Fusion peptide and use thereof

Abstract

Provided are a fusion peptide and a use thereof. The fusion peptide comprises: pan DR binding epitope (PADRE); a first tetanus toxin epitope TTD632–651; and a second tetanus toxin epitope TTD950–969; which can significantly improve immune response.

Description

A fusion peptide and its applications Technical Field

[0001] This invention belongs to the fields of molecular biology and immunology, and specifically relates to a fusion peptide and its applications. Technical Background

[0002] Neisseria meningitidis (meningococcus) is a capsulated Gram-negative diplococcus that inhabits the nasopharynx or upper respiratory tract of humans and can cause sepsis and meningitis. Approximately 10% of the general population carries Neisseria meningitidis. It is reported that about 500,000 cases of meningococcal disease occur annually, resulting in approximately 50,000 deaths. Worldwide, almost all meningococcal infections are caused by six of the twelve typical meningococcal serogroups (A, B, C, W, X, and Y). Currently, effective capsular polysaccharide vaccines have been developed for serogroups A, C, W, and Y. However, the polysaccharide of meningococcal serogroup B (MenB) strains has a similar structure to the polysialic acid on the surface of human nerve cells, resulting in poor immunogenicity of MenB polysaccharide vaccines. Although outer membrane vesicle (OMV)-based vaccines have successfully controlled epidemics caused by single MenB strains, the immune response induced by these vaccines primarily targets the highly variable PorA protein. Therefore, their effectiveness is typically limited to the target strain. Consequently, the search for surface-exposed proteins capable of inducing protective bactericidal antibodies against different MenB strains to develop broadly effective MenB vaccines has become a hot research topic.

[0003] Two MenB vaccines have been developed based on factor H binding protein (fHBP; also known as LP2086 and GNA1870): a bivalent rLP2086 vaccine. MenB-FHbp) and 4CMenB ( MenB-4C. The bivalent rLP2086 is composed of two different subfamily variants of fHBP, one from subfamily A (variant A05) and the other from subfamily B (variant B01). 4CMenB contains four meningococcal antigen proteins (two fusion proteins: a fusion protein containing GNA2091 and the fHBP protein from subfamily B, and a fusion protein containing NHBA and GNA1030; NadA protein; and OMV). The bivalent rLP2086 has been approved in the United States for the prevention of MenB disease in individuals aged 10 to 25 years. 4CMenB was also approved a few months later and licensed in Europe, Canada, Australia, and Brazil. Although two fHBP protein-based MenB vaccines have been developed, there remains a need to develop new fHBP protein-based MenB vaccines. Summary of the Invention

[0004] The first aspect of the present invention is to provide a fusion peptide.

[0005] A second aspect of the present invention is to provide a fusion protein.

[0006] A third aspect of the present invention aims to provide biomaterials related to the fusion peptide of the first aspect of the present invention or the fusion protein of the second aspect of the present invention.

[0007] The fourth aspect of this invention is to provide a recombinant lactic acid bacteria.

[0008] The fifth aspect of this invention is to provide a method for preparing recombinant lactic acid bacteria according to the fourth aspect of this invention.

[0009] The sixth aspect of this invention aims to provide the application of the fusion peptide of the first aspect of this invention, the fusion protein of the second aspect of this invention, the biomaterial of the third aspect of this invention, and the recombinant lactic acid bacteria of the fourth aspect of this invention in the preparation of products.

[0010] The seventh aspect of this invention aims to provide a product.

[0011] The object of the eighth aspect of the present invention is to provide a method.

[0012] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0013] In a first aspect, the present invention provides a fusion peptide comprising: a pan DR binding epitope (PADRE); a first tetanus toxin epitope TTD632–651; and a second tetanus toxin epitope TTD950–969.

[0014] In some embodiments, the fusion peptide comprises PADRE, a first tetanus toxin epitope TTD632–651, and a second tetanus toxin epitope TTD950–969 from the N-terminus to the C-terminus.

[0015] In some embodiments, the PADRE further includes a linker peptide between itself and the first tetanus toxin epitope TTD632–651.

[0016] In some embodiments, TTD632–651 further comprises a linker peptide between the second tetanus toxin epitope TTD950–969.

[0017] In some embodiments, each of the linker peptides is independently selected from at least one of AAY, KK, GGEAAAK (SEQ ID NO:9), RVRR (SEQ ID NO:10), GGGGS (SEQ ID NO:11), GGPPG (SEQ ID NO:12), and CPPGG (SEQ ID NO:13); further, each of the linker peptides is independently selected from any one of AAY and GGPPG.

[0018] In some embodiments, the linker peptide between PADRE and the first tetanus toxin epitope TTD632–651 is AAY or GGPPG.

[0019] In some embodiments, the linker peptide between the first tetanus toxin epitope TTD632–651 and the second tetanus toxin epitope TTD950–969 is AAY.

[0020] In some embodiments, the amino acid sequence of the PADRE is as follows:

[0021] a1) The amino acid sequence shown in amino acids 292-304 of SEQ ID NO:2; or

[0022] The amino acid sequences shown in a2) and a1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and have the same function.

[0023] In some embodiments, the amino acid sequence of the first tetanus toxin epitope TTD632–651 is as follows:

[0024] b1) The amino acid sequence as shown in amino acids 308-327 of SEQ ID NO:2; or

[0025] The amino acid sequences shown in b2) and b1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function.

[0026] In some embodiments, the amino acid sequence of the second tetanus toxin epitope TTD950–969 is as follows:

[0027] c1) The amino acid sequence as shown in amino acids 331-351 of SEQ ID NO:2; or

[0028] The amino acid sequences shown in c2) and c1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function.

[0029] In some embodiments, the amino acid sequence of the fusion peptide is as follows:

[0030] d1) The amino acid sequence as shown in amino acids 292-351 of SEQ ID NO:2; or

[0031] d2) The amino acid sequence as shown in amino acids 285-346 of SEQ ID NO:6; or

[0032] The amino acid sequence shown in d3) has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in d1) or d2) and has the same function.

[0033] A second aspect of the present invention provides a fusion protein comprising a target immunogen and a fusion peptide of the first aspect of the present invention.

[0034] In some embodiments, the target immunogen is a pathogen antigen or a tumor-associated antigen; more specifically, it is a pathogen antigen.

[0035] In some embodiments, the pathogen is a virus, fungus, parasite, or bacteria; more specifically, Neisseria meningitidis; and even more specifically, Neisseria meningitidis serogroup B.

[0036] In some embodiments, the tumor includes at least one of a solid tumor and a hematoma.

[0037] In some embodiments, the target immunogen is an H factor binding protein; further, it is at least one of the H factor binding protein A subfamily and the H factor binding protein B subfamily; even further, it is either the H factor binding protein A subfamily or the H factor binding protein B subfamily.

[0038] In some embodiments, the fusion protein comprises, from the N-terminus to the C-terminus, the target immunogen and the fusion peptide of the first aspect of the present invention.

[0039] In some embodiments, a linker peptide is also included between the target immunogen and the fusion peptide.

[0040] In some embodiments, the linker peptide comprises at least one of AAY, KK, GGEAAAK (SEQ ID NO:9), RVRR (SEQ ID NO:10), GGGGS (SEQ ID NO:11), GGPPG (SEQ ID NO:12), and CPPGG (SEQ ID NO:13); further comprising GGPPG.

