RNA sequence for expressing protein in cardiomyocytes

Modified RNA molecules with enhanced 5' UTRs and chemical modifications address translation inefficiencies in cardiomyocytes, enhancing protein expression and therapeutic efficacy.

WO2026107144A1PCT designated stage Publication Date: 2026-05-21MT SINAI SCHOOL OF MEDICINE
View PDF 11 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
MT SINAI SCHOOL OF MEDICINE
Filing Date
2025-11-13
Publication Date
2026-05-21

AI Technical Summary

Technical Problem

Existing methods for transfecting RNA into cardiomyocytes face inefficiencies in translation and short half-life, leading to low protein expression and limited therapeutic efficacy due to intricate post-transcriptional regulation.

Method used

The use of modified RNA molecules (modRNA) with enhanced 5' untranslated regions (5' UTRs) and chemical modifications, such as pseudouridine and 3'-O-Me-m7G(5')ppp(5')G Anti Reverse Cap Analog (ARCA), to stabilize and enhance translation efficiency in cardiomyocytes.

Benefits of technology

The modified RNA molecules significantly increase protein translation efficiency, reducing the amount needed for a desired effect and minimizing immune response, thus improving therapeutic outcomes.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025055261_21052026_PF_FP_ABST
    Figure US2025055261_21052026_PF_FP_ABST
Patent Text Reader

Abstract

Provided is an RNA molecule including a 5' UTR that promotes translation of an open reading frame of the RNA molecule in cardiomyocytes or heart tissue.
Need to check novelty before this filing date? Find Prior Art

Description

RNA SEQUENCE FOR EXPRESSING PROTEIN IN CARDIOMYOCYTESCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit of priority from U.S. Provisional Patent Application No. 63 / 720,396, filed November 1, 2024, the entire contents of which are incorporated herein by reference.SEQUENCE LISTING

[0002] The instant application contains an electronic sequence listing. The contents of the electronic sequence listing P-230707-WO_Sequence_listing_XML_file_3710084AWO.xml; Size: 11,255 bytes; and Date of Creation: November 3, 2025, is herein incorporated by reference in its entirety.BACKGROUND

[0003] Transgene expression in cardiomyocytes or heart tissue provides opportunities for various clinically relevant interventions, such as to induce cardiac regeneration, protection, or vascularization post-ischemic injury. For example, transfection of cardiomyocytes with RNA encoding various proteins has shown promise for treatment of ischemia and heart disease. However, inefficiencies in translation from transfected RNA, coupled with its short half-life, can result in low levels of protein expression and limit effectiveness. The expression of genes is controlled intricately at the post-transcriptional level, rhe level of an individual mRNA type in a cell does not ensure the synthesis of comparable amounts of respective proteins. Both positive and negative modulators influence translation and maintain certain levels of protein. Eukary otic gene translation is regulated in the translation level by several components, including 5' untranslated region (UTR), 3' UTR, poly(A) tail, and cap structure of an RNA molecule. There are multiple regulatory elements within the UTRs of the mRNA, which are critical for the stability and translation of mRNA into protein. The 5' UTR plays a significant role in the regulation of translational efficiency by helping the ribosome to bind the messenger RNA (mRNA) in the proximity7of the start codon and thus, is a main contributor to the cellular proteome. Additionally, 5' UTRs can contain sequence elements that can function as binding sites for regulatory' proteins.Improved post-transcriptional regulation of expression from transfected RNA in cardiomyocytes is needed to enhance therapeutic efficacy. The present disclosure is directed to overcoming these and other deficiencies in the artSUMMARY

[0004] In an aspect, provided is polynucleotide including a nucleotide sequence wherein the nucleotide sequence is as set out in SEQ ID NO: 1. The nucleotide sequence may be as set out in SEQ ID NO: 2 or SEQ ID NO: 3.

[0005] Also provided is a ribonucleic acid molecule (RNA) including a 5' untranslated region (5' UTR), wherein the 5' UTR includes any foregoing polynucleotide. The 5' UTR of the RNA may include the nucleotide sequence as set out in SEQ ID NO: 2 or in SEQ ID NO: 3. The RNA may include a start codon and the start codon is one nucleotide 3'-adjacent to the 5' UTR. The RNA may include a sequence AUGG one nucleotide 3'-adjacent to the 5' UTR. The RNA may include a 3'-O-Me-m7G(5')ppp(5')G Anti Reverse Cap Analog (ARCA) at its 5' end. In any foregoing RNA, the 5' UTR may precede a coding sequence for a protein of interest.

[0006] In any foregoing RNA, one or more uridine of the RNA may be substituted with pseudouridine, one or more cytidine of the RNA may be substituted with 5-methylcytidine, or both. The RNA may include one or both of pseudouridine m place of uridine and 5-methylcitidine in place of cy tidine.

[0007] Also provide is a deoxyribonucleic acid molecule (DNA) encoding any foregoing polynucleotide.

[0008] Also provided is a cell including any foregoing polynucleotide, wherein the polynucleotide is a transgene. The cell may be a cardiomyocyte.

[0009] Also provided is a non-human organism including any foregoing polynucleotide or any foregoing cell.

[0010] Also provided is a vector including any foregoing polynucleotide. The vector may be a viral vector or a liposomal vector.

[0011] Also provided is a method of transfecting a cell, including contacting the cell with any foregoing polynucleotide. The cell may be a cardiomyocyte. An organism may include the cell. The organism may be a human, or a non-human. A vector may include the polynucleotide and contacting the cell may include contacting the cell with the vector. The vector may include a viral vector or a liposomal vector.

[0012] Also provided is a method of expressing a protein of interest in a cell, including contacting the cell with any foregoing polynucleotide, wherein the 5' UTR precedes a coding sequence for the protein of interest. The cell may be a cardiomyocyte. An organism may include the cell. The organism may be a human, or a non-human. A vector may includethe polynucleotide and contacting the cell may include contacting the cell with the vector. The vector may include a viral vector or a liposomal vector.BRIEF DESCRIPTION OF THE DRAWINGS

[0013] These and other features, aspects, and advantages of the present disclosure will become better understood when the following detailed description is read with reference to the accompanying drawings, wherein:

[0014] FIG. 1 shows a graph depicting that nGFP modRNA carrying 5' UTR Top Heart has significant higher translation post-delivery7into isolated neonatal CM over other 5' UTRs.

[0015] FIG. 2 shows an example of Luc modRNA carrying 5' UTR Top Heart has significant higher translation post-delivery directly into heart over other 5' UTRs.

[0016] FIG. 3 shows a graph depicting that nGFP modRNA carrying 5' UTR Top Heart or carrying the last 20 nucleotides of 5' UTR Top Heart has significant higher translation post-delivery into isolated neonatal CMs over other 5' UTRs.

[0017] FIG. 4 shows a graph depicting that nGFP modRNA carrying 5' UTR Top Heart or carrying the last 20 nucleotides of 5' UTR Top Heart has significant higher translation post-delivery into human iPS derived CMs over control 5' UTR.DETAILED DESCRIPTION

[0018] This disclosure relates to an RNA molecule including a nucleotide sequence in its 5' UTR that increases translation of a protein encoded by the RN A molecule.. Modulation of the 5' UTR as disclosed herein enhances translation efficiency in cardiomyocytes and the heart. RNA including 5' UTR as disclosed herein reduces the amount of RNA that must be administered in order to produce a desired amount of protein translated therefrom or a desired cellular or clinical effect.

[0019] A nucleoside is a molecule including a nitrogenous base (i.e., a nucleobase) linked to a pentose (e.g., deoxyribose or ribose) sugar. Nitrogenous bases which form nucleosides include adenine, guanine, cytosine, 5-methyl cytosine, uracil, and thymine. Suitable ribonucleosides (which include ribose as the pentose sugar) include, e.g., adenosine (A), guanosine (G), 5-methyl uridine (m5U), uridine (U), and cytidine (C). Nucleotides are molecules including a nucleoside (e.g., a ribonucleoside) and a phosphate group.Ribonucleotides include, e.g., adenosine monophosphate, adenosine diphosphate, adenosine triphosphate, guanosine monophosphate, guanosine diphosphate, guanosine triphosphate.cytidine monophosphate, cytidine diphosphate, cytidine triphosphate, uridine monophosphate, uridine diphosphate, uridine triphosphate, and derivatives thereof.

[0020] Modified RNA, or modRNA, is a synthetic modified RNA that can be used for expression of a gene of interest. Chemical modifications to a ribonucleotide included in modRNA may stabilize an RNA molecule, blunt an immune response, or enhance transcription. Additionally, unlike delivery of protein agents directly to a cell, which can activate the immune system, the delivery of modRNA can be achieved without immune impact. For example, substitution of uridine and cytidine with pseudouridine or Nl-methylpseudouridine and 5 -methylcytidine, respectively, drastically reduces the immune response elicited from exogenous RNA without such substitutions. Stability and translational efficiency from an RNA molecule may also be increased by including a 3'-O-Me-m7G(5')ppp(5')G Anti Reverse Cap Analog (ARCA) at the 5' end of the RNA molecule.

