Oligonucleotide compositions and methods thereof

Abstract

Among other things, the present disclosure provides oligonucleotide compositions and methods thereof. In some embodiments, oligonucleotides comprise various chemical modifications of sugars, nucleobases, and / or internucleotidic linkages and patterns thereof and are useful for exon skipping. In some embodiments, the present disclosure provides technologies useful for skipping cryptic exons of stathmin-2(STMN2) transcripts. In some embodiments, the present disclosure provides technologies useful for modulating STMN2 transcript splicing. In some embodiments, the present disclosure provides methods for preventing or treating conditions, disorders or diseases including neurodegenerative diseases, e.g., amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).

Description

Attorney Docket No: 2010581-1550OLIGONUCLEOTIDE COMPOSITIONS AND METHODS THEREOFCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to United States Provisional Application Nos. 63 / 724,265. filed November 22, 2024, and 63 / 770.930. filed March 12. 2025, the entirety of each of which is incorporated herein by reference.BACKGROUND

[0002] Oligonucleotides are useful in various applications, e.g., therapeutic, diagnostic, and / or research applications. For example, oligonucleotides targeting various genes can be useful for treatment of conditions, disorders or diseases related to such target genes.SUMMARY

[0003] Among other things, the present disclosure encompasses the recognition that structural elements of oligonucleotides, such as base sequence, chemical modifications (e.g.. modifications of sugar, base, and / or internucleotidic linkages, and patterns thereof), and / or stereochemistry’ (e.g, stereochemistry' of backbone chiral centers (chiral internucleotidic linkages), and / or patterns thereof), can have a significant impact on oligonucleotide properties, e.g., exon skipping (e.g., of cryptic exon, e.g., exon 2a, of STMN2), toxicities, stability, protein binding characteristics, etc. In some embodiments, the present disclosure provides oligonucleotides that, among other things, have certain numbers of non -negatively charged linkages at certain locations. In some embodiments, the present disclosure provides oligonucleotides that, among other things, have certain numbers of PN linkages at certain locations. Such non-negatively charged linkages and / or PN linkages, in combination with other structure features (e.g., 2’-F modified sugars, 2’-OMe modified sugars, phosphorothioate internucleotidic linkages, natural phosphate linkages, linkage phosphorus stereochemistry', etc.) of such oligonucleotides, can provide useful therapeutic profiles, such as pharmacokinetic and pharmacodynamic profiles including delivery / , distribution, stability, exon skipping efficiency, toxicity, etc., for such oligonucleotides to be utilized for treating conditions, disorders or diseases including neurodegenerative diseases, e.g., amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD).

[0004] In some embodiments, the present disclosure provides an oligonucleotide or an oligonucleotide composition capable of mediating skipping of an exon, e.g., a cryptic exon, e.g., exon 2a, of the STMN2 gene and useful for treating neurodegenerative conditions, disorders or diseases. In some embodiments, an oligonucleotide or an oligonucleotide composition is useful for treatment of a neurodegenerative condition, disorder or disease, e.g, ALS, FTLD. In some embodiments, an oligonucleotide is an oligonucleotide disclosed herein (e.g., in Table 1, e.g., in Table 1A, Table IB, Table 1C. Table ID, Table IE). In some embodiments, an oligonucleotide composition is a composition comprising an oligonucleotide disclosed herein 1 oi’46113113958vlAttorney Docket No: 2010581-1550(e.g., in Table 1, e.g., in Table 1A, Table IB, Table 1C, Table ID, Table IE). In some embodiments, an oligonucleotide composition is a chirally controlled oligonucleotide composition comprising an oligonucleotide disclosed herein (e.g., in Table 1, e.g., in Table 1 A, Table IB, Table 1C. Table ID, Table IE),

[0005] In some embodiments, as demonstrated herein, provided technologies (e.g., oligonucleotides, compositions, methods, etc.) are particularly useful for reducing levels of a mRNA comprising a cryptic exon (e.g.. a truncated STMN2 mRNA, a STMN2 mRNA comprising a cryptic exon, e.g., exon 2a). and increasing levels of full-length and / or wild-type mRNA (e.g., a full-length and / or wild-type STMN2 mRNA, a STMN mRNA comprising exons 1, 2, 3, 4, and 5) and / or proteins encoded thereby. In some embodiments, provided technologies are particularly useful for modulating splicing of STMN2 transcripts, e.g., to increase levels of desired splicing products (e.g., a full-length and / or wild-type STM 2 mRNA, STMN2 mRNA comprising exons 1, 2, 3, 4, and 5) and / orto reduce levels of undesired splicing products (e g., a truncated STMN2 mRNA, a STMN2 mRNA comprising a cryptic exon, e.g,, exon 2a).

[0006] In some embodiments, the present disclosure provides an oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17. 18, 19, 20, etc.) contiguous nucleobases of a complement of a STMN2 transcript and the oligonucleotide comprises a chirally controlled internucleotidic linkage. In some embodiments, the present disclosure provides an oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of a complement of a STMN2 transcript and the oligonucleotide comprises a non-negatively charged internucleotidic linkage. In some embodiments, the present disclosure provides an oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of a complement of a STMN2 transcript and the oligonucleotide comprises a PN internucleotidic linkage. In some embodiments, a base sequence of an oligonucleotide comprises 1 or more contiguous nucleobases of a complement of a STMN2 transcript. In some embodiments, a base sequence of an oligonucleotide comprises 20 or more contiguous nucleobases of a complement of a STMN2 transcript. In some embodiments, a base sequence of an oligonucleotide is the same as an equal length portion in a complement of a STMN2 transcript. In some embodiments, the present disclosure provides an oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15. 16, 17, 18, 19. 20, etc.) contiguous nucleobases that are complementary to an equal length portion in a STMN2 transcript and the oligonucleotide comprises a chirally controlled internucleotidic linkage. In some embodiments, the present disclosure provides an oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases that are complementary to an equal length portion in a STMN2 transcript and the oligonucleotide comprises a non-negatively charged internucleotidic linkage. In some embodiments, the present disclosure provides an oligonucleotide, wherein the base sequence of the oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases that are complementary to an equal length portion in a STMN2 transcript and the 2 oi'46113113958vlAttorney Docket No: 2010581-1550oligonucleotide comprises a PN intemucleotidic linkage. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases that are complementary to an equal length portion in a STMN2 transcript. In some embodiments, a base sequence of an oligonucleotide compri ses 20 or more contiguous nucleobases that are complementary to an equal length portion in a STMN2 transcript. In some embodiments, a base sequence of the oligonucleotide is complementary to the base sequence of an equal length portion in a STMN2 transcript. In some embodiments, the present disclosure provides an oligonucleotide, wherein the oligonucleotide can hybridize to an equal length portion in a STMN2 transcript and the oligonucleotide comprises a chirally controlled intemucleotidic linkage. In some embodiments, the present disclosure provides an oligonucleotide, wherein the oligonucleotide can hybridize to an equal length portion m a STMN2 transcript and the oligonucleotide comprises a non-negatively charged intemucleotidic linkage. In some embodiments, the present disclosure provides an oligonucleotide, wherein the oligonucleotide can hybridize to an equal length portion in a STMN2 transcript and the oligonucleotide comprises a PN intemucleotidic linkage. In some embodiments, a STMN2 transcript is a STM 2 pre-mRNA. In some embodiments, a STM 2 transcript or a wild-type version thereof encodes stathmin-2.

[0007] In some embodiments, each nucleobase of an oligonucleotide is independently an optionally substituted nucleobase selected from A. T, C. G and U. or an optionally substituted tautomer of a nucleobase selected from A, T, C, G and U. In some embodiments, each nucleobase of an oligonucleotide is independently A, T, C, 5mC, G or U. In some embodiments, length of an oligonucleotide is 20 or more nucleobases. In some embodiments, length of an oligonucleotide is 20 nucleobases.

[0008] In some embodiments, an oligonucleotide comprises 3, 4, 5 or more PN intemucleotidic linkages In some embodiments, an oligonucleotide comprises 4. 5, 6 or more PN intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 3 or more PN intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 4 or more PN intemucleotidic linkages In some embodiments, an oligonucleotide comprises 5 or more PN intemucleotidic linkages, hr some embodiments, an oligonucleotide comprises 3, 4, 5 or more Rp PN intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 4. 5 or more Rp PN intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 3 or more Ap PN intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 4 or more Rp PN intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 5 or more Rp PN intemucleotidic linkages. In some embodiments, each PN intemucleotidic linkage is a 7 p PN intemucleotidic linkage. In some embodiments, an oligonucleotide comprises 3, 4, 5 or more phosphoryl guanidine intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 4, 5 or more phosphoryl guanidine intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 3 or more phosphoryl guanidine intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 4 or more phosphoryl guanidine intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 5 or more phosphoryl guanidine intemucleotidic linkages. In some embodiments, each PN intemucleotidic linkage is a phosphoryl guanidine intemucleotidic linkage. In some embodiments, an oligonucleotide 3 oi'46113113958vlAttorney Docket No: 2010581-1550comprises 3, 4, 5 or more Rp phosphoryl guanidine intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 4, 5 or more Rp phosphoryl guanidine intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 3 or more Rp phosphoryl guanidine intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 4 or more Rp phosphoryl guanidine intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 5 or more Rp phosphoryl guanidine intemucleotidic linkages. In some embodiments, each phosphory l guanidine intemucleotidic linkage is a Rp phosphoryl guanidine intemucleotidic linkage In some embodiments, an oligonucleotide comprises 3, 4, 5 or more nOOl intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 4, 5 or more nOO l intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 3 or more nOOl intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 4 or more nOOl intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 5 or more nOOl intemucleotidic linkages. In some embodiments, each phosphoryl guanidine intemucleotidic linkage is anOOl intemucleotidic linkage. In some embodiments, an oligonucleotide comprises 3, 4, 5 or more Rp nOOl intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 4, 5 or more Rp nOOl intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 3 or more Rp nOOl intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 4 or more Rp nOOl intemucleotidic linkages. In some embodiments, an oligonucleotide comprises 5 or more / ip nOOl intemucleotidic linkages. In some embodiments, each nOOl intemucleotidic linkage is a Rp nOOl intemucleotidic linkage.

[0009] In some embodiments, an intemucleotidic linkage between the first and the second nucleosides, the third and the fourth nucleosides, the sixth and the seventh nucleosides, the 17th and the 18th nucleosides, and / or the last two nucleosides (unless otherwise noted, 5' to 3’ direction) of an oligonucleotide is a PN linkage. In some embodiments, an intemucleotidic linkage between the first and the second nucleosides, the third and the fourth nucleosides, the sixth and the seventh nucleosides, the 17th and the 18th nucleosides of an oligonucleotide is a PN linkage, and the last two nucleosides of an oligonucleotide is a PN linkage. In some embodiments, an intemucleotidic linkage between the first and the second nucleosides, the third and the fourth nucleosides, the sixth and the seventh nucleosides, the 17th and the 18th nucleosides, and the last two nucleosides of an oligonucleotide is a PN linkage. In some embodiments, an intemucleotidic linkage between the first and the second nucleosides of an oligonucleotide is a PN linkage. In some embodiments, an intemucleotidic linkage between the third and the fourth nucleosides of an oligonucleotide is a PN linkage. In some embodiments, an intemucleotidic linkage between the sixth and the seventh nucleosides of an oligonucleotide is a PN linkage. In some embodiments, an intemucleotidic linkage between the 17th and the 18th nucleosides of an oligonucleotide is a PN linkage. In some embodiments, an intemucleotidic linkage between the last two nucleosides of an oligonucleotide is a PN linkage.

[0010] In some embodiments, an oligonucleotide comprises a PS intemucleotidic linkage In some embodiments, an oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more PS intemucleotidic linkages. In some embodiments, an oligonucleotide comprises a PS intemucleotidic linkage.4 of 46113113958vlAttorney Docket No: 2010581-1550In some embodiments, an oligonucleotide comprises a Sp PS intemucleotidic linkage. In some embodiments, an oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more rip PS intemucleotidic linkages. In some embodiments, each PS intemucleotidic linkage is Sp, In some embodiments, each PS intemucleotidic linkage is independently a phosphorothioate intemucleotidic linkage. In some embodiments, an oligonucleotide comprises a phosphorothioate intemucleotidic linkage. In some embodiments, an oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more phosphorothioate intemucleotidic linkages. In some embodiments, an oligonucleotide comprises a Sp phosphorothioate intemucleotidic linkage. In some embodiments, an oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10. 11, 12, 13, 14, 15, 16 or more Sp phosphorothioate intemucleotidic linkages. In some embodiments, each phosphorothioate intemucleotidic linkage is independently Sp.

[0011] In some embodiments, an intemucleotidic linkage between the first and the second nucleosides, the second and the third nucleosides, the fourth and the fifth nucleosides, the fifth and the sixth nucleosides, the seventh and the eighth nucleosides, the eighth and the ninth nucleosides, the ninth and the tenth nucleosides, the 10th and the 11th nucleosides, the 11th and the 12th nucleosides, the 12th and the 13th nucleosides, the 13th and the 14th nucleosides, the 14th and the 15th nucleosides, the 15 th and the 16th nucleosides, the 16th and the 17th nucleosides, the 18th and the 19th nucleosides, and / or the last two nucleosides (unless otherwise noted, 5’ to 3’ direction) of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the first and the second nucleosides of an oligonucleotide, if it is not a PN linkage, is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the second and the third nucleosides of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the fourth and the fifth nucleosides of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the fifth and the sixth nucleosides of an oligonucleotide is a PS intemucleotidic linkage In some embodiments, an intemucleotidic linkage between the seventh and the eighth nucleosides of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the eighth and the ninth nucleosides of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the ninth and the tenth nucleosides of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the 10th and the 11th nucleosides of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the 11th and the 12th nucleosides of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the 12th and the 13th nucleosides of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between tire 13tli and tire 14th nucleosides of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the 14th and the 15th nucleosides of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the 15th and the 16th nucleosides of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the 16th and the 17th 5 oi'46113113958vlAttorney Docket No: 2010581-1550nucleosides of an oligonucleotide is a PS intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the 18th and the 19th nucleosides of an oligonucleotide is a PS intemucleotidic linkage, hi some embodiments, an intemucleotidic linkage between the last two nucleosides of an oligonucleotide, if it is not a PN linkage, is a PS intemucleotidic linkage.

[0012] In some embodiments, an oligonucleotide comprises a PO intemucleotidic linkage. In some embodiments, an oligonucleotide comprises 2, 3 or more PO intemucleotidic linkages. In some embodiments, each PO intemucleotidic linkage is independently a natural phosphate linkage. In some embodiments, an oligonucleotide comprises a natural phosphate intemucleotidic linkage. In some embodiments, an oligonucleotide comprises 2, 3 or more natural phosphate intemucleotidic linkages. In some embodiments, an intemucleotidic linkage between the fifth and the sixth nucleoside of an oligonucleotide is a PO intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the ninth and the tenth nucleoside of an oligonucleotide is a PO intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the 11th and the 12th nucleoside of an oligonucleotide is a PO intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the 13th and the 14th nucleoside of an oligonucleotide is a PO intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the 15th and the 16th nucleoside of an oligonucleotide is a PO intemucleotidic linkage. In some embodiments, an intemucleotidic linkage between the 16th and the 17th nucleoside of an oligonucleotide is a PO intemucleotidic linkage. In some embodiments, a PO intemucleotidic linkage is bonded to 3" of a 2’-ORakmodified sugar, wherein Rakis optionally substituted Ci0aliphatic. In some embodiments, a PO intemucleotidic linkage is bonded to 3' of a 2’-OMe modified sugar. In some embodiments, a PO intemucleotidic linkage is bonded to 5’ of a 2’-ORakmodified sugar, wherein Rakis optionally substituted Cue aliphatic. In some embodiments, a PO intemucleotidic linkage is bonded to 5’ of a 2"-OMe modified sugar. In some embodiments, a PO intemucleotidic linkage is bonded to 3’ of a first 2’-ORakmodified sugar and 5’ of a second 2’-ORakmodified sugar, wherein each Rakis independently optionally substituted Cue, aliphatic. In some embodiments, a PO intemucleotidic linkage is bonded to 3' of a first 2'-OMc modified sugar and 5’ of a second 2 -OMc modified sugar. In some embodiments, a PO intemucleotidic linkage is bonded to a 2'-F modified sugar. In some embodiments, a PO intemucleotidic linkage is bonded to 3’ of a 2’-OMe modified sugar and 5’ of a 2’-F modified sugar. In some embodiments, an intemucleotidic linkage between the 13th and the 14th nucleoside of an oligonucleotide is a PO intemucleotidic linkage and the PO intemucleotidic linkage is bonded to 3’ of a 2’-OMe modified sugar and 5’ of a 2’-F modified sugar. In some embodiments, an intemucleotidic linkage between the 16th and the 17th nucleoside of an oligonucleotide is a PO intemucleotidic linkage and the PO intemucleotidic linkage is bonded to 3’ of a first 2’-ORakmodified sugar and 5’ of a second 2’-ORakmodified sugar, wherein each Rakis independently optionally substituted Cus aliphatic. In some embodiments, an intemucleotidic linkage between the 16th and the 17th nucleoside of an oligonucleotide is a PO intemucleotidic linkage and the PO intemucleotidic linkage is bonded to 3’ of a first 2’-OMe modified sugar and 5’ of a second 2’-OMe modified sugar.6 of 46113113958vlAttorney Docket No: 2010581-1550

[0013] In some embodiments, an oligonucleotide comprises a sugar modification. In some embodiments, an oligonucleotide comprises a 2'-modified sugar. In some embodiments, an oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18. 19. 20 or more 2’-modified sugars. In some embodiments, an oligonucleotide comprises a 2'-F modified sugar. In some embodiments, an oligonucleotide comprises 2, 3.4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 or more 2’-F modified sugars. In some embodiments, sugar at positions 2, 3, 4. 5, 7, 8, 10, 12, 14, 15, 18, and 19 of an oligonucleotide are 2’-F modified sugar. In some embodiments, sugar at positions 2, 3, 4, 5, 7, 8, 10, 12, 14, 15, 18, 19, and 20 of an oligonucleotide are 2’ -F modified sugar. In some embodiments, sugar at positions 2, 3, 4, 7, 8, 10, 12. 14. 15. 17, 18, and 19 of an oligonucleotide are 2 -F modified sugar. In some embodiments, sugar at positions 2, 3, 4, 7, 8, 10, 12, 14. 15, 17, 18, 19, and 20 of an oligonucleotide are 2 -F modified sugar. In some embodiments, an oligonucleotide comprises a 2 -OR modified sugar, wherein R is optionally substituted Ci-Cg aliphatic In some embodiments, an oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8 or more 2’-OR modified sugars, wherein R is optionally substituted Ci-Cg aliphatic. In some embodiments, sugar at positions 1, 5, 6, 9, 11, 13, and 16 of an oligonucleotide are independently 2'-OR modified sugars, wherein Ris optionally substituted C1-C& aliphatic. In some embodiments, sugar at positions 1, 5, 6. 9, 11, 13. 16. and 20 of an oligonucleotide are independently 2’-OR modified sugars, wherein R is optionally substituted Ci-Cs aliphatic. In some embodiments, sugar at positions 1, 6, 9, 11, 13, 16, and 17 of an oligonucleotide are independently 2’-OR modified sugars, wherein R is optionally substituted Ci-Co aliphatic. In some embodiments, sugar at positions 1, 6, 9, 11, 13, 16, 17, and 20 of an oligonucleotide are independently 2 ’-OR modified sugars, wherein Ris optionally substituted Ci-Ce aliphatic. In some embodiments, an oligonucleotide comprises a 2’-OMe modified sugar. In some embodiments, an oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8 or more 2’-OMe modified sugars. In some embodiments, an oligonucleotide comprises 2'-OR modified sugar is a 2’-OMe modified sugar.

[0014] In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases that are complementary’ to an equal length portion in a STMN2 transcript. In some embodiments, a base sequence of an oligonucleotide comprises 20 or more contiguous nucleobases that arc complementary to an equal length portion in a STMN2 transcript. In some embodiments, a base sequence of the oligonucleotide is complementary to the base sequence of an equal length portion in a STMN2 transcript. In some embodiments, a STMN2 transcript is a STMN2 mRNA. In some embodiments, a STMN2 transcript, e.g, a full-length and / or wild-type STMN2 mRNA encodes stathmin-2.

[0015] In some embodiments, an oligonucleotide can hybridize to a region of a STMN2 transcript. In some embodiments, a region of a STMN2 transcript is intron 1. In some embodiments, a region of a STMN2 transcript comprises UGCAGGACU CGGCAGAAGACCUUCGAGAGAAAGGU AGAAAAUAA, wherein each U is optional ly and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises CUCUGUGUGAGCAUGUGUGCGUGUGUGCGAGAGAGAGAGACAGACAGCCUG, wherein each U is optionally and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises 7 of 46113113958vlAttorney Docket No: 2010581-1550 AGCCUGCCUAAGAAGAAAUGAAUGUGAAUGCGGCUUGUGGCACAGUUGACAAGGAUGAUAA AUCAAUAAUGCA, wherein each U is optionally and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises GAAGAAAUGAAUGUGAAUGC, wherein each U is optionally and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises GAAAUGAAUGUGAAUGCGGC, wherein each U is optionally and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises UGUGGCACAGU GACAAGGA, wherein each U is optionally and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises AAUGUGAAUGCGGCUUGUGG, wherein each U is optionally and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises UUCGAGAGAAAGGUAGAAAA, w'herein each U is optionally and independently replaced with T In some embodiments, a region of a STM 2 transcript comprises GUGUGCGAGAGAGAGAGACA, wherein each U is optionally and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises GCCUAAGAAGAAAUGAAUGU, wherein each U is optionally and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises UGAAUGUGAAUGCGGCUUGU, w herein each U is optionally and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises GAAUGUGAAUGCGGCUUGUG, wherein each U is optionally and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises GUGGCACAGUUGACAAGGAU, w'herein each U is optionally and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises CAGUUGACAAGGAUGAUAAA, wherein each U is optionally and independently replaced with T. In some embodiments, a region of a STMN2 transcript comprises GAUGAUAAAUCAAUAAUGCA. wherein each U is optionally and independently replaced with T

[0016] In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases complementary to 10 or more (e.g, 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of a STMN2 transcript. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary to 10 or more (e.g., 10-20, 10, 11, 12, 13. 14, 15, 16, 17, 18, 19, 20. etc.) contiguous nucleobases of a STM 2 transcript. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20. etc.) contiguous nucleobases complementary' to 20 or more contiguous nucleobases of a STMN2 transcript. In some embodiments, contiguous nucleobases of a STMN2 transcript are in intron 1. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases complementary to 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15. 16, 17, 18, 19, 20, etc.) contiguous nucleobases of GAAGAAAUGAAUGUGAAUGC, wherein each U is optionally and independently replaced w'ith T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary to 15 or more contiguous nucleobases of GAAGAAAUGAAUGUGAAUGC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide 8 of 46113113958vlAttorney Docket No: 2010581-1550comprises 20 or more contiguous nucleobases complementary to 20 or more contiguous nucleobases of GAAGAAAUGAAUGUGAAUGC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14. 15, 16, 17, 18, 19. 20. etc.) contiguous nucleobases complementary to 10 or more (e.g.. 10-20, 10, 11. 12, 13. 14.15, 16. 17, 18, 19, 20, etc.) contiguous nucleobases of GAAAUGAAUGUGAAUGCGGC. wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary to 15 or more contiguous nucleobases of GAAAUGAAUGUGAAUGCGGC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 20 or more contiguous nucleobases complementary to 20 or more contiguous nucleobases of GAAAUGAAUGUGAAUGCGGC, wherein each U is optionally and independently replaced with T In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases complementary to 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of UGUGGCACAGUUGACAAGGA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary to 15 or more contiguous nucleobases of UGUGGCACAGUUGACAAGGA. wherein each U is optionally and independently replaced with T. In some embodiments, abase sequence of an oligonucleotide comprises 20 or more contiguous nucleobases complementary to 20 or more contiguous nucleobases of UGUGGCACAGUUGACAAGGA, wherein each U is optionally and independently replaced with T. In some embodiments, abase sequence of an oligonucleotide comprises 10 or more (e.g, 10-20, 10, 11, 12, 13. 14. 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases complementary to 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of AAUGUGAAUGCGGCUUGUGG, wherein each U is optionally and independently replaced with T. In some embodiments, abase sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary to 15 or more contiguous nucleobases of AAUGUGAAUGCGGCUUGUGG, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 20 or more contiguous nucleobases complementary to 20 or more contiguous nucleobases of AAUGUGAAUGCGGCUUGUGG, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 10 ormore (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases complementary to 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of UUCGAGAGAAAGGUAGAAAA, wherein each U is optionally and independently replaced w ith T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary to 15 or more contiguous nucleobases of UUCGAGAGAAAGGUAGAAAA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 20 or more contiguous nucleobases complementary to 20 ormore contiguous nucleobases of UUCGAGAGAAAGGUAGAAAA, wherein each U 9 of 46113113958vlAttorney Docket No: 2010581-1550is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases complementary’ to 10 or more (e.g,, 10-20, 10, 11, 12. 13, 14, 15, 16, 17, 18, 19, 20. etc.) contiguous nucleobases of GUGUGCGAGAGAGAGAGACA. wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary to 15 or more contiguous nucleobases of GUGUGCGAGAGAGAGAGACA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 20 or more contiguous nucleobases complementary to 20 or more contiguous nucleobases of GUGUGCGAGAGAGAGAGACA, wherein each U is optionally and independently replaced w'ith T. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10.11. 12, 13, 14, 15, 16, 17, 18, 19. 20, etc.) contiguous nucleobases complementary’ to 10 or more (e.g.. 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19. 20, etc.) contiguous nucleobases of GCCUAAGAAGAAAUGAAUGU, wherein each U is optionally' and independently replaced with T. In some embodiments, abase sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary to 15 or more contiguous nucleobases of GCCUAAGAAGAAAUGAAUGU, wherein each U is optionally7and independently replaced with T, In some embodiments, a base sequence of an oligonucleotide comprises 20 or more contiguous nucleobases complementary’ to 20 or more contiguous nucleobases of GCCUAAGAAGAAAUGAAUGU, wherein each U is optionally and independently replaced w ith T. in some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases complementary to 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19. 20, etc.) contiguous nucleobases of UGAAUGUGAAUGCGGCUUGU, wherein each U is optionally and independently replaced w ith T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary’ to 15 or more contiguous nucleobases of UGAAUGUGAAUGCGGCUUGU, wherein each U is optionally’ and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 20 or more contiguous nucleobases complementary’ to 20 or more contiguous nucleobases of UGAAUGUG AAUGCGGCUUGU, wherein each U is optionally and independently replaced w ith T. in some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11. 12, 13, 14, 15, 16, 17, 18. 19, 20, etc.) contiguous nucleobases complementary’ to 10 or more (e.g, 10-20, 10, 1 1, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of GAAUGUGAAUGCGGCUUGUG, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary to 15 or more contiguous nucleobases of GAAUGUGAAUGCGGCUUGUG, wherein each U is optionally’ and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 20 or more contiguous nucleobases complementary’ to 20 or more contiguous nucleobases of GAAUGUGAAUGCGGCUUGUG, wherein each U is optionally and independently replaced w’ith T. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10,10 of 46113113958vlAttorney Docket No: 2010581-155011, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases complementary to 10 or more (e.g., 10-20, 10, 11, 12. 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of GUGGCACAGUUGACAAGGAU, wherein each U is optionally and independently replaced with T, In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary' to 15 or more contiguous nucleobases of GUGGCACAGUUGACAAGGAU, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 20 or more contiguous nucleobases complementary to 20 or more contiguous nucleobases of GUGGCACAGUUGACAAGGAU, wherein each U is optionally and independently replaced with T, In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11. 12. 13, 14, 15, 16, 17, 18. 19, 20, etc.) contiguous nucleobases complementary to 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17. 18, 19. 20, etc.) contiguous nucleobases of CAGUUGACAAGGAUGAUAAA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary- to 15 or more contiguous nucleobases of CAGUUGACAAGGAUGAUAAA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 20 or more contiguous nucleobases complementary to 20 or more contiguous nucleobases of CAGUUGACAAGGAUGAUAAA. wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases complementary' to 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of GAUGAUAAAUCAAUAAUGCA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary' to 15 or more contiguous nucleobases of GAUGAUAAAUCAAUAAUGCA, wherein each U is optionally and independently replaced with T. In some embodiments, abase sequence of an oligonucleotide comprises 20 or more contiguous nucleobases complementary' to 20 or more contiguous nucleobases of GAUGAUAAAUCAAUAAUGCA, wherein each U is optionally' and independently replaced w ith T. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14. 15. 16, 17, 18, 19, 20, etc.) contiguous nucleobases complementary to 10 or more (e.g., 10-20.10, 11, 12, 13. 14, 15, 16. 17, 18, 19, 20, etc.) contiguous nucleobases of GCAUUCACAUUCAUUUCUUC. wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases complementary’ to 15 or more contiguous nucleobases of GCAUUCACAUUCAUUUCUUC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 20 or more contiguous nucleobases complementary to 20 or more contiguous nucleobases of GCAUUCACAUUCAUUUCUUC. wherein each U is optionally and independently replaced with T.

[0017] In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g.. 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of GCAUUCACAUUCAUUUCUUC,11 of 46113113958vlAttorney Docket No: 2010581-1550wherein each U is optionally and independently replaced with T. In some embodiments, abase sequence of an oligonucleotide comprises 15 or more contiguous nucleobases of GCAUUCACAUUCAUUUCUUC, wherein each U is optionally and independently replaced with T, In some embodiments, a base sequence of an oligonucleotide comprises GCAUUCACAUUCAUUUCUUC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide is GCAUUCACAUUCAUUUCUUC. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g.. 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of GCCGCAUUCACAUUCAUUUC, wherein each U is optionally and independently replaced with T, In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases of GCCGCAUUCACAUUCAUUUC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises GCCGCAUUCACAUUCAUUUC, wherein each U is optionally and independently replaced with T, In some embodiments, a base sequence of an oligonucleotide is GCCGCAUUCACAUUCAUUUC. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13. 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of UCCUUGUCAACUGUGCCACA, wherein each U is optionally and independently replaced with T, In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases of UCCUUGUCAACUGUGCCACA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises UCCUUGUCAACUGUGCCACA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide is UCCUUGUCAACUGUGCCACA. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, II, 12, 13, 14. 15, 16, 17, 18, 19. 20, etc.) contiguous nucleobases of CCACAAGCCGCAUUCACAUU, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases of CCACAAGCCGCAUUCACAUU, wherein each U is optionally and independently replaced with T In some embodiments, a base sequence of an oligonucleotide comprises CCACAAGCCGCAUUCACAUU, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide is CCACAAGCCGCAUUCACAUU. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13.14, 15, 16, 17, 18, 19, 20, etc ) contiguous nucleobases of UUUUCUACCUUUCUCUCGAA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases of UUUUCUACCUUUCUCUCGAA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises UUUUCUACCUUUCUCUCGAA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide is UUUUCUACCUUUCUCUCGAA. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10. 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of UGUCUCUCUCUCUCGCACAC, wherein each U 12 of 46113113958vlAttorney Docket No: 2010581-1550is optionally and independently replaced with T. in some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases of UGUCUCUCUCUCUCGCACAC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises UGUCUCUCUCUCUCGCACAC. wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide is UGUCUCUCUCUCUCGCACAC. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of ACAUUCAUUUCUUCUUAGGC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases of ACAUUCAUUUCUUCUUAGGC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises ACAUUCAUUUCUUCUUAGGC, wherein each U is optionally and independently replaced with T In some embodiments, a base sequence of an oligonucleotide is ACAUUCAUUUCUUCUUAGGC. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of ACAAGCCGCAUUCACAUUCA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases of ACAAGCCGCAUUCACAUUCA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises ACAAGCCGCAUUCACAUUCA, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide is ACAAGCCGCAUUCACAUUCA. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13. 14. 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of CACAAGCCGCAUUCACAUUC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases of CACAAGCCGCAUUCACAUUC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises CACAAGCCGCAUUCACAUUC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide is CACAAGCCGCAUUCACAUUC. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11. 12, 13. 14, 15.16, 17, 18, 19, 20, etc ) contiguous nucleobases of AUCCUUGUCAACUGUGCCAC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases of AUCCUUGUCAACUGUGCCAC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises AUCCUUGUCAACUGUGCCAC, wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide is AUCCUUGUCAACUGUGCCAC. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g., 10-20, 10. 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of UUUAUCAUCCUUGUCAACUG, wherein each 13 of 46113113958vlAttorney Docket No: 2010581-1550U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases of UUUAUCAUCCUUGUCAACUG, wherein each U is optionally and independently replaced with T, In some embodiments, a base sequence of an oligonucleotide comprises UUUAUCAUCCUUGUCAACUG. wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide is UUUAUCAUCCUUGUCAACUG. In some embodiments, a base sequence of an oligonucleotide comprises 10 or more (e.g.. 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of UGCAUUAUUGAUUUAUCAUC, wherein each U is optionally and independently replaced with T, In some embodiments, a base sequence of an oligonucleotide comprises 15 or more contiguous nucleobases of UGCAUUAUUGAUUUAUCAUC. wherein each U is optionally and independently replaced with T. In some embodiments, a base sequence of an oligonucleotide comprises UGCAUUAUUGAUUUAUCAUC. wherein each U is optionally and independently replaced with T, In some embodiments, a base sequence of an oligonucleotide is UGCAUUAUUGAUUUAUCAUC.

