Biology and Evolution (2013) 30(4) 772-780) software.

[0298] When using such software, the default parameters, e.g. for gap penalty and extension penalty, are preferably used.

[0299] A preferred example of algorithm that is suitable for determining percent sequence identity and sequence similarity are the BLAST and BLAST 2.0 algorithms, which are described in Altschul et aL, Nuc. Acids Res. 25:3389-3402 (1977) and Altschul et al., J. Mol. Biol. 215:403-410 (1990), respectively.

[0300] Sequences

[0301] The present disclosure includes the combination of the aspects and preferred features described except where such a combination is clearly impermissible or expressly avoided.

[0302] The section headings used herein are for organisational purposes only and are not to be construed as limiting the subject matter described.

[0303] Aspects and embodiments of the present disclosure will now be illustrated, by way of example, with reference to the accompanying figures. Further aspects and embodiments will be apparent to those skilled in the art. All documents mentioned in this text are incorporated herein by reference.

[0304] Throughout this specification, including the claims which follow, unless the context requires otherwise, the word ‘comprise,’ and variations such as ‘comprises’ and ‘comprising,’ will be understood to imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integers or steps.

[0305] As used herein, a ‘peptide’ refers to a chain of two or more amino acid monomers linked by peptide bonds. A peptide typically has a length in the region of about 2 to 50 amino acids. A ‘polypeptide’ is a polymer chain of two or more peptides. Polypeptides typically have a length greater than about 50 amino acids. Reference herein to peptides, polypeptides and proteins also includes glycopeptides / glycopolypeptides / glycoproteins, lipopeptides / lipopolypeptides / lipoproteins, nucleopeptides / nucleopolypeptides / nucleoproteins, etc.

[0306] As used herein, an amino acid sequence, or a region of a polypeptide, which ‘corresponds’ to a specified reference amino acid sequence or region of a polypeptide has at least 60%, e.g. one of at least >65%, >70%, >75%, >80%, >85%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99% or 100% sequence identity to the amino acid sequence of the amino acid sequence / polypeptide / region. An amino acid sequence / region / position of a polypeptide / amino acid sequence which ‘corresponds’ to a specified reference amino acid sequence / region / position of a polypeptide / amino acid sequence can be identified by sequence alignment of the subject sequence to the reference sequence, e.g. using sequence alignment software such as ClustalOmega (Soding, J. 2005, Bioinformatics 21 , 951-960).

[0307] Similarly, a nucleotide sequence, or a region of a polynucleotide, which ‘corresponds’ to a specified reference nucleotide sequence or region of a polynucleotide has at least 60%, e.g. one of at least >65%, >70%, >75%, >80%, >85%, >90%, >91%, >92%, >93%, >94%, >95%, >96%, >97%, >98%, >99% or 100% sequence identity to the amino acid sequence of the nucleotide sequence / polynucleotide / region. A polynucleotide / region / position of a polynucleotide / nucleotide sequence which ‘corresponds’ to a specified reference nucleotide sequence / region / position of a polynucleotide / nucleotide sequence can be identified by sequence alignment of the subject sequence to the reference sequence, e.g. using sequence alignment software such as ClustalOmega (Soding, J. 2005, Bioinformatics 21, 951-960).

[0308] As used herein, an amino acid sequence (e.g. the amino acid sequence of a peptide / polypeptide / domain / region) which is ‘derived from’ a reference amino acid sequence (e.g. the amino acid sequence of a reference peptide / polypeptide / domain / region) comprises, or consists of, an amino acid sequence having at least 60%, e.g. one of at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the reference amino acid sequence. Similarly, a nucleotide sequence (e.g. a nucleotide sequence of a polynucleotide) which is ‘derived from’ a reference nucleotide sequence comprises, or consists of, a nucleotide sequence having at least 60%, e.g. one of at least 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to the reference nucleotide sequence.

[0309] It must be noted that, as used in the specification and the appended claims, the singular forms ‘a,’ ‘an,’ and ‘the’ include plural referents unless the context clearly dictates otherwise. Ranges may be expressed herein as from ‘about’ one particular value, and / or to ‘about’ another particular value. When such a range is expressed, another embodiment includes from the one particular value and / or to the other particular value. Similarly, when values are expressed as approximations, by the use of the antecedent ‘about,’ it will be understood that the particular value forms another embodiment.

[0310] Where a nucleic acid sequence is disclosed herein, the reverse complement thereof is also expressly contemplated. Methods described herein may preferably be performed in vitro. The term ‘in vitro' is intended to encompass procedures performed with cells in culture whereas the term ‘in vivo’ is intended to encompass procedures with / on intact multi-cellular organisms.

[0311] Brief Description of the Figures

[0312] Embodiments and experiments illustrating the principles of the present disclosure will now be discussed with reference to the accompanying figures.

[0313] Figure 1 . Synthesis of intermediate linker compound 5 used in this study.

[0314] Figure 2. Secondary Structure of TfR and Truncated TfR Aptamers. The expected structures were predicted using the mFold RNA structure program. A) 87-nucleotide (nt) RNA TfR aptamer. B) 22- nucleotide truncated RNA TfR aptamer.

[0315] Figure 3. Synthesis of azido-DSPE-PEG 1 k maleimide reagent (7).

[0316] Figure 4. Cy7-labelling of Cys-TAT and conjugation of TfR aptamer and anti-miR.

[0317] Figure 5. Main steps of the study described in Example 1 : 1) SELEX provides new TfR aptamer; 2) Solid-phase RNA synthesis with required modifications; sequence: 5'- / 5ThioMC6- D / / iSpC3 / / iSpC3 / / i2FU / / i2FU / / i2FU / rA / i2FU / / i2FU / Zi2FC / rA / i2FC / rA / i2FU / / i2FU / / i2F U / / i2FU / / i2FU / rGrArA / i2FU / / i2FU / rG rA -3', where Sp = spacer, i2F = 2’F-2’-deoxy; 3) Bioconjugation to DSPE-PEG; 4) Labelling with Cy7. n ~ 23.

[0318] Figure 6. Graphical representation of the study described in Example 2.

[0319] Figure 7. Results of human cell line study for Cy7 and conjugates TAT-Cy7 and C1-Cy7. Bars represent mean values for intra-plate duplicates, p barrier-no barrier 0.01 ; p groups 0.78 (ANOVA).

[0320] Figure 8. Whole-body micro-CT images for C1-Cy7 (A) and TAT-Cy7 (B) administered i.v. into male Balb / cJ mice. (C) Images of fluorescence in harvested brains of male mice 1 day post-i.v. injection of C1- Cy7, 20mg / kilo.

[0321] Figure 9. Fluorescence-CT scanned C1-Cy7, TAT-Cy7 (both 20 mg / kg) and PBS control groups along data points. Fluorescence intensity normalized to 8000 e- / s.

[0322] Figure 10. Evolution of distribution of C1-Cy7 along the time measured by CT fluorescence scans, displaying 3 male mice laying on their stomach (top row) and on their side (bottom row). For the anaesthetized mice (fluorescence intensity normalized to 1000 e- / s), their disposition is not changed along the data points or orientation display. After termination, organs of each mice were extracted and disposed in the same order than in the anaesthetized scans. Figure 11. Biodistribution results for male Balb / cJ mice treated with C1-Cy7, 20 mg / kilo. A) Boxplot with outliers for mice organs 2 days post-administration of C1-Cy7 (n=3), B) Micro-CT images of harvested mice brains, 2 days post-administration of C1-Cy7. Images shown for biological triplicates. Ns = not significant.

[0323] Figure 12. C2 effectively delivers anti-miR to mouse brain. A) Sequence of anti-miR 125b1 and structure of conjugate C2; B) qPCR levels of anti-miR 125b1 in brain, liver and kidney of mice (n=3); C) Brain to serum ratio for anti-miR 125b1 . ** 99% significance level.

[0324] Figure 13. Delivery of unconjugated anti-miR 125b1. A) qPCR levels of anti-miR 125b1 in brain, liver and kidney of mice; B) and brain-to-serum ratios. ** 99% significance level.

[0325] Figure 14. Levels and areas of the mouse brain analyzed in this study: A) Lateral view of brain areas analyzed; B) Analyzed mouse brain sections and levels with key areas indicated: Acb, nucleus accumbens; Cg, cingulate cortex; Cpu, caudate-putamen; Ent, entorhinal cortex; H, hypothalamus; M, motor cortex; O, orbital cortex; PL, posterior lobe; PrL, prelimbic cortex; S, somatosensory cortex; SN, substantia nigra; Th, thalamus; VTA, ventral tegmental area.

