Mutant β-galactosidase enzymes for the degradation of lactobionic acid
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- CHR HANSEN AS
- Filing Date
- 2025-11-13
- Publication Date
- 2026-05-21
Smart Images

Figure EP2025082974_21052026_PF_FP_ABST
Abstract
Description
[0001] Mutant p-galactosidase enzymes for the degradation of lactobionic acid
[0002] Technical field
[0003] The present invention relates to mutant p-galactosidase enzymes, in particular a mutant LacZ from Escherichia coli, which are useful for the degradation of lactobionic acid (LBA). The mutant p-galactosidase enzyme of the present invention, and / or a genetically engineered microorganism capable of expressing a mutant P-galactosidase enzyme of the present invention, is found to be particularly useful for the purification of human milk oligosaccharides (HMOs) from a fermentation broth obtained by microbial fermentation.
[0004] Sequence listing
[0005] The instant application contains a sequence listing which has been submitted electronically in XML format and which is hereby incorporated by reference in its entirety. Said XML file, created on November 14, 2024, is named P8067EP00 -Sequence Listing and is 36 KB in size.
[0006] Background
[0007] Human milk contains a complex mixture of carbohydrates, fats, proteins, vitamins, minerals and trace elements. Human milk oligosaccharides (HMOs) are the third most abundant component of human milk, after lactose and lipids. HMOs comprise mixtures of complex oligosaccharides that are specific to humans and which are virtually absent in cow milk and many infant formulae.
[0008] HMOs are found to be associated with several health benefits and functions, such as the protection against diarrhea in breast-fed infants. Several studies have reported beneficial effects of HMOs including the prevention of pathogen adhesion, improved development of the intestinal microflora of infants, or antiviral activity.
[0009] Human breast milk contains three major HMO types: fucosylated HMOs, sialylated HMOs, and nonfucosylated neutral HMOs. Sialylated oligosaccharides, such as 6'-sialyllactose or 3'-sialyllactose, are present in large quantities in colostrum. This subgroup of HMOs is thought to have significant health benefits for the neonate due to their roles in providing resistance to pathogens, and in supporting gut maturation, immune function, and cognitive development. Among the sialylated oligosaccharides in human milk, 3'-sialyllactose (3’-SL), 6'-sialyllactose (6’-SL), sialyllacto-ZV-tetraose a (LST-a), sialyllacto-ZV-tetraose b (LST-b), sialyllacto- / V-tetraose c (LST-c) and disialyllacto- / V-tetraose (DSLNT) are the most prevalent members.
[0010] Human milk is also rich in neutral oligosaccharides, such as 2-fucosyllactose (2’-FL), 3-fucosyllactose (3-FL), lacto-N-tetraose (LNT), lacto-N-neotetraose (LNnT) and lacto-N-fucopentaose I (LNFP-I). Neutral HMOs have been shown to have antiinflammatory effects on the intestinal epithelium. Neutral HMOs are also found to be associated with multiple maternal and infant characteristics.
[0011] In view of these benefits of HMOs, there is an increased interest in manufacturing HMOs on an industrial scale. However, some of the known chemical synthetic routes to produce HMOs involve noxious and / or expensive chemicals, thus implying a risk of contaminating the final product and making them less attractive for industrial scale production. In view of these challenges, enzymatic methods and fermentative approaches are increasingly used for producing HMOs. Some of these known biotechnological processes involve the production of HMOs through controlled fermentation of lactose, for example via a strain of non-harmful bacteria or yeast. The shift from chemical synthesis to biotechnological manufacturing has recently made HMOs accessible in larger quantities and at lower prices.
[0012] However, biotechnological manufacturing methods also tend to yield complex mixtures of oligosaccharides, which means that the desired product is often obtained in a mixture with undesired by-products. Therefore, one or more purification steps are typically required in the biotechnological manufacturing of HMOs. Known methods for purifying individual oligosaccharides from such complex mixtures tend to be cumbersome and tedious, thus rendering them unsuitable for food applications.
[0013] Lactobionic acid (LBA) can be an undesired side product in HMO biosynthesis. LBA (4-O-p-galactopyranosyl-D-gluconic acid) is a disaccharide formed from gluconic acid and galactose. Known methods of removing LBA are not satisfactory, as they typically rely on repeated runs of ion-exchange chromatography, which is timeconsuming and expensive and thus not attractive for scale-up. Also, known methods for removing lactobionic acid tend to result in a dissatisfactory purity of the resulting product.
[0014] It is therefore an object of the present invention to provide an improved method for LBA removal in HMO biosynthesis, in particular in the context of microbial fermentation on an industrial scale.
[0015] It is a further object of the present invention to provide a method of LBA removal and HMO purification, which is more efficient, less time consuming and more cost-effective.
[0016] Summary
[0017] The inventors have identified p-galactosidase enzymes with properties not previously described, in particular exhibiting an enhanced hydrolase activity towards lactobionic acid (LBA). In this regard, it was surprisingly found that one or more of the above-mentioned objects can be achieved by providing a mutant P-galactosidase enzyme comprising a variant of the amino acid sequence of SEQ ID NO: 1 with the mutation W811X, preferably W811G. It was unexpectedly found that a substitution of the amino acid tryptophan 811, preferably with glycine 811, in the N-terminal loop of the active site changes the substrate specificity from lactose towards LBA.