[0018] In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising an oligonucleotide described herein, wherein the composition is enriched, relative to a substantially racemic preparation of the oligonucleotide, for the oligonucleotide. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides each of which is an oligonucleotide described herein, wherein oligonucleotides of the plurality share the same constitution and at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all oligonucleotides in the composition that share the same constitution are oligonucleotides of the plurality. In some embodiments, the present disclosure provides a chirally controlled oligonucleotide composition comprising an oligonucleotide described herein, wherein at least 5%, 10%. 15%, 20%. 25%, 30%. 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, or 95% of all oligonucleotides in the composition that share the same constitution as the oligonucleotide are the oligonucleotide. In some embodiments, the present disclosure provides an oligonucleotide composition comprising a plurality of oligonucleotides, wherein oligonucleotides of the plurality share 1) a common base sequence and 2) the same linkage phosphorus stereochemistry independently at 1. 2, 3, 4, 5. 6, 7, 8, 9. 10. 11, 12, 13, 14, 15, 16, 17, 18, 19. 20 or more chiral intemucleotidic linkages, wherein oligonucleotides of the plurality7are an oligonucleotide described herein and wherein at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the oligonucleotides in the composition that share the common base sequence are oligonucleotides of the plurality. In some embodiments, oligonucleotides of plurality share the same linkage phosphorus stereochemistry independently at each chiral intemucleotidic linkage. In some embodiments, the present disclosure provides an oligonucleotide composition, wherein a level of ah oligonucleotides in the composition are oligonucleotides each independently having the structure of an oligonucleotide described herein (e g., in Table 1, e g., in Table 1A, Table IB, Table IC, Table ID, Table IE). In some embodiments, a level is about 5%, 10%, 15%, 20%, 25%. 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,14 of 46113113958vlAttorney Docket No: 2010581-155090%, 95% or more of all oligonucleotides that share the same base sequence as an oligonucleotide having the structure or a pharmaceutically acceptable salt thereof. In some embodiments, a level is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of all oligonucleotides that share the same constitution as an oligonucleotide having the structure or a pharmaceutically acceptable salt thereof. In some embodiments, a level is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% based on UV peak area at 260 nm.

[0019] In some embodiments, the present disclosure provides a pharmaceutical composition composing an oligonucleotide or oligonucleotide composition described herein. In some embodiments, a pharmaceutical composition comprises one or more pharmaceutically acceptable salts of an oligonucleotide. In some embodiments, a pharmaceutical composition is a solution. In some embodiments, a pharmaceutical composition comprises a buffer. In some embodiments, a pharmaceutical composition comprises artificial cerebrospinal fluid (aCSF).

[0020] In some embodiments, the present disclosure provides methods using oligonucleotides and compositions described herein. In some embodiments, the present disclosure provides a method for altering splicing of a STMN 2 transcript in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition described herein. In some embodiments, the present disclosure provides a method for providing STMN2 exon skipping in a system, comprising administering or delivering to tire system an effective amount of an oligonucleotide or composition described herein. In some embodiments, the present disclosure provides a method for decreasing level of a truncated STMN 2 transcript in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition described herein. In some embodiments, the present disclosure provides a method for decreasing level of a truncated STMN2 transcript in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition described herein, wherein the STMN2 transcript comprises a characteristic sequence of exon 2a. In some embodiments, the present disclosure provides a method for increasing level of a STMN2 transcript in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition described herein, wherein the STMN 2 transcript comprises a characteristic sequence of STMN2 exon 2, 3, 4. or 5. In some embodiments, the present disclosure provides a method for increasing level of a STMN2 transcript in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition described herein, wherein the STMN2 transcript docs not comprise a sequence characteristic of exon 2a relative to exon 2, 3, 4 or 5. In some embodiments, the present disclosure provides a method for increasing level of a STMN 2 transcript in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition described herein, wherein the STMN2 transcript does not comprise ACAGCAAUGGGACUCGGCAG. in some embodiments, the present disclosure provides a method for increasing level of STMN2 polypeptide in a system, comprising administering or delivering to the system an 15 of 46113113958vlAttorney Docket No: 2010581-1550effective amount of an oligonucleotide or composition described herein. In some embodiments, the present disclosure provides a method for increasing level of stathmin-2 activity m a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition described herein.

[0021] In some embodiments, the present disclosure provides a method for preventing or treating a disease, disorder or condition, comprising administering or delivering to a subject susceptible thereto or suffering therefrom an effective amount of an oligonucleotide or composition described herein. In some embodiments, the present disclosure provides a method for treating a neurodegenerative disease, disorder or condition, comprising administering or delivering to a subject suffering therefrom an effective amount of an oligonucleotide or composition described herein. In some embodiments, a neurodegenerative disease, disorder or condition is a STMN2-associated disease, disorder or condition. In some embodiments, a neurodegenerative disease, disorder or condition is a TDP-43 -associated disease, disorder or condition. In some embodiments, a neurodegenerative disease, disorder or condition is amyotrophic lateral sclerosis (ALS). In some embodiments, a neurodegenerative disease, disorder or condition is frontotemporal lobar degeneration (FTLD). In some embodiments, a neurodegenerative disease, disorder or condition is frontotemporal dementia (FTD).

[0022] In some embodiments, the present disclosure provides a method for manufacturing or preparing an oligonucleotide or composition described herein.BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1. Sequence mapping of increases in full-length STMN2 mRNA and decreases in STMN2 mRNA comprising a cryptic exon (CE) provided by oligonucleotides with various base sequences that can hybridize to various sequences in STN1N2 transcripts. In (A), mean percent full-length STMN2 mRNA recoven' is presented relative to untreated. In (B), mean percent STMN2 mRNA comprising a cryptic exon (CE) is presented relative to mock treated. The X-axis depicts genomic location of the target sites of the tested oligonucleotides relative to reference STMN2 transcript (NM_007029) Intron I, Exon 2a (E2A), and TDP- 43 binding motif locations arc indicated by boxes below plotted data.

[0024] Figure 2. Provided oligonucleotides can provide dose-dependent decreases in cryptic exon-containing STMN2 mRNA and increases in full-length STMN2 mRNA. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl). etc.), sugar modifications (e.g., 2’-F, 2’-0Me, etc.), and stereochemistry and patterns thereof were designed and assessed. As described in Example 7, cells pre-treated with 20 uM of oligonucleotide targeting TARDBP were subsequently gymnotically dosed 20.0000, 6.6667, 2.2222, 0.7407, 0.2469, 0.0823, 0.0274, 0.0091, 0.0030, 0.0010, or 0.0003 uM of oligonucleotides targeting STMN2 for skipping of exon 2a. Cells that did not receive either the oligonucleotide targeting TARDBP or an oligonucleotide targeting STMN2 were examined as an untreated control. Cells that received only the oligonucleotide targeting TARDBP were examined as a mock-treated control. After 7 days under treatment with oligonucleotides targeting STMN2 for skipping of exon 2a, cells were harvested. RNA was collected using trizol-based extraction and transcribed 16 of 46113113958vlAttorney Docket No: 2010581-1550into cDNA. qPCR was performed using produced cDNA. Resulting qPCR data was analyzed using a robust linear mixed effects model to quantify mRNA remaining relative to mock treatment for STMN2 mRNA with crypt ic exon (as shown in right graph) and mRNA restored relative to untreated for full-length STMN2 mRNA (as shown in left graph).

[0025] Figure 3. Provided oligonucleotides can provide dose-dependent decreases in cryptic exon-containing STMN2 mRNA and increases in full-length STMN2 mRNA. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphor}’! guanidine linkages such as nOOl), etc.), sugar modifications (e.g,, 2'-F, 2’-OMe, etc.), and stereochemistry and patterns thereof were designed and assessed. As described in Example 7, cells pre-treated with 20 uM of oligonucleotide targeting TARDBP ■were subsequently gymnotically dosed 20.0000. 6.6667, 2.2222, 0.7407, 0.2469, 0.0823, 0.0274, 0.0091.0.0030, 0.0010, or 0.0003 uM of oligonucleotides targeting STMN2 for skipping of exon 2a. Cells that did not receive either the oligonucleotide targeting TARDBP or an oligonucleotide targeting STMN2 were examined as an untreated control. Cells that received only the oligonucleotide targeting TARDBP were examined as a mock-treated control. After 7 days under treatment with oligonucleotides targeting STMN2 for skipping of exon 2a, cells were harvested. RNA was collected using trizol-based extraction and transcribed into cDNA. qPCR was performed using produced cDNA. Resulting qPCR data was analyzed using a robust linear mixed effects model to quantify mRNA remaining relative to mock treatment for STMN2 mRNA -with cryptic exon (as shown in right graph) and mRNA restored relative to untreated for full-length STMN2 mRNA (as shown in left graph).

[0026] Figure 4, Provided oligonucleotides can provide dose-dependent decreases in cryptic exon-containing STMN2 mRNA and increases in full-length STMN2 mRNA. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2.’-F, 2’-0Me, etc.), and stereochemistry and patterns thereof were designed and assessed. As described in Example 7, cells pre-treated with 20 uM of oligonucleotide targeting TARDBP were subsequently gymnotically dosed 20.0000, 6.6667, 2.2222, 0.7407, 0 2469, 0.0823, 0.0274, 0.0091, 0.0030, 0.0010, or 0.0003 uM of oligonucleotides targeting STMN2 for skipping of exon 2a. Cells that did not receive either tire oligonucleotide targeting TARDBP or an oligonucleotide targeting STM 2 were examined as an untreated control. Cells that received only the oligonucleotide targeting TARDBP were examined as a mock-treated control. After 7 days under treatment with oligonucleotides targeting STMN2 for skipping of exon 2a, cells were harvested. RNA was collected using trizol-based extraction and transcribed into cDNA. qPCR was performed using produced cDNA. Resulting qPCR data was analyzed using a robust linear mixed effects model to quantify mRNA remaining relative to mock treatment for STMN2 mRNA with cryptic exon (as shown in right graph) and mRNA restored relative to untreated for full-length STMN2 mRNA (as shown in left graph).

[0027] Figure 5. Provided oligonucleotides can provide dose-dependent decreases m cryptic exon-containing STMN2 mRNA and increases in full-length STMN2 mRNA. Oligonucleotides comprising various 17 of 46113113958vlAttorney Docket No: 2010581-1550modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2'-F, 2’-0Me, etc.), and stereochemistry and patterns thereof were designed and assessed. As described in Example 7, cells pre-treated with 20 uM of oligonucleotide targeting T. ARDBP were subsequently gymnotically dosed 20.0000. 6.6667, 2.2222, 0.7407, 0.2469. 0.0823, 0.0274, 0.0091.0.0030, 0.0010, or 0.0003 uM of oligonucleotides targeting STMN2 for skipping of exon 2a. Cells that did not receive either the oligonucleotide targeting TARDBP or an oligonucleotide targeting STMN2 were examined as an untreated control. Cells that received only the oligonucleotide targeting TARDBP were examined as a mock-treated control. After 7 days under treatment with oligonucleotides targeting STMN2 for skipping of exon 2a, cells were harvested. RNA was collected using trizol-based extraction and transcribed into cDNA. qPCR was performed using produced cDNA. Resulting qPCR data was analyzed using a robust linear mixed effects model to quantify mRNA remaining relative to mock treatment for STMN2 mRNA with cryptic exon (as shown in graph in (B)) and mRNA restored relative to untreated for ful 1-1 ength STMN2 mRNA (as shown in graph in (A)).

[0028] Figure 6. Provided oligonucleotides can provide dose-dependent decreases in cryptic exon-containing STM 2 mRNA and increases m full-length STMN2 mRNA. Oligonucleotides comprising various modifications, such as linkage modifications (e.g.. PS. PN (e.g., phosphoryl guanidine linkages such as nOOl). etc.), sugar modifications (e.g., 2'-F, 2’-OMe, etc.), and stereochemistry' and patterns thereof were designed and assessed. As described in Example 7, cells pre-treated with 20 uM of oligonucleotide targeting TARDBP were subsequently' gymnotically' dosed 20.0000, 6.6667, 2.2222, 0.7407, 0.2469, 0.0823, 0.0274, 0.0091, 0,0030, 0,0010, or 0.0003 uM of oligonucleotides targeting STMN2 for skipping of exon 2a. Cells that did not receive either tire oligonucleotide targeting TARDBP or an oligonucleotide targeting STMN2 were examined as an untreated control. Cells that received only the oligonucleotide targeting TARDBP were examined as a mock-treated control. After 7 days under treatment with oligonucleotides targeting STMN2 for skipping of exon 2a. cells were harvested. RNA was collected using trizol-based extraction and transcribed into cDNA. qPCR was performed using produced cDNA. Resulting qPCR data was analyzed using a robust linear mixed effects model to quantify mRNA remaining relative to mock treatment for STMN2 mRNA with cryptic exon (as shown in graph in (B)) and mRNA restored relative to untreated for full-length STMN2 mRNA (as shown in graph in (A)).

[0029] Figure 7 Provided oligonucleotides can provide dose-dependent decreases in cryptic exon-containing STMN2 mRNA and increases in full-length STMN2 mRNA. Oligonucleotides comprising various modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2"-F, 2"-0Me, etc.), and stereochemistry and patterns thereof were designed and assessed. As described in Example 7. cells pre-treated with 20 uM of oligonucleotide targeting TARDBP were subsequently gymnotically dosed 20.0000, 6.6667, 2.2222, 0.7407, 0.2469, 0.0823, 0.0274, 0.0091, 0.0030, 0.0010, or 0 0003 uM of oligonucleotides targeting STMN2 for skipping of exon 2a. Cells that did not receive either the oligonucleotide targeting TARDBP or an oligonucleotide targeting STMN2 were 18 of 46113113958vlAttorney Docket No: 2010581-1550examined as an untreated control. Cells that received only the oligonucleotide targeting TARDBP were examined as a mock-treated control. After 7 days under treatment with oligonucleotides targeting STMN2 for skipping of exon 2a, cells were harvested. RNA was collected using trizol-based extraction and transcribed into cDNA. qPCR was performed using produced cDNA. Resulting qPCR data was analyzed using a robust linear mixed effects model to quantify mRNA remaining relative to mock treatment for STMN2 mRNA with cryptic exon (as shown in graph in (B)) and mRNA restored relative to untreated for full-length STMN2 mRNA (as shown in graph in (A)).

[0030] Figure 8, Diagram of generation of humanized STMN2 knock-in (11STMN2 KI) mice, A targeting vector comprising human STMN2 Exon 1-Exon 2a transcript-201 (NM__007029.4) was incorporated into C57BL / 6J mice using CRISPR / Cas9-based genome editing system at the targeted allele of mouse STMN2.

[0031] Figure 9. Treatment of heterozygous hSTMN2 KI mice with oligonucleotides targeted to TARDBP can decrease levels of TARDBP transcripts in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 50, 100, or 200 ug of oligonucleotides targeting TARDBP or PBS control. On day 28, mice were euthanized and tissues collected. RNA was isolated, transcribed to cDNA, and levels of TARDBP transcripts quantified using qPCR. Tissue type is indicated above each graph, (A) Cortex (left) and Spinal Cord (right), (B) Cerebellum (left) and Hippocampus (right). From left to right for each oligonucleotide, columns represent dosing with 50, 100, or 200 ug of indicated oligonucleotide.

[0032] Figure 10. Treatment of heterozygous hSTMN2 KI mice w ith oligonucleotides targeted to TARDBP can decrease levels of TARDBP protein in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 50, 100, or 200 ug of oligonucleotides targeting TARDBP or PBS control. On day 28, mice were euthanized and tissues collected. Protein was extracted and quantified. Tissue type is indicated above each graph, (A) Cortex (left) and Spinal Cord (right). (B) Cerebellum. From left to right for each oligonucleotide, columns represent dosing with 50. J 00, or 2.00 ug of indicated oligonucleotide.

[0033] Figure 11. Treatment of heterozygous hSTMN2 KI mice with oligonucleotides targeted to TARDBP can increase levels of STMN2 mRNA comprising cryptic exon in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 50, 100, or 200 ug of oligonucleotides targeting TARDBP or PBS control. On day 28, mice 'ere euthanized and tissues collected. RNA was isolated, transcribed to cDNA, and levels of STMN2 mR A comprising cryptic exon quantified using qPCR. Tissue type is indicated above each graph. (A) Cerebellum (left) and Cortex (right), (B) Hippocampus (left) and Spinal Cord (right). From left to light for each oligonucleotide, columns represent dosing with 50, 100, or 200 ug of indicated oligonucleotide.

[0034] Figure 12. Treatment of heterozygous hSTMN2 KI mice with oligonucleotides targeted to TARDBP does not affect levels of full-length STMN2 mRNA in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 50, 100, or 200 ug of oligonucleotides targeting TARDBP or PBS control. On day 28, mice were euthanized and tissues collected. RNA was isolated, transcribed to cDNA, and levels of full-length STMN2 mRNA quantified using qPCR. Tissue type is indicated above each graph, (A) Cerebellum (left) and Cortex (right), (B) Hippocampus (left) and Spinal Cord (right). From left to right for 19 of 46113113958vlAttorney Docket No: 2010581-1550each oligonucleotide, columns represent dosing with 50, 100, or 200 ug of indicated oligonucleotide.

[0035] Figure 13. Treatment of homozygous hSTMN2 KI mice with oligonucleotides targeted to TARDBP can decrease levels of TARDBP mRNA in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 150 ug of DSR-0103350 targeting TARDBP, 150 ug of ASO-0139885 targeting TARDBP, or PBS. On day 7, mice that had previously received 150 ug of ASO-0139885 were dosed again with 150 ug of ASO-0139885. On day 14, mice were intracerebroventricularly dosed with 50 ug of ASO-0140416 targeting STMN2 or 50 ug of ASO-0140514, a non-targeting control. On day 56, mice were euthanized and tissues collected. RNA was isolated, transcribed to cDNA, and levels of TARDBP mRNA quantified using qPCR. Tissue type is indicated above each graph; (A) hippocampus, (B) cerebellum, (C) cortex, (D ) spinal cord. Hexagons indicate mice that were terminated early from the study.

[0036] Figure 14. Provided oligonucleotide can decrease levels of STMN2 mRNA comprising cryptic exon in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 150 ug of DSR-0103350 targeting TARDBP, 150 ug of ASO-0139885 targeting TARDBP, or PBS. On day 7, mice that had previously received 150 ug of ASO-0139885 were dosed again with 150 ug of ASO-0139885. On day 14, mice were intracerebroventricularly dosed with 50 ug of ASO-0140416 targeting STMN2 or 50 ug of ASO-0140514. a non-targeting control. On day 56. mice w 'ere euthanized and tissues collected. RNA was isolated, transcribed to cDNA, and levels of STMN2 mRNA with cryptic exon quantified using qPCR. Tissue type is indicated above each graph: (A) hippocampus, (B) cerebellum, (C) cortex, (D) spinal cord. Hexagons indicate mice that were terminated early from the study.

[0037] Figure 15. Treatment of homozygous hSTMN2 KI mice with oligonucleotides targeted to TARDBP does not affect levels of full-length STMN2 mRNA in vivo In brief, on day 0, mice were intracerebroventricularly dosed with 150 ug of DSR-0103350 targeting TARDBP, 150 ug of ASO-0139885 targeting TARDBP, or PBS. On day 7, mice that had previously received 150 ug of ASO-0139885 were dosed again with 150 ug of ASO-0139885. On day 14, mice were intracerebroventricularly dosed with 50 ug of ASO-0140416 targeting STMN2 or 50 ug of ASO-0140514, a non-targeting control. On day 56, mice were euthanized and tissues collected. RNA was isolated, transcribed to cDNA, and levels of full-length STMN2 mRNA quantified using qPCR. Tissue type is indicated above each graph; (A) spinal cord, (B) cortex. Hexagons indicate mice that were terminated early from the study.

[0038] Figure 16. Treatment of homozygous hSTMN2 KI mice with oligonucleotides targeted to TARDBP does not affect levels of STMN2 protein in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 150 ug of DSR-0103350 targeting TARDBP, 150 ug of ASO-0139885 targeting TARDBP, or PBS. On day 7, mice that had previously received 150 ug of ASO-0139885 were dosed again with 150 ug of ASO-0139885, On day 14, mice were intracerebroventricularly dosed with 50 ug of ASO-0140416 targeting STMN2 or 50 ug of ASO-0140514, a non-targeting control. On day 56, mice were euthanized and tissues collected. Protein was extracted and quantified. Tissue type is indicated above each graph; (A) spinal cord, (B) cortex. Hexagons indicate mice that were terminated early from the study.20 of 46113113958vlAttorney Docket No: 2010581-1550100391 Figure 17. Treatment of homozygous hSTMN2 KI mice with oligonucleotides targeted to TARDBP can decrease levels of TARDBP protein in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 150 ug of DSR-0103350 targeting TARDBP, 150 ug of ASO-0139885 targeting TARDBP, or PBS, On day 7. mice that had previously received 150 ug of ASO-0139885 were dosed again with 150 ug of ASO- 0139885. On day 14, mice were intracerebroventricularly dosed with 50 ug of ASO-0140416 targeting STM 2 or 50 ug of ASO-0140514, a non-targeting control. On day 56, mice were euthanized and tissues collected. Protein was extracted and quantified. Tissue A e is indicated above each graph: (A) posterior cortex, (B) spinal cord.

[0040] Figure 18. Provided oligonucleotides can decrease levels of STMN2 mRNA comprising cryptic exon in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 150 ug of DSR-0103350 targeting TARDBP or PBS. On day 14, mice were intracerebroventricularly dosed with 50 ug of oligonucleotides targeting STMN2 (ASO-0141171, ASO-0141458, ASO-0141133, ASO-0141158) or 50 ug of ASO-0140514, a non-targeting control. On day 42, mice were euthanized and tissues collected. RNA was isolated, transcribed to cDNA, and levels of full-length STMN2 mRNA quantified using qPCR. Tissue type is indicated above each graph; (A) cerebellum, (B) cortex, (C) hippocampus. (D) spinal cord.

[0041] Figure 19 Treatment of homozygous hSTMN2 KI mice with oligonucleotides targeted to TARDBP can decrease levels of TARDBP mRNA in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 150 ug of DSR-0103350 targeting TARDBP or PBS. On day 14, mice were intracerebroventricularly dosed with 50 ug of oligonucleotides targeting STMN2 (ASO-0141171, ASO-0141458, ASO-0141133, ASO- 0141158) or 50 ug of ASO-0140514, a non-targeting control. On day 42, mice were euthanized and tissues collected. RNA was isolated, transcribed to cDNA, and levels of TARDBP mRNA quantified using qPCR. Tissue type is indicated above each graph; (A) cerebellum, (B) cortex, (C) hippocampus. (D) spinal cord.

[0042] Figure 20. Provided oligonucleotides can provide dose-dependent increases in levels of STMN2 protein. Oligonucleotides comprising various modifications, such as linkage modifications (e g., PS. PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2’-F, 2'-0Mc, etc.), and stereochemistry and patterns thereof were designed and assessed. Wild-type human spinal motor neurons were pre-treated with oligonucleotide targeting TARDBP (ASO-0137331) on day 4 and subsequently gymnotically dosed with various concentrations of oligonucleotides targeting STMN2 for skipping of exon 2a on day 7. Cells that did not receive either the oligonucleotide targeting TARDBP or an oligonucleotide targeting STMN2 were examined as an untreated control. Cells that received only the oligonucleotide targeting TARDBP or the oligonucleotide targeting TARDBP in combination with an oligonucleotide not targeting STMN2 were also examined. Ceils were harvested on day 14. Cell lysates were collected and analyzed using a Meso Scale Discovery (MSD) assay as described in Example 14. Graphs depict interpolated STMN2 protein concentration for cells treated with oligonucleotides at bottom.

[0043] Figure 21. Provided oligonucleotides can provide dose-dependent decreases in cryptic exon¬ containing STM 2 mRNA and increases in full-length STMN2 mRNA. Oligonucleotides comprising various 21 of 46113113958vlAttorney Docket No: 2010581-1550modifications, such as linkage modifications (e.g., PS, PN (e.g., phosphoryl guanidine linkages such as nOOl), etc.), sugar modifications (e.g., 2'-F, 2’-0Me, etc.), and stereochemistry and patterns thereof were designed and assessed. Cells pre-treated with 20 uM of oligonucleotide targeting TARDBP were subsequently gymnotically dosed with various concentrations of oligonucleotides targeting STMN2 for skipping of exon 2a. After 7 days under treatment with oligonucleotides targeting STMN2 for skipping of exon 2a, cells were harvested. RNA was collected using trizol-based extraction and transcribed into cDNA. qPCR was performed using produced cDNA. Resulting qPCR data was analyzed using a robust linear mixed effects model to quantify mRNA remaining relative to mock treatment for STMN2 mRNA with cryptic exon (as shown in graph in (B)) and mRNA restored relative to untreated for full-length STMN2 mRNA (as shown in graph in (A)).

[0044] Figure 22. Assessment of oligonucleotides for decrease in cryptic exon-containmg STMN2 mRNA and increases m frill-length STMN2 mRNA. Oligonucleotides comprising various modifications and patterns thereof were designed and assessed. Cells pre-treated with 20 uM of oligonucleotide targeting TARDBP were subsequently gymnotically dosed with various concentrations of oligonucleotides targeting STMN2 for skipping of exon 2a. After 7 days under treatment with oligonucleotides targeting STMN2 for skipping of exon 2a. cells were harvested. RNA was collected using trizol-based extraction and transcribed into cDNA. qPCR was performed using produced cDN. Resulting qPCR data was analyzed using a robust linear mixed effects model to quantify mRNA remaining relative to mock treatment for STMN2 mRNA with cryptic exon (as shown in graph in (B)) and mRNA restored relative to untreated for full-length STMN2 mRNA (as shown in graph in (A)).

[0045] Figure 23, Provided oligonucleotides can decrease levels of STMN2 mRNA comprising cryptic exon in vivo. In brief, on day 0. mice were intracerebroventricularly dosed with 150 ug of DSR-0103350 targeting TARDBP or PBS. On day 14, mice were intracerebroventricularly dosed with 50 ug of oligonucleotides targeting STMN2 (ASO-OI41963. ASO-0137330, ASO-0141961, ASO-0141158, or ASO-0141458), PBS, or 50 ug of ASO-0140 14, a non-targeting control. On day 42, mice w ere euthanized and tissues collected. RN A was isolated, transcribed to cDNA, and levels of full-length STMN2 mRNA quantified using qPCR. Tissue type is indicated above each graph; (A) cerebellum, (B) cortex, (C) hippocampus, (D) spinal cord, ns: not significant; ** p < 0.01; *** p < 0.01; **** p < 0.0001 by one-wax ANOVA w ith multiple comparisons test.

[0046] Figure 24. Treatment of homozygous hSTMN2 KI mice with oligonucleotides targeted to TARDBP can decrease levels of TARDBP mRNA in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 150 ug of DSR-0103350 targeting TARDBP or PBS. On day 14, mice were intracerebroventricularly dosed with 50 ug of oligonucleotides targeting STMN2 (ASO-0141963, ASO-0137330, ASO-0141961, ASO-0141158, or ASO-0141458), PBS, or 50 ug of ASO-0140514, a non-targeting control. On day 42, mice were euthanized and tissues collected. RNA was isolated, transcribed to cDNA, and levels of TARDBP mRNA quantified using qPCR. Tissue type is indicated above each graph; (A) cerebellum, (B) cortex, (C) hippocampus, (D) spinal cord.

[0047] Figure 25. Provided oligonucleotides can provide increased level of full-length STMN2 mRNA in 22 of 46113113958vlAttorney Docket No: 2010581-1550Purkinje cells in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 150 ug of DSR-0103350 targeting TARDBP or PBS. On day 14, mice were intracerebroventricularly dosed with 50 ug of oligonucleotides targeting STMN2 (ASO-0141458, ASO-0141158) or 50 ug of ASO-0140514. a non -targeting control. On day 42, mice were euthanized and tissues collected. In situ hybridization was performed on cerebellum samples using probes for human STMN2 mRNA with cryptic exon and mouse full-length STMN2 mRNA. (A) Representative images of cerebellum from mice administered PBS and PBS (top left), DSR-0103350 and ASO-0140514 (top nght). DSR-0103350 and ASO-0141158 (bottom left), and DSR-0103350 and ASO-0141458 (bottom right). Arrows indicate Purkinje cells positive for full-length STMN2 mRNA. (B) Quantification of full-length STMN2-positive cells in the Purkinje layer of the cerebellum using HALO. Data are means ± SEM of three mice per group. * p< 0.05 by one-way ANOVA with Tukey ’s multiple comparison test. Plotted points (circle, square, triangle) represent data from individual mice.

