Targeting reagent for preparation of animal of fragile x syndrome and use thereof

By using CRISPR/Cas9 technology to target and downregulate FMR1 gene exons in non-human primates, an animal model of Fragile X syndrome was constructed, overcoming the limitations of existing models and realizing a more accurate disease simulation and drug development platform.

WO2026103458A1PCT designated stage Publication Date: 2026-05-21CENT FOR EXCELLENCE IN BRAIN SCI & INTELLIGENCE TECH CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
CENT FOR EXCELLENCE IN BRAIN SCI & INTELLIGENCE TECH CHINESE ACAD OF SCI
Filing Date
2025-10-22
Publication Date
2026-05-21

AI Technical Summary

Technical Problem

Existing fruit fly, zebrafish, and mouse models have limitations in simulating Fragile X syndrome, failing to fully reproduce human disease characteristics, resulting in poor drug development outcomes, and there is a lack of suitable non-human primate models.

Method used

Using CRISPR/Cas9 technology to target and downregulate the third and fourth exons of the FMR1 gene in non-human primates, an animal model of Fragile X syndrome was constructed. Gene editing was performed in fertilized eggs using sgRNA and Cas9 mRNA to obtain animals with typical disease symptoms.

Benefits of technology

A fragile X syndrome animal model that closely resembles human disease symptoms has been successfully established, stably exhibiting symptoms such as increased total activity, repetitive and stereotyped behaviors, anxiety, social impairment, and cognitive impairment, providing a more similar drug development platform.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025129280-FTAPPB-I100001
    Figure PCTCN2025129280-FTAPPB-I100001
  • Figure PCTCN2025129280-FTAPPB-I100002
    Figure PCTCN2025129280-FTAPPB-I100002
  • Figure PCTCN2025129280-FTAPPB-I100003
    Figure PCTCN2025129280-FTAPPB-I100003
Patent Text Reader

Abstract

Provided is an sgRNA for down-regulating the FMR1 gene of a non-human primate. The sgRNA targets a target sequence in a fourth exon of the FMR1 gene and / or targets a target sequence in a third exon of the FMR1 gene. Also provided is a use of the sgRNA in the preparation of a non-human primate of fragile X syndrome.
Need to check novelty before this filing date? Find Prior Art

Description

Targeting reagents for the preparation of animals with Fragile X syndrome and their applications

[0001] This invention claims priority to patent application CN 202411614512.7, filed on November 12, 2024, the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention belongs to the fields of medicine and biology, and more specifically, this invention relates to animal models of Fragile X syndrome, their construction and application. Background Technology

[0003] Fragile X Syndrome (FXS) is the second most common inherited intellectual disability after Down syndrome, and it is also the most common type of autism spectrum disorder. The incidence rate is 1 / 2500-1 / 5000 for males and 1 / 4000-1 / 6000 for females. FXS patients present with diverse clinical manifestations, primarily moderate to severe intellectual disability, with IQ scores often between 20 and 60. FXS patients also exhibit abnormal physical features, such as a prominent forehead, large and protruding jaw, large ears, high-arched palate, thick lips, and a protruding lower lip. Males may develop enlarged testes during puberty. Some patients exhibit behavioral disorders, such as ADHD, autistic behaviors (e.g., aggressive behavior, social impairment, and stereotyped behaviors), and 20% experience occasional epileptic seizures.

[0004] FXS is caused by mutations in the FMR1 gene, located on chromosome X q27.3. The FMR1 gene contains CGG repeat sequences in its 5'-UTR (5'-untranslated region). The normal number of CGG trinucleotide repeats in the FMR1 gene is generally between 6 and 54. Individuals with premutations have 55-200 CGG trinucleotide repeats. The CGG copy number in females carrying premutations is unstable and easily transforms into a full mutation during transmission to offspring. When the number of CGG trinucleotide repeats exceeds 200, it is called a full mutation. At this point, the FMR1 gene undergoes epigenetic changes; the CGG repeat sequence and the FMR1 promoter are methylated, leading to silencing of FMR1 gene expression. Over 99% of cases are caused by additional extension of the CGG trinucleotide repeat sequence in the 5'-UTR of the FMR1 gene (>200 copies), while the remaining 1% are due to point mutations and gene duplication / deletion in the FMR1 gene. The protein FMRP, encoded by the FMR1 gene, is expressed in various mammalian tissues, with particularly high expression in the brain and testes, and is expressed in brain neurons and various types of glial cells. FMRP is an RNA-binding protein that regulates protein expression by binding to mRNA. Its selectivity for RNA targets largely depends on two central KH domains and a C-terminal arginine-glycine-rich domain. Current research suggests that FMRP primarily negatively regulates the expression of local neuronal proteins, most of which are related to dendritic growth and development and receptor signaling pathways. In the absence of FMRP, the expression of these regulated proteins increases. The specific mechanism by which FMRP deficiency leads to FXS is currently unclear. Clinically, there are no specific drugs for treating FXS; treatment mainly focuses on symptomatic and supportive care.

[0005] Animal models are a crucial foundation for studying the mechanisms of human diseases and developing new drugs. Currently, animal models for FXS include fruit fly models, zebrafish models, mouse models, and rat models. However, these animals have shown significant limitations in simulating FXS disease.

[0006] The Drosophila homolog of the FMR1 gene is Dfmr1. DFMRP-deficient Drosophila exhibit several FXS patients.

[0007] Related phenotypes include sleep problems, memory deficits, social interaction deficits, and neurodevelopmental deficits. However, they do not exhibit phenotypes such as increased activity and anxiety; nor do they exhibit typical repetitive and stereotyped behaviors.

[0008] Zebrafish models also exhibit some phenotypes of FXS patients, including behavioral characteristics such as anxiety and hyperactivity. Fmr1 knockout zebrafish showed anxiety when transferred to new aquariums. Craniofacial developmental abnormalities were also observed in Fmr1 knockout zebrafish larvae. However, they did not exhibit cognitive impairment or social behavioral abnormalities; nor did they display typical repetitive and stereotyped behaviors. Furthermore, the drug absorption and metabolism pathways in fruit flies and zebrafish differ significantly from those in humans, thus greatly limiting the application of fruit flies and zebrafish in FXS drug development.

[0009] The Fmr1 knockout mouse model is the most widely used animal model for FXS (Human Factor Surgery). Fmr1 knockout mice exhibit some phenotypes of FXS patients, including abnormal development of dendritic spines and giant testes. However, they also show behavioral abnormalities such as hyperactivity and auditory-induced seizures (not just occasional seizures); but they do not exhibit typical repetitive and stereotyped behaviors. Furthermore, autism-like phenotypes common in FXS patients are not observed in many mouse strains, and the mouse models lack the cognitive impairments most typical of FXS patients; social behavioral manifestations (such as social impairment) are also lacking. Another significant issue is that current potential treatment strategies and drug development for FXS are primarily driven by Fmr1 knockout mice. Although various pharmacological strategies can improve the phenotype of model mice, they have shown disappointing results in clinical trials.

[0010] To date, no suitable model of Fragile X syndrome has been prepared in this field, and there is still a gap in the field of non-human primate models. Constructing a non-human primate model of Fragile X syndrome is of great significance for the study of the mechanism of the disease and drug development. Summary of the Invention

[0011] The purpose of this invention is to provide an animal model of Fragile X syndrome, its construction method, and its application.

[0012] In a first aspect of the invention, there is a use of sgRNA in the preparation of Fragile X syndrome animals (including the preparation of a construct for preparing the animals, wherein the sgRNA is introduced into the construct), wherein the sgRNA downregulates the FMR1 gene of the animals, the downregulation targeting the third and / or fourth exon of the FMR1 gene; wherein the animals are non-human primates.

[0013] In another aspect of the invention, there is provided the use of sgRNA in the preparation of animal cells, wherein the sgRNA downregulates the FMR1 gene in the animal cells, the downregulation targeting the third and / or fourth exon of the FMR1 gene; wherein the animal is a non-human primate; preferably, the cells comprise fertilized eggs.

[0014] In one or more preferred embodiments, the sgRNA includes: sgRNA targeting the target sequence SEQ ID NO:3 (Exon4) in the fourth exon of the FMR1 gene; and / or sgRNA targeting the target sequences SEQ ID NO:2 (Exon3-2) and / or SEQ ID NO:1 (Exon3-1) in the third exon of the FMR1 gene.

[0015] In one or more preferred embodiments, the sgRNA includes: an sgRNA targeting the target sequence SEQ ID NO:3 in the fourth exon of the FMR1 gene, and an sgRNA targeting the target sequence SEQ ID NO:2 in the third exon of the FMR1 gene.

[0016] In one or more preferred embodiments, the sgRNA comprises a subset selected from:

[0017] The sgRNA targeting the target sequence SEQ ID NO:3 has the nucleotide sequence shown in SEQ ID NO:6;

[0018] The sgRNA targeting the target sequence SEQ ID NO:2 has the nucleotide sequence shown in SEQ ID NO:5;

[0019] The sgRNA targeting the target sequence SEQ ID NO:1 has the nucleotide sequence shown in SEQ ID NO:4.

[0020] In one or more preferred embodiments, the sgRNA and Cas mRNA or a construct capable of forming the sgRNA and Cas9 mRNA are introduced into the fertilized egg of an animal; preferably, the process further includes: allowing the fertilized egg to develop to obtain the Fragile X syndrome animal.

[0021] In one or more preferred embodiments, the non-human primates include monkeys, orangutans, apes, etc.

[0022] In one or more preferred embodiments, the use of preparing animals with Fragile X syndrome or the use of preparing animal cells is for "non-therapeutic purposes".

[0023] In one or more preferred embodiments, the Fragile X syndrome animals have a phenotype selected from the group consisting of: increased total activity and repetitive stereotyped activities, increased anxiety, language development disorders, decreased social willingness; memory impairment; decreased cognitive flexibility; and attention deficit (altered gaze characteristics).

[0024] In another aspect of the invention, sgRNA for preparing animals with Fragile X syndrome is provided, which targets the target sequence SEQ ID NO:3 (Exon4) in the fourth exon of the animal's FMR1 gene, the target sequence SEQ ID NO:2 (Exon3-2) in the third exon, or SEQ ID NO:1 (Exon3-1).