[0018] In further aspects, the present invention relates to the use of the mutant P-galactosidase enzyme for degrading LBA in an aqueous solution, and to a process for the purification of HMOs from a fermentation broth. In yet further aspects, the present invention relates to a gene encoding the mutant P-galactosidase enzyme, a genetically engineered vector and a genetically engineered microorganism, comprising the gene, a method for producing the mutant P-galactosidase enzyme using the genetically engineered microorganism, and a method for degrading LBA using the mutant p-galactosidase enzyme of the present invention. Brief description of the drawings
[0019] Figs. 1 and 2 show the degradation of LBA examined for different strains of E. coli in two different bacterial culture media, measured over an incubation period of 20 hours in a microtiter-scale screening approach.
[0020] Fig. 3 shows the degradation of LBA examined for different strains of E. coli in a 3’-SL fermentation broth, as compared to a blank (medium without any of said strains).
[0021] Figs. 4-8 illustrate the stability of the HMOs 2’-FL, 3-FL, 3’-SL, 6’-SL and LNT in the presence of microbial strains comprising the mutant p-galactosidase enzyme of the present invention.
[0022] Figs. 9 and 10 show the degradation of LBA by different strains of E. coli in the absence and in the presence of lactose.
[0023] Brief description of the sequences
[0024] SEQ ID NO: 1 is the amino acid sequence of Escherichia coli LacZ p-galactosidase.
[0025] SEQ ID NO: 2 is the amino acid sequence of a mutant p-galactosidase enzyme according to the present invention.
[0026] SEQ ID NO: 3 is a nucleotide sequence encoding the amino acid sequence of SEQ ID NO: 2.
[0027] SEQ ID NOs: 4 to 8 are nucleotide sequences of primers used for introducing a mutation according to the invention (Primer 1, SEQ ID NO: 4, MAGE-oligo) and for colony-PCR to identify successfully mutated clones (Primers 2-4, SEQ ID NO: 5-7).
[0028] SEQ ID NO: 9 is the amino acid sequence of a motif of a p-galactosidase.
[0029] SEQ ID NOs: 10 to 20 are the amino acid sequences of the members of the amino acid sequence motif as set forth in SEQ ID NO: 9. Detailed description
[0030] The present invention will be described with respect to particular embodiments and with reference to drawings, but the invention is not limited thereto but only by the claims. Furthermore, the terms first, second and the like in the description and in the claims, are used for distinguishing between similar elements and not necessarily for describing a sequence, either temporally, spatially, in ranking or in any other manner. It is to be understood that the terms so used are interchangeable under appropriate circumstances and that the embodiments of the invention described herein are capable of operation in other sequences than described or illustrated herein.
[0031] In the description and drawings provided herein, numerous specific details are set forth. However, it is understood that embodiments of the invention may be practiced without these specific details. In other instances, well-known methods, structures and techniques have not been shown in detail in order not to obscure an understanding of this description.
[0032] The term “comprising”, as used herein, should not be interpreted as being restricted to the means listed thereafter; it does not exclude other elements or steps. It is thus to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more other features, integers, steps or components, or groups thereof. Thus, the scope of the expression “a device comprising means A and B” should not be limited to devices consisting only of components A and B. It means that with respect to the present invention, the only relevant components of the device are A and B.
[0033] Reference throughout this specification to “one embodiment” or “an embodiment” means that a particular feature, structure or characteristic described in connection with the embodiment is included in at least one embodiment of the present invention. Thus, appearances of the phrases “in one embodiment” or “in an embodiment” in various places throughout this specification are not necessarily all referring to the same embodiment, but may. Furthermore, the particular features, structures or characteristics may be combined in any suitable manner, as would be apparent to one of ordinary skill in the art from this disclosure, in one or more embodiments.
[0034] Similarly, it should be appreciated that in the description of exemplary embodiments of the invention, various features of the invention are sometimes grouped together in a single embodiment, figure, or description thereof for the purpose of streamlining the disclosure and aiding in the understanding of one or more of the various inventive aspects. This method of disclosure, however, is not to be interpreted as reflecting an intention that the claimed invention requires more features than are expressly recited in each claim. Rather, as the following claims reflect, inventive aspects lie in less than all features of a single foregoing disclosed embodiment. Thus, the claims following the detailed description are hereby expressly incorporated into this detailed description, with each claim standing on its own as a separate embodiment of this invention.
[0035] Furthermore, while some embodiments described herein include some, but not other features included in other embodiments, combinations of features of different embodiments are meant to be within the scope of the invention, and form different embodiments, as would be understood by those in the art. In particular, one or more features or embodiments described in the context of one aspect of the present invention, may apply likewise to the other aspects of the present invention. For example, in the following claims, any of the claimed embodiments can be used in any combination.
[0036] In a first aspect, the present invention relates to a mutant p-galactosidase enzyme, or a fragment thereof having p-galactosidase activity, the mutant p-galactosidase enzyme comprising an amino acid sequence which is at least 50% identical, preferably at least 70% identical, to the amino acid sequence of SEQ ID NO: 1 and comprising the mutation W811X, preferably W811G, according to the numbering of SEQ ID NO: 1. In one embodiment, the mutation is W811A.