[0326] Figure 15. Light micrograph images of Hematoxylin and eosin stained brain tissues from female mice treated with Tf, TAT and PBS (control); frontal lobes; Tf, L1: a,b; L2, c,d; L3, e,f; TAT, L1 , g,h; L2,i ,j; L3, k, I; PBS, L1, m; L2, n; L3, o.

[0327] Examples

[0328] Example 1 : Materials and Methods l .1 Materials

[0329] Unless otherwise stated, all reagents were purchased from Merk and used without previous purification. Cys-TAT(47-57) was purchased from Anaspec / Bionordika Denmark (cat no AS-61212), at HPLC purity > 95%, and used as received.

[0330] Cy7 reagents were purchased from Lumiprobe: alkyne (cat no A50B0); maleimide (cat no 15080). DSPE PEG 1 k NHS ester (cat no PLS-9916) was purchased from Creative PEG works and used as received.

[0331] Anti-miR molecules were designed with Python script using miR base for target miR 125b1 sequence. Conservation was checked for human vs mice miR. Anti-miR reagents were purchased from IDT and used as received (HPLC purity > 93%).

[0332] Cell lines were purchased from ATCC, grown and studies in class 1 cell laboratory at DTU Chemistry. All other reagents were purchased from commercial vendors (Sigma, ThermoFisher) and used as received. Fluorescence read out was done using microplate reader Magellan Tecan.

[0333] 1.2 Synthesis of linker compound intermediate 5

[0334] Figure 1 is a scheme showing synthesis of intermediate compound 5. The intermediate compound 5 is used to synthesise a linker reagent disclosed herein, see for example Figure 3 and section 1.6 below.

[0335] 1.3-Diazidopropan-2-ol (compound 2 in Figure 1)

[0336] To a solution of 1 ,3-dibromopropan-2-ol (compound 1 in Figure 1, 1.00 g, 4.59 mmol, 1.0 eq) in dry DMF (3 mL), sodium azide (895 mg, 13.8 mmol, 3.0 eq) was added and the reaction mixture was heated at 80 °C for 16 h. The mixture was allowed to cool down to room temperature, diluted with water (10 mL) and extracted with EtOAc (4 x 10 mL). Organic phases were combined, washed with water (4 x 20 mL), brine (4 x 20 mL), dried over anhydrous Na2SO4 and concentrated under reduced pressure to yield the product as a slightly yellow oil (534 mg, 3.76 mmol, 82% yield). Crude product was used without further purification.

[0337] 1H NMR (400 MHz, CDCh) 5 3.93 (tt, J = 6.2, 4.7 Hz, 1 H), 3.47 - 3.36 (m, 4H), 2.29 (br s, 1 H).

[0338] 13C NMR (101 MHz, CDCh) 5 69.72, 53.97.

[0339] 1.3-Diazidopropan-2-yl methanesulfonate (compound 3 in Figure 1)

[0340] To a solution of 1 ,3-diazidopropan-2-ol (compound 2 in Figure 1 , 150 mg, 1.06 mmol, 1.0 eq) in dry DCM (3 mL) was added EhN (292 pL, 2.11 mmol, 2.0 eq). The mixture was cooled down in an ice-bath and methanesulfonyl chloride (123 pL, 1.58 mmol, 1.5 eq) in dry DCM (2 ml) was added over 10 min. The mixture was allowed to warm up to room temperature and stirred overnight. The solution was diluted with DCM to 10 mL, organic phase washed with 0.1 M aq HCI (3 x 10 mL), water (10 mL), brine (10 mL), dried over Na2SO4and concentrated under reduced pressure to give the product as a slightly yellow oil (215 mg, 0.986 mmol, 93%). Crude product was used without further purification.

[0341] 1H NMR (400 MHz, CDCh) 54.84 - 4.74 (qn, J = 5.3 Hz, 1 H), 3.68 - 3.55 (m, 4H), 3.15 (s, 3H).

[0342] 13C NMR (101 MHz, CDCh)

[0343] The synthesis of compound 4 in Figure 1 was conducted as described earlier, see: M.A. Walker, The Mitsunobu reaction: A novel method for the synthesis of bifunctional maleimide linkers, Tetrahedron Lett. 35 (1994) 665-668.32

[0344] The synthesis of compound 5 in Figure 1 was conducted as described earlier, see: Kurti, L.; Czako, B.; Strategic Applications of Named Reactions in Organic Synthesis, Staudinger reaction.33

[0345] 1.3 RNA SELEX

[0346] In vitro selection was enacted as previously described31. The RNA library was produced via in vitro transcription of randomized synthetic DNA oligonucleotides using nucleoside triphosphates (NTPs) and T7 RNA polymerase. The sequence of the RNA library is 5'-GGGAGAGCGGAAGCGUGCUGGGCC-N40- CAUAACCCAGAGGUCGAUGGAUCCCCCC -3', where N40 represents 40 nucleotides with equimolar incorporation of A, G, C, and U at each position. hTfR was purchased from Sino Biological (11020-H07H; Beijing, P.R. China). The extracellular domain of hTfR (NP_003225.2) (Cys 89-Phe 760) was expressed with a His6-tag at the N terminus in human cells (HEK293). 2'F-RNA aptamers which bound with hTfR protein were nominated from 40-nt randomized sequences constructed by in vitro transcription of synthetic with DNA templates, NTPs (2'F dUTP [2'-Fluoro-2'-deoxyuridine-5'-triphosphate], 2’F dCTP [2 - Fluoro-2'-deoxycytidine-5'-triphosphate], GTP, ATP; Epicenter Biotechnologies, Madison, Wl, USA) and T7 RNA polymerase. To remove RNAs that bound nonspecifically to agarose beads, 1.44 pM of the RNA library was pre-incubated with 20 pL of Ni-NTA agarose beads in 100 pL of binding buffer (30 mM Tris- HCI [pH 7.5]; 150 mM NaCI; 5 mM MgCh; 2 mM dithiothreitol; 100 pg / mL yeast tRNA; 1 % BSA) for 30 min at room temperature with shaking, precipitated by centrifugation, and discarded. The precleared supernatant was collected and reacted with 300 nM His6-tagged hTfR for 30 min at room temperature. RNAs bound to hTfR were recovered, amplified by RT-PCR and in vitro transcription, and used in subsequent selection rounds. In subsequent rounds, the hTfR concentration was reduced by 2-fold every three rounds for more stringent conditions. After nine rounds of SELEX, the resulting cDNA was amplified. The amplified DNA was cloned, and individual clones were identified by DNA sequencing.

[0347] Aptamer structures were predicted using Mfold2(available at http: / / www.bioinfo.rpi.edu / applications / mfold / ), employing a salt correction algorithm and temperature correction for 25°C, or predicted using NUPACK3(available at http: / / www.nupack.org / ). Based on structural analysis using computational prediction, we truncated the TfR aptamer into the smallest functional unit expected to maintain binding to hTfR, generating a truncated TfR aptamer with 22 nucleotides.

[0348] 1.4 Solid-phase RNA synthesis tTfR aptamer (22-nt) :

[0349] 5’- / i2FU / / i2FU / / i2FU / rA / i2FU / / i2FU / / i2FC / rACrA / i2FU / / i2FU / / i2FU / / i2FU / / i2FU / rGrArA / i2FU / / i2FU / rGrA-3’

[0350] RNA sequence NH726:

[0351] 5'- / 5ThioMC6-D / / iSpC3 / / iSpC3 / / i2FU / / i2FU / / i2FUZ rA / i2FU / / i2FU / Zi2FC / rA / i2FC / rA / i2FU / / i2FU / Zi2FU / / i2FU / / i2FUZ rGrArA Zi2FU / / i2FU / rG rA -3' where Sp = spacer, i2F = 2’F-2’-deoxy.