[0041] In some embodiments, the amino acid sequence of the H factor binding protein A subfamily is as follows:

[0042] e1) The amino acid sequence as shown in amino acids 25-286 of SEQ ID NO:2; or

[0043] The amino acid sequences shown in e2) and e1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and have the same function.

[0044] In some embodiments, the amino acid sequence of the H factor binding protein B subfamily is as follows:

[0045] f1) The amino acid sequence as shown in amino acids 25-279 of SEQ ID NO:6; or

[0046] The amino acid sequences shown in f2) and f1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function.

[0047] (i) When the fusion protein is fusion protein A.

[0048] In some embodiments, the N-terminus of the target immunogen also includes a lipid-based signal peptide.

[0049] In some embodiments, the amino acid sequence of the lipolysis signal peptide is as follows:

[0050] g1) The amino acid sequence shown in positions 1-24 of SEQ ID NO:2; or

[0051] g2) The amino acid sequence as shown in SEQ ID NO:14; or

[0052] The amino acid sequences shown in g3) and g1) or g2) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and have the same function.

[0053] In some embodiments, the amino acid sequence of the lipolysis signal peptide is as follows:

[0054] g1) The amino acid sequence shown in positions 1-24 of SEQ ID NO:2; or

[0055] The amino acid sequences shown in g2) and g1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function.

[0056] In some embodiments, the amino acid sequence of the fusion protein is as follows:

[0057] j1) The amino acid sequences shown in SEQ ID NO:2 and SEQ ID NO:6; or

[0058] The amino acid sequences shown in j2) and j1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and have the same function.

[0059] (ii) When the fusion protein is fusion protein B.

[0060] In some embodiments, the N-terminus of the target immunogen also includes an IL2 secretion signal peptide.

[0061] In some embodiments, the amino acid sequence of the IL2 secretion signal peptide is as follows:

[0062] h1) The amino acid sequence as shown in the first 20 amino acids of SEQ ID NO:4; or

[0063] The amino acid sequences shown in h2) and h1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and have the same function.

[0064] In some embodiments, the C-terminus of the fusion peptide also includes a glycosylphosphatidylinositol (GPI) anchoring protein.

[0065] In some embodiments, the glycosylphosphatidylinositol (GPI) anchoring protein comprises at least one of EFNA1, EFNA2, EFNA3, EFNA5, CD24, CNTN1, FOLI, LSAMP, PPB1, and RTN4R; more specifically, EFNA3.

[0066] In some embodiments, the amino acid sequence of EFNA3 is as follows:

[0067] i1) The amino acid sequence shown in amino acids 348-382 of SEQ ID NO:4; or

[0068] The amino acid sequences shown in i2) and i1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and have the same function.

[0069] In some embodiments, the amino acid sequence of the fusion protein is as follows:

[0070] n1) The amino acid sequence shown in SEQ ID NO:4 or SEQ ID NO:8; or

[0071] The amino acid sequences shown in n2) and n1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function.

[0072] A third aspect of the invention provides biomaterials related to the fusion peptide of the first aspect of the invention or the fusion protein of the second aspect of the invention, wherein the biomaterials are any one of k1)-k14):

[0073] k1) A nucleic acid molecule encoding the fusion peptide of the first aspect of the present invention or the fusion protein of the second aspect of the present invention;

[0074] k2) contains an expression cassette of the nucleic acid molecule described in k1);

[0075] k3) is a carrier containing the nucleic acid molecule described in k1);

[0076] k4) is a carrier containing the expression box described in k2);

[0077] k5) contains the nucleic acid molecules described in k1);

[0078] k6) contains cells containing the expression cassette described in k2);

[0079] k7) contains cells containing the carrier described in k3);

[0080] k8) contains cells containing the carrier described in k4);

[0081] k9) is a recombinant bacterium containing the nucleic acid molecules described in k1);

[0082] k10) contains the recombinant bacteria of the expression cassette described in k2);

[0083] k11) contains recombinant bacteria containing the vector described in k3);

[0084] k12) contains recombinant bacteria containing the vector described in k4);

[0085] k13) Cells containing the fusion peptide of the first aspect of the present invention or the fusion protein of the second aspect of the present invention;

[0086] k14) is a recombinant bacterium containing the fusion peptide of the first aspect of the present invention or the fusion protein of the second aspect of the present invention.

[0087] In some embodiments, any of the cells described in k5)-k8) do not contain reproductive material.

[0088] In some embodiments, the nucleotide sequence of the nucleic acid molecule encoding the fusion peptide of the first aspect of the present invention is as follows:

[0089] l1) The nucleotide sequence shown in nucleotides 874-1056 of SEQ ID NO:1; or

[0090] l2) The nucleotide sequence shown in nucleotides 853-1041 of SEQ ID NO:5; or

[0091] The nucleotide sequences shown in l3) and l1) or l2) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and have the same function.

[0092] In some embodiments, the nucleotide sequence of the nucleic acid molecule encoding the fusion protein of the second aspect of the present invention is as follows:

[0093] m1) Nucleotide sequences as shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7; or

[0094] The nucleotide sequences shown in m2) and m1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function.

[0095] In some embodiments, the nucleotide sequence of the vector is:

[0096] q1) The nucleotide sequence shown in SEQ ID NO:23; or

[0097] The nucleotide sequences shown in q2) and q1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and have the same function.

[0098] In some embodiments, the nucleotide sequence of the vector is:

[0099] r1) The nucleotide sequence shown in SEQ ID NO:24; or

[0100] The nucleotide sequences shown in r2) and r1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function.

[0101] A fourth aspect of the present invention provides a recombinant lactic acid bacteria comprising any one of the biological materials of the third aspect of the present invention (k1)-k4).

[0102] In some embodiments, the recombinant lactic acid bacteria (recombinant lactic acid bacteria A) comprises any one of the biological materials k1)-k4) of the third aspect of the present invention, wherein k1) is a nucleic acid molecule encoding a fusion protein of the second aspect of the present invention, and the target immunogen is a subfamily of factor H binding protein A.

[0103] In some embodiments, the recombinant lactic acid bacteria (recombinant lactic acid bacteria B) comprises any one of the biological materials k1)-k4) of the third aspect of the present invention, wherein k1) is a nucleic acid molecule encoding a fusion protein of the second aspect of the present invention, and the target immunogen is a subfamily of H factor binding protein B.

[0104] In some embodiments, the lactic acid bacteria are selected from subspecies of Lactococcus, Streptococcus, Lactobacillus, Leuconostoc, Pediococcus, Brachybacterium, and Propionibacterium.

[0105] In some embodiments, the lactic acid bacteria comprises *Lactococcus lactis*; further comprising *Lactococcus lactis* NZ3000.

[0106] In some embodiments, the recombinant lactic acid bacteria comprises two expression cassettes: one expression cassette contains a nucleic acid molecule encoding fusion protein A in the second aspect of the invention, and the other expression cassette contains a nucleic acid molecule encoding fusion protein B in the second aspect of the invention.

[0107] In some implementations, the two expression boxes are located in the same carrier.