[0021] modRNA may encompass an RNA molecule with at least uridine substituted with pseudouridine, modRNA may encompass an RNA molecule with at least c tidine substituted with 5-metliylcytidine. modRNA may encompass an RNA molecule including the modified nucleoside 5-methylcytidine (5mC). modRNA may encompass an RNA molecule including the modified nucleoside 2-Thiouridine-5'-Triphosphate (2 -thio \| / U). modRNA may encompass an RN A molecule with at least the modified nucleoside 1 -Methylpseudoundine-5 Triphosphate (l-nngU). modRNA may encompass an RNA molecule with at least the modified nucleoside N 1 -methvl-pseudouridine (N 1 m ) substituted for uridine. modRNA may encompass an RNA molecule wherein at least 5' tnphosphates are removed. modRNA may encompass an RNA molecule wherein at least a 3'-O-Me-m7G(5')ppp(5')G Anti Reverse Cap Analog (ARCA) cap or C32H43N15O24P4 CleanCap Reagent AG included in a 5' untranslated regions of the RNA molecule.

[0022] modRNAs may be prepared by in vitro transcription. modRNA may be in vitro transcribed, e.g., from a linear DNA template using one or more reagents selected from a cap analog, guanosine triphosphate, adenosine triphosphate, cytidine triphosphate, uridine triphosphate, and derivatives thereof. A cap analog may be selected from Anti-Reverse Cap Analog (ARCA) 3'-O-Me-m7G(5')ppp(5')G. standard cap analog m7G(5')ppp(5')G, unmethylated cap analog G(5')ppp(5')G, methylated cap analog for A+l sites m7G(5')ppp(5')A, and unmethylated cap analog for A+l sites G(5')ppp(5')A. In certain examples, a cap analog is Anti-Reverse Cap Analog (ARCA) 3'-O-Me-m7G(5')ppp(5')G. According to some examples, modRNA may be in vitro transcribed from a plasmid template using one or more reagents selected from 3'-O-Me-m7G(5')ppp(5')G, guanosine triphosphate,adenosine triphosphate, cytidine triphosphate, N1 -methylpseudoundine- 5 -triphosphate, and any one or more of the aforementioned examples of modRNA, or others, without limitation and in any combination.

[0023] Additional suitable modifications to a modRNA or mRNA molecule are well known in the art (see, e.g., U. S. Patent No. 8,278,036 to Kariko et al.; U. S. Patent No.10,086.043 to Chien et al.; U. S. Patent Application Publication No. 2019 / 0203226 to Zangi et ah: and U. S. Patent Application Publication No. 2018 / 0353618 to Burkhardt et al,, which are hereby incorporated by reference m their entirety). In some embodiments, the nucleoside that is modified in the modRNA is a uridine (U), a cytidine (C), an adenine (A), or guanine (G). The modified nucleoside can be, for example, m5C (5 -methylcytidine), m°A (N6- methyladenosine), s2U (2-thiouridien), (pseudoundine), or Um (2-O-metliyluridine). Some exemplary chemical modifications of nucleosides m the modRNA molecule may further include, for example and without limitation, pyridine-4-one ribonucleoside, 5 -aza- uridine, 2- thio-5-aza uridine, 2-thiouridine, 4-thio pseudouridine, 2-thio pseudouridine, 5-hydroxyuridine, 3-methyluridine, 5-carbox methyl uridine, 1 -carboxymethyl pseudoundine.5-propynyl undine, 1-propynyl pseudouridine, 5-taurinomethyluridine, 1-taunnomethyl pseudouridine, 5-taurinomethyl-2-thio uridine, 1 -taurinomethyl-4-thio uridine, 5-methyl uridine, 1-methyl pseudouridine. 4-tlno- l -methyl pseudouridine, 2-thio- 1 -methyl pseudouridine, 1-methy 1-1 -deaza pseudo uridine, 2-lliio-l-methyl-l-deaza pseudouridine, dihydrouridine, dihydropseudouridine, 2-thio dihydrouridine. 2-thio dihydropseudouridine, 2- methoxyundine, 2-methoxy-4-thio uridine, 4-methoxy pseudouridine. 4-methoxy-2-thio pseudoundine, 5-aza cytidine, pseudoisocytidme, 3-methyl cytidine, N4-acetylcytidine, 5- formylcytidine, N4-methylcytidine, 5-hydroxymethylcytidine, 1-methyl pseudoisocytidine, pyrrolo-cytidine. pyrrolo-pseudoi socy ti dine. 2-thio cytidine, 2-thio-5-methyl cytidine, 4-thio pseudoisocytidine, 4-thio- 1-methyl pseudoisocytidine. 4-thio-l -methyl- 1 -deaza pseudoisocytidine, 1 -methyl- 1 -deaza pseudoisocytidine, zebularine, 5-aza zebularine, 5-methyl zebularine, 5-aza-2-thio zebularine, 2-thio zebularine, 2-methoxy cytidine, 2- methoxy-5-methyl cytidine, 4-methoxy pseudoisocytidine, 4-methoxy- 1-methyl pseudoisocytidme, 2-aminopurine. 2.6-diaminopurme, 7-deaza adenine, 7 -deaza-8-aza adenine, 7-deaza-2-aminopurine, 7-deaza-8-aza-2-aminopurine, 7-deaza-2,6-diaminopurine, 7-deaza-8-aza-2,6-diaminopurine, 1 -methyladenosine, N6-methyl adenosine, N6-isopentenyladenosine, N6-(cis-hydroxyisopentenyl) adenosine, 2-methyithio-N6-(cis-hydroxyisopentenyl) adenosine, N6-glycinylcarbamovladenosine. N6-threonylcarbamoyladenosine, 2-methylthio-N6-threonyl carbamoyladenosine, N6, N6-dimethyladenosine, 7-methyladenine, 2-methylthio adenine, 2 -methoxy adenine, inosine. 1-methyl inosine, wyosine, wybutosine, 7-deaza guanosine, 7-deaza-8-aza guanosine, 6-tliio guanosine, 6-thio-7 -deaza guanosine, 6-thio-7-deaza-8-az.a guanosine, 7 -methyl guanosine, 6- thio-7-methyl guanosine. 7-methylinosine, 6-methoxy guanosine, 1 -methylguanosine, N2- methylguanosine, N2, N2-dimethylguanosine, 8-oxo guanosine, 7-methyl-8-oxo guanosine, 1-methyl-6-thio guanosine, N2-methyl-6-thio guanosine, or N2, N2-dimethyl-6-thio guanosine.