[0352] 1.5 Binding Affinity of TfR Aptamer

[0353] The binding affinity of the TfR aptamer was measured using a surface plasmon resonance (SPR)-based biosensor assay. The Biacore T100 (GE Healthcare, Sweden) was employed to monitor real-time, label- free interactions between the TfR aptamer and hTfR protein. A biotinylated aptamer was coupled to a streptavidin-coated Biacore chip (SensorChip SA, BR-1003-98; General Electric Company) by injection in binding buffer (30 mM Tris-HCI [pH 7.5], 150 mM NaCI, 5 mM MgCI2) at a concentration of 25 pg / mL and a flow rate of 10 pL / min. The RNA was refolded by heating to 65°C, followed by cooling to 37°C before immobilization. To measure binding kinetics, five different concentrations of purified hTfR protein were injected at a flow rate of 10 pL / min. Following binding, the surface was regenerated by injecting a dissociation buffer of 50 mM NaOH at a flow rate of 15 pL / min for 20 seconds. Data from the control surface were removed. BIAevaluation software (GE Healthcare) was utilized for analysis. The binding data were fitted to a one-to-one ratio binding model with mass transfer to calculate kinetic parameters.

[0354] Kinetic parameters for the interaction between the TfR aptamer and hTfR protein, calculated using a 1:1 binding model with mass transfer. The association rate constant (Ka) was determined by fitting the association phase of the binding curve, representing the rate at which the aptamer binds to the hTfR protein. The dissociation rate constant (Kd) was determined by fitting the dissociation phase of the binding curve, representing the rate at which the aptamer dissociates from the hTfR protein. The equilibrium dissociation constant (KD) was calculated as the ratio of Kd to Ka (KD = Kd / Ka), indicating the affinity of the aptamer for the hTfR protein. Lower KD values correspond to higher binding affinity.

[0355] 1.6 Bioconiuqations

[0356] Maleimide-azido-DSPE (7) reagent was prepared by in situ reaction of DSPE-PEG 1 k NHS ester (6) with 1-amino-3-azidopropan-2-ol (5) followed by previously reported Mitsunobu conversion of secondary alcohol to maleimide32(Figure 3).

[0357] General procedure for maleimide conjugations

[0358] Sulfhydryl-containing compound (50 nmol; RNA aptamer-SH or Cys-TAT) in 110 mM sterile-filtered PBS pH 7.0 was incubated with 20 mM TCEP (final volume 200 pL) for 30min in argon atmosphere, followed by adding maleimide reagent (20 nmol; azido-DSPE-PEG conjugate (7) or Cy7-maleimide) to afford C1 or TAT-Cy7 conjugates, respectively (Figure 4).

[0359] The pH of TCEP stock was adjusted to 7.0 prior to using. Incubation was kept at room temperature for 3 hours followed by purification with MWKO 10k Amicon device centrifugation and washing 2 times 1x PBS.

[0360] General procedure for CuAAC conjugations

[0361] Azide-containing product C1 (50 nmol) was dissolved in 0.1 M TEAA, pH 7.2, and mixed subsequently with alkyne-reagent (R-C=CH in Figure 4, 200 nmol; Cy7 alkyne (where R is C7) or anti-miR alkyne (where R is anti-miR), Cu-TBTA (10 nmol) and fresh ascorbic acid (5 nmol), in a total volume of 200 uL. The reaction was degassed with argon and kept at room temperature for 6h, followed by purification with MWKO 10k Amicon device centrifugation and washing 2 times 1x PBS to afford conjugates C1-Cy7 and C2 (Figure 5).

[0362] Conjugate characterization procedures

[0363] For purification and characterization of conjugates, HPLC was used with the following conditions:

[0364] Stationary phase: Poly(styrene-divinylbenzene).

[0365] Column is UHPLC+ focused Dionex Ultimate 3000 equipped with a DNAPac RP, Analytical, 4 pm, 3.0 * 100 mm. Buffers: Buffer A (triethylammonium acetate (TEAA) in MQ water, 0.05 M, pH 7.4) and buffer B (MeCN 75% in TEEA 0.0125 M).

[0366] Gradient: 5-60% of buffer B in a total run time of 30 min.

[0367] Flow rate was 0.5 mL / min and UV for collection was 260 nm. Applied injection volume for analytical method was 12 pL.

[0368] MALDI: MALDI was obtained on Bruker Autoflex Speed with TOF mass analyzer using a matrix of 3- hydroxypicolinic acid and MQ water. To determine masses using MALDI-TOF MS, 0.5 pL matrix and 0.5 pL sample were spotted.

[0369] 1.7 Tests in human cells

[0370] 1. . 1 Cell Culture hCMEC / D3 Cell culture:

[0371] 1. Thaw hCMEC / D3 cells quickly in a 37°C water bath.

[0372] 2. Transfer cells to a 15 mL conical tube with 10 mL of pre-warmed EGM-2 medium.

[0373] 3. Centrifuge at 200 x g for 5 minutes.

[0374] 4. Discard the supernatant and resuspend the cell pellet in EGM-2 medium.

[0375] 5. Plate cells in a culture flask pre-coated with attachment factor (e.g., Poly-L-Lysine).

[0376] 6. Incubate at 37°C with 5% CO2, changing the medium every 2 days.

[0377] Neuron Cell Line Culture:

[0378] 1. Thaw SH-SY5Y cells quickly in a 37°C water bath.

[0379] 2. Transfer cells to a 15 mL conical tube with 10 mL of pre-warmed growth medium.

[0380] 3. Centrifuge at 200 x g for 5 minutes.

[0381] 4. Discard the supernatant and resuspend the cell pellet in growth medium.

[0382] 5. Plate cells in a culture flask pre-coated with attachment factor.

[0383] 6. Incubate at 37°C with 5% CO2, changing the medium every 2 days.

[0384] 1.7.2. hCMEC / D3 Barrier growing on top of neurons

[0385] 1. When hCMEC / D3 and SH-SY5Y cells reach 80-90% confluence, passage cells and seed hCMEC / D3 on top of plates containing SH-SY5Y cells.

[0386] 2. Replace EGM-2 medium with neuronal differentiation medium (Neurobasal medium with B-27 supplement).

[0387] 3. Add differentiation factors (NGF).

[0388] 4. Maintain cells in differentiation medium for 1 week, changing medium every 2 days.

[0389] 1.7.3. Barrier integrity analysis

[0390] Confluent monolayer of hCMEC / D3 was tested with FITC dextran fluorescent tracer (Sigma). Solution of FITC dextran (10mM, in 1xPBS) was added to cells in millicell two-chamber wells. Cells were incubated for 2 hours at 37 °C, upper layer was removed; and lower layer was analyzed with fluorescence reader. Data was processed as follows:

[0391] \[ P = \frac{(dQ / dt)}{(A \cdot C_0)} \]

[0392] Where:

[0393] \( P \) = permeability coefficient

[0394] \( dQ / dt \) = amount of tracer passing through the monolayer per unit time

[0395] \( A \) = surface area of the insert

[0396] \( C_0 \) = initial concentration of the tracer in the upper chamber

[0397] Resulting P values for triplicate measurements were as follows:

[0398] 1.56 e-6 cm / s

[0399] 1 .60 e-6 cm / s

[0400] 1.52 e-6 cm / s

[0401] 1.7.4 hCMEC / D3 passage test

[0402] Milli well two chamber plates were used for the assays. TAT-Cy7 and C1-Cy7 samples were added to neuron cells with and without hCMEC / D3 layer in concentration 2 nM, sterile 1xPBS, pH 7.0 (Thermo Fisher). After incubation for 30 min, plates were washed 3 times with 100 pL 1xPBS, and analyzed with microplate fluorescence reader.

[0403] 1.7.5 Barrier integrity analysis

[0404] Confluent monolayer of hCMEC / D3 was tested with FITC dextran fluorescent tracer (Sigma). Solution of FITC dextran (10mM, in 1xPBS) was added to cells in millicell two-chamber wells. Cells were incubated for 2 hours at 37 °C, upper layer was removed; and lower layer was analyzed with fluorescence reader. Data was processed as follows:

[0405] \[ P = \frac{(dQ / dt)}{(A \cdot C_0)} \]

[0406] Where:

[0407] \( P \) = permeability coefficient

[0408] \( dQ / dt \) = amount of tracer passing through the monolayer per unit time

[0409] \( A \) = surface area of the insert

[0410] \( C_0 \) = initial concentration of the tracer in the upper chamber

[0411] Resulting P values for triplicate measurements were as follows: 1.56 e-6 cm / s 1 .60 e-6 cm / s 1.52 e-6 cm / s

[0412] 1.7.6 hCMEC / D3 passage test

[0413] Milli well two chamber plates were used for the assays. TAT-Cy7 and C1-Cy7 samples were added to neuron cells with and without hCMEC / D3 layer in concentration 2 nM, sterile 1xPBS, pH 7.0 (Thermo Fisher). After incubation for 30 min plates were washed 3 times with 100 pL 1xPBS, and analyzed with microplate fluorescence reader.