[0108] In some embodiments, the nucleotide sequence of the vector for the recombinant lactic acid bacteria A is as follows:

[0109] q1) The nucleotide sequence as shown in SEQ ID NO:24; or

[0110] The nucleotide sequences shown in q2) and q1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and have the same function.

[0111] In some embodiments, the nucleotide sequence of the vector for the recombinant lactic acid bacteria B is as follows:

[0112] r1) The nucleotide sequence shown in SEQ ID NO:23; or

[0113] The nucleotide sequences shown in r2) and r1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function.

[0114] A fifth aspect of the present invention provides a method for preparing recombinant lactic acid bacteria according to the fourth aspect of the present invention, wherein any one of the biomaterials of the third aspect of the present invention (k3)-k4) is introduced into the lactic acid bacteria.

[0115] In some implementations, the importation is carried out via electroporation.

[0116] A sixth aspect of the present invention provides the use of the fusion peptide of the first aspect of the present invention, the fusion protein of the second aspect of the present invention, the biomaterial of the third aspect of the present invention, or the recombinant lactic acid bacteria of the fourth aspect of the present invention in the preparation of a product; said product having at least one function of (o1)-o3):

[0117] o1) Prevent pathogen infection;

[0118] o2) Treatment and / or prevention of diseases caused by pathogen infection;

[0119] o3) Prevention and treatment of tumors.

[0120] In some embodiments, the pathogen is a virus, fungus, parasite, or bacteria; more specifically, Neisseria meningitidis; and even more specifically, Neisseria meningitidis serogroup B.

[0121] In some embodiments, the tumor includes at least one of a solid tumor and a hematoma.

[0122] In some embodiments, the product comprises at least one of a drug, feed, feed additive, and reagent; further, it is a drug.

[0123] In some embodiments, the reagent comprises at least one of a disinfectant and a cleaning agent.

[0124] In some embodiments, the drug is administered via oral, injection, pulmonary, mucosal, nasal, intraperitoneal, intracranial, intratumoral, sublingual, buccal, transdermal, topical, immersion, or spraying routes.

[0125] In some embodiments, the drug also includes pharmaceutically acceptable excipients.

[0126] In some embodiments, the drug is a vaccine.

[0127] A seventh aspect of the present invention provides a product comprising the fusion peptide of the first aspect of the present invention, the fusion protein of the second aspect of the present invention, the biomaterial of the third aspect of the present invention, or the recombinant lactic acid bacteria of the fourth aspect of the present invention.

[0128] In some embodiments, the product comprises recombinant lactic acid bacteria A and recombinant lactic acid bacteria B from the fourth aspect of the present invention.

[0129] In some embodiments, the product has at least one of the functions of o1)-o3):

[0130] o1) Prevent pathogen infection;

[0131] o2) Treatment and / or prevention of diseases caused by pathogen infection;

[0132] o3) Prevention and treatment of tumors.

[0133] In some embodiments, the pathogen is a virus, fungus, parasite, or bacteria; more specifically, Neisseria meningitidis; and even more specifically, Neisseria meningitidis serogroup B.

[0134] In some embodiments, the disease caused by the pathogen infection includes sepsis or meningitis.

[0135] In some embodiments, the tumor includes at least one of a solid tumor and a hematoma.

[0136] In some embodiments, the product comprises at least one of a drug, feed, feed additive, and reagent; further, it is a drug.

[0137] In some embodiments, the reagent comprises at least one of a disinfectant and a cleaning agent.

[0138] In some embodiments, the drug is administered via oral, injection, pulmonary, mucosal, nasal, intraperitoneal, intracranial, intratumoral, sublingual, buccal, transdermal, topical, immersion, or spraying routes.

[0139] In some embodiments, the drug also includes pharmaceutically acceptable excipients.

[0140] In some embodiments, the drug is a vaccine.

[0141] In some embodiments, a vaccine comprises an adjuvant and recombinant lactic acid bacteria according to the fourth aspect of the present invention.

[0142] In some embodiments, a vaccine comprises an adjuvant and recombinant lactic acid bacteria A and recombinant lactic acid bacteria B as described in the fourth aspect of the present invention.

[0143] An eighth aspect of the invention provides a method for administering a therapeutically effective amount of the product of the seventh aspect of the invention to a subject; said method is used for any one of p1)-p3):

[0144] p1) Prevention of pathogen infection;

[0145] p2) Treatment and / or prevention of diseases caused by pathogen infection;

[0146] p3) Prevention and treatment of tumors.

[0147] In some embodiments, the subject may include mammals, such as humans or non-human mammals. In some embodiments, the non-human mammals may include, but are not limited to, non-human primates (e.g., monkeys, orangutans), mice, rats, hamsters, gerbils, cats, dogs, guinea pigs, rabbits, horses, sheep, cattle, pigs, etc.

[0148] In some embodiments, the pathogen is a virus, fungus, parasite, or bacteria; more specifically, Neisseria meningitidis; and even more specifically, Neisseria meningitidis serogroup B.

[0149] In some embodiments, the disease caused by the pathogen infection includes sepsis or meningitis.

[0150] In some embodiments, the tumor includes at least one of a solid tumor and a hematoma.

[0151] The beneficial effects of this invention are:

[0152] The present invention provides a fusion peptide comprising a pan DR binding epitope (PADRE); a first tetanus toxin epitope TTD632–651; and a second tetanus toxin epitope TTD950–969; the fusion peptide can significantly enhance the immune response.

[0153] This invention provides a fusion protein comprising an immunogen and the aforementioned fusion peptide. By adding the fusion peptide, the immunogenicity of the fusion protein can be significantly improved.

[0154] The present invention provides a recombinant lactic acid bacteria comprising a nucleic acid molecule encoding the above-mentioned fusion peptide or fusion protein, which has good immunogenicity. Attached Figure Description

[0155] Figure 1 shows the amino acid homology of MenB FHbp proteins between and within subfamilies.

[0156] Figure 2 shows the rootless phylogenetic tree of MenB strains.

[0157] Figure 3 shows information on MenB strains 52400 and 52223.

[0158] Figure 4 shows a comparison of the fHBP protein sequences of MenB strains 52400 and 52223.

[0159] Figure 5 shows the expression results of fHBP protein A and fHBP protein B subfamily in Lactococcus lactis, including the expression cassette for expressing fHBP protein A subfamily and the expression cassette for expressing fHBP protein B subfamily in Lactococcus lactis.

[0160] Figure 6 shows the expression results of fHBP protein A subfamily in mammals, and fHBP protein B subfamily in mammals expressed in expression cassettes for expression of fHBP protein B subfamily. Detailed implementation method:

[0161] definition

[0162] Factor H binding protein (fHBP; also known as LP2086 and GNA1870) is a conserved surface-exposed lipoprotein expressed in almost all MenB strains and is considered a broad and effective target for MenB. Based on amino acid sequence, FHBP variants are divided into two immunologically distinct subfamilies (referred to as subfamily A and subfamily B); each MenB strain expresses a single subfamily variant (see Figure 1). The fHBP protein shares only 60–75% amino acid homology between subfamilies. However, its amino acid homology within subfamilies is >83%.