[0037] The present invention also relates to a mutant p-galactosidase enzyme, or a fragment thereof having p-galactosidase activity, the mutant p-galactosidase enzyme comprising a mutation in the motif [WY]X[EACT][RKQ]WXX (SEQ ID NO: 9), wherein said mutation is an amino acid substitution at position 5 of SEQ ID NO: 9, preferably a substitution of the amino acid tryptophan with glycine. In some embodiments, the motif of the mutant p-galactosidase has an amino acid sequence selected from the group consisting of the amino acid sequences set forth in SEQ ID NOs: 10 to 20. In one embodiment, the mutation is an amino acid substitution at position 5 of SEQ ID NO: 9, wherein tryptophan is substituted with alanine.
[0038] Beta-galactosidase (P-D-galactoside galactohydrolase, EC 3.2.1.23) is a glycoside hydrolase enzyme that hydrolyzes the terminal non-reducing p-D-galactose residues in p-D-galactosides, such as lactose, oligosaccharides, glycolipids, and glycoproteins. Beta-galactosidase activity may be determined using an assay in which a diluted enzyme sample is added to a buffer containing the substrate o-nitrophenyl-p-D-galactopyranoside. The p-galactosidase hydrolyzes the colorless substrate to o-nitrophenol during an incubation period of e.g. 30 minutes, and the reaction can then be terminated by addition of sodium carbonate, followed by reading the absorbance at 420nm with a spectrophotometer.
[0039] The mutant p-galactosidase enzyme is preferably a variant of the amino acid sequence of SEQ ID NO:1 with the mutation W811X, preferably W811G, having p-galactosidase activity. The term "variant" means a polypeptide, preferably a polypeptide having hydrolase activity towards LBA, comprising an alteration, i.e., a substitution, insertion, and / or deletion of one or more (several) amino acid residues at one or more (several) positions as compared to their reference sequence. A substitution means a replacement of an amino acid occupying a position with a different amino acid; a deletion means removal of an amino acid occupying a position; and an insertion means adding 1-3 amino acids adjacent to an amino acid occupying a position.
[0040] Particularly preferred in the present invention are mutant p-galactosidase enzymes having hydrolase activity towards lactobionic acid (LBA). The mutant P-galactosidase enzymes of the present invention are thus able to hydrolyze LBA, preferably at enhanced rates as compared to the wild type p-galactosidase enzyme, for example at an enhanced rate as compared to the wild type LacZ p-galactosidase enzyme of E. coli having the amino acid sequence of SEQ ID NO: 1. As used herein, the term “wild type” means the form of an organism, strain, gene, protein, enzyme or characteristic as it most commonly occurs in nature as distinguished from mutant or variant forms.
[0041] In some embodiments, the mutant p-galactosidase enzyme is a variant of the P-galactosidase enzyme consisting of an amino acid sequence as set forth in SEQ ID NO: 1 with the mutation W811G, which has hydrolase activity towards lactobionic acid. In some embodiments, the mutant p-galactosidase enzyme is a variant of the amino acid sequence of SEQ ID NO: 1 with the mutation W811G, preferably having hydrolase activity towards LBA, further comprising one or more amino acid substitutions, and / or one or more amino acid deletions, and / or one or more amino acid insertions or any combination thereof in 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37,38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 positions.
[0042] In a preferred embodiment, the mutant p-galactosidase enzyme having hydrolase activity towards LBA, comprises an amino acid sequence which is at least 70% identical to the amino acid sequence of SEQ ID NO: 1. A preferred enzyme is a mutant p-galactosidase enzyme, preferably having hydrolase activity towards LBA, with the mutation W811G comprising an amino acid sequence which is at least 75%, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99% identical to the amino acid sequence of SEQ ID NO: 1.
[0043] Additional embodiments relate to a mutant p-galactosidase enzyme with the mutation W811G, preferably having hydrolase activity towards LBA, comprising an amino acid sequence which is at least 75%, e.g., at least 76%, at least 77%, at least 78%, at least 79%, at least 80%, at least 81%, at least 82%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, identical to the amino acid sequence of SEQ ID NO: 1.
[0044] For the purposes of the present invention, the degree of identity between two amino acid sequences is determined using the Needleman-Wunsch algorithm (Needleman and Wunsch (1970) J. Mol. Biol. 48: 443-453) as implemented in the Needle program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al. (2000) Trends in Genetics 16: 276-277), preferably version 3.0.0 or later. The optional parameters used are gap open penalty of 10, gap extension penalty of 0.5, and the EBLOSUM62 (EMBOSS version of BLOSUM62) substitution matrix. The output of Needle labelled "longest identity" (obtained using the -no brief option) is used as the percent identity and is calculated as follows:
[0045] (Identical Residues x 100) / (Length of Alignment - Total Number of Gaps in Alignment)
[0046] In a particularly preferred embodiment, the mutant p-galactosidase enzyme, having hydrolase activity towards LBA, is a mutant LacZ from Escherichia coli. The P-galactosidase LacZ (EC 3.2.1.23) is the first product of the lac operon of Escherichia coli and is coded for by the lacZ gene. The amino acid sequence of the LacZ protein is described in Kalnins A, Otto K, Ruther U, Muller-Hill B. Sequence of the lacZ gene of Escherichia coli. EMBO J. 1983;2(4):593-7. doi: 10.1002 / j.1460-2075.1983. tbO1468.x. PMID: 6313347; PMCID: PMC555066.
[0047] According to a preferred embodiment, the mutant p-galactosidase enzyme, having hydrolase activity towards LBA, has the amino acid sequence of SEQ ID NO: 2.
[0048] In a preferred embodiment, the mutant p-galactosidase enzyme catalyzes the degradation of lactobionic acid, typically by hydrolyzing lactobionic acid.