[0414] 1.8 Studies in vivo

[0415] FELASA trained personnel was conducting in vivo studies in accordance with EU legislation for ethical animal research.

[0416] 7-Week old Balb / cJ mice (male and female) were purchased from Janvier, France. Mice were randomized at arrival and accommodated for 1 week prior to study initiation with unrestricted access to water and standard diet.

[0417] • Study groups were as follows: C1-Cy7, 20 mg / kilo, n=5 male, n=2 female

[0418] • TAT-Cy7, 20 mg / kilo, n=2 female

[0419] • C2, n=3 male, n = 3 female

[0420] • Unconjugated anti-miR 125b1, n=3 male, n = 3 female

[0421] • Not treated controls, n= 3 male, n= 3 female

[0422] Mice were dosed i.v. into tail vein, anesthetized with isoflurane / oxygen, shaved and analyzed longitudinally with whole-body micro-CT imaging.

[0423] Micro-CT study was conducted on Cy7-labelled groups and 1 PBS control of each sex using U-CT(UHR)- OI(FLTZBLT) scan system from MILabs (Utrecht, The Netherlands). U-CT-OI device was used under fluorescence mode and the following parameters: exposure time, 60000 ms; iris setting, f / 2.0;

[0424] Preamplification, 2x; Binning, 2x2; Emission, 785 nm; Excitation, 710 nm. Fluorescence units are given in to electron flux units (e- / s). After injection, CT groups mice were scanned at points 0, 1 , 3, 6 hours and 1 , 2, 3, 4, 7 days. (Figure 9).

[0425] Three mice from the C1-Cy7 male group were scanned at points 1, 6, 24 and 48 hours, then terminated after data point 48 h and their organs scanned after dissection for biodistribution studies (Figure 10).

[0426] Blood samples were taken longitudinally from tongue vein. Serum was obtained as follows:

[0427] 1. Whole blood collected in a covered test tube

[0428] 2. Blood let clot by leaving it undisturbed at room temperature for about 15-30 minutes.

[0429] 3. Blood centrifuged at 2,000 x g for 10 minutes in a refrigerated centrifuge

[0430] 4. The resulting supernatant is carefully removed using a Pasteur pipette

[0431] 5. Serum samples stored in aliquots at -20°C for 2-month time and at -80°C for prolonged time

[0432] Mice were sacrificed with CO2 followed by cervical dislocation. Mice were opened; spleen, liver, kidney, lungs and brain were weighed. Samples of organs were transferred into formaldehyde for further paraffin embedding. Paraffin embedded organs were spleen, liver, kidney, lungs and brain. Samples of brain (frontal lobe areas) were cryo-preserved in sterile tubes with liquid nitrogen and stored at - 80 °C. 1.9 gPCR measurements

[0433] Cryo-preserved tissue samples were processed with tissue homogenizer. DNA was extracted with Qiagen DNeasy Blood & Tissue Kit. DNA from sera samples was obtained with same kit.

[0434] Extended qPCR primers were designed with Python script and obtained from IDT. Primer sequences were as follows:

[0435] Forward: 5’-TCA CAA GTT AGG GTC TCA G-3’

[0436] Reverse: 5’- TCT C+AG GGA TCC C+AG-3’

[0437] Where +N is locked nucleic acid modification to increase specificity and affinity.

[0438] SYBR Green PCR Master Mix was applied (ThermoFisher). Reactions were performed using Roche Light Cycler 480. Each reaction was carried out in intra-plate duplicate. Serial dilution of unmodified DNA anti- miR were used to generate standard curve.

[0439] The following protocol was used for qPCR quantification of DNA from mouse tissue samples and sera:

[0440] 1. Prepare qPCR Reaction Mix

[0441] 10 pL of SYBR Green PCR Master Mix

[0442] 1 pL of forward primer (10 pM)

[0443] 1 pL of reverse primer (10 pM)

[0444] 1 pL of template DNA (2 ng / pL)

[0445] Nuclease-free water to a final volume of 20 pL

[0446] 2. qPCR Cycling Conditions

[0447] Initial denaturation: 95°C for 2 minutes

[0448] Denaturation: 95°C for 20 seconds

[0449] Annealing: 58°C for 20 seconds

[0450] Extension: 72°C for 30 seconds

[0451] Number of cycles: 38

[0452] 3. After the final extension, perform a melt curve analysis by gradually increasing the temperature from 65°C to 95°C and measuring fluorescence continuously.

[0453] 4. Ct values obtained and converted to ng / pL DNA using calibration curve; CV% determined from intra- plate duplicates.

[0454] 1.10 Histopathology

[0455] Paraffin-embedded tissue slices were stained with Hematoxylin and Eosin (H&E), and imaged with Leica LS8 microscope using 20x objective. 1.10.1 Pathological Features in Kidney and Liver

[0456] Kidney pathology of glomeruli is seen as hypertrophy, mesangial expansion, sclerosis (indicated by increased matrix deposition), or glomerular basement membrane thickening (REF). Glomerular pathology scoring was done as follows:

[0457] 0: Normal glomeruli.

[0458] 1 : Mild glomerular hypertrophy or sclerosis (<25% of glomeruli affected).

[0459] 2: Moderate hypertrophy or sclerosis (25-50%).

[0460] 3: Severe hypertrophy or sclerosis (>50%).

[0461] Pathology of kidney tubules is seen as tubular dilation, atrophy, necrosis, or casts. Scoring was done as follows:

[0462] 0: Normal tubules.

[0463] 1 : Mild tubular dilation or degeneration.

[0464] 2: Moderate dilation, atrophy, or necrosis.

[0465] 3: Severe necrosis or widespread atrophy.

[0466] Assessment for inflammation (presence of immune cells), fibrosis (collagen deposition), or edema was scored as follows:

[0467] 0: Normal interstitium.

[0468] 1 : Mild interstitial inflammation or fibrosis.

[0469] 2: Moderate inflammation or fibrosis.

[0470] 3: Severe fibrosis, inflammation, or edema.

[0471] Pathology of liver was assessed for hepatocytes by examining for ballooning degeneration, apoptosis, necrosis, and fatty changes (steatosis) (REF).

[0472] Scoring was done as follows:

[0473] 0: Normal hepatocytes.

[0474] 1 : Mild degeneration or steatosis (affecting <5% of hepatocytes).

[0475] 2: Moderate changes (5-25%).

[0476] 3: Severe changes (>25%).

[0477] We also revised for disruption in lobular architecture, such as fibrosis or bridging necrosis.

[0478] Scoring was done as follows:

[0479] 0: Normal architecture.

[0480] 1 : Mild disruption or fibrosis.

[0481] 2: Moderate disruption with fibrotic septa.

[0482] 3: Severe architectural distortion with extensive fibrosis.

[0483] 1.10.2 Pathology of lungs and spleen

[0484] Spleen pathology evaluation included assessment of following features (REF):

[0485] 1. White Pulp: Lymphoid hyperplasia / atrophy. Hyperplasia indicates an increase in the number of lymphocytes, while atrophy indicates a reduction.

[0486] Germinal Center Formation: Evaluate the presence and size of germinal centers within the white pulp, which indicates active immune responses.

[0487] 2. Red Pulp:

[0488] Hemosiderin Deposition: presence of hemosiderin, a breakdown product of hemoglobin, which appears as brown granules in macrophages. This may indicate increased red blood cell destruction or altered iron metabolism.

[0489] Congestion: dilated blood vessels filled with erythrocytes, which may indicate circulatory disturbances or inflammation.

[0490] Extramedullary Hematopoiesis (EMH): clusters of immature blood cells (megakaryocytes, myeloid cells) in the red pulp, indicating hematopoiesis outside the bone marrow.

[0491] 3. Overall splenic architecture:

[0492] - Disruption of Architecture: changes in the normal organization of the spleen, which can indicate fibrosis, necrosis, or neoplastic infiltration.