[0163] The "sequence identity percentage" or "identity percentage" between two polynucleotide or polypeptide sequences refers to the number of identical matching positions shared by sequences within a comparison window, taking into account additions or deletions (i.e., vacancies) that must be introduced for optimal alignment of the two sequences. A matching position is any location where the same nucleotide or amino acid is present in both the target and reference sequences. Vacancies are not nucleotides or amino acids and are not counted in the target sequence. Similarly, vacancies in the reference sequence are not counted because nucleotides or amino acids from the target sequence are included, but those from the reference sequence are excluded.

[0164] The percentage of sequence identity can be calculated as follows: determine the number of positions in both sequences where the same amino acid residue or nucleic acid base appears (the number of matching positions), divide the number of matching positions by the total number of positions in the comparison window, and multiply the result by 100 to obtain the percentage of sequence identity. Sequence comparison and determination of the percentage of sequence identity between two sequences can be accomplished using software that is readily available online and downloadable. Suitable software programs are available from various sources for protein and nucleotide sequence alignment. A suitable program for determining the percentage of sequence identity is bl2seq, which is part of the BLAST program suite available from the National Center for Biotechnology Information (NCBI) website (blast.ncbi.nlm.nih.gov). Bl2seq uses either the BLASTN or BLASTP algorithm for comparing two sequences. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, for example, Needle, Stretcher, Water, or Matcher, which are part of the EMBOSS suite of bioinformatics programs and are also available from the European Institute of Bioinformatics (EBI) at www.ebi.ac.uk / Tools / psa. The phrase "at least 85% identity" compared to a reference sequence, as mentioned herein, can include at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% sequence identity.

[0165] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of this application in any way. The actual scope of protection of this application is set forth in the claims.

[0166] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly used in the field to which this invention pertains. For the purposes of interpreting this specification, the following definitions will apply, and where appropriate, terms used in the singular will also include the plural forms, and vice versa.

[0167] The present invention will be further described in detail below through specific embodiments.

[0168] It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0169] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. Unless otherwise specified, the materials and reagents used in these examples are commercially available. For reagents whose manufacturers are listed, similar products from other manufacturers are substituted.

[0170] Example

[0171] Example 1. Selection of popular type B bacteria strains and construction of expression systems, transformation of Lactococcus lactis and expression of target proteins.

[0172] The full-length fHBP gene sequence was downloaded from PubMLST (Neisseria spp.|PubMLST), and a rootless phylogenetic tree was constructed using ITOL (ITOL: Interactive tree Of Life, embl.de) (Figure 2). Based on phylogenetic distance, the fHBP protein sequences of strains 52400 (subfamily A) and 52223 (subfamily B) were selected (information on strains 52400 and 52223 is shown in Figure 3) (a comparison of the fHBP protein sequences of strains 52400 and 52223 is shown in Figure 4) to cover the fHBP sequence diversity within and between subfamilies.

[0173] To improve antigen expression efficiency, a plasmid containing two expression cassettes was constructed: one for expression in Lactococcus lactis and the other for expression in mammalian phagocytes after Lactococcus lactis escapes from lysosomes.

[0174] Plasmids containing gene sequences for expression of the fHBP protein subfamily A or fHBP protein subfamily in Lactococcus lactis and gene sequences for expression of the fHBP protein subfamily A or fHBP protein subfamily in mammals were constructed, respectively.

[0175]

[0176] The PepN promoter and gene sequence for expressing the fHBP protein A subfamily in Lactococcus lactis were obtained by digesting the plasmid Lipo52400 with restriction endonucleases (NcoI and Bam HI). The sequence was then cloned into the pET-26(b) vector (MilliporeSigma, Massachusetts, USA) digested with the same enzymes to obtain the pET-26(b) / Lipo52400 plasmid.

[0177]

[0178] The gene sequence for mammalian expression of the fHBP protein A subfamily was obtained by digesting plasmid GPI52400 with restriction endonucleases (NcoI and NheI), and cloned into the pVIVO1-GFP / LacZ vector digested with the same enzyme group to obtain the pVIVO1-GFP / GPI-52400 plasmid.

[0179]

[0180] The PepN promoter and the gene sequence for expressing the fHBP protein B subfamily in Lactococcus lactis were obtained by digesting the plasmid Lipo52223 with restriction endonucleases and cloned into the pET-26(b) vector digested with the same enzyme group to obtain the pET-26(b) / Lipo52223 plasmid.

[0181]

[0182] The gene sequence for mammalian expression of the fHBP protein B subfamily was obtained by digesting plasmid GPI52223 with restriction endonucleases (NcoI and NheI), and cloned into the pVIVO1-GFP / LacZ vector digested with the same enzyme group to obtain the pVIVO1-GFP / GPI-52223 plasmid.

[0183] Using plasmid pNZ8149 as a template, the LacF fragment was amplified using upstream primer (CCAAAACGATCTCAACAAACAAAGAAAAAGAGTTATTTGCTG, SEQ ID NO:15), downstream primer (TGCAATAAACAAGTTGAAAGGGAAACGACGGATCA, SEQ ID NO:16), and high-fidelity Q5 polymerase.

[0184] Using pVIVO1-GFP / GPI-5223 and pVIVO1-GFP / GPI-52400 plasmids as templates, the SV40-GPI-52223-CMV and SV40-GPI-52400-CMV fragments were amplified using upstream primer (TGATCCGTCGTTTCCCTTTC, SEQ ID NO:17), downstream primer (CAATGAGTAAACAAGCGTTACATAACTTACGGTAAATG, SEQ ID NO:18), and high-fidelity Q5 polymerase, respectively.

[0185] Using plasmids pET-26(b) / Lipo52223 and pET-26(b) / Lipo52400 as templates, PepN-Lipo-52223-T7Te and PepN-Lipo-52400-T7Te fragments were amplified using upstream primer (CTTGTTTACTCATTGATTTCATTC, SEQ ID NO:19) and downstream primer (CAAAAAACCCCTCAAGAC, SEQ ID NO:20).

[0186] Using plasmid pTRKH3-ERmGFP as a template, the AMB1 ori fragment was amplified using the upstream primer (ATTTCGCTTTCGATAGAACACCCAAGAATTAGAAATGAGTAG, SEQ ID NO:21) and the downstream primer (TTGAGATCGTTTTGGTCTG, SEQ ID NO:22).

[0187] All the PCR amplification products were first treated with Dpn I and then purified using the QIAquick PCR purification kit.

[0188] Following the instructions of the HiFi DNA Assembly Kit, plasmid Expression-TRH-52223-final (sequence shown in SEQ ID NO:23) was assembled using lacF fragment, SV40-GPI-52223-CMV fragment, PepN-Lipo-52223-T7Te fragment, and AMB1 ori fragment.

[0189] Plasmid Expression-TRH-52223-final was electrotransfected (MoBiTec GmbH, Goettingen, Germany) into NZ3000 lactic acid bacteria. Transfected cells were plated on M17 (containing 0.5% lactose) plates. A loopful of colony was cultured in M17 (containing 0.5% lactose) broth. Plasmid extraction was performed according to the QIAprep Spin Miniprep Kit instructions (initial step: treatment with 2 mg / mL lysozyme for 10 min). Positive clones were obtained by sequential restriction endonuclease and sequencing screening (containing expression cassettes for expressing the fHBP protein B subfamily in *Lactococcus lactis* and expression cassettes for expressing the fHBP protein B subfamily in mammals).