[0025] In one or more preferred embodiments, the sgRNA is a combination of sgRNAs, including: a target sequence SEQ ID NO:3 (Exon4) targeting the fourth exon of the FMR1 gene in animals, and a target sequence SEQ ID NO:2 (Exon3-2) targeting the third exon of the FMR1 gene in animals.

[0026] In one or more preferred embodiments, the sgRNA targeting the target sequence SEQ ID NO:3 has a nucleotide sequence as shown in SEQ ID NO:6; the sgRNA targeting the target sequence SEQ ID NO:2 has a nucleotide sequence as shown in SEQ ID NO:5; or the sgRNA targeting the target sequence SEQ ID NO:1 has a nucleotide sequence as shown in SEQ ID NO:4.

[0027] In another aspect of the invention, the application of the Fragile X syndrome animals prepared by the method is provided for: serving as an animal model for screening candidate drugs or therapeutic agents to alleviate or treat Fragile X syndrome; serving as an animal model for studying Fragile X syndrome; or for conducting drug metabolism and toxicology tests.

[0028] In one or more preferred embodiments, the method or application is a non-diagnostic or non-therapeutic method or application, and is not intended for the diagnosis or treatment of a disease.

[0029] In another aspect of the invention, a kit for preparing animals with Fragile X syndrome is provided, comprising the sgRNA described above for preparing animals with Fragile X syndrome.

[0030] In one or more preferred embodiments, the kit further contains Cas mRNA or a construct capable of forming Cas mRNA.

[0031] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. Attached Figure Description

[0032] Figure 1. Gene-specific guide RNA design and efficiency testing;

[0033] (A) Schematic diagram of the FMR1 locus in cynomolgus monkeys and guide RNA sequence;

[0034] (B) Results of fertilized eggs injected with a mixture of FMR1 guide RNA / Cas9 mRNA developing into blastocysts and undergoing amplification of the target sequence;

[0035] (C) The proportion of FMR1 gene editing in embryos obtained from the results of TA cloning of the amplification product.

[0036] Figure 2. Genotyping of model monkeys and FMRP protein expression analysis;

[0037] (A) M4 photo;

[0038] (B) Electrophoresis results of FMR1 gene guide RNA target region amplification products from surviving monkeys;

[0039] (C) Immunoblot results of leukocyte proteins in the blood of surviving monkeys;

[0040] (D) Immunoblotting results of prefrontal lobe tissue proteins in aborted monkeys.

[0041] Figure 3. FMRP protein expression analysis in F1 generation FMR1 gene mutant monkeys;

[0042] (A) Analysis of FMRP protein expression levels in blood leukocytes of F1 generation FMR1 gene mutant monkeys;

[0043] (B) Immunoblotting analysis of FMRP protein expression levels in the prefrontal cortex of F1 generation FMR1 gene mutant monkeys;

[0044] (C) FMRP immunofluorescence detection of the frontal cortex of F1 generation FMR1 gene mutant monkeys.

[0045] Figure 4. Genomic DNA extracted from F0 generation surviving genetically modified monkeys and sequenced for analysis.

[0046] Figure 5. Genomic DNA extracted from F0 generation aborted monkeys and sequenced for analysis.

[0047] Figure 6. Genomic DNA extracted from F1 generation genetically modified monkeys and sequenced for analysis.

[0048] Figure 7. Increased total activity and repetitive stereotyped activities in FMR1 knockout monkeys;

[0049] (A) Schematic diagram of the movement trajectories of WT4 and M5 in the activity level test experiment;

[0050] (B) Total distance traveled;

[0051] (C) Percentage of time spent in the upper part of the cage;

[0052] (D) Percentage of time spent at the bottom of the cage;

[0053] (E) Statistics on the number of repetitive stereotyped behaviors.

[0054] Figure 8. Reduced vocalization in FMR1 knockout monkeys during threat-related anxiety and defense (TAD) behavioral tests;

[0055] (A) Total number of gurgling sounds during non-eye contact phase;

[0056] (B) Total number of gurgling sounds during the eye contact phase;

[0057] (C) Total number of sounds produced during the entire test.

[0058] Figure 9. Reduced social willingness in FMR1 knockout monkeys;

[0059] (A) Statistics on the time spent by the tested monkeys exploring unfamiliar monkeys during the adaptation phase;

[0060] (B) Statistics on repetitive and stereotyped behaviors;

[0061] (C) Attack behavior statistics;

[0062] (DG) statistics on proactive social behavior;

[0063] (HK) Statistics on passive social behavior.

[0064] Figure 10. FMR1 knockout monkeys exhibit working memory impairment;

[0065] (A) The time taken by knockout monkeys M2, M3, M4, M5 and their age-matched WT control (2.5 years) to pass the Wisconsin black and white patch test at three stages;

[0066] (B) Statistics on the time taken for knockout monkeys M2, M3, M4, M5 and their age-matched WT controls (2.5 years) to pass the adaptation phase;

[0067] (C) Time statistics of knockout monkeys M2, M3, M4 and M5 and their age-matched WT controls (2.5 years) through the color recognition stage;

[0068] (D) Time statistics of color inversion in knockout monkeys M2, M3, M4, M5 and their age-matched WT controls (2.5 years);

[0069] (E) The time taken by knockout monkeys M6, M7, M8, M9 and their age-matched controls (1.5 years) to pass the Wisconsin black-and-white patch test at three stages;

[0070] (F) Statistics on the time taken for knockout monkeys M6, M7, M8, M9 and their age-matched controls (1.5 years) to pass the adaptation phase;

[0071] (G) Time statistics of knockout monkeys M6, M7, M8, M9 and their age-matched controls (1.5 years) in the color recognition stage;

[0072] (H) Statistical analysis of color inversion time in knockout monkeys M6, M7, M8, M9 and their age-matched controls (1.5 years).

[0073] Figure 11. FMR1 knockout monkeys exhibit poor cognitive flexibility;

[0074] (A, B) Statistical analysis of the daily task accuracy of knockout monkeys M2, M3, M4, M5 and their age-matched WT control (2.5 years old) during the five days of the second and third phases of the Hamilton search experiment;

[0075] (C) The percentage of knockout monkeys M2, M3, M4, M5 and their age-matched WT controls that achieved an accuracy rate of 75% or higher on day 5 of phase 3 of the Hamilton Experiment.

[0076] (D, E) Statistical analysis of the daily task accuracy of knockout monkeys M6, M7, M8, M9 and their age-matched WT controls (1.5 years old) during the five days of the second and third phases of the Hamilton search experiment.

[0077] (F) The percentage of knockout monkeys M6, M7, M8, M9 and their age-matched WT controls that achieved an accuracy rate of 75 percent or higher on day 5 of phase 3 of the Hamilton Experiment.

[0078] Figure 12. Different gaze characteristics and behavioral statistics during eye-tracking experiments in FMR1 gene knockout monkeys;

[0079] (A) Comparison of the number of correct answers in the target test phase of FMR1 knockout monkeys with the accuracy rate of the WT control;

[0080] (B) Comparison of the accuracy rate of FMR1 gene knockout monkeys in the target testing phase with the number of correct answers in the WT control group;

[0081] (C) Comparison of the accuracy of FMR1 gene knockout monkeys in the picture viewing stage with that of the WT control;

[0082] (D) Comparison of the percentage of FMR1 knockout monkeys and WT monkeys staring at monkey face images during the picture viewing phase;

[0083] (E) Statistics on the number of times FMR1 gene knockout monkeys and WTs smacked their lips during the picture viewing phase;

[0084] (F) Comparison of the number of times FMR1 knockout monkeys and WT monkeys struggled during the picture viewing phase;

[0085] Statistics on the number of fearful faces made by (G)FMR1 gene knockout monkeys and WT monkeys during the picture viewing phase;

[0086] Comparison of the number of times (H)FMR1 gene knockout monkeys and WT monkeys made gurgling sounds during the picture viewing phase. Detailed Implementation

[0087] The inventors conducted in-depth research and screening on the sequence of the FMR1 gene in primate genomes, revealing suitable targets for gene modification in non-human primates: exons 3 and / or 4 of the FMR1 gene. Targeting reagents designed to target these exons and implementing downregulation can yield animal models of Fragile X syndrome exhibiting typical disease symptoms. These animal models are stable and controllable, easy to observe, and exhibit more typical disease symptoms compared to animal models from other species, demonstrating promising application prospects.

[0088] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by those skilled in the art.

[0089] As used in this invention, the animals are non-human primates, including but not limited to: monkeys, orangutans, and apes; preferably, the monkeys include monkeys selected from the group consisting of: cynomolgus monkeys, rhesus monkeys, macaques, green monkeys, marmosets, squirrel monkeys, etc.

[0090] As used in this invention, the term "sgRNA target" refers to a target region in the gene of interest suitable for gene editing. For example, regulation can be achieved by introducing exogenous gene editing reagents (such as sgRNA and Cas mRNA) targeting this target.

[0091] As used herein, “sgRNA” refers to “single-guide RNA” or “single-guide RNA”, which is designed based on “target sites on target genes”. The sequence it contains is sufficient to work synergistically with endonucleases Cas (such as Cas9) to guide Cas enzyme-mediated DNA double-strand breaks at the target sites.

[0092] As used herein, the terms “introduction” or “transformation” refer to the transfer of exogenous polynucleotides into a host (an animal or animal cell in this invention).

[0093] As used herein, the term "construction" includes "plasmid".

[0094] As used herein, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between cells and hosts from different sources. For example, if the combination of nucleic acid and host cell is not naturally occurring, the nucleic acid is heterologous to that host cell. A particular sequence is "heterogeneous" to the cell or organism into which it is inserted.

[0095] Fragile X syndrome is the second most common inherited intellectual disability after Down syndrome, and it is also the most common type of autism spectrum disorder. Mutations in the FMR1 gene leading to the loss of FMRP protein expression are one possible cause of FXS. Currently, the specific mechanisms underlying FXS are unclear, and there are no specific drugs for treating it clinically; treatment mainly focuses on symptomatic and supportive care.