[0493] Scoring was done as follows:

[0494] 0: Normal

[0495] 1 : Mild changes (e.g., slight lymphoid hyperplasia, mild congestion)

[0496] 2: Moderate changes (e.g., moderate hyperplasia, hemosiderin deposition, moderate congestion) 3: Severe changes (e.g., marked hyperplasia / atrophy, extensive EMH, severe congestion, fibrosis)

[0497] Pathology of lungs was assessed for the following features:

[0498] 1 . Alveoli:

[0499] Emphysema: enlargement of alveolar spaces with destruction of alveolar walls.

[0500] Edema: fluid accumulation within alveolar spaces.

[0501] Inflammation: presence of immune cells (neutrophils, macrophages) within alveolar spaces, indicating conditions like pneumonia.

[0502] 2. Bronchi and Bronchioles:

[0503] Bronchitis / Bronchiolitis: inflammation of the bronchial and bronchiolar walls, characterized by thickening of the walls and infiltration of inflammatory cells.

[0504] Hyperplasia: epithelial cell hyperplasia or metaplasia in the bronchi / bronchioles, which can indicate chronic irritation or infection.

[0505] 3. Vascular Changes:

[0506] Pulmonary Hypertension: thickening of the walls of pulmonary arteries, which can indicate increased blood pressure within the lung vasculature.

[0507] Congestion: engorgement of blood vessels, indicating circulatory disturbances. 4. Interstitial Changes:

[0508] Fibrosis: presence of collagen deposition in the interstitium, which thickens the alveolar septa and disrupts gas exchange.

[0509] Inflammatory Infiltrate: immune cells within the interstitial spaces, which may indicate interstitial lung disease.

[0510] Scoring was done as follows:

[0511] 0: Normal lung architecture with no significant changes.

[0512] 1 : Mild changes (e.g., mild alveolar inflammation, slight congestion).

[0513] 2: Moderate changes (e.g., moderate bronchitis, interstitial inflammation, or fibrosis).

[0514] 3: Severe changes (e.g., widespread emphysema, severe bronchitis / bronchiolitis, marked fibrosis).

[0515] 1.10.3 Pathology assessment of brain

[0516] Brain tissue for each mouse was sectioned in three Ventral-Dorsal oriented levels:

[0517] L1 mainly showing cortex;

[0518] L2 mid Ventral level;

[0519] L3 deep Ventral level.

[0520] H&E staining was performed followed by light micrographs obtained for three areas:

[0521] Frontal lobes

[0522] Midbrain

[0523] Cerebellum

[0524] Levels and areas of brain sections used in this study are illustrated in Fig Sx. In total each mouse has had 9 brain sections analyzed.

[0525] Analyzing and scoring pathology in H&E-stained mouse brain tissue involves identifying specific cell types in different brain regions and understanding how these regions are affected by disease or experimental conditions. Performed analyses and scoring approach are as follows:.

[0526] 1. L1 Cortex

[0527] Pathology Analysis:

[0528] Neuronal Density: number of neurons per unit area, noting any reductions that might indicate neurodegeneration.

[0529] Cell Morphology: neuronal and glial morphology for signs of atrophy, swelling, or nuclear changes.

[0530] Gliosis: the extent of reactive gliosis (increase in glial cells in response to injury).

[0531] 2. Mid Ventral Level (L2)

[0532] Pathology Analysis:

[0533] Neuronal Loss: neuronal dropout, particularly in key nuclei like the thalamus. Vacuolization: vacuoles in the neuropil, which might indicate neurodegeneration or metabolic issues.

[0534] Gliosis: increased glial cell proliferation, particularly around areas of damage.

[0535] 3. Deep Ventral Level (L3)

[0536] Pathology Analysis:

[0537] Neuronal Degeneration: motor neurons in areas like the brainstem and basal ganglia. Axonal Damage: signs of axonal degeneration or demyelination.

[0538] Inflammatory Infiltrates: presence of immune cells indicative of neuroinflammation.

[0539] In addition, in frontal lobes white matter myelination patterns and axonal integrity was analyzed. Focus was paid to the severity of atrophy, gliosis, and any cortical thinning.

[0540] In midbrain, infiltration of immune cells has been accounted for.

[0541] In cerebellum, density and morphology of Purkinje cells was assessed.

[0542] Applied scale for all pathology types has been as follows:

[0543] 0: Normal, no pathology observed.

[0544] 1: Mild changes, minimal impact on tissue architecture; number of neurons 2: Moderate changes, noticeable impact on cell density or structure 3: Severe changes, significant disruption of tissue structure.

[0545] 1.11 Statistical analyses

[0546] Data was analyzed in R. Data normality was validated with Shapiro-Wilk test. ANOVA was applied for study group comparison.

[0547] Example 2: Generation of aptamer-DSPE lipid conjugates

[0548] Transferrin is a glycoprotein that binds and transports iron throughout the body. The transferrin receptor (TfR) is widely expressed on BBB11. In this example, a new effective reagent for delivery of oligonucleotides across the BBB is developed. This conjugate combines a new TfR-targeting RNA aptamer and lipophilicity-enhancing lipid.

[0549] The main steps of this study are illustrated in Figures 5 and 6. First, a TfR-targeting RNA aptamer was generated with systematic evolution of ligands by exponential enrichment (SELEX)15'16. The aptamer library selection utilized 2’-fluoro modified ribonucleoside triphosphates (NTPs), specifically 2’-fluoro-2’- deoxyuridine-5’-triphosphate (2’F dUTP), 2’-fluoro-2’-deoxycytidine-5'-triphosphate (2'F dCTP), guanosine triphosphate (GTP), and adenosine triphosphate (ATP), in the in vitro transcription RNA synthesis process. Upon successful selection, the aptamer sequence was resynthesized using standard solidphase RNA synthesis17.

[0550] Binding affinity of the TfR aptamer was measured using a SPR-based biosensor assay (Table 1).

[0551] Table 1. Binding properties of TfR aptamers and hTfR Protein determined with Biacore.

[0552] The aptamer was also modified with 5’-terminal sulfide group that allowed for orthogonal bioconjugation to maleimide-DSPE-PEG reagent18. At the final step, the conjugate was labelled with Cy7 using click chemistry19. TAT peptide labelled with Cy7 was used as a control. The products were purified and characterized with IE HPLC and MALDI MS (Table 2).

[0553] Table 2. Characterization of conjugation products used in this study.

[0554] Tests of the new conjugate and TAT peptide control were performed in a cell model of human BBB20. Human neurons were grown with a layer of hcmec / d3 epithelial cells above them. With this assay, high passage efficacy was confirmed for both C1-Cy7 and TAT-Cy7 through the hcmec / d3 (Figure 7). This relates to previous results showing that TAT and other peptides enhance uptake of nanoparticles and biomolecular analogues in cellular BBB models by over 2-fold compared to unmodified controls21-23.

[0555] Cellular tests alone cannot provide information on organ targeting and biodistribution. The conjugates were therefore testes in vivo. Male and female Balb / cJ mice received i.v. injection of 20 mg / kilo of C1-Cy7 or TAT-Cy7 (see Example 1 .8 for details on in vivo experiments). Biodistribution of compounds in mice was evaluated longitudinally with micro-CT14. As can be seen in Figure 8, C1-Cy7 effectively accumulated in mice brain, whereas TAT remained in liver of the mice. Accumulation of C1-Cy7 in the brain was further confirmed after dissection of the mice (Figure 8B). Notably, efficacy of brain uptake was higher for male vs female Balb / cJ (Figure 9). This might reflect specific physiology of BBB in Balb / cJ mouse strain. Biodistribution in male Balb / cJ was analyzed (Figure 11, Figure 10). Kidney and liver take up significant amounts of C1-Cy7. Less is biodistributed into lungs and spleen. Remarkably, uptake into brain is nearly as high as into liver, and does not differ with statistical significance from other organs. Harvesting followed by brain dissection and micro-CT also revealed that areas with highest uptake of C1-Cy7 were frontal lobes, and less cerebellum and brainstem (Figure 11 B).

[0556] Example 3: Delivery of therapeutic moieties to the brain

[0557] To further study the brain delivery potential of the new conjugate, it was attached to DNA strand targeting human miR-125b1 (Figure 12A). miR-125b1 is a microRNA, which are small, non-coding RNA molecules involved in the regulation of gene expression25. miR-125b1 plays a role in controlling cell proliferation, differentiation, and apoptosis, with confirmed role in cancer and inflammation. Among other functions, miR-125b1 is upregulated in neurogenerative diseases such as Alzheimer’s disease26. Targeting it with DNA anti-miR could be an approach to prevention of this devastating condition.