[0190] Following the instructions of the HiFi DNA Assembly Kit, plasmid Expression-TRH-52400-final (sequence shown in SEQ ID NO:24) was assembled using lacF fragment, SV40-GPI-52400-CMV fragment, PepN-Lipo-52400-T7Te fragment, and AMB1 ori fragment.

[0191] Plasmid Expression-TRH-52400-final was electrotransfected into NZ3000 lactic acid bacteria (MoBiTec GmbH, Goettingen, Germany), and the transfected cells were plated on M17 (containing 0.5% lactose) plates. A loopful of colony was cultured in M17 (containing 0.5% lactose) broth. Plasmid extraction was performed according to the QIAprep Spin Miniprep Kit instructions (initial step: treatment with 2 mg / mL lysozyme for 10 min). Positive clones were obtained by sequential restriction endonuclease and sequencing screening (containing expression cassettes for expressing the fHBP protein A subfamily in *Lactococcus lactis* and expression cassettes for expressing the fHBP protein A subfamily in mammals).

[0192] Example 2. Expression of the target protein

[0193] One loopful of each of the above-mentioned expression cassettes containing the expression cassettes for the fHBP protein A subfamily in *Lactococcus lactis*, the expression cassette for the fHBP protein A subfamily in mammals, the expression cassette for the fHBP protein B subfamily in *Lactococcus lactis*, and the expression cassette for the fHBP protein B subfamily in mammals were inoculated into 5 mL of Elliker medium (containing 0.5% lactose) and cultured overnight (30°C). The culture product was then inoculated into fresh Elliker medium (containing 0.5% lactose) (culture product to medium volume ratio 1:25) and cultured at 30°C until the stationary phase.

[0194] Ten mL of culture cultured to the stationary phase was centrifuged at 10,000 g for 10 min at 4 °C, and the Lactococcus lactis was resuspended in 1 mL of ice-cold phosphate buffer. The Lactococcus lactis was then sonicated to disrupt its structure. The cell extract was centrifuged at 15,000 g for 15 min at 4 °C. Finally, the isolated and purified soluble protein fraction was used for Western blot analysis.

[0195] Soluble protein fractions were analyzed by denaturing SDS-PAGE (10% acrylamide). Samples were resuspended in denaturing buffer (Laemli 4x: Tris base 1.28 g, glycerol 8 mL, SDS 1.6 g, β-mercaptoethanol 4 mL, urea 9.6 g / 100 mL). The soluble protein fractions were boiled for 5 minutes and loaded onto the gel wells. After electrophoresis, the gel was transferred to a membrane and treated with a monoclonal antibody against mouse factor H binding protein (fHbp) (clone JAR 41, Cat. No. MABF2675) (Millipore Sigma, Massachusetts, US). The secondary antibody was HRP-conjugated goat anti-mouse IgG antibody (Cat: 665739, Millipore Sigma, Massachusetts, US). Protein bands were observed using the chromogenic substrate DAB (Cat: 34002, Therm oFisher, US). The results are shown in Figure 5: Lactococcus lactis containing expression cassettes for expressing the fHBP protein A subfamily, Lactococcus lactis containing expression cassettes for expressing the fHBP protein A subfamily in mammals, Lactococcus lactis containing expression cassettes for expressing the fHBP protein B subfamily, and Lactococcus lactis containing expression cassettes for expressing the fHBP protein B subfamily in mammals, all expressed the fHBP protein A subfamily and fHBP protein B subfamily.

[0196] Mouse macrophage-like RAW 264.7 cells were used to determine the expression of fHBP protein A subfamily in *Lactococcus lactis*, fHBP protein B subfamily in *Lactococcus lactis*, and fHBP protein B subfamily in *Lactococcus lactis* containing expression cassettes for expressing fHBP protein A and B subfamily in mammals. RAW 264.7 cells were placed in six-well plates containing DMEM medium (10% FBS) and incubated overnight at 37°C with 5% CO2. Lactococci containing expression cassettes for fHBP protein A subfamily expression in *Lactococcus lactis*, fHBP protein A subfamily expression in mammals, fHBP protein B subfamily expression in *Lactococcus lactis*, and fHBP protein B subfamily expression in mammals were washed three times with PBS. The washed cells were then added to six-well plates (5:1 ratio of *Lactococcus lactis* to RAW 264.7 cells). After 48 hours, RAW 264.7 cells were washed with PBS to remove unphagocytosed *Lactococcus lactis*. Cells were stained with Jar41 anti-fHBP primary antibody and FITC-conjugated goat anti-mouse secondary antibody (BD Pharmingen, NJ, USA). easyCyte TM The stained cells were analyzed by flow cytometry. The results are shown in Figure 6: approximately 45.8% and 55.78% of the raw cells expressed the fHBP protein subfamily B and subfamily A, respectively. It can be seen that the expression cassettes for expressing the fHBP protein subfamily A in *Lactococcus lactis*, the expression cassettes for expressing the fHBP protein subfamily A in mammals, and the expression cassettes for expressing the fHBP protein subfamily B in *Lactococcus lactis* and the expression cassettes for expressing the fHBP protein subfamily B in mammals all expressed the fHBP protein subfamily A and B.

[0197] Example 3. Animal Immunization Test

[0198] I. Vaccine strain information

[0199] NZ3000 lactic acid bacteria.

[0200] A strain (A-23-3) NZ3000 modified lactic acid bacteria vaccine strain (the above contains expression cassettes for expressing fHBP protein B subfamily in Lactococcus lactis and expression cassettes for expressing fHBP protein B subfamily in mammals).

[0201] B-40-4) NZ3000 modified lactic acid bacteria vaccine strain (the above contains expression cassettes for expressing the fHBP protein A subfamily in Lactococcus lactis and expression cassettes for expressing the fHBP protein A subfamily in mammals).

[0202] Physical properties: Milky white powder (the bacteria are in a milky white powder state after lyophilization).

[0203] Storage: Store in a sealed container at 4℃.

[0204] II. Preparation process of freeze-dried bacterial powder

[0205] 1. Lactic acid bacteria culture

[0206] 1.1M17 Culture Medium Preparation

[0207] 1) Culture medium composition

[0208] Liquid culture medium: The culture medium used in this experiment for the culture and preservation of microorganisms (lactic acid bacteria for mouse injection: NZ3000 lactic acid bacteria, A bacteria and B bacteria) was purchased from Solarbio's commercial M17 Broth medium. The M17 Broth medium has a volume of 250g / bottle, and the batch number of the medium used is (Lot. No. 1105G031, Cat#LA0610).

[0209] 2) Preparation and sterilization of culture medium

[0210] Weigh 42.3g of M17 broth culture medium and add it to 1000mL of distilled water. Stir magnetically for 15min at room temperature until the culture medium is completely dissolved and the pH value is 7.2±0.2. Dispense the solution into culture flasks and autoclave them at 121℃ for 15min using a vertical automatic pressure steam sterilizer (model: GR60DR Zhiwei (Xiamen) Instrument Co., Ltd.). After sterilization, remove the flasks and place them on the workbench to cool to room temperature for later use.