[0049] According to an embodiment, the mutant p-galactosidase enzyme has no hydrolase activity towards 2’-FL. According to another embodiment, the mutant P-galactosidase enzyme has no hydrolase activity towards 3-FL. According to another embodiment, the mutant p-galactosidase enzyme has no hydrolase activity towards 3’-SL. According to another embodiment, the mutant p-galactosidase enzyme has no hydrolase activity towards 6’-SL. According to another embodiment, the mutant p-galactosidase enzyme has no hydrolase activity towards LNT. According to a particularly preferred embodiment, the mutant p-galactosidase enzyme has no hydrolase activity towards each of 2’-FL, 3-FL, 3’-SL, 6’-SL and LNT. These embodiments are advantageous as they make the mutant P-galactosidase enzymes of the present invention particularly useful for the purification of HMOs by removing LBA from mixtures containing one or more of said HMOs. It is particularly preferred that the mutant p-galactosidase enzymes of the present invention have an enhanced hydrolase activity towards LBA. The term "enhanced hydrolase activity towards LBA" as used herein refers to a relatively higher specific activity of a p-galactosidase enzyme towards LBA in comparison to a reference sequence, i.e., as compared to a p-galactosidase enzyme having the amino acid sequence of SEQ ID NO:1. The hydrolase activity towards LBA can, for example, be determined by incubating an aqueous solution containing LBA with a genetically engineered microorganism, capable of expressing a mutant p-galactosidase enzyme of the present invention, and determining the concentration of LBA over a defined time period, relative to a microorganism free control. The hydrolase activity towards LBA could also be determined by adding the mutant p-galctosidase to an aqueous solution containing LBA, and determining the concentration of LBA over a defined time period, relative to an enzyme-free control.
[0050] In one aspect, the present invention relates to a mutant p-galactosidase enzyme comprising a variant of the amino acid sequence of SEQ ID NO: 1 with the mutation W811X, preferably W811G, according to the numbering of SEQ ID NO: 1 , preferably comprising an amino acid sequence which is at least 50%, preferably at least 70%, identical to the amino acid sequence of SEQ ID NO: 1.
[0051] In another aspect, the present invention relates to a mutant p-galactosidase enzyme as described above for the degradation of lactobionic acid. In another aspect, the present invention relates to the use of a mutant p-galactosidase enzyme according to the present invention for the degradation of lactobionic acid in an aqueous solution, preferably in a fermentation broth obtained by microbial fermentation. In a preferred embodiment, said degradation of lactobionic acid takes place in the presence of lactose.
[0052] In a related aspect, the present invention relates to a method of degradation of lactobionic acid in an aqueous solution containing lactobionic acid, said method comprising bringing the aqueous solution into contact with a microorganism, preferably a genetically engineered microorganism, capable of expressing a mutant P-galactosidase enzyme as described above, or bringing the aqueous solution into contact with a mutant p-galactosidase enzyme as described above. In another aspect, the present invention relates to a process for the purification of one or more human milk oligosaccharides (HMOs) from a fermentation broth obtained by microbial fermentation, by bringing the fermentation broth into contact with a microorganism, preferably a genetically engineered microorganism, capable of expressing a p-galactosidase enzyme suitable for the degradation of lactobionic acid, preferably a mutant p-galactosidase enzyme as described above, or by adding a p-galactosidase enzyme suitable for the degradation of lactobionic acid to the fermentation broth, preferably a mutant p-galactosidase enzyme as described above. The microbial fermentation, from which the fermentation broth is obtained, preferably comprises the microbial production of at least one HMO.
[0053] The HMO may be selected from the group consisting of 2'-fucosyllactose, 3-fucosyllactose, 2',3-difucosyllactose, lacto-N-triose II, lacto-N-tetraose, lacto-N-neotetraose, lacto- N-fucopentaose I, lacto-N-neofucopentaose I, lacto-N-fucopentaose II, lacto-N-fucopentaose III, lacto-N-fucopentaose V, lacto-N-neofucopentaose V, lacto-N-difucohexaose I, lacto-N-difucosylhexaose II, para-lacto-N-fucosylhexaose, fucosyl-lacto-N-sialylpentaose b, fucosyl-lacto-N-sialyl-pentaose c, disialyl-lacto-N-fucopentaose, 3-fucosyl-3'-sialyllactose, 3-fucosyl-6'-sialyllactose, lacto-N-neodifucohexaose I, 3'-sialyllactose, 6'-sialyllactose, sialyllacto-N-tetraoses LST-a, LST-b, LST-c, and disialyllacto-N-tetraose. The HMO is preferably 3'-sialyllactose or 6'-sialyllactose, most preferably 6'-sialyllactose.
[0054] As used herein, the term "fermentation broth" refers to the broth obtained after completion of fermentation and / or bioconversion by a microorganism in a culture medium which typically comprises a nitrogen source, an organic substrate, and optionally a co-substrate. It is particularly preferred that the fermentation broth used in the process for the purification of one or more HMOs obtained by microbial fermentation contains LBA. Thus, typically the fermentation broth contains the one or more HMOs as well as LBA. In a preferred embodiment, the fermentation broth contains at least 0.2 g / L of LBA, preferably at least 0.5 g / L of LBA or at least 0.8 g / L of LBA, prior to bringing the fermentation broth into contact with the microorganism, or prior to adding the beta-galactosidase enzyme. In a preferred embodiment, the fermentation broth also contains lactose. In a preferred embodiment of the process for the purification of one or more HMOs, the genetically engineered microorganism is grown in a culture medium. In one embodiment of the process for the purification of one or more HMOs, the mutant p-galactosidase enzyme can be added as a crude enzyme or as a purified enzyme.