[0558] To stabilize DNA molecule of anti-miR in vivo, locked nucleic acids (LNA) were incorporated30. At this stage, Cy7 label was not applied, and instead anti-miR was “clicked” to the aptamer-DSPE-PEG (C1 ) and compared to unconjugated anti-miR 125b1 (Figure 12A). The product conjugate C2 was injected i.v. in male and female Balb / cJ mice at dose 5 mg / kilo. The dose was deliberately reduced compared to C1- Cy7, to reduce accumulation in other organs such as kidney and liver. After 2 days mice were harvested, their organs were processed and DNA levels were analyzed with qPCR (Figures 12, Tables 3-5). Remarkably, levels of DNA in the mice brain were higher than in kidney and liver. Brain-to-serum ratios were also remarkably high for both male and female mice, reaching 4.6-6.5 two days post-injection (Figure 12B). Similar effects were not observed using unconjugated anti-miR 125b1 (Figure 13). biological triplicates (1 ,2,3) and assay triplicates (-1 ,2,3).

[0559] Table 4. Anti-miR levels for conjugate C2 determined longitudinally in brain and serum samples: qPCR results for male (m1-3) and female (f1 -3) mice, in intra-plate duplicates. MALE FEMALE

[0560] Brain level Brain level

[0561] Table 5. Anti-miR levels (unconjugated) determined longitudinally in brain and serum samples: qPCR results for male (m1-3) and female (f1 -3) mice, in intra-plate duplicates.

[0562] There is no precedent in the literature on achieving this high level of DNA delivery through the BBB2-8. This confirms that the combination of hydrophilicity and BBB-targeting aptamer at small conjugate size, i.e. without nanoparticle formulation, is a potent design for brain targeting. One week post-injection anti- miR was cleared from both brain and serum.

[0563] Safety of treatment is an important consideration to be taken into account. Histopathology of both male and female mice 1 week after receiving C1-Cy7 (Tf), TAT-Cy7 (TAT) and PBS (negative control) was analyzed. Both TAT and nucleic acid molecules have reported toxicity, affecting mainly liver and kidney27-29. Lungs and spleen also get affected, especially by lipid reagents. Therefore, in addition to the targeted organ, the brain, kidney, liver, spleen and lung pathology was also analyzed. These organs have different regeneration properties. Liver and spleen cells have high propensity of mitosis and recover faster after chemical or mechanical injury. Kidney and brain cells on the contrary do not divide actively through mitosis, making them target for acute and prolonged pathology. Lung cells have some ability to divide through mitosis and therefore are moderately subjected to persistent pathology.

[0564] Minor pathology affecting kidney glomeruli and pointing on inflammation is seen in males receiving Tf; TAT is affecting negatively kidney in both females and males with a rather high score (4 total) (Table 6).

[0565] Table 6. Kidney pathology scores for mice treatment groups, contrasted to healthy controls. F = female; M = male Only mild pathology is detected in males receiving TAT. All other groups have no changes in liver (Table 7).

[0566] Table 7. Liver pathology scores for mice treatment groups, contrasted to healthy controls. F = female; M

[0567] = male.

[0568] Minor pathology of the spleen was detected in females receiving TAT (germinal centers and / or infiltrates in white pulp) (Table 8). Table 8. Spleen pathology scores for mice treatment groups, contrasted to healthy controls. F = female;

[0569] M = male.

[0570] Pathology of lungs was found in males and females, in a different fashion. Females had minor effect of Tf on alveoli; TAT affected negatively alveoli and induced interstitial fibrosis. In males, bronchi and vascular pathology were observed for Tf. TAT led to infiltration in lungs (Table 9).

[0571] Table 9. Lung pathology scores for mice treatment groups, contrasted to healthy controls. F = female; M = male.

[0572] Table 10. Brain pathology scores for mice treatment groups - analysis of gliosis and cell infiltrates. F = female; M = male. L1-L3 are dorsal-ventral orientation levels; F, Mid and Cerebellum are Rostral-Caudal orientation levels of the sections. The kidney was found to be is the organ that is most negatively affected with the TAT treatment, both in males and females (Tables 6-10). Moreover, lungs shower high pathology in males and females as well, especially after receiving TAT. Spleen and liver were not affected. In the brain, reduced cell counts and small number of infiltrates were observed, mostly in females; and only in case of mice receiving TAT (Table 11 ). Exemplary light micrograph images of H&E-stained frontal lobe tissues from female mice treated with Tf, TAT and PBS are shown in Figure 15. Table 11 . Analysis of cell count per cm2in H&E strained brain tissue samples of mice. F = frontal lobe, m= midbrain, c = cerebellum.

[0573] In conclusion, a novel RNA aptamer targeting the transferrin receptor (TfR), conjugated with DSPE lipid was synthesized and tested. The new TfR-targeting conjugate demonstrates both high efficacy and low acute toxicity in Balb / cJ mice. Through micro-CT imaging and PCR analyses, the conjugate has been shown to successfully deliver a substantial amount of DNA oligonucleotide to the brains of Balb / cJ mice and demonstrate effectiveness in a human blood-brain barrier cell line model. The conjugate achieves remarkably efficient brain uptake, reaching brain-to-serum ratios as high as 6.5.

[0574] The conjugate does not exclusively target the brain. It also affects kidney, liver and lungs. Nevertheless, it has unprecedently high brain-to-serum ratio that opens path for further developments in this direction.

[0575] The combination of high brain targeting ability upon systemic administration and no acute toxicity is unique and makes our conjugate a potent new delivery tool for the brain.

[0576] References

[0577] [1] L. Han, C. Jiang, Acta Pharm Sin B 2021 , 11 , 2306-2325.

[0578] [2] Chang HY, Wu S, Li Y, Guo L, Li Y, Shah DK. Effect of the Size of Protein Therapeutics on Brain Pharmacokinetics Following Systematic Administration. AAPS J. 2022 May 2;24(3):62. doi: 10.1208 / sl 2248-022-00701 -5. Erratum in: AAPS J. 2022 May 24;24(4):69. doi: 10.1208 / s12248-022- 00718-w. PMID: 35501500.

[0579] [3] Chang HY, Morrow K, Bonacquisti E, Zhang W, Shah DK. Antibody pharmacokinetics in rat brain determined using microdialysis. MAbs. 2018 Aug / Sep;10(6):843-853. doi: 10.1080 / 19420862.2018.1473910. Epub 2018 Aug 6. PMID: 29944439; PMCID: PMC6260134.

[0580] [4] Pornnoppadol G, Bond LG, Lucas MJ, Zupancic JM, Kuo YH, Zhang B, Greineder CF, Tessier PM. Bispecific antibody shuttles targeting CD98hc mediate efficient and long-lived brain delivery of IgGs. bioRxiv [Preprint], 2023 Apr 29:2023.04.29.538811. doi: 10.1101 / 2023.04.29.538811. Update in: Cell Chem Biol. 2024 Feb 15;31(2):361-372.e8. doi: 10.1016 / j.chembiol.2023.09.008. PMID: 37162883; PMCID: PMC10168297.

[0581] [5] Teleanu Rl, Preda MD, Niculescu AG, Vladacenco O, Radu Cl, Grumezescu AM, Teleanu DM. Current Strategies to Enhance Delivery of Drugs across the Blood-Brain Barrier. Pharmaceutics. 2022 May 4;14(5):987. doi: 10.3390 / pharmaceutics14050987. PMID: 35631573; PMCID: PMC9145636.

[0582] [6] Cheng J, Wang L, Guttha V, Haugstad G, Kandimalla KK. Delivery of RNA to the Blood-Brain Barrier Endothelium Using Cationic Bicelles. Pharmaceutics. 2023 Aug 4;15(8):2086. doi: 10.3390 / pharmaceuticsl 5082086. PMID: 37631300; PMCID: PMC10459289.

[0583] [7] Khare P, Edgecomb SX, Hamadani CM, Tanner EEL, S Manickam D. Lipid nanoparticle- mediated drug delivery to the brain. Adv Drug Deliv Rev. 2023 Jun;197:114861 . doi:

[0584] 10.1016 / j.addr.2023.114861. Epub 2023 May 6. PMID: 37150326.