[0048] Figure 26. Provided oligonucleotides can provide decreased level of Purkinje cell loss in vivo. In brief, on day 0, mice were intracerebroventricularly dosed with 150 ug of DSR-0103350 targeting TARDBP or PBS. On day 14, mice were intracerebroventricularly dosed with 50 ug of oligonucleotides targeting STMN2 (ASO-0141458, ASO-0141158) or 50 ug of ASO-0140514. anon-targeting control. On day 42. mice were euthanized and tissues collected Immunohistochemistry' (LHC) was performed on cerebellum samples with an anti-calbindin antibody. In representative images, Purkinje cell nuclei are dark rounded structures, dendrites extend toward one another and the clear central space (meninges), and axons are visible as thicker lines extending away from nuclei and dendrites. (A) Representative image of cerebellum from a mouse administered PBS and PBS, (B) Representative image of cerebellum from a mouse administered DSR-0103350 and PBS. (C) Representative image of cerebellum from a mouse administered DSR-0103350 and ASO-0140514. (D) Representative image of cerebellum from amouse administered DSR-0103350 and ASO-0141158. (E) Representative image of cerebellum from a mouse administered DSR-0103350 and ASO- 0141458. (F) Quantification of calbindin-positive neurons in the Purkinje cell layer of cerebellum Data are means ± SEM of three mice per group. Plotted points (circle, square, triangle) represent data from individual mice.DETAILED DESCRIPTION OF CERI AIN EMBODIMENTS

[0049] Technologies of the present disclosure may be understood more readily by' reference to the following detailed description of certain embodiments.Definitions

[0050] As used herein, the following definitions shall apply unless otherwise indicated For purposes of this disclosure, the chemical elements are identified in accordance with the Periodic Table of the Elements, CAS version, Handbook of Chemistry and Physics, 75th Ed. Additionally, general principles of organic chemistry are described in " Organic Chemistry ", Thomas Sorrell, University Science Books, Sausalito: 1999, and 23 of 46113113958vlAttorney Docket No: 2010581-1550" March's Advanced Organic Chemistry", 5th Ed., Ed.: Smith. M. B. and March. J, John Wiley & Sons, New York: 2001

[0051] As used herein in the present disclosure, unless otherwise clear from context, (i) the term “a” or “an” may be understood to mean “at least one”; (ii) the term “or” may be understood to mean “and / or”; (iii) the terms “comprising”, “comprise”, “including” (whether used with “not limited to” or not), and “include” (whether used with “not limited to” or not) may be understood to encompass itemized components or steps whether presented by themselves or together with one or more additional components or steps; (iv) the term “another” may be understood to mean at least an additional / second one or more; (v) the terms “about” and “approximately” may be understood to permit standard variation as would be understood by those of ordinary skill m the art: and ( vi) where ranges are provided, endpoints are included.[0052J Unless otherwise specified, description of oligonucleotides and elements thereof (e.g, base sequence, sugar modifications, intemucleotidic linkages, linkage phosphorus stereochemistry, patterns thereof, etc.) is from 5’ to 3’. As those skilled in the art will appreciate, in some embodiments, oligonucleotides may be provided and / or utilized as salt forms, particularly pharmaceutically acceptable salt forms, e.g., sodium salts. As those skilled in the art will also appreciate, in some embodiments, individual oligonucleotides within a composition may be considered to be of the same constitution and / or structure even though, within such composition (e.g., a liquid composition), particular such oligonucleotides might be in different salt form(s) (and may be dissolved and the oligonucleotide chain may exist as an anion form when, e.g., in a liquid composition) at a particular moment in time. For example, those skilled in the art will appreciate that, at a given pH, individual intemucleotidic linkages along an oligonucleotide chain may be in an acid (H) form, or in one of a plurality of possible salt forms (e.g, a sodium salt, or a salt of a different cation, depending on which ions might be present in the preparation or composition), and will understand that, so long as their acid forms (e.g, replacing all cations, if any, with H l are of the same constitution and / or structure, such individual oligonucleotides may properly be considered to be of the same constitution and / or structure.

[0053] Aliphatic: As used herein, “aliphatic” means a straight-chain (i.c, unbranchcd) or branched, substituted or unsubstituted hydrocarbon chain that is completely saturated or that contains one or more units of unsaturation (but not aromatic), or a substituted or unsubstituted monocyclic, bicyclic, or polycyclic hydrocarbon ring that is completely saturated or that contains one or more units of unsaturation (but not aromatic), or combinations thereof In some embodiments, aliphatic groups contain 1-50 aliphatic carbon atoms. In some embodiments, aliphatic groups contain 1-20 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-10 aliphatic carbon atoms, in other embodiments, aliphatic groups contain 1-9 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-8 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-7 aliphatic carbon atoms. In other embodiments, aliphatic groups contain 1-6 aliphatic carbon atoms. In still other embodiments, aliphatic groups contain 1-5 aliphatic carbon atoms, and in yet other embodiments, aliphatic groups contain 1, 2, 3, or 4 aliphatic carbon atoms. Suitable aliphatic groups include, but are not limited to, linear or branched, substituted or unsubstituted alkyl, alkenyl,24 of 46113113958vlAttorney Docket No: 2010581-1550alk nyl groups and hybrids thereof such as (cycloalky l)alkyl, (cycloalkenyl)alkyl or (cycloalkyl)alkenyl.

[0054] Alkenyl: As used herein, the term “alkenyl” refers to an aliphatic group, as defined herein, having one or more double bonds.

[0055] Alkyl: As used herein, the term “alkyl” is given its ordinary meaning in the art and may include saturated aliphatic groups, including straight-chain alkyl groups, branched-chain alkyl groups, cycloalkyl (alicyclic) groups, alkyl substituted cycloalkyl groups, and cycloalkyl substituted alkyl groups. In some embodiments, alkyl has 1-100 carbon atoms. In certain embodiments, a straight chain or branched chain alkyl has about 1-20 carbon atoms in its backbone (e.g., C1-C20 for straight chain, C2-C20 for branched chain), and alternatively, about 1-10. In some embodiments, cycloalkyl rings have from about 3-10 carbon atoms in their ring structure where such rings are monocyclic, bicyclic, or polycyclic, and alternatively about 5, 6 or 7 carbons in the ring structure. In some embodiments, an alkyl group may be a lower alkyl group, wherein a lower alkyl group comprises 1-4 carbon atoms (e.g., C1-C4 for straight chain lower alkyls).

[0056] Alkynyl: As used herein, the term “alkynyl” refers to an aliphatic group, as defined herein, having one or more triple bonds.

[0057] Analog: The term “analog” includes any chemical moiety which differs structurally from a reference chemical moiety or class of moieties, but which is capable of performing at least one function of such a reference chemical moiety or class of moieties. As non-limiting examples, a nucleotide analog differs structurally from a nucleotide but performs at least one function of a nucleotide; a nucleobase analog differs structurally7from a nucleobase but performs at least one function of a nucleobase; etc.

[0058] Animal: As used herein, the term “animal'’ refers to any member of the animal kingdom. In some embodiments, “animal” refers to humans, at any stage of development. In some embodiments, “animal” refers to non-human animals, at any stage of development. In certain embodiments, the non-human animal is a mammal (e.g, a rodent, a mouse, a rat, a rabbit, a monkey, a dog. a cat, a sheep, cattle, a primate and / or a pig). In some embodiments, animals include, but are not limited to. mammals, birds, reptiles, amphibians, fish and / or worms. In some embodiments, an animal may7be a transgenic animal, a genetically-engineered animal and / or a clone.

[0059] Aryl: The term “aryl", as used herein, used alone or as part of a larger moiety as in “aralkyl,” “aralkoxy,” or “aryloxyalkyl.” refers to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic. Tn some embodiments, an aryl group is a monocyclic, bicyclic or polycyclic ring system having a total of five to fourteen ring members, wherein at least one ring in the system is aromatic, and wherein each ring in the system contains 3 to 7 ring members. In some embodiments, each monocyclic ring unit is aromatic. In some embodiments, an aryl group is a biaryl group. Tire term “aryl” may be used interchangeably with the term “aryl ring.” In certain embodiments of the present disclosure, “aryl” refers to an aromatic ring system which includes, but is not limited to, phenyl, biphenyl, naphthyl, binaphthyl, anthracyl and the like, which may bear one or more substituents. Also included within the scope of the term “and,” as it is used herein, is a group in which an 25 of 46113113958vlAttorney Docket No: 2010581-1550aromatic ring is fused to one or more non--aromatic rings, such as indanyl, phthalimidyl, naphthimidyl, phenantliridmyl, or tetrahydronaphthyl, and the like.

[0060] Characteristic portion: As used herein, the term ‘■characteristic portion”, in the broadest sense, refers to a portion of a substance whose presence (or absence) correlates with presence (or absence) of a particular feature, attribute, or activity of the substance. In some embodiments, a characteristic portion of a substance is a portion that is found in the substance and in related substances that share the particular feature, attribute or activity, but not in those that do not share the particular feature, attribute or activity. In certain embodiments, a characteristic portion shares at least one functional characteristic with the intact substance. For example, in some embodiments, a ‘■characteristic portion” of a protein or polypeptide is one that contains a continuous stretch of ammo acids, or a collection of continuous stretches of ammo acids, that together are characteristic of a protein or polypeptide. In some embodiments, each such continuous stretch generally contains at least 2, 5, 10, 15, 20, 50, or more amino acids. In general, a characteristic portion of a substance (<? g., of a protein, antibody, etc.) is one that, in addition to the sequence and / or structural identity specified above, shares at least one functional characteristic with the relevant intact substance. In some embodiments, a characteristic portion may be biologically active.[0061J Chiral control: As used herein, ‘'chiral control” refers to control of the stereochemical designation of the chiral linkage phosphorus in a chiral intemucleotidic linkage within an oligonucleotide. As used herein, a chiral intemucleotidic linkage is an intemucleotidic linkage whose linkage phosphorus is chiral. In some embodiments, a control is achieved through a chiral element that is absent from the sugar and base moieties of an oligonucleotide, for example, in some embodiments, a control is achieved through use of one or more chiral auxiliaries during oligonucleotide preparation, which chiral auxiliaries often are part of chiral phosphoramidites used during oligonucleotide preparation. In contrast to chiral control, a person having ordinary skill in the art will appreciate that conventional oligonucleotide synthesis which does not use chiral auxiliaries cannot control stereochemistry at a chiral intemucleotidic linkage if such conventional oligonucleotide synthesis is used to form the chiral intemucleotidic linkage. In some embodiments, the stereochemical designation of each chiral linkage phosphorus in each chiral intemucleotidic linkage 'ithin an oligonucleotide is controlled.

[0062] Chirally controlled oligonucleotide composition: The terms “chirally controlled oligonucleotide composition”, “chirally controlled nucleic acid composition”, and the like, as used herein, refers to a composition that comprises a plurality of oligonucleotides (or nucleic acids) which share a common base sequence, wherein the plurality of oligonucleotides (or nucleic acids) share the same linkage phosphorus stereochemistry at one or more chiral intemucleotidic linkages (chirally controlled or stereodefined intemucleotidic linkages, whose chiral linkage phosphorus is Rp or Sp in the composition (“stereodefined”), not a random Rp and Sp mixture as non -chirally controlled intemucleotidic linkages). In some embodiments, a chirally controlled oligonucleotide composition comprises a plurality of oligonucleotides (or nucleic, acids) that share: 1) a common base sequence, 2) a common pattern of backbone linkages, and 3) a common pattern 26 of 46113113958vlAttorney Docket No: 2010581-1550of backbone phosphorus modifications, wherein the plurality of oligonucleotides (or nucleic acids) share the same linkage phosphorus stereochemistry' at one or more chiral intemucleotidic linkages (chirally controlled or stereodefined intemucleotidic linkages, whose chiral linkage phosphorus is Rp or Sp in the composition (“stereodefined’’), not a random Rp and Sp mixture as non-chirally controlled intemucleotidic linkages). Level of the plurality of oligonucleotides (or nucleic acids) in a chirally controlled oligonucleotide composition is pre-determined / controlled or enriched (e.g., through chirally controlled oligonucleotide preparation to stereoselectively form one or more chiral intemucleotidic linkages) compared to a random level in a non¬ chirally controlled oligonucleotide composition. In some embodiments, about l%-100%. (e.g.. about 5%- 100%. 10%-l 00%, 20%-100%, 30%-l 00%. 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90- 100%.95-100%, 50%-90%, or about 5%. 10%, 20%, 30%. 40%, 50%. 60%, 70%, 80%. 85%. 90%, 91%. 92%.93%. 94%. 95%. 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally' controlled oligonucleotide composition are oligonucleotides of the plurality. In some embodiments, about 1%-100%, (e.g., about 5%-100%, 10%- 100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%. 80-100%. 90-100%, 95-100%, 50%-90%, or about 5%, 10%, 20%, 30%, 40%. 50%. 60%. 70%. 80%, 85%, 90%, 91%, 92%. 93%. 94%. 95%, 96%, 97%, 98%, 99%, or 100%. or at least 5%, 10%, 20%, 30%.40%.50%. 60%, 70%, 80%, 85%, 90%, 91%. 92%, 93%. 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a chirally controlled oligonucleotide composition that share the common base sequence, the common pattern of backbone linkages, and the common pattern of backbone phosphorus modifications are oligonucleotides of the plurality. In some embodiments, a level is about 1 %-100%, (e.g,, about 5%-l 00%, 10%-100%, 20%-100%. 30%-100%, 40%-100%. 50%-100%, 60%-100%, 70%-100%. 80-100%. 90-100%, 95-100%, 50%-90%, or about 5%, 10%. 20%. 30%. 40%, 50%, 60%. 70%, 80%, 85%, 90%, 91%. 92%, 93%.94%, 95%, 96%, 97%, 98%, 99%, or 100%, or at least 5%, 10%, 20%, 30%, 40%, 50%. 60%, 70%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides in a composition, or of all oligonucleotides in a composition that share a common base sequence (e.g., of a plurality of oligonucleotide or an oligonucleotide type), or of all oligonucleotides in a composition that share a common base sequence, a common pattern of backbone linkages, and a common pattern of backbone phosphorus modifications, or of all oligonucleotides in a composition that share a common base sequence, a common patter of base modifications, a common pattern of sugar modifications, a common pattern of intemucleotidic linkage types, and / or a common pattern of intemucleotidic linkage modifications. In some embodiments, the plurality of oligonucleotides share the same stereochemistry' at about 1-50 (e.g., about 1-10, 1-20, 5-10, 5-20, 10-15, 10-20, 10-25, 10-30, or about 1, 2, 3, 4, 5. 6, 7, 8, 9. 10, 11, 12, 13, 14, 15, 16, 17. 18, 19, or 20, or at least 1, 2, 3, 4, 5, 6, 7. 8, 9. 10, 11, 12, 13, 14, 15, 16, 17, 18. 19. or 20) chiral intemucleotidic linkages. In some embodiments, the plurality of oligonucleotides share the same stereochemistry' at about 1%-100% (e.g., about 5%-100%. 10%-100%, 20%-100%, 30%-100%. 40%-100%, 50%-100%, 60%-100%. 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%, about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%,27 of 46113113958vlAttorney Docket No: 2010581-155065%, 70%, 75%, 80%, 85%, 90%, 95%, or 100%, or at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99%) of chiral intemucleotidic linkages. In some embodiments, oligonucleotides (or nucleic acids) of a plurality share the same pattern of sugar and / or nucleobase modifications, in any. In some embodiments, oligonucleotides (or nucleic acids) of a plurality are various forms of the same oligonucleotide (e.g., acid and / or various salts of the same oligonucleotide). In some embodiments, oligonucleotides (or nucleic acids) of a plurality are of the same constitution. In some embodiments, level of the oligonucleotides (or nucleic acids) of the plurality is about l%-100%, (e.g., about 5%-100%. 10%-100%, 20%-100%, 30%-100%, 40%-100%, 50%-100%, 60%-100%, 70%-100%, 80-100%, 90-100%, 95-100%, 50%-90%. or about 5%, 10%, 20%, 30%, 40%, 50%, 60%. 70%. 80%. 85%. 90%, 91%, 92%. 93%, 94%, 95%, 96%, 97%. 98%, 99%, or 100%. or at least 5%, 10%, 20%, 30%, 40%, 50%, 60%. 70%.80%. 85%, 90%, 91%. 92%. 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of all oligonucleotides (or nucleic acids) in a composition that share the same constitution as the oligonucleotides (or nucleic acids) of the plurality. In some embodiments, each chiral intemucleotidic linkage is a chiral controlled intemucleotidic linkage, and the composition is a completely chirally controlled oligonucleotide composition. In some embodiments, oligonucleotides (or nucleic acids) of a plurality are structurally identical. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 80%. 85%, 90%.91%. 92%, 93%, 94%, 95%, 96%. 97%, 98%. 99% or 99.5%, typically at least 90%, 91%, 92%. 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 95%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 96%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 97%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 98%. In some embodiments, a chirally controlled intemucleotidic linkage has a diastereopurity of at least 99%. In some embodiments, a percentage of a level is or is at least (DS)nc, wherein DS is a diastereopurity as described in the present disclosure (e.g., 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more) and nc is the number of chiral linkage phosphorus as described in the present disclosure (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15, 16. 17. 18. 19. 20, 21, 22, 23, 24, 25 or more). In some embodiments, a percentage of a level is or is at least (DS)nc, wherein DS is a diastereopurity as described in the present disclosure (e.g., 90%.91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% or more) and nc is the number of chirally controlled intemucleotidic linkages as described in the present disclosure (e.g., 1-50, 1-40, 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10. 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or more). In some embodiments, a percentage of a level is or is at least (DS)nc, wherein DS is 95%-100%. For example, when DS is 99% and nc is 10, the percentage is or is at least 90% ((99%)100.90 = 90%). In some embodiments, level of a plurality of oligonucleotides in a composition is represented as the product of the diastereopurity of each chiral linkage phosphorus. In some embodiments, level of a plurality of28 of 46113113958vlAttorney Docket No: 2010581-1550oligonucleotides in a composition is represented as the product of the diastereopurity of each chirally controlled intemucleotidic linkage in the oligonucleotides. In some embodiments, diastereopurity of an intemucleotidic linkage connecting two nucleosides in an oligonucleotide (or nucleic acid) is represented by the diastereopurity of an intemucleotidic linkage of a dimer connecting the same two nucleosides, wherein the dimer is prepared using comparable conditions, in some instances, identical synthetic cycle conditions (e.g., for the linkage between Nx and Ny in an oligonucleotide.... NxNy, the dimer is NxNy). In some embodiments, not all chiral intemucleotidic linkages are chiral controlled intemucleotidic linkages, and the composition is a partially chirally controlled oligonucleotide composition. In some embodiments, a non-chirally controlled intemucleotidic linkage has a diastereopurity of less than about 80%, 75%, 70%, 65%. 60%, 55%. or of about 50%, as typically observed in stereorandom oligonucleotide compositions (e.g., as appreciated by those skilled in the art. from traditional oligonucleotide synthesis, e.g, the phosphoramidite method). In some embodiments, oligonucleotides (or nucleic acids) of a plurality are of the same type. In some embodiments, a chirally controlled oligonucleotide composition comprises non-random or controlled levels of individual oligonucleotide or nucleic acids types. For instance, in some embodiments a chirally controlled oligonucleotide composition comprises one and no more than one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises more than one oligonucleotide type. In some embodiments, a chirally controlled oligonucleotide composition comprises multiple oligonucleotide types. In some embodiments, a chirally controlled oligonucleotide composition is a composition of oligonucleotides of an oligonucleotide type, which composition comprises a non-random or controlled level of a plurality of oligonucleotides of the oligonucleotide type,

[0063] Comparable: The term "‘comparable” is used herein to describe two (or more) sets of conditions or circumstances that are sufficiently similar to one another to permit comparison of results obtained or phenomena observed hi some embodiments, comparable sets of conditions orcircumstanc.es are characterized by a plurality of substantially identical features and one or a small number of varied features. Those of ordinary skill in the art will appreciate that sets of conditions arc comparable to one another when characterized by a sufficient number and type of substantially identical features to warrant a reasonable conclusion that differences in results obtained or phenomena observed under the different sets of conditions or circumstances are caused by or indicative of the variation in those features that are varied.

[0064] Cycloaliphatic: The term “cycloaliphatic,” “carbocycle,” “carbocyclyl,” “carbocyclic radical,” and “carbocyclic ring,” are used interchangeably, and as used herein, refer to saturated or partially unsaturated, but non-aromatic, cyclic aliphatic monocyclic, bicyclic, or polycyclic ring systems, as described herein, having, unless otherwise specified, from 3 to 30 ring members. Cycloaliphatic groups include, without limitation, cyclopropyl, cyclobutyl, cyclopentyl, cyclopentenyl, cyclohexyl, cyclohexenyl, cycloheptyl, cycloheptenyl, cyclooctyl, cyclooctenyl, norbomyl, adamantyl, and cy clooctadieny I. In some embodiments, a cycloaliphatic group has 3 -6 carbons. In some embodiments, a cycloaliphatic group is saturated and is cycloalkyl. The term “cycloaliphatic” may also include aliphatic rings that are fused to one or more aromatic or nonaromatic rings,29 of 46113113958vlAttorney Docket No: 2010581-1550such as decahydronaphthyl or tetrahydronaphthyl. In some embodiments, a cycloaliphatic group is bicyclic. In some embodiments, a cycloaliphatic group is tricyclic. In some embodiments, a cycloaliphatic group is polycyclic. In some embodiments, “cycloaliphatic" refers to Cs-Cg monocyclic hydrocarbon, or Cg-Cio bicyclic or polycyclic hydrocarbon, that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule, or a C9-C1.5 polycyclic hydrocarbon that is completely saturated or that contains one or more units of unsaturation, but which is not aromatic, that has a single point of attachment to the rest of the molecule.

[0065] Heteroaliphatic: The term “heteroaliphatic ’, as used herein, is given its ordinary meaning in the art and refers to aliphatic groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like). In some embodiments, one or more units selected from C, CH, CH2, and CHj are independently replaced by one or more heteroatoms (including oxidized and / or substituted forms thereof) In some embodiments, a heteroaliphatic group is heteroalkyl. In some embodiments, a heteroaliphatic group is heteroalkenyl.

[0066] Heteroalkyl: The term “heteroalky 1”, as used herein, is given its ordinary meaning in the art and refers to alkyl groups as described herein in which one or more carbon atoms are independently replaced with one or more heteroatoms (e.g., oxygen, nitrogen, sulfur, silicon, phosphorus, and the like). Examples of heteroalkyl groups include, but are not limited to, alkoxy, poly(ethylene glycol)-, alkyl-substituted amino, tetrahydrofuranyl, piperidmyl, morpholinyl, etc.

[0067] Heteroaryl: The terms “heteroary l” and “heteroar-", as used herein, used alone or as part of a larger moiety, e.g., “heteroaralkyl.” or “heteroaralkoxy,” refer to monocyclic, bicyclic or polycyclic ring systems having a total of five to thirty ring members, wherein at least one ring in the system is aromatic and at least one aromatic ring atom is a heteroatom. In some embodiments, a heteroaryl group is a group having 5 to 10 ring atoms (i.e., monocyclic, bicyclic or polycyclic), in some embodiments 5, 6, 9, or 10 ring atoms. In some embodiments, each monocyclic ring unit is aromatic. In some embodiments, a heteroaryl group has 6, 10, or 14 Ti electrons shared in a cyclic array; and having, in addition to carbon atoms, from one to five hctcroatoros. Heteroaryl groups include, without limitation, thienyl, furanyl, pyrrolyl, imidazolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, oxadiazolyl, thiazolyl, isothiazolyl, thiadiazolyl, pyridyl, pyridazinyl, pyrimidmyl, pyrazmyl, indolizinyl, purinyl, naphthyridmyl, and pteridinyl. In some embodiments, a heteroaryl is a heterobi and group, such as bipyridyl and the like. The terms “heteroaryl” and “heteroar-”, as used herein, also include groups in which a heteroaromatic ring is fused to one or more aryl, cycloaliphatic, or heterocyclyl rings, where the radical or point of attachment is on the hctcroaromatic ring. Non-limiting examples include indolyl, isoindolyl, benzothienyl, benzofuranyl, dibenzofuranyl, indazolyl, benzimidazolyl, benzthiazolyl, quinolyl, isoquinolyl, cinnolinyl, phthalazinyl, quinazolinyl, quinoxaJtnyl. 4H-quinolizinyl, carbazolyl. acridinyl, phenazinyl, phenothiazinyl, phenoxazinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, and pyrido[2,3-b]--l,4--oxazin-3(4H) -one. A heteroaryl group may be monocyclic, bicyclic or polycyclic. The term “heteroaryl” may be used interchangeably with the terms “heteroaryl ring,” “heteroaryl group,” or 30 of 46113113958vlAttorney Docket No: 2010581-1550“heteroaromatic.” any of which terms include rings that are optionally substituted. The term “heteroaralkyl” refers to an alkyl group substituted by a heteroaryl group, wherein the alkyl and heteroaryl portions independently are optionally substituted.

[0068] Heteroatom: The term “heteroatom", as used herein, means an atom that is not carbon or hydrogen. In some embodiments, a heteroatom is boron, oxygen, sulfur, nitrogen, phosphorus, or silicon (including oxidized forms of nitrogen, sulfur, phosphorus, or silicon; charged forms of nitrogen (e.g., quaternized forms, forms as in iminium groups, etc ), phosphorus, sulfur, oxygen; etc.). In some embodiments, a heteroatom is silicon, phosphorus, oxygen, sulfur or nitrogen. In some embodiments, a heteroatom is silicon, oxygen, sulfur or nitrogen. In some embodiments, a heteroatom is oxygen, sulfur or nitrogen.

[0069] Heterocycle: As used herein, the terms “heterocycle,” “heterocyclyl,” “heterocyclic radical.” and “heterocyclic ring", as used herein, are used interchangeably and refer to a monocyclic, bicyclic or polycyclic ring moiety (e.g., 3-30 membered) that is saturated or partially unsaturated and has one or more heteroatom ring atoms. In some embodiments, a heterocyclyl group is a stable 5- to 7-membered monocyclic or 7- to 10- membered bicyclic heterocyclic moiety that is either saturated or partially unsaturated, and having, in addition to carbon atoms, one or more, preferably one to four, heteroatoms, as defined above. When used in reference to a ring atom of a heterocycle, the term "nitrogen" includes substituted nitrogen. As an example, in a saturated or partially unsaturated ring having 0-3 heteroatoms selected from oxygen, sulfur and nitrogen, the nitrogen may be N (as in 3,4-dihydro-2H-pyrrolyl), NH (as in pyrrolidinyl), or+NR (as in N-substituted pyrrolidinyl). A heterocyclic ring can be attached to its pendant group at any heteroatom or carbon atom that results in a stable structure and any of the ring atoms can be optionally substituted. Examples of such saturated or partially unsaturated heterocyclic radicals include, without limitation, tetrahydrofuranyl, tetrahydrothienyl, pyrrolidinyl. piperidinyl, pyrrolinyl, tetrahydroquinolinyl, tetrahydroisoquinolinyl, decahydroquinolinyl, oxazolidinyi, piperazinyl, dioxanyl, dioxolanyl. diazepinyl, oxazepinyl, thiazepinyl, morpholinyl, and quinuclidinyl. The terms “heterocycle,” “heterocyclyl,” “heterocyclyl ring,” “heterocyclic group,” “heterocyclic moiety,” and “heterocyclic radical,” arc used interchangeably herein, and also include groups in which a heterocyclyl ring is fused to one or more aryl, heteroaryl, or cycloaliphatic rings, such as indolinyl, 3H-indolyl, chromanyl, phenanthridinyl, or tetrahydroquinolinyl. A heterocyclyl group may be monocyclic, bicyclic or polycyclic. The term “heterocyclylalkyl” refers to an alkyl group substituted by a heterocyclyl. wherein the alkyl and heterocyclyl portions independently are optionally substituted.

[0070] Identity: As used herein, the term “identity” refers to the overall relatedness between polymeric molecules, e.g., between nucleic acid molecules (e.g., oligonucleotides, DNA, RNA, etc.) and / or between polypeptide molecules. In some embodiments, polymeric molecules are considered to be “substantially identical” to one another if their sequences are at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%.70%, 75%, 80%, 85%, 90%, 95%, or 99% identical. Calculation of the percent identity of two nucleic acid or polypeptide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second sequences for optimal alignment 31 of 46113113958vlAttorney Docket No: 2010581-1550and non-identical sequences can be disregarded for comparison purposes). In certain embodiments, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%. at least 90%, at least 95%, or substantially 100% of the length of a reference sequence. The nucleotides at corresponding positions are then compared When a position in the first sequence is occupied by the same residue (e.g.. nucleotide or amino acid) as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. Tire comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. For example, the percent identity between two nucleotide sequences can be determined using the algorithm of Meyers and Miller (CABIOS, 1989, 4: 11-17), which has been incorporated into the ALIGN program (version 2.0). In some exemplary embodiments, nucleic acid sequence comparisons made with the ALIGN program use a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4. Hie percent identity between two nucleotide sequences can, alternatively, be determined using the GAP program in the GCG software package using an NWSgapdna. CMP matrix.[0071J Intemucleotidic linkage: As used herein, the phrase “intemucleotidic linkage’' refers generally to a linkage linking nucleoside units of an oligonucleotide or a nucleic acid. In some embodiments, an intemucleotidic linkage is a phosphodiester linkage, as extensively found in naturally occurring DNA and RNA molecules (natural phosphate linkage (~-OP(=O)(OH)O~), which as appreciated by those skilled in tire art may exist as a salt form). In some embodiments, an intemucleotidic linkage is a modified intemucleotidic linkage (not a natural phosphate linkage). In some embodiments, an intemucleotidic linkage is a “modified intemucleotidic linkage” wherein at least one oxygen atom or OH of a phosphodiester linkage is replaced by a different organic or inorganic moiety. In some embodiments, such an organic or inorganic moiety is selected from =S, =Se, =NR’. -SR’, -SeR’, -N(R’)2, B(R’)3J-S-, -Se-, and ~N(R’)~, wherein each R’ is independently as defined and described in the present disclosure. In some embodiments, an intemucleotidic linkage is a phosphotriester linkage, phosphorothioate linkage (or phosphorothioate diester linkage, ~OP(=O)(SH)O“, which as appreciated by those skilled in the art may exist as a salt form), or phosphorothioate triester linkage. In some embodiments, a modified intemucleotidic linkage is a phosphorothioate linkage. In some embodiments, an intemucleotidic linkage is one of, e.g., PNA (peptide nucleic acid) or PMO (phosphorodiamidate Morpholino oligomer) linkage. In some embodiments, a modified intemucleotidic linkage is a non-negatively charged intemucleotidic linkage. In some embodiments, a modified intemucleotidic linkage is a neutral intemucleotidic linkage (e.g., nOOi in certain provided oligonucleotides). It. is understood by a person of ordinary' skill in the art that an intemucleotidic linkage may exist as an anion or cation at a given pH due to the existence of acid or base moieties in the linkage. In some embodiments, a modified intemucleotidic linkages is a modified intemucleotidic linkages designated as s, si. s2, s3, s4, s5, s6, s7, s8, s9, slO, s 11, s!2, sl3, s!4, sl5, s!6, s!7 and s!8 as described in WO 2017 / 210647.32 of 46113113958vlAttorney Docket No: 2010581-1550

[0072] In vitro: As used herein, the term “in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within an organism (e.g., animal, plant and / or microbe).

[0073] In vivo: As used herein, the term “in vivo” refers to events that occur within an organism (e.g.. animal, plant and / or microbe).

[0074] Linkage phosphorus: as defined herein, the phrase “linkage phosphorus” is used to indicate that the particular phosphorus atom being referred to is the phosphorus atom present in the internucleotidic linkage, which phosphorus atom corresponds to the phosphorus atom of a phosphodiester internucleotidic linkage as occurs in naturally occurring DNA and RNA. In some embodiments, a linkage phosphorus atom is in a modified internucleotidic linkage, wherein each oxygen atom of a phosphodiester linkage is optionally and independently replaced by an organic or inorganic moiety. In some embodiments, a linkage phosphorus atom is chiral (e.g., as in phosphorothioate internucleotidic linkages). In some embodiments, a linkage phosphorus atom is achiral (e.g., as in natural phosphate linkages).