[0055] In some embodiments of the process, the fermentation broth contains less than 0.2 g / L of LBA, preferably less than 0.1 g / L of LBA, most preferably less than 0.05 g / L LBA, after bringing the fermentation broth into contact with the microorganism, or after adding the p-galactosidase enzyme.
[0056] The process for the purification of one or more HMOs from a fermentation broth may preferably be the second step of a two-step fermentation process. Thus, the HMO may be produced in a two-step fed-batch fermentation process, wherein the first step includes the microbial production of at least one HMO and the second step includes the process for the purification of said at least one HMO.
[0057] Preferably, the two-step fermentation process involves two different bacterial strains, preferably genetically modified strains, preferably derived from a host strain of Escherichia coli. These two different strains may be termed the “production strain” and the “degradation strain”. While the production strain is preferably genetically modified to effectively synthesize the HMO, such as 6'-SL, the degradation strain comprises a mutant p-galactosidase enzyme of the present invention to degrade LBA in order to purify the HMO. In some embodiments, the production strain comprises a mutant p-galactosidase enzyme of the present invention to degrade LBA in order to purify the HMO.
[0058] The production strain can be a genetically engineered strain that possesses a metabolic pathway or enhanced metabolic pathway to provide the nucleotide-activated sugar(s) as donor substrate(s) for one or more glycosyltransferase(es) for transferring the sugar moiety to an acceptor molecule (e.g. lactose).
[0059] At the end of the fermentation process, the bacterial biomass can be removed from the final product, for example by centrifugation and / or ultrafiltration. The isolation, purification and concentration of the HMO may also involve several filtrations, ion removal and / or de-colorization steps. In a preferred embodiment of the process for the purification of one or more HMOs, the purity of the HMO in the fermentation broth is <70%, <60%, <50%, <40%, <30%, <20%, <10% or <5% (wherein 0.1% equals 1 g / L). It is also preferred that a purified solution obtained by said process contains the HMO at a purity of >80%, preferably of >90%.
[0060] The process for the purification of one or more HMOs from the fermentation broth may additionally comprise one or more of the following steps: a separation of biomass from the fermentation broth, a cationic ion exchanger treatment for the removal of positively charged material, an anionic ion exchanger treatment for the removal of negatively charged material, a nanofiltration step, an electrodialysis step. The purified HMO may be spray-dried to obtain a powder form.
[0061] In one aspect, the present invention also relates to one or more HMOs obtainable by the process of the present invention.
[0062] In a further aspect, the present invention relates to a process for producing an HMO, the process comprising the steps of i) cultivating a first microorganism suitable for the production of the HMO under conditions and in a medium permissive for the production of said HMO, whereby at least said HMO is produced and lactobionic acid (LBA) is generated; ii) using a mutant p-galactosidase enzyme as described above in the medium the host microorganism is cultivated in, to degrade LBA, wherein the mutant p-galactosidase enzyme, or a second microorganism capable of expressing a mutant p-galactosidase enzyme as described above, is added to the medium; and iii) recovering the HMO. The process can be a batch or a continuous process. In a preferred embodiment, the medium also contains lactose.
[0063] The HMO can be selected from 2'-fucosyllactose, 3-fucosyllactose, 2'3-difucosyllactose, 3'-sialyllactose, 6'-sialyllactose, 3-fucosyl-3'-sialyllactose, lacto-N-tetraose, lacto-N-neotetraose, lacto-N-fucopentaose I, lacto-N-fucopentaose II, lacto-N-fucopentaose III, lacto-N-fucopentaose V, lacto-N-difucosylhexaose I, lacto-N-difucosylhexaose II, lacto-N-sialylpentaose LSTa, LSTb, LSTc, or derivatives thereof.
[0064] In some embodiments, the HMO can be selected from lacto-N-triose II, lacto-N-neofucopentaose I, lacto-N-neofucopentaose V, 6'-galactosyllactose, 3'-galactosyl-lactose, lacto-N-hexaose, lacto-N-neohexaose, para-lacto-N-hexaose, para-lacto-N-neohexaose, difucosyl-lacto-N-neohexaose, fucosyl-lacto-N-sialylpentaose a, fucoyl- lacto-N-sialylpentaose b, fucosyl-lacto-N-sialylpentaose c, disialyl-lacto-N-tetraose, disialyl-lacto-N-fucopentaose, 3-fucosyl-6'-siayllactose, lacto-N-neodifucohexaose I, or derivatives thereof.
[0065] In another aspect, the present invention relates to a nucleic acid molecule comprising a nucleotide sequence encoding the mutant p-galactosidase of the present invention. In a particularly preferred embodiment, the nucleic acid molecule is a mutated lacZ gene of Escherichia coli. The sequence of the lacZ gene is described in Kalnins A, Otto K, Ruther II, Muller-Hill B. Sequence of the lacZ gene of Escherichia coli. EMBO J. 1983;2(4):593-7. doi: 10.1002 / j.1460-2075.1983. tbO1468.x. PMID: 6313347; PMCID: PMC555066.