[0096] Robust disease phenotypes are crucial for developing new treatments for Fragile X syndrome (FXS) because they provide sufficient capability to evaluate drug efficacy. Current FXS animal models include fruit fly, zebrafish, mouse, and rat models. However, these models cannot fully mimic the disease characteristics of patients, and the clinical translation rate of candidate drugs developed based on them is low. Therefore, establishing FXS disease models based on disease typicality is urgently needed. Although non-human primates are more similar to humans in terms of tissue structure, physiology, metabolism, and immunity, no successful FXS animal models for non-human primates have been obtained to date. This may be due to factors such as the complexity of animal genomes and uncertainties in the design of targeted manipulation reagents.

[0097] The inventors are dedicated to establishing an animal model of Fragile X syndrome. In preliminary research, they conducted detailed analyses targeting multiple targets and aspects, ultimately pinpointing the third and / or fourth exons of the FMR1 gene in the animal genome. Using these exons as targets, they downregulated the FMR1 gene to obtain the Fragile X syndrome animal model. In a preferred embodiment, the inventors further incorporated CRISPR / Cas knockout technology into the animal model preparation process.

[0098] The inventors discovered that the application of the CRISPR-CAS system to the animal genome and FMR1 gene targeted in this invention has some problems. First, its binding to the target site is imprecise; its recognition sequence is only 20 bp, which is not long enough to cover all similar sequences in the entire genome. Base matching is a chemical equilibrium of hydrogen bond formation; the larger the ΔH, the higher the matching probability. However, the length of the recognition sequence limits the lower limit of the probability of finding similar sequences and the upper limit of the enthalpy change, thus limiting the lower limit of the off-target probability. Second, the detection during binding is not as precise as a true replication-transcription-translation enzyme system; it may non-specifically cleave sequences it doesn't intend to bind to, leading to a series of unwanted non-specific mutations. Third, editing relies on introducing a foreign DNA homology repair segment, but this may lack compatibility with the DNA repair systems of different species; therefore, the selection of the foreign DNA (sgRNA) is crucial.

[0099] Based on the inventors' screening results, a guide RNA with high editing activity on the FMR1 gene in non-human primates at the embryonic level was obtained. FMR1 gene editing was performed on fertilized animal eggs, and combined with assisted reproductive technology, FMR1 gene knockout non-human primates were successfully obtained. Superovulation, intracytoplasmic sperm injection, and assisted reproduction were performed on sexually mature female FMR1 gene knockout animals, successfully obtaining FMR1 gene knockout F1 generation animals. For this animal model, the inventors did not observe mutations at other locations in the genome or other side effects in the animals. The successful establishment of the FMR1 gene knockout animal model is of great significance for elucidating the mechanism of FXS occurrence and accelerating the development of FXS drugs.

[0100] Observations showed that FMR1 gene knockout animals exhibited increased total activity and repetitive stereotyped activities, increased anxiety, language development disorders, decreased social willingness, working memory impairment, decreased cognitive flexibility, and attention deficits (altered gaze characteristics). These phenotypes in the animal disease model of this invention highly accurately fit the phenotypes and symptoms of human patient populations.

[0101] The FMR1 gene is located on the long arm of the X chromosome (in Xq27.3) and contains 17 exons spanning 38 kb. The FMR1 gene produces 4.4 kb of mRNA with an open reading frame (ORF) of 1.9 kb, plus minor isoforms produced by alternative splicing. The major product of FMR1 expression, FMRP, is a 632 aa protein with a molecular weight ranging from 70 to 80 kDa; its GenBank accession number is 2332.

[0102] Gene downregulation includes “knockout,” “deletion / reduction,” or “inactivation” or “repression,” meaning that the gene or the protein it encodes is not produced, or is produced in the host cell in an inactive form, or is produced in the host cell at a level lower than that found in the wild-type form in the host cell under the same or similar growth conditions.

[0103] Under the guidance of this invention, various gene-disrupting methods known in the art can be employed to target the gene targets identified in this invention. These can be achieved, for example (but not limited to), through one or more of the following methods: CRISPR / Cas technology, homologous recombination, RNA interference-based techniques, ZFN, and TALEN, etc.

[0104] As a preferred embodiment of the present invention, a CRISPR / Cas (such as Cas9) system can be used for targeted gene editing to modify the FMR1 gene in the target region. The knockout method includes co-transferring sgRNA or a nucleic acid capable of forming said sgRNA, Cas mRNA or a nucleic acid capable of forming said Cas mRNA, to the target region or target cell. After the target site is determined, known methods can be used to introduce sgRNA and Cas into the cell.

[0105] In a specific implementation, the CRISPR / Cas technology is CRISPR / Cas9. This includes introducing a specific sgRNA targeting the FMR1 gene into an animal, while simultaneously introducing Cas9 mRNA to facilitate gene editing.

[0106] After using the CRISPR / Cas9 system for gene editing as the basis for constructing animal models, suitable sgRNA target sites can lead to more ideal gene editing efficiency and better animal phenotypic performance. In a preferred embodiment of the present invention, preferred target sites were designed and identified, and sgRNAs were designed.

[0107] After identifying the target site, sgRNA or a nucleic acid capable of forming said sgRNA, and Cas9 mRNA or a nucleic acid capable of forming said Cas9 mRNA are co-transferred into animal zygotes to obtain gene-edited animals. Alternatively, the nucleic acid capable of forming said sgRNA can be a nucleic acid construct or expression vector, or the nucleic acid capable of forming said Cas9 mRNA can be a nucleic acid construct or expression vector. These expression vectors are introduced into cells, thereby forming active sgRNA and Cas9 mRNA within the cells. Furthermore, Cas9 mRNA and sgRNA can also be obtained through in vitro transcription.

[0108] As an alternative approach, homologous recombination can be used to specifically target the FMR1 gene, causing expression defects or deletions. Alternatively, Cre and Loxp methods can be applied to selectively knock out related genes in the cell genome, resulting in gene modification outcomes similar to or identical to those achieved with the CRISPR / Cas9 system.

[0109] The animal models constructed in this invention can be used for screening and testing specific drugs. In drug screening, candidate drugs or therapeutics refer to substances known to have certain pharmacological activities or substances currently being tested that may have certain pharmacological activities, including but not limited to nucleic acids, proteins, carbohydrates, chemically synthesized small or large molecular compounds, and cells. The administration routes for candidate drugs or therapeutics can be oral, intravenous, intraperitoneal, subcutaneous, spinal, or direct intracerebral injection.

[0110] As those skilled in the art will understand, due to the complexity of the organism's genes, the influence of multiple signaling pathways on diseases, and the existence of the body's own compensatory or repair mechanisms, it is difficult to obtain animal models that exhibit typical disease symptoms. However, this invention, through optimized design, overcomes these technical difficulties. The animal model constructed by this invention can serve as a powerful tool for scientific research and new drug evaluation.

[0111] In the study of disease mechanisms, the animal model constructed in this invention, which stably presents Fragile X syndrome, can be used to investigate the disease mechanism, explore the key factors leading to the progression from ordinary inhibition to Fragile X syndrome, and investigate the intermediate mechanisms that prevent or delay the development of this disease. The model system of this invention helps to better understand Fragile X syndrome and to explore / identify candidate drugs / therapeutic agents that can prevent, delay, or reverse the disease process.

[0112] In preclinical drug testing, the animal model constructed using this invention, which stably exhibits Fragile X syndrome, is expected to be used for preclinical drug metabolism, toxicity, and efficacy testing. This animal model is physiologically close to the human body and supports long-term sampling, detection, and tracking, facilitating the advancement of new drug development. In this invention, there are no particular limitations on the types of candidate drugs used for drug testing; they can be obtained from various sources, including synthetic or natural compound libraries. For example, there are various methods for the random and directed synthesis of a variety of organic compounds and biomolecules, including the expression of random oligonucleotides and oligopeptides; or, natural compound libraries in the form of bacterial, fungal, plant, and animal extracts can be obtained or readily generated. Furthermore, libraries and compounds generated by natural or synthetic methods can be readily modified by conventional chemical, physical, and biochemical methods and can be used to generate combinatorial libraries. Known pharmacological reagents can be chemically modified (e.g., acylation, alkylation, esterification, amidation, etc.) to generate structural analogs.

[0113] The method for preparing animal models in this invention is simple to operate, and the resulting animal models are highly stable, effectively mimicking the Fragile X syndrome phenotype. The resulting disease symptoms are very typical, and phenotypic changes are easily observed. Non-human primates are evolutionarily close to humans, and their tissue structure, physiology, metabolism, and immunity are highly similar to humans. They possess unparalleled advantages in brain structure and function, especially in these areas compared to rodents. Non-human primates can better replicate the development and progression of human brain diseases than other model organisms, making them the best model organisms for studying human brain diseases. Furthermore, research results on non-human primates can be directly translated into clinical applications, more effectively predicting the efficacy of candidate drugs in clinical applications and reducing the risks of new drug development. This invention is the first to successfully obtain a Fragile X syndrome model using non-human primates, which has significant implications for the study of pathogenic mechanisms, drug screening, and clinical treatment.

[0114] Based on the method of the present invention, the present invention also provides a kit for preparing an animal model of Fragile X syndrome, the kit comprising: sgRNA targeting and downregulating the FMR1 gene based on the CRISPR / Cas system; preferably, the gRNA targets a specific site in the third exon and / or the fourth exon of the FMR1 gene, and preferably targets a specific site in both exons simultaneously.

[0115] Other reagents commonly used in transgenic operations may also be included in the kit for the convenience of those skilled in the art, such as reagents for microinjection. Furthermore, the kit may include instructions for use by those skilled in the art.

[0116] After obtaining the animal model of the present invention, substances of interest can be screened based on this model, which can (or potentially can) alleviate or treat Fragile X syndrome. Following screening, truly useful drugs can be identified from the substances of interest.

[0117] Therefore, the present invention also provides a method for screening potential substances, the method comprising: (1) preparing an animal model of fragile X syndrome using the method or kit described above; (2) administering a candidate substance to the animal model of (1) and observing whether the candidate substance has an alleviating or therapeutic effect on fragile X syndrome; if the symptoms of fragile X syndrome in the animal model are observed to be relieved, then the candidate substance is a substance for alleviating or treating fragile X syndrome.