[0075] Modified nucleobase: The terms "modified nucleobase", "modified base" and the like refer to a chemical moiety which is chemically distinct from a nucleobase, but which is capable of performing at least one function of a nucleobase. In some embodiments, a modified nucleobase is a nucleobase which comprises a modification. In some embodiments, a modified nucleobase is capable of at least one function of a nucleobase, e.g., forming a moiety in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases. In some embodiments, a modified nucleobase is substituted A, T, C, G, or U, or a substituted tautomer of A, T. C, G, or U. In some embodiments, a modified nucleobase in the context of oligonucleotides refer to a nucleobase that is not A, T, C, G or U.

[0076] Modified nucleoside: The term "modified nucleoside" refers to a moiety derived from or chemically similar to a natural nucleoside, but. which comprises a chemical modification which differentiates it from a natural nucleoside. Non -limiting examples of modified nucleosides include those which comprise a modification at the base and / or the sugar. Non-limiting examples of modified nucleosides include those with a 2’ modification at a sugar. Non-limiting examples of modified nucleosides also include abasic nucleosides (which lack a nucleobase). In some embodiments, a modified nucleoside is capable of at least one function of a nucleoside, e.g., forming a moiety m a polymer capable of base -pairing to a nucleic acid comprising an at least complementary sequence of bases.

[0077] Modified nucleotide: The term “modified nucleotide” includes any chemical moiety which differs structurally from a natural nucleotide but is capable of performing at least one function of a natural nucleotide. In some embodiments, a modified nucleotide comprises a modification at a sugar, base and / or internucleotidic linkage. In some embodiments, a modified nucleotide comprises a modified sugar, modified nucleobase and / or modified internucleotidic linkage. In some embodiments, a modified nucleotide is capable of at least one function of a nucleotide, e.g.. forming a subunit in a polymer capable of base-pairing to a nucleic acid comprising an at least complementary sequence of bases.33 of 46113113958vlAttorney Docket No: 2010581-1550

[0078] Modified sugar. The term “modified sugar” refers to a moiety that can replace a sugar. A modified sugar mimics the spatial arrangement, electronic properties, or some other physicochemical property of a sugar. In some embodiments, as described in the present disclosure, a modified sugar is substituted ribose or deoxyribose. In some embodiments, a modified sugar comprises a 2’ -modification. Examples of useful 2’-modification are widely utilized in the art and described herein. In some embodiments, a 2’ -modification is 2’-F. In some embodiments, a 2 ’-modification is 2’-OR, wherein R is optionally substituted Cuo aliphatic. In some embodiments, a 2 ’-modification is 2’-OMe In some embodiments, a 2 ’-modification is 2 ’-MOE. In some embodiments, a modified sugar is a bicyclic sugar (e.g., a sugar used in LNA, BNA, etc ). In some embodiments, in the context of oligonucleotides, a modified sugar is a sugar that is not ribose or deoxyribose as typically found in natural RNA or DNA.

[0079] Nucleic acid: The term “nucleic acid”, as used herein, includes any nucleotides and polymers thereof Tire term “polynucleotide”, as used herein, refers to a polymeric form of nucleotides of any length, either ribonucleotides (RNA) or deoxynbonucleotides (DNA) or a combination thereof. These terms refer to the primary structure of the molecules and, thus, include double- and single -stranded DNA, and double- and singlestranded RNA. These terms include, as equivalents, analogs of either RNA or DNA comprising modified nucleotides and / or modified polynucleotides, such as, though not limited to, methylated, protected and / or capped nucleotides or polynucleotides. Tire terms encompass poly- or oligo-ribonucleotides (RNA) and poly- or oligo-deoxyribonucleotides (DNA); RNA or DNA derived from N-glycosides or C-glycosides of nucleobases and / or modified nucleobases; nucleic acids derived from sugars and / or modified sugars; and nucleic acids derived from phosphate bridges and / or modified intemucleotidic linkages. The term encompasses nucleic acids containing any combinations of nucleobases, modified nucleobases, sugars, modified sugars, phosphate bridges or modified intemucleotidic linkages. Examples include, and are not limited to, nucleic acids containing ribose moieties, nucleic acids containing deoxy-ribose moieties, nucleic acids containing both ribose and deoxyribose moieties, nucleic acids containing ribose and modified ribose moieties. Unless otherwise specified, the prefix poly- refers to a nucleic acid containing 2 to about 10,000 nucleotide monomer units and wherein the prefix oligo- refers to a nucleic acid containing 2 to about 200 nucleotide monomer units.

[0080] Nucleobase: The term “nucleobase” refers to the parts of nucleic acids that are involved m the hydrogen-bonding that binds one nucleic acid strand to another complementary' strand in a sequence specific manner. Tire most common naturally-occurring nucleobases are adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, a naturally-occurring nucleobases arc modified adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a naturally -occurring nucleobases are methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a nucleobase comprises a heteroaryl ring wherein a ring atom is nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety. In some embodiments, a nucleobase comprises a heterocyclic ring wherein a ring atom is nitrogen, and when in a nucleoside, the nitrogen is bonded to a sugar moiety. In some embodiments, a nucleobase is a “modified 34 of 46113113958vlAttorney Docket No: 2010581-1550nucleobase,” a nucleobase other than adenine (A), guanine (G), uracil (U), cytosine (C), and thymine (T). In some embodiments, a modified nucleobase is substituted A, T, C, G or U. In some embodiments, a modified nucleobase is a substituted tautomer of A, T, C, G, or U, In some embodiments, a modified nucleobases is methylated adenine, guanine, uracil, cytosine, or thymine. In some embodiments, a modified nucleobase mimics the spatial arrangement, electronic properties, or some other physicochemical property of the nucleobase and retains the property of hydrogen -bonding that binds one nucleic acid strand to another in a sequence specific manner. In some embodiments, a modified nucleobase can pair with all of the five naturally occurring bases (uracil, thymine, adenine, cytosine, or guanine) without substantially affecting the melting behavior, recognition by intracellular enzymes or activity of the oligonucleotide duplex. As used herein, the term ‘'nucleobase7’ also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleobases and nucleobase analogs. In some embodiments, a nucleobase is optionally substituted A, T, C, G, or U, or an optionally substituted tautomer of A, T, C, G, or U. In some embodiments, a “nucleobase” refers to a nucleobase unit in an oligonucleotide or a nucleic acid (e.g., A, 1. C, G or U as in an oligonucleotide or a nucleic acid).

[0081] Nucleoside: The term “nucleoside” refers to a moiety wherein a nucleobase or a modified nucleobase is covalently bound to a sugar or a modified sugar. In some embodiments, a nucleoside is a natural nucleoside, e.g., adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, or deoxycytidine. In some embodiments, a nucleoside is a modified nucleoside, e.g., a substituted natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxycytidine. In some embodiments, a nucleoside is a modified nucleoside, e.g,, a substituted tautomer of a natural nucleoside selected from adenosine, deoxyadenosine, guanosine, deoxyguanosine, thymidine, uridine, cytidine, and deoxy cytidine. In some embodiments, a "nucleoside” refers to a nucleoside unit in an oligonucleotide or a nucleic acid.

[0082] Nucleotide: The term “nucleotide” as used herein refers to a monomeric unit of a polynucleotide that consists of a nucleobase, a sugar, and one or more intemuclcotidic linkages (e.g., phosphate linkages in natural DNA and RNA). Hie naturally occurring bases [guanine, (G), adenine. (A), cytosine, (C), thymine, (T), and uracil (U)] are derivatives of purine or pyrimidine, though it should be understood that naturally and non- naturally occurring base analogs are also included. Hie naturally occurring sugar is the pentose (five-carbon sugar) deoxyribose (which forms DNA) or ribose (which forms RNA), though it should be understood that naturally and non-naturally occurring sugar analogs are also included. Nucleotides are linked via intemuclcotidic linkages to form nucleic acids, or polynucleotides. Many intemuclcotidic linkages arc known in the art (such as, though not limited to, phosphate, phosphorothioates, boranophosphates and the like). Artificial nucleic acids include PNAs (peptide nucleic acids), phosphotriesters, phosphorothionates. H-phosphonates, phosphoramidates, boranophosphates, methylphosphonates, phosphonoacetates, thiophosphonoacetates and other variants of the phosphate backbone of native nucleic acids, such as those described herein In some embodiments, a natural nucleotide comprises a naturally7occurring base, sugar and 35 of 46113113958vlAttorney Docket No: 2010581-1550internucleotidic linkage. As used herein, the term “nucleotide” also encompasses structural analogs used in lieu of natural or naturally-occurring nucleotides, such as modified nucleotides and nucleotide analogs. In some embodiments, a “nucleotide” refers to a nucleotide unit in an oligonucleotide or a nucleic acid.

[0083] Oligonucleotide: The term "oligonucleotide" refers to a polymer or oligomer of nucleotides, and may contain any combination of natural and non-natural nucleobases, sugars, and internucleotidic linkages.

[0084] Oligonucleotides can be single-stranded or double-stranded. A single -stranded oligonucleotide can have double -stranded regions (formed by two portions of the single -stranded oligonucleotide) and a double¬ stranded oligonucleotide, which comprises two oligonucleotide chains, can have single-stranded regions for example, at regions where the two oligonucleotide chains are not complementary to each other. Example oligonucleotides include, but are not limited to structural genes, genes including control and termination regions, self-replicating systems such as viral or plasmid DNA, single-stranded and double -stranded RNAi agents and other RNA interference reagents (RNAi agents or iRNA agents), shRNA, antisense oligonucleotides, ribozymes, microRNAs, microRNA mimics, supermirs, aptamers, antimirs, antagomirs, U1 adaptors, triplex-forming oligonucleotides, G-quadruplex oligonucleotides, RNA activators, immunostimulatory oligonucleotides, and decoy oligonucleotides.

[0085] Oligonucleotides of the present disclosure can be of various lengths. In particular embodiments, oligonucleotides can range from about 2 to about 200 nucleosides in length. In various related embodiments, oligonucleotides, single-stranded, double-stranded, or triple-stranded, can range in length from about 4 to about 10 nucleosides, from about 10 to about 50 nucleosides, from about 20 to about 50 nucleosides, from about 15 to about 30 nucleosides, from about 20 to about 30 nucleosides in length. In some embodiments, an oligonucleotide is from about 9 to about 39 nucleosides in length. In some embodiments, an oligonucleotide is from about 25 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 26 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 27 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 28 to about 70 nucleosides in length Tn some embodiments, an oligonucleotide is from about 29 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 30 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 31 to about 70 nucleosides in length. In some embodiments, an oligonucleotide is from about 32 to about 70 nucleosides m length. In some embodiments, an oligonucleotide is from about 25 to about 60 nucleosides in length. In some embodiments, an oligonucleotide is from about 25 to about 50 nucleosides in length. In some embodiments, an oligonucleotide is from about 25 to about 40 nucleosides in length. In some embodiments, an oligonucleotide is from about 30 to about 40 nucleosides in length. In some embodiments, the oligonucleotide is at least 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17. 18, 19, 20, 21, 22, 23, 24, or 25 nucleosides in length. In some embodiments, an oligonucleotide is at least 4 nucleosides in length. In some embodiments, an oligonucleotide is at least 5 nucleosides in length. In some embodiments, an oligonucleotide is at least 6 nucleosides in length. In some embodiments, an oligonucleotide is at least 7 nucleosides in length. In some embodiments, an oligonucleotide is at least 8 nucleosides in length.36 of 46113113958vlAttorney Docket No: 2010581-1550In some embodiments, an oligonucleotide is at least 9 nucleosides in length. In some embodiments, an oligonucleotide is at least 10 nucleosides in length. In some embodiments, an oligonucleotide is at least 11 nucleosides in length. In some embodiments, an oligonucleotide is at least 12 nucleosides in length. In some embodiments, an oligonucleotide is at least 15 nucleosides in length. In some embodiments, an oligonucleotide is at least 15 nucleosides in length. In some embodiments, an oligonucleotide is at least 16 nucleosides in length. In some embodiments, an oligonucleotide is at least 17 nucleosides in length. In some embodiments, an oligonucleotide is at least 18 nucleosides in length. In some embodiments, an oligonucleotide is at least 19 nucleosides in length. In some embodiments, an oligonucleotide is at least 20 nucleosides in length. In some embodiments, an oligonucleotide is at least 25 nucleosides in length. In some embodiments, an oligonucleotide is at least 26 nucleosides in length. In some embodiments, an oligonucleotide is at least 27 nucleosides in length. In some embodiments, an oligonucleotide is at least 28 nucleosides in length In some embodiments, an oligonucleotide is at least 29 nucleosides in length. In some embodiments, an oligonucleotide is at least 30 nucleosides in length. In some embodiments, an oligonucleotide is at least 31 nucleosides in length. In some embodiments, an oligonucleotide is at least 32 nucleosides in length. In some embodiments, an oligonucleotide is at least 33 nucleosides in length. In some embodiments, an oligonucleotide is at least 34 nucleosides in length In some embodiments, an oligonucleotide is at least 35 nucleosides in length. In some embodiments, an oligonucleotide is at least 36 nucleosides in length. In some embodiments, an oligonucleotide is at least 37 nucleosides in length. In some embodiments, an oligonucleotide is at least 38 nucleosides in length. In some embodiments, an oligonucleotide is at least 39 nucleosides in length. In some embodiments, an oligonucleotide is at least 40 nucleosides in length. In some embodiments, an oligonucleotide is 25 nucleosides in length In some embodiments, an oligonucleotide is 26 nucleosides in length. In some embodiments, an oligonucleotide is 27 nucleosides in length. In some embodiments, an oligonucleotide is 28 nucleosides in length. In some embodiments, an oligonucleotide is 29 nucleosides in length. In some embodiments, an oligonucleotide is 30 nucleosides in length. In some embodiments, an oligonucleotide is 31 nucleosides in length. In some embodiments, an oligonucleotide is 32 nucleosides in length. In some embodiments, an oligonucleotide is 33 nucleosides in length. In some embodiments, an oligonucleotide is 34 nucleosides in length. In some embodiments, an oligonucleotide is 35 nucleosides in length. In some embodiments, an oligonucleotide is 36 nucleosides m length. In some embodiments, an oligonucleotide is 37 nucleosides in length. In some embodiments, an oligonucleotide is 38 nucleosides in length. In some embodiments, an oligonucleotide is 39 nucleosides in length. In some embodiments, an oligonucleotide is 40 nucleosides in length. In some embodiments, each nucleoside counted in an oligonucleotide length independently comprises a nuclcobasc comprising a ring having at least one nitrogen ring atom. In some embodiments, each nucleoside counted in an oligonucleotide length independently comprises A, T, C. G, or U, or optionally substituted A. T, C, G, or U, or an optionally substituted tautomer of A, T. C, G or U.

[0086] Oligonucleotide type: As used herein, the phrase “oligonucleotide type” is used to define an oligonucleotide that has a particular base sequence, pattern of backbone linkages (i.e., pattern of 37 of 46113113958vlAttorney Docket No: 2010581-1550internucleotidic linkage types, for example, phosphate, phosphorothioate, phosphorothioate triester, etc.), pattern of backbone chiral centers [i.e., pattern of linkage phosphorus stereochemistry (Rp / Sp)], and pattern of backbone phosphorus modifications In some embodiments, oligonucleotides of a common designated “type” are structurally identical to one another.

[0087] One of skill in the art will appreciate that synthetic methods of the present disclosure provide for a degree of control during the synthesis of an oligonucleotide strand such that each nucleotide unit of the oligonucleotide strand can be designed and / or selected in advance to have a particular stereochemistry at the linkage phosphorus and / or a particular modification at the linkage phosphorus, and / or a particular base, and / or a particular sugar. In some embodiments, an oligonucleotide strand is designed and / or selected in advance to have a particular combination of stereocenters at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and / or determined to have a particular combination of modifications at the linkage phosphorus. In some embodiments, an oligonucleotide strand is designed and / or selected to have a particular combination of bases. In some embodiments, an oligonucleotide strand is designed and / or selected to have a particular combination of one or more of the above structural characteristics. In some embodiments, the present disclosure provides compositions comprising or consisting of a plurality of oligonucleotide molecules (e.g., chirally controlled oligonucleotide compositions) In some embodiments, ail such molecules are of the same type (i.e., are structurally identical to one another). In some embodiments, however, provided compositions comprise a plurality of oligonucleotides of different types, typically in pre -determined relative amounts.

[0088] Optionally Substituted: As described herein, compounds of the disclosure may contain optionally substituted, substituted and / or unsubstituted moieties. In general, the term “substituted,” means that one or more hydrogens of the designated moiety are independently replaced with a substituent. Unless otherwise indicated, an “optionally substituted” group may independently have a substituent at each substitutable position of the group, and when more than one position in any given structure may be substituted with two or more substituents, the substituents may be cither the same or different at every position. In some embodiments, an optionally substituted group is unsubstituted. In some embodiments, an optionally substituted group is substituted. Various substituents are described below'.

[0089] Monovalent substituents are independently halogen; -(CH2)o^R°; -(CH2)o-iOR0; -0(CH?)o.4R°, -O-(CH2)( IC(0)0R°; -(CHZ)CMCH(0RO)2; -(CH2)0^Ph, which may be substituted with R°; -(CH2)o^O(CH2)o- iPh which may be substituted with R°; -CH=CHPh, which may be substituted with R°; -(CH2)O-IO(CH2)O-I-pyridyl which may be substituted with R; -NO?; ~CN; -Ns; -(CH2)C N(R°)2; -(CH2)(WSN(RO)C(0)R°; -N(R°)C(S)R°; -(CH2)O^N(R°)C(0)N(RC)2; -N(RC)C(S)N(R°)2; -(CH:)O^N(RC)C(0)OR°; N(R°)N(R°)C(O)R°; -N(Ro)N(R°)C(0)N(Rc)2; -N(R°)N(Ro)C(0)0R0; -(CH2)0^C(O)R°; -C(S)R°; -(CH?)C C(O)OR°; -(CH2)O^C(0)SR°; -(CH2)c C(O)OSi(R°)3; -(CH2)0^OC(O)R°; -OC(O)(CH2)0^SR°. -SC(S)SR°; -(CH2)O^SC(0)R°; -(CH2)O^C(0)N R°)2; -C(S)N(R0)?; -C(S)SR°; -SC(S)SR°, -(CH2)0_38 of 46113113958vlAttorney Docket No: 2010581-15504OC(O)N(R°)2; -C(O)N(OR°)R°; -C(O)C(O)R°; -C(O)CH2C(O)RO; -C(NOR°)R°; -(CH2)O 4SSR°; -(CH2)y4S O)2R°; -(CH2)C S(O)2OR°; -(CH2)O 40S(0) RO: -S(0)2N(RO)2; -(CH )4S(O)R°L -N(R°)S(O)2N(R°)2; - N(R°)S(O)2R°: N(OR°)R°; C(NH)N(RO)2; -Si(R°)3; -OSi(R°)3; -P(R°)2; P(ORO)2; 0P(RO)2; 0P(0RO)2; -N(R°)P(RO)2; B(RO)2; OB(RO)2; -P(0)(RO)2; 0P(0)(RO)2; -N(R°)P(O)(RO)2; (CI-4straight or branched alkylene)O--N(R°)2: or — (Ci-4straight or branched alkylene)C(O)O-N(R°)2; wherein each R° may be independently substituted as defined below and is independently hydrogen, C1-10 (e.g., Ci-6, CI.4, etc.) aliphatic, CMO (e g., C1.6, C1.4, etc.) heteroaliphatic having 1-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, CC 10 (e.g., Ce, C;o, etc.) aryl, 5-10 (e g., 5-9, 5-6, 5, 6, 9, 10, etc.) membered hctcroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen and sulfur, -CH2-(C6-IO (e.g., C6, C10, etc.) aryl), -0(CH2)O-I(C6-IO (e.g.. C6, Cio, etc.) aryl), -CH2-(5-10 (e.g.. 5-9, 5-6, 5, 6, 9. 10, etc.) membered heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen and sulfur), -0(CH2)O-I(5-10 (e.g., 5-9, 5-6, 5, 6, 9, 10, etc.) membered heteroaryl having 1-4 heteroatoms independently selected from nitrogen, oxygen and sulfiir), a 3-10 (e.g., 3-6, 5-6, 3, 4, 5, 6. 7, 8, 9, 10, etc.) membered, monocyclic, bicyclic, or polycyclic, saturated, or partially unsaturated ring having 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfur, silicon and phosphorus, or, notwithstanding the definition above, two independent occurrences of R°, taken together with their intervening atom(s), form a 3- 10 (e.g., 3-6, 5-6, 3, 4, 5, 6, 7, 8, 9. 10, etc.) membered, monocyclic, bicyclic, or polycyclic, saturated, partially unsaturated or aromatic ring (for aromatic ring, 5-10 (e g., 5-9, 5-6, 5, 6. 9, 10, etc.) membered) having, in addition to the intervening atom(s), 0-5 heteroatoms independently selected from nitrogen, oxygen, sulfiir, silicon and phosphorus, which may be substituted as defined below.

[0090] Monovalent substituents on R° (or the ring formed by taking two independent occurrences of R° together with their intervening atoms), are independently halogen. ~(CH2)O2R*, -(haloR*), ~(CH2)o-2OH, - (CH2)n..2OR*, (CH2)O..2CH(OR*)2; -O(haloR*). -CN, -N3. (CH2)0 2C(O)R*, -(CH2)y 2C(O)OH, -(CH2)0_2C(O)OR*, -(CH2)O..2SR*, -(CH2)O.:SH, -(CH2)O-2NH2, -(CH2)0.2NHRe, -(CH2)O-2NR*2, -NO2, -SiR*3, -OSiR*;,, -C(O)SR* - (C 1 -4 straight or branched alkylenc)C(O)OR*, or -SSR* wherein each R* is unsubstituted or where preceded by “halo’’ is substituted only with one or more halogens, and is independently selected from Ci4aliphatic, -CH2Ph, -0(CH2)o- iPh, or a 3-6 (e.g.. 3-5, 5-6, etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Divalent substituents on a saturated carbon atom of R° are independently =0 or =S.

[0091] Divalent substituents are independently the following: (). =S, =NNR*2, =NNT1C(O)R*,:::NNHC(O)OR*, -MNHS(O)2R*, -NR*. -NOR*, O(C(R*2))2..3O -, or -S(C(R*2))2-3S-, wherein each independent occurrence of R’ is selected from hydrogen. Cut, aliphatic which may be substituted as defined below, or an unsubstituted 3-6 (e.g., 3-5, 5-6. etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen,39 of 46113113958vlAttorney Docket No: 2010581-1550and sulfur. Divalent substituents that are bound to vicinal substitutable carbons of an “optionally substituted” group are independently O(( k’" ) ■ sO, wherein each independent occurrence of R' is selected from hydrogen, Cue aliphatic which may be substituted as defined below, or an unsubstituted 3-6 (e.g.. 3-5, 5-6, etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur. Trivalent substituents are independently ^CR* or ==N, wherein R* are independently as described herein.

[0092] Substituents on the aliphatic group of R* are independently halogen, -R*, -(haloR*). -OH, -OR®, - O(haloR*), -CN, -C(O)OH, C(O)OR*, -NH2, - HR* -NR*2. or -NO; >, wherein each R* is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independently C1.4 aliphatic, -CH2PI1, -O(CH2)C -iPh, or a 3-6 (e.g., 3-5, 5-6, etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0093] Substituents on a substitutable nitrogen are independently -Rf, ~NR12, ~C(O)Rv -C(O)ORt, - C(O)C(O)Rt, -C(O)CH2C(O)Rf, -S(O)2R1, S(O) \R 2. -C(S)NR'f2, -C(NH)NRr2, or -N(Rt)S(O)2R1': wherein each R' is independently hydrogen, C1-6 aliphatic which may be substituted as defined below, unsubstituted OPh, or an unsubstituted 3-6 (e.g., 3-5, 5-6, etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur, or, notwithstanding the definition above, two independent occurrences of R. taken together with their intervening atom(s) fonn an unsubstituted 3-12 (e.g., 3-10, 3-6, 5-10, 5-6, 3, 4, 5, 6, 7, 8, 9, 10. etc.) membered saturated, partially unsaturated, or and mono- or bicyclic ring having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0094] Substituents on the aliphatic group of R^ are independently halogen, -R*. -(haloR*), -OH. -OR*, - O(haloR*), -CN, C(O)OH, C(O)OR*. NH2, -NHR®, -NR®2, or NO2, wherein each R* is unsubstituted or where preceded by “halo” is substituted only with one or more halogens, and is independentlyaliphatic, -CH2PI1, -0(CH2)O iPh, or a 3-6 (e.g., 3-5, 5-6. etc.)-membered saturated, partially unsaturated, or aromatic ring (for aromatic ring, 5- or 6-membered) having 0-4 heteroatoms independently selected from nitrogen, oxygen, and sulfur.

[0095] P-modification: as used herein, the term ' -modification” refers to any modification at the linkage phosphorus other than a stereochemical modification. In some embodiments, a P-modification comprises addition, substitution, or removal of a pendant moiety covalently attached to a linkage phosphorus.

[0096] Partially unsaturated: As used herein, the term “partially unsaturated” refers to a ring moiety that includes at least one double or triple bond. Tire term “partially unsaturated” is intended to encompass rings having multiple sites of unsaturation, but is not intended to include aryl or heteroaryl moieties, as herein defined.

[0097] Pharmaceutical composition: As used herein, the term “pharmaceutical composition” refers to an40 of 46113113958vlAttorney Docket No: 2010581-1550active agent, formulated together with one or more pharmaceutically acceptable carriers. In some embodiments, an active agent is present in unit dose amount appropriate for administration in a therapeutic regimen that shows a statistically significant probability of achieving a predetermined therapeutic effect when administered to a relevant population. In some embodiments, pharmaceutical compositions may be specially formulated for administration in solid or liquid form, including those adapted for the following: oral administration, for example, drenches (aqueous or non-aqueous solutions or suspensions), tablets, e.g., those targeted for buccal, sublingual, and systemic absorption, boluses, powders, granules, pastes for application to the tongue; parenteral administration, for example, by subcutaneous, intramuscular, intravenous or epidural injection as, for example, a sterile solution or suspension, or sustained-release formulation; topical application, for example, as a cream, ointment, or a controlled-release patch or spray applied to the skin, lungs, or oral cavity; intravaginally or intrarectally, for example, as a pessary', cream, or foam; sublingually; ocularly; transderm ally; or nasally, pulmonary, and to other mucosal surfaces.

[0098] Pharmaceutically acceptable: As used herein, the phrase “pharmaceutically acceptable” refers to those compounds, materials, compositions and / or dosage forms which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / nsk ratio.

[0099] Pharmaceutically acceptable carrier: As used herein, the term “pharmaceutically acceptable carrier” means a pharmaceutically -acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation and not injurious to the patient. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as com starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar: buffering agents, such as magnesium hydroxide and aluminum hydroxide; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; pH buffered solutions; polyesters, polycarbonates and / or poly anhydrides; and other non-toxic compatible substances employed in pharmaceutical formulations.

[0100] Pharmaceutically acceptable salt: The term “pharmaceutically acceptable salt”, as used herein, refers to salts of such compounds that are appropriate for use in pharmaceutical contexts, i.e., salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge, et 41 of 46113113958vlAttorney Docket No: 2010581-1550al. describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences, 66: 1-19 (1977). In some embodiments, pharmaceutically acceptable salt include, but are not limited to, nontoxic acid addition salts, which are salts of an amino group formed with inorganic acids such as hydrochloric acid, hydrobromic acid, phosphoric acid, sulfuric acid and perchloric acid or with organic acids such as acetic acid, maleic acid, tartaric acid, citric acid, succinic acid or malonic acid or by using other methods used in the art such as ion exchange. In some embodiments, pharmaceutically acceptable salts include, but are not limited to, adipate, alginate, ascorbate, aspartate, benzenesulfonate, benzoate, bisuifate, borate, butyrate, camphorate, camphorsulfonate, citrate, cyclopentanepropi onate, digluconate, dodecylsulfate, ethanesulfonate, formate, fumarate, glucoheptonate, glycerophosphate, gluconate, hemisulfate, heptanoate. hexanoate, hydroiodide, 2 -hydroxyethanesulfonate, lactobionate, lactate, laurate, lauryl sulfate, malate, maleate, malonate, methanesulfonate, 2-naphthalenesulfonate, nicotinate, nitrate, oleate, oxalate, palmitate, pamoate, pectinate, persulfate, 3-phenylpropi onate, phosphate, picrate, pivalate, propionate, stearate, succinate, sulfate, tartrate, thiocyanate, p-toluenesulfonate, undecanoate, valerate salts, and the like. In some embodiments, a provided compound comprises one or more acidic groups, e.g., an oligonucleotide, and a pharmaceutically acceptable salt is an alkali, alkaline earth metal, or ammonium (e.g., an ammonium salt of N(R)s, wherein each Ris independently defined and described in the present disclosure) salt. Representative alkali or alkaline earth metal salts include sodium, lithium, potassium, calcium, magnesium, and the like. In some embodiments, a pharmaceutically acceptable salt is a sodium salt. In some embodiments, a pharmaceutically acceptable salt is a potassium salt. In some embodiments, a pharmaceutically acceptable salt is a calcium salt. In some embodiments, pharmacally acceptable salts include, when appropriate, nontoxic ammonium, quaternary ammonium, and amine cations formed using counterions such as halide, hydroxide, carboxylate, sulfate, phosphate, nitrate, alkyl having from 1 to 6 carbon atoms, sulfonate and aryl sulfonate. In some embodiments, a provided compound comprises more than one acid groups, for example, an oligonucleotide may comprise two or more acidic groups (e.g., in natural phosphate linkages and / or modified mtemucleotidic linkages) In some embodiments, a pharmaceutically acceptable salt, or generally a salt, of such a compound comprises two or more cations, which can be the same or different. In some embodiments, in a pharmacally acceptable salt (or generally, a salt), all ionizable hydrogen (e.g.. in an aqueous solution with a pKa no more than about 11, 10, 9, 8, 7, 6, 5, 4. 3, or 2; in some embodiments, no more than about 7; m some embodiments, no more than about 6; in some embodiments, no more than about 5; in some embodiments, no more than about 4; in some embodiments, no more than about 3) in the acidic groups are replaced with cations. In some embodiments, each phosphorothioatc and phosphate group independently exists in its salt form (e.g., if sodium salt, “O“P(O)(SNa)~O“ and “O“P(O)(ONa)”O“. respectively). In some embodiments, each phosphorothioate and phosphate mtemucleotidic linkage independently exists in its salt form (e.g., if sodium salt. ~O”P(O)(SNa)" O“ and “O" P(O)(ONa)~O“, respectively). In some embodiments, a pharmaceutically acceptable salt is a sodium salt of an oligonucleotide. In some embodiments, a pharmacally acceptable salt is a sodium salt of an oligonucleotide, wherein each acidic phosphate and modified phosphate group (e.g.,42 of 46113113958vlAttorney Docket No: 2010581-1550phosphorothioate, phosphate, etc.), if any, exists as a salt form (all sodium salt).