[0211] 1.2 Lactic acid bacteria culture

[0212] 1) Sterilization of the ultra-clean workbench

[0213] Before inoculating with lactic acid bacteria, the ultra-clean workbench (Thermo) was sterilized with ultraviolet light for 30 minutes. The remaining experimental materials were sterilized by high temperature and high pressure moist heat sterilization at 121℃ for 20 minutes.

[0214] 2) Inoculation and culture of lactic acid bacteria

[0215] Take the lactic acid bacteria that have been pre-preserved in a -80℃ medical low-temperature storage box (Haier, model: DW-86L626) and place them in a sterilized laminar flow hood. After the bacteria have thawed, pipette 200μL into 1L of M17 broth culture medium, shake well, and then place it in a mold incubator (MJ-Ⅱ series, Shanghai Yiheng Technology Co., Ltd.). Incubate at 30±0.5℃ and 60% humidity for 48 hours.

[0216] 2. Collection of lactic acid bacteria

[0217] 2.1 Bacterial cell collection

[0218] After culturing lactic acid bacteria for 48 hours, the bacterial cells were collected by centrifugation. The centrifuge (ThermoFisher, Sorvall Lynx 6000) was set to 4000 rpm, 4℃, and 10 min. After centrifugation, the supernatant was discarded, and the bacterial precipitate was recovered.

[0219] 2.2 Cleaning of bacterial cells

[0220] Add 100 mL of sterile distilled water to the bacterial precipitate obtained from 1 L of culture medium. Disperse the precipitate and suspend it evenly in the sterile distilled water. Centrifuge at 4000 rpm, 4 °C for 10 min. Remove the supernatant and repeat the washing process twice until the supernatant is clear and transparent with no yellow culture medium residue. After washing, collect the bacterial precipitate and resuspend it in sterile 1X PBS (pH adjusted to 7, autoclaved at 121 °C for 15 min, cooled to room temperature, and ready for use). Adjust the absorbance of the bacterial solution at 600 nm (OD600nm) to 3.0 and store at 4 °C for later use.

[0221] 3. Preparation of lactic acid bacteria powder

[0222] 3.1 Preparation of inactivated lactic acid bacteria powder

[0223] Incubate at 68℃-72℃ for 1.5-2.5 hours, then cool to below 23℃ and centrifuge at 4000 rpm for 10 minutes to collect the bacterial cells. Freeze-dry the bacterial cells for 48 hours to obtain inactivated lactic acid bacteria powder, which is a milky white powder. Store in a sealed container at 4℃. For mouse injection experiments, dissolve the bacterial powder in 1X PBS at a specific ratio before injection.

[0224] III. Procedure for Gavage and Injection Experiments in Balb / c Mice

[0225] 1. Laboratory animals

[0226] Twenty-four Balb / c mice (approximately 6 weeks old, weighing 18-20g), half male and half female, were randomly assigned to groups with a weight difference not exceeding 20% ​​of the average weight. Each group consisted of six mice of each sex (two groups in total). One group was used for ELISA detection of B-brain antibodies in the immune serum, and the other group was used for serum sterilization assay.

[0227] 2. Experimental procedure: Intradermal injection

[0228] The A and B strains were mixed and administered intradermally, with each strain receiving a dose of 1*10^9 (Table 1). The mixture was administered every two weeks, with blood collected again two weeks after the third administration. Body weight and temperature were measured.

[0229] Injection dates: August 28, September 11, and September 28;

[0230] Blood collection date: November 6th.

[0231] Table 1

[0232] IV. ELISA Detection Procedure and Results of Brain B Antibodies in Mouse Immune Serum

[0233] 1. Experimental Principle

[0234] ELISA (Enzyme-Linked Immunosorbent Assay) is a laboratory technique used to detect and quantify antigens or antibodies. Its basic principle is based on the specific binding between antigens and antibodies. Enzyme-labeled probe antibodies are used to detect and quantify specific antibodies in a sample, and the enzyme-catalyzed signal amplification enables accurate measurement of the antibody quantity.

[0235] This experiment used the indirect ELISA method. The antigen was lactic acid bacteria (a mixture of bacteria A and bacteria B (1:1)). After the bacteria were fixed overnight, the mouse immune serum (primary antibody) was detected, incubated with enzyme-labeled secondary antibody, and finally detected by an enzyme-linked immunosorbent assay (ELISA) reader.

[0236] 2. Experimental Procedure

[0237] 1.1. Coating antigen: 50 mL of overnight culture of the target bacteria, centrifuged at 4°C, washed three times with PBS, and the cell density adjusted to 1 x 10⁻⁵ cells / mL with PBS. 9 Add 100 μL of cells / mL to each well and incubate overnight at 4°C.

[0238] 1.2. Washing: Remove the coating solution and wash 3 times with washing solution.

[0239] 1.3. Blocking: Add 300 μL of blocking solution to each well, place in a humidified chamber, and incubate at 37°C for 2 hours. Note that the humidified chamber should be preheated in a 37°C incubator beforehand.

[0240] 1.4. Washing: Remove the sealing solution and wash 3 times with washing solution.

[0241] 1.5. Add primary antibody, i.e., test serum (mixed serum from immunized mice): Add 100 μL of test serum diluted with primary antibody diluent to each well, place in a humidified chamber, and incubate at 37°C for 1.5 h. Note that positive and negative controls should be included.

[0242] 1.6. Washing: Remove the primary antibody and wash 4 times with washing buffer.

[0243] 1.7. Add enzyme-labeled secondary antibody: After diluting the secondary antibody by a certain factor, add 100 μL to each well, place in a humidified chamber, and incubate at 37°C for 1 h.

[0244] 1.8. Washing: Remove the secondary antibody and wash 4 times with washing solution.

[0245] 1.9. Add colorimetric reagent: Add 100 μL of TMB colorimetric reagent to each well and react in the dark for 15 minutes.

[0246] 1.10. Termination: Add 50 μL of termination solution to each well.

[0247] 1.11. Reading: Place the ELISA reaction plate into the microplate reader and read the OD450 value.

[0248] 3. Result determination:

[0249] A P / N ratio (positive serum / negative serum) greater than or equal to 2.1 is considered positive, a P / N ratio less than 2.1 but greater than 1.5 is considered suspicious, and a P / N ratio less than 1.5 is considered negative.

[0250] 4. Results of the B-brain serum IgG test

[0251] The enzyme-labeled secondary antibody was anti-MOUSE (HRP-goat anti-mouse IgG, 1:2000), and the mouse serum titer was approximately 1:5*10. 4 (Tables 2 and 3) (Antibody titer is defined as the maximum serum dilution factor when the A450 ratio of the experimental group to the negative control group is ≥2.0).

[0252] Table 2

[0253] Table 3

[0254] Example 4. Serum bactericidal test

[0255] 1. Measurement Principle

[0256] The target strain of *Neisseria meningitidis* was lysed in the presence of meningococcal-specific antibodies and complement (antibody-mediated, complement-dependent killing). Serially diluted human serum was incubated with the target strain and complement. The meningococcal-specific antibody binds to the target cell surface via a meningococcal-specific protein or carbohydrate fragment. The C1q subunit of C1 binds to the Fc portion of surface-bound Ig. The binding of C1q to Ig activates the classical complement pathway, ultimately leading to target cell death. The serum bactericidal titer is the serum dilution that produces 50% killing compared to the number of target cells present before serum and complement incubation.