[0118] According to the animal model of the present invention, the observation of whether the candidate substance has an alleviating or therapeutic effect on Fragile X syndrome includes (but is not limited to) analyzing the following phenotypes: activity level, repetitive stereotyped activities, vocalization, social willingness, working memory, cognitive flexibility, and attention. If the phenotypes are significantly alleviated / improved (activity level decreases, repetitive stereotyped activities decrease, gurgling decreases or total vocalizations increase, social willingness increases, working memory improves, cognitive flexibility improves, and attention becomes more focused), then the candidate substance is a substance that alleviates or treats Fragile X syndrome.

[0119] In a preferred embodiment of the present invention, during screening, a control group may be set up to make it easier to observe changes in the symptoms of Fragile X syndrome. The control group may be the animal model without the addition of the candidate substance.

[0120] As a preferred embodiment of the invention, the method further includes: conducting further cell experiments and / or animal experiments and / or clinical trials on the obtained potential substances to further select and identify truly useful substances.

[0121] On the other hand, the present invention also provides potential substances of interest obtained using the aforementioned screening method. These initially screened substances can form a screening library, from which relatively ideal, safe substances that are truly effective in alleviating or treating Fragile X syndrome can be selected.

[0122] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Science Press, or according to the manufacturer's recommendations.

[0123] Materials and methods

[0124] 1. Preparation, transcription, and purification of sgRNA

[0125] (1) Synthesis of sgRNA template

[0126] The sgRNA transcription sequence containing the T7 promoter was amplified using PCR.

[0127] The F primer for PCR contains the T7 promoter sequence and the sgRNA sequence, which are as follows:

[0128] 5'-GAAATTAATACGACTCACTATAGG(SEQ ID NO:11)-sgRNA-GTTTTAGAGCTAG AAATAGC(SEQ ID NO:12)-3';

[0129] The reverse primer is a universal primer, and its sequence is:

[0130] 5'-TTGTGAAAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTA TTTTAACTTGCTATTTCTAGCTCTAAAAC-3' (SEQ ID NO: 13).

[0131] Five tubes of each sgRNA were amplified by PCR, and the gel was then recovered. Electrophoresis was performed on a 2% agarose gel, and the target region band was excised and recovered using a Novizan gel recovery kit. The specific steps were as follows: the gel block was dissolved in lysis buffer in a 50°C water bath; the dissolved liquid was added to the separation column and centrifuged at 12000 rpm for 1 min; the liquid was then discarded; wash buffer was added to the column, and the column was centrifuged at 12000 rpm for 1 min, followed by two washes. Finally, the empty column was centrifuged at 12000 rpm for 3 min, air-dried at room temperature for 10 min, and then eluted with an appropriate amount of DEPC-H2O.

[0132] (2) sgRNA transcription

[0133] Transcription was performed using the MEGA Shortscript T7 kit (Life Technologies). All components required for transcription were thoroughly mixed and placed in a PCR instrument. The reaction temperature was 37°C for 3 hours. After transcription, 1.5 μL of DNase was added to each reaction mixture, and the mixture was incubated at 37°C for 30 minutes to remove the DNA template.

[0134] (3) sgRNA purification

[0135] Purification was performed using the MEGA clear kit (Life Technologies). The transcript was diluted 5-fold with DEPC water, and then half a volume of Binding Solution and 5 volumes of anhydrous ethanol were added and mixed thoroughly. The mixture was then transferred to an RNA adsorption column, incubated at room temperature for 5 min, and centrifuged at 12,000 rpm for 1 min. The centrifuged liquid was discarded, and 500 μL of wash buffer was added to the adsorption column. The column was centrifuged at 12,000 rpm for 1 min, and the wash was repeated once. The column was then incubated at 12,000 rpm for 10 min, incubated at room temperature for 10 min, and finally eluted with 50 μL of DEPC water. The concentration of the recovered sgRNA was determined using a Nano2000 instrument. 1 μL of the recovered product was subjected to agarose gel electrophoresis to check for degradation. The recovered sgRNA was aliquoted into 5 μL tubes and stored at -80°C for immediate use.

[0136] 2. In vitro transcription and purification of Cas9 mRNA

[0137] (1) Obtaining the Cas9 transcription template. The Cas9 expression cassette was amplified from the px260 vector using primers Cas9-F and Cas9-R, where the Cas9-F sequence contains the T7 promoter sequence. Amplification was performed using Novizan high-fidelity DNA polymerase.

[0138] Five tubes of each sgRNA were amplified by PCR, and the gel was then recovered. Electrophoresis was performed on a 1% agarose gel, and the target region band was excised and recovered using a Novizan gel recovery kit. The specific steps were as follows: the gel block was dissolved in lysis buffer in a 50°C water bath; the dissolved liquid was added to the separation column and centrifuged at 12000 rpm for 1 min; the liquid was then discarded; wash buffer was added to the column, and the column was centrifuged at 12000 rpm for 1 min, followed by two washes. Finally, the empty column was centrifuged at 12000 rpm for 3 min, allowed to air dry at room temperature for 10 min, and then eluted with an appropriate amount of DEPC-H2O.

[0139] (2) Transcription of Cas9 mRNA

[0140] Transcription was performed using the MEGA Shortscript T7 kit (Life Technologies). All components required for transcription were thoroughly mixed and placed in a PCR instrument. The reaction temperature was 37°C for 3 hours. After transcription, 1.5 μL of DNase was added to each reaction mixture, and the mixture was incubated at 37°C for 30 minutes to remove the DNA template.

[0141] (3) Purification of Cas9 mRNA

[0142] Purification was performed using the MEGA clear kit (Life Technologies). The transcript was diluted 5-fold with DEPC water, and then half a volume of Binding Solution and 5 volumes of anhydrous ethanol were added and mixed thoroughly. The mixture was then transferred to an RNA adsorption column, incubated at room temperature for 5 min, and centrifuged at 12,000 rpm for 1 min. The centrifuged liquid was discarded, and 500 μL of wash buffer was added to the adsorption column. The column was centrifuged at 12,000 rpm for 1 min, and the wash was repeated once. The column was then incubated at 12,000 rpm for 10 min, incubated at room temperature for 10 min, and finally eluted with 50 μL of DEPC water. The concentration of the recovered sgRNA was determined using a Nano2000 instrument. 1 μL of the recovered product was subjected to agarose gel electrophoresis to check for degradation. The recovered sgRNA was aliquoted into 5 μL tubes and stored at -80°C for immediate use.

[0143] 3. Oocyte retrieval and intracytoplasmic sperm injection (ICSI) in cynomolgus monkeys

[0144] (1) Observe the menstrual cycle of sexually mature female monkeys. Check whether there is vaginal bleeding in sexually mature cynomolgus monkeys at 8 am and 8 pm every day. The period from the first appearance of blood to the day before the next appearance of blood is recorded as a menstrual cycle.

[0145] (2) Superovulation was induced in female monkeys with normal menstrual cycles using medication. Starting on day 3 of the menstrual cycle, 20 IU of recombinant human follicle-stimulating hormone (rhFSH) was injected intramuscularly twice daily (morning and evening). On day 11 of the menstrual cycle, 1000-1500 IU of human chorionic gonadotropin (hCG) was injected intramuscularly. Oocytes were retrieved via laparoscopy 32-36 hours later. Oocytes containing granulosa cells were digested with 0.5 mg / mL hyaluronidase, washed, and qualified oocytes were selected under a stereomicroscope and placed in HECM-9 medium. The medium was then incubated at 37°C in a 5% CO2 incubator.

[0146] (3) Semen was collected from sexually mature male cynomolgus monkeys by penile electrical stimulation. The collected semen was left to stand at room temperature for 20 minutes to allow for liquefaction. The supernatant was transferred to a new centrifuge tube and 3 mL of TH3 solution was added. The tube was centrifuged at 1800 rpm for 4 minutes. The supernatant was discarded, and the mixture was resuspended in TH3 solution. The washing was repeated 3 times. Finally, a portion of the resuspended liquid was transferred to a culture dish and sealed with mineral oil. The mixture was then incubated at 37°C in a 5% CO2 incubator before the experiment.

[0147] (4) Selecting oocytes in the MII stage for intracytoplasmic sperm injection (ICSI). First, transfer the oocytes to a new TH3 droplet, fix the oocytes with an oocyte-holding needle, and use a flat needle to aspirate a single sperm with the head facing the needle opening. Then, inject the sperm into the oocyte cytoplasm. Transfer the fertilized eggs after ICSI to a HECM-9 culture base and incubate them at 37°C in a constant temperature incubator containing 5% CO2. After 6-8 hours, observe whether double pronuclei have formed. The appearance of double pronuclei indicates successful fertilization.

[0148] 4. Construction and transplantation of cynomolgus monkey FMR1 gene-edited embryos

[0149] Select oocytes in the MII stage for intracytoplasmic sperm injection (ICSI). First, transfer the oocyte to a new TH3 droplet, fix the oocyte with an oocyte holding needle, and use a flat needle to aspirate a single sperm with the head facing the needle opening. Then, inject the sperm into the oocyte cytoplasm.

[0150] After intracytoplasmic sperm injection (ICSI), fertilized eggs were transferred to a HECM-9 culture medium and cultured in a 37°C, 5% CO2 incubator. After 6-8 hours, the formation of two pronuclei was observed; the appearance of two pronuclei indicated successful fertilization. Cas9 mRNA and sgRNA were pre-thawed on ice and mixed at final concentrations of 100 ng / μL and 50 ng / μL, respectively. Successfully fertilized cynomolgus embryos were aspirated and transferred to new TH3 droplets (containing 5 μg / mL cytochalasin B). The fertilized eggs were secured with an oocyte-holding needle, and the Cas9 mRNA and sgRNA mixture was slowly injected into the cytoplasm of the fertilized eggs using a flat needle.

[0151] After injection, the manipulated embryos were transferred to HECM-9 medium and cultured in a 37°C, 5% CO2 incubator. Transfer was performed the afternoon of the day after Cas9 mRNA and sgRNA injection, at which point the embryos were in the 2-cell stage. Sexually mature female cynomolgus monkeys with synchronized menstrual cycles were selected as embryo transfer recipients. Under laparoscopic guidance, a glass transfer tube was inserted into the fallopian tube through the fimbriae, and then the embryos were injected into the fallopian tube. One to two embryos were transferred to each recipient monkey.