[0101] Predetermined: By predetermined (or pre -determined) is meant deliberately selected or non-random or controlled, for example as opposed to randomly occurring, random, or achieved without control. Those of ordinary' skill in the art, reading the present specification, will appreciate that the present disclosure provides technologies that permit selection of particular chemistry and / or stereochemistry features to be incorporated into oligonucleotide compositions, and further permits controlled preparation of oligonucleotide compositions having such chemistry and / or stereochemistry features. Such provided compositions are “predetermined” as described herein. Compositions that may contain certain oligonucleotides because they happen to have been generated through a process that are not controlled to intentionally generate the particular chemistry and / or stereochemistry features are not “predetermined” compositions. In some embodiments, a predetermined composition is one that can be intentionally reproduced (e.g., through repetition of a controlled process) In some embodiments, a predetermined level of a plurality of oligonucleotides in a composition means that the absolute amount, and / or the relative amount (ratio, percentage, etc.) of the plurality of oligonucleotides in the composition is controlled. In some embodiments, a predetermined level of a plurality of oligonucleotides in a composition is achieved through chirally controlled oligonucleotide preparation.[0102J Protecting group: The term “protecting group,” as used herein, is well known in the art and includes those described in detail in Protecting Groups in Organic Synthesis, T. W. Greene and P. G. M. Wuts, 3rdedition, John Wiley & Sons. 1999, the entirety of which is incorporated herein by reference. Also included are those protecting groups specially' adapted for nucleoside and nucleotide chemistry described in Current Protocols in Nucleic Acid Chemistry, edited by Serge L Beaucage et al. 06 / 2012, the entirety of Chapter 2 is incorporated herein by reference. Suitable amino-protecting groups include methyl carbamate, ethyl carbamante, 9 -fluorenylmethyl carbamate (Fmoc), 9-(2-sulfo)fluorenylmethyl carbamate, 9-(2.7- di brom o)fluoroenylm ethyl carbamate, 2.7— di— t— butyd— [9— ( 10.10-dioxo-10, 10, 10, 10- tetrahydrothioxanthyl)] methyl carbamate (DBD-Tmoc), 4-methoxyphenacyl carbamate (Phenoc), 2,2,2- trichlorocthy I carbamate (Troc), 2-trimcthylsilylcthyl carbamate (Tcoc), 2-phcnylcthyl carbamate (hZ), 1-(1-adamantyl)-l-methyiethyl carbamate (Adpoc), l,l-dimethyl-2-haloethyl carbamate, 1, l-dimethyl-2,2-dibromoethyl carbamate (DB-t-BOC), 1,1 -dimethyl -2,2, 2- trichloroethyl carbamate (TCBOC). 1 -methyl---! - (4-biphenylyl)ethyl carbamate (Bpoc), l-(3,5-di-t-butylphenyl)-l-methylethyI carbamate (t-Bumeoc), 2- (2’- and 4’-pyridyl)ethyl carbamate (Pyoc), 2-(N, N-dicyclohexylcarboxamido)ethyl carbamate, t-butyl carbamate (BOC), 1-adamantyl carbamate (Adoc), vinyl carbamate (Voc), allyl carbamate (Alloc), 1- isopropylallyl carbamate (Ipaoc), cinnamyl carbamate (Coc), 4 -nitrocinnamyl carbamate (Noc), 8 -quinolyl carbamate, N-hydroxypiperidinyl carbamate, alkyldithio carbamate, benzyl carbamate (Cbz), p-methoxybenzyl carbamate (Moz), p-nitobenzyl carbamate, p-bromobenzyl carbamate, p-chlorobenzyl carbamate, 2,4-dichlorobenzyl carbamate, 4-methylsuIfinylbenzyl carbamate (Msz), 9-anthrylmethyl carbamate, diphenylmethyl carbamate, 2 -methylthioethyl carbamate, 2 -methylsulfonylethyl carbamate, 2— (p - toluenesulfony'l)ethyl carbamate, [2-(l,3-dithianyl)]methyI carbamate (Dmoc), 4— methylthiophenyl 43 of 46113113958vlAttorney Docket No: 2010581-1550carbamate (Mtpc), 2,4 -dimethylthiophenyl carbamate (Bmpc), 2 -phosphonioethyl carbamate (Peoc), 2- triphenylphosphonioisopropyl carbamate (I’poc), l,l-dimethyl-2-cyanoethyl carbamate, m-chloro-p- acvloxybenzyl carbamate, p-(dihydroxyboryl)benzyl carbamate, 5-benzisoxazolylmethyl carbamate, 2-(trifluoromethyl)-6-chromonylmethyl carbamate (Tcroc), m-nitrophenyl carbamate, 3.5-di methoxybenzyl carbamate, o-nitrobenzyl carbamate, 3,4--dimethoxy---6--nitrobenzyI carbamate, phenyl(o-nitrophenyl)methyl carbamate, phenothiazinyl -(lO)-carbonyl derivative, N' -p -toluenesulfonylaminocarbony l derivative, N’- phenylaminothiocarbonyl derivative, t amyl carbamate, S benzyl thiocarbamate, p cyanobenzyl carbamate, cyclobutyl carbamate, cyclohexyl carbamate, cyclopentyl carbamate, cyclopropylmethyl carbamate, p-decyloxybenzyl carbamate, 2,2-dimethoxycarbonylvinyl carbamate, o-(N, N-dimethylcarboxainido)benzyl carbamate, 1,1 -dimethyl-3-(N, N-dimethylcarboxamido)propyl carbamate, 1, 1-dimethylpropynyl carbamate. di(2-pyridyl)methyl carbamate, 2-furanylmethyl carbamate, 2-iodoethyl carbamate, isoborynl carbamate, isobutyl carbamate, isonicotinyl carbamate, p-(p’-methoxyphenylazo)benzyl carbamate, 1 -methy lcyclobutyl carbamate, 1-methylcyclohexyl carbamate, 1-methyl-l-cyclopropylmethyl carbamate, l-methyl-l-(3,5-dimethoxypheny l)ethyl carbamate, 1 -methyl-- 1 -(p -phenylazopheny Ijethyl carbamate, 1 -methyl- 1- phenylethyl carbamate, 1 -methyl- l-(4-pyridyl)ethyl carbamate, phenyl carbamate, p-(phenylazo)benzyl carbamate, 2,4.6-tri-t-butylphenyl carbamate, 4-(trimethylammomum)benzyl carbamate, 2,4,6-trimethylbenzyl carbamate, formamide, acetamide, chloroacetamide, trichloroacetamide, tri fluoroacetamide, phenylacetamide, 3 -phenylpropanamide, picolinamide, 3 -pyridylcarboxamide, N-benzoy Iphenylalanyl derivative, benzamide, p-phenydbenzamide, o-nitophenylacetamide, o-nitrophenoxyacetamide, acetoacetamide, (N'-dithiobenzyloxycarbonylamino)acetainide, 3-(p-hydroxyphenyl)propanamide, 3-(o-nitrophenyl)propanamide, 2-methyl-2-(o-nitrophenoxy)propanamide, 2-methyl-2-(o- phenylazophenoxylpropanamide, 4 -chlorobutanamide, 3 -methyl -3 -nitrobutanamide, o -nitrocinnamide, N- acetylmethionine derivative, o-nitrobenzamide, o-(benzoyloxymethyl)benzamide.4,5-diphenyl-3-oxazolin-2-one, N-phthalimide, N-dithiasuccinimide (Dts), N-2,3-diphenylmaleimide, N-2,5-dimethylpyrrole, N- 1,1,4,4-tctramcthyldisilylazacyclopcntanc adduct (STABASE), 5-substitutcd 1,3-dimcthyl- 1,3,5-triazacyclohexan-2-one, 5-substituted l,3-dibenz l-l,3,5-triazacyclohexan-2-one, 1-substituted 3,5- dinitro -4-pyridone, N -methylamine, N-allylamine, N-[2 -(trimethylsilyl)ethoxyjmethylamine (SEM), N-3- acetoxypropylamine, N-( l-isopropyl-4-nitro-2-oxo-3-pyroolin-3-yl)amme, quaternary ammonium salts, N-benzylamine, N-di(4-methoxyphenyl)methylamine, N-5-dibenzosubeTylamine, N-triphenylmetbylamine (Tr), N-[(4-methoxyphenyl)diphenylmethyl]amine (MMTr), N-9-phenylfluorenylamine (PhF), N-2,7- dichloro-9-fluorcnylmcthylcncaminc, M -fcrroccnylmcthylamino (Fem), N -2 -picolylamino N"-oxidc, N- 1, 1 -dimethylthiomethyleneamine, N -benzylideneamine, N-p-methoxybenzylideneamine, N-diphenylmethyleneamine, N-[(2-pyridyl)mesityl]methyleneaniine, N-(N’. N'-dimethylaminomethylene)amine, N. N’-isopropylidenediamine, N-p-nitrobenzylideneamine, N- salicylideneamine, N-5- chlorosalicylideneamine, N -(5 -chloro-2-hydroxyphenyl)phenylmethyleneamine, N-cyclohexylideneamine, N-(5,5-dimethyl-3-oxo-l-cyclohexenyl)amine, N-borane derivative, N- 44 of 46113113958vlAttorney Docket No: 2010581-1550diphenylborimc acid derivative. N-- [phenyl(pentacarbonylchromium -- or tungsten)carbony l]amine, N-copper chelate, N-zinc chelate, N-nitroamine, N-nitrosoamine, amine N-oxide, diphenylphosphinamide (Dpp), dimethylthiophosphinamide (Mpt), diphenylthiophosphinamide (Ppt), dialkyd phosphoramidates, dibenzyl phosphoramidate, diphenyl phosphoramidate. benzenesulfenamide, o-nitrobenzenesulfenamide (Nps), 2,4- dinitrobenzenesullenamide, pentachlorobenzenesulfenamide, 2 -nitra-4--methoxybenzenesulfenamide, triphenylmethylsulfenamide, 3 -nitropyridines ulfenamide (Npys), p -toluenesulfonamide (Ts), benzenesulfonamide, 2,3,6,-trimethyl-4-methoxybenzenesulfonamide (Mtr), 2,4,6-trimethoxybenzenesulfonamide (Mtb), 2,6-dimethyl-4-methoxybenzenesulfonamide (Pme), 2, 3,5,6-tetramethyl-4-methoxybenzenesulfonamide (Mte). 4-methoxybenzenesulfonamide (Mbs). 2,4,6- trimethylbenzenesulfonamide (Mts), 2.6 -dimethoxy -4 -methylbenzenesulfonamide (iMds), 2,2,5, 7,8- pentamethylchroman-6-sulfonamide (Pmc). methanesulfonamide (Ms), 0-trimethylsilylethanesulfonamide (SES), 9-anthracenesulfonamide, 4-(4’,8’-dimethoxynaphthylmethyl)benzenesulfonamide (DNMBS), benzylsulfonamide, trifluoromethylsulfonamide, and phenacylsulfonamide.

[0103] Suitably protected carboxylic acids further include, but are not limited to. silyl-, alkyl-, alken l-, ary l -. and arylalkyl-protected carboxylic acids. Examples of suitable silyl groups include trimethylsilyl, triethylsilyl. t-butyldimethylsilyl, t-butyldiphenylsilyl, triisopropylsilyl, and the like. Examples of suitable alkyl groups include methyl, benzyl, p-methoxybenzyl. 3,4-dimethoxybenzyl, trityl, t-butyl, tetrahydropyran- 2— yl. Examples of suitable alkenyl groups include allyl. Examples of suitable aryl groups include optionally substituted phenyd, biphenyl, or naphthyl. Examples of suitable arylalkyl groups include optionally substituted benzyl (e.g., p-methoxybenzyl (MPM), 3,4-dimethoxybenzyl, O-nitrobenzyl, p-nitrobenzyl, p-halobenzyl, 2,6-dichlorobenzyl, p-cyanobenzyl), and 2- and 4-picolyl.

[0104] Suitable hydroxyl protecting groups include methyl, methoxylmethyl (MOM), methylthiomethyl (MTM), t-butylthiomethyl, (phenyldimethylsilyl)methoxymethyl (SMOM), benzyloxymethyl (BOM), p-methoxybenzyloxymethyl (PMBM), (4-methoxyphenoxy)methyl (p-AOM), guaiacolmethyl (GUM), t- butoxy methyl, 4-pcntcnyl oxymcthyl (POM), siloxymethyl, 2-mctboxycthoxymcthyl (MEM), 2,2,2-trichloroethoxymethyl, bis(2-chloroethoxy)methyl, 2-(trimethylsilyl)ethoxymethyl (SEMOR), tetrahydropyranyl (THP), 3-bromotetrahydropyranyl, tetrahydrothiopyranyl, l-methoxycyclohexyl, 4- methoxyletrah dropyranyl (MTHP), 4-methoxytetrahydrothiopyranyl, 4-methoxyletrahydrothiopyranyl S. S-dioxide, l-[(2-chloro-4-methyl)phenyl]-4-methoxypiperidin-4-yd (CTMP), 1,4-dioxan-2-yl, tetrahydrofuranyl, tetrahydrothiofuranyl, 2,3,3a,4,5,6,7,7a-octahydro-7,8,8-trimethyl-4,7- mcthanobcnzofuran-2-yl, 1-cthoxycthyl, 1 - (2 -chlorocthoxy)cthyl, 1 -methyl- 1 -mcthoxycthyl, 1 -methyl- 1- benzyloxyethyl, 1-methyd- l-benzyloxy-2-fluoroethyl, 2,2,2-trichloroethyl, 2-trimethy Isilylethyl, 2-(phenylselenyl)ethyl, t-butyl, allyl, p-chlorophenyl, p-methoxyphenyl. 2.4-dinitrophenyl, benzyl, p-methoxybenzyl, 3,4-dimethoxybenzyl, o-nitrobenzyl, p-nitrobenzyl. p-halobenzyl, 2,6-dichlorobenzyl, p- cyanobenzyl, p -phenylbenzyl, 2-picolyl, 4-picolyl, 3-methyl-2 -picolyl N-oxido, diphenylmethyl, p,p’ ~ dinitrobenzhydryl, 5-dibenzosuberyi, triphenylmethyl, a-naphthyldiphenylmethyl, p- 45 of 46113113958vlAttorney Docket No: 2010581-1550methoxyphenyldiphenylmethyl, di(p-methoxyphenyl)phenylmetliyl, tri(p -metho xyphenyl)methyi, 4-(4’- bromophenacyloxyphenyl)diphenylmethyl, 4,4’,4’’-tris(4.5-dichlorophthalimidophenyl)methyl, 4,4 ’,4”-tris(levulinoyloxyphenyl)methyl, 4,4’,4”-tris(benzoyloxyphenyl)methyl, 3-(imidazol-l-yl)bis(4',4'’-dimethoxyphenyl)methyl, 1, l-bis(4-methoxyphenyl)-r-pyrenylmethyl, 9-anthryl, 9-(9-phenyl)xanthenyl.9-(9-phenyl-10--oxo)anthryl, 1.3-benzodithiolan-2-yl, benzisothiazolyl S. S-dioxido, trimethylsilyl (TMS), triethylsilyl (TES), triisopropylsilyl (TIPS), dimethylisopropylsilyl (IPDMS), diethylisopropylsilyl (DEIPS), dimethylthexyisilyl, t -butyldimethylsilyl (TBDMS), t -butyldiphenylsilyl (TBDPS), tribenzylsilyl, tri p xylylsilyl, triphenylsilyl, diphenylmethyl silyl (DPMS), t-butylmethoxyphenylsilyl (TBMPS), formate, benzoylformate, acetate, chloroacetate, dichloroacetate, trichloroacetate, trifluoroacetate, methoxyacetate, triphenylmethoxyacetate, phenoxyacetate, p- chlorophenoxyacetate, 3 -phenylpropionate, 4-oxopentanoate (levulinate), 4,4-(ethylenedithio)pentanoate (levulinoyldithioacetal), pivaloate, adamantoate, crotonate, 4- methoxycrotonate, benzoate, p-phenylbenzoate, 2,4,6-trimefhylbenzoate (mesitoate), alkyl methyl carbonate, 9-fluorenylmethyl carbonate (Fmoc), alkyl ethyl carbonate, alkyl 2,2,2-trichloroethyl carbonate (Troc), 2-(trimethylsilyl)ethyl carbonate (TMSEC), 2-(phenylsulfonyl) ethyl carbonate (Psec), 2--(triphenylphosphonio) ethyl carbonate (Peoc), alkyl isobutyl carbonate, alkyl vinyl carbonate alkyl allyl carbonate, alkyl p-nitrophenyl carbonate, alkyl benzyl carbonate, alkyl p-methoxybenzyl carbonate, alkyl 3.4-dimethoxybenzyl carbonate, alkyl o-nitrobenzyl carbonate, alkyl p-nitrobenzyl carbonate, alkyl S-benzyl thiocarbonate, 4- ethoxy-l-napththyl carbonate, methyl dithiocarbonate, 2 -iodobenzoate, 4-azidobutyrate, 4-nitro-4- methylpentanoate, o-(dibromomethyl)benzoate, 2-formylbenzene sulfonate, 2-(methylthiomethoxy)ethyl, 4-(methylthiomethoxy)butyrate, 2-(methylthiomethoxymethyl)benzoate, 2,6-dichloro-4-methylphenoxyacetate, 2.6-dichloro-4-( 1,1,3,3-tetramethylbutyl)phenoxyacetate, 2,4-bis( 1,1- dimethylpropyl)phenoxyacetate, chlorodiphenylacetate, isobutyrate, monosuccinoate, (E)-2-methyI-2- butenoate, o~(m ethoxy carbonyl) benzoate, a-naphthoate, nitrate. alkyl N, N, N’, N’- tetramethylphosphorodiamidate, alkyl N-phenylcarbamate, borate, dimethylphosphinothioyl, alkyl 2,4- dinitrophcnylsulfcnatc, sulfate, metbancsulfonatc (mesylate), bcnzylsulfonatc, and tosylatc (Ts). For protecting 1,2- or 1,3-diols, the protecting groups include methylene acetal, ethylidene acetal, 1-t-butylethyhdene ketal. 1 -phenylethylidene ketal, (4-methoxyphenyl)ethylidene acetal. 2,2, 2- trichloroethyhdene acetal, acetonide, cyclopentylidene ketal, cyclohexylidene ketal, cycloheptylidene ketal, benzylidene acetal, p-methoxybenzylidene acetal, 2,4-dimetboxybenzylidene ketal, 3,4-dimethoxybenzylidene acetal, 2 -nitrobenzylidene acetal, methoxymethylene acetal, ethoxymethylene acetal, dimcthoxymcthylcnc ortho ester, 1 -methoxy ethylidene ortho ester, 1-cthoxyc thy lidinc ortho ester, 1,2- dimethoxy eth lidene ortho ester, a-methoxybenzylidene ortho ester, I“(N. N-dimetliylamino)ethylideiie derivative, a-(N, N'-dimethylamino)benzylidene derivative, 2-oxacyclopentylidene ortho ester, di— t— butylsilylene group (DTBS), l,3-( 1,1,3,3-tetraisopropyldisiloxanylidene) derivative (TIPDS), tetra-t- butoxydisiloxane-l,3-diylidene derivative (TBDS). cyclic carbonates, cyclic boronates, ethyl boronate, and phenyl boronate.46 of 46113113958vlAttorney Docket No: 2010581-1550

[0105] In some embodiments, a hydroxyl protecting group is acetyl, t-butyl, t-butoxymethyl, methoxymethyl, tetrahydropyranyl, 1 -ethoxyethyl, 1 -(2 -chloroethox )ethyl, 2- trimethylsilylethyl, p-chlorophenyl, 2,4-dinitrophenyl, benzyl, benzoyl, p-phenylbenzoyl, 2.6- dichlorobenzyl, diphenylmethyl, p-nitrobenzyl, triphenylmethyl (trityl), 4,4'-dimethoxytrityl, trimethylsilyl, triethylsilyl, t-butyldimethylsilyl, t- butyldiphenylsilyl, triphenylsilyl, triisopropylsilyl, benzoylformate, chloroacetyl, trichloroacetyl, trifiuoroacetyl, pivaloyl, 9- fluorenylmethyl carbonate, mesylate, tosylate, tritiate, trityl, monomethoxytrityl (MMTr), 4,4'-dimethoxytrityl, (DMTr) and 4,4',4"-trimethoxytrityl (TMTr), 2-cyanoethyl (CE or Cne), 2-(trimethylsilyl)ethyl (TSE), 2-(2-nitrophenyl)ethyl, 2-(4-cyanophenyl)ethyl 2-(4-nitrophenyl)ethyl (NPE), 2-(4-nitrophenylsulfonyl)ethyl, 3.5 -dichlorophenyl. 2,4-dimethylphenyl, 2-nitrophenyl, 4-nitrophenyl, 2,4,6- trimethylphenyl. 2-(2-nitrophenyl)ethyl. butylthiocarbonyl, 4,4',4"-tris(benzoyloxy)trityl, diphenylcarbamoyl, levulinyl, 2-(dibromomethyl)benzoyl (Dbmb), 2-(isopropylthiomethoxymethyl)benzoyl (Ptmt), 9- phenylxanthen-9-yl (pixy!) or 9-(p-methoxyphenyl)xanthine-9-yl (MOX). In some embodiments, each of the hydroxyl protecting groups is, independently selected from acetyl, benzyl, t- butyldimethylsilyl, t- butyldiphenylsilyl and 4,4'-dimethoxytrity 1. In some embodiments, the hydroxyl protecting group is selected from the group consisting of trityl, monomethoxytrityl and 4,4'-dimethoxytrityl group. In some embodiments, a phosphorous linkage protecting group is a group atached to the phosphorous linkage (e.g., an intemucleotidic linkage) throughout oligonucleotide synthesis. In some embodiments, a protecting group is attached to a sulfur atom of an phosphorothioate group. In some embodiments, a protecting group is attached to an oxygen atom of an intemucleotide phosphorothioate linkage. In some embodiments, a protecting group is attached to an oxygen atom of the intemucleotide phosphate linkage. In some embodiments a protecting group is 2- cyanoethyl (CE or Cue). 2-trimethylsilylethyl, 2 -nitroethyl, 2 -sulfonylethyl. methyl, benzyl, o-nitrobenzyl, 2- (p-mtrophenyl)ethyl (NPE or Npe), 2-phenylethyl, 3-(N-tert-butylcarboxamido)-l-propyl, 4-oxopentyl, 4-methylthio-l-butyl. 2 -cyano- 1,1 -dimethylethyl, 4-N -methyl aminobutyl, 3 -(2-pyridyl)-l -propyl, 2-[N-methyl- N-(2-pyridyl)Jaminoethyl, 2-(N -formyl, N-methyl)aminoethyl, or 4-[N-methyl-N-(2,2,2- trifluoroacctyl)ammo]butyl.

[0106] Subject: As used herein, the term “subject” or “test subject” refers to any organism to which a compound (e.g.. an oligonucleotide) or composition is administered in accordance with the present disclosure e.g., for experimental, diagnostic, prophylactic and / or therapeutic puiposes. Typical subjects include animals (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans; insects; worms; etc.) and plants. In some embodiments, a subject is a human. In some embodiments, a subject may be suffering from and / or susceptible to a disease, disorder and / or condition.

[0107] Substantially: As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest A base sequence which is substantially identical or complementary' to a second sequence is not fully identical or complementary to the second sequence, but is mostly or nearly identical or complementary to the second sequence. In some embodiments, an oligonucleotide with a substantially' complementary sequence to another oligonucleotide or 47 of 46113113958vlAttorney Docket No: 2010581-1550nucleic acid forms duplex with the oligonucleotide or nucleic acid in a similar fashion as an oligonucleotide with a folly complementary sequence. In addition, one of ordinary skill in the biological and / or chemical arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and / or chemical phenomena.

[0108] Sugar: The term “sugar” refers to a monosaccharide or polysaccharide in closed and / or open form. In some embodiments, sugars are monosaccharides. In some embodiments, sugars are polysaccharides. Sugars include, but are not limited to, ribose, deoxyribose, pentoforanose, pentopyranose, and hexopyranose moieties. As used herein, the term “sugar” also encompasses structural analogs used in lieu of conventional sugar molecules, such as glycol, polymer of which forms the backbone of the nucleic acid analog, glycol nucleic acid (“G A”), etc. As used herein, the term “sugar” also encompasses structural analogs used m lieu of natural or naturally-occurring nucleotides, such as modified sugars and nucleotide sugars. In some embodiments, a sugar is a RNA or DN sugar (ribose or deoxyribose). In some embodiments, a sugar is a modified ribose or deoxyribose sugar, e.g., 2‘-modified, 5 ’-modified, etc. As described herein, in some embodiments, when used in oligonucleotides and / or nucleic acids, modified sugars may provide one or more desired properties, activities, etc. In some embodiments, a sugar is optionally substituted ribose or deoxyribose. In some embodiments, a “sugar” refers to a sugar unit in an oligonucleotide or a nucleic acid.

[0109] Susceptible to: An individual who is “susceptible to” a disease, disorder and / or condition is one who has a higher risk of developing the disease, disorder and / or condition than does a member of the general public. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition is predisposed to have that disease, disorder and / or condition. In some embodiments, an individual w’ho is susceptible to a disease, disorder and / or condition may not have been diagnosed with the disease, disorder and / or condition. In some embodiments, an individual ho is susceptible to a disease, disorder and / or condition may exhibit symptoms of the disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder and / or condition may not exhibit symptoms of the disease, disorder and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will develop the disease, disorder, and / or condition. In some embodiments, an individual who is susceptible to a disease, disorder, and / or condition will not develop the disease, disorder, and / or condition.

[0110] Therapeutic agent: As used herein, the term “therapeutic agent” in general refers to any agent that elicits a desired effect (e.g., a desired biological, clinical, or pharmacological effect) when administered to a subject. In some embodiments, an agent is considered to be a therapeutic agent if it demonstrates a statistically significant effect across an appropriate population. In some embodiments, an appropriate population is a population of subjects suffering from and / or susceptible to a disease, disorder or condition. In some embodiments, an appropriate population is a population of model organisms In some embodiments, an appropriate population may be defined by one or more criterion such as age group, gender, genetic background, preexisting clinical conditions, prior exposure to therapy. In some embodiments, a therapeutic agent is a 48 of 46113113958vlAttorney Docket No: 2010581-1550substance that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of, reduces severity of, and / or reduces incidence of one or more symptoms or features of a disease, disorder, and / or condition in a subject when administered to the subject in an effective amount. In some embodiments, a “therapeutic agent” is an agent that has been or is required to be approved by a government agency before it can be marketed for administration to humans. In some embodiments, a “therapeutic agent” is an agent for which a medical prescription is required for administration to humans. In some embodiments, a therapeutic agent is a provided compound, e.g., a provided oligonucleotide.

[0111] Therapeutically effective amount: As used herein, the term “therapeutically effective amount” means an amount of a substance (e.g.. a therapeutic agent, composition, and / or formulation) that elicits a desired biological response when administered as part of a therapeutic regimen. In some embodiments, a therapeutically effective amount of a substance is an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, diagnose, prevent, and / or delay the onset of the disease, disorder, and / or condition. As will be appreciated by those of ordinary skill in this art, the effective amount of a substance may vary depending on such factors as the desired biological endpoint, the substance to be delivered, the target cell or tissue, etc. For example, the effective amount of compound in a formulation to treat a disease, disorder, and / or condition is the amount that alleviates, ameliorates, relieves, inhibits, prevents, delays onset of. reduces severity of and / or reduces incidence of one or more symptoms or features of the disease, disorder, and / or condition. In some embodiments, a therapeutically effective amount is administered in a single dose; in some embodiments, multiple unit doses are required to deliver a therapeutically effective amount.

[0112] Treat: As used herein, the term “treat,” “treatment,” or “treating” refers to any method used to partially or completely alleviate, ameliorate, relieve, inhibit, prevent, delay onset of reduce severity of, and / or reduce incidence of one or more symptoms or features of a disease, disorder, and / or condition. ’Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and / or condition. In some embodiments, treatment may be administered to a subject who exhibits only' early signs of the disease, disorder, and / or condition, for example for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and / or condition.

[0113] Unsaturated: " Die term "unsaturated," as used herein, means that a moiety7has one or more units of unsaturation.

[0114] Wild-type: As used herein, the term “wild-type” has its art-understood meaning that refers to an entity having a structure and / or activity as found in nature in a “normal” (as contrasted with mutant, diseased, altered, etc.) state or context. Those of ordinary skill in the art will appreciate that wild type genes and polypeptides often exist in multiple different forms (e.g., alleles),

[0115] As those skilled in the art will appreciate, methods and compositions described herein relating to provided compounds (e.g. oligonucleotides) generally also apply to pharmaceutically acceptable salts of such compounds.49 of 46113113958vlAttorney Docket No: 2010581-1550Description of Certain Embodiments

[0116] Oligonucleotides are usefill tn various therapeutic, diagnostic, and research applications. Use of naturally occurring nucleic acids is limited, for example, by their susceptibility to endo- and exo-nucleases. As such, various synthetic counterparts have been developed to circumvent these shortcomings and / or to further improve various properties and activities. These include synthetic oligonucleotides that contain chemical modifications, e.g., base modifications, sugar modifications, backbone modifications, etc., which, among other things, render these molecules less susceptible to degradation and improve other properties and / or activities.

[0117] From a structural point of view, modifications to internucleotidic linkages can introduce chirality, and certain properties and activities may be affected by configurations of linkage phosphorus atoms of oligonucleotides For example, binding affinity, sequence specific binding to complementary RNA, stability to nucleases, activities, delivery, pharmacokinetics, etc. can be affected by, inter alia, chirality of backbone linkage phosphorus atoms.STMN2

[0118] In some embodiments, the present disclosure provides technologies, e.g., oligonucleotides, compositions, methods, etc., related to the stathmin-2 (STMN2) gene or a gene product thereof (e.g., a nucleic acid (e.g., DNA, RNA), a transcript (e.g., a STMN2 transcript), a protein encoded thereby (e.g., a STMN2 polypeptide), etc.),

[0119] In some embodiments, STMN2 refers to a gene or a gene product thereof (e.g., a nucleic acid (e.g., DNA. RNA, etc.), a transcript (e.g.. a STMN2 mRNA), a polypeptide encoded thereby (e.g., a STMN2 polypeptide), etc.), from a species, which may be known as stathmin-2, SCG1, SCGN10. superior cervical ganglion-10 protein, etc. Various STMN2 sequences including variants thereof are readily available to those of skill in the art, including reference mRNA sequences available under NCBI Accession Nos. NM_001199214.2 and NM__007029.4, reference protein sequences available under NCBI Accession Nos. NP 001186143.1 and NP 008960.2, etc. Various technologies, e.g., assays, cells, animal models, etc., have also been reported and can be utilized for characterization and / or assessment of provided technologies (e.g.. oligonucleotides, compositions, methods, etc.) in accordance with the present disclosure.

[0120] Under healthy conditions, STMN2 can be transcribed to form a mRNA comprising five exons that encode stathmin-2 protein. However, in ncurodcgencrativc diseases marked by TDP-43 pathology (e.g., TDP-43 loss-of-fiinction, TDP-43 mislocalization, TDP-43 aggregation), loss of STMN2 expression and stathniin-2 protein function has been observed. In healthy neurons (e.g., motor neurons), TDP-43 reportedly recognizes and binds a GU-rich motif in intron 1 of STMN2, which ensures that splicing of STMN2 results in inclusion of exons 1, 2, 3, 4, and 5. However, in neurons with loss of TDP-43 function, TDP-43 does not bind to this motif and cryptic splicing of STMN2 occurs that generates a truncated STMN2 mRNA comprising exon 1 and 350 of 46113113958vlAttorney Docket No: 2010581-1550exon 2a, which is a cryptic exon that can be found in intron 1 and within which the TDP-43 binding motif exists, lire truncated STMN2 mRNA comprising only exon 1 and the cryptic exon 2a reportedly contains a truncated open reading frame of only 17 codons, which leads to a deficit in production of stathmm-2 protein normally encoded by full-length, wild-type STMN2 mRNA. Further, some reports indicate that any polypeptides produced by truncated STMN2 mRNA comprising exon 2a are highly unstable, likely being rapidly degraded. See, e.g., Seddighi S, Qi YA, Brown AL, etal. Preprint. bioRxiv. 2023;2023.01.23.525149.