[0257] Due to the low incidence of meningococcal disease, conducting studies sufficient to demonstrate the effectiveness of a meningococcal vaccine is impractical, as this would require an impractical number of participants. To obtain approval, the immunogenicity of 4CMenB and rLP1986 was demonstrated in clinical trials, specifically by the percentage of participants whose serum bactericidal activity (SBA) exceeded a certain threshold after vaccination.

[0258] The complement-dependent, antibody-mediated lysis of meningococcal bacteria was measured using a serum bactericidal assay with human complement (hSBA). hSBA titer was defined as the highest serum dilution that killed ≥50% of the detected bacteria; an hSBA titer ≥1:4 is a recognized indicator of protection against meningococcal disease, and hSBA response rate based on this association has been used as a surrogate indicator of meningococcal vaccine efficacy.

[0259] 1. Gram-positive bacteria inherently resist the direct bactericidal activity of complement due to their thick peptidoglycan layer in their cell walls. Therefore, the pET-26(b) / lipo52223 and pET-26(b) / 52400 plasmids were transformed into Escherichia coli as target strains.

[0260] The pET-26(b) / lipo52223 and pET-26(b) / lipo52400 plasmids were transformed into BL21(DE3)Competent Cells (Fisher Scientific) according to the manufacturer's instructions. The transformed bacteria were screened on LB plates supplemented with 50 μg / mL kanamycin. The recombinant bacteria were named BL21 / Lipo52223 and BL21 / Lipo52400, respectively.

[0261] To induce protein production, colonies of BL21 / Lipo52223 and BL21 / Lipo52400 were inoculated into 5 mL of LB broth containing 50 μg / mL kanamycin and incubated overnight at 37°C. After reaching OD600nm = 0.7–1.0, cells were induced with 0.1% IPTG for 3 hours (Fermentas, USA). The negative control was a culture without IPTG (pre-induction).

[0262] 2. Human complement

[0263] IgG / IgM deficient human complement mixed serum (Pel-Freez Biologicals, AR, USA).

[0264] 3. Before adding SBA (complement), the test serum is heated to 56°C in a water bath for 30 minutes to inactivate any endogenous complement that could interfere with the test reading.

[0265] BL21 / Lipo52223 and BL21 / 52400 bacteria were used at 8x10 4 The bacterial suspension was resuspended at a concentration of [number] CFU / mL in assay buffer (Hanks balanced salt solution with 0.5% BSA and 0.5% heparin). Heat-inactivated serum samples were serially diluted two-fold in assay buffer, ranging from 1:4 to 1:256. An equal volume (10 μL) of bacterial suspension and human complement was added to 20 μL of heat-inactivated test serum and placed in a 96-well U-bottom microtiter plate. The reaction mixture was tapped to mix. After incubating the reaction mixture at 37°C for 60 minutes, 10 μL was removed from each well and spread onto an LB agar plate containing kanamycin. 10 μL of the complement-free reaction mixture was spread onto an LB agar plate containing kanamycin to determine the number of CFU at time zero. Each test serum sample included control wells; Control 1 contained bacteria and active complement. Although validated complement was used in the analysis, this control indicated that a particular batch of complement needed to be retested. Control 2 contained bacteria and inactive complement. This demonstrates the consistency of the test results. This reading is used to calculate the percentage of kill at each dilution. Control 3 contains bacteria, inactive complement, and a 1:4 dilution. This is used to verify that the test serum does not contain components capable of killing bacteria, but rather that bacteria are killed by complement-mediated antibodies.

[0266] The bactericidal titer of each serum sample is the dilution at which complement-mediated antibody killing rate reaches 50%.

[0267] Kill rate = 100% - (count of serum at different dilutions / count of control 2 × 100%).

[0268] 4. Experimental Data

[0269] The mixed serum of 5 immunized mice and 3 control mice was used for SBA (the mixed serum of the immunized mice came from Example 3).

[0270] The results of immunization with serum containing expression cassettes for expressing the fHBP protein B subfamily in Lactococcus lactis and expression cassettes for expressing the fHBP protein B subfamily in mammals are shown in Table 4: the titer can reach 1:128.

[0271] Table 4

[0272] The results of immunization with serum containing expression cassettes for expressing the fHBP protein A subfamily in Lactococcus lactis and expression cassettes for expressing the fHBP protein A subfamily in mammals are shown in Table 5: the titer can reach 1:128.

[0273] Table 5

[0274] The SBA titers of control mouse serum against BL21 / lipo52223 and BL21 / lipo52400 bacteria were not significant (data not shown).

[0275] The technical solutions of the present invention are not limited to the specific embodiments described above. Any technical modifications made in accordance with the technical solutions of the present invention fall within the protection scope of the present invention.