[0152] Embryos used for guide RNA editing activity assays were collected and lysed after developing to the blastocyst stage. One month after embryo transfer, ultrasound was used to determine if the recipient monkey was pregnant.

[0153] 5. Guide RNA editing efficiency detection

[0154] (1) Using an oocyte aspiration needle, transfer a single embryo that has developed to the blastocyst stage from HECM-9 medium into a PCR tube. Add 5 μL of embryo lysis buffer (containing 50 mM DTT and 200 mM NaOH) and lyse at 65 °C for 10 min. After lysis, add 5 μL of neutralization buffer (containing 200 mM HCl and 300 mM KCl) for neutralization.

[0155] (2) Random genome amplification was performed on the embryos. The random amplification reaction system is as follows:

[0156] The PCR reaction program was as follows: denaturation at 95°C for 1 min, annealing at 37°C for 2 min, followed by ramping up to 55°C at 10 s / °C, and holding at 55°C for 4 min for polymerization extension. A total of 50 cycles of amplification were performed.

[0157] (3) The target gene was amplified using the randomly amplified embryonic genome product as a template. The PCR product was used for Sanger sequencing and TA cloning analysis.

[0158] (4) TA cloning. The target sequence was amplified using rTaq enzyme, and the PCR product was directly recovered. The product fragment was then constructed into a T vector.

[0159] The above mixture was incubated overnight at 16°C, and the transformation was performed the next day. Twenty clones were selected from each sample for sequencing.

[0160] 6. Protein immunoblotting

[0161] Add 100 μL of RIPA strong lysis buffer (50 mM Tris (pH 7.4), 1% sodium deoxycholate, 1% Triton X-100, 0.1% SDS, 150 mM NaCl, 2 mM sodium pyrophosphate, 25 mM β-glycerophosphate, 1 mM EDTA) to each well of the cell culture plate, pre-contained with cocktail, PMSF, NaF, and a phosphatase inhibitor, to each well. Incubate on ice for 10 minutes, then completely pipette the cells. Transfer the cells to EP tubes, add loading agent and DTT, and boil in boiling water for 8 minutes to denature them. Aliquot the samples and store at -80°C for long-term storage. Load the cooked proteins into the wells of a polyacrylamide gel, with the gel concentration ranging from 7% to 15% depending on the size of the target protein. Electrophoresis program: 80 V, 30 min; 120 V, 90 min. After electrophoresis, the polyacrylamide gel was removed and placed in transfer solution. It was then placed in the transfer clamp in the following order: sponge-filter paper-coagulation-PVDF membrane-filter paper-sponge. The membrane was rotated at a constant current of 300 mA for 60-90 min, depending on the size of the target protein. After transfer, the PVDF membrane was removed, with the side facing the gel as the front, and a corner was cut off in the upper right corner as a mark. The membrane was placed in TBST containing 5% skim milk powder and blocked on a shaker at room temperature for 2 h. After blocking, the target band was cut and placed in primary antibody diluted with blocking buffer (NeuN, Cell Signaling Technology, 24307S; FMRP, Cell Signaling Technology, 4317S), and incubated overnight at 4°C on a shaker. The next day, the membrane was rinsed three times with TBST for 15 min each time. Finally, the membrane was placed in secondary antibody diluted with blocking buffer and incubated on a shaker at room temperature for 2 h. Development and analysis were performed using ECL chemiluminescence solution, adjusting the exposure time according to the signal intensity.

[0162] 7. Immunofluorescence of brain tissue

[0163] (1) After the brain tissue was removed, it was immersed in tissue fixation solution. It was fixed at 4℃ for 3 days. After fixation, a part of the tissue block was cut off and dehydrated by adding 30% sucrose solution. When the tissue block sank to the bottom, a new 30% sucrose solution was used for secondary dehydration.

[0164] (2) Cut the dehydrated brain tissue into appropriate sizes and place them on a fixed base. Add OCT for embedding and freeze at -20℃ for 30 min. Use a cryostat to slice the brain tissue to a thickness of 25 μm. Place the sliced ​​brain tissue in PBS, or wash with PBS and then place in cryopreservation solution at -80℃ for long-term storage.

[0165] (3) Rinse the brain slices three times with PBS, add blocking buffer (5% BSA + 0.2% Triton X-100), and block at room temperature for 1 hour. After blocking, add diluted antibody, NeuN (Cell Signaling Technology, 24307S), and FMRP (Abcam, ab259335), and incubate overnight at 4°C. The next day, rinse the brain slices with PBS for 10 minutes each time, repeating three times. After rinsing, add diluted fluorescent secondary antibody and DAPI, and incubate at room temperature for 2 hours. After incubation, rinse the brain slices with PBS for 10 minutes each time, repeating three times. After rinsing, place the brain slices in a 10cm dish containing PBS for slide mounting, attach the brain slices to a glass slide, and finally mount with anti-fluorescence quenching mounting medium. Air dry in a well-ventilated place away from light at room temperature.

[0166] 8. Observation, recording, and analysis of the daily behavior of cynomolgus monkeys.

[0167] The daily behavioral observation and assessment study was conducted by two specially trained professional observers. These observers underwent independent training programs to ensure the efficiency and consistency of their observational skills. Before formal observation, the reliability between the observers was established through cross-validation using video recordings of cynomolgus monkey behavior from other sources. The results showed a consistency coefficient of at least 80%. To ensure the objectivity and unbiasedness of the assessment results, a double-blind method was implemented, meaning the observers remained unaware of the genotype information of the experimental monkeys.

[0168] The living and behavioral monitoring cages used in the experiment had standardized dimensions: 1.5 meters long, 1 meter wide, and 1.1 meters high. To record the monkeys' daily behavioral patterns in detail, observers selected three different dates, recording one hour of video on each date. The video recordings were scheduled during the animals' most active periods, namely 9:00 AM to 12:00 PM and 2:00 PM to 5:00 PM, intentionally avoiding the monkeys' regular sleep cycles.

[0169] After collecting the video data, observers conducted detailed behavioral statistics and analysis on the acquired video material. This analysis process included the identification, classification, and quantification of behaviors to ensure the high accuracy and scientific rigor of the description and explanation of monkey behavior. Through this method, this study aims to reveal the association between monkey behavioral patterns and underlying biological factors. Repetitive stereotyped behavior, in animal behaviorology, generally refers to a fixed pattern of behavior characterized by purposeless, repetitive, and frequent actions. These behaviors remain largely unchanged in morphology and appear not directly related to any obvious environmental stimuli or biological needs. Repetitive stereotyped behaviors (occurring independently or consecutively more than three times within one minute) were defined as occurring frequently within a short period of time, and these repetitive stereotyped behaviors were recorded, analyzed, and statistically analyzed in detail.

[0170] 9. Activity level analysis of model monkeys

[0171] FMR1 knockout cynomolgus monkeys and control wild-type cynomolgus monkeys were placed in cages measuring 1.75 meters long, 1.3 meters wide, and 1.2 meters high for observation. To ensure the animals adapted to this new experimental environment, they were allowed free movement in the cages for 3 hours each, with three adaptation periods to reduce potential stress from environmental changes. After the animals had fully adapted to the new cage environment, the formal video recording phase began. During this phase, Sony cameras were used to record the cynomolgus monkeys' free movement for 2 hours each day, with three non-contiguous rounds of recording for each monkey. The obtained video data was then used for analysis of motor function and related behaviors. In the video analysis, the middle hour of each video segment was selected for detailed analysis using Noldus video analysis software. During the analysis of the monkeys' free movement, the total distance traveled was the primary focus to assess the total amount of exercise. Additionally, the total time spent by the monkeys at the bottom and top of the cage was recorded. The comprehensive analysis of these indicators helps to more accurately understand the potential impact of FMR1 gene deletion on the motor abilities of cynomolgus monkeys, and provides important basic data for subsequent behavioral and neurobiological research.

[0172] 10. Assessment of Threat Anxiety and Defensive Behavior

[0173] Anxiety-related behaviors are very common in patients with FXS (Functional Hypersensitivity Syndrome). In this study, the Threat-Related Anxiety and Defensive Behavior Test (TAD) was used to examine the vocal responses of monkeys to human gaze, aiming to quantify the anxiety and defensive behaviors exhibited by animals in the face of potentially threatening stimuli. Typical vocalizations included purring, cooing, and screeching. During the experiment, individual monkeys from the FMR1 knockout group or the wild-type (WT) group were placed in a specific-sized observation cage (1.75 m long, 1.3 m wide, and 1.2 m high) and given a 9-minute acclimatization period to familiarize themselves with the new environment. Subsequently, the observer stood 2 meters away from the cage in a sideways position for 9 minutes, during which the observer avoided eye contact with the monkey; this phase was defined as the "non-eye contact period." This was followed by a 3-minute "relaxation period" during which the observer left, allowing the monkey to be alone. After the relaxation period, the experiment entered the "eye contact period," lasting 9 minutes, during which the observer sat in front of the cage and looked directly at the monkey with a neutral expression. Throughout the experiment, the monkeys' behavior and vocalizations were recorded via video for subsequent quantitative and qualitative analysis.

[0174] 11. Social Analysis of Model Monkeys

[0175] The experiment used a specially designed social behavior cage with an insertable partition in the center to control visual contact between the experimental animals. The procedure was as follows: First, the partition was inserted into the center of the cage, dividing it into two separate areas. Then, the cynomolgus monkeys to be tested (from the FMR1 gene knockout group and the wild-type control group, respectively) were introduced into the area on one side of the partition. Next, a completely unfamiliar probe monkey (previously housed in separate enclosures to ensure it had no prior contact with either group participating in the experiment, including the gene knockout cynomolgus monkey and the wild-type control group) was introduced into the other side of the partition. This partition was designed to completely block visual communication while allowing olfactory and auditory perception. With the partition in place, the monkeys were allowed ten minutes to adapt, during which their behavior was recorded via video. The number of times the monkeys explored the probe monkey on the other side of the partition during this time was statistically analyzed as an indicator of their social curiosity. After the adaptation period, the partition was removed, allowing the monkeys on both sides to engage in face-to-face social interaction. The entire interaction process was recorded via video for subsequent analysis. In the experiment, each participating monkey engaged in social interactions with n=8 different unfamiliar probe monkeys to ensure the breadth and reliability of the data. To ensure the objectivity and accuracy of the data analysis, independent double-blind analyses were conducted by two rigorously trained professional video analysts. These analysts performed detailed classification and quantification of the monkeys' social behaviors, including both active and passive social interactions.