[0121] Stathmin-2 protein reportedly functions in axonal regeneration and maintenance of neuromuscular junctions (NMJs). Thus, loss of stathmin-2 and its function has been associated neuronal toxicity and denervation, e.g., denervation of NMJs. Alterations in STMN2 splicing and decreases in levels of full-length, wild-type STMN2 mRNA and STMN2 protein has been tied to motor neuropathy. See, e.g., Krus KL. Strickland A, Yamada Y, et al. Cell Rep. 2022:39(13): 111001 and Guerra San Juan I, Nash LA. Smith KS, et al. Neuron. 2022:110(10): 1671-1688. e6. Research has indicated that restoration of stathmin-2 protein levels and activity may provide benefits to neuronal health and increased ability for neurons to maintain or regrow axons. Approaches reported include various molecules that can act steric blockers that bind to areas in and around exon 2a to prevent the undesirable splicing of exon 2a into STMN2 mRNA. Some molecules that have been reported include usage of a deactivated Cas protein, antisense oligonucleotides, and MS2-coat protein (MCP). See, e.g., Baughn MW, Melamed Z, Lopez-Erauskin J, et al. Science. 2023;379(6637): 1140-1149; Melamed Z. Lopez-Erauskin J, Baughn MW, et al. Nat Neurosci. 2019;22(2): 180-190. However, there remains a need for improved compositions and methods that can provide high levels of skipping of exon 2a in a TDP-43 loss-of-function environment for treatment of numerous neurodegenerative diseases characterized by TDP-43 proteinopathy.

[0122] STMN2 has been reported to be associated with various conditions, diseases, and disorders including myriad neurodegenerative conditions, diseases, and disorders. Examples include amyotrophic lateral sclerosis (ALS) and frontotemporal lobar degeneration (FTLD), frontotemporal dementia (FID), Alzheimer’s disease (AD), Parkinson’s disease (PD), progressive supranuclear palsy (PSP), etc.In some embodiments, provided technologies reduce level of a STMN2 transcript (such a transcript, a level decreasing STMN2 transcript). In some embodiments, the base sequence of the level decreasing STMN2 transcript comprises a characteristic sequence of STMN2 exon 2a. In some embodiments, a characteristic sequence of STMN2 exon 2a differentiates exon 2a from the other STMN2 exons. In some embodiments, a characteristic sequence of STMN2 exon 2a differentiates exon 2a-containing STMN2 transcripts from other transcripts. In some embodiments, the base sequence of a level decreasing STMN2 transcript comprises a characteristic portion of GACTCGGCAGAAGACCTTCGAGAGAAAGGTAGAAAATAAGAATTTGGCTCTCTGTGTGAGCAT GTGTGCGTGTGTGCGAGAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATGAATGTGAATGCG GCTTGTGGCACAGTTGACAAGGATGATAAATCAATAATGCAAGCTTACTATCATTTATGAATAG CAATACTGAAGAAATTAAAACAAAAGA ITGC TGTC TC, wherein each T can be optionally and 51 of 46113113958vlAttorney Docket No: 2010581-1550independently replaced with U. In some embodiments, the base sequence of a level decreasing STMN2 transcript comprises a characteristic portion of GACUCGGCAGAAGACCUUCGAGAGAAAGGUAGAAAAUAAGAAUUUGGCUCUCUGUGUGAGC AUGUGUGCGUGUGUGCGAGAGAGAGAGACAGACAGCCUGCCUAAGAAGAAAUGAAUGUGAA LTGCGGCUUGUGGCACAGUUGACAAGGAUGAUAAALTCAAUAAUGCAAGCLTUACUAUCAUUUA UGAAUAGCAAUACUGAAGAAAUUAAAACAAAAGAUUGCUGUCUC. In some embodiments, the base sequence of a level decreasing STMN2 transcript comprises GACTCGGCAGAAGACCTTCGAGAGAAAGGTAGAAAATAAGAATTTGGCTCTCTGTGTGAGCAT GTGTGCGTGTGTGCGAGAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATGAATGTGAATGCG GCTTGTGGCACAGTTGACAAGGATGATAAATCAATAATGCAAGCTTACTATCATTTATGAATAG CAATACTGAAGAAATTAAAACAAAAGATTGCTGTCTC, wherein each T can be optionally and independently replaced with U. In some embodiments, the base sequence of a level decreasing STMN2 transcript comprises GACUCGGCAGAAGACCUUCGAGAGAAAGGUAGAAAALTAAGAAUUUGGCUCUCUGUGUGAGC AUGUGUGCGUGUGUGCGAGAGAGAGAGACAGACAGCCUGCCUAAGAAGAAAUGAAUGUGAA UGCGGCUUGUGGCACAGUUGACAAGGAUGAUAAAUCAAUAAUGCAAGCUUACUAUCAUUUA UGAAIJAGCAAUACUGAAGAAAUUAAAACAAAAGAUUGCUGUCUC In some embodiments, the base sequence of a level decreasing STMN2 transcript comprises CGTCTGCACATCCCTACAATGGCTAAAACAGCAATGGGACTCGGCAGAAGACCTTCGAGAGAA AGGTAGAAAATAAGAATTTGGCTCTCTGTGTGAGCATGTGTG. wherein each T can be optionally and independently replaced with U. In some embodiments, the base sequence of a level decreasing STMN2 transcript comprises CGUCUGCACAUCCCUACAAUGGCUA AAACAGCAAUGGGACUCGGCAGAAGACCUUCGAGAGA AAGGUAGAAAAUAAGAAUUUGGCUCLCUGUGUGAGCAUGUGUG. In some embodiments, the base sequence of a level decreasing STMN2 transcript comprises TGTGTGAGCATGTGTGCGTGTGTG, wherein each T can be optionally and independently replaced with U. In some embodiments, the base sequence of a level decreasing STMN2 transcript comprises UGUGUGAGCAUGLIGUGCGUGUGLIG. In some embodiments, the base sequence of a level decreasing STMN2 transcript comprises TCTCTGTGTGAGCATGTGTG, wherein each T can be optionally and independently replaced with U. In some embodiments, the base sequence of a level decreasing STMN2 transcript comprises UCUCUGUGUGAGCAUGUGUG. In some embodiments, the base sequence of a level decreasing STMN2 transcript comprises CAATGGGACTCGGCAGAAGACCTT, wherein each T can be optionally and independently replaced with U In some embodiments, the base sequence of a level decreasing STMN2 transcript comprises CAAUGGGACUCGGCAGAAGACCUU, wherein each T can be optionally and independently replaced with U In some embodiments, for a base sequence of a transcript, each T is independently replaced with U. Alternatively or additionally, in some embodiments, provided technologies 52 of 46113113958vlAttorney Docket No: 2010581-1550increase level of a STMN2 transcript (such a transcript, a level increasing STMN2 transcript). In some embodiments, the base sequence of a level increasing STMN2 transcript does not comprise a sequence described above for a level decreasing STMN2 transcript. For example, in some embodiments, the base sequence of a level increasing STMN2 transcript does not comprise GACTCGGCAGAAGACCTTCGAGAGAAAGGTAGAAAATAAGAATTTGGCTCTCTGTGTGAGCAT GTGTGCGTGTGTGCGAGAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATGAATGTGAATGCG GCTTGTGGCACAGTTGACAAGGA'rGATAAATCAATAAIGCAAGCTTACTATCATTrATGAATAG CAATACTGAAGAAATTAAAACAAAAGATTGCTGTCTC, TGTGTGAGCATGTGTGCGTGTGTG, TCTCTGTGTGAGCATGTGTG, or CAATGGGACTCGGCAGAAGACCTT, or a characteristic portion thereof, wherein each T can be optionally and independently replaced with U. In some embodiments, the base sequence of a level increasing STMN2 transcript comprises a characteristic sequence of STMN2 exon 2, exon 3, exon 4, and / or exon 5. Tn some embodiments, the base sequence of a level increasing STMN2 transcript comprises STMN2 exon 2, exon 3, exon 4, and / or exon 5. In some embodiments, the base sequence of a level increasing STMN2 transcript comprises STMN2 exon 2, exon 3, exon 4, and exon 5. in some embodiments, the base sequence of a level increasing STMN2 transcript comprises ACGATGATATGGAAGTGAAGC A A AT. wherein each T can be optionally and independently replaced with U. In some embodiments, the base sequence of a level increasing STMN2 transcript comprises AACAGCAATGGCCTACAAGGAA, wherein each T can be optionally and independently replaced with U. In some embodiments, for a base sequence of a transcript, each T is independently replaced with U. In some embodiments, the base sequence of a level increasing STMN2 transcript comprises ACGAUGAUAUGGAAGUGAAGCAAAU In some embodiments, the base sequence of a level increasing STMN2 transcript comprises AACAGCAAUGGCCUACAAGGAA.Oligonucleotides

[0123] Among other things, the present disclosure provides oligonucleotides of various designs, which may comprise various nucleobases and patterns thereof, sugars and patterns thereof, intemucleotidic linkages and patterns thereof, and / or additional chemical moieties and patterns thereof as described in the present disclosure.

[0124] In some embodiments, the present disclosure provides oligonucleotides and / or oligonucleotide compositions that are useful for various purposes, e.g., modulating skipping, reducing levels of certain STMN2 transcripts, increasing levels of certain STMN2 transcripts, improving levels of beneficial proteins, treating conditions, diseases and disorders, etc. In some embodiments, the present disclosure provides oligonucleotide compositions with improved properties, e.g., increased skipping of a cryptic exon (e.g., exon 2a), reduced toxicities, etc. Among other things, oligonucleotides of the present disclosure comprise chemical modifications, stereochemistry', and / or combinations thereof which can improve various properties and activities of oligonucleotides. Non-limiting examples of oligonucleotides are listed in Table I (e.g.. Table 1A, Table IB, Table 1C, Table ID, Table IE).53 of 46113113958vlAttorney Docket No: 2010581-1550Base Sequences

[0125] As appreciated by those skilled in the art, structural features of the present disclosure, such as nucleobase modification, sugar modifications, intemucleotidic linkage modifications, linkage phosphorus stereochemistry, etc., and combinations thereof may be utilized with various suitable base sequences to provide oligonucleotides and compositions with desired properties and / or activities.

[0126] In some embodiments, an oligonucleotide has a base sequence described herein (e.g., in a Table) or a portion thereof (e.g., a span of 10-50, 10-40, 10-30, 10-20, or 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or at least 10. at least 15, at least 20 contiguous nucleobases) with 0-5 (e.g., 0, I, 2. 3, 4 or 5) mismatches, wherein each T can be independently substituted with U and vice versa. In some embodiments, an oligonucleotide comprises a base sequence described herein, or a portion thereof, wherein a portion is a span of at least 10 contiguous nucleobases, or a span of at least 15 contiguous nucleobases with 0-5 mismatches. In some embodiments, provided oligonucleotides have a base sequence described herein, or a portion thereof, wherein a portion is a span of at least 10 contiguous nucleobases, or a span of at least 10 contiguous nucleobases with 1-5 mismatches, wherein each T can be independently substituted with U and vice versa.

[0127] In some embodiments, base sequences of oligonucleotides comprise or consist of 10-60 (e.g, about or at least 10. 11, 12, 13. 14, 15, 16, 17, 18, 19, 20. 21, 22, 23. 24, 25, 26, 27, 28, 29, 30. 31, 32, 33. 34, 35, 36, 37, 38. 39, 40, 45, 50, 55, 60; in some embodiments, at least 15; in some embodiments, at least 16; in some embodiments, at least 17; in some embodiments, at least 18; in some embodiments, at least 19; in some embodiments, at least 20; in some embodiments, at least 21; in some embodiments, at least 22; in some embodiments, at least 23; in some embodiments, at least 24; in some embodiments, at least 25; in some embodiments, at least 26; in some embodiments, at least 27; in some embodiments, at least 28; in some embodiments, at least 29; in some embodiments, at least 30; in some embodiments, at least 31; in some embodiments, at least 32; in some embodiments, at least 33; in some embodiments, at least 34; in some embodiments, at least 35) bases, optionally contiguous, of a base sequence that is identical or complementary to a base sequence of nucleic acid, e.g., a STMN2 gene or a transcript thereof. In some embodiments, the base sequence of an oligonucleotide is or comprises a sequence that is complementary to a target sequence in a gene or a transcript thereof.

[0128] In some embodiments, a target sequence is or comprises a characteristic sequence of a nucleic acid sequence (e.g., of an gene or a transcript thereof) in that it defines the nucleic acid sequence over others in a relevant organism; for example, a characteristic sequence is not in or has at least various mismatches from other genomic nucleic acid sequences (e.g., genes) or transcripts thereof in a relevant organism. In some embodiments, a characteristic sequence of a transcript defines that transcript over other transcripts in a relevant organism; for example, in some embodiments, a characteristic sequence is not in transcripts that are transcribed from a different nucleic acid sequence (e.g., a different gene). In some embodiments, transcript variants from a nucleic acid sequence (e.g., mRNA variants of a gene) may share a common characteristic sequence that 54 of 46113113958vlAttorney Docket No: 2010581-1550defines them from, e.g., transcripts of other genes.

[0129] Base sequences of provided oligonucleotides, as appreciated by those skilled in the art, typically have sufficient lengths and complementarity to their target nucleic acids, e.g., RNA transcripts (e.g., pre-mRNA, mature mRNA, etc.) for, e.g.. exon skipping. As appreciated by those skilled in the art. in many instances target nucleic acids are longer than oligonucleotides of the present disclosure, and complementarity may be properly assessed based on the shorter of the two, oligonucleotides. In some embodiments, the base sequence of an oligonucleotide has 90% or more identity with the base sequence of an oligonucleotide disclosed in a Table, wherein each T can be independently substituted with U and vice versa. In some embodiments, the base sequence of an oligonucleotide has 95% or more identity with the base sequence of an oligonucleotide disclosed in a Table, wherein each T can be independently substituted with U and vice versa. In some embodiments, the base sequence of an oligonucleotide comprises a continuous span of 15, 16, 17, 18. 19, 20 or more bases of an oligonucleotide disclosed in a Table, -wherein each T can be independently substituted with U and vice versa, except that one or more bases within the span are abasic (e.g., a nucleobase is absent from a nucleotide).

[0130] In some embodiments, the present disclosure pertains to an oligonucleotide having a base sequence which comprises the base sequence of any oligonucleotide disclosed herein, wherein each T may be independently replaced with U and vice versa.

[0131] In some embodiments, the present disclosure pertains to an oligonucleotide having a base sequence which is the base sequence of any oligonucleotide disclosed herein, wherein each T may be independently repl ced with U and vice versa,

[0132] In some embodiments, the present disclosure pertains to an oligonucleotide having a base sequence which comprises at least 15 contiguous bases of the base sequence of any oligonucleotide disclosed herein, wherein each T may be independently replaced ith U and vice versa.

[0013] In some embodiments, the present disclosure pertains to an oligonucleotide having a base sequence which is at least 90% identical to the base sequence of any oligonucleotide disclosed herein, wherein each T may be independently replaced with U and vice versa.

[0134] In some embodiments, the present disclosure pertains to an oligonucleotide having a base sequence which is at least 95% identical to the base sequence of any oligonucleotide disclosed herein, wherein each T may- be independently replaced with U and vice versa.

[0135] In some embodiments, a base sequence of an oligonucleotide is, comprises, or comprises 10-40, e.g., 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 contiguous bases of the base sequence of any oligonucleotide described herein, wherein each T may be independently replaced -with U and vice versa.

[0136] In some embodiments, an oligonucleotide is an oligonucleotide presented m a Table herein.

[0137] In some embodiments, the base sequence of an oligonucleotide is complementary to that of a target nucleic acid, e.g., a dystrophin gene or transcript thereof. In some embodiments, a base sequence of an 55 of 46113113958vlAttorney Docket No: 2010581-1550oligonucleotide is at least about 50%, 60%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, or 100% complementary to a target sequence in a STMN2 transcript. In some embodiments, abase sequence of an oligonucleotide is fully complementary to a target sequence in a STMN2 transcript.

[0138] In some embodiments, an oligonucleotide has a base sequence which comprises at least 15 contiguous bases (e.g., 15, 16. 17, 18, 19, or 20) of an oligonucleotide in a Table, wherein each T can be independently substituted with U and vice versa,

[0139] In some embodiments, an oligonucleotide composes a base sequence or portion thereof (e.g., a portion comprising 10-40. e.g., 15, 16, 17. 18. 19, 20, 21, 22, 23, 24, 25. 26, 27. 28, 29, 30, 31, 32, 33, 34, 35. 36. 37, 38, 39, 40 nucleobases) described in any of the Tables, wherein each T may be independently replaced with U and vice versa, and / or a sugar, nucleobase, and / or intemucleotidic linkage modification and / or stereochemistry, and / or a pattern thereof described in any of the Tables, and / or an additional chemical moiety (in addition to an oligonucleotide chain, e.g., a target moiety, a lipid moiety, a carbohydrate moiety, etc.) described in any of the Tables.

[0140] In some embodiments, the terms ' complementary,'’ '‘fully complementary” and '‘substantially complementary” may be used with respect to the base matching between an oligonucleotide and a target sequence, as will be understood by those skilled in the art from the context of their uses. It is noted that substitution of T for U, or vice versa, generally does not alter the amount of complementarity. As used herein, an oligonucleotide that is ‘ substantially complementary” to a target sequence is largely or mostly complementary’ but not necessarily 100% complementary. In some embodiments, a sequence (e.g.. an oligonucleotide ) which is substantially complementary’ has one or more, e.g., 1. 2, 3, 4 or 5 mismatches when maximally aligned to its target sequence. In some embodiments, an oligonucleotide has a base sequence which is substantially complementary to a target sequence of a target nucleic acid. In some embodiments, an oligonucleotide has a base sequence which is substantially complementary’ to the complement of the sequence of an oligonucleotide disclosed herein. As appreciated by’ those skilled in the art, in some embodiments, sequences of oligonucleotides need not be 100% complementary' to their targets for oligonucleotides to perform their functions. In some embodiments, base sequences of provided oligonucleotides are fully complementary to their target sequences (A-T / U and C-G base pairing).

[0141] In some embodiments, an oligonucleotide comprises an oligonucleotide comprises a sequence that is complementary' to a characteristic portion of a nucleic acid. In some embodiments, an oligonucleotide comprises a sequence that is complementary to a characteristic portion of a STMN2 transcript. In sonic embodiments, the base sequence of an oligonucleotide is complementary to a characteristic portion of a nucleic acid. In some embodiments, the base sequence of an oligonucleotide is complementary to a characteristic portion of a STMN2 transcript. In some embodiments, a characteristic portion is a characteristic sequence. In some embodiments, a characteristic sequence of a STMN2 transcript is or comprises a complementary sequence of the sequence of an oligonucleotide in Table 1 (e.g., Table 1A, Table IB, Table 1C, Table ID,56 of 46113113958vlAttorney Docket No: 2010581-1550Table IE). In some embodiments a characteristic sequence is or comprises GAAGAAAUGAAUGUGAAUGC, wherein each U may be independently replaced with T. In some embodiments a characteristic sequence is or comprises GAAAUGAAUGUGAAUGCGGC, wherein each U may be independently replaced with T In some embodiments a characteristic sequence is or comprises UGUGGCACAGUUGACAAGGA, wherein each U may be independently replaced with T. In some embodiments a characteristic sequence is or comprises AAUGUGAAUGCGGCUUGUGG, wherein each U may be independently replaced with T. In some embodiments a characteristic sequence is or comprises UUCGAGAGAAAGGUAGAAAA, wherein each U may be independently replaced with T, In some embodiments a characteristic sequence is or comprises GUGUGCGAGAGAGAGAGACA, wherein each U may be independently replaced with T. In some embodiments a characteristic sequence is or comprises GCCUAAGAAGAAAUGAAUGU, wherein each L may be independently replaced with T. In some embodiments a characteristic sequence is or comprises UGAAUGUGAAUGCGGCUUGU, wherein each U may be independently replaced with T. In some embodiments a characteristic sequence is or comprises GAAUGLGAAUGCGGCUUGUG, wherein each U may be independently replaced with T. In some embodiments a characteristic sequence is or comprises GUGGCACAGUUGACAAGGAU, wherein each U may be independently replaced with T. In some embodiments a characteristic sequence is or comprises CAGUUGACAAGGAUGAUAAA, wherein each U may be independently replaced with T. In some embodiments a characteristic sequence is or comprises GALTGAUAAAUCAAUAAUGCA, wherein each U may be independently replaced with T.

[0142] In some embodiments, an oligonucleotide can hybridize to a region of a nucleic acid. In some embodiments, a region has a length of about 20-200 (e.g., about 20-150, 20-100, 30-200, 30-150, 40-200, 40- 150. 50-100, or about 20, 25, 30, 35, 40. 50, 60. 70. 80. 90, 100. 110. 120, 130. 140, 150. 160, 170, 180, 190 or 200) nucleobases In some embodiments, a region has a length of about 30 nucleobases. In some embodiments, a region has a length of about 40 nucleobases. In some embodiments, a region has a length of about 50 nucleobases. In some embodiments, a region has a length of about 60 nucleobases. In some embodiments, a region has a length of about 70 nucleobases. In some embodiments, a region has a length of about 80 nucleobases. In some embodiments, a region has a length of about 90 nucleobases. In some embodiments, a region has a length of about 100 nucleobases. In some embodiments, a region has a length of about 120 nucleobases. In some embodiments, a region has a length of about 150 nucleobases. In some embodiments, a region has a length of about 200 nucleobases. In some embodiments, a region comprises a complementary sequence of a base sequence of an oligonucleotide in Tabic 1 (c.g., Table 1A, Tabic IB, Table 1C, Table ID, Table IE), which in some embodiments, is in the middle of a region. For example, m some embodiments, a region is or comprises STMN2 intron 1. In some embodiments, a region is or comprises exon 2a. In some embodiments, a region is CCCCATCACTCTCTCTTAATTGGATTTTTAAAATTATATTCATATTGCAGGACTCGGCAGAAGAC CTTCGAGAGAAAGGTAGAAAATAAGAATTTGGCTCTCTGTGTGAGCATGTGTGCGTGTGTGCGA57 of 46113113958vlAttorney Docket No: 2010581-1550 GAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATGAATGTGAATGCGGCTTGTGGCACAGTTG ACAAGGATGATAAATCAATAATGCAAGCTTACTATCATTTATGAATAGCAATACrGAAGAAATr AAAACAAAAGATTGCTGTCTCAATATATCTTATATTTATTATTTACCAAATTATTCTAAGAGTAT TTCTTC, wherein each T can be optionally and independently replaced with U. In some embodiments, a region is CCCCAUCACUCUCUCUUAAUUGGAUUUUUAAAAUUAUAUUCAUAUUGCAGGACUCGGCAGA AGACCUUCGAGAGAAAGGUAGAAAAUAAGAAUUUGGCUCUCUGUGUGAGCAUGUGUGCGUG UGUGCGAGAGAGAGAGACAGACAGCCUGCCUAAGAAGAAAUGAAUGUGAAUGCGGCUUGUG GCACAGUUGACAAGGAUGAUAAAUCAAUAAUGCAAGCUUACUAUCAUUUAUGAAUAGCAAU ACUGAAGAAAUUAAAACAAAAGAUUGCUGUCUCAAUAUAUCUUAUAUUUAUUAUUUACCAA AUUAUUCUAAGAGUAUUUCUUC. In some embodiments. a region is or comprises GA AGAA AUG UGUGA UGC. In some embodiments, a region is or comprises GAAAUGAAUGUGAAUGCGGC. In some embodiments, a region is or comprises UGUGGCACAGUUGACAAGGA. In some embodiments, a region is or comprises AAUGUGAAUGCGGCUUGUGG. In some embodiments, a region is or comprises U UCGAGAG AGGUAGAAAA In some embodiments, a region is or comprises GUGUGCGAGAGAGAGAGACA. In some embodiments, a region is or comprises GCCUAAGAAGAAAUGAAUGU. In some embodiments, a region is or comprises UGAAUGUGAAUGCGGCUUGU. In some embodiments, a region is or comprises GA AUGUG AAUGCGGCUUGUG. In some embodiments, a region is or comprises GUGGCACAGUUGACAAGGAU In some embodiments, a region is or comprises CAGUUGACAAGGAUGA AAA. In some embodiments, a region is or comprises GA UGAU AAA UC A AU A AUGC A. In some embodiments, a region is or comprises UGCAGGACUCGGCAGAAGACCUUCGAGAGAAAGGUAGAAAAUAA. In some embodiments, a region is or comprises a 20-base portion of UGCAGGACUCGGCAGAAGACCUUCGAGAGAAAGGUAGAAAAUAA. In some embodiments, a regioncomprises CUCUGUGUGAGCAUGUGUGCGUGUGUGCGAGAGAGAGAGACAGACAGCCUG. In some embodiments, a region is or comprises a 20-base portion of CUCUGUGUGAGCAUGUGUGCGUGUGUGCGAGAGAGAGAGACAGACAGCCUG. In some embodiments,regioncomprises AGCCUGCCUAAGAAGAAAUGAAUGUGAAUGCGGCUUGUGGCACAGUUGACAAGGAUGAUAA AUCAAUAAUGCA. In some embodiments, a region is or comprises a 20-base portion of AGCCUGCCUAAGAAGAAAUGAAUGUGAAUGCGGCUUGUGGCACAGUUGACAAGGAUGAUAA AUCAAUAAUGCA. Among other things, the present disclosure provides the recognition that oligonucleotides targeting certain regions can provide higher levels of desired STMN2 transcripts and / or lower 58 of 46113113958vlAttorney Docket No: 2010581-1550levels of undesired STMN2 transcripts.

[0143] In some embodiments, the base sequence of an oligonucleotide is or comprises an oligonucleotide base sequence described in WO 2023102242, WO 2024173645, WO 2024124203, WO 2023222858. WO 2023102242, WO 2023018858, WO 2022120410. WO 2022018187. WO 2022018155. WO 2021247800, WO 2021195446, WO 2021108869, WO 2020247419, WO 2020150290. or WO 2019241648. the base sequences of each of which are independently incorporated herein by reference. In some embodiments, an oligonucleotide can hybridize to a region of a nucleic acid, e.g., hotspot regions described in WO 2023102242, WO 2024173645, WO 2024124203, WO 2023222858, WO 2023102242, WO 2023018858, WO 2022120410, WO 2022018187, WO 2022018155. WO 2021247800. WO 2021195446, WO 2021108869, WO 2020247419, WO 2020150290, or WO 2019241648, the hotspot regions of each of which are independently incorporated herein by reference. In some embodiments, the base sequence of an oligonucleotide is or comprises an oligonucleotide base sequence described in WO 2019241648, the base sequences of which are incorporated herein be reference. In some embodiments, an oligonucleotide can hybridize to a region of a nucleic acid, e.g., hotspot regions described in WO 2019241648, the hotspot regions of which are incorporated herein by reference. In some embodiments, applying provided technologies, e.g., sugars, internucleotidic linkages, stereochemistry’, etc, and patterns thereof, to reported base sequences can provide improvements, e.g,. increased activities, improved properties, etc, compared to reported oligonucleotides with the same base sequence.

[0144] In some embodiments, tire present disclosure provides an oligonucleotide comprising a sequence found in an oligonucleotide described in a Table, wherein one or more U is independently’ and optionally replaced with T or vice versa. In some embodiments, an oligonucleotide can comprise at least one T and / or at least one U. In some embodiments, the present disclosure provides an oligonucleotide comprising a sequence found in an oligonucleotide described in a 'Table herein, w’herein the said sequence has over 50% identity with the sequence of the oligonucleotide described in a Table. In some embodiments, the present disclosure provides an oligonucleotide whose base sequence is the sequence of an oligonucleotide disclosed in a Table, wherein each T may be independently replaced with U and vice versa. In some embodiments, the present disclosure provides an oligonucleotide comprising a sequence found in an oligonucleotide in a Table, wherein the oligonucleotides have a pattern of backbone linkages, pattern of backbone chiral centers, and / or pattern of backbone phosphorus modifications of the same oligonucleotide or another oligonucleotide in a Table herein.

[0145] In some embodiments, the disclosure provides an oligonucleotide having a base sequence which is, comprises, or comprises a portion of the base sequence of an oligonucleotide disclosed herein, e.g., in a Tabic, wherein each T may be independently replaced with U and vice versa, w’herein the oligonucleotide optionally further comprises a chemical modification, stereochemistry', format, an additional chemical moietys described herein (e.g., a targeting moiety, lipid moiety, carbohydrate moiety, etc.), and / or another structural feature.