Claims

A fusion peptide comprising: a pan DR-binding epitope (PADRE); a first tetanus toxin epitope TTD632–651; and a second tetanus toxin epitope TTD950–969. The fusion peptide according to claim 1, characterized in that, The PADRE also contains a linker peptide between itself and the first tetanus toxin epitope TTD632–651. Preferably, a linker peptide is further included between the first tetanus toxin epitope TTD632–651 and the second tetanus toxin epitope TTD950–969. Preferably, each of the linker peptides is independently selected from at least one of AAY, KK, GGEAAAK (SEQ ID NO:9), RVRR (SEQ ID NO:10), GGGGS (SEQ ID NO:11), GGPPG (SEQ ID NO:12), and CPPGG (SEQ ID NO:13); further, each of the linker peptides is independently selected from any one of AAY and GGPPG. Preferably, the amino acid sequence of the PADRE is as follows: a1) The amino acid sequence shown in amino acids 292-304 of SEQ ID NO:2; or The amino acid sequences shown in a2) and a1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function. Preferably, the amino acid sequence of the first tetanus toxin epitope TTD632–651 is as follows: b1) The amino acid sequence as shown in amino acids 308-327 of SEQ ID NO:2; or b2) and b1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function of the amino acid sequence. Preferably, the amino acid sequence of the second tetanus toxin epitope TTD950–969 is as follows: c1) The amino acid sequence as shown in amino acids 331-351 of SEQ ID NO:2; or The amino acid sequences shown in c2) and c1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function. Preferably, the amino acid sequence of the fusion peptide is as follows: d1) The amino acid sequence as shown in amino acids 292-351 of SEQ ID NO:2; or d2) The amino acid sequence as shown in amino acids 285-346 of SEQ ID NO:6; or The amino acid sequence shown in d3) has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the amino acid sequence shown in d1) or d2) and has the same function. A fusion protein comprising a target immunogen and the fusion peptide according to any one of claims 1-2. The fusion protein according to claim 3 is characterized in that, The target immunogen is a pathogen antigen or a tumor-associated antigen; more specifically, it is a pathogen antigen. Preferably, the pathogen is a virus, fungus, parasite, or bacteria; more preferably, it is Neisseria meningitidis; and even more preferably, it is Neisseria meningitidis serogroup B. Preferably, the target immunogen is an H factor binding protein; further, it is at least one of the H factor binding protein A subfamily and the H factor binding protein B subfamily; even further, it is either the H factor binding protein A subfamily or the H factor binding protein B subfamily. Preferably, the fusion protein comprises, from the N-terminus to the C-terminus, the target immunogen and the fusion peptide according to any one of claims 1-2; Preferably, a linker peptide is further included between the target immunogen and the fusion peptide; Preferably, the amino acid sequence of the H factor binding protein A subfamily is as follows: e1) The amino acid sequence as shown in amino acids 25-286 of SEQ ID NO:2; or The amino acid sequences shown in e2) and e1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and have the same function. Preferably, the amino acid sequence of the H factor binding protein B subfamily is as follows: f1) The amino acid sequence as shown in amino acids 25-279 of SEQ ID NO:6; or The amino acid sequences shown in f2) and f1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function. The fusion protein according to claim 4 is characterized in that, The N-terminus of the target immunogen also contains an esterified signal peptide; Preferably, the amino acid sequence of the lipolysis signal peptide is as follows: g1) The amino acid sequence shown in positions 1-24 of SEQ ID NO:2; or g2) The amino acid sequence as shown in SEQ ID NO:14; or The amino acid sequences shown in g3) and g1) or g2) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity and have the same function. Preferably, the amino acid sequence of the fusion protein is as follows: j1) The amino acid sequences shown in SEQ ID NO:2 and SEQ ID NO:6; or The amino acid sequences shown in j2) and j1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and have the same function. The fusion protein according to claim 4 is characterized in that, The N-terminus of the target immunogen also contains an IL2 secretion signal peptide; Preferably, the C-terminus of the fusion peptide further comprises a glycosylphosphatidylinositol anchoring protein; Preferably, the glycosylphosphatidylinositol anchoring protein comprises at least one of EFNA1, EFNA2, EFNA3, EFNA5, CD24, CNTN1, FOLI, LSAMP, PPB1, and RTN4R; more preferably, EFNA3; Preferably, the amino acid sequence of the fusion protein is as follows: n1) The amino acid sequence shown in SEQ ID NO:4 or SEQ ID NO:8; or The amino acid sequences shown in n2) and n1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function. Biomaterials relating to the fusion peptide of any one of claims 1-2 or the fusion protein of any one of claims 3-6, wherein the biomaterials are any one of k1)-k14): k1) is a nucleic acid molecule that encodes the fusion peptide of any one of claims 1-2 or the fusion protein of any one of claims 3-6; k2) contains an expression cassette of the nucleic acid molecule described in k1); k3) is a carrier containing the nucleic acid molecule described in k1); k4) is a carrier containing the expression box described in k2); k5) A transgenic cell line containing the nucleic acid molecules described in k1); k6) A transgenic cell line containing the expression cassette described in k2); k7) A transgenic cell line containing the vector described in k3); k8) is a transgenic cell line containing the vector described in k4); k9) is a recombinant bacterium containing the nucleic acid molecules described in k1); k10) contains the recombinant bacteria of the expression cassette described in k2); k11) contains recombinant bacteria containing the vector described in k3); k12) contains recombinant bacteria containing the vector described in k4): k13) contains a cell comprising the fusion peptide of any one of claims 1-2 or the fusion protein of any one of claims 3-6; k14) is a recombinant bacterium comprising the fusion peptide of any one of claims 1-2 or the fusion protein of any one of claims 3-6; None of the cells described in k5)-k8) contain reproductive material; Preferably, the nucleotide sequence of the nucleic acid molecule encoding the fusion peptide according to any one of claims 1-2 is as follows: l1) The nucleotide sequence shown in nucleotides 874-1056 of SEQ ID NO:1; or l2) The nucleotide sequence shown in nucleotides 853-1041 of SEQ ID NO:5; or l3) has at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the nucleotide sequence shown in l1) or l2) and has the same function. Preferably, the nucleotide sequence of the nucleic acid molecule encoding the fusion protein of any one of claims 3-6 is as follows: m1) Nucleotide sequences as shown in SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, and SEQ ID NO:7; or The nucleotide sequences shown in m2) and m1) have at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, and 99% identity and the same function. A recombinant lactic acid bacteria comprising any one of k1)-k4) as described in claim 7. The recombinant lactic acid bacteria according to claim 8 is characterized in that, The recombinant lactic acid bacteria is recombinant lactic acid bacteria A, which includes any one of k1)-k4) in claim 7, wherein k1) is a nucleic acid molecule encoding any one of the fusion proteins in claims 3-6, and the target immunogen is the H factor binding protein A subfamily; Preferably, the recombinant lactic acid bacteria is recombinant lactic acid bacteria B, which comprises any one of k1)-k4) as described in claim 7, wherein k1) is a nucleic acid molecule encoding any one of the fusion proteins described in claims 3-6, and the target immunogen is the H factor binding protein B subfamily; Preferably, the lactic acid bacteria are selected from Lactococcus subsp., Streptococcus subsp., Lactobacillus subsp., Leuconostoc subsp., Pediococcus subsp., Brachybacterium subsp., and Propionibacterium subsp.; Preferably, the lactic acid bacteria comprises Lactococcus lactis; more preferably, it comprises Lactococcus lactis NZ3000; Preferably, the recombinant lactic acid bacteria comprises two expression cassettes: one expression cassette contains a nucleic acid molecule encoding the fusion protein of claim 5, and the other expression cassette contains a nucleic acid molecule encoding the fusion protein of claim 6. The application of the fusion peptide of any one of claims 1-2, the fusion protein of any one of claims 3-6, the biomaterial of claim 7, or the recombinant lactic acid bacteria of any one of claims 8-9 in the preparation of the product; the product having at least one function of (o1)-o3): o1) Prevent pathogen infection; o2) Treatment and / or prevention of diseases caused by pathogen infection; o3) Prevention and treatment of tumors. A product comprising the fusion peptide of any one of claims 1-2, the fusion protein of any one of claims 3-6, the biomaterial of claim 7, or the recombinant lactic acid bacteria of any one of claims 8-9. The application or product according to any one of claims 10-11 is characterized in that: The product comprises the recombinant lactic acid bacteria A and recombinant lactic acid bacteria B as described in claim 9; Preferably, the pathogen is a virus, fungus, parasite, or bacteria; more preferably, it is Neisseria meningitidis; and even more preferably, it is Neisseria meningitidis serogroup B. Preferably, the tumor comprises at least one of a solid tumor and a hematoma; Preferably, the product comprises at least one of a drug, feed, feed additive, and reagent; more preferably, it is a drug. Preferably, the reagent comprises at least one of a disinfectant and a cleaning agent; Preferably, the drug is administered via oral, injection, pulmonary, mucosal, nasal, intraperitoneal, intracranial, intratumoral, sublingual, buccal, transdermal, topical, immersion, or spraying route. Preferably, the drug further comprises pharmaceutically acceptable excipients; Preferably, the drug is a vaccine. A vaccine comprising an adjuvant and the recombinant lactic acid bacterium according to any one of claims 8-9. A method of administering to a subject a therapeutically effective amount of the product according to any one of claims 11-12 or the vaccine according to claim 13; the method being for any one of p1) - p3): p1) preventing a pathogen infection; p2) treating and / or preventing a disease caused by a pathogen infection; p3) preventing and / or treating a tumor.

Images