[0176] 12. Working memory assessment in model monkeys

[0177] To accurately assess the cognitive function of FMR1 knockout cynomolgus monkeys, this study employed the black-and-white patch experiment using the Wisconsin General Test Apparatus (WGTA) as the evaluation paradigm. The experimental setup consisted of a cage containing a display tray with four food troughs, a door allowing the monkeys to enter and exit, a sliding door separating the monkeys from the display tray, and a recording camera. All tests were conducted in a quiet room with standard lighting. At the start of each test, the sliding door opened, allowing the monkey to touch and open the food troughs on the display tray (defined as a response). After a response occurred, the opaque sliding door closed to evaluate the correctness of the response and prepare for the next round of testing. To motivate the monkeys to complete the test tasks, they were not fed before the test day. During the black-and-white patch and Hamiltonian search tasks, all wild-type control monkeys and FMR1 knockout monkeys followed the same brief fasting procedure.

[0178] This study aimed to assess the working memory capacity of monkeys through this experimental design. These data are crucial for understanding the impact of FMR1 gene knockout on the cognitive function of cynomolgus monkeys and provide an animal model for cognitive deficits in FXS. The black-and-white tile test consisted of three phases: adaptation, discrimination, and reversal. In the adaptation phase, the monkeys' ability to retrieve food rewards from the display board was assessed. Prior to the formal adaptation phase, a series of pre-testing steps were performed to ensure readiness, including placing rewards under different conditions (in front of the trough, in the trough, in a trough with a gray adaptation cover nearby, and in a trough half-covered by a gray adaptation cover). In the adaptation phase, monkeys were required to successfully retrieve food when the trough was completely covered by the gray adaptation cover. Each monkey was allowed a maximum of 25 trials per day for each item, with 23 correct responses considered a success. In the discrimination phase, monkeys were required to choose food rewards from troughs covered by either black or white tiles. Each monkey was allowed 25 trials per day, with a success rate of at least 23 correct responses required to proceed to the next phase. The reversal phase followed the same procedure as the discrimination phase, but the color of the reward was reversed. The monkeys were tested 25 times a day, five days a week, to assess their performance on a reversal task. The number of days they passed the test was used to measure their cognitive abilities.

[0179] 13. Assessment of cognitive flexibility in model monkeys

[0180] To assess and quantify the cognitive flexibility of these monkeys, this study employed the Hamiltonian search experiment based on the Wisconsin General Testing Apparatus (WGTA) described in previous literature. The Hamiltonian search task was designed according to previously published methods. In this experiment, the monkeys faced four identical food troughs, each with a movable lid. Only one trough contained a food reward, and the monkeys' goal was to minimize the number of times they had to open the lid to find the reward. Before performing this task, the monkeys had to successfully complete the adaptation phase of the black-and-white patch test. The Hamiltonian search task consisted of three phases: Phase 1: Set Making. In this phase, the monkeys needed to develop a search strategy to find the food reward. The reward was randomly placed in any hole in one of the four troughs, but the same location would not be offered a reward twice consecutively. The monkeys had to lift the corresponding lid to obtain the reward. One trial consisted of a series of responses until the monkey successfully found the food. The optimal strategy was to avoid opening the trough that had previously contained a reward and to find the food by opening only the other three troughs once. The experimenters recorded the order and number of times the monkeys explored. The trial ended either when the monkey found the food or 60 seconds later, whichever occurred first. Monkeys are considered proficient when they successfully complete the trial five times consecutively. Monkeys perform 25 trials per day for five consecutive days. Phase Two: Set Breaking. In Phase Two, the best well selected in the previous phase is consistently placed with a reward in each trial. Monkeys can open any number of troughs to find the reward, and the reward hole remains constant throughout the test session. The ideal strategy is to quickly identify the specific location that always contains the reward and open only that hole in each trial. Monkeys perform 25 trials per day for five consecutive days in this phase. To evaluate performance, the number of times a monkey successfully opens the correct well on its first attempt is recorded (denoted as "X"). For each monkey, the difference between the value of X on day five and day one is calculated, called "delta," which represents the change in outcome due to learning, reflecting the monkey's improved ability to identify and open reward holes over the five days. Phase Three: Forced Set Breaking. In Phase Three, the task setup is similar to Phase Two, but with two major differences: first, the reward location is different from Phase Two; second, monkeys are only allowed to open one hole per trial. The monkeys had to make a single choice, which was rated as correct or incorrect depending on the presence or absence of a reward. During the forced-break search strategy phase, the monkeys performed 25 trials per day for five consecutive days. To evaluate performance, the percentage of correct trials per day was calculated over the five days.

[0181] 14. Tracking and Analysis of Eye Movements in Model Monkeys

[0182] Patients with FXS and other autism spectrum disorders often exhibit abnormal eye movements, such as avoiding eye contact in daily life and displaying eye movement patterns different from those of ordinary individuals in eye-tracking experiments. To investigate the eye movements of FMR1 gene knockout cynomolgus monkeys, the inventors designed an eye-tracking experiment to test the eye movement characteristics of these monkeys. The experiment included a fixation task and an image recognition test. The fixation task, designed to assess attention deficits or cognitive deficits, tested the monkeys by displaying randomly appearing animated dots on a screen. In the image recognition phase, images of different monkey faces or different plants were randomly displayed on the screen, each for a specific duration, for the monkeys to view. The inventors analyzed parameters such as fixation time, number of fixations, and eye movement trajectories when the monkeys viewed different stimuli, and compared the eye movement data of the FMR1 gene knockout group with the control group to identify potential differences. Through these eye-tracking experiments, the inventors hope to better understand the impact of FMR1 gene knockout on the social behavior and cognitive function of cynomolgus monkeys.

[0183] In this study, to investigate the eye movement characteristics of FMR1 knockout cynomolgus monkeys, a 23.5-inch monitor (1920x1080 resolution, 60Hz refresh rate), the standard screen for the Tobii Spectrum Pro, was used to present visual stimuli. All behavioral tasks were controlled by the custom behavioral software Opticka, the code of which is available at https: / / github.com / iandol / opticka. During the experiment, the Tobii Spectrum Pro was used to detect the monkeys' eye movements while observing faces and objects at a sampling frequency of 300Hz. For optimal control of calibration and validation, as well as data encoding, the enhanced toolkit Titta was used, the code of which is available at https: / / github.com / dcnieho / Titta. The monkeys were trained to sit in a monkey chair with their heads semi-fixed by a custom 3D-printed helmet to adapt to the experimental environment. The experimental setup also included high-precision cameras capable of monitoring and recording various movements of the cynomolgus monkeys in real time throughout the experiment. Before the formal experiment began, the monkeys were acclimatized to the eye-tracking device and restrained in a standard monkey chair with their heads semi-fixed for stability. Image recognition was performed after fixation training and experiments with the cynomolgus monkeys. The experiment consisted of 100 sets of images, each pairing a neutral monkey face photograph with a plant leaf photograph. The plant images were from the MSRC image database, and the neutral-expression monkey face portraits were from Pfefferle 2020. Each image was a square with sides of 15° of visual field, and the face image was randomly presented at (-12, 0)° or (12, 10)° positions. The experiment began with a fixation point lasting 0.25 to 0.5 seconds, followed by an 8-second presentation of face and object images, with a 2-second interval between trials. Subjects were free to look at the images during the stimulus presentation period, and were rewarded after the stimulus ended if they gazed at the screen for at least 2 seconds within the 8-second presentation period. Eye-tracking signal analysis was performed using a method adapted by Niehorster and colleagues. The Holmqvist (2010) algorithm, whose MATLAB code is available at https: / / github.com / dcnieho / NystromHolmqvist2010. According to... Holmqvist (2010) proposed a method to detect gaze / saccade / blink events and generate gaze duration and gaze count on faces and objects after the stimulus begins. The region of interest (ROI) of the image was set to [-20 20 -8 8]°, slightly larger than the size of the image itself.

[0184] Example 1: Design and efficiency assay of FMR1 gene-targeting guide RNA

[0185] The monkey FMR1 gene (GenBank ID 2332) contains 17 exons spanning 38kb; the editing efficiency and effects on animals vary depending on the gene location targeted.

[0186] Targeting the monkey genome, the inventors discovered that CRISPR-CAS exhibits imprecise binding to its target sites. This may be because its recognition sequence, approximately 20 bp, is insufficiently long compared to all similar sequences across the entire genome. The length of the recognition sequence limits the lower bound of the probability of finding similar sequences and the upper bound of the enthalpy change, thus limiting the lower bound of the off-target probability. The detection during binding is not as precise as that of a true replication-transcription-translationase system, and it may accidentally bind to sequences it doesn't intend to. When different sgRNAs are selected, non-specific cleavage occurs at different locations, often leading to various undesirable mutations. Therefore, the establishment of animal models is often affected by other non-specific mutations in the genome, resulting in atypical symptoms or other diseases.

[0187] Based on the sequence structure characteristics of the monkey genome and the FMR1 gene, and after extensive analysis, selection and experimentation, and with full consideration of minimizing non-specific cleavage, the inventors located the target site in exons 3 and 4 of the FMR1 gene (Figure 1A).

[0188] The inventors discovered that even after identifying exons 3 and 4 in the monkey genome that were analyzed and deemed suitable for targeted regulation, the editing effect varied depending on the target site. The inventors cited three sgRNAs used to transcribe cynomolgus monkeys.

[0189] The target sequence of FMR1 targeted by the sgRNA is (the 3' terminal tribase is the PAM site):

[0190] Exon3-1: GGGAATCTGACATCATGGAATGG (SEQ ID NO: 1);

[0191] Exon 3-2: GTCAGATTCCCACCTCCTGTAGG (SEQ ID NO: 2);

[0192] Exon 4: GTTGGTGGTTAGCTAAAGTGAGG (SEQ ID NO: 3).