[0146] In some embodiments, a "portion” (e.g., of a base sequence or a pattern of modifications or other structural element) is at least 5, 6, 7, 8, 9, 10, 11, 12. 13, 14, 15, 16, 17, 18, 19, or 20 monomeric units long.59 of 46113113958vlAttorney Docket No: 2010581-1550

[0147] As examples, certain oligonucleotides comprising certain example base sequences, nucleobase modifications and patterns thereof, sugar modifications and patterns thereof, intemucleotidic linkages and patterns thereof, linkage phosphorus stereochemistry and patterns thereof, linkers, and / or additional chemical moieties, etc., are presented in Table I. below. Among other things, these oligonucleotides may be utilized for exon skipping. In some embodiments, listed in Tables are stereorandom oligonucleotide compositions. In some embodiments, the present disclosure provides chirally controlled oligonucleotide compositions.In some embodiments, a base sequence is or comprises a particular sequence. In some embodiments, a base sequence is complementary to a base sequence that is or comprises a base sequence that is complementary to a particular sequence. In some embodiments, a base sequence is or comprise a sequence that differs from a particular sequence at no more than 1, 2, 3, 4, or 5 positions. In some embodiments, a base sequence is or comprise a sequence that differs from about 15-30 (e.g., 15-25. 15-20, 20-30. 15. 16. 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30) consecutive nucleobases of a particular sequence at no more than 1, 2, 3, 4, or 5 positions. In some embodiments, a base sequence is or comprise a sequence that differs from a particular sequence at no more than 1 position. In some embodiments, a base sequence is or comprise a sequence that differs from a particular sequence at no more than 2 positions. In some embodiments, a base sequence is or comprise a sequence that differs from a particular sequence at no more than 3 positions. In some embodiments, a base sequence is or comprise a sequence that differs from a particular sequence at no more than 4 positions. In some embodiments, a base sequence is or comprise a sequence that differs from a particular sequence at no more than 5 positions. In some embodiments, a particular sequence is or comprises a base sequence selected from Table 1. In some embodiments, a particular sequence is or comprises 5-20, 10-20, or 15-20 (e.g,, 5, 6, 7, 8, 9. 10, 11, 12, 13, 14, 15, 16. 17, 18. 19. or 20) consecutive bases in a base sequence selected from Table I. In some embodiments, a particular sequence is or comprises 10 consecutive bases in a base sequence selected from Table 1. In some embodiments, a particular sequence is or comprises 1 1 consecutive bases in a base sequence selected from Table 1. In some embodiments, a particular sequence is or comprises 12 consecutive bases in a base sequence selected from Table 1, In some embodiments, a particular sequence is or comprises 13 consecutive bases in a base sequence selected from Table 1. In some embodiments, a particular sequence is or comprises 14 consecutive bases in a base sequence selected from Table 1. In some embodiments, a particular sequence is or comprises 15 consecutive bases in a base sequence selected from Table 1. In some embodiments, a particular sequence is or comprises 16 consecutive bases in a base sequence selected from Table 1. In some embodiments, a particular sequence is or comprises 17 consecutive bases in a base sequence selected from Tabic 1. In some embodiments, a particular sequence is or comprises 18 consecutive bases in a base sequence selected from Table 1. In some embodiments, a particular sequence is or comprises 19 consecutive bases in a base sequence selected from Table 1. In some embodiments, a particular sequence is or comprises 20 consecutive bases in a base sequence selected from Table 1. In some embodiments, a base sequence selected from Table 1 is a base sequence selected from Table 1A. In some embodiments, a base sequence selected from Table 1 is a base sequence selected from Table IB. In some embodiments, a base 60 of 46113113958vlAttorney Docket No: 2010581-1550sequence selected from Table 1 is a base sequence selected from Table 1C. In some embodiments, a base sequence selected from Table 1 is a base sequence selected from Table ID. In some embodiments, a base sequence selected from Table 1 is a base sequence selected from Table IE. In some embodiments, a particular sequence is or comprises GCAUUCACAUUCAUUUCUUC. wherein each U can be independently replaced with T and vice versa. In some embodiments, a particular sequence is or comprises GCAUUCACAUUCAUUUCUUC. In some embodiments, a particular sequence is or comprises GCCGCAUUCACAUUCAUUUC, wherein each U can be independently replaced with T and vice versa. In some embodiments, a particular sequence is or comprises GCCGCAUUCACAUUCAUUUC. In some embodiments, a particular sequence is or comprises UCCUUGUCAACUGUGCCACA, wherein each U can be independently replaced with T and vice versa. In some embodiments, a particular sequence is or comprises UCCUUGUCAACUGUGCCACA In some embodiments, a particular sequence is or comprises CCACAAGCCGCAUUCACAUU, wherein each U can be independently replaced with T and vice versa In some embodiments, a particular sequence is or comprises CCACAAGCCGCAUUCACAUU. In some embodiments, a particular sequence is or comprises UUUUCUACCUUUC CUCGAA, wherein each U can be independently replaced with T and vice versa. In some embodiments, a particular sequence is or comprises UUUUCUACCUUUCUCUCGAA. In some embodiments, a particular sequence is or comprises UGUCUCUCUCUCUCGCACAC, wherein each U can be independently replaced with T and vice versa. In some embodiments, a particular sequence is or comprises UGUCUCUCUCUCUCGCACAC. In some embodiments, a particular sequence is or comprises ACAUUCAUUUCUUCUUAGGC, wherein each U can be independently replaced with T and vice versa. In some embodiments, a particular sequence is or comprises ACAUUCAUUUCUUCUUAGGC. In some embodiments, a particular sequence is or comprises ACAAGCCGCAUUCACAUUCA, wherein each U can be independently replaced with T and vice versa. In some embodiments, a particular sequence is or comprises ACAAGCCGCAUUCACAUUCA. In some embodiments, a particular sequence is or comprises CACAAGCCGCAUUCACAUUC, wherein each U can be independently replaced with T and vice versa. In some embodiments, a particular sequence is or comprises CACAAGCCGCAUUCACAUUC. In some embodiments, a particular sequence is or comprises AUCCUUGUCAACUGUGCCAC, wherein each U can be independently replaced with T and vice versa. In some embodiments, a particular sequence is or comprises AUCCUUGUCAACUGUGCCAC. hi some embodiments, a particular sequence is or comprises UUUAUCAUCCUUGUCAACUG, wdieretn each U can be independently replaced with T and vice versa. In some embodiments, a particular sequence is or comprises UUUAUCAUCCUUGUCAACUG. In some embodiments, a particular sequence is or comprises UGCAUUAUUGAUUUAUCAUC, wherein each U can be independently replaced with T and vice versa. In some embodiments, a particular sequence is or comprises UGCAUUAUUGAUUUAUCAUC.61 of 46113113958vlAttorney Docket No.: 2010581-1550Table 1. Example oligonucleotides and / or compositions.Table 1A. Example oligonucleotides and / or compositions.ID HELM Description Base Sequence ASO- RNA1 {[moe]([m5C])[sp].[moe](G)[sp].[moe]([m5C])[sp].[moe](A)[sp].[moe](T)[sp].[moe](T)[sp].[moe]([m5C])[ CGCATTCACAT 0137330 sp].[moe](A)[sp].[moe]([m5C])[sp] Jmoel(A)[sp].[moel(T)[sp].[moe](T)[sp].[moe]([m5C])[sp] [moe](A)[sp] [mo TCATTTC e] (T) [sp], [moe] (T) [sp]. [moe] (T) [sp]. [moe] ([m5 C ]) } $$$SV2.0ASO- RNA1 {[fl2r](A)[Ssp].[f!2r](A)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp] [f AAUUAAGAGA 0136727 12r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp],[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp],[fl2r](G)[Ssp].[fl2r](A)[ GAGUGAUGGG Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2rj(G)[Ssp].[fl2r](G)}$S$$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp] [fl2r](A)[n001].[fl2r](A)[Ssp].[fl CAAUUAAGAG 0136728 2r](G)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp] m(A)[Ssp],[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[ AGAGUGAUGG Ssp].[fl2r](A)[n001].[fl2r](D)[SspJ.[fl2r](G)[Ssp].[fl2rj(G)}$S$$V2.0ASO- RNA1 {[fl2r](C)[Ssp].[fl2r](C)[Ssp].[f]2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001],[fl2r](A)[Ssp].[fl CCAAUUAAGA 0136729 2r](A)[Ssp].m(G)[Ssp],[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp] m(G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[ GAGAGUGAUG Ssp].[fl2r](G)[n001].[fl2r](A)[SspJ.[fl2r](U)[SspJ.[fl2r](G)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl UCCAAUUAAG 0136730 2r](A)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[ AGAGAGUGAU Ssp].[fl2r](U)[n001].[fl2r](G)[Sspj. [fl2r](A)[Ssp]. [fl2rJ(U)}$$$$ V20ASO- RNAl {[fl2r](A)[Ssp].[fl2r](U)[Ssp] [fl2r](C)[n001].[f]2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001] [fl2r](U)[Ssp].[fl AUCCAAUUAA 0136731 2r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[ G AG AGAGU GA Ssp].[fl2r](G)[n001].[fl2r](U)|Ssp].[fl2r](G)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](A)[Ssp].[il2r](U)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl AAUCCAAUUA 0136732 2r](U)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(A)[Sspj.[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[ AGAGAGAG U G Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](G)}$$$$V2.0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[ii001].[fl2r](A)[Ssp].[fl AAAUCCAAUU 0136733 2r](A)[Ssp].m(LT)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[ AAGAGAGAGU Ssp].[fl2r](G)[n001].|fI2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r|(U)}$S$$V2.0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2rJ(A)[Ssp].[fl2rKU)[Ssp].[fl2rJ(C)[n001].[fl2r](C)[Ssp].[fl AAAAUCCAAU 0136734 2r|(A)[Ssp|.m(A)[Ssp|.[fl2r](U)[Ssp].m(U)[Ssp] Jfl2i](A)[Sspl.m(A)|Ssp].[fi2r|(G)[Ssp].[fl2f|(A)[Ssp|.[fl2r](G)[ U A AGAGAGAG Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](Gj}$$$$V2.0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2rJ(A)[n001j.[fl2rj(A)[Sspj.[fl2rj(A)lSspj.[fl2rj(U)[n001J.[fl2r](C)[Ssp].[fl AAAAAUCCAA 0136735 2r](C)[Ssp].m(A)[Ssp|.|fl2r](A)[Ssp].m(U)[Ssp].[fl2r|(U)[Ssp|.m(A)[Sspl.[fl2r](A)[Ssp].[fl2r|(G)[Ssp].[fl2r](A)[ UUAAGAGAGASsp].[fl2rl(G)[n0011.[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)}$S$$V2.062 of 46113113958vJAttorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(U)[Ssp|.|fl2r](A)|Ssp].[fl2r](A)[n001].[fl2r](A)iSsp].[fl2r](A)[Ssp].[fl2r](A)[n00r|.|fI2r](U)|Ssp].[f UAAAAAUCCA 0136736 12r](C)[Ssp].m(C)[Sspl.[fl2r](A)[Ssp].m(A)[Ssp].[fl2rl(U)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Sspl.[fl2r](G)[ AUUAAGAGAG Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2rl(A)[Ssp].[fl2r](G)}$S$$V2.0ASO- RNAl{|fl2r](U)i: Ssp].[fl2r|(Li)[Ssp].[fl2r](A)|n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r|(A)[Ssp].|f UUAAAAAUCC 0136737 12r](U)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[ AAUUAAGAGA Ssp] Jfl2rl(G)[n001].[fl2r](A)[Ssp].[fl2r](G)rSsp].rfl2r](A)}$S$$V2.0ASO- RNAl{[fl2r|(U)[Ssp|.|fl2r](U)|Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[ii00r|.|112r](A)|Ssp].[f UUUAAAAAUC 0136738 12r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2rl(A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Sspl.[fl2r](A)[ CAAUUAAGAG Ssp].[f]2r](A)[n001],[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[f UUUUAAAAAU 0136739 12r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Sspl.m(C)[Ssp].[fl2rl(C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ CCAAUUAAGA Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](A)[Sspl [f!2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Sspl.[fl2rl(U)[Ssp].[fl2r](A)[n001] [fl2r](A)[Ssp].[f AUUUUAAAAA 0136740 12r](A)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ UCCAAUUAAG Ssp].[fl2r](U)[n001] [f!2r](A)[Ssp]. [fl2r](A)[Ssp] [fl2r](G)}$S$$V2,0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](A)[Sspl.[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[f UAAUUUUAAA 0136741 12r](A)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp] [fl2r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ AAUCCAAUUA Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2rJ(U)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp],[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp],[fl2r](A)[Ssp].[fl2r](U)[n001],[fl2r](U)[Ssp].[f UAUAAUUUUA 0136742 ]2r](U)[Ssp],m(U)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp] [fl2r](A)[Ssp].[fl2r](U)[Ssp],[fl2r](C)[ AAAAUCCAAU Ssp].[fl2r](C)[n001j.[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)}$$S$V2.0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](U)[Ssp],[fl2r](A)[n001],[fl2r](U)[Ssp].[fl2r](A)[Ssp] [fl2r](A)[n001].[fl2r](U)[Ssp].[f AUAUAAUUUU 0136743 12r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ AAAAAUCCAA Ssp],[fl2r](C)[n001].[fl2rJ(C)[SspJ.[fl2r](A)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNAl{[f]2r](A)[Ssp].[fl2r](U)[Ssp].[f]2r](A)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001] [fl2r](A)[Ssp],[f AUAUGAAUAU 0136744 12r](U)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(U)[SspJ.[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ AAUUUUAAAA Ssp].[fl2r](A)|n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNA1 {[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp] [G2r](G)[n001 ]. [fl 2r](A)[Ssp]. [f AAUAUGAAUA 0136745 12r](A)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2rJ(U)[SspJ.[fl2r](U)[Ssp].[fl2r](U)[ UAAUUUUAAA Ssp]. [fl2r] (U) [nOO 1 ]. [fI2r](A) | Ssp]. [fl2r ] (A) [ Ssp ]. [fl2r] (A) } $S$$V2.0ASO- RNAl{[fl2r](C)[SspJ.[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](L!)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001J.[fl2r](G)[Ssp].[fl CAAUAUGAAU 0136746 2r](A)[Ssp].m(A)[Ssp].[fl2r](ll)[Ssp].m(A)[Sspj.[fl2rj(U)[Ssp].m(A)[Ssp].[fl2r](A)[Sspj.[fl2r](U)[Ssp].[fl2r](ll)[ AUAAUUUUAASsp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)]$$$$V2.063 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNA1 {[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n00r|.[fl2r](A)|Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl GCAAUAUGAA 0136747 2r](G)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2rl(A)[Ssp].m(U)[Sspl.[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ UAUAAUUUUA Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2rl(U)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](G)[Ssp|.[fl2r](C)[n001].[fl2r](A)[Ssp|.[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl UGCAAUAUGA 0136748 2r](U)[Ssp].m(G)[Ssp].[fl2rl(A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[ AUAUAAUUUU Ssp],[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[fl2r](C)[Sspl.[fI2r](U)[Ssp].[fl2rl(G)[n00r|.[fl2r](C)[Ssp|.ifl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssph[fl CUGCAAUAUG 0136749 2r](A)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2rl(A)[Ssp].m(U)[Sspl.[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[ AAUAUAAUUU Ssp].[fl2r](A)[n001],[fl2r](U)[Ssp].[fl2r](U)[Ssp] [fl2r](U)}$S$$V2.0ASO- RNA1 {[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl CCUGCAAUAU 0136750 2r](U)[Ssp].m(A)[Ssp].[fl2rl(U)[Sspj.m(G)[Sspl.[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ GAAUAUAAUU Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl UCCUGCAAUA 0136751 2r](A)[Ssp].m(U)[Ssp].[f]2r](A)[Ssp],m(U)[Ssp],[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[ UGAAUAUAAU Ssp].[f]2r](U)[n001] [fl2r](A)[Ssp].[fl2r](A)[Ssp] [fl2r](U)}$S$$V2,0ASO- RNAl {[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2rl(C)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl GUCCUGCAAU 0136752 2r](A)[Ssp].m(A)[Ssp],[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp] m(G)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ AUGAAUAUAA Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[tl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](A)[Ssp],[fl2r](G)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp],[fl AGUCCUGCAA 0136753 2r](C)[Ssp].m(A)[Ssp],[fl2r](A)[Ssp].m(U)[Ssp].[f! 2r](A)[Ssp].m(U)[Ssp],[fl2r](G)[Ssp].[fl2r](A)[Ssp],[fl2r](A)[ UAUGAAUAUA Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2rJ(A)}$$$$V2.0ASO- RNAl {[fl2r](G)[Ssp].[fl2r](A)[Ssp],[fl2r](G)[n001],[fl2r](U)[Ssp].[fl2r](C)[Ssp].[f]2r](C)[n001] [fl2r](U)[Ssp].[f] GAGUCCUGCA 0136754 2r](G)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp],[fl2r](G)[Ssp].[fl2r](A)[ AUAUGAAUAU Ssp],[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](A)[SspJ.[fl2r](U)}$S$$V2.0ASO- RNAl{[f]2r](C)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001],[fl2r](G)[Ssp].[fl2r](U)[Ssp],[fl2r](C)[n001].[f!2r](C)[Ssp].[fl CGAGUCCUGC 0136755 2r](U)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2iJ(A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[ AAUAUGAAUA Ssp].[fl2r](A)|n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNA1 {[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[n001],[fl2r](C)[Ssp],[fl CCGAGUCCUG 0136756 2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp] m(C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ CAAUAUGAAU Ssp]. [fl2r] (G) [nOO 1 ]. [fI2r](A) | Ssp]. [fl2r ] (A) [ Ssp ]. [fl2r] (U) } $S$$V2.0ASO- RNA 1 { [fl2r] (G) [Ssp]. [fl2r] (C) [Ssp]. [fl2r] (C) [nOO 1 ]. [f!2r] (G) [Ssp]. [f!2r] (A)[Ssp]. [fl2r] (G) [nOO 1 ]. [fl2r] (U) [Ssp]. [fl GCCGAGUCCU 0136757 2r](C)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[ GCAAUAUGAASsp].[fl2r](U)[n001].[fl2rj(G)[Ssp].[fl2r](A)[Ssp].[fl2r](A)}$$$$V2.064 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(U)[Ssp].|fl2r](G)|Ssp].[fl2r](C)|n00r|.[tl2r](C)[Ssp|.|fl2r](G)|Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[tl UGCCGAGUCC 0136758 2r](U)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ UGCAAUAUGA Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2rl(G)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](C)[Ssp]Jfl2i|(U)|Ssp|.[fl2r](G)[n001].[fl2r](C)|Ssp].[fl2rl(C)|Ssp|.[fl2r](G)[n001].[fl2r|(A)[Ssp|.[fl CUGCCGAGUC 0136759 2r](G)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[ CUGCAAUAUG Ssp] Jfl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)}$S$$V2.0ASO- RNAl{[fl2r|(U)[Ssp|.|fl2r](C)[Ssp].|fl2r](U)[n00r^ UCUGCCGAGU 0136760 2r](A)[Ssp].m(G)[Ssp].[f]2r](U)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ CCUGCAAUAU Ssp].[f]2r](A)[n001],[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl UUCUGCCGAG 0136761 2r](G)[Ssp].m(A)[Ssp].[fl2rl(G)[Ssp].m(U)[Sspl.[fl2r](C)[Ssp].m(C)[Sspl.[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[ UCCUGCAAUA Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Sspl.[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl CUUCUGCCGA 0136762 2r](C)[Ssp],m(G)[Ssp],[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[ GUCCUGCAAU Ssp]. [fl 2r](C) [nOO 1 ], [f!2r] (A) [Ssp]. [fl 2r] (A) [Ssp], [f!2r] (U) } $$S$V2.0ASO- RNA1 {[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl UCUUCUGCCG 0136763 2r](C)[Ssp].m(C)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(U)[Ssp],[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[S AGUCCUGCAA sp]. [fl2r] (G)[n001]. [fl2r] (C) [S spj. [fl2r] (A) [Ssp]. [fl2r j ( A) } $$$$ V2.0ASO- RNAl{[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl GUCUUCUGCC 0136764 2r](G)[Ssp].m(C)[Ssp],[fl2r](C)[Ssp],m(G)[Ssp],[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[S GAGUCCUGCA sp]. [fl2r] (U)[n001]. [fl2r] (G)[Ssp]. [fl2r] (C) [ Ssp]. [fl2r] (A) } $$$$V2.0ASO- RNAl{[fl2r](G)[Ssp].[fl2r](G)[Ssp],[fl2r](U)[n001],[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001] [fl2r](C)[Ssp].[fl GGUCUUCUGC 0136765 2r](U)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].in(C)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2i](U)[Ssp],[fl2r](C)[ CGAGUCCUGC Ssp],[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl{[f]2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp],[fl2r](C)[Ssp],[fl2r](U)[n001] [fl2r](U)[Ssp].[fl AGGUCUUCUG 0136766 2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[ CCGAGUCCUG Ssp].[fl2r](C)[n001].[fl2r|(C)|Ssp].[fl2rj(U)[Ssp].[fl2r](G)}S$$$V20ASO- RNAl{[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](G)[Ssp].[fl2r](U)[Ssp] [fl2r](C)[n001] [fl2r](U)[Ssp].[fl AAGGUCUUCU 0136767 2r](U)[Ssp] m(C)[Ssp].[fl2r](lT)[Ssp] m(G)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[ GCCGAGUCCU Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)}$$$$V2.0ASO- RNAl{[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl GAAGGUCUUC 0136768 2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp],m(C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[ UGCCGAGUCCSsp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)}$$$$V2.065 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(U)[Ssp].|fl2r](C)[Ssp].|fl2rl(U)|n00r|.[tl2r](C)[Ssp|.|fl2r](U)|Ssp].[fl2r](C)[n00r|.|fl2r](G)|Ssp].[fl UCUCUCGAAG 0136769 2r](A)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(G)[Ssp].[fl2rl(U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Sspl.[fl2r](C)[ GUCUUCUGCC Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2rl(C)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl{[fl2r](U)|Ssp].[fl2r|(U)[Ssp|.|fl2r](C)[n001].[fl2r](U)[Ssp|.[fl2r](C)[Ssp].|fl2r](U)|n00r|.[fl2r](C)[Ssp|.|fl UUCUCUCGAA 0136770 2r](G)[Ssp].m(A)[Ssp].[fl2rl(A)[Ssp].m(G)[Ssp].[fl2r](G)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ GGUCUUCUGC Ssp],[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[f]2r](C)}$$$$V2,0ASO- RNAl{[fl2r|(Li)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[ii001].[fl2r](U)[Ssp].[tl UUUCUCUCGA 0136771 2r](C)[Sspl.m(G)[Sspl.[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[ AGGUCUUCUG Ssp].[f]2r](U)[ii001],[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)}$$S$V2.0ASO- RNA1 {[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](LT)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl CUUUCUCUCG 0136772 2r](U)[Ssp].m(C)[Ssp].[fl2r](G)[Sspl.m(A)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2rl(C)[ AAGGUCUUCU Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)}$$$$V2,0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n00l].[fl2r](U)[Sspl.[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl ccuuucucuc 0136773 2r](C)[Ssp],m(U)[Ssp],[fl2r](C)[Ssp].m(G)[Ssp],[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp],[fl2r](G)[Ssp].[fl2r](U)[ GAAGGUCUUC Ssp]. [fl 2r](C) [nOO 1 ], [f!2r] (U) [Ssp]. [fl 2r] (U) [Ssp], [f!2r] (C) } $$$$V2.0ASO- RNA1 {[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl ACCUUUCUCU 0136774 2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp],[fl2r](A)[Ssp].[fl2r](G)[Ssp] [fl2r](G)[ CGAAGGUCUU Ssp]. [fl2r] (U) [nOO 1 ]. [f!2r] (C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (U) } $$$$ V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl UACCUUUCUC 0136775 2r](C)[Ssp].m(U)[Ssp],[fl2r](C)[Ssp],m(U)[Ssp],[fl2r](C)[Ssp],m(G)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[ UCGAAGGUCU Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)}$$S$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp],[fl2r](U)[n001].[fl2r](U)[Ssp],[fl CUACCUUUCU 0136776 2r](U)[Ssp].m(C)[Ssp].[fl2r](l))[Ssp].in(C)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[ CUCGAAGGUC Ssp],[fl2r](G)[n001].[fl2r](G)[Ssp].[fl2rj(U)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl{[f!2r](U)[Ssp],[fl2r](C)[Ssp].[fl2r](U)[n001],[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001],[fl2r](U)[Ssp].[fl UCUACCUUUC 0136777 2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(D)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[ UCUCGAAGGU Ssp].[fl2r](A)[n001].[tl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](U)}$$$$V2.0ASO- RNA1 {[fl2r](U)[Ssp].[f]2r](U)[Ssp],[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[f]2r](C)[n001],[fl2r](C)[Ssp],[fl UUCUACCUUU 0136778 2r](U)[Ssp] m(U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[ CUCUCGAAGG Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](G)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](C)[Ssp].[fl UUUCUACCUU 0136779 2r](C)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(lJ)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[S UCUCUCGAAGsp].[fl2r|(G)[n001].[fl2r|(A)[Ssp].[fl2r](A)[Ssp].[fl2r](G)}$$$SV2.066 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(Li)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)|Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl UUUUCUACCU 0136780 2r](C)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp],[fl2r](U)[S UUCUCUCGAA spl.[fl2r](C)[n001].[fl2rl(G)[Ssp].[fl2r](A)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNAl{[fl2r](A)|Ssp].[fl2r|(U)[Ssp|.|fl2r](U)|n001].[fl2r](lJ)[Ssp].|fl2r|(U)|Ssp|.[fl2r](C)[n001].|fl2r](U)|Ssp].[fl AUUUUCUACC 0136781 2r](A)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[S UUUCUCUCGA sp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](G)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp|.[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](U)|Ssp].[fl2r](LT)[Ssp].[fl2r](U)[ri00r|.[fl2r](C)[Ssp].[fl UAUUUUCUAC 0136782 2r](U)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[ CUUUCUCUCG Ssp].[fl2r](C)[n001],[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](G)}S$$$V2.0ASO- RN A 1 { [f!2r] (U) [Ssp]. [fl2r] (U) [Sspl. [fl2r] ( A) [nOO 1 ]. ffl2r](U) [Ssp]. [f!2r] (U) [Ssp]. [fl2r] (U) [nOO 1 ]. [fl2r] (U) [Ssp]. [f UUAUUUUCUA 0136783 12r](C)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(C)[Sspl.[fl2r](C)[Ssp].m(U)[Ssp].[f12r](U)[Sspl.[fl2r](U)[Ssp].[fl2r](C)[ ccuuucucuc Ssp], [f!2r] (U) [n 001 ]. [fl 2r] (C ) [Ssp]. [f!2r] (U) [Ssp]. [fl 2r] (C) } $$$$V2, 0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n00l].[fl2r](A)[Sspl.[fl2r](C)[Ssp].[fl2r](A)[n001].[fI2r](C)[Ssp].[fl CUCACACAGA 0136784 2r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp],m(G)[Ssp],[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ GAGCCAAAUU Ssp].[fl2r](A)[n001] [fl2r](A)[Ssp].[fl2r](U)[Ssp] [fl2r](U)}$S$$V2,0ASO- RNAl {[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl GCUCACACAG 0136785 2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp] [fl2r](C)[Ssp] [fl2r](C)[ AGAGCCAAAU Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp],[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](C)[Ssp].[fl UGCUCACACA 0136786 2r](A)[Ssp].m(C)[Ssp],[fl2r](A)[Ssp].m(G)[Ssp].[fl 2r](A)[Ssp],m(G)[Ssp],[fl2r](A)[Ssp].[fl2r](G)[Ssp],[fl2r](C)[ GAGAGCCAAA Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](A)}$$S$V2.0ASO- RN A 1 { [fl2r] (A) [Ssp]. [fl 2r] (U) [Ssp], [f!2 r] (G) [nOO 1 ], [fl2r](C) [Ssp]. [f!2r] (U) [Ssp]. [fl 2r] (C) [nOO 1 ] [fl2r] (A) [Ssp]. [fl AUGCUCACAC 0136787 2r](C)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp],[fl2r](G)[ AGAGAGCCAA Ssp],[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001],[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl CAUGCUCACA 0136788 2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[ CAGAGAGCCA Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}S$$$V2.0ASO- RNAl {[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl ACAUGCUCAC 0136789 2r](C)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[ ACAGAGAGCC Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl CACAUGCUCA 0136790 2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[ CACAGAGAGCSsp].[fl2r](G)[n001].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](C)}$$$$V2.067 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(A)[Ssp].|fl2r](C)[Ssp].|fl2rl(A)|n00r|.[tl2r](C)[Ssp|.|fl2r](A)|Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[tl ACACAUGCUC 0136791 2r](C)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp],[fl2r](G)[S ACACAGAGAG sp].[fl2r](A)[n001] [fl2r](G)[Ssp].[fl2r](A)[Sspl.[fl2r](G)}$$$$V2.0ASO- RNAl{|fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[n001j.[fl2r](A)[Ssp].[fl2rKC)[Ssp].[fl2r](A)[n001].[fl2r|(U)[Ssp].[fl CACACAUGCU 0136792 2r](G)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[S CACACAGAGA sp].[fl2r](G)[n001].[fl2r](A)[Ssp].[fl2r](G)[Sspl.[fl2r](A)}$$$$V2.0ASO- RNAl{[fl2r|(G)[Ssp|.|fl2r](C)[Ssp].|fl2r](A)[n00r|.^ GCAC AC AU GC 0136793 2r](U)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[S UCACACAGAG sp].[fl2r](A)[n001].[fl2r](G)[Ssp].[f]2r](A)[Ssp].[fl2r](G)}$$$$V2.0ASO- RNAl {[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](C)[Sspl [fl2r](U)[n001].[fl2r](C)[Ssp].[fl GUCUCUCUCU 0136794 2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[S CUCGCACACA sp].[fl2r](C)[n001],[f!2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp] [fl2r](C)[n001].[fl2r](U)[Ssp].[fl UGUCUCUCUC 0136795 2r](C)[Ssp],m(U)[Ssp],[fl2r](C)[Ssp].m(U)[Ssp],[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[S UCUCGCACAC sp] [fl2r](A)[n001].[f]2r](C)[Ssp].[fl2r](A)[Ssp].[tl2r](C)}$$S$V2,0ASO- RNAl {[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2rl(U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl CUGUCUCUCU 0136796 2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[S CUCUCGCACA spJ.[fl2r](C)[n001].[fl2rJ(A)[SspJ.[fl2r](C)[Ssp].[fl2r](A)}$$S$V2.0ASO- RNAl{[fl2r](U)[Ssp],[fl2r](C)[Ssp].[fl2r](U)[ii001].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp],[fl UCUGUCUCUC 0136797 2r](C)[Ssp].m(U)[Ssp],[fl2r](C)[Ssp],m(U)[Ssp],[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[S UCUCUCGCAC sp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](A)[SspJ.[fl2r](C)}$$S$V2.0ASO- RNA1 {[fl2r](G)[Ssp].[fl2r](U)[Ssp],[fl2r](C)[n001].[f]2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[n001] [fl2r](C)[Ssp].[fl GUCUGUCUCU 0136798 2r](U)[Ssp].m(C)[Ssp].[fl2r](l))[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[S CUCUCUCGCA spJ.[fl2r](C)[n001].[fl2rJ(G)[Ssp].[fl2r](C)[Ssp],[fl2r](A)}$$S$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp],[fl2r](G)[n001] [fl2r](U)[Ssp].[fl UGUCUGUCUC 0136799 2r](C)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp] [fl2r](C)[S UCUCUCUCGC sp]4fl2r|(U)[n001].[fl2r](C)[Ssp].[fl2r|(G)[Ssp].[fl2r|(C)}$$$$V2.0ASO- RNA1 {[fl2r](G)[Ssp].[fl2r](G)[Ssp],[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[n001] [f!2r](C)[Ssp].[fl GGCUGUCUGU 0136800 2r](U)[Ssp] m(G)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[SspJ.[fl2r](U)[ CUCUCUCUCU Ssp].[fl2r](C)|n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)}$$$$V2.0ASO- RNA 1 { [fl2r] (A) [Ssp]. [fl2r] (G) [Ssp]. [il2r] (G) [nOO 1 ]. [fl2r J (C ) [ S sp]. [fL2r] ( LT) [ S sp]. [fl2r] (G) [nOO 1 J. [f!2 r] (U) [ S sp]. [fl AGGCU G U C U G 0136801 2ij(C)[Sspj.m(U)[Ssp],[fl2r](G)[Ssp],m(U)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[t!2rj(C)[Sspj. [fl2r](U)[Ssp], [f!2r](C)[S ucucucucucsp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)}$$$$V2.068 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RMAl{[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n00r|.[fl2r](G)|Ssp].[fl2r](C)[Ssp].[fl2rl(U)[n001].[fl2r](G)[Ssp].[fl CAGGCUGUCU 0136802 2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[ GUCUCUCUCU Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](Uj}$$$$V2.0ASO- RNAl{[fl2r](G)|Ssp].[fl2r|(C)|Ssp|.[fl2r](A)[n001].[fl2r](G)[Ssp|.[fl2r](G)|Ssp].[fl2r|(C)|n00r|.[fl2r](LT)|Ssp].[fl GCAGGCUGUC 0136803 2r](G)[Ssp].m(U)[Ssp].[fl2rl(C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[ UGUCUCUCUC Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[f]2r](C)}$$$$V2,0ASO- RN A 1 { [fl2r |(G) [Ssp [fl2r] (G) [Ssp]. [fl2r] (C) [nOO 1 ]. [ t!2r](A) [ Ssp]. [fl2r |(G) [Ssp [ fl2r] (G) |n001 ]. [fl2r](C)[Ssp].[tl GGCAGGCUGU 0136804 2r](U)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[ CUGUCUCUCU Ssp].[fl2r](C)[n001],[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)}S$$$V2.0ASO- RN A 1 { [fl2r] (A) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (G) [nOO 1 ]. [fl2r](C) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (G) [nOO 1 ]. [f!2r] (G) [Ssp]. [fl AGGCAGGCUG 0136805 2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[ UCUGUCUCUC Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](Uj[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp] [fl2r](A)[n001].[fl2r](G)[Ssp].[fl UAGGCAGGCU 0136806 2r](G)[Ssp].m(C)[Ssp],[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp],[fl2r](G)[Ssp].[fl2r](U)[ GUCUGUCUCU Ssp].[fl2r](C)[n001], [tl2r](U)[Ssp].[fl 2r](C)[Ssp].[fl2r](U)}$$$$V2.0ASO- RNAl {[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2rl(A)[n001].[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl UUAGGCAGGC 0136807 2r](G)[Ssp] m(G)[Ssp],[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fI2r](U)[Ssp] [fl2r](G)[ UGUCUGUCUC Ssp]. [fl2r] (U) [nOO 1 ]. [tl2r](C) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) } S$$$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[n001] [fl2r](C)[Ssp],[fl CUUAGGCAGG 0136808 2r](A)[Ssp].m(G)[Ssp].[fl2r](G)[Ssp] m(C)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp],[fl2r](U)[Ssp].[f]2r](C)[Ssp].[fl2r](U)[ CUGUCUGUCU Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)}$$S$V2.0ASO- RNAl {[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[f]2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001] [fl2r](G)[Ssp].[fl UCUUAGGCAG 0136809 2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].in(G)[Ssp].[fl2r](C)[Ssp].in(U)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[ GCUGUCUGUC Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl{[f!2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001] [fl2r](G)[Ssp].[fl UUCUUAGGCA 0136810 2r](G)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](G)[Ssp],m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[ GGCUGUCUGU Ssp].[fl2r](C)[n001].[fl2r|(U)[Ssp].[fl2r](G)[Ssp].[fl2r](Li)}$$S$V2.0ASO- RNA1 {[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ii001].[fl2r](A)[Ssp].[f] CUUCUUAGGC 0136811 2r](G)[Ssp] m(G)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2iJ(G)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[ AGGCU G U C U G Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)}$$$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[ii001].[fl2r](L!)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl UCUUCUUAGG 0136812 2r](A)[Ssp].m(G)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp],m(G)[Ssp].[fl2r](G)[SspJ.[fl2r](C)[Ssp].[fl2r](U)[ CAGGCUGUCUSsp]. [fl2 r] (G) [nOO 1 ]. [fl2r](U ) [ Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) } $$S$V2.069 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(U)[Ssp].|fl2r](U)|Ssp].[fl2r](C)|n00r|.[tl2r](U)|Ssp].[fl2r|(U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[tl UUCUUCUUAG 0136813 2r](U)[Ssp].m(A)[Ssp]Jfl2r](G)[Ssp].m(G)[Sspl.[fl2rl(C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[ GCAGGCUGUC Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](Cj}$$$$V2.0ASO- RNAl{[fl2r](U)|Ssp].[fl2r|(U)[Ssp|.|fl2r](U)|n001].[fl2r](C)[Ssp|.[fl2r](U)[Ssp].[fl2r|(U)[n001].|fl2r](C)[Ssp].[fl UUUCUUCUUA 0136814 2r](U)[Ssp].m(U)[Ssp].[fl2rl(A)[Ssp].m(G)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[ GGCAGGCUGU Ssp],[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[f]2rl(U)}$$$$V2,0ASO- RNAl{[fl2r|(A)[Ssp|.[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp|.[fl2r](U)[n001].[fl2r](U)[Ssp].[fl AUUUCUUCUU 0136815 2r](C)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp] m(G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[ AGGCAGGCUG Ssp].[f]2r](G)[ii001],[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)}$$S$V2.0ASO- RNA1 {[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl CAUUUCUUCU 0136816 2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Sspl.m(U)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ UAGGCAGGCU Ssp].[fl2r](G)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](U)}$$$$V2,0ASO- RNAl{[f]2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001] [fl2r](U)[Ssp].[fl2r](U)[Ssp] [fl2r](U)[n001].[fl2r](C)[Ssp].[fl UCAUUUCUUC 0136817 2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[f]2r](U)[Ssp].m(A)[Ssp],[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[ UUAGGCAGGC Ssp].[f]2r](A)[n001] [fl2r](G)[Ssp].[fl2r](G)[Ssp] [fl2r](C)}$$$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2rl(A)[Ssp].[fl2r](U)[Sspl.[fl2r](U)[n001].[fl2r](U)[Ssp].[fl UUCAUUUCUU 0136818 2r](C)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp],[fl2r](A)[Ssp].[fl2r](G)[Ssp] [fl2r](G)[ CUUAGGCAGG Ssp]. [fl2r] (C) [nOO 1 ]. [fl2r] (A) [Ssp]. [fl2r] (G) [Ssp]. [fl2r] (G) } $$$$ V2.0ASO- RNAl{[fl2r](A)[Ssp],[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001] [fl2r](U)[Ssp].[fl AUUCAUUUCU 0136819 2r](U)[Ssp].m(C)[Ssp],[fl2r](U)[Ssp].m(U)[Ssp].[f!2r](C)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[ UCUUAGGCAG Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](G)}$$S$V2.0ASO- RNA1 {[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001] [fl2r](U)[Ssp].[f] CAUUCAUUUC 0136820 2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].in(U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp],[fl2r](A)[ UUCUUAGGCA Ssp],[fl2r](G)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNAl{[f!2r](A)[Ssp],[fl2r](C)[Ssp].[fl2r](A)[n001],[fl2r](U)[Ssp].[fl2r](U)[Ssp] [fl2r](C)[n001 ] [fl2r](A)[Ssp] [fl ACAUUCAUUU 0136821 2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2i-](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ CUUCUUAGGC Ssp].[fl2r](A)|n001].[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](C)}$$S$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl CACAUUCAUU 0136822 2r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2rj(C)[Ssp].m(U)[Ssp].tfl2r](lT)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[ UCUUCUUAGG Ssp]. [fl2r] (U) [nOO 1 ]. [fI2r](A) [Ssp]. [fl2r ] (G) [ Ssp ]. [fl2r] (G) } $S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ii001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl UCACAUUCAU 0136823 2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](l))[Ssp],m(C)[Ssp].[tl2rj(Ll)[Sspj.[fl2r](U)[Sspj.[fl2r](C)[ UUCUUCUUAGSsp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](G)]$$$$V2.070 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(U)[Ssp].|fl2r](U)|Ssp].[fl2r](C)|n00r|.[tl2r](A)|Ssp].[fl2r|(C)|Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[tl UUCACAUUCA 0136824 2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ UUUCUUCUUA Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](Aj}$$$$V2.0ASO- RNAl{[fl2r](A)|Ssp].[fl2r|(U)[Ssp|.|fl2r](U)|n001].[fl2r](C)[Ssp|.[fl2r](A)[Ssp].[fl2r|(C)|n00r|.[fl2r](A)|Ssp].[fl AUUCACAUUC 0136825 2r](U)[Ssp].in(U)[Ssp].[fl2rl(C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[ AUUUCUUCUU Ssp]Jfl2r](U)[n001].[fl2r](C)[Ssp]Jfl2r](U)[Ssp].[fl2r](U)}$$S$V2.0ASO- RNAl{[fl2r](C)[Sspl.[fl2r](A)[Ssp].[fl2r](U)[ii00r|.[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](C)[Ssp].[fl CAUUCACAUU 0136826 2r](A)[Ssp].m(U)[Ssp].[f]2r](U)[Sspl.m(C)[Ssp].[fl2r](A)[Ssp] m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp] [fl2r](C)[ CAUUUCUUCU Ssp].[fl2r](U)[n001],[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](Uj}$$$$V2.0ASO- RNAl{[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl GCAUUCACAU 0136827 2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ UCAUUUCUUC Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n00l].[fl2r](A)[Sspl.[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl CGCAUUCACA 0136828 2r](A)[Ssp].m(C)[Ssp],[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp],[fl2r](U)[Ssp].[fl2r](U)[ UUCAUUUCUU Ssp]. [fl 2r] (U) [nOO 1 ] [fl 2r] (C ) [Ssp]. [fl 2r] (U) [Ssp], [f!2r] (U) } $$S$V2.0ASO- RNA1 {[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl CCGCAUUCAC 0136829 2r](C)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp],[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ AUUCAUUUCU Ssp]. [fl2r] (U) [nOO 1 ]. [f!2r] (U) [ Ssp]. [fl2r] (C) [Ssp]. [fl2r] (U) } $$$$ V2.0ASO- RNAl{[fl2r](G)[Ssp],[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001],[fl2r](U)[Ssp].[fl GCCGCAUUCA 0136830 2r](U)[Ssp].m(C)[Ssp],[fl2r](A)[Ssp].m(C)[Ssp],[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ CAUUCAUUUC Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2rJ(C)}$$S$V2.0ASO- RNA1 {[fl2r](A)[Ssp].[f]2r](G)[Ssp].[fl2r](C)[n001].[f]2r](C)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n00]].[f]2r](A)[Ssp].[fl AGCCGCAUUC 0136831 2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].in(A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2i](U)[Ssp],[fl2r](C)[ ACAUUCAUUU Ssp],[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](U)[SspJ.[fl2r](U)}$S$$V2.0ASO- RNAl{[f]2r](A)[Ssp].[fl2r](A)[Ssp].[f]2r](G)[n00l].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl AAGCCGCAUU 0136832 2r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ CACAUUCAUU Ssp].[fl2r](C)[n001].[fl2r|(A)[Ssp].[fl2r](U)[Ssp].[fl2r](Li)}$$S$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n00]].[fl2r](G)[Ssp].[fl CAAGCCGCAU 0136833 2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp] m(U)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ UCACAUUCAU Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)]$$$$V2'0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ii001].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl ACAAGCCGCA 0136834 2r](G)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](l))[Ssp],m(C)[Ssp].[fl2rj(A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ UUCACAUUCASsp]. [fl2 r] ( U) [nOO 1 ]. [f!2r ](U ) [ Ssp]. [fl2r] (C) [Ssp]. [fl2r] ( A) } $$S$V2.071 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RlMAl{[fl2r](C)[Sspl.[fl2r](A)[Ssp].[fl2rl(C)[n001].[fl2r](A)[Ssp|.|fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](C)|Ssp].[fl CACAAGCCGC 0136835 2r](C)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[S AUUCACAUUC sp]. [f!2r] (A)[n001 ] [fl 2r] (U) [S sp]. [fl 2r] ( U) [ S spl. [fl 2r] (C) } $$$$V2.0ASO- RNAl{[fl2r](C)[Ssp].|fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r|(G)[Ssp|.|fl CCACAAGCCG 0136836 2r](C)[Ssp].m(C)[Ssp].[fl2r](G)[Ssp],m(C)[Ssp].[fl2r](A)[Ssp],m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[S CAUUCACAUU sp].[fl2r](C)[n001],[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2rl(U)}$$$$V2.0ASO- RM A 1 { [fl2r | (G) [Ssp]. [fl2r] (C) [ Ssp ]. | fl2r] (C ) [ nOO 1 ]. [f!2r ] (A) [ S sp ]. [fl2r] (C)[ S sp ]. [fl2r| (A) [nOO 1 ]. [fl2r] (A) [ Ssp]. [11 GCCACAAGCC 0136837 2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[S GCAUUCACAU sp]. [f!2r] (A)[n001], [fl2r] (C) [S sp]. [fl2r] (A)[Ssp]. [fl2r] |(U) } $S$$V2.0ASO- RNA1 {[fl2r](U)[Ssp].[fl2r](G)[Ssp],[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp],[fl UGCCACAAGC 0136838 2r](A)[Ssp].m(G)[Ssp].[fl2r](C)[Sspl.m(C)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[f12r](U)[Ssp].[fl2r](U)[ CGCAUUCACA Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNAl{[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](C)[Ssp].[fl GUGCCACAAG 0136839 2r](A)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp],m(C)[Ssp].[fl2r](C)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp],[fl2r](A)[Ssp].[fl2r](U)[ CCGCAUUCAC Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl {[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl UGUGCCACAA 0136840 2r](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp],m(C)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[S GCCGCAUUCA spJ.[tl2r](U)[n001].[fl2r](U)[Ssp],[fl2r](C)[Ssp].[fl2rj(A)}$$$$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[ii001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl CUGUGCCACA 0136841 2r](A)[Ssp].m(C)[Ssp],[fl2r](A)[Ssp].m(A)[Ssp].[f! 2r](G)[Ssp],m(C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[S AGCCGCAUUC sp]. [f!2r] (A)[n001]. [fl2r| (U)[Ssp]. [f!2r] ( U) [S sp]. [fl2r] (C) } $$$$V2.0ASO- RNA1 {[fl2r](A)[Ssp].[f]2r](C)[Ssp].[fl2r](U)[n001].[f]2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001] [fl2r](C)[Ssp].[fl ACUGUGCCAC 0136842 2r](C)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)[S AAGCCGCAU U sp]. [fI2r] (C)[n001 ]. [f!2r] ( A) [S sp]. [fl2r] (U)[Ssp]. [fl2r] (U) } $$$$ V2.0ASO- RNAl{[f!2r](A)[Ssp],[fl2r](A)[Ssp].[fl2r](C)[n001],[fl2r](U)[Ssp].[f]2r](G)[Ssp].[fl2r](U)[n001] [fl2r](G)[Ssp].[fl AACUGUGCCA 0136843 2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp] [fl2r](C)[S CAAGCCGCAU sp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r|(U)}$S$$V2.0ASO- RNA1 {[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001],[fl2r](U)[Ssp].[f] CAACUGUGCC 0136844 2r](G)[Ssp] m(C)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[S ACAAGCCGCA sp|.[fl2r](C)[n001].[fl2r|(G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ii001].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl UCAACUGLGC 0136845 2r](U)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[ C AC AAGC CGCSsp]. [f!2 r] (C) [nOO 1 ]. [fl2r] (C) [Ssp]. [f!2r] (G)[ Ssp]. [fl2r] (C) } $$$$ V2.072 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(G)[Ssp].|fl2r](U)|Ssp].[fl2r](C)|n00r|.[tl2r](A)|Ssp].[fl2r|(A)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[tl GUCAACUGUG 0136846 2r](G)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[ CCACAAGCCG Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](G)}$$$$V2.0ASO- RNAl{|fl2r](U)i: Ssp].[fl2r|(G)[Ssp].[fl2r](U)|n001].[fl2r](C)[Ssp].|fl2r](A)[Ssp].[fl2r|(A)[n001].[fl2r](C)|Ssp].[fl UGUCAACUGU 0136847 2r](U)[Ssp] m(G)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ GCCACAAGCC Ssp],[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)}$$$$V2,0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl UUGUCAACUG 0136848 2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp] m(C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[S UGCCACAAGC sp]. [f!2r] (A)[n001]. [fl2r] (A)[Ssp]. [fl2r](G)[Ssp]. [fl2r] (C) } $$$$V2.0ASO- RNA1 {[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl CUUGUCAACU 0136849 2r](A)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ GUGCCACAAG Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](G)}$$$$V2,0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n00l].[fl2r](U)[Sspl.[fl2r](G)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl CCUUGUCAAC 0136850 2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[f]2r](G)[Ssp].m(U)[Ssp],[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[ UGUGCCACAA Ssp].[fl2r](A)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl UCCUUGUCAA 0136851 2r](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp],[fl2r](U)[Ssp].[fl2r](G)[Ssp] [fl2r](C)[ CUGUGCCACA Ssp]. [fl2r] (C) [nOO 1 ]. [fl2r] (A) [Ssp]. [fl2r] (C)[Ssp]. [fl2rj ( A) } S$$$V2.0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl AUCCUUGUCA 0136852 2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp],[fl2r](U)[Ssp].[fl2r](G)[ ACUGUGCCAC Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp],[fl2r](U)[n001].[fl2r](U)[Ssp],[fl CAUCCUUGUC 0136853 2r](G)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].in(A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2i](G)[Ssp],[fl2r](U)[ AACUGUGCCA Ssp],[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNAl{[f!2r](U)[Ssp],[fl2r](C)[Ssp].[fl2r](A)[n001],[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[n001],[fl2r](U)[Ssp].[fl UCAUCCUUGU 0136854 2r](U)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2i-](C)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[ CAACUGUGCC Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](C)}S$$$V2.0ASO- RNAl{[fl2r](A)[Ssp].[f]2r](U)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[ii001].[fl2r](C)[Ssp].[fl AUCAUCCUUG 0136855 2r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(U)[Ssp].[fl2rj(C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[ UCAACUGUGC Ssp]. [fl2r] (G) [nOO 1 ]. [fI2r](U) [Ssp]. [fl2r ] (G) [ Ssp ]. [fl2r] (C) } $$$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl UAUCAUCCUU 0136856 2r](C)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](l))[Ssp],m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[ GUCAACUGUGSsp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](G)}$$$$V2.073 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](U)|Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl UUAUCAUCCU 0136857 2r](C)[Sspl.m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(U)[Ssp].[fl2rl(C)[Ssp].[fl2rl(A)[Ssp].[fl2r](A)[ UGUCAACUGU Ssp].[fl2r](C)[n001].[fl2r](uj[Ssp].[fl2rj(G)[Ssp].[fl2r](U)}$$$$V2.0ASO- RNAl{[fl2r](U)|Ssp].[fl2r|(U)[Ssp|.|fl2r](U)|n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl UUUAUCAUCC 0136858 2r](U)[Ssp].m(C)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ UUGUCAACUG Ssp],[fl2r](A)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[f]2r](G)}$$$$V2,0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ii00r|.[fl2r](C)[Ssp].[fl AUUUAUCAUC 0136859 2r](A)[Ssp].m(U)[Ssp].[f]2r](C)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[ CUUGUCAACU Ssp]. [fl 2r] (A)