[0024] In an example, modifications made to the modRNA are independently selected from 5-methylcytosine, pseudouridine, and 1 -methylpseudouridine.10025 ] In some embodiments, the modRNA includes a modified uracil selected from the group consisting of pseudouridine (v), pyridine-4-one ribonucleoside, 5-az.a uridine, 6- aza uridine, 2-thio-5-aza undine, 2-tlno uridine (s2U). 4-tlno uridine (s4U). 4-tlno pseudouridme, 2-thio pseudouridine, 5-hydroxy uridine (ho5U), 5-ammoallyl uridine, 5-halo uridine (e.g., 5-iodom uridine or 5-bromo uridine), 3-methyl uridine (m3U), 5-methoxy uridine (mo5U), uridine 5-oxyacetic acid (cmo5U), uridine 5-oxyacetic acid methyl ester (mcmo’U). 5-carboxymethyl uridine (cnrlT), 1-carboxymethyl pseudouridine, 5- carboxyhydroxymethyl uridine (chm5U), 5-carboxyhydroxym ethyl uridine methyl ester (mchm5U), 5-methoxy carbonylmethyl uridine (mcm5U), 5-methoxy carbonylmethyl-2-thio uridine (mcm5s2U), 5-aminomethyl-2-thio uridine (nm5s2U), 5-methylaminometliyl uridine (mnm5U), 5-methylaminomethyl-2-thio uridine (mnm5s2U), 5-methylannnomethyl-2-seleno uridine (mnm5se2U). 5 -carbamoylmethyl uridine (ncm5U), 5-carboxymethylaminomethyl uridine (cmnm5U), 5-carboxymethylaminomethyl-2-thio uridine (cmnm5s2U), 5-propynyl uridine, 1-propynyl pseudouridine, 5-taurinomethyl uridine (rcni5U), 1-taurinomethyl pseudouridine, 5-taurinomethyl-2-thio uridine (™5s2U), l-taurinomethyl-4-thio pseudouridine, 5-methyl uridine (ra5U, e.g., having the nucleobase deoxy thymine). 1 -methyl pseudouridine (m1^), 5-methyl-2-thio uridine (nrs2U), 1 -methyl -4-tliio pseudouridine (mis4\| / ), 4-thio-l -methyl pseudouridine, 3-methyl pseudouridine (m3\| / ), 2-thio- 1 -methyl pseudouridine, 1-methy 1-1 -deaza pseudo uridine, 2-thio- 1 -methyl- 1 -deaza pseudouridine, dihydrouridine (D), dihydropseudouridine, 5,6-dihydrouridine, 5-methyl dihydrouridine (m5D), 2-thio dihydroundine, 2 -thio dihydropseudoundine, 2 -methoxy uridine. 2-methoxy-4-thio uridine, 4-methoxy pseudouridine, 4-methoxy-2-thio pseudouridme, N^methyl pseudouridine, 3-(3-amino-3-carboxypropyl) uridine (acp3U), l-methyl-3-(3-amino-3-carboxypropyl) pseudouridine (acp3i| / ), 5-(isopentenylaminomethyl) uridine (inm5U), 5-(isopentenylaminomethyl)-2-thio uridine (inm5s2U), a-thio uridine. 2'-O-methyl uridine (Um), 5,2'-O-dimethyl uridine (m5Um), 2'-O-methyl pseudouridine (vm), 2-thio-2'-O-methyluridine (s2Um), 5-methoxycarbonylmethyl-2'-O-metliyl undine (mcnriUm), 5-carbamoylmetliyl-2'-O-methyl uridine (ncm5Um). 5-carboxymethylaminomethyI-2'-O-methyl uridine (cmnm5Um), 3, 2'-0-di methyl undine (m3Um), 5-(isopentenylaminomethyI)-2'-O- methyl uridine (inm5Um), 1-thio uridine, deoxy thymidine, 2'-F-ara uridine. 2'-F uridine, 2'-OH-ara uridine, 5-(2-carbomethoxy vinyl) uridine, and 5-3-(l-E-propenylamino) uridine.

[0026] In some embodiments, the inodRNA includes a modified cytosine selected from the group consisting of 5 -aza cytidine. 6-aza cytidine, pseudoisocytidme, 3 -methyl cytidine (m3C). N4-acetyl cytidine (act), 5-formyl cytidine (PC), N4-methyl cytidine (m4C), 5-methyl cytidine (m5C), 5-halo cytidine (e.g, 5-iodo cytidine), 5 -hydroxymethyl cytidine (hm5C), 1 -methyl pseudoisocytidine, p rrolo-cy tidine, pyrrolo-pseudoisocytidine, 2-thio cytidine (s2C). 2-thio-5-methyl cytidine, 4-thio pseudoisocytidme, 4-thio-l -methyl pseudoisocytidine, 4-thio-l -methyl- 1 -deaza pseudoisocytidine, 1-methyl-l -deaza pseudoisocytidine, zebularine, 5-azazebularine, 5-methyl zebularine, 5-aza-2-thio zebularine, 2-thio zebularine, 2-methoxy cytidine, 2-methoxy-5-methyI cytidine, 4-methoxy pseudoisocytidine, 4-methoxy- 1 -methyl pseudoisocytidine, lysidme (k2C), alpha-thio cytidine, 2'-O-methyl cytidine (Cm), 5,2'-O-dimethyl cytidine (n? Cm), N4-acetyl-2'-O-methyl cytidine (ac4Cm), N4,2'-O-dimethyl cytidine (m4Cm), 5-formyl-2'-O-methyl cytidine (PCm), N4, N4,2'-O-trimethyl cytidine (m Cm), 1-thio cytidine, 2'-F-ara cytidine, 2'-F cytidine, and 2'-OH-ara cytidine.

[0027] In some embodiments, the modRNA includes a modified adenine selected from the group consisting of 2-amrno purine, 2,6-diarmno purine, 2-amino-6-halo purine (<?.g., 2-ammo-6-chloro purine), 6-halo purine (e.g., 6-chloro purine), 2-amino-6-methyl purine, 8-azido adenosine, 7-deaza adenine, 7 -deaza-8-az.a adenine, 7-deaz.a-2-amino purine, 7-deaza-8-aza-2-amino purine, 7-deaza-2,6-diamino purine. 7-deaza-8-aza-2,6-diamino purine, 1 -methyl adenosine (m'A). 2 -methyl adenine (m2A). Nb-methyl adenosine (m6A), 2-methylthio-N6-methyl adenosine (ms m6A), iN6-isopentenyl adenosine (i6A), 2-methylthio-N6-isopentenyl adenosine (ms2i6A), N6-(cis-hydroxyisopentenyl) adenosine (io6A), 2- methylthio-N6-(cis-hydroxyisopentenyl) adenosine (ms2io6A), N6-glycinylcarbamoyl adenosine (g”A). Nc-threonylcarbamoyl adenosine (t6A), N',-methyl-N6-threonylcarbamoyl adenosine (m6t6A), 2-methylthio-N6-threonylcarbamoyl adenosine (ms2g6A), N6, N6-dimethyl adenosine (m6? A), N6-hydroxynon'alyIcarbamoyl adenosine (hn6A), 2-methylthio-N6-hydroxynorvalylcarbamoyl adenosine (ms2hn6A), Nf’-acetyl adenosine (ac6A), 7-methyl adenine, 2-methylthio adenine. 2-methoxy adenine, alpha-thio adenosine. 2'-O-methyI adenosine (Am), N6,2'-O-dimethyl adenosine (m6Am) N6, N6,2'-O-trimethyl adenosine(m62Am), l,2'-0-dimethyl adenosine (nfiAni), 2'-O-ribosyl adenosine (phosphate) (Ar(p)), 2-amino-N6-methyl purine, 1-thio adenosine, 8-azido adenosine, 2'-F-ara adenosine, 2'-F adenosine, 2'-OH-ara adenosine, andN6-(19-amino-pentaoxanonadecyl) adenosine.

[0028] In some embodiments, the modRNA includes a modified guanine selected from the group consisting of inosine (I), 1 -methyl inosine (m1!), wyosine (imG), methyl wyosine (mimG), 4-demethyl wyosine (imG-14), isowyosine (imG2), wybutosine (yW), peroxywybutosine (oj W), hydroxywybutosine (OHyW), undermodified hydroxywybutosine (OHyWy). 7-deaza guanosine, queuosine (Q), epoxyqueuosine (oQ), galactosyl queuosine (galQ), mannosyl queuosine (manQ), 7-cyano-7-deaza guanosine (preQo), 7-aminomethyl-7-deaza guanosine (preQi), archaeosine (G I. 7-deaza-8-aza guanosine, 6-thio guanosine. 6-thio-7-deaza guanosine, 6-thio-7-deaza-8-aza guanosine, 7-methyl guanosine (m'G), 6-thio-7-methyl guanosine, 7-methyl inosine, 6-methoxy guanosine, 1 -methyl guanosine (nfG), N2-methyl-guanosine (tn til. N2, N2-dimethyl guanosine (m22G), N2,'-dimethyl guanosine (m2''G), N2, Ni7-dimethyl guanosine (m2-2’7G), 8-oxo guanosine, 7-methyl-8-oxo guanosine. 1-methio guanosine. N2-methyl-6-thio guanosine. N2. N2-dimethyl- 6-thio guanosine, alpha-thio guanosine, 2'-O-methyl guanosine (Gm), N2-methyl-2'-O-methyl guanosine (m2Gm). N2, N2-dimethyl-2'-O-methyl guanosine (mAGm), l-methyl-2'-O-methy] guanosine (m’Gm), N2, / -dimethyl-2'-O-methyl guanosine (m2,7Gm), 2'-O-methyl inosine (Im), l,2'-O-dimethyl inosine (m’lni). 2'-O-ribosyl guanosine (phosphate) (Gr(p)). 1-thio guanosine, O6-methyl guanosine, 2'-F-ara guanosine, and 2'-F guanosine

[0029] modRNA may include, for example, a non-natural or modified nucleotide. The non-natural or modified nucleotide may include, for example, a backbone modification, sugar modification, or base modification. The non-natural or modified nucleotide may include, for example, base modification. In some embodiments, the base modification is selected from the group consisting of 2-amino-6-chloropurine riboside 5' triphosphate. 2-aminoadenosine 5' triphosphate, 2-thiocytidme 5' triphosphate, 2 -thiouridine 5' triphosphate, 4-thiouridine 5' triphosphate, 5 -aminoallyl cytidine 5' triphosphate, 5-aminoallyluridine 5' triphosphate, 5-bromocytidine 5' triphosphate. 5-bromouridme 5' triphosphate, 5-iodocytidine 5' triphosphate, 5-iodouridine 5' triphosphate, 5-methylcytidme 5' triphosphate, 5-methyluridme 5' triphosphate, 6-azacytidine 5' triphosphate, 6-azauridine 5' triphosphate, 6-chloropurine riboside 5 '-tri phosphate, 7-deazaadenosine 5' triphosphate, 7-deazaguanosine 5' triphosphate, 8-azaadenosine 5' triphosphate, 8-azidoadenosine 5' triphosphate, benzimidazole riboside 5' triphosphate. N1-methyladenosine 5' triphosphate. N^-methylguanosine 5' triphosphate, N6-methyladenosine 5' triphosphate, O6-methylguanosine 5' triphosphate, N'-methyl-pseudoundine 5' triphosphate, puromycin 5 '-triphosphate, and xanthosine 5' triphosphate. Thus, according to some embodiments, the modRNA includes N'-methyl-pseudouridine 5' triphosphate.