[0193] The corresponding guide RNA sequences are as follows:

[0194] FMR1-sgRNA1:5'-GGGAATCTGACATCATGGAA-3' (SEQ ID NO:4);

[0195] FMR1-sgRNA2: 5'-GTCAGATTCCCACCTCCTGT-3' (SEQ ID NO: 5);

[0196] FMR1-sgRNA3: 5'-GTTGGTGGTTAGCTAAAGTG-3' (SEQ ID NO: 6);

[0197] The editing efficiency of individual guide RNAs was further examined at the embryonic level. Embryos developed to the blastocyst stage were randomly amplified, and the sequence containing the guide RNA was amplified using these embryos as templates (Figure 1B). The amplification primers were:

[0198] FMR1-exon 3-F1:5'-ATGCTGATAACGTCATACTGATCAGC-3' (SEQ ID NO:7);

[0199] FMR1-exon 3-R1:5'-AGCAGGTAGTTCACGATATGCCC-3' (SEQ ID NO:8);

[0200] FMR1-exon 4-F1:5'-TCCAGGAGATGTGAATGCCAGAG-3' (SEQ ID NO:9);

[0201] FMR1-exon 4-R1:5'-TTGTCGTAAGTCTTCTGGCACATCC-3' (SEQ ID NO:10);

[0202] Then, Sanger sequencing and TA cloning were performed. Of the 8 embryos collected from the FMR1-sgRNA1 group, 6 were successfully amplified. Sequencing results of the PCR products showed that only 1 embryo was edited, and not completely edited (editing rate not exceeding 50%). TA cloning analysis was performed on the PCR products.

[0203] Seven embryos collected from the FMR1-sgRNA2 group were successfully amplified, and sequencing results of the PCR products showed that all seven embryos were edited. TA cloning results showed that five embryos were completely edited, with embryo #4 having an editing rate of 10 / 20 (50%) and embryo #5 having an editing rate of 18 / 20 (90%).

[0204] Eight embryos collected from the FMR1-sgRNA3 group were successfully amplified. Sequencing results of the PCR products showed that seven embryos were edited, and all of them were completely edited, which was consistent with the TA cloning results (Figure 1C).

[0205] Therefore, the FMR1-sgRNA2 group showed better editing results, while the FMR1-sgRNA3 group showed the best editing results. The FMR1-sgRNA1 group and some other sgRNAs tried in previous studies by the inventors did not achieve ideal results.

[0206] However, the analysis also showed that when FMR1-sgRNA2 or FMR1-sgRNA3 was used alone in animal experiments, FMRP protein expression analysis (WT) showed some expression, indicating a need for further optimization. Compared to using individual sgRNAs or other combinations of two or more, the combination of FMR1-sgRNA2 and FMR1-sgRNA3, when introduced into fertilized eggs to prepare embryos, showed significantly better FMRP knockout effects at the animal level.

[0207] Example 2: Genotyping and Protein Expression Analysis of Newborn Crab-Eating Macaques

[0208] The combination of FMR1-sgRNA2 and FMR1-sgRNA3 was introduced into fertilized eggs to prepare embryos and produce offspring of cynomolgus monkeys.

[0209] A total of 175 embryos were transferred to 99 recipients, of whom 15 successfully became pregnant, resulting in 16 fetuses. 13 were born live, of whom 9 survived and successfully completed lactation with good growth (Figure 2A), while the other 4 died shortly after birth. Two of the 3 miscarried fetuses had well-preserved tissues (Table 1).

[0210] Table 1

[0211] Genome samples were extracted from ear tip skin tissue of nine surviving monkeys (M1-M9) for genotyping. Specifically, guide RNA targeting sequences were amplified, followed by PCR product sequencing and TA cloning analysis. Electrophoresis results of the PCR products showed that the size of the amplified fragments in some monkeys was inconsistent with the WT band size, and some target sequences even failed to amplify, indicating that the FMR1 gene knockout effect was good in these monkeys (Figure 2B).

[0212] Subsequently, these PCR products were cloned and sequenced using TA. The results showed (Figure 4) that the FMR1 gene in M1 monkeys was not edited, while the FMR1 gene in M2 and M3 monkeys was partially edited, with editing rates of 68.8% and 58.8%, respectively. The other monkeys achieved complete editing of the FMR1 gene.

[0213] To determine FMRP protein expression, blood was collected from monkeys. Red blood cells were removed, and white blood cells were retained for protein extraction and immunoblotting analysis. Results showed that FMRP protein levels in M2 and M3 were lower than in the WT control. FMRP protein expression was undetectable in samples M4, M5, M6, M7, M8, and M9, consistent with genotypic analysis (Figure 2C). Genomic DNA was extracted from the tissues of aborted monkeys and sequenced. Results showed that the FMR1 gene was completely edited in all three aborted monkeys. In aborted monkey #2, one editing method involved a 6-base knockout without introducing frameshift mutations (Figure 5).

[0214] Two of the three aborted monkeys had relatively well-preserved tissues, and the expression of FMRP protein in the prefrontal cortex tissue of these two monkeys was detected. The results showed that there was no expression of FMRP protein in the aborted 1# monkey, and the FMRP protein level in the aborted 2# monkey was very low (Figure 2D), and the results of genotypic analysis were consistent with this (Figure 5).

[0215] Example 3: Genotyping and Protein Expression Analysis of F1 Generation FMR1 Gene-Edited Monkeys of the Present Invention

[0216] After female FMR1 gene-edited monkeys reached sexual maturity, they were bred in the F1 generation, undergoing superovulation and assisted reproduction. The inventors transferred a total of 89 embryos to 30 recipients, of which 12 recipients successfully became pregnant, resulting in a total of 13 fetuses, of which 6 were born and survived (Table 2).

[0217] Table 2

[0218] The inventors collected blood samples from four older surviving monkeys for genotypic analysis and FMRP protein expression analysis. The gene analysis results showed that three female F1 generation monkeys had heterozygous mutations in the FMR1 gene, while one male F1 generation monkey had a homozygous mutation (Figure 6).

[0219] Analysis of FMRP protein in leukocytes showed that the expression level of FMRP protein in female F1 generation monkeys was lower than that in WT monkeys, while FMRP protein expression was undetectable in male F1 generation leukocytes (Figure 3A). This is consistent with the expectation that females in the F1 generation have heterozygous mutations in the FMR1 gene, while males have homozygous mutations in the FMR1 gene. Analysis of FMRP protein expression in the prefrontal cortex of a well-preserved aborted male F1 generation monkey showed that FMRP protein expression was undetectable by either Western blotting or immunofluorescence (Figures 3B and 3C).

[0220] Example 4: Increased total activity and repetitive stereotyped activities in FMR1 gene knockout monkeys according to the present invention.

[0221] The inventors analyzed the activity of monkeys in a large behavioral cage, including six monkeys with complete FMR1 gene knockout (M4-M9) and two monkeys with partial FMR1 gene knockout (M2 and M3 with knockout rates of 68.8% and 58.8%, respectively). The red lines in Figure 7A represent the monkeys' movement trajectories in the behavioral cage. The analysis showed that the total movement distance (i.e., total amount of movement) covered by the FMR1 gene knockout cynomolgus monkeys during the observation period was significantly longer than that of the wild-type control group (Figure 7B), similar to the hyperactivity phenotype exhibited by patients.

[0222] The inventors discovered that FMR1 knockout cynomolgus monkeys tended to spend more time at the bottom of their enclosures during the experiment, significantly exceeding the time spent at the bottom compared to their age-matched wild-type controls (Figures 7C and D). This indicates a difference in activity preferences between FMR1 knockout cynomolgus monkeys and control monkeys.

[0223] In addition, the inventors made extensive records and analyzed the daily behavior of monkeys in their cages and found that FMR1 knockout cynomolgus monkeys exhibited a significant increase in repetitive stereotyped behaviors (Figure 7E), including continuous meaningless circling movements, frequent lip smacking or tongue sticking out, finger sucking, meaningless grasping in the air, and continuous pulling of identification tags. These behavioral patterns are very consistent with the increase in repetitive stereotyped behaviors reported in clinical reports.

[0224] Example 5: Reduced vocalization in FMR1 gene knockout monkeys according to the present invention

[0225] During the non-gazing phase of the TAD test, there was no significant difference in gurgling sounds between the two groups of cynomolgus monkeys (Fig. 8A). During the gaze phase, the FMR1 knockout cynomolgus monkeys showed a trend of increased gurgling sounds (Fig. 8B). Gurgling sounds are a typical phenotype of anxiety in macaques; therefore, the anxiety level of the FMR1 knockout monkeys was higher than that of the control monkeys during the gaze phase. Throughout the human invasion experiment, the total number of vocalizations produced by the FMR1 knockout cynomolgus monkeys was significantly less than that of the wild-type control monkeys (Fig. 8C), which is consistent with the characteristics of language development disorders in FXS patients.

[0226] Example 6: Reduced social willingness in FMR1 gene knockout monkeys according to the present invention

[0227] The inventors designed a social behavior cage with an insertable partition in the center to control visual and tactile contact between experimental animals. During the adaptation phase, the FMR1 knockout cynomolgus monkeys showed significantly lower performance in exploratory behavior compared to the wild-type control group (Figure 9A).

[0228] This finding indicates that the FMR1 gene knockout of this invention affects monkeys' curiosity and motivation to explore novel stimuli such as social interactions. In the subsequent social interaction phase, the cynomolgus monkeys in the FMR1 gene knockout group exhibited significantly higher levels of repetitive and stereotyped behaviors than the control group (Figure 9B). These stereotyped behaviors were associated with increased anxiety or stress levels, consistent with the inventors' previous experimental results.

[0229] Notably, the FMR1 knockout group monkeys also showed an increased trend in aggressive behavior towards other monkeys (Figure 9C). This increase in aggressive behavior is very similar to the violent tendencies often reported in adolescents with Fragile X syndrome in clinical practice. The inventors categorized social interaction behaviors into two main types: proactive social behavior and reactive social behavior. The FMR1 knockout group cynomolgus monkeys exhibited social avoidance patterns in various aspects of both proactive and reactive social behaviors. For example, in proactive social behavior, the FMR1 knockout group monkeys showed significantly fewer instances of "grooming" behavior than the control group (Figures 9D-G), indicating that they have difficulty initiating social interactions. In reactive social behavior, the FMR1 knockout group monkeys also showed significantly fewer instances of "being followed" behavior than the control group (Figures 9H-K), indicating that they also have difficulty responding to social attempts by other monkeys.