[31001] . [f!2r]( A) [Ssp]. [fl2r] (C) [Ssp], [fl2r] (U) } $$S$V2.0ASO- RN A 1 { [fl2r] (G) [Ssp]. [fl2r] ( A) [Ssp]. [fl2r] (U) [nOO 1 ]. [fl2r](U) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (A) [nOO 1 ]. [fl2r] (U) [Ssp]. [f GAUUUAUCAU 0136860 12r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(C)[Sspl.[fl2r](C)[Ssp].m(U)[Ssp].[f12r](U)[Sspl.[fl2r](G)[Ssp].[fl2r](U)[ CCUUGUCAAC Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](C)]$$$$V2.0ASO- RNAl{[f]2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001] [fl2r](A)[Ssp].[f UGAUUUAUCA 0136861 12r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp],m(U)[Ssp],[fl2r](C)[Ssp].in(C)[Ssp],[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[ UCCUUGUCAA Ssp].[fl2r](U)[n001] [fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNA1 {[fl2r](U)[Ssp].[fl2rl(U)[Ssp].[fl2r](G)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[f UUGAUUUAUC 0136862 12r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp] m(C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ AUCCUUGUCA Ssp]. [fl2r] (G) [nOO 1 ]. [tl2r](U) [Ssp]. [fl2rj (C) [Ssp]. [fl2r] (A) } $$$$ V2.0ASO- RNA 1 { [fl 2r] (A) [Ssp]. [f!2r] (U) [Ssp]. [fl 2r] (U) [nOO 1 ]. [fl2r](G) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (U) [nOO 1 ], [fl2r] (U) [Ssp]. [f AUUGAUUUAU 0136863 ]2r](U)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp],[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[ CAUCCUUGUC Ssp]. [fl2r] ( U) [nOO 1 ]. [fl2r](G) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] (C) } $$S$V2.0ASO- RNA1 {[fl2r](U)[Ssp].[fl2r](A)[Ssp],[fl2r](U)[n001],[fl2r](U)[Ssp].[fI2r](G)[Ssp] [fl2r](A)[n001].[fl2r](U)[Ssp].[f UAUUGAUUUA 0136864 12r](U)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](C)[ UCAUCCUUGU Ssp],[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2rj(G)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[f]2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp],[fl2r](U)[Ssp].[fl2r](G)[n001] [fl2i](A) [Ssp], [f UUAUUGAUUU 0136865 12r](U)[Ssp].m(lT)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[ AUCAUCCUUG Ssp].[fl2r](C)[n001].[fl2r|(U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)}$$S$V2.0ASO- RNA1 {[fl2r](A)[Ssp].[f]2r](U)[Ssp].[fl2r](U)[n00J].[fl2r](A)[Ssp].[fl2r](U)[Ssp] [G2r](U)[n001 ]. [fl 2r](G)[Ssp]. [f AUUAUUGAUU 0136866 12r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp] m(U)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ UAUCAUCCUU Ssp].[fl2r](C)[n001].[112r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](L])}$$$$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ii001].[fl2r](L!)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl CAUUAUUGAU 0136867 2r](G)[Ssp].m(A)[Ssp].[fl2r](ll)[Ssp].in(ll)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[SspJ.[fl2r](A)[ UUAUCAUCCUSsp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](C)[Ssp].[fl2r](U)}$$$$V2.074 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNA1 {[fl2r|(G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n00r|.[fl2r](U)|Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](L])[Ssp].[fl GCAUUAUUGA 0136868 2r](U)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2rl(U)[Ssp].m(U)[Sspl.[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[ UUUAUCAUCC Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2rl(C)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl{|fl2r](U)|Ssp].[fl2r|(G)[Sspl.[fl2r](C)[n001].[fl2r](A)[Ssp|.|fl2r](U)[Ssp].[fl2r|(Li)[n001].ifl2r](A)|Ssp].[fl UGCAUUAUUG 0136869 2r](U)[Ssp].m(U)[Ssp].[fl2rl(G)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ AUUUAUCAUC Ssp],[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[f]2rl(C)}$$$$V2,0ASO- RNAl{[fl2r|(Li)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)|Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](L])[Ssp].[fl UUGCAUUAUU 0136870 2r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2rl(A)[Ssp].m(U)[Sspl.[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[ GAUUUAUCAU Ssp]. [fl 2r] (U)

[31001] . [fl2r](C) [Ssp]. [fl2r] (A) [Ssp], [fl2r] (U) } $$S$V2.0ASO- RNA1 {[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl CUUGCAUUAU 0136871 2r](U)[Ssp].m(A)[Ssp].[fl2rl(U)[Ssp].m(U)[Sspl.[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ UGAUUUAUCA Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$$$$V2,0ASO- RNAl{[f]2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001] [fl2r](U)[Ssp].[fl2r](G)[Ssp] [fl2r](C)[n001].[fl2r](A)[Ssp].[fl GCUUGCAUUA 0136872 2r](U)[Ssp].m(U)[Ssp].[f]2r](A)[Ssp],m(U)[Ssp],[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ UUGAUUUAUC Ssp].[fl2rKU)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2rj(C)}$$$$V2.0ASO- RNA1 {[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl AGCUUGCAUU 0136873 2r](A)[Ssp].m(U)[Ssp],[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp] m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ AUUGAUUUAU Ssp].[fl2r](U)[n001].[tl2r](U)[Ssp].[fl2r](A)[Ssp].[tl2r](U)}$S$$V2.0ASO- RNAl{[fl2r](A)[Ssp],[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001] [fl2r](G)[Ssp].[fl AAGCUUGCAU 0136874 2r](C)[Ssp].m(A)[Ssp],[fl2r](U)[Ssp].m(U)[Ssp].[f! 2r](A)[Ssp].m(U)[Ssp],[fl2r](U)[Ssp].[fl2r](G)[Ssp],[fl2r](A)[ UAUUGAUUUA Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2rJ(A)}$$$$V2.0ASO- RN A 1 { [fl2i] (U) [Ssp]. [fl 2 r] (A) [Ssp], [f!2r] ( A) [nOO 1 ], [fl2r](G) [Ssp]. [fl 2r] (C) [Ssp]. [fl 2r] (U) [nOO 1 ] [fl 2 r] (U) [Ssp]. [fl UAAGCUUGCA 0136875 2r](G)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].in(U)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](l))[Ssp],[fl2r](U)[Ssp].[fl2r](G)[ UUAUUGAUUU Ssp],[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[f!2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp],[fl2r](G)[Ssp].[fl2r](C)[n001] [fl2r](U)[Ssp].[fl GUAAGCUUGC 0136876 2r](U)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](lT)[Ssp].m(U)[Ssp].[fl2i-](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ AUUAUUGAUU Ssp].[fl2r](G)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](LT)}$S$$V2.0ASO- RNAl {[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp] [fl2r](G)[n001].[fl2r](C)[Ssp].[fl AGUAAGCUUG 0136877 2r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(Li)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ CAUUAUUGAU Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNA 1 { [f!2r] (LT) [Ssp]. [f!2r] (A) [Ssp]. [i!2r] (G) [nOO 1 ]. [fl2r j(U) [Ssp]. [fl2r] (A) [Ssp]. [f!2 r] (A) [nOO 1 ]. [fl2r] (G) [Ssp]. [f UAGUAAGCUU 0136878 12r](C)[Ssp].m(U)[Ssp].[fl2r](U)[SspJ.m(G)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](lJ)[Ssp].[fl2r](A)[ GCAUUAUUGASsp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](A)}$$$$V2.075 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](G)|Ssp].[fl2r](LT)[Ssp].[fl2r](A)[n00r|.[fI2r](A)[Ssp].[f AUAGUAAGCU 0136879 12r](G)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ UGCAUUAUUG Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)}$S$$V2.0ASO- RNAl{[fl2r](G)|Ssp].[fl2r|(A)[Ssp|.|fl2r](U)|n001].[fl2r](A)[Ssp].|fl2r|(G)|Ssp|.[fl2r](LT)[n001].[fl2r|(A)[Ssp|.|f GAUAGUAAGC 0136880 12r](A)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp],[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ UUGCAUUAUU Ssp],[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2rl(U)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[fl2r|(U)[Ssp|.[fl2r](G)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[ri00r|.[fl2r](U)[Ssp].[f UGAUAGUAAG 0136881 12r](A)[Ssp] m(A)[Ssp] [fl2r](G)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp] [fl2r](C)[Ssp].[fl2r](A)[ CUUGCAUUAU Ssp].[fl2r](U)[n001],[fl2r](U)[Ssp].[fl2r](A)[Ssp] [fl2r](U)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl UUCAGUAUUG 0136882 2r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[ CUAUUCAUAA Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[f]2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl CUUCAGUAUU 0136883 2r](A)[Ssp].m(U)[Ssp].[f]2r](U)[Ssp],m(G)[Ssp],[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ GCUAUUCAUA Ssp]. [fl 2r](C) i n 001 ], [t!2r] (A) [Ssp]. [fl 2r] (U) [Ssp], [f!2r] ( A) } $$S$V2.0ASO- RNA1 {[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl UCUUCAGUAU 0136884 2r](U)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].ni(C)[Ssp].[f]2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ UGCUAUUCAU Ssp]. [fl2r] (U) [nOO 1 ]. [f!2r] (C) [Ssp]. [fl2r] (A) [Ssp j. [fl2r] (U) } $$$$ V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl UUCUUCAGUA 0136885 2r](G)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp] m(U)[Ssp],[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].[f]2r](U)[Ssp],[fl2r](A)[ UUGCUAUUCA Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$$S$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](U)[Ssp],[fl2r](U)[n001],[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001] [fl2r](C)[Ssp].[fl UUUCUUCAGU 0136886 2r](A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[ AUUGCUAUUC Ssp],[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2rj(U)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl{[f!2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp],[fl2r](C)[Ssp],[fl2r](U)[n001] [fl2r](U)[Ssp].[fl AUUUCUUCAG 0136887 2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(L;)[Ssp].[fl2r](A)[Ssp],m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[ UAUUGCUAUU Ssp].[fl2r](U)[n001].[tl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)}$$$$V2.0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp] [fl2r](C)[n001] [fl2r](U)[Ssp].[fl AAUUUCUUCA 0136888 2r](U)[Ssp] m(C)[Ssp].[fl2r](A)[Ssp] m(G)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](LT)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[ GUAUUGCUAU Ssp].[fl2r](C)|n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)}$$$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl UAAUUUCUUC 0136889 2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp],m(Ll)[Ssp].[fl2r](A)[SspJ.[fl2r](L))[Ssp].[fl2r](Li)[ AGUAUUGCUASsp]. [ ±12 r] (G) [nOO 1 ]. [f!2r ](C) [Ssp]. [ ±12r] ( U) [Ssp]. [fl2r] (A) } $$S$V2.076 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(Li)[Ssp|.[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](A)|Ssp].[fl2r](LT)[Ssp].[fl2r](U)[n00r|.[fl2r](U)[Ssp].[f UUAAUUUCUU 0136890 12r](C)[Ssp].m(U)[Ssp].[fl2rl(U)[Ssp].m(C)[Ssp].[fl2rl(A)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Sspl.[fl2r](U)[ CAGUAUUGCU Ssp].[fl2r](U)[n00i].[fl2r](G)[Ssp].[fl2r](C)[Ssp] [fl2r](U)]$$$$V2.0ASO- RNAl{|fl2r](U)i: Ssp].[fl2r|(L9[Ssp].|fl2r](U)|n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](LT)[n001].[fl2r|(U)[Ssp].|:f UUUAAUUUCU 0136891 12r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[ UCAGUAUUGC Ssp],[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)}$$S$V2.0ASO- RNAl{[fl2r](U)[Ssp|.|fl2r](U)|Ssp].[fl2r](U)[n001].[fl2r](U)|Ssp].[fl2r](A)[Ssp].[fl2rl(A)[ii00r|.|fl2r](U)|Ssp].[f UUUUAAUUUC 0136892 12r](U)[Ssp] m(U)[Sspl [fl2r](C)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Sspl [fl2r](G)[Ssp].[fl2r](U)[ UUCAGUAUUG Ssp].[f]2r](A)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp] [fl2r](G)}$$$$V2.0ASO- RNAl {[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[f GUUUUAAUUU 0136893 12r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[ CUUCAGUAUU Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001] [fl2r](A)[Ssp].[f UGUUUUAAUU 0136894 12r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ UCUUCAGUAU Ssp].[fl2r](G)[n001] [f!2r](U)[Ssp]. [fl2r](A)[Ssp] [fl2r](U)}$S$$V2,0ASO- RN A 1 { [f!2r] (U) [Ssp]. [fl2r] (U) [Ssp]. [f!2r] (G) [nOO 1 ]. [fl2r](U) [Ssp]. [f!2r] (U) [Ssp]. [fl2r] (U) [nOO 1 ]. [fl2r] (U) [Ssp]. [f UUGUUUUAAU 0136895 12r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp] [fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp],[fl2r](C)[ UUCUUCAGUA Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001],[fl2r](U)[Ssp].[f UUUGUUUUAA 0136896 ]2r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp],m(U)[Ssp] [fl2r](C)[Ssp],[fl2r](U)[Ssp].[fl2r](U)[ UUUCUUCAGU Ssp].[fl2r](C)[n001J.[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](U)}$$S$V2.0ASO- RNAl {[fl2r](U)[Ssp].[fl2r](U)[Ssp],[fl2r](U)[n001],[fl2r](U)[Ssp].[fl2r](G)[Ssp] [fl2r](U)[n001].[fl2r](U)[Ssp].[f UUUUGUUUUA 0136897 12r](U)[Ssp].m(L!)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[ AUUUCLTUCAG Ssp],[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](G)}$$$$V2.0ASO- RNAl{[f!2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001],[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001] [fl2r](U)[Ssp].[fl CUUUUGUUUU 0136898 2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2rJ(U)[SspJ.[fl2r](U)[Ssp].[fl2r](C)[ AAUUUCUUCA Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$$S$V2.0ASO- RNAl {[fl2r](U)[Ssp].[f]2r](C)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001] [fl2r](G)[Ssp].[fl UCUUUUGUUU 0136899 2r](U)[Ssp] m(U)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ UAAUUUCUUC Ssp].[fl2r](C)|n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNA 1 { [fl2r] (A) [Ssp]. [fl2r] (U) [Ssp]. [i!2r] (C) [nOO 1 ]. [fl2r](U) [Ssp]. [fl2r] (IT) [Ssp]. [fl2r] (U) [nOO 1 ]. [fl2r] (U) [Ssp]. [fl AUCUUUUGUU 0136900 2r](G)[Ssp].m(U)[Ssp].[fl2r](ll)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](ll)[ UUAAUUUCUUSsp]. [ ±12 r] ( U) [nOO 1 ]. [fl2r] (C) [Ssp]. [ ±12r] ( U) [