[0030] Unless otherwise specified herein, the term ribonucleotide, ribonucleotide molecule, polyribonucleotide, and nucleotide when referring to a ribonucleotide, nucleotide molecule when referring to a ribonucleotide molecule, and polynucleotide when referring to a polyribonucleotide as evinced by context, may include any one or more of the foregoing modifications or examples of modRN A

[0031] An RNA molecule, such as mRNA or a modRNA as disclosed herein, may typically include a 5' UTR upstream of an open reading frame, which is followed by a 3' UTR. An open reading frame (ORF) may be a sequence of several nucleotide triplets, referred to as codons, which may be translated into a peptide or protein, each codon coding for a given ammo acid in the translated protein or peptide product. An open reading frame typically includes a start codon, i.e. a combination of three subsequent nucleotides coding usually for the amino acid methionine (AUG), at the ORF’s 5'-end and a subsequent region, which usually exhibits a length which is a multiple of 3 nucleotides, or codons. The 5'-most nucleotide of an ORF, such as the A of an AUG start codon, is referred to as being in the +1 position, the next, e.g. the U of an AUG start codon is referred to as being in the +2 position, etc. The nucleotide immediately 5 'to the start codon is described as being in the -1 position, the next being in the -2 position, etc. An ORF may terminated by a stop-codon (e.g., UAA, UAG, UGA). An open reading frame may also be termed “(protein) coding sequence” or “coding sequence”

[0032] The term “UTR” refers to an “untranslated region” located upstream (5') and / or downstream (3') of a coding region of a nucleic acid molecule as described herein, thereby typically flanking said coding region. Accordingly, the term “UTR” generally encompasses 3'untranslated regions (“3'-UTRs”) and 5'-untranslated regions (“5'-UTRs”). UTRs may ty pically include or consist of nucleic acid sequences that are not translated into protein. Typically, UTRs include “regulatory' elements”. The term “regulatory element” refers to a nucleic acid sequences having gene regulatory activity, the ability to affect the expression, in particular transcription or translation, of an operably (in cis or trans) linked transcribable nucleic acid sequence. The term includes promoters, enhancers, internal ribosomal entry' sites (IRES), introns, leaders, transcription termination signals, such as polyadenylation signals and poly-U sequences and other expression control elements.Regulatory elements may act constitutively or in a time- and / or cell specific manner.Optionally, regulatory elements may exert their function via interacting with (e.g. recruiting and binding of) regulatory' proteins capable of modulating (inducing, enhancing, reducing, abrogating, or preventing) expression, in particular protein translation. UTRs are preferably “operably linked”, i.e. placed in a functional relationship, to a coding region, preferably in a manner that allows them to control (i.e. modulate or regulate, preferably7enhance) the expression of said coding sequence.

[0033] The term “5'-UTR” refers to a part of a nucleic acid molecule, which is located 5' (i.e. “upstream”) of an open reading frame and which is not translated into protein. A 5'-UTR is the series of ribonucleotides that starts with the transcriptional start site and ends one nucleotide before the start codon of the open reading frame. The 5'-UTR may include regulatory elements, which may include, for example, ribosomal binding sites. The 5'-UTR may include a 5'-Cap. Thus, 5'-UTRs may correspond to the sequence of a polyribonucleotide located between the 5'-Cap and the start codon, and more specifically to a sequence, which extends from a nucleotide located 3' to the 5'-Cap, preferably from the nucleotide located immediately 3' to the 5'-Cap. to a nucleotide located 5' to the start codon of the ORF, preferably to the nucleotide located immediately' 5' to the start codon of the protein coding sequence. The nucleotide located immediately73' to the 5'-Cap of a mature mRNA ty pically7corresponds to the transcriptional start site. 5' UTRs ty pically7have a length of less than 500, 400, 300, 250 or less than 200 nucleotides, in some embodiments its length may be in the range of at least 10, 20, 30 or 40, preferably up to 100 or 150, nucleotides.

[0034] A 5' UTR as disclosed herein may include a Kozak sequence, or the portion of a Kozak sequence that is 5' to a start codon such as AUG. A Kozak sequence is a sequence known to occur in eukaryotic mRNA and has the consensus (gcc)gccRccAUGG. The Kozak consensus sequence plays a major role in the initiation of the translation process. This sequence in an mRNA molecule is recognized by the ribosome at the translational start site, from which a protein is coded by that mRN A molecule. The ribosome requires this sequence, or a possible variation thereof to initiate translation. The sequence is identified by the notation (gcc)gccRccAUGG as follows: a lower case letter denotes the most common base at a position where the base can nevertheless vary; upper case letters indicate highly conserved bases, i.e. the “AUGG” sequence is constant or rarely, if ever, changes, “R” which indicates that a purine (adenine or guanine) is always observed at this position; and the sequence in parentheses ((gcc)) is of uncertain significance.

[0035] The Kozak consensus sequence was originally defined as ACCAUGG due to an analysis of point mutations around the initiation codon (AUG, with A defining in thiscontext the position +1) on translation of the preproinsulin gene. More detailed mutagenesis of 699 vertebrate mRNAs resulted in the consensus sequence GCCGCCACCAUGG, where the A upstream the AUG start codon at position -3 could instead be a G (Nucleic Acids Res., 1987, 15 (20): 8125-8148), Studies on preproinsulin and alpha-globin translation in eukaryotic cells revealed that a purine (usually A) at position -3 is essential for efficient translation initiation and if this purine is missing a G at position +4 is essential (J. Cell Biol., 1989, 108:229-41). The amount of protein synthesized from an mRNA molecule strongly depends on the sequence of the Kozak element: the AUG start codon, encoding the N-terminal methionine of the protein, is most important. For a strong consensus, the nucleotides at positions +4 (G) and -3 (A or G) must both match the consensus. An adequate consensus sequence has only one of these two sites, while a weak consensus sequence does neither fulfill the requirements at positions +4 nor on ~3. The two cytidine residues at ~1 and -2 are not that much conserved (Cell, 1986, 44 (2):283-92), while the G at position -6 is important for the initiation of translation (Br. J. Haematol., 2004, 124 (2):224-31).

[0036] 5' UTR sequences disclosed herein (e.g., SEQ ID NO: 1. SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 6) include, at their 3' termini, ending at position - 1, i.e., one nucleotide 5' to a start codon, which start codon is not included in the aforementioned sequences, the following Kozak sequence segment: GCCGCCACC.However, any one of SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 6 may be modified to include a different Kozak sequence from that recited in the aforementioned SEQ IDs, provided the different Kozak sequence corresponds to (gcc)gccRcc or gccRcc as described above, wherein R may be G or A.

[0037] Also disclosed herein is a DNA molecule encoding an RNA molecule having any 5' UTR disclosed herein The DNA molecule may be included in a vector such as a plasmid or cosmid, transgenic organism such as a bacteria, an artificial chromosome, or a viral vector. The DNA molecule may be an oligonucleotide. Optionally, the DNA molecule may include one or more sequence promoting transcription of an RNA molecule, such that an RNA molecule including a 5' UTR as disclosed herein may be produced by a cell that includes the DNA molecule. A vector may contain the necessary elements that permit transcribing an RNA molecule from the DNA molecule, and, optionally, translating the transcript into a polypeptide. A vector may be an episomal vector (i.e., does not integrate into the genome of a host cell), or can be vectors that integrate into the host cell genome. Ihe term vector may thus also be defined as a gene delivery vehicle that facilitates gene transfer into a target cell. This definition includes both non-viral and viral vectors. Non-viral vectors,including either a DNA or RNA payload, include but are not limited to cationic lipids, liposomes, nanoparticles, PEG, PEI. plasmid vectors (e.g. pUC vectors, bluescript vectors (pBS) and pBR322 or derivatives thereof that are devoid of bacterial sequences (mini circles)) transposons-based vectors (e.g. PiggyBac (PB) vectors or Sleeping Beauty (SB) vectors), etc. Viral vectors are derived from viruses and include but are not limited to retroviral, lentiviral, adeno-associated viral, adenoviral, herpes viral, hepatitis viral vectors or the like. Typically, but not necessarily, viral vectors are replication-deficient as they have lost the ability to propagate in a given cell since viral genes essential for replication have been eliminated from the viral vector.