[0066] In another aspect, the present invention relates to a vector or to a genetically engineered cell carrying the above-described gene. The genetically engineered cell can be a prokaryotic cell or a eukaryotic cell. Preferably, the genetically engineered cell is a microbial cell. Useful microbial cells may include yeast cells, bacterial cells, archaebacterial cells, algae cells, and fungal cells. Said microbial cells may be selected from Escherichia, such as E. coli, Bacillus, such as B. subtilis, Corynebacterium, such as C. glutamicum, and Saccharomyces, such as S. cerevisiae.
[0067] The term "genetically engineered" as used herein refers to the modification of the cell's genetic make-up using molecular biological methods. The modification of the cell's genetic make-up may include the transfer of genes within and / or across species boundaries, inserting, deleting, replacing and / or modifying nucleotides, triplets, genes, open reading frames, promoters, enhancers, terminators and other nucleotide sequences mediating and / or controlling gene expression. The modification of the cell's genetic make-up aims to generate a genetically modified organism possessing particular, desired properties. Genetically engineered cells can contain one or more genes that are not present in the native (not genetically engineered) form of the cell. Techniques for introducing exogenous nucleic acid molecules and / or inserting exogenous nucleic acid molecules (recombinant, heterologous) into a cell's hereditary information for inserting, deleting or altering the nucleotide sequence of a cell's genetic information are known to the skilled person. Genetically engineered cells can contain one or more genes that are present in the native form of the cell, wherein said genes are modified and reintroduced into the cell by artificial means. The term "genetically engineered" also encompasses cells that contain a nucleic acid molecule being endogenous to the cell, and that has been modified without removing the nucleic acid molecule from the cell. Such modifications include those obtained by gene replacement, site-specific mutations, and related techniques.
[0068] In a preferred embodiment, the genetically engineered cell has been transformed to contain and express a nucleic acid molecule which comprises a nucleotide sequence which encodes a mutant p-galactosidase as described above. In one embodiment, the nucleotide sequence corresponds to the nucleotide sequence of SEQ ID NO: 3. In some embodiments, the nucleotide sequence is complementary to any one of the above-identified nucleotide sequences, or is a fragment of any one of the above-identified nucleotide sequences.
[0069] In another aspect, the present invention relates to a genetically engineered microorganism having the above-described gene and or being capable of expressing a mutant p-galactosidase enzyme according to the present invention. It is particularly preferred that the genetically engineered microorganism is capable of growing on LBA, preferably as sole carbon source. In a preferred embodiment, said microorganism is Escherichia coli.
[0070] In some embodiments, the mutant p-galactosidase is constitutively expressed. In other embodiments, the mutant p-galactosidase is inducibly expressed, preferably in the presence of lactose.
[0071] In further aspects, the present invention relates to a nucleotide sequence which encodes a polypeptide having an amino acid sequence which is at least 50%, preferably at least 70%, preferably at least 75%, such as at least 80%, at least 85%, at least 90%, at least 95%, at least 98% or at least 99%, identical to the amino acid sequence of SEQ ID NO: 1 and which comprises the mutation W811G according to the numbering of SEQ ID NO: 1, and to a genetically engineered microbial cell containing a nucleic acid molecule comprising said nucleotide sequence.
[0072] In another aspect, the present invention relates to a method of producing the mutant P-galactosidase enzyme of the present invention using the genetically engineered cell of the present invention, the method comprising the steps of performing a fermentation culture of the genetically engineered cell, and performing centrifuging to obtain a supernatant from the fermentation culture, wherein the supernatant comprises a crude enzyme solution comprising the mutant p-galactosidase enzyme.
[0073] In another aspect, the present invention relates to a method for producing the mutant p-galactosidase enzyme of the present invention, comprising the steps of expressing the mutant p-galactosidase by culturing the genetically engineered microorganism of the present invention, and recovering the expressed mutant P-galactosidase.
[0074] In yet another aspect, the present invention relates to a use of the mutant P-galactosidase enzyme of the present invention in the manufacture of a nutritional composition, and to a nutritional composition obtained by a method involving the use of the mutant p-galactosidase enzyme of the present invention or of the genetically engineered microbial cell of the present invention. The nutritional composition can be selected from the group consisting of medicinal, pharmaceutical, formulations, infant formula and dietary supplements.
[0075] The invention will now be described by a detailed description of several examples. It is clear that other examples of the invention can be configured according to the knowledge of persons skilled in the art without departing from the true spirit or technical teaching of the invention, the invention being limited only by the terms of the appended claims.
[0076] Example 1: Introducing the mutation W811G into E. coli LacZ through singlestranded oligonucleotide mediated genome editing - MAGE
[0077] A DNA oligonucleotide comprising 80-90 nucleotides which carries a mismatch mutation to the target gene can be electroporated into A-red competent cells for targeted genome editing. In this case, 5-20 % of the obtained colonies carry the mutation, which is screened by nested PGR, i.e. , one screening primer complement at its 3'-end either to the wild-type or the mutant DNA sequence and a reverse primer. The following primer sequences were used:
[0078] lacZ_W811G_MAGE (Primer 1, SEQ ID NO: 4):
[0079] G*A*C*A*TTGGCGTAAGTGAAGCGACCCGCATTGACCCTAACGCCTGGGTCGA ACGCGGGAAGGCGGCGGGCCATTACCAGGC
[0080] lacZ_W811G_mutF (Primer 2, SEQ ID NO: 5): GCCTGGGTCGAACGCG
[0081] lacZ_wtF (Primer 3, SEQ ID NO: 6): GCCTGGGTCGAACGCT
[0082] lacZ_SR550 (Primer 4, SEQ ID NO: 7): CGTCGATATTCAGCCATGTGCCTTC
[0083] lacZ_SF (Primer 5, SEQ ID NO: 8): CGACCGCATGGTCAGAAGCC
[0084] The asterisk (*) above indicates phosphorothioate oligonucleotides (PTO's). The nucleotide that is responsible for the mutation is indicated in bold and underlined.
[0085] Primer 1 was used for the mutation (so-called MAGE-oligo).
[0086] Primers 2 to 4 were used for the colony-PCR to identify successfully mutated clones.
[0087] Primers 4 and 5 were used to amplify the genomic region of colony-PCR positive clones (mutant clones) and the resulting PCR product was sequenced with Primer 5 (Sanger sequencing method) to confirm the mutation.
[0088] Example 2: Degradation of LBA in different culture media
[0089] Degradation of LBA was monitored for different strains of E. coli in bacterial culture medium, including one E. coli strain with the LacZ p-galactosidase with the mutation W811G according to the numbering of SEQ ID NO: 1 (labelled as strain #5). Strains #1 - #4 have the native lacZ gene and lac promoter. Strain #5 exhibits constitutive expression of the mutated lacZ. A volume of 50 pL of a preculture (incubated for 24 h) with an optical density (OD) of between 4.0 and 5.0 was transferred to the main culture. Figs. 1 and 2 show the results of LBA degradation over an incubation period of 20 hours in a microtiter-scale screening approach. The culture medium used in the experiments leading to the results shown in Fig. 1 contains LBA as sole carbon source. The culture medium used in the experiments leading to the results shown in Fig. 2 contains a mixture of different carbon sources that are side products in SL-fermentations including 0.25% w / v (about 11 mM) N-acetylglucosamine (GIcNAc), 1% (w / v) (about 32 mM) N-acetylneuraminic acid (Neu5Ac), 10 mM LBA and 10 mM lactose.
[0090] The values depicted in Figs. 1 and 2 represent the mean of three replicates (n = 3) per strain and the error bars correspond to the standard deviation. Strain #5 is the strain with the LacZ p-galactosidase with the mutation W811G according to the numbering of SEQ ID NO: 1. Strains #1 - #4 are different ancestors of strain #5 which do not comprise this mutation of the LacZ p-galactosidase. Strain #4 is isogenic to strain #5, apart from the mutant p-galactosidase. Strain #4 is the direct ancestor of #5.
[0091] The results shown in Figs. 1 and 2 demonstrate the efficient degradation of LBA by strain #5 having a mutant p-galactosidase of the present invention, as compared to the control strains #1 - #4.
[0092] Example 3: Degradation of LBA in 3’-SL fermentation broth
[0093] This experiment was conducted to verify the efficient degradation of LBA by strain #5, i.e., the strain comprising the LacZ p-galactosidase with the mutation W811G according to the numbering of SEQ ID NO: 1, under fermentation conditions. Strain #5 and the different ancestor strains #1 - #4 were incubated in 3’-SL fermentation broth obtained by microbial fermentation in the production of 3’-SL.
[0094] As seen in Fig. 3, strain #5 is the only strain degrading LBA within the incubation time, as compared to the blank, which contained no microbial strain. The control strains #1 - #4 had substantially the same LBA concentration as compared to the blank after 20 hours of incubation. The values depicted in Fig. 3 represent the mean of four replicates (n = 4) per strain and the error bars correspond to the standard deviation. The results shown in Fig. 3 demonstrate the efficient degradation of LBA by strain #5 having a mutant p-galactosidase of the present invention, in a 3’-SL fermentation broth containing LBA.
[0095] Example 4: Growth with LBA as sole carbon source
[0096] To further prove the capability of strain #5, this strain was successfully grown with constitutively expressed LacZ W811G on plates with LBA as sole carbon source (minimal medium plates with 10 mM LBA as sole carbon source, using Gerhardt salts for cultivation of bacteria).
[0097] In contrast to strains without constitutively expressed LacZ W811G this strain #5 was found to be able to grow on LBA. Said strain was shown to exhibit much faster growth than control strains constitutively expressing wild type LacZ.
[0098] Example 5: Lack of degradation of HMOs
[0099] In order to verify that bacterial strains comprising the LacZ p-galactosidase with the mutation W811G according to the numbering of SEQ ID NO: 1 only degrade the LBA and lactose, but not HMOs such as 2'FL and 3-FL, the specificity of two different E. coli strains equipped with said mutant p-galactosidase enzyme (strains #5 and #6) was tested in culture broth with different included HMO products. Strain #5 comprises a native lac operon with the LacZ W811G mutation. In strain #6, the native lac operon was deleted and lacZ under the control of the tet-promoter was integrated.
[0100] The different media used in these experiments contain the indicated HMO. The values in Figs. 4-8 depict the mean of four replicates (n = 4) per strain, and the error bars correspond to the standard deviation.
[0101] As shown in Figs. 4-8, none of the HMOs 2’-FL, 3-FL, 3’-SL, 6’-SL and LNT were found to be significantly degraded by the strains comprising the LacZ P-galactosidase with the mutation W811G. Thus, it is seen that these strains are useful in various HMO production processes. Example 6: Effective LBA degradation due to mutant beta-galactosidase enzyme in various E. coli strains
[0102] In order to further demonstrate the effectiveness of LBA degradation imparted by the LacZ p-galactosidase with the mutation W811G, the single nucleotide polymorphism leading to this mutation was introduced in the lacZ gene of E. coli strains #1 and #4 as these strains were not able to degrade LBA previously. The mutated strains originating from strain #1 and #4 are labelled as strains #8 and #9, respectively.
[0103] In the experiments leading to the results shown in Fig. 9, the bacterial culture medium did not contain lactose. However, in a second experiment, the results of which are shown in Fig. 10, lactose was added to the bacterial culture medium as an inducer. Values depict the mean of three replicates (n = 3) per strain and the error bars correspond to the standard deviation.
[0104] Indeed, after modifying the lacZ gene of strains #1 and #4, the resulting strains #8 and #9 were found to be able to degrade LBA and to use LBA as a carbon source for growth, as illustrated in Fig. 10. However, strains #8 and #9 appear to require lactose as an inducer of the lac operon, see the lack of LBA degradation by strains #8 and #9 in Fig. 9. By contrast, strain #5 exhibits constitutive expression of lacZ and thus does not require an inducer for lacZ gene expression. The blank in Fig. 10 is 1xGSG medium including Neu5Ac (1 % w / v), GIcNAc (0,25 % w / v), lactose (10 mM) and LBA (10 mM), wherein the blank is not inoculated with any strains.
Claims
CLAIMS1. A mutant p-galactosidase enzyme, or a fragment thereof having p- galactosidase activity, wherein the mutant p-galactosidase enzyme comprisesa) an amino acid sequence which is at least 50% identical to the amino acid sequence of SEQ ID NO: 1 and which comprises the mutation W811X, and / orb) a mutation in the motif [WY]X[EACT][RKQ]WXX (SEQ ID NO: 8), wherein said mutation is an amino acid substitution at position 5 of SEQ ID NO: 8.
2. The mutant p-galactosidase enzyme, or a fragment thereof having P-galactosidase activity, according to claim 1, wherein the mutation in a) is W811G and / or wherein the amino acid substitution in b) is a substitution with glycine at position 5 of SEQ ID NO:8.
3. The mutant p-galactosidase enzyme, or a fragment thereof having P-galactosidase activity, according to claims 1 or 2, wherein the mutant P-galactosidase enzyme is a mutant LacZ from Escherichia coli.
4. The mutant p-galactosidase enzyme, or a fragment thereof having P-galactosidase activity, according to any of the preceding claims, wherein the mutant p-galactosidase enzyme has the amino acid sequence of SEQ ID NO: 2.
5. The mutant p-galactosidase enzyme, or a fragment thereof having P-galactosidase activity, according to any of the preceding claims, wherein the enzyme hydrolyzes lactobionic acid.
6. The mutant p-galactosidase enzyme, or a fragment thereof having P-galactosidase activity, according to any of the preceding claims, wherein the mutant p-galactosidase enzyme has a higher specificity towards lactobionic acid as compared to LacZ from Escherichia coli.
7. Use of a mutant p-galactosidase enzyme, or a fragment thereof having P-galactosidase activity, according to any of claims 1 to 6 for the degradation of lactobionic acid in an aqueous solution.
8. A process for the purification of one or more human milk oligosaccharides (HMOs) from a fermentation broth containing the one or more HMOs and lactobionic acid, said fermentation broth being obtained by microbial fermentation, wherein the process comprises bringing the fermentation broth into contact with a microorganism expressing a mutant p-galactosidase enzyme, or a fragment thereof having p-galactosidase activity, according to any of claims 1-6, or by adding a mutant p-galactosidase enzyme, or a fragment thereof having p-galactosidase activity, according to any of claims 1 to 6 to the fermentation broth.
9. The process according to claim 8, wherein the fermentation broth contains said one or more HMOs, lactobionic acid and optionally lactose.
10. A nucleic acid molecule comprising a nucleotide sequence encoding the mutant p-galactosidase, or encoding a fragment of the mutant p-galactosidase having p-galactosidase activity, of any of claims 1 to 6.
11. A vector or a genetically engineered cell carrying the nucleic acid molecule of claim 10.
12. A genetically engineered microorganism having the nucleic acid molecule of claim 10 and / or being capable of expressing a mutant p-galactosidase enzyme, or a fragment thereof having p-galactosidase activity, according to any of claims 1 to 6.
13. A genetically engineered microorganism according to claim 12, wherein said microorganism is Escherichia coli.
14. A method for producing the mutant p-galactosidase enzyme, or a fragment thereof having p-galactosidase activity, of any of claims 1 to 6, using the genetically engineered microorganism of claims 12 or 13, the method comprising the steps of performing a fermentation culture of the genetically engineered microorganism, and performing centrifugation to obtain a supernatant from the fermentation culture, wherein the supernatant comprises a crude enzyme solution comprising the mutant p-galactosidase enzyme, or the fragment thereof having p-galactosidase activity.
15. A method for producing the mutant p-galactosidase enzyme, or a fragment thereof having p-galactosidase activity, of any of claims 1 to 6, comprising the steps of: expressing the mutant p-galactosidase by culturing the genetically engineered microorganism of claims 12 or 13, and recovering the expressed mutant p-galactosidase, or the fragment thereof having p-galactosidase activity.