[0585] [8] Ogawa K, Kato N, Yoshida M, Hiu T, Matsuo T, Mizukami S, Omata D, Suzuki R, Maruyama K, Mukai H, Kawakami S. Focused ultrasound / microbubbles-assisted BBB opening enhances LNP-mediated mRNA delivery to brain. J Control Release. 2022 Aug;348:34-41 . doi: 10.1016 / j.jconrel.2022.05.042.

[0586] Epub 2022 Jun 1. PMID: 35640764.

[0587] [9] Delac M, Motaln H, Ulrich H, Lah TT. Aptamer for imaging and therapeutic targeting of brain tumor glioblastoma. Cytometry A. 2015 Sep;87(9):806-16. doi: 10.1002 / cyto.a.22715. Epub 2015 Jul 17. PMID: 26189784.

[0588]

[0010] Monaco I, Camorani S, Colecchia D, Locatelli E, Calandra P, Oudin A, Niclou S, Arra C, Chiariello M, Cerchia L, Comes Franchini M. Aptamer Functionalization of Nanosystems for Glioblastoma Targeting through the Blood-Brain Barrier. J Med Chem. 2017 May 25;60(10):4510-4516. doi: 10.1021 / acs.jmedchem.7b00527. Epub 2017 May 10. PMID: 28471660.

[0589]

[0011] Macdonald J, Henri J, Goodman L, Xiang D, Duan W, Shigdar S. Development of a Bifunctional Aptamer Targeting the Transferrin Receptor and Epithelial Cell Adhesion Molecule (EpCAM) for the Treatment of Brain Cancer Metastases. ACS Chem Neurosci. 2017 Apr 19;8(4):777-784. doi: 10.1021 / acschemneuro.6b00369. Epub 2017 Jan 25. PMID: 28010059.

[0590]

[0012] F. Li, K. Ichinose, S. Ishibashi, S. Yamamoto, E. Iwasawa, M. Suzuki, K. Yoshida-Tanaka, K. Yoshioka, T. Nagata, H. Hirabayashi, K. Mogushi, T. Yokota, Molecular Therapy 2023, 31, 1106-1122.

[0591]

[0013] J. Li, H. Zeng, Y. You, R. Wang, T. Tan, W. Wang, L. Yin, Z. Zeng, Y. Zeng, T. Xie, J Nanobiotechnology 2021 , 19, DOI 10.1186 / s12951 -021 -01048-3.

[0592]

[0014] Z. Zhu, Y. Zhai, Y. Hao, Q. Wang, F. Han, W. Zheng, J. Hong, L. Cui, W. Jin, S. Ma, L. Yang, G. Cheng, J Extracell Vesicles 2022, 11 , DOI 10.1002 / jev2.12255.

[0593]

[0015] J. Zhou, J. Rossi, Nat Rev Drug Discov 2017, 16, 181-202.

[0594]

[0016] R.-J. Lin, RNA-Protein Complexes and Interactions Methods and Protocols Second Edition, n.d.

[0017] M. Egli, M. Manoharan, Nucleic Acids Res 2023, 51 , 2529-2573.

[0595]

[0018] X. Shao, H. Zhang, Z. Zhu, F. Ji, Z. He, Z. Yang, Y. Xia, Z. Cai, Anal Chem 2023, 95, 11124- 11131.

[0596]

[0019] A. S. Jorgensen, P. Gupta, J. Wengel, I. K. Astakhova, Chemical Communications 2013, 49, 10751-10753.

[0597]

[0020] D. Qi, H. Lin, B. Hu, Y. Wei, Journal of Controlled Release 2023, 358, 78-97.

[0598]

[0021] R. K. Sajja, P. Cudic, L. Cucullo, BMC Neurosci 2019, 20, DOI 10.1186 / s12868-019-0504-x.

[0599]

[0022] R. M. Ray, A. H. Hansen, M. Taskova, B. Jandl, J. Hansen, C. Soemardy, K. V. Morris, K. Astakhova, Beilstein Journal of Organic Chemistry 2021 , 17, 891-907.

[0600]

[0023] R. A. Martino, E. C. Fluck, J. Murphy, Q. Wang, H. Hoff, R. A. Pumroy, C. Y. Lee, J. J. Sims, S. Roy, V. Y. Moiseenkova-Bell, J. M. Wilson, J Virol 2021 , 95, DOI 10.1128 / jvi.O1164-21 .

[0601]

[0024] K. Astakhova, Chemosensors 2014, 2, 193-206.

[0602]

[0025] P. Takousis, A. Sadlon, J. Schulz, I. Wohlers, V. Dobricic, L. Middleton, C. M. Lili, R. Perneczky, L. Bertram, Alzheimer’s and Dementia 2019, 15, 1468-1477.

[0603]

[0026] S. Swarbrick, N. Wragg, S. Ghosh, A. Stolzing, Mol Neurobiol 2019, 56, 6156-6167.

[0604]

[0027] F. Ferraresso, A. W. Strilchuk, L. J. Juang, L. G. Poole, J. P. Luyendyk, C. J. Kastrup, Mol Pharm 2022, 19, 2175-2182.

[0605]

[0028] A. Schlegel, P. Bigey, H. Dhotel, D. Scherman, V. Escriou, Journal of Controlled Release 2013, 165, 1-8.

[0606]

[0029] C. Wang, Y. Zhang, Y. Dong, Acc Chem Res 2021 , 54, 4283-4293.

[0607]

[0030] Astakhova IK, Pasternak K, Campbell MA, Gupta P, Wengel J. A locked nucleic acid-based nanocrawler: designed and reversible movement detected by multicolor fluorescence. J Am Chem Soc. 2013 Feb 20;135(7):2423-6. doi: 10.1021 / ja311250w. Epub 2013 Feb 8. PMID: 23379691.

[0608]

[0031] Herrera A, Zhou J, Song MS, Rossi JJ. Evolution of Cell-Type-Specific RNA Aptamers via Live Cell-Based SELEX. Methods Mol Biol. 2023;2666:317-346. doi: 10.1007 / 978-1-0716-3191-1_22. PMID: 37166674.

[0609]

[0032] M.A. Walker, The Mitsunobu reaction: A novel method for the synthesis of bifunctional maleimide linkers, Tetrahedron Lett. 35 (1994) 665-668. https: / / doi.org / 10.1016 / 30040-4039(00)75785-6.

[0610]

[0033] Kurti, L.; Czako, B.; Strategic Applications of Named Reactions in Organic Synthesis, Staudinger reaction

Claims

Claims:1 . A conjugate of the following formula: Spacer — Lipidwherein r is 0 or 1 ;MAis a functional moiety, wherein the functional moiety is selected from the group consisting of therapeutic moieties and imaging moieties;MBis a targeting moiety; the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula:wherein each R is independently C1-24 alkyl or C2-24 alkenyl.

2. An intermediate conjugate of one of the following formulae: M' Lipid Spacer — LipidorrB;RAand RBare independently a reactive moiety;MAis a functional moiety, wherein the functional moiety is selected from the group consisting of therapeutic moieties and imaging moieties;MBis a targeting moiety; the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula:wherein each R is independently C1-24 alkyl or C2-24 alkenyl.

3. The conjugate according to claim 1 , wherein r is 1 .

4. The intermediate conjugate of claim 2, or the conjugate of claim 3, wherein the targeting moiety is an aptamer.

5. The conjugate or intermediate conjugate of claim 4, wherein the aptamer is capable of binding to transferrin receptor (TfR).

6. The conjugate or intermediate conjugate of claim 5, wherein the aptamer is capable of binding to TfR on a cell surface.

7. The conjugate or intermediate conjugate of any one of claims 4 to 6, wherein the aptamer comprises or consists of an RNA sequence having at least 90% sequence identity to SEQ ID NO:1 or SEQ ID NO: 40, wherein said RNA sequence has a length of 29 nucleotides or fewer.

8. The conjugate or intermediate conjugate of claim 7, wherein the RNA sequence has a length of 22 nucleotides of fewer.

9. The conjugate or intermediate conjugate of any one of claims 4 to 6, wherein the aptamer comprises or consists of an RNA sequence having at least 85% sequence identity to SEQ ID NO:5.