[0038] A vector may be an adeno-associated viral (AAV) vector. AAV vectors are preferably used as self-complementary, double-stranded AAV vectors (scAAV) in order to overcome one of the limiting steps in AAV transduction (i.e. single-stranded to doublestranded AAV conversion) (McCarty, 2001, 2003; Nathwani et al, 2002, 2006, 2011; Wu at al,, 2008), although the use of single-stranded AAV vectors (ssAAV) are also encompassed herein. AAV serotype 9 (AAV9) is ideally suited to achieve efficient transduction in heart and skeletal muscle. Accordingly, a vector may be an AAV9 vector, including a self-complementary AAV9 vector (scAAV9). A vector may be anon-viral vector, such as a plasmid, a minicircle, or a transposon-based vector, such as a Sleeping Beauty(SB)-based vector or piggy Bac(PB)-based vector.

[0039] Disclosed herein is a cell transfected with or expressing any of the foregoing polynucleotides, and a method of transfecting a cell with any of the foregoing polynucleotides, including by contacting the cell or an organism with any of the foregoing vectors or any of the foregoing polynucleotides. The cell may be a cardiomyocyte.

[0040] An RNA may be administered on its own or may be included together with other components as part of a nanoparticle and administered as part of such a nanoparticle. A nanoparticle is a composition of matter having a nanoscale-dimension size, such as a diameter from about 1 nm to about 100 nm, though may refer to compositions having a larger diameter as well, such as up to 500 nm. A nanoparticle may provide enhanced cellular uptake and stability of an RNA molecule. Packaging an RNA molecule in a nanoparticle may protect it from extracellular degradation processes that may otherwise occur following, for example, systemic or other administration of an RNA molecule, thereby increasing cellular uptake by prolonging the time period between administration of the RNA molecule and when it is taken up by a cell.

[0041] A nanoparticle may also improve cellular uptake by providing a mechanism for cellular entry, such as fusion of a nanoparticle's membrane with a cellular membrane for delivery of the nanoparticle’s payload to an intracellular compartment. A variety of materials are known to be suitable for nanoparticles for intracellular delivery of their payloads such as lipid or phospholipid micelles or liposomes, metal nanoparticles, such as gold, aluminum, iron nanoparticles, polyacrylamide, polyacrylate, or chitosan nanoparticles, a polymer-based nanoparticle such as a poly lactic-co-glycolic nanoparticle, may be used in accordance with the present disclosure, with an RNA molecule packaged in any type of nanoparticle suitable for an intended purpose, synthesized according to standard methods.

[0042] A nanoparticle including an RNA molecule with a 5' UTR as disclosed herein, or a DNA molecule encoding such an RNA molecule, may include a lipoplex or a lipid nanoparticle (LNP). LNPs ty pically include four components: ionizable cationic lipids, neutral lipids such as phospholipids, a steroid such as cholesterol, and a polymer conjugated lipid such as polyethylene glycol (PEG)-lipids. Each component is responsible for payload protection, and enables effective intracellular delivery. LNPs may be prepared by mixing lipids dissolved in ethanol rapidly with nucleic acid in an aqueous buffer. The LNP may include any lipid capable of forming a particle to which the one or more nucleic acid molecules are attached, or in which the one or more nucleic acid molecules are encapsulated. An LNP may include one or more cationic lipids, and one or more stabilizing lipids.Stabilizing lipids include neutral lipids and pegy dated lipids. An LNP may include a cationic lipid, a neutral lipid, a steroid, a polymer conjugated lipid; and the RNA molecule or DNA molecule, encapsulated within or associated with the lipid nanoparticle.J 0043 ] Included in the present disclosure is a method of treating a subject including administering a polynucleotide having or encoding any 5' UTR disclosed herein. As used herein, the terms ’‘treatment” or “treating,” or “palliating” or “ameliorating” refer to an approach for obtaining beneficial or desired results including but not limited to therapeutic benefit and / or a prophylactic benefit. A polynucleotide as disclosed herein may be administered to treat a subject for or following myocardial infarction or heart failure. For example, the method may include administering the polynucleotide to a subject, wherein the subject suffered a myocardial infarction or suffers from heart failure. The polynucleotide may include RNA, or DNA, and may be a nanoparticle such as a lipid nanoparticle or lipoplex, or may be a vector such as any viral vector disclosed herein. Administering may include administering intravenously, administering by intramyocardial injection.

[0044] Various examples of transgenes expressed in heart tissue or cardiomyocytes have been shown to improve or repair cardiac function following cardiac ischemia or heart failure. See for example US Patent No. 11,299,749 and US Patent Application Publication Nos. 2021 / 0000975 1, 2022 / 0339246A1, and 2024 / 0100188 Al, the entire contents of which patent and applications are hereby incorporated by reference herein in their entireties for all purposes.

[0045] A coding sequence of an RNA disclosed herein may encode a cell cycle inducer protein. Expression of a cell cycle inducer protein following transfection with a polynucleotide as disclosed herein may promote cardiomyocyte growth and promote beneficial cardiac remodeling following heart injury such as a cardiac ischemic event. Cell cycle inducer proteins may include, without limitation, Lin28, Pyruvate Kinase Muscle Isozyme M2 (Pkm2). p-catenin, caERBB2, Yes Associated Protein 1 (YAP), Cyclin DI, and c-Myc.

[0046] A coding sequence of an RNA disclosed herein may encode Lin28, Lin28 is a suppressor of Let7 that controls cell cycle regulators Treatment of cardiomyocytes post- myocardial infarction using modRNA constructs encoding Lin28 induces cardiomyocyte proliferation, reduce apoptosis, and increase capillary density Transfecting cardiomyocytes or heart tissue with a polynucleotide as disclosed herein having an ORF that encodes Lin28 may be an effective treatment for cardiac ischemia or heart failure in a subject in need of such treatment.

[0047] A coding sequence of an RNA disclosed herein may encode Pyruvate Kinase Muscle Isozyme M2 (Pkm2). Pkm2 is a pro-proliferative factor, highly expressed in regenerative fetal and early neonatal cardiomyocytes. In the cytoplasm, Pkm2 shifts the metabolic fate from glycolysis to pentose phosphate pathway (“PPP”) by reducing the conversion of phosphoenolpyruvate to pyruvate, which leads to the accumulation of glucose, a glycolysis intermediate, and activation of PPP via Glucose-6-phosphate dehydrogenase (G6pd). PPP pathway activation leads to the synthesis of nucleotides, amino acids, and lipids and the production of reduced NADPH, increase nitric oxide synthase and DNA repair In the nucleus, Pkm2 directly interacts with the transcription factors p-catenin and Hifla. This interaction promotes the expression of genes such as in Ccdnl, c-Myc and Vegfa, and Bcl2. Restoration of Pkm2 levels using modRNA into adult cardiomyocytes post-myocardial infarction significantly and exclusively induces cardiomyocyte proliferation; associated with improved cardiac function, reduced scar size, and increased heart to body weight ratio; reduce cardiomyocyte size; reduce apoptosis; and increase capillary density.Transfecting cardiomyocytes or heart tissue with a polynucleotide as disclosed herein having an ORF that encodes Pkm2 may be an effective treatment for cardiac ischemia or heart failure in a subject in need of such treatment.

[0048] A coding sequence of an RNA disclosed herein may encode P-catenin. p-catenin is a subunit of the cadherin protein complex and acts as an intracellular signal transducer in the Wnt signaling pathway. In cardiac muscle, P-catenin localizes to adherens junctions in intercalated disc structures, which are critical for electrical and mechanical coupling between adjacent cardiomyocytes. Loss of β-catenin during early heart formation results in multiple heart defects and lethality demonstrating its crucial function for embryonic heart development. In adults, p-catenin signaling plays an important role in normal and stress-induced cardiac hypertrophic remodeling. Wnt / β-catenin signaling may function in a stage-specific biphasic manner, either promoting or inhibiting cardiogenesis. Transfecting cardiomyocytes or heart tissue with a polynucleotide as disclosed herein having an ORF that encodes P-catenin may be an effective treatment for cardiac ischemia or heart failure in a subject in need of such treatment.