[0230] In summary, these results support the typicality of FMR1 knockout cynomolgus monkeys as a model of social impairment in FXS. The changes in social behavior caused by FMR1 knockout in cynomolgus monkeys are highly similar to / essentially identical to the difficulties in social interaction experienced by FXS patients.

[0231] Example 7: FMR1 gene knockout monkeys exhibit working memory impairment.

[0232] Working memory was assessed using the Wisconsin-Black-White Test. The results showed that, in all three phases of the experiment—adaptation, discrimination, and reversal—FMR1 knockout cynomolgus monkeys exhibited significantly prolonged passage times in each phase (Figures 10A-H).

[0233] This result suggests that FMR1 knockout monkeys have impaired working memory capabilities. Specifically, the longer throughput reflects their difficulties in meeting memory task requirements, implementing strategies, and adapting to task changes, difficulties that are closely related to deficits in working memory function.

[0234] Therefore, these data provide important evidence for assessing the impact of FMR1 gene knockout on the cognitive function of cynomolgus monkeys and further support the value of the FMR1 gene knockout cynomolgus monkey model in FXS working memory impairment.

[0235] Example 8: FMR1 gene knockout monkeys exhibit poor cognitive flexibility.

[0236] In the second phase of the Hamiltonian search task, the control group and the FMR1 knockout group showed a significant difference in X-value (i.e., the number of times they successfully opened the correct well on their first attempt). In both the second and third phases, the daily task completion accuracy trends of the monkeys differed significantly between the two groups: the wild-type monkeys in the control group were able to quickly establish and adjust their strategies, accurately finding food rewards; while the FMR1 knockout cynomolgus monkeys did not show significant improvement. Specifically, in the second phase, the wild-type control monkeys were able to quickly learn and adapt to the new reward patterns as the experiment progressed, as evidenced by a significant increase in X-value, meaning they opened wells containing rewards more frequently on their first attempt. Conversely, the FMR1 knockout group monkeys did not show a significant increase in X-value in the same phase, indicating that they had difficulty learning and adapting to new reward locations. In the third phase, the control group of cynomolgus monkeys also showed a high accuracy rate, indicating that they were able to effectively adjust their strategies to cope with changes in the reward location; while the FMR1 knockout group monkeys still performed poorly in this phase, with no significant improvement in accuracy, which further indicates their deficiency in cognitive flexibility (Figure 11A-F).

[0237] These results suggest that knocking out the FMR1 gene has a significant negative impact on the cognitive flexibility of cynomolgus monkeys, consistent with their performance in mimicking the cognitive impairment of patients with Fragile X syndrome.

[0238] Example 9: Changes in gaze characteristics in FMR1 gene knockout monkeys

[0239] The FMR1 knockout group of cynomolgus monkeys showed significantly lower accuracy and total task completion rates in all stages of the eye-tracking task compared to the wild-type control group, confirming a decline in attention in the FMR1 knockout group. These results are highly consistent with previously reported findings in FXS patients, where attention deficit hyperactivity disorder (ADHD) is a common comorbidity characterized by difficulty concentrating, hyperactivity, and impulsivity. The attention deficits exhibited by the FMR1 knockout group cynomolgus monkeys in the fixation task are consistent with the attention-shifting and hyperactivity symptoms observed in FXS patients. Furthermore, the results in the image recognition stage indicated that the FMR1 knockout group cynomolgus monkeys avoided looking at images of monkey faces, preferring instead images of plants (Figures 12A-H). These results further demonstrate their social avoidance phenotype.

[0240] These experimental results demonstrate a high degree of accuracy in fitting the phenotypes and symptoms between the animal disease model of this invention and the human patient population.

[0241] discuss

[0242] FXS (Autism Spectrum Disorder) is the second most common inherited intellectual disability after Down syndrome and is the most prevalent type of autism spectrum disorder. FXS is caused by a mutation in the FMR1 gene on the X chromosome, resulting in the deletion of the FMRP (Fatal Function Retention Platelet). In most cases, the loss of FMRP is caused by an amplification of the trinucleotide CGG repeat sequence in the 5′UTR of the FMR1 gene. The loss of FMRP leads to typical FXS features, including mild to severe intellectual disability, cognitive impairment, seizures, language impairment, physical changes (such as megalocardia and facial deformities), and behavioral problems (such as social difficulties, anxiety, hyperactivity, hypersensitivity to sensory stimuli, and other autistic-like behaviors). Behavioral deficits in FXS can be detected as early as infancy and early childhood, and these deficits persist throughout the patient's life, causing immense suffering for patients and their families. Currently, there are no effective medications for treating FXS; clinical treatment primarily involves symptomatic and supportive care.

[0243] Current animal models of FXS include invertebrates (fruit flies) and vertebrates (mice, rats, and zebrafish). While these animal models contribute unique insights into the molecular, cellular, physiological, and behavioral defects associated with FXS, none can fully reconstruct the FXS phenotype. This is likely due to significant differences in sensory, biochemical, and anatomical aspects between these species and humans, leading to considerable limitations in modeling higher cognitive functions and social behavior. Given the limitations in enrolling FXS patients in clinical trials, and the associated costs and time, suitable animal models will play a crucial role in identifying and testing promising therapeutic candidates. Non-human primates are evolutionarily close to humans, sharing high similarities in tissue structure, physiology, metabolism, and immunity. They possess unparalleled advantages in brain structure and function, particularly in brain structure and function, making them the optimal model organisms for studying human brain diseases, as they can better replicate the development and progression of these diseases compared to other model organisms. Furthermore, research findings in non-human primates can be directly translated into clinical applications, more effectively predicting the efficacy of candidate drugs in clinical settings and reducing the risks associated with new drug development.

[0244] In this invention, CRISPR / Cas9 technology was used to extensively analyze target sites of the cynomolgus monkey FMR1 gene, and guide RNAs with high editing activity against the cynomolgus monkey FMR1 gene were screened at the embryonic level. FMR1 gene editing was performed on cynomolgus monkey fertilized eggs, and FMR1 gene knockout cynomolgus monkeys were successfully obtained using assisted reproductive technology. Superovulation, intracytoplasmic sperm injection, and assisted reproduction were then performed on sexually mature FMR1 gene knockout cynomolgus monkeys, successfully obtaining FMR1 gene knockout F1 generation cynomolgus monkeys. The successful establishment of the FMR1 gene knockout cynomolgus monkey model is of great significance for elucidating the mechanism of FXS occurrence and accelerating the development of FXS drugs.

[0245] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these modifications and improvements all fall within the scope of protection of the present invention. Therefore, the scope of protection of this patent should be determined by the appended claims.

Claims

1. Use of sgRNA in the preparation of animals with Fragile X syndrome, wherein the sgRNA downregulates the FMR1 gene of the animal, and the downregulation targets the third and / or fourth exon of the FMR1 gene; wherein the animal is a non-human primate.

2. Use according to claim 1, characterized in that, The sgRNA includes: sgRNA targeting the target sequence SEQ ID NO:3 in the fourth exon of the FMR1 gene; and / or sgRNA targeting the target sequences SEQ ID NO:2 and / or SEQ ID NO:1 in the third exon of the FMR1 gene.

3. Use according to claim 2, characterized in that, The sgRNA includes: an sgRNA targeting the target sequence SEQ ID NO:3 in the fourth exon of the FMR1 gene, and an sgRNA targeting the target sequence SEQ ID NO:2 in the third exon of the FMR1 gene.

4. The use according to claim 2, characterized in that, The sgRNA includes those selected from: The sgRNA targeting the target sequence SEQ ID NO:3 has the nucleotide sequence shown in SEQ ID NO:6; The sgRNA targeting the target sequence SEQ ID NO:2 has the nucleotide sequence shown in SEQ ID NO:5; The sgRNA targeting the target sequence SEQ ID NO:1 has the nucleotide sequence shown in SEQ ID NO:

4.

5. Use according to claim 4, characterized in that, The sgRNA and Cas mRNA, or constructs capable of forming the sgRNA and Cas9 mRNA, are introduced into the fertilized eggs of animals.

6. Use according to claim 5, characterized in that, After being introduced into the fertilized egg of an animal, the process also includes: allowing the fertilized egg to develop to obtain the Fragile X syndrome animal.

7. The use according to claim 1, characterized in that, The animals with Fragile X syndrome exhibited phenotypes selected from the following groups: increased total activity and repetitive stereotyped activities, increased anxiety, language development disorders, decreased social willingness; memory impairment; and reduced cognitive flexibility. Attention deficit.

8. sgRNA for preparing animals with Fragile X syndrome, which targets the target sequence SEQ ID NO:3 in the fourth exon of the FMR1 gene of the animal, and the target sequence SEQ ID NO:2 or SEQ ID NO:1 in the third exon.

9. The sgRNA for making a Fragile X syndrome animal of claim 8, wherein, The sgRNA is a combination of sgRNAs, including: a target sequence SEQ ID NO:3 targeting the fourth exon of the FMR1 gene in animals, and a target sequence SEQ ID NO:2 targeting the third exon of the FMR1 gene in animals.

10. The sgRNA for making a Fragile X syndrome animal of claim 9, wherein, The sgRNA targeting the target sequence SEQ ID NO:3 has the nucleotide sequence as shown in SEQ ID NO:6; the sgRNA targeting the target sequence SEQ ID NO:2 has the nucleotide sequence as shown in SEQ ID NO:5; or the sgRNA targeting the target sequence SEQ ID NO:1 has the nucleotide sequence as shown in SEQ ID NO:

4.

11. A kit for preparing animals with Fragile X syndrome, comprising the sgRNA for preparing animals with Fragile X syndrome as described in any one of claims 8 to 10.

12. The kit of claim 11, wherein The kit also contains Cas mRNA or a construct that can form Cas mRNA.