10. The intermediate conjugate of claim 2, or the conjugate of claim 3, wherein the targeting moiety comprises a GalNAc residue.11 . The conjugate or intermediate conjugate of any one of claims 1 to 10, wherein the functional moiety is a therapeutic moiety12. The conjugate or intermediate conjugate of claim 11, wherein the therapeutic moiety is a nucleic acid moiety, a peptide moiety or a small molecule drug moiety.

13. The conjugate or intermediate conjugate of claim 12, wherein the therapeutic moiety is an antisense nucleic acid, a small interfering RNA (siRNA), a small activating RNA (saRNA), a micro-RNA (miRNA) or an aptamer.

14. The conjugate or intermediate conjugate of claim 13, wherein the therapeutic moiety is anti-miR 125b1.

15. The conjugate or intermediate conjugate of claim 13, wherein the therapeutic moiety is a CCAAT / enhancer-binding protein (C / EBP ) siRNA.

16. The conjugate or intermediate conjugate of any one of claims 1 to 10, wherein the functional moiety is an imaging moiety, optionally wherein the imaging moiety is a bioluminescent molecule, a photoactive molecule, a metal or a nanoparticle.

17. A linker reagent of the formula:75Spacer — Lipidwherein r is 0 or 1 ;RAand RBare independently a reactive moiety; the spacer moiety comprises at least one group consisting of: a polyethylene glycol (PEG) chain, an amide bond, an alkylene group, a carbamate bond, and combinations thereof; and the lipid moiety is of the formula:wherein each R is independently C1-24 alkyl or C2-24 alkenyl.

18. The intermediate conjugate according to any one of claims 2 to 16, or linker reagent according to claim 17, wherein RAand RBare each a reactive moiety selected from the group consisting of: maleimide, thiol, azide, alkyne, and alkene.

19. The intermediate conjugate according to claims 2 to 16, or 18, or the linker reagent according to claim 17 or claim 18, wherein RAand RBare each a reactive moiety selected from the group consisting of: maleimide and azide.

20. The conjugate according to any one of claims 1 to 16, or the intermediate conjugate according to any one of claims 2 to 16, or 18 to 19, or the linker reagent according to any one of claims 17 to 19, wherein the spacer moiety is selected from one of the following formulae:wherein: a is 1-6; b is 1-6; n is 1-300;L1and L2are each independently Ci-e alkylene; the one or two attachments to the left of -[CH2]a- are the attachment or attachments to RA, RB, MA, or MB; and the attachment to the right of L2is the attachment to the lipid moiety.

21. The linker reagent according to any one of claims 17 to 20, wherein r is 1.

22. The conjugate according to any one of claims 3 to 16, or the intermediate conjugate according to any one of claims 2, 4 to 16, or 18 to 20, or the linker reagent according to claim 21, wherein the spacer moiety is selected from one of the following formulae:wherein: a is 1-6; b is 1-6; n is 1-300;L1and L2are each independently Ci-e alkylene; the one or two attachments to the left of -[CH2]a- are the attachment or attachments to RA, RB, MA, or MB; and the attachment to the right of L2is the attachment to the lipid moiety.

23. The conjugate, the intermediate conjugate, or the linker reagent according to claim 22, wherein the spacer moiety is:wherein: a is 1-6; n is 1-300;L1and L2are each independently Ci-e alkylene; the two attachments to the left of -[CH2]a- are the attachments to RA, RB, MA, or MB; and the attachment to the right of L2is the attachment to the lipid moiety.

24. The conjugate, the intermediate conjugate, or the linker reagent according to claim 23, wherein the spacer moiety is:wherein:77n is 1-300;L1and L2are each independently C1-6 alkylene; the two attachments to the left of -[CH2]a- are the attachments to RA, RB, MA, or MB; and the attachment to the right of L2is the attachment to the lipid moiety.

25. The conjugate according to any one of claims 20 or 22 to 24, or the intermediate conjugate according to any one of claims 20 or 22 to 24, or the linker reagent according to any one of claims 20 to 24, wherein L1is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C3 alkylene.

26. The conjugate according to any one of claims 20 or 22 to 25, or the intermediate conjugate according to any one of claims 20 or 22 to 25, or the linker reagent according to any one of claims 20 to 25, wherein L2is C1-5 alkylene, such as C1-4 alkylene, such as C1-3 alkylene, such as C2-3 alkylene, such as C2 alkylene.

27. The conjugate according to any one of claims 1 , 3 to 16, or 20 to 26, or the intermediate conjugate according to any one of claims 2, 4 to 16, 18 to 20, or 22 to 26, or the linker reagent according to any one of claims 17 to 26, wherein the lipid moiety is:

28. The conjugate according to any one of claims 1 , 3 to 16, or 20 to 27, or the intermediate conjugate according to any one of claims 2, 4 to 16, 18 to 20, or 22 to 27, or the linker reagent according to any one of claims 17 to 27, wherein each R is independently C1-20 alkyl, such as C10-20 alkyl, such as C15-20 alkyl, such as C17 alkyl.

29. The conjugate according to any one of claims 1 , 3 to 16, or 20 to 28, or the intermediate conjugate according to any one of claims 2, 4 to 16, 18 to 20, or 22 to 28, wherein the spacer-lipid moiety is:wherein the -S- attachment to the pyrrolidine-2, 5-dione moiety and the attachment to the 1 ,2,3-triazolyl group are the attachments to RA, RB, MAand MB;78optionally wherein the -S- attachment to the pyrrolidine-2, 5-dione moiety is the attachment to RBor MB, and the attachment to the 1 ,2,3-triazolyl group is the attachment to RAor MA.

30. The linker reagent according to any one of claims 17 to 28, wherein the linker reagent is:31 . The conjugate according to any one of claims 1 , 3 to 16, 20, or 22 to 29, or the intermediate conjugate according to any one of claims 2, 4 to 16, 18 to 20, or 22 to 29, or the linker reagent according to any one of claims 17 to 28 or 30, wherein n is 100-280, such as 150-260, such as 200-250, such as about 230.

32. The conjugate according to any one of claims 1 , 3 to 16, 20, or 22 to 29, or the intermediate conjugate according to any one of claims 2, 4 to 16, 18 to 20, or 22 to 29, or the linker reagent according to any one of claims 17 to 28 or 30, wherein n is 1-100, such as 1-50, such as 1-30, such as about 23 or about 22.

33. A pharmaceutical composition comprising the conjugate according to any one of claims 1 , 3 to 16, 20, 22 to 29, or 31 to 32, or the intermediate conjugate according to any one of claims 2, 4 to 16, 18 to 20, 22 to 29, or 31 to 32, and a pharmaceutically acceptable excipient.

34. A conjugate according to any one of claims 1 , 3 to 16, 20, 22 to 29, or 31 to 32, an intermediate conjugate according to any one of claims 2, 4 to 16, 18 to 20, 22 to 29, or 31 to 32, or a pharmaceutical composition according to claim 33, for use in a method of treating or preventing a disease or disorder.

35. Use of a conjugate according to any one of claims 1 , 3 to 16, 20, 22 to 29, or 31 to 32, an intermediate conjugate according to any one of claims 2, 4 to 16, 18 to 20, 22 to 29, or 31 to 32, or a pharmaceutical composition according to claim 33, in the manufacture of a medicament for use in a method of treating or preventing a disease or disorder.

36. A method of treating or preventing a disease or disorder, the method comprising administering to a subject in need thereof an effective amount of a conjugate according to any one of claims 1 , 3 to 16, 20, 22 to 29, or 31 to 32, an intermediate conjugate according to any one of claims 2, 4 to 16, 18 to 20, 22 to 29, or 31 to 32, or a pharmaceutical composition according to claim 33.

37. The conjugate, intermediate conjugate or pharmaceutical composition for use according to claim 34, the use according to claim 35, or the method according to claim 36, wherein the disease or condition is a brain disease.7938. The conjugate, intermediate conjugate or pharmaceutical composition for use, the use, or the method according to claim 37, wherein the brain disease is a cancer of the brain or central nervous system, a neurodegenerative disease or an infection.

39. A method of delivering a functional moiety to a cell, the method comprising: a. contacting a cell with the conjugate according to any one of claims 1 , 3 to 16, 20 to 29, or 31 to 32 or a pharmaceutical composition according to claim 33; and b. allowing said conjugate to bind to a transferrin receptor on said cell and pass into said cell thereby delivering said functional moiety into said cell.80