[0049] A coding sequence of an RNA disclosed herein may encode ERBB2 (erb-b2 receptor tyrosine kinase 2). ERBB2 forms a heterodimer with other epidermal growth factor receptor ty rosine kinase family members. ERBB2 is required for cardiomyocyte proliferation at embryonic / neonatal stages. Transient induction of a constitutively active ERBB2 (caERBB2) for 10-20 days after ischemic injury, either in juvenile or adult hearts, has been shown to trigger a series of events starting with cardiomyocyte dedifferentiation, proliferation, neovascularization and, after ERBB2-signaling termination, proceeding to cardiomyocyte re-differentiation that together lead to anatomical and functional heart regeneration. Transfecting cardiomyocytes or heart tissue with a polynucleotide as disclosed herein having an ORF that encodes ERBB2 may be an effective treatment for cardiac ischemia or heart failure in a subject in need of such treatment.

[0050] A coding sequence of an RNA disclosed herein may encode Yes Associated Protein 1 (YAP). YAP is a transcriptional coactivator, whose activation in adult cardiomyocytes has been shown to increases cardiomyocyte proliferation and improve cardiac function after myocardial infarction in mice. Transfecting cardiomyocytes or heart tissue with a polynucleotide as disclosed herein having an ORF that encodes YAP may be an effective treatment for cardiac ischemia or heart failure in a subject in need of such treatment.

[0051] A coding sequence of an RNA disclosed herein may encode Cyclin D1. Cy clin DI is a regulatory subunit of CDK4 and CDK6, whose activity is required for cell cycle Gl / Stransition. Overexpression of cyclin DI results in an increase in CDK4 levels in the adult myocardium, as well as modest increases in proliferating cell nuclear antigen and CDK2 levels. Expression of cyclin DI promotes cell cycle reentry of cardiomyocytes in adult hearts. Transfecting cardiomyocytes or heart tissue with a polynucleotide as disclosed herein having an ORF that encodes Cyclin DI may be an effective treatment for cardiac ischemia or heart failure in a subject in need of such treatment.

[0052] A coding sequence of an RNA disclosed herein may encode cMyc. cMyc is highly expressed in fetal, proliferating cardiac myocytes. Although expressed at low levels in the adult heart under normal physiological conditions, c-Myc expression is rapidly upregulated in response to hypertrophic stimuli. Activation of cMyc in adult myocardium provokes cell cycle reentry in post-mitotic myocytes. Transfecting cardiomyocytes or heart tissue with a polynucleotide as disclosed herein having an ORF that encodes cMyc may be an effective treatment for cardiac ischemia or heart failure in a subject in need of such treatment.

[0053] A coding sequence of an RNA disclosed herein may encode one or more of a cardiac reprogramming gene and a reprogramming helper gene. Examples of cardiac reprogramming genes or proteins they encode include GATA Binding Protein 4 (Gata4), Myocyte Enhancer Factor 2C (Mef2c), T-box 5 (Tbx), and Heart- and neural crest derivatives-expressed protein 2 (Hand2). Examples of cardiac reprogramming helper genes or proteins they encode include, Dominant Negative (DN) transforming growth factor beta (DN-TGFβ). DN-Wingless-related integration site 8a (DN-Wnt8a). and Acid ceramidase (AC). Transfection of heart tissue cells with a polynucleotide disclosed herein including, for example, an ORF’ encoding one or more of the foregoing cardiac reprogramming genes or reprogramming helper genes as gene of interest may promote cardiac regeneration, remodeling, and function following an insult such as a cardiac ischemic event.

[0054] A coding sequence of an RNA disclosed herein may encode ty pe 2 phosphatidylinositol-5-phosphate 4-kinase gamma (pip4k2c, used herein to refer to a polynucleotide coding for the protein phosphatidylinositol-5-phosphate 4-kinase type 2 gamma (PI5P4Ky). Pip4k2c is a type 2 phosphatidylinositol-5-phosphate 4-kinase (PI5P4K), which converts phosphatidylinositol-5-phosphate to phosphatidylinositol 4, 5 -bisphosphate in mammals. The mammalian gene PI5P4K encodes for three enzy mes - PI5P4Ka, PI5P4KP, and PI5P4Ky. Pip4k2c inhibits mTORC1-signaling. The mTORCl signaling pathway is one of the main signaling pathways that induce cardiac hypertrophy after pressure overload Moreover, TGF-p signaling plays an important role in the pathogenesis of cardiac fibrosis, and increased expression of Pip4k2c significantly attenuates and / or prevents cardiachypertrophy and fibrosis in the failing heart and improved cardiac function via inhibition of mTORC1 and TGF-β activity. TGFβ1. is pro-fibrotic, increases after cardiac ischemic injury and can lead to cardiomyocyte cell death. As the TGFpi and, in some cases, mTORCl pathways are crucial to other fibrotic diseases, such as pulmonary’ fibrosis and chronic renal fibrosis, uptake of an RNA molecule disclosed herein including a coding sequence for phosphatidylinositol-5-phosphate 4-kinase type 2 gamma may be useful in treating such fibroses. Transfecting cardiomyocytes or heart tissue with a polynucleotide as disclosed herein having an ORF that encodes pip4k2c may be an effective treatment for cardiac ischemia or heart failure in a subject in need of such treatment.

[0055] A coding sequence of an RNA disclosed herein may encode a ceramidase. Ceramidase is an enzy me that cleaves fatty’ acids from ceramide, producing sphingosine (SPH), which in turn is phosphorylated by a sphingosine kinase to form sphingosine- 1 -phosphate (SIP). Ceramidase is the only’ enzy me that can regulate ceramide hydrolysis to prevent cell death and S1PK is the only enzyme that can synthesize sphingosine 1 phosphate (SIP) from sphingosine (the ceramide hydrol sis product) to initiate cell survival. S1PR. a G protein-coupled receptor binds the lipid-signaling molecule S 1 P to induce cell proliferation, survival, and transcriptional activation. Seven human ceramidases encoded by 7 distinct genes have been cloned: acid ceramidase (ASAHI), associated with cell survival; neutral ceramidase (AS AH2, ASAH2B, ASAH2C). protective against inflammatory cytokines; alkaline ceramidase 1 (ACER1), mediating cell differentiation by controlling the generation of SPH and SIP; alkaline ceramidase 2 (ACER2), important for cell proliferation and survival; and alkaline ceramidase 3 (ACER3). Transfecting cardiomyocytes or heart tissue with a polynucleotide as disclosed herein having an ORF that encodes a ceramidase may be an effective treatment for cardiac ischemia or heart failure in a subject in need of such treatment

[0056] Any polynucleotide as disclosed herein, such as for treatment of myocardial infarction or heart failure, may be administered to a subject by’ direct injection to the heart. It may be administered to a subject systemically, such as intravenously. It may include a nanoparticle which, in some cases, may promote stability of the polynucleotide or promote access to or uptake by a target cell such as a cardiomyocyte. It may be administered repeatedly to a subject, or only once. It may be administered daily’, or every’ two, three, four, or more days, or on repeated days separated by different directions from each other, depending on a desired frequency of administration or peak expression of a protein encoded by the ORF.

[0057] Compositions of the present invention may be administered orally, parenterally, by inhalation, topically, rectally, nasally, buccally. sublingually, vaginally or via an implanted reservoir. The term “parenteral” as used herein includes subcutaneous, intravenous, intramuscular, intra-articular, intra-synovial, intrastemal, intrathecal, intrahepatic, intralesional and intracranial injection or infusion techniques. In some embodiments, compositions may be administered orally, intraperitoneally or intravenously. Sterile injectable forms of compositions may be aqueous or oleaginous suspension Suspensions may be formulated according to techniques known in the art using suitable dispersing or wetting agents and suspending agents. A sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally acceptable diluent or solvent. Among acceptable vehicles and solvents that may be employed are water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixed oils may be employed as a solvent or suspending medium. Pharmaceutically acceptable compositions may be orally administered in any orally acceptable dosage form including capsules, tablets, aqueous suspensions or solutions.

[0058] An in vivo dosage unit (e.g., for contacting target cells within a subject) may include from, for example, 1 to 100 pg, 10 to 100 pg, 15 to 100 pg, 20 to 100 pg, 25 to 100 pg, and 1 to 200 pg (e.g, 1 pg, 2 pg, 3 pg, 4 pg, 5 pg, 6 pg, 7 pg, 8 pg, 9 pg, 10 pg, 11 pg, 12 pg, 13 pg, 14 pg, 15 pg, 20 pg, 25 pg, 30 pg, 35 pg. 40 pg, 45 pg, 50 pg. 55 pg, 60 pg, 65 pg, 70 pg. 75 pg. 80 pg, 85 pg, 90 pg, 95 pg, 100 pg, 110 pg. 120 pg, 130 pg, 140 pg.150 pg, 160 pg, 170 pg, 180 pg, 190 pg. 200 pg of any RNA molecule as disclosed herein, including in an example a nanoparticle, as disclosed herein. In an example, a dosage unit may include, for example, 1 to 10 mg, 1 to 20 mg, 1 to 30 mg, 1 to 40 mg, 1 to 50 mg, 1 to 60 mg, 1 to 70 mg. 1 to 80 mg, 1 to 90 mg, 1 to 100 mg, 10 to 100 mg, 20 to 100 mg, 30 to 100 mg, 40 to 100 mg, 50 to 100 mg, 60 to 100 mg, 70 to 100 mg, 80 to 100 mg, and 90 to 100 mg (e.g., 1 mg, 2 mg, 3 mg, 4 mg, 5 mg, 6 mg, 7 mg, 8 mg, 9 mg, 10 mg, 11 mg, 12 mg, 13 mg, 14 mg, 15 mg, 16 mg, 17 mg, 18 mg, 19 mg, 20 mg, 25 mg, 30 mg, 35 mg, 40 mg, 45 mg, 50 mg, 55 mg. 60 mg. 65 mg, 70 mg, 75 mg, 80 mg, 85 mg, 90 mg, 95 mg, 100 mg of any RNA molecule disclosed herein, including in an example a nanoparticle, as disclosed herein.

[0059] The following nucleotide sequences of 5' UTR are referred to in the present disclosure:SEQ ID NO: 1, the 3'-most nucleotides of Top Heart: CCCCCGCCCCCGCCGCCACC SEQ ID NO: 2, referred to herein as Top Heart:CCCCCCCCCCGCCCCCGGCGCCCCCGCCCCCGCCGCCACCSEQ ID NO: 3, referred to herein as Top Heart B:CCCCCCCGGCGGCCGCGGCGCCCCCGCCCCCGCCGCCACC SEQ ID NO: 4, used as a positive control 5' UTR herein:AAATAAGAGAGAAAATAAGAGTAAGAAGAAATATAAGAGCCACC SEQ ID NO: 5, referred to herein as Top Cardiomyocyte or Top CM:CCCCCCCGGCGGCCGCGGCGGGGCCCGCCCCGCCGCCACC SEQ ID NO: 6:, referred to herein as Top Elevated Heart:CCGCCCCCGCGGCCCCGGCCCGGCCGGCCCCGCCGCCACC SEQ ID NO: 7, referred to herein as Top Heart A:CCCCCCCCCCGCCCCCGGCGGGGCCCGCCCCGCCGCCACC

[0060] Any of the foregoing 5' UTR sequences may include a single nucleotide substitution wherein the single nucleotide substitution includes substitution of a nucleotide other than the nucleotide identified in the foregoing sequences at any position of the polynucleotide, provided the Kozak sequence is maintained,

[0061] Top Heart A includes the first, 5 '-most 20 nucleotides from 5' UTR Top Heart and the last, 3'-most 20 nucleotides of 5' UTR Top CMs. Top Heart B includes the last, 3'- most 20 nucleotides from 5' UTR Top Heart and the first, 5'-most 20 nucleotides of 5' UTR Top CMsEXAMPLES

[0062] The following examples are intended to illustrate particular embodiments of the present disclosure, but are by no means intended to limit the scope thereof10063 ] Material and Methods

[0064] Identification of 5' UTR Top heart. Top CMs and Top Elevated Heart.Assessment of the frequency of different mRNA ribonucleotide (A, U, T, and C) to appear in each position (40 to 1 ribonucleotide before start codon) was done using 5' UTR of a 1000 genes that are highly expressed in the heart (for 5' UTR Top heart) or specifically in cardiomyocytes (for 5' UTR Top CMs). 5' UTR of 348 genes that are elevated in the human heart post heart attack was used to create the 5' UTR of Top Elevated Heart. For more details, please see attached excel sheet.

[0065] Construction of DNA templates and synthesis of synthetic of mRNA. Clean PCR products generated with plasmid templates of nGFP or Luc carry ing different 5' UTRs, purchased from GenScript, were used as the template for mRNA. modRNAs were generated by transcription in vitro with a customized ribonucleoside blend of Cleancap AG (TrilinkBiotechnologies): GTP; ATP; CTP (Life Technologies) and Nl-methylpseudouridine-50- triphosphate (Trilink Biotechnologies). The mRNA was purified either with the MEGA clear kit (Life Technologies) according to the manufacturer’s instructions or using Amicon Ultra-4 Centrifugal Filter Unit 4 mL 10 kDa (Millipore Sigma). The mRNA was quantified using a NanoDrop spectrometer (Thermo Scientific). The open reading frame for the Luc and nGFP modRNA is listed below.

[0066] Neonatal mouse CM isolation and FACS analysis. CMs from El 8 fetal C57BL / 6 mice hearts were isolated using multiple rounds of digestion with 0.14-mg / mL collagenase II (Invitrogen). After each digestion, the supernatant was collected in horse serum (Invitrogen). Total cell suspension was centrifuged at 300 g for 5 min. Supernatants were discarded and cells were resuspended in DMEM (GIBCO) medium with 0.1 mM ascorbic acid (Sigma), 0.5% Insulin-Transferrin-Selenium (100X), penicillin (100 U / mL) and streptomycin (100 pg / mL). Cells were plated in plastic culture dishes for 90 min until most of the non-myocytes attached to the dish and myocytes remained in suspension. Myocytes were then seeded at 1 x 105 cells / well in a 24-well plate. Isolated CMs were incubated for 48 hrs in DMEM medium containing 5% horse serum plus Ara c. After incubation, cells were transfected with nGFP modRNAs carrying different 5' UTRs. 24 hours later cells were collected and FACS analysis was performed to evaluate GFP expression in the cells post different treatments.

[0067] Bioluminescence imaging

[0068] Luc modRNA carrying different 5' UTRs were directly injected into the myocardium of CFW mice Bioluminescence imaging of the injected mice was taken 24- and 48-hours post modRNA delivery. Prior to bioluminescence imaging, mice were anesthetized with isoflurane (Abbott Laboratories), and D-Luciferin Potassium Salt (Perkin Elmer, #122799) was injected intraperitoneally at 150 mg / kg body weight. Mice were imaged using an IVIS100 charge-coupled device imaging system every 2 min until the Luc signal reached a plateau. Imaging data were analyzed and quantified with Living Image software 2.0. Cardiac tissues from mice injected with only Luciferin served as a baseline reading for Luc expression.

[0069] Results

[0070] modRNA of nGFP or Luc was made with different 5' UTRs

[0071] Neonatal mouse CM were isolated from Pl mice and isolated cells were plated in 6 well plate. At day four post isolation cells were transfected with nGFP modRNA carrying different 5' UTRs. One day later, were collected, and FACS analysis was used toevaluated GFP expression. FIG. 1. Quantification of GFP Median Fluorescence Intensity (MFI) based on the experiment on A (n=3). One-way ANOVA. Tukey's Multiple Comparison Test was used.

[0072] FIG 2 A. Delivery' of naked Luc modRNA carrying different 5' UTRs directly into the heart in an open chest surgery. I VIS system was used to evaluate Luc expression in the heart one and two days post-delivery'. B. Quantification of Luc expression based on the experiment on A (n=6-8). One-way ANOVA. Tukey's Multiple Comparison Test -was used,

[0073] FIG. 3. 5' UTRs of different nGFP modRNA was compared for their ability to promote modRNA translation in neonatal CMs. Neonatal mouse CM were isolated from P1 mice and isolated cells were plated in 24 well plate. At day four post isolation cells were transfected with nGFP modRNA carrying different 5' UTRs. One day later, cells were collected, and FACS analysis was used to evaluated GFP expression. FIG. 3. Quantification of GFP Median Fluorescence Intensity (MFI) based on the experiment on B using the 5' UTR that presented in A (n=4). One-way ANOVA, Tukey’s Multiple Comparison Test was used.

[0074] 5' UTRs of different nGFP modRNA was compared for their ability' to promote modR A translation m neonatal CMs. Human 1PS derived CMs were plated in 24 well plate. At day four post isolation cells were transfected with nGFP modRN carrying different 5' UTRs. One day' later, cells were collected, and FACS analysis was used to evaluated GFP expression. FIG. 4. Quantification of GFP Median Fluorescence Intensity (MFI) using the indicated 5' UTRs (n=8). One-w'ay ANOVA. Tukey's Multiple Comparison Test was used.

[0075] Top Heart (SEQ ID NO: 2) and Top Heart B (SEQ ID NO: 3), both of which include the twenty 3'-most nucleotides of Top Heart (SEQ ID NO: 1), whose 3'-most nucleotides were at RNA position -1, adjacent to the start codon of an ORF, significantly increased translation compared to control (SEQ ID NO: 4).

[0076] Nucleotide sequences of ORFs are presented in Table 1:Luc ORF ATGGCCGATGCTAAGAACATTAAGAAGGGCCCTGCTCCCTTCTACCC SEQ ID NO: TCTGGAGGATGGCACCGCTGGCGAGCAGCTGCACAAGGCCATGAAG 8 AGGTATGCCCTGGTGCCTGGCACCATTGCCTTCACCGATGCCCACATT GAGGTGGACATCACCTATGCCGAGTACTTCGAGATGTCTGTGCGCCT GGCCGAGGCCATGAAGAGGTACGGCCTGAACACCAACCACCGCATC GTGGTGTGCTCTGAGAAC TCTCTGC AGTTCT TCATGCC AGTGCTGGGC GCCCTGTTCATCGGAGTGGCCGTGGCCCCTGCTAACGACATTTACAA CGAGCGCGAGCTGCTGAACAGCATGGGCATTFCTCAGCCTACCGTGG TGTTCGTGTCTAAGAAGGGCCTGCAGAAGATCCTGAACGTGCAGAAG AAGCTGCCTATCATCCAGAAGATCATCATCATGGACTCTAAGACCGA CTACCAGGGCTTCCAGAGCATGTACACATTCGTGACATCTCATCTGCCTCCTGGCTTCAACGAGTACGACTTCGTGCCAGAGTCTTTCGACAGGG ACAAAACCATTGCCCTGATCATGAACAGCTCTGGGTCTACCGGCCTG CCTAAGGGCGTGGCCCTGCCTCATCGCACCGCCTGTGTGCGCTTCTCT CACGCCCGCGACCCTATТТТCGGCAACCAGATCATCCCCGACACCGC TATTCTGAGCGTGGTGCCATTCCACCACGGCTTCGGCATGTTCACCAC CCTGGGCTACCTGATTTGCGGCTTTCGGGTGGTGCTGATGTACCGCTT CGAGGAGGAGCTGTTCCTGCGCAGCCTGCAAGACTACAAAATTCAGT CTGCCCTGCTGGTGCCAACCCTGTTCAGCTTCTTCGCTAAGAGCACCC TGATCGACAAGTACGACCTGTCTAACCTGCACGAGAT TGCCTC TGGC GGCGCCCCACTGTCTAAGGAGGTGGGCGAAGCCGTGGCCAAGCGCTT TCATC TGCCAGGCATCCGCC AGGGC TACGGCCTGACCGAGACAACCA GCGC C ATTCTGATTAC CC C AGAGGGCG ACG AC A AGC CTGGCGCC GTG GGCAAGGTGGTGCCATTCTTCGAGGCCAAGGTGGTGGACCTGGAC AC CGGCAAGACCCTGGGAGTGAACCAGCGCGGCGAGCTGTGTGTGCGC GGCCCTATGATTATGTCCGGCTACGTGAATAACCCTGAGGCCACAAA CGCCCTGATCGACAAGGACGGCTGGCTGCACTCTGGCGACATTGCCT ACTGGGACGAGGACGAGCACTTCTTCATCGTGGACCGCCTGAAGTCT CTGATCAAGTACAAGGGCTACCAGGTGGCCCCAGCCGAGCTGGAGTC TATCCTGCTGCAGCACCCTAACATTTTCGACGCCGGAGTGGCCGGCC TGCCCGACGACGATGCCGGCGAGCTGCCTGCCGCCGTCGTCGTGCTG GAACACGGCAAGACCATGACCGAGAAGGAGATCGTGGACTATGTGG CCAGCCAGGTGACAACCGCCAAGAAGCTGCGCGGCGGAGTGGTGTT CGTGGACGAGGTGCCCAAGGGCCTGACCGGCAAGCTGGACGCCCGC AAGATCCGCGAGATCCTGATCAAGGCTAAGAAAGGCGGCAAGATCG CCGTGTAAnGFP ORF ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCT SEQ ID NO: GGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCG 9 GCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTT CATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGA CCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCAC ATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGT CCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCC GCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGA GCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCAC AAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGA CAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAAC ATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACA CCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTG AGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATC ACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGC ATGGACGAGCTGTACAAGGGAGATCCAAAAAAGAAGAGAAAGGTAG GCGATCCAAAAAAGAAGAGAAAGGTAGGTGATCCAAAAAAGAAGA GAAAGGTATAA

[0077] The 5' UTR disclosed herein (5' UTR Top Heart), and the RNA motif in the 5' UTR (Area B) allows ~50% more translation in mouse and human CMs with comparison to control, standard 5' UTR. 5' UTR Top Heart in an in vivo mouse model, doubled translation of modRNA in the heart 24 or 48 hours post-delivery. These results contribute to superiormodRNA and allow use of less RNA or achieve higher expression for the same amount of RNA when injected into the heart.

[0078] Although some non-limiting examples have been depicted and described in detail herein, it will be apparent to those skilled in the relevant art that various modifications, additions, substitutions, and the like can be made without departing from the spirit of the present disclosure and these are therefore considered to be within the scope of the present disclosure as defined in the claims that follow

[0079] It should be appreciated that all combinations of the foregoing concepts and additional concepts discussed in greater detail herein (provided such concepts are not mutually inconsistent) are contemplated as being part of the inventive subject matter disclosed herein. In particular, all combinations of claimed subject matter appealing at the end of this disclosure are contemplated as being part of the inventive subject matter disclosed herein and may be used to achieve the benefits and advantages described herein.

Claims

WHAT IS CLAIMED IS:

1. A polynucleotide comprising a nucleotide sequence wherein the sequence is as set out in SEQ ID NO: 1.

2. The polynucleotide of claim 1, wherein the nucleotide sequence is as set out in SEQ ID NO: 2 or SEQ ID NO: 3.

3. A ribonucleic acid molecule (RNA) comprising a 5' untranslated region (5' UTR), wherein the 5' UTR comprises the polynucleotide of claim 1 or claim 2.

4. The RNA of claim 3, wherein the 5' UTR comprises the nucleotide sequence as set out in SEQ ID NO: 2 or in SEQ ID NO: 3.

5. The RNA of claim 3 or claim 4, wherein the RNA comprises a start codon and the start codon is one nucleotide 3'-adjacent to the 5' UTR.

6. The RNA of any one of claim 3 through 5, wherein the RNA comprises a sequence AUGG one nucleotide 3'-adjacent to the 5' UTR.

7. The RNA of any one of claim 3 through 6, comprising a 3 -O-Me-m7G(5')ppp(5')G Anti Reverse Cap Analog (ARCA) at its 5' end.

8. The RNA of any one of claims 3 through 7, wherein the 5' UTR precedes a coding sequence for a protein of interest.

9. The RNA of any one of claims 3 through 8, wherein one or more uridine of the RNA is substituted with pseudouridine, one or more cytidine of the RNA is substituted with 5 -methyl cytidine, or both.

10. The RNA of claim 9, comprising one or both of pseudouridine in place of uridine and 5-methylcitidine in place of cytidine.

11. A deoxyribonucleic acid molecule (DNA) encoding the polynucleotide of any one of claims 1 through 8.

12. A cell comprising the polynucleotide of any one of claims 1 through 11. wherein the polynucleotide is a transgene.

13. The cell of claim 12, wherein the cell is a cardiomyocyte.

14. An non-human organism comprising the polynucleotide of any one of claims 1 through 11 or the cell of claim 12 or claim 13.

15. A vector comprising the polynucleotide of any one of claims 1 through 11.

16. The vector of claim 15, wherein the vector comprises a viral vector or a liposomal vector.

17. A method of transfecting a cell, comprising contacting the cell with the polynucleotide of any one of claims 1 through 11.

18. The method of claim 17, wherein the cell is a cardiomyocyte.

19. The method of claim 17 or 18, wherein an organism comprises the cell.

20. The method of claim 19, wherein the organism is a human21. The method of any one of claims 17 through 20, wherein a vector comprises the polynucleotide and contacting the cell comprises contacting the cell with the vector.

22. The method of claim 21, wherein the vector comprises a viral vector or a liposomal vector23. A method of expressing a protein of interest in a cell, comprising contacting the cell with the polynucleotide of any one of claims 3 through 11, wherein the 5’ UTR precedes a coding sequence for the protein of interest.

24. The method of claim 23, wherein the cell is a cardiomyocyte.

25. The method of claim 23 or 24, wherein an organism comprises the cell.

26. The method of claim 25, wherein the organism is a human.

27. The method of any one of claims 23 through 26, wherein a vector comprises the polynucleotide and contacting the cell comprises contacting the cell with the vector.

28. The method of claim 27, wherein the vector comprises a viral vector or a liposomal vector