Meso-2,3-dimercaptosuccinic acid (DMSA)-conjugated nucleotide-based agents having improved delivery to kidney tissue
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SHEBA IMPACT LTD
- Filing Date
- 2025-11-16
- Publication Date
- 2026-05-21
Smart Images

Figure IL2025051020_21052026_PF_FP_ABST
Abstract
Description
[0001] Meso-2,3-dimercaptosuccinic acid (DMSA)-conjugated nucleotide-based agents having improved delivery to kidney tissue FIELD OF THE INVENTION
[0002] The present invention is generally directed to agents for delivery to the kidney. More specifically, the invention relates to DMSA-conjugated nucleotide-based agents for improved delivery to kidney tissue and especially to distal tubule kidney regions.
[0003] BACKGROUND OF THE INVENTION
[0004] Chronic kidney disease (CKD) is a public health challenge that affects more than 800 million people worldwide and has no specific curable treatments. CKD may be caused by a variety of disease processes. Recently, multiple worldwide reports indicated that a diverse array of distinct monogenic disorders may explain approximately 30 to 50% of CKD cases among children, and approximately 10 to 20% of adult cases.
[0005] RNA-based technologies, including chemically modified antisense oligonucleotides and small interfering RNAs, modulate the abundance, processing, and translational output of cellular RNA without the need for transgene delivery into the kidney. Such RNA-based agents can change the expression of any protein, even proteins that are not amenable to traditional approaches involving small molecules, and can be used for previously “undruggable” targets. Specifically, antisense oligonucleotides (ASO) are an emerging tool for gene expression modulation. These small (16-30 nucleotides), synthetic molecules are significantly affected by the vast variety of chemical modifications employed to them, changing their stability, their ability to enter cells, and even their mechanism of action. ASOs interact with their target RNA molecule via complementary Watson-Crick base pairs, thus creating duplexes which mediate their downstream effect. They can be divided to two main categories based on their activity: steric blockers and gapmers, which are RNase-H recruiting ASOs, leading to the target's degradation.
[0006] The field of oligonucleotides-based therapy is rapidly evolving, resulting in a significantly increased number of clinical trials and FDA-approved drugs. However, the delivery of oligonucleotides to their target tissue remains a significant challenge; to date, most of the approved therapies focus on locally-provided treatment (e.g. intrathecal inj ection of ASO to target the central nervous system, intravitreal to target the eye), or systematic administration in order to target the liver.
[0007] With respect to the kidneys, it was previously shown in various bio-distribution experiments, that a "naked" ASO (without additional conjugates) can reach the kidney and accumulate in its cells, mostly in the proximal tubule. These are encouraging results, supporting the feasibility of treating renal-diseases with oligonucleotides based therapies. Moreover, previous studies attributed nephrotoxicity effects to ASO treatments, due to their non-specific accumulation in the kidneys, and suggested to avoid such therapies in patients with renal disease.
[0008] Nonetheless, an analysis conducted based on data collected from different clinical trials of oligonucleotides-based therapy suggests that there are no clinically significant effects on the kidney function, and no nephrotoxicity side-effects. This meta-analysis focused on 2'-O-methoxyethyl (MOE) antisense oligonucleotides, and included patients with no renal symptoms as well as patients with renal dysfunction. ASOs with a phosphorothioate (PS) backbone and 2M0E modifications are taken up mainly by the liver and kidney, when administered systemically. In a healthy kidney, most of the ASOs accumulate in the proximal tubule epithelial cells, limiting the relevant and applicable renal indications. In addition, a significant portion of the ASO is cleared away in the urine. In summary, drug delivery to the specific kidney cells of interest remains challenging.
[0009] Accordingly, there is a need for developing improved methods of delivery of ASO to kidney tissue, especially to distal kidney areas, and improving kidney retention of ASO in the distal kidney areas.
[0010] SUMMARY OF INVENTION
[0011] The following embodiments are described and illustrated in conjunction with compositions and methods which are meant to be exemplary and illustrative, not limiting in scope. In various embodiments, one or more of the above-described problems have been reduced or eliminated, while other embodiments are directed to other advantages or improvements.
[0012] According to some embodiments, there is provided a pharmaceutical composition including a nucleic acid molecule conjugated to a metal chelating agent.
[0013] According to some embodiments, there is provided a pharmaceutical composition including a nucleic acid molecule conjugated to a metal chelating agent for use in a method of treatment and / or diagnosis of a kidney disease.
[0014] In some embodiments, the metal chelating agent is selected from meso-2,3-dimercaptosuccinic acid (DMSA), mercaptoacetyltriglycine (MAG3), and diethylenetriaminepentaacetate (DTP A).
[0015] In some embodiments, the kidney disease is a chronic kidney disease (CKD). In some embodiments, the kidney disease is of a genetic origin. In some embodiments, the kidney disease is associated with diabetes insipidus, hypertension, and / or syndrome of inappropriate ADH secretion (SIADH). In some embodiments, the kidney disease is a genetic kidney disease selected from Gitelman syndrome, nephrogenic diabetes insipidus, X-linked Alport syndrome (XLAS), autosomal dominant tubulointerstitial kidney disease (ADTKD), autosomal dominant tubulointerstitial kidney disease (ADTKD-MUC1), and autosomal dominant tubulointerstitial kidney disease-UMOD (ADTKD-UMOD).
[0016] In some embodiments, the kidney disease involves at least one kidney region distal to the kidney proximal convoluted tubule. In some embodiments, the at least one kidney region distal to the kidney proximal convoluted tubule is selected from kidney medulla, loop of Henle, distal convoluted tubule, collecting duct, and combinations thereof.
[0017] In some embodiments, the nucleic acid molecule is capable of affecting expression of a target gene expressed in kidneys.
[0018] In some embodiments, the target gene is expressed in a kidney region selected from kidney medulla, loop of Henle, distal convoluted tubule, collecting duct, and combinations thereof. In some embodiments, the target gene is associated with kidney disease or dysfunction. In some embodiments, the target gene is selected from COL4A5, SLC12A3, AQP2, MUC1, and UMOD.
[0019] In some embodiments, the nucleic acid molecule is an antisense nucleic acid molecule (ASO).
[0020] In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 1-47 and 49-64.
[0021] In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 71-117 and 119-134.
[0022] In some embodiments, the nucleic acid molecule is a modified ASO selected from SEQ ID Nos: 141-187 and 189-204
[0023] In some embodiments, the nucleic acid molecule is a modified ASO selected from SEQ ID Nos: 148-151, 168-170, 177, 185, 195, 198, and 200
[0024] In some embodiments, the metal chelating agent is conjugated to the nucleic acid molecule via a linker.
[0025] In some embodiments, the linker is selected from succinimidyl 4-(N-maleimidomethyl)cyclohexane-l -carboxylate (SMCC), pegylated SMCC crosslinkers such as SM(PEG)4 or SM(PEG)12, maleimide-PEG-NHS, thiol -reactive functional groups such as a pyridyl-disulfide spacer (i.e., pyridyldithio or 2-pyridyl disulfide linker), and a disulfide spacer.
[0026] In some embodiments, the metal chelating agent is conjugated to the 5’ end of the nucleic acid molecule.
[0027] In some embodiments, , there is provided a method of treating or diagnosing a kidney disease in a subject, the method including administering to the subject an effective amount of a pharmaceutical composition including a nucleic acid molecule conjugated to a metal chelating agent.
[0028] In some embodiments, the metal chelating agent is selected from meso-2,3-dimercaptosuccinic acid (DMSA), mercaptoacetyltriglycine (MAG3), and diethylenetriaminepentaacetate (DTP A).
[0029] In some embodiments, the kidney disease is a chronic kidney disease (CKD). In some embodiments, the kidney disease is of a genetic origin. In some embodiments, the kidney disease is associated with diabetes insipidus, hypertension, and / or syndrome of inappropriate ADH secretion (SIADH). In some embodiments, the kidney disease is a genetic kidney disease selected from Gitelman syndrome, nephrogenic diabetes insipidus, X-linked Alport syndrome (XLAS), autosomal dominant tubulointerstitial kidney disease (ADTKD), autosomal dominant tubulointerstitial kidney disease (ADTKD-MUC1), and autosomal dominant tubulointerstitial kidney disease-UMOD (ADTKD-UMOD).
[0030] In some embodiments, the kidney disease involves at least one kidney region distal to the kidney proximal convoluted tubule. In some embodiments, the at least one kidney region distal to the kidney proximal convoluted tubule is selected from the kidney medulla, the loop of Henle, the distal convoluted tubule, the collecting duct, and combinations thereof.
[0031] In some embodiments, the nucleic acid molecule is capable of affecting expression of a target gene expressed in kidneys.
[0032] In some embodiments, the target gene is expressed in a kidney region selected from kidney medulla, loop of Henle, distal convoluted tubule, collecting duct, and combinations thereof. In some embodiments, the target gene is associated with kidney disease or dysfunction. In some embodiments, the target gene is selected from COL4A5, SLC12A3, AQP2, MUC1, and UMOD.
[0033] In some embodiments, the nucleic acid molecule is an antisense nucleic acid molecule (ASO).
[0034] In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 1-47 and 49-64.
[0035] In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 71-117 and 119-134.
[0036] In some embodiments, the nucleic acid molecule is a modified ASO selected from SEQ ID Nos: 141-187 and 189-204
[0037] In some embodiments, the nucleic acid molecule is a modified ASO selected from SEQ ID Nos: 148-151, 168-170, 177, 185, 195, 198, and 200 In some embodiments, the metal chelating agent is conjugated to the nucleic acid molecule via a linker.
[0038] In some embodiments, the linker is selected from succinimidyl 4-(N-maleimidomethyl)cyclohexane-l -carboxylate (SMCC), pegylated SMCC crosslinkers such as SM(PEG)4 or SM(PEG)12, maleimide-PEG-NHS, thiol -reactive functional groups such as a pyridyl-disulfide spacer (i.e., pyridyldithio or 2-pyridyl disulfide linker), and a disulfide spacer.
[0039] In some embodiments, the metal chelating agent is conjugated to the 5’ end of the nucleic acid molecule.
[0040] In some embodiments, the administration is systemic administration.
[0041] In some embodiments, the administration involves delivery of the nucleic acid molecule to at least one kidney region distal to the kidney proximal convoluted tubule.
[0042] The method of claim 42, wherein the at least one kidney region distal to the kidney proximal convoluted tubule is selected from the kidney medulla, loop of Henle, distal convoluted tubule, collecting duct, and combinations thereof.
[0043] In some embodiments, the method causes a reduction of at least about 20% in expression levels of the target gene in at least one kidney region distal to the kidney proximal convoluted tubule.
[0044] In some embodiments, there is provided method of delivery of a nucleic acid to a kidney region distal to a kidney proximal convoluted tubule of a subject, the method including administering to the subject a composition including a nucleic acid molecule conjugated to a metal chelating agent.
[0045] In addition to the exemplary embodiments described above, further embodiments will become apparent by reference to the figures and by study of the following detailed descriptions.
[0046] BRIEF DESCRIPTION OF DRAWINGS
[0047] The invention will now be described in relation to certain examples and embodiments with reference to the following illustrative figures.
[0048] Figs. 1A-1B show a schematic diagram of the synthesis of ASO-DMSA. Fig. 1A. A schematic diagram of the synthesis of ASO-SMCC. Briefly, SMCC is added to ASO-amine and incubated overnight at room temperature with KH2PO4 at pH 7.8, the resulting ASO-SMCC is purified by gel filtration to separate from the N-hydroxysuccinimide byproduct, mol.: molecules.
[0049] Fig. IB. A schematic diagram of the synthesis of ASO-DMSA from ASO-SMCC. Briefly, DMSA is added with Tris(2-carboxyethyl)phosphine (TCEP) in PBS (Ph =7-7.5) to ASO-SMCC.
[0050] Figs.2A-2F show the effect of DMSA conjugation to ASO (targeting UMOD which encodes uromodulin, and is expressed in the loop of Henle) on delivery to different mouse kidney segments.
[0051] Figs. 2A, 2C, and 2E: naked (no DMSA) ASO; Figs. 2B, 2D, and 2F: DMSA-conjugated ASO.
[0052] Figs. 2A-2B: thick ascending limb of the loop of Henle; Figs. 2C-2D: distal tubule; Figs. 2E-2F: collecting duct. ASO is labeled in green, proximal tubule is labeled in magenta, as well as DAPI counterstaining. Red indicates the specific nephron segment shown in the respective image.
[0053] Figs. 3A-3B show DMSA conjugated ASO delivery to the distal tubule (Fig. 3A) and to the collecting duct (Fig. 3B) (Scale=8 pm). Left panels - overlay of ASO and kidney region staining; right panels show separate staining: top panel is ASO (green), bottom panel is kidney region (red). The distal tubule is marked by Rabbit IgG anti-SLC12A3, Abeam & Donkey anti-rabbit IgG-Alexa 555, Abeam. The collecting duct is marked by Rabbit IgG anti-AQP2, Sigma & Donkey anti-rabbit IgG- Alexa 555, Abeam.
[0054] Fig. 4A-B show Malatl transcript levels in a mouse whole kidney, following injection of saline, DMSA conjugated ASO and naked (unconjugated ASO), both targeting Malatl (25 mg / kg, n=3). Mice were euthanized for 7, 30 (Fig. 4A) and 90 (Fig. 4B) days post injection, and Malatl levels were quantified in the whole kidneys by qRT-PCR.
[0055] DETAILED DESCRIPTION OF THE INVENTION
[0056] In the following description, various aspects of the disclosure will be described. For the purpose of explanation, specific configurations and details are set forth in order to provide a thorough understanding of the different aspects of the disclosure. However, it will also be apparent to one skilled in the art that the disclosure may be practiced without specific details being presented herein. Furthermore, well-known features may be omitted or simplified in order not to obscure the disclosure.
[0057] Delivery of nucleic acids and specifically of antisense oligonucleotides (ASO)s is generally restricted to specific tissues and organs, depending on chemical modifications, conjugants and injection routes. Delivery to the kidney can be achieved using systemic administration of an unconjugated ("naked") nucleic acid. Such regimens result in accumulation of the nucleic acid in the liver, and specific sites in the kidney (proximal tubule). However, efficient delivery to the kidney medulla as well as to other parts of the nephron remains unsolved.
[0058] As shown in the present application, conjugation of an ASO to the metal chelating agent meso-2,3-dimercaptosuccinic acid (DMSA) enabled its delivery to other sites in the kidney, including the distal convoluted tubule (DCT) and the collecting duct. Conjugation of ASO to the metal chelating agent is also expected to extend the accumulation of the ASO in the proximal tubules, and hence to possibly prolong therapeutic activity. This expanded bio-distribution to additional tissues enables treating various renal indications and targeting many new disease-related genes. For example, SLC12A3, primarily expressed in the DCT, is routinely targeted by Thiazide (diuretics) to treat hypertension and edema. DMSA also improves delivery to the collecting duct, enabling possible targeting of targets which primarily express in these cells, including AQP2, encoding aquaporin2. As aquaporin greatly involves in water homeostasis, it can be downregulated by ASOs to serve as aquaretics, and to counteract the effects of elevated vasopressin. Accordingly, a variety of diseases associated with kidney function may be treated, including hypertension, diabetes insipidus, syndrome of inappropriate ADH secretion (SIADH), as well as many common and rare forms of CKD of genetic origin.
[0059] In the experiments presented herein, DMSA was conjugated to the 5’ end of ASOs via a Succinimidyl 4-(N-maleimidomethyl)cyclohexane-l -carboxylate (SMCC) cross-linker. As shown in Figs.2 and 3, DMSA conjugation increased delivery of ASOs to distal areas of the kidney, such as the DCT and the collecting duct, compared to “naked” ASOs (namely, including only nucleotides).
[0060] Conjugated nucleic acids for use in delivery, treatment or diagnostics
[0061] In some embodiments, there is provided a composition including a nucleic acid molecule conjugated to a metal chelating agent.
[0062] In some embodiments, there is provided a composition including a nucleic acid molecule conjugated to a metal chelating agent for delivery of the nucleic acid to a kidney region distal to the kidney proximal convoluted tubule.
[0063] In some embodiments, the delivery is a targeted delivery, i.e. for targeting a specific cell or gene. The delivery may be for any suitable purpose, including for therapy or for diagnosis.
[0064] In some embodiments, there is provided a pharmaceutical composition including a nucleic acid molecule conjugated to a metal chelating agent for use in a method of treatment of a kidney disease.
[0065] In some embodiments, there is provided a pharmaceutical composition including a nucleic acid molecule conjugated to a metal chelating agent for use in a method of diagnosis of a kidney disease.
[0066] In some embodiments, the metal chelating agent is selected from DMSA, mercaptoacetyltriglycine (MAG3), and di ethylenetriaminepentaacetate (DTP A).
[0067] These three metal chelators are used for renal imaging and accordingly are expected to have a similar effect to each other on nucleic acid delivery.
[0068] In some embodiments, the metal chelating agent is DMSA. DMSA is an organosulfur compound which is represented by the formula HO2CCH(SH)CH(SH)CO2H, and appears as a white crystalline powder with a special sulfhydryl odor, highlighting its distinctiveness. It is insoluble in water but soluble in alkaline solutions. Functioning as a pharmaceutical chelating agent, DMSA plays a crucial role in binding to metal ions, facilitating their removal from the body. DMSA is primarily used for the treatment of heavy metal poisoning, particularly lead poisoning, in both children and adults. Moreover, it is also used routinely in nuclear medicine as a ligand to prepare diagnostic and therapy radiopharmaceuticals, exploiting its chelation. It contains two sulfhydryl groups, an analog of dimercaprol and is used for metal chelation. Tc-99m DMSA (a technetium radiopharmaceutical) accumulates in proximal tubular cells of kidneys and thereby used for renal cortical radio nucleic imaging.
[0069] MAG3 is a radiopharmaceutical used in a MAG3 renogram scan to evaluate kidney function and drainage. It is a technetium-99m (Tc-99m) labeled tracer that is excreted through the renal tubules and used to produce high-quality images that show how the kidneys are processing and draining urine, even in cases of impaired kidney function.
[0070] DTPA is a chelating agent used to bind with and remove certain metal ions from the body or industrial solutions. In nuclear medicine, DTPA is used for GFR measurement (99mTc-DTPA is freely filtered by glomeruli and not secreted or reabsorbed. The plasma clearance or renogram curve reflects true GFR), or to perform a renogram (allows assessment of unilateral renal function or obstruction).
[0071] In some embodiments, the kidney disease is a chronic kidney disease (CKD).
[0072] In some embodiments, the kidney disease is an acute kidney disease.
[0073] In some embodiments, the kidney disease is associated with hypertension, diabetes insipidus, and / or SIADH.
[0074] In some embodiments, the kidney disease is of a genetic origin, i.e. caused by a genetic mutation. Single-gene (monogenic) disorders may explain approximately 30 to 50% of CKD cases among children and approximately 10 to 20% of adult cases. These conditions can lead to progressive kidney damage, potentially resulting in kidney failure. Genetic kidney diseases can be grouped into multiple subcategories that encompass various malformations or syndromes attributable to specific single-gene conditions, including: (1) Renal cystic ciliopathies, e.g., associated with the genes: PKD1, PKD2, PKHD1, NPHP1-NPHP19, BBS1-BBS21; (2) Podocytopathies, e.g., associated with the genes: NPHS1, NPHS2, WT1, ACTN4, INF2, TRPC6 and APOL1; (3) Basement membrane diseases, e.g. associated with the genes: COL4A5, COL4A4 and COL4A3; (4) Tubulopathies, e.g. associated with the genes: UMOD, MUC1, CTNS, SLC12A1, SLC12A3, CLCN5, AQP2, and OCRL; (5) Nephrolithiasis, e.g. associated with the genes: AGXT, GRHPR, HOGA1, SLC3A1, SLC7A9, SLC34A1 and SLC34A3; (6) Congenital anomalies of the kidney and urinary tract, e.g. associated with the genes: PAX2, HNF1B, SALL1 and EYA1; and (7) Complement related kidney diseases, e.g. associated with the genes: CFH, CFI, C3, CD46, CFB, MCP, THBD and CFHR.
[0075] In some embodiments, the kidney disease is a genetic kidney disease selected from renal cystic ciliopathies, podocytopathies, basement membrane diseases, tubulopathies, Nephrolithiasis, congenital anomalies of the kidney and urinary tract, and complement related kidney diseases. In some embodiments, the kidney disease is a genetic kidney disease selected from Gitelman syndrome, nephrogenic diabetes insipidus, X-linked Alport syndrome (XLAS), autosomal dominant tubulointerstitial kidney disease (ADTKD), autosomal dominant tubulointerstitial kidney disease (ADTKD-MUC1), and autosomal dominant tubulointerstitial kidney disease-UMOD (ADTKD-UMOD).
[0076] The kidney disease or the CKD may involve any region of the kidney, including the glomerulus, parts of the nephron including the proximal and distal tubules, the loop of Henle, as well as collecting ducts.
[0077] In some embodiments, the CKD involves at least one kidney region distal to the kidney proximal convoluted tubule. In some embodiments, the distal kidney region is selected from the kidney medulla, the loop of Henle, the distal convoluted tubule, the collecting duct, and combinations thereof.
[0078] In some embodiments, the nucleic acid molecule is capable of affecting expression of a target gene expressed in kidneys.
[0079] The term “capable of affecting expression”, as used herein with reference to a target gene, means that the nucleic acid molecule is capable of at least partially inhibiting or reducing expression of the target gene at the transcription or at the translation level. Such effects may be the result of various mechanisms resulting from an interaction between the nucleic acid molecule and the target RNA, including causing degradation of the target RNA, inhibiting translation by steric inhibition, or causing a modification in the mRNA such as exon skipping, which may cause early termination of translation. In some embodiments, affecting expression means reducing expression levels. In this application, this term is used interchangeably with the term “targets”, e.g., as in “the nucleic acid molecule targets a gene”, since the capability of affecting expression of a gene is a result of targeting the gene (or an RNA molecule related to the gene). In terms of sequence, the nucleic acid molecule is reverse complementary to the sequence it targets. The term “reverse-complementary” is well known, briefly, it means being in a reverse orientation and having a matching base to the base of the target sequence at a corresponding position, according to standard base pairing: A-T / U, C-G.
[0080] In some embodiments, the target gene is expressed in at least one kidney region distal to a kidney proximal convoluted tubule. In some embodiments, the target gene is expressed in at least one kidney region selected from the glomerulus, the medulla, the proximal tubule, the loop of Henle, the distal tubule, and the collecting duct. In some embodiments, the target gene is expressed in a kidney region selected form kidney medulla, loop of Henle, distal convoluted tubule, collecting duct, and combinations thereof. In some embodiments, the target gene is associated with kidney disease or dysfunction as described herein.
[0081] In some embodiments, the target gene is expressed in the distal tubule. In some embodiments, the target gene is expressed in the collecting duct. In some embodiments, the target gene is expressed in kidney essentially only in kidney regions distal to a kidney proximal convoluted tubule. In some embodiments, the target gene is essentially not expressed in the proximal convoluted tubule.
[0082] The term “essentially” as used above with reference to expression of the target gene means that although the target gene is not expressed in the excluded kidney regions, there may still be low residual expression of the target gene in these regions. In some embodiments, the residual expression level is less than about 10%, 5%, or 1% compared to the expression level of the target gene in the kidney regions distal to a kidney proximal convoluted tubule.
[0083] In some embodiments, the target gene is selected from COL4A5, SLC12A3, AQP2, MUC1, and UMOD.
[0084] The SLC12A3 gene encodes a protein called the sodium-chloride cotransporter (NCC), which is crucial for kidney function. This protein moves sodium Na+and chloride Cl" ions across cell membranes in the distal convoluted tubule of the kidney, a process essential for regulating salt and blood pressure. Mutations in the SLC12A3 gene can lead to a genetic disorder called Gitelman syndrome.
[0085] The AQP2 gene encodes the aquaporin-2 protein, a water channel protein crucial for reabsorbing water in the kidneys. This protein is found in the kidney's collecting ducts and is regulated by the hormone vasopressin to help the body concentrate urine and maintain water balance. Mutations in the AQP2 gene can lead to a condition called nephrogenic diabetes insipidus.
[0086] The COL4A5 gene encodes the alpha-5(IV) chain of type IV collagen, a protein crucial for basement membranes in the kidney, inner ear, and eye. Mutations in this gene are primarily associated with X-linked Alport syndrome (XLAS), a genetic disorder that can lead to kidney disease, hearing loss, and eye abnormalities.,
[0087] The MUC1 gene encodes the mucin 1 protein, which forms a protective and lubricating mucus layer on epithelial cells and is involved in cell signaling. Mutations in the MUC1 gene can cause autosomal dominant tubulointerstitial kidney disease (ADTKD) and are associated with various cancers, often due to the protein's role in cell processes and its abnormal expression or localization in tumors.
[0088] The UMOD gene encodes the uromodulin protein, which is primarily found in the urine and plays a role in kidney function. It helps regulate mineral transport in the kidneys and is thought to protect against urinary tract infections by binding to and aggregating bacteria. Variants in the UMOD gene can lead to a progressive kidney disease known as autosomal dominant tubulointerstitial kidney disease-UMOD (ADTKD-UMOD), which is caused by the uromodulin protein building up inside kidney cells.
[0089] The nucleic acid molecule may be any nucleic acid molecule including DNA and / or RNA nucleotides suitable for treating disease, such as by silencing a gene, including antisense oligonucleotide (ASO), siRNA, microRNA, mRNA, etc.
[0090] In some embodiments, the nucleic acid molecule is an ASO. In some embodiments, the nucleic acid molecule is an RNA ASO.
[0091] The term “antisense oligonucleotide (ASO)”, as used herein, encompasses single stranded oligonucleotides having a length of about 14-30 nucleotides and a sequence complementary to an mRNA which it targets and reduces expression of. ASOs are short, synthetic, single-strand oligonucleotides, that can bind to target RNA and modulate its expression. They can be divided to two major categories - steric-blockers and RNAse-H recruiting ASOs (gapmers). An ASO may include DNA or RNA nucleotides, as well as modified nucleotides. Gapmers can efficiently recruit and localize RNase H for mRNA degradation, by utilizing the “gapmer” design.
[0092] A “gapmer”, as used herein, relates to an ASO having several (e.g. 5) 2' -methoxy ethyl (2'-MOE)-modified ribonucleotides (RNA) at each terminus and a central region of 2'-deoxynucleotide (DNA) nucleotides (8-10 bases). While the flanking 2' -MOE ends prevent nuclease cleavage of the ASO, the chimeric gapmer ASO design directs RNase Hl to the central gap made of DNA where it performs specific mRNA degradation, as RNase Hl shows high specificity for DNA-RNA duplexes. It is noted that siRNA, being double stranded, is not encompassed by the definition of an ASO.
[0093] In some embodiments, the nucleic acid molecule has a length of about 14-30 nucleotides. In some embodiments, the nucleic acid molecule has a length of about 20-30 nucleotides. In some embodiments, the nucleic acid molecule has a length of about 15-25 nucleotides. In some embodiments, the nucleic acid molecule has a length of about 15-20 nucleotides. In some embodiments, the nucleic acid molecule has a length of about 20-25 nucleotides. In some embodiments, the nucleic acid molecule has a length of about 20 nucleotides.
[0094] In some embodiments, the nucleic acid molecule is a modified nucleic acid molecule, i.e., it includes at least one modified nucleotide. Nonlimiting examples for modification of nucleotides include the addition of functional or stabilizing moieties or groups, such as a methyl group (as in 5 ’-methylcytosine), a 2'-O-methoxy ethyl (MOE) group, a methylene group between the 2'-0 and 4'-C of the nucleotide (locked nucleic acid, LNA), a constrained ethyl (cET) group, 2'-O-methylation (20me), and combinations thereof.
[0095] In some embodiments, the at least one modified nucleotide includes a 2'-O-methoxyethyl (MOE) group. In some embodiments, at least 2, 3, 4, 5, 6, 7, 8, 9, or 10 of the nucleic acid molecule nucleotides are modified nucleotides. In some embodiments, the nucleic acid molecule includes at least 1, 2, 3, 4, or 5 modified nucleotides both at the 5 ’-end and at the 3 ’-end. In some embodiments, the nucleic acid molecule includes 5 modified nucleotides each at the 5 ’-end and at the 3 ’-end. In some embodiments, all of the nucleotides of the nucleic acid molecule are modified by adding a 2'-O-methoxyethyl (MOE) group. In some embodiments, all of the nucleotides modified by adding a 2’-M0E group are RNA nucleotides.
[0096] In some embodiments, the nucleic acid molecule includes at least one 5 ’-methylcytosine. In some embodiments, all of the cytosines in the nucleic acid molecule are 5 ’-methylcytosines.
[0097] In some embodiments, the nucleic acid molecule includes both DNA and RNA nucleotides. In some embodiments, the nucleic acid molecule includes a stretch of DNA nucleotides flanked on both sides by RNA nucleotides.
[0098] In some embodiments, the nucleic acid molecule includes a central region (i.e., not at the 5’ or the 3’ ends) including only DNA nucleotides. In some embodiments, the central region has a length of about 5-10, or 8-10 nucleotides. In some embodiments, the central region has a length of about 10 nucleotides.
[0099] In some embodiments, the nucleic acid molecule has at least one phosphorothioate (PS) bond. In some embodiments, the nucleic acid molecule includes PS bonds instead of all of the phosphodiester bonds. In some embodiments, the nucleic acid molecule includes no phosphodiester bonds. In some embodiments, all bonds between nucleotides of the ASO are PS bonds. In some embodiments, the nucleic acid molecule has a phosphorothioate (PS) backbone.
[0100] In some embodiments, the nucleic acid molecule is a gapmer.
[0101] In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to a sequence selected from sequences in Table 1. In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 1-47 and 49-64. In some embodiments, the nucleic acid molecule targets a COL4A5 sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 1-35. In some embodiments, the nucleic acid molecule targets a UMOD sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 36-47. In some embodiments, the nucleic acid molecule targets a MUC1 sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 49-64
[0102] In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 8-11, 28-30, 37, 45, 55, 58, and 60. In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 8. In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 9. In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 10. In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 11 In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to SEQ ID No.28. In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 29. In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 30.
[0103] In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 37. In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 45. In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 55. In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 58 In some embodiments, the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 60.
[0104] In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to a sequence selected from sequences defined in Table 2. In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 71-117 and 119-134. In some embodiments, the nucleic acid molecule targets a COL4A5 sequence and includes a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 71-105. In some embodiments, the nucleic acid molecule targets a UMOD sequence and includes a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 106-117. In some embodiments, the nucleic acid molecule targets a MUC1 sequence and includes a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 119-134.
[0105] In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 78-81, 98-100, 107, 115, 125, 128, and 130. In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 78. In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 79. In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 80.
[0106] In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 81 In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 98. In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 99. In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 100 In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 107. In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 115. In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 125 In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 128. In some embodiments, the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to SEQ ID No. 130.
[0107] In some embodiments, the nucleic acid molecule is a modified ASO selected from modified ASOs presented in Table 3. In some embodiments, the nucleic acid molecule is a modified ASO selected from modified ASOs defined by SEQ ID Nos: 141-187 and 189-204. In some embodiments, the nucleic acid molecule is a modified ASO targeting a COL4A5 sequence selected from modified ASOs defined by SEQ ID Nos: 141-175. In some embodiments, the nucleic acid molecule is a modified ASO targeting a UMOD sequence selected from modified ASOs defined by SEQ ID Nos: 176-187. In some embodiments, the nucleic acid molecule is a modified ASO targeting a MUC1 sequence selected from modified ASOs defined by SEQ ID Nos: 189-204.
[0108] In some embodiments, the nucleic acid molecule is a modified ASO selected from SEQ ID Nos: 148-151, 168-170, 177, 185, 195, 198, and 200. In some embodiments, the nucleic acid molecule is a modified ASO defined by SEQ ID No. 148. In some embodiments, the nucleic acid molecule is a modified ASO defined by SEQ ID No. 149. In some embodiments, the nucleic acid molecule is a modified ASO defined by SEQ ID No. 150. In some embodiments, the nucleic acid molecule is a modified ASO defined by SEQ ID No. 151. In some embodiments, the nucleic acid molecule is a modified ASO defined by SEQ ID No. 168. In some embodiments, the nucleic acid molecule is a modified ASO defined by SEQ ID No. 169. In some embodiments, the nucleic acid molecule is a modified ASO defined by SEQ ID No. 170. In some embodiments, the nucleic acid molecule is a modified ASO defined by SEQ ID No. 177. In some embodiments, the nucleic acid molecule is a modified ASO defined by SEQ ID No. 185. In some embodiments, the nucleic acid molecule is a modified ASO defined by SEQ ID No. 195. In some embodiments, the nucleic acid molecule is a modified ASO defined by SEQ ID No. 198. In some embodiments, the nucleic acid molecule is a modified ASO defined by SEQ ID No. 200.
[0109] The metal chelating agent may be linked to the nucleic acid by any suitable way. For example, the metal chelating agent may be directly conjugated to the 5’ or to the 3’ end of the nucleic acid. In some embodiments, the metal chelating agent is conjugated to the 5’ end of the nucleic acid.
[0110] In some embodiments, the metal chelating agent is linked to the nucleic acid by a linker. The linker may be any suitable linker. In some embodiments, the linker is selected from succinimidyl 4-(N-maleimidomethyl)cyclohexane-l -carboxylate (SMCC), pegylated SMCC crosslinkers such as SM(PEG)4 or SM(PEG)12, maleimide-PEG-NHS, thiol -reactive functional groups such as a pyridyl-disulfide spacer (i.e., pyridyldithio or 2-pyridyl disulfide linker), and a disulfide spacer. In some embodiments, the linker is SMCC.
[0111] In some embodiments, the nucleic acid is further functionalized to allow binding of the DMSA. Such functionalization may be carried out by methods known in the art, for example by the addition of an aminohexyl linker (such as 6-aminohexyl (5'-NHC6)).
[0112] In some embodiments, the nucleic acid is an ASO, and the metal chelating agent is linked to the 5’ end of the ASO. In some embodiments, the nucleic acid is an ASO, and the metal chelating agent is DMSA linked to the 5’ end of the ASO through an SMCC linker.
[0113] Methods of delivery, treatment and diagnosis
[0114] In some embodiments, there is provided a method of delivery of a nucleic acid to a kidney region distal to a kidney proximal convoluted tubule of a subject, the method including administering to the subject a composition including a nucleic acid molecule conjugated to a metal chelating agent.
[0115] In some embodiments, there is provided a method of treating a kidney disease in a subject, the method including administering to the subject an effective amount of a pharmaceutical composition including a nucleic acid molecule conjugated to a metal chelating agent.
[0116] Definitions and embodiments mentioned above and which may be relevant to the present embodiments also apply here, and vice versa. Some particularly relevant embodiments may be pointed out or explicitly repeated. For terms used herein, unless stated otherwise, their definition and embodiments are intended to be the same as above (mutatis mutandis). In some embodiments, the nucleic acid molecule is capable of affecting expression of a target gene.
[0117] In some embodiments, the method causes a reduction of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% in expression levels of the target gene in at least one kidney region. In some embodiments, the method causes a reduction of at least about 20% in expression levels of the target gene in at least one kidney region. In some embodiments, the method causes a reduction of at least about 30% in expression levels of the target gene in at least one kidney region. In some embodiments, the method causes a reduction of at least about 50% in expression levels of the target gene in at least one kidney region.
[0118] In some embodiments, the method causes reduction of at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% in expression levels of the target gene in at least one kidney region distal to the kidney proximal convoluted tubule. In some embodiments, the method causes reduction of at least about 30% in expression levels of the target gene in at least one kidney region distal to the kidney proximal convoluted tubule. In some embodiments, the method causes reduction of at least about 50% in expression levels of the target gene in at least one kidney region distal to the kidney proximal convoluted tubule.
[0119] In some embodiments, the nucleic acid is an ASO. In some embodiments, the nucleic acid is a gapmer.
[0120] In some embodiments, the subject is a child. In some embodiments the subject is an adult. In some embodiments, the administration involves delivery of the nucleic acid molecule to any kidney region, such as, e.g., the glomerulus, the medulla, the proximal tubule, the loop of Henle, the distal tubule, and the collecting duct.
[0121] In some embodiments, the administration involves delivery of the nucleic acid molecule to at least one kidney region distal to the kidney proximal convoluted tubule.
[0122] In some embodiments, the at least one distal kidney region is selected from the kidney medulla, loop of Henle, distal convoluted tubule, collecting duct, and combinations thereof.
[0123] In some embodiments, the administration involves delivery of the nucleic acid molecule to a distal convoluted tubule. In some embodiments, the administration involves delivery of the nucleic acid molecule to a collecting duct.
[0124] It is appreciated that the term “delivery” with reference to a target organ or part thereof means that by administering the nucleic acid molecule to the subject, the nucleic acid molecule reaches the target organ or part thereof and accumulates there to a sufficient level to cause a desired effect, which may be relevant to treatment or to diagnosis. Alternatively, the nucleic acid molecule may be directly administered to the target organ or part thereof. The term “treating” or “treatment”, as used herein, refers to means of obtaining a desired physiological effect. The effect may be therapeutic in terms of partially or completely curing a disease and / or symptoms attributed to the disease. The term comprises inhibiting the disease, i.e. arresting its development; or ameliorating the disease, i.e. causing regression of the disease, e.g., by eliminating or ameliorating its symptoms.
[0125] Methods of treatment may include any suitable methods, including, e.g., methods of targeting genes in order to reduce their expression, and radiotherapy methods including adding a radiolabel to the nucleic acid conjugate.
[0126] Methods of diagnostics include any relevant methods, such as imaging, e.g., by adding a radioactive label to the nucleic acid conjugate.
[0127] The term "effective amount" as used herein means an amount of a substance that is effective for the relevant procedure. For example, for a therapeutic method, that is the amount of substance (drug, therapeutic) that will elicit the biological or medical response of a tissue, system, animal or human that is being sought. The amount must be effective to achieve the desired therapeutic effect, depending inter alia, on the type and severity of the condition to be treated and the treatment regime. The therapeutically effective amount is typically determined in appropriately designed clinical trials (dose range studies) and the person skilled in the art will know how to properly conduct such trials to determine the effective amount. As generally known, an effective amount depends on a variety of factors including the affinity of a ligand to its binding partner, its distribution profile within the body, a variety of pharmacological parameters such as half-life in the body, on undesired side effects, if any, and on factors such as age and gender, etc.
[0128] Pharmaceutical compositions for use in accordance with the present invention may be formulated in any conventional manner using one or more physiologically or pharmaceutically acceptable carriers or excipients. The carrier(s) must be "acceptable" in the sense of being compatible with the other ingredients of the composition, not being deleterious to the recipient thereof, and not significantly interfering with the activity of the compound of the invention, or of any other active ingredient in the pharmaceutical composition.
[0129] The term “carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the active agent is administered. The carriers in the pharmaceutical composition may comprise a binder, such as microcrystalline cellulose, polyvinylpyrrolidone (polyvidone or povidone), gum tragacanth, gelatin, starch, lactose or lactose monohydrate; a disintegrating agent, such as alginic acid, maize starch and the like; a lubricant or surfactant, such as magnesium stearate, or sodium lauryl sulphate; and a glidant, such as colloidal silicon dioxide.
[0130] Methods of administration include, but are not limited to, parenteral, e.g., intravenous, intraperitoneal, intramuscular, subcutaneous; mucosal (e.g., oral, sublingual, intranasal, buccal, vaginal, rectal, intraocular), intrathecal, topical, renal, intrarenal, and intradermal routes. Administration can be systemic or local. In certain embodiments, the pharmaceutical composition is adapted for oral administration. In some embodiments, the administration is intravenous administration. In some embodiments, the administration is subcutaneous administration.
[0131] In some embodiments, the administration is systemic administration.
[0132] In some embodiments, the administration is selected from intravenous and subcutaneous administration.
[0133] In some embodiments, there is provided a method of diagnosing a kidney disease in a subject, the method including administering to the subject an effective amount of a pharmaceutical composition including a nucleic acid molecule conjugated to a metal chelating agent.
[0134] Definitions and embodiments mentioned above and which may be relevant to the present embodiments also apply here, and vice versa. Some particularly relevant embodiments may be pointed out or explicitly repeated. For terms used herein, unless stated otherwise, their definition and embodiments are intended to be the same as above (mutatis mutandis).
[0135] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains.
[0136] The term "a" and "an" refers to one or to more than one (i.e., to at least one, or to one or more) of the grammatical object of the article. By way of example, “an element” means one element or more than one element.
[0137] The term "about", when referring to a measurable value such as an amount, a ratio, and the like, is meant to encompass variations of ±10% of the indicated value, as such variations are also suitable to perform the disclosed invention. Any numerical values appearing in the application are intended to be construed as if preceded by “about”, unless indicated otherwise.
[0138] The term “sequence”, “nucleotide sequence” or “nucleic acid sequence”, as used herein, relates to a sequence of nucleotides and may include different types of nucleotides, such as DNA nucleotides, RNA nucleotides, modified nucleotides, and synthetic nucleotides.
[0139] The term “bp”, as used herein, means base pair, or base pairs.
[0140] The term “aa”, as used herein, means amino acid or amino acids.
[0141] While certain embodiments of the invention have been illustrated and described, it will be clear that the invention is not limited to the embodiments described herein. Numerous modifications, changes, variations, substitutions, and equivalents will be apparent to those skilled in the art without departing from the spirit and scope of the present invention as described by the claims, which follow.
[0142] The following examples are presented in order to more fully illustrate some embodiments of the invention. They should in no way be construed, however, as limiting the broad scope of the invention. One skilled in the art can readily devise many variations and modifications of the principles disclosed herein without departing from the scope of the invention.
[0143] EXAMPLES
[0144] Materials and Methods
[0145] DMSA conjugation
[0146] 5'-NHC6 (6-aminohexyl (aminohexyl linker)) UMOD-targeting ASO gapmer (TGCTACTGGGTGTGGCATAG, SEQ ID NO: 177) was used as "naked" or with meso-2,3-dimercaptosuccinic acid (DMSA) conjugation by a succinimidyl 4-(N-maleimidomethyl)cyclohexane-l -carboxylate (SMCC) crosslinker. To conjugate SMCC (succinimidyl-4-(N-maleimidom ethyl) cyclohexane- 1 -carboxylate) to an amine-modified oligonucleotide, 20 nmoles of the oligonucleotide were dissolved in 100 mM KH2PO4 buffer at pH 7.2. Separately, 1 mg of SMCC was dissolved in acetonitrile (1 mL, 3 mM) and 67 pL of this solution was added to the oligonucleotide mixture, followed by vortexing and centrifugation. The reaction was maintained at room temperature for 30 minutes, after which an ethanol precipitation was performed to remove excess SMCC. In an alternative protocol, SMCC (1 mg, 15 equivalents) was added to 200 nmol of ASO-amine in water, followed by additional SMCC after 3 hours, with the reaction left overnight. The product was purified using a NAP™ 10 Sephadex® G25 gel filtration column and reverse-phase HPLC, achieving a 60% yield. The final product was stored dry at -20°C. DMSA was further conjugated to the SMCC.
[0147] ASO dosing in vivo
[0148] All animal experiments described herein were approved by the Sheba Medical Center IACUC (1339 / 22 / ANIM), and the experiments were carried at the Sheba animal facility.
[0149] 6 weeks old C57Bl / 6J01aHsd females were injected systemically (IV) with naked ASO or DMSA conjugated ASO (25 mg / kg). Mice were euthanized 7 days post injection, and both kidneys were harvested and fixed in 4% paraformaldehyde for subsequent analysis Immunohistochemistry and In-Situ Hybridization
[0150] Kidneys were collected from injected mice, fixed in 4% paraformaldehyde, embedded in paraffin, and cut into 5 pm sections. The sections were mounted on glass slides and stored at 4 °C until use. The sections were deparaffinized, rehydrated, and underwent antigen retrieval with 0.1% sodium citrate. DIG tagged, ASO-specific LNA probe was used to stain and detect ASO by hybridization. Sections were then stained for DIG detection and for targets enabling detection of the nephron segments (11207741910, Roche, Anti-Digoxigenin-Fluorescein, Rabbit IgG anti-SLC12A3, Abeam, Rabbit IgG anti-AQP2, Sigma).
[0151] Example 1: DMSA conjugation enables ASO delivery to distal tubules
[0152] DMSA was conjugates to UMOD-targeting ASO by SMCC cross linker (Figs. 1A-1B). Wild type mice were intravenously injected with 25mg / kg of DMSA-ASO or naked ASO and subsequently euthanized 7 days post injection. In-situ hybridization shows co-localization of DMSA-ASO with SLC12A3 positive staining, marking the distal tubules, and with AQP2 staining, marking the collecting duct (Figs. 2-3).
[0153] Example 2: DMSA conjugation prolongs ASO activity in the kidney
[0154] DMSA was conjugated to Malatl-tagreting ASO gapmer (GCCAGGCTGGTTATGACTCA, also known as ION-626112, SEQ ID NO: 205) by SMCC cross linker (Figs. 1A-1B). Wild type mice were intravenously injected with 25 mg / kg of DMSA-ASO or naked ASO, and euthanized 7, 30 or 90 days post injection (n=3 per group). qRT-PCR analysis for Malatl levels shows the lowest transcript levels in mice dosed with the naked ASO were seen 7 days post-injection, followed by gradual increase in the transcript levels. DMSA-ASO shows a different trend, with a gradual decrease in Malatl levels, but no increase in transcript levels between days 30 and 90 (Fig 4A). At day 90, mice dosed with Naked ASO show 14% reduction in transcript levels, comparing to 23% reduction in mice dosed with DMSA-ASO (Fig.
[0155] 4B)
[0156] Example 3: The effect of DMSA conjugation on activity of ASOs directed to UMOD, COL4A5, or MUC1
[0157] DMSA is conjugated to a modified ASO targeting UMOD, COL4A5, or MUC1 (as defined in Table 3, SEQ ID Nos: 141-187 and 189-204) by an SMCC cross linker. Wild type mice are intravenously injected with 25 mg / kg of DMSA-ASO or naked ASO, and euthanized 7, 30 or 90 days post injection. qRT-PCR analysis is performed for target mRNA levels. It is expected that the levels of the target mRNA will be reduced to a greater extent and to a longer period of time when a DMSA-ASO is used compared to an ASO not conjugated to DMSA.
[0158] Table 1: List of target sequences for ASOs
[0159]
[0160] "
[0161]
[0162]
[0163] The ASOs of Table 2 were further modified as follows: the phosphodiester bond was replaced with a phosphorothioate (PS) bond, the first and last five nucleotides in each ASO are RNA nucleotides, the RNA nucleotides or all nucleotides were modified by a 2'-O-methoxyethyl (MOE) group, and all cytosines were modified to 5 ’-methylcytosines. The modified ASOs are presented in Table 3.
[0164] Table 3: List of modified ASOs
[0165]
[0166]
[0167]
[0168] * - PS bond; eN = 2'MOE modified base; X - 5’mC (methyl cytosine); Z - 2'MOE-5’mC; the unmodified nucleotides are DNA (in bold).
Claims
CLAIMSWhat is claimed is:
1. A pharmaceutical composition comprising a nucleic acid molecule conjugated to a metal chelating agent for use in a method of treatment and / or diagnosis of a kidney disease.
2. The pharmaceutical composition for use of claim 1, wherein the metal chelating agent is selected from meso-2,3-dimercaptosuccinic acid (DMSA), mercaptoacetyltriglycine (MAG3), and diethylenetriaminepentaacetate (DTP A).
3. The pharmaceutical composition for use of claim 1 or 2, wherein the kidney disease is a chronic kidney disease (CKD).
4. The pharmaceutical composition for use of any one of claims 1-3, wherein the kidney disease is of a genetic origin.
5. The pharmaceutical composition for use of any one of claims 1-4, wherein the kidney disease is associated with diabetes insipidus, hypertension, and / or syndrome of inappropriate ADH secretion (SIADH).
6. The pharmaceutical composition for use of any one of claims 1-4, wherein the kidney disease is a genetic kidney disease selected from Gitelman syndrome, nephrogenic diabetes insipidus, X-linked Alport syndrome (XLAS), autosomal dominant tubulointerstitial kidney disease (ADTKD), autosomal dominant tubulointerstitial kidney disease (ADTKD-MUC1), and autosomal dominant tubulointerstitial kidney disease-UMOD (ADTKD-UMOD).
7. The pharmaceutical composition for use of any one of claims 1-6, wherein the kidney disease involves at least one kidney region distal to the kidney proximal convoluted tubule.
8. The pharmaceutical composition for use of claim 7, wherein the at least one kidney region distal to the kidney proximal convoluted tubule is selected from kidney medulla, loop of Henle, distal convoluted tubule, collecting duct, and combinations thereof.
9. The pharmaceutical composition for use of any one of claims 1-8, wherein the nucleic acid molecule is capable of affecting expression of a target gene expressed in kidneys.
10. The pharmaceutical composition for use of claim 9, wherein the target gene is expressed in a kidney region selected from kidney medulla, loop of Henle, distal convoluted tubule, collecting duct, and combinations thereof11. The pharmaceutical composition for use of claim 9 or 10, wherein the target gene is associated with kidney disease or dysfunction.
12. The pharmaceutical composition for use of any one of claims 9-11, wherein the target gene is selected from COL4A5, SLC12A3, AQP2, MUC1, and UMOD.
13. The pharmaceutical composition for use of any one of claims 1-12, wherein the nucleic acid molecule is an antisense nucleic acid molecule (ASO).
14. The pharmaceutical composition for use of any one of claims 1-13, wherein the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 1-47 and 49-6415. The pharmaceutical composition for use of any one of claims 1-14, wherein the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 71-117 and 119-13416. The pharmaceutical composition for use of any one of claims 1-15, wherein the nucleic acid molecule is a modified ASO selected from SEQ ID Nos: 141-187 and 189-204.
17. The pharmaceutical composition for use of claim 16, wherein the nucleic acid molecule is a modified ASO selected from SEQ ID Nos: 148-151, 168-170, 177, 185, 195, 198, and 200.
18. The pharmaceutical composition for use of any one of claims 1-17, wherein the metal chelating agent is conjugated to the nucleic acid molecule via a linker.
19. The pharmaceutical composition for use of claim 18, wherein the linker is selected from succinimidyl 4-(N-maleimidomethyl)cyclohexane-l -carboxylate (SMCC), pegylated SMCC crosslinkers such as SM(PEG)4 or SM(PEG)12, maleimide-PEG-NHS, thiol -reactive functional groups such as a pyridyl -di sulfide spacer (i.e., pyridyldithio or 2-pyridyl disulfide linker), and a disulfide spacer.
20. The pharmaceutical composition for use of any one of claims 1-19, wherein the metal chelating agent is conjugated to the 5’ end of the nucleic acid molecule.
21. A pharmaceutical composition comprising a nucleic acid molecule conjugated to a metal chelating agent.
22. A method of treating or diagnosing a kidney disease in a subject, the method comprising administering to the subject an effective amount of a pharmaceutical composition comprising a nucleic acid molecule conjugated to a metal chelating agent.
23. The method of claim 22, wherein the metal chelating agent is selected from meso-2,3- dimercaptosuccinic acid (DMSA), mercaptoacetyltriglycine (MAG3), and diethylenetriaminepentaacetate (DTP A).
24. The method of claim 22 or 23, wherein the kidney disease is a chronic kidney disease (CKD).
25. The method of any one of claims 22-24, wherein the kidney disease is of a genetic origin.
26. The method of any one of claims 22-25, wherein the kidney disease is associated with diabetes insipidus, hypertension, and / or syndrome of inappropriate ADH secretion (SIADH).
27. The method of any one of claims 22-25, wherein the kidney disease is a genetic kidney disease selected from Gitelman syndrome, nephrogenic diabetes insipidus, X-linked Alport syndrome (XLAS), autosomal dominant tubulointerstitial kidney disease (ADTKD), autosomal dominant tubulointerstitial kidney disease (ADTKD-MUC1), and autosomal dominant tubulointerstitial kidney disease-UMOD (ADTKD-UMOD).
28. The method of any one of claims 22-27, wherein the kidney disease involves at least one kidney region distal to the kidney proximal convoluted tubule.
29. The method of claim 28, wherein the at least one kidney region distal to the kidney proximal convoluted tubule is selected from the kidney medulla, the loop of Henle, the distal convoluted tubule, the collecting duct, and combinations thereof.
30. The method of any one of claims 22-29, wherein the nucleic acid molecule is capable of affecting expression of a target gene expressed in kidneys.
31. The method of claim 30, wherein the target gene is expressed in a kidney region selected from kidney medulla, loop of Henle, distal convoluted tubule, collecting duct, and combinations thereof.
32. The method of claim 30 or 31, wherein the target gene is associated with kidney disease or dysfunction.
33. The method of any one of claims 30-32, wherein the target gene is selected from COL4A5, SLC12A3, AQP2, MUC1, andUMOD.
34. The method of any one of claims 22-33, wherein the nucleic acid molecule is an antisense nucleic acid molecule (ASO).
35. The method of any one of claims 22-34, wherein the nucleic acid molecule targets a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 1-47 and 49- 6436. The method of any one of claims 22-35, wherein the nucleic acid molecule includes a sequence at least 90%, 95%, or 99% identical to a sequence selected from SEQ ID Nos: 71-117 and 119-13437. The method of any one of claims 22-36, wherein the nucleic acid molecule is a modified ASO selected from SEQ ID Nos: 141-187 and 189-20438. The method of claim 37, wherein the nucleic acid molecule is a modified ASO selected from SEQ ID Nos: 148-151, 168-170, 177, 185, 195, 198, and 20039. The method of any one of claims 22-38, wherein the metal chelating agent is conjugated to the nucleic acid molecule via a linker.
40. The method of claim 39, wherein the linker is selected from succinimidyl 4-(N- maleimidomethyl)cyclohexane-l -carboxylate (SMCC), pegylated SMCC crosslinkers such as SM(PEG)4 or SM(PEG)12, maleimide-PEG-NHS, thiol -reactive functional groups such as a pyridyl-disulfide spacer (i.e., pyridyldithio or 2-pyridyl disulfide linker), and a disulfide spacer.
41. The method of any one of claims 22-40, wherein the metal chelating agent is conjugated to the 5’ end of the nucleic acid molecule.
42. The method of any one of claims 22-41, wherein the administration is systemic administration.
43. The method of any one of claims 22-42, wherein the administration involves delivery of the nucleic acid molecule to at least one kidney region distal to the kidney proximal convoluted tubule.
44. The method of claim 43, wherein the at least one kidney region distal to the kidney proximal convoluted tubule is selected from the kidney medulla, loop of Henle, distal convoluted tubule, collecting duct, and combinations thereof.
45. The method of any one of claims 22-44, wherein the method causes a reduction of at least about 20% in expression levels of the target gene in at least one kidney region distal to the kidney proximal convoluted tubule.
46. A method of delivery of a nucleic acid to a kidney region distal to a kidney proximal convoluted tubule of a subject, the method comprising administering to the subject a composition comprising a nucleic acid molecule conjugated to a metal chelating agent.