Use of OSK8 gene in promoting plant growth
By overexpressing the OSK8 gene in rice to promote nitrogen fertilizer absorption, the problem of low nitrogen fertilizer utilization efficiency in rice production was solved, thereby improving rice growth and protecting the environment.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- INST OF FOOD CROPS HUBEI ACAD OF AGRI SCI
- Filing Date
- 2025-02-26
- Publication Date
- 2026-05-21
Smart Images
Figure CN2025079145_21052026_PF_FP_ABST
Abstract
Description
Application of an OSK8 gene in promoting plant growth Technical Field
[0001] This disclosure relates to the field of molecular breeding, and in particular to the application of an OSK8 gene in promoting plant growth. Background Technology
[0002] Rice (Oryza sativa) is my country's primary staple food crop, with more than half of the population relying on it as their main food source. The development of dwarf rice breeding spurred the first "Green Revolution," significantly increasing rice yields. However, in an effort to boost yields, many producers resort to excessive fertilization.
[0003] Currently, over-fertilization is also a problem in rice production. This leads to a large amount of nitrogen fertilizer not being absorbed and utilized by the rice, but instead being absorbed by the soil or washed away by water, causing pollution. Moreover, excessive application of nitrogen fertilizer reduces the nitrogen fertilizer utilization efficiency of rice, which is not conducive to rice cultivation.
[0004] To reduce the environmental pollution caused by excessive nitrogen fertilizer, further exploration and utilization of genes related to nitrogen fertilizer absorption in rice plays an important role in the development of green agriculture.
[0005] Public content
[0006] To address the problems of existing technologies, this disclosure provides an application of the OSK8 gene in promoting plant growth. The technical solution is as follows:
[0007] This disclosure provides an application of the OSK8 gene in promoting plant growth, the application including: using the OSK8 gene to promote plant growth.
[0008] Specifically, the application includes: the OSK8 gene positively regulating plant growth by promoting nitrogen fertilizer absorption.
[0009] Specifically, the application includes: positively regulating plant growth by overexpressing the OSK8 gene to promote nitrogen fertilizer absorption.
[0010] Specifically, the plant includes rice.
[0011] Specifically, the applications include:
[0012] Using the cDNA of the sample as a template, PCR amplification was performed using forward and reverse primers to obtain the amplification product;
[0013] The amplification product was subjected to agarose gel electrophoresis to obtain the target fragment.
[0014] The double-enzyme digestion vector was ligated to the target fragment to obtain the ligation product;
[0015] The ligation product was transformed into the recipient material, and positive plants were selected to obtain overexpression transgenic material.
[0016] Specifically, the receptor material is rice ZH11.
[0017] Specifically, the amplified product fragment is 372 bp.
[0018] Specifically, the sequence of the forward primer is shown as SEQ ID NO: 1 in the sequence listing, and the sequence of the reverse primer is shown as SEQ ID NO: 2 in the sequence listing.
[0019] The beneficial effects of the technical solution provided in this disclosure are as follows: This disclosure provides an application of the OSK8 gene in promoting plant growth. The OSK8 gene promotes the plant height and underground growth of seedlings. Furthermore, the plant height of OE (Organic Rice) varies greatly under different concentrations of nitrate nitrogen treatment, indicating sensitivity to changes in nitrate nitrogen concentration. This means that the OSK8 gene affects nitrogen uptake, demonstrating that the OSK8 gene positively regulates rice growth through nitrogen uptake. Therefore, transgenic materials overexpressing the OSK8 gene can improve nitrogen fertilizer use efficiency. Attached Figure Description
[0020] To more clearly illustrate the technical solutions in the embodiments of this disclosure, the accompanying drawings used in the description of the embodiments will be briefly introduced below. Obviously, the accompanying drawings described below are only some embodiments of this disclosure. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0021] Figure 1 is a schematic diagram of the construction of the OSK8 overexpression vector provided in Embodiment 1 of this disclosure;
[0022] Figure 2 is a comparison of the expression levels of transgenic plants OE-1 and OE-2 overexpressing WT and OSK8, as analyzed by qPCR according to Embodiment 1 of this disclosure.
[0023] Figure 3 is a Western-blotting analysis of the protein levels in transgenic plants OE-1 and OE-2 with overexpression of WT and OSK8 provided in Embodiment 1 of this disclosure;
[0024] Figure 4 is a comparison of the plant height differences of transgenic plants OE-1 and OE-2 with WT and OSK8 overexpression provided in Embodiment 1 of this disclosure;
[0025] Figure 5 is a statistical diagram of the plant height of transgenic plants OE-1 and OE-2 with WT and OSK8 overexpression provided in Embodiment 1 of this disclosure;
[0026] Figure 6a is a phenotypic comparison of WT and OE seedlings under hydroponic conditions provided in Embodiment 2 of this disclosure;
[0027] Figure 6b is a comparison of root development of WT and OE seedlings under hydroponic conditions provided in Embodiment 2 of this disclosure;
[0028] Figure 7a is a phenotypic comparison of WT and OE seedlings under low nitrogen culture conditions provided in Embodiment 2 of this disclosure;
[0029] Figure 7b is a comparison of root development of WT and OE seedlings under low nitrogen culture conditions provided in Embodiment 2 of this disclosure;
[0030] Figure 8a is a phenotypic comparison of WT and OE seedlings under medium nitrogen culture conditions provided in Example 2 of this disclosure;
[0031] Figure 8b is a comparison of root development of WT and OE seedlings under medium nitrogen culture conditions provided in Embodiment 2 of this disclosure;
[0032] Figure 9a is a phenotypic comparison of WT and OE seedlings under high nitrogen culture conditions provided in Embodiment 2 of this disclosure;
[0033] Figure 9b is a comparison of root development of WT and OE seedlings under high nitrogen culture conditions provided in Embodiment 2 of this disclosure;
[0034] Figure 10 is a statistical chart of the plant height of WT and OE seedlings under different culture conditions provided in Embodiment 2 of this disclosure;
[0035] Figure 11 is a statistical chart of the total root length of WT and OE seedlings under different culture conditions provided in Embodiment 2 of this disclosure;
[0036] Figure 12 is a statistical chart of the root projection area of WT and OE seedlings under different culture conditions provided in Embodiment 2 of this disclosure. Detailed Implementation
[0037] To make the objectives, technical solutions, and advantages of this disclosure clearer, the embodiments of this disclosure will be described in further detail below with reference to the accompanying drawings.
[0038] Example 1
[0039] This disclosure provides an application of the OSK8 gene in promoting plant growth, the application including: using the OSK8 gene to promote plant growth. In this embodiment, the coding sequence of the OSK8 gene (LOC_Os11g48030) is shown as SEQ ID NO: 3 in the sequence listing, specifically: ATGCTGCGGAAGGGAGAGGCGCCGGGGCACCAAACCCCACCCCACCTGCACAAGGACGACGGCGACGACGACGACGACGCACCGTCCGGCTTCGTCAAGCTCATCAGCGCCGAGGGCTTCGAGTTCGTCGTCGACAAGAAGGCCGCCATGGTCTCCAACACGCTCCGCAACATGCTCACCTCCCCCCCGGCGGCTTCTCCGAGACGCGCGAGGGCGAGGTTAGGTTCCCCGAGATCAGCACCCCCATCCTCGAGAAGATCTGCCAGTACTTCTACTGGTCGCTCCACTACTCCAGTGGGAAGGAGACATCTGAGTTTCAAATTGAACCGGAGATAACTCTGGAGCTGATGATGGCTGCAAACTATCTGGACACCTGA.
[0040] Specifically, the plants include rice.
[0041] Specifically, the application includes: obtaining an overexpression vector by driving the overexpression of the OSK8 gene through a promoter;
[0042] The overexpression vector was transformed into the recipient material to obtain the overexpression transgenic materials OE-1 and OE-2.
[0043] Specifically, the recipient material is rice ZH11.
[0044] Specifically, the promoter is the Ubiquitin promoter.
[0045] Specifically, cDNA of rice ZH11 was obtained. In this embodiment, total RNA was first extracted from the rice material; the total RNA was then reverse transcribed to obtain cDNA. Specifically, the total RNA was extracted from the rice material using the RNAiso Plus kit (TaKaRa Code: D9108A), and the specific operation procedure is described in the kit's instruction manual. Then, the PrimeScript™ RT reagent Kit with gDNA Eraser (Lot#AK4901) from TAKARA was used. The procedure was followed according to the kit's instructions, and finally, the cDNA was stored at 4°C. In this embodiment, rice ZH11 is a commercially available rice variety.
[0046] Using cDNA as a template, PU2301F as the forward primer and PU2301R as the reverse primer, PCR (Polymerase Chain Reaction) amplification was performed to obtain the amplified product (the coding region of the OSK8 gene, OX-OSK8), with a fragment length of 372 bp. The sequence of the forward primer is: ccatttacgaacgatagccggtaccatgctgcggaagggagaggc, as shown in SEQ ID NO: 1 in the sequence listing; the sequence of the reverse primer is: gatctttgtaatcggatccggatccggtgtccagatagtttgcag, as shown in SEQ ID NO: 2 in the sequence listing.
[0047] In this embodiment, the PCR amplification system was as follows: 3 μL DNA, 25 μL 2×KOD Fx (1 U / μL) PCR buffer, 10 μL 2 mM dNTPs, 1.5 μL forward primer, 1.5 μL reverse primer, 1 μL KOD Fx (1 U / μL), and 8 μL ddH2O. The PCR amplification procedure is shown in Table 1.
[0048] Table 1 shows the PCR amplification procedure.
[0049] After confirming the correct size of the amplified product by agarose gel electrophoresis, the amplified product was recovered by gel extraction using a DNA recovery kit (TIANGEN DNA purification and recovery kit, catalog number DP241-03) to obtain the target fragment OX-OSK8.
[0050] The commercially available vector pU2301 was subjected to double digestion with KpnⅠ and BamHI. After complete digestion was detected by agarose gel electrophoresis, the vector was recovered and purified to obtain the double-digested vector pU2301 (KpnⅠ / BamHI).
[0051] The target fragment OX-OSK8 was ligated with the double-digested vector pU2301 (KpnⅠ / BamHI) using a one-step Gibson Assembly. The ligation system consisted of 2 μL of the target fragment OX-OSK8, 0.5 μL of the double-digested vector pU2301 (KpnⅠ / BamHI), and 7.5 μL of the one-step ligase Mixture. After thorough mixing, the mixture was incubated at 50°C for 50 min to obtain the ligation product. The ligation product was transformed into competent *E. coli* cells Trans5α, and single clones were picked and cultured to obtain bacterial culture. After preservation, positive single clones were preliminarily identified by PCR, followed by plasmid extraction and sequencing. The positive single clones without mutation were selected as the constructed OSK8 overexpression vector, as shown in Figure 1. The OSK8 overexpression vector was transformed into rice ZH11 using Agrobacterium-mediated genetic transformation to obtain transgenic T0 generation overexpression plants. Transgenic T0 generation overexpressing plants were identified by Hyg primer positive identification, and positive seedlings were selected. Subsequently, the positive seedlings were further propagated by multiple generations, and expression level and protein level were detected to screen out transgenic plants with OSK8 overexpression.
[0052] In this embodiment, qPCR (quantitative polymerase chain reaction) was used to detect the OSK8 gene expression in transgenic plants overexpressing OSK8, with wild-type rice ZH11 used as the control group (WT). As shown in Figure 2, compared to WT, the OSK8 gene expression levels in the OSK8-overexpressing transgenic plants OE-1 and OE-2 were significantly increased. As shown in Figure 3, Western blotting analysis of OE-1 and OE-2 with WT (using Flag as the antibody and Actin as the internal control protein) showed that OSK8-flag protein was detectable in the OSK8-overexpressing transgenic plants, but not in WT. This indicates that the overexpression family exhibited overexpression at both the transcriptional and protein levels. The results also showed that the plant height of the overexpression material was significantly increased compared to WT.
[0053] After soaking and germinating seeds of OE-1, OE-2, and WT, 50 seeds from each variety with normal germination and similar germination rates were selected and sown in seedling trays. At 25 days of age, the seedlings were transplanted into the field at a spacing of 16.7 cm between plants and 26.7 cm between rows, planted in plots of 10 plants × 5 rows, and managed with normal field water and fertilizer. After seed maturity, the plant heights of OE-1, OE-2, and WT were observed and photographed (Figure 4). The plant heights of WT, OE-1, and OE-2 were also statistically analyzed (Figure 5). Combining Figures 4 and 5, it can be seen that the plant heights of OE-1 and OE-2 were significantly increased compared to WT. This indicates that increased OSK8 gene expression positively regulates rice growth.
[0054] Example 2
[0055] This disclosure provides an application of the OSK8 gene in promoting plant growth, the application of which includes: the OSK8 gene positively regulating plant growth by promoting nitrogen fertilizer absorption.
[0056] Specifically, the application includes: positively regulating plant growth by overexpressing the OSK8 gene to promote nitrogen fertilizer absorption.
[0057] In this embodiment, transgenic plants OE with OSK8 overexpression and control group WT were cultured as seedlings under different culture conditions, and the growth of the seedlings was recorded. The different culture conditions included the application of water and low nitrogen (0.375mM NO3). - ), medium nitrogen (1.25mM NO3) - ) and high nitrogen (2mM NO3) - ).
[0058] As shown in Figures 6a and 6b, under hydroponic conditions, the seedling height and root development of OE seedlings did not change significantly compared to those of WT seedlings.
[0059] Combining Figures 7a and 7b, it can be seen that at low nitrogen (0.375mM NO3)... - Under the same cultivation conditions, compared with WT seedlings, OE seedlings showed a significant increase in plant height, while OE seedlings showed no significant difference in root development.
[0060] Combining Figures 8a and 8b, it can be seen that, regarding root development, in medium nitrogen (1.25 mM NO3)... - Under the specified cultivation conditions, the seedling height and root area of OE seedlings increased significantly. In this embodiment, the significance was determined by a t-test.
[0061] Combining Figures 9a and 9b, it can be seen that in high nitrogen (2mM NO3) conditions... -Under the same cultivation conditions, there were significant differences in the plant height and root development of OE seedlings, with OE seedlings having larger root systems.
[0062] As shown in Figures 10 to 12, the OSK8 gene promotes seedling height and underground growth. Furthermore, the plant height of OE (Olympiad Erytheme) varies significantly under different nitrate nitrogen concentrations, indicating its sensitivity to changes in nitrate nitrogen concentration. This suggests that the OSK8 gene influences nitrogen uptake. Therefore, the OSK8 gene positively regulates rice growth by affecting nitrogen uptake, which explains why overexpression of the OSK8 gene in transgenic materials can improve nitrogen fertilizer use efficiency.
[0063] The above description is merely an optional embodiment of this disclosure and is not intended to limit this disclosure. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of this disclosure should be included within the protection scope of this disclosure.
Claims
1. An application of the OSK8 gene in promoting plant growth, characterized in that, The application includes using the OSK8 gene to promote plant growth.
2. The application according to claim 1, characterized in that, The application includes: the OSK8 gene positively regulates plant growth by promoting nitrogen fertilizer absorption.
3. The application according to claim 1, characterized in that, The application includes: positively regulating plant growth by overexpressing the OSK8 gene to promote nitrogen fertilizer absorption.
4. The application according to claim 1, characterized in that, The plant mentioned includes rice.
5. The application according to claim 4, characterized in that, The applications include: Using the cDNA of the sample as a template, PCR amplification was performed using forward and reverse primers to obtain the amplification product; The amplification product was subjected to agarose gel electrophoresis to obtain the target fragment. The double-enzyme digestion vector was ligated to the target fragment to obtain the ligation product; The ligation product was transformed into the recipient material, and positive plants were selected to obtain overexpression transgenic material.
6. The application according to claim 5, characterized in that, The receptor material is rice ZH11.
7. The application according to claim 5, characterized in that, The amplified product fragment is 372 bp.
8. The application according to claim 5, characterized in that, The sequence of the forward primer is shown in SEQ ID NO: 1 in the sequence listing, and the sequence of the reverse primer is shown in SEQ ID NO: 2 in the sequence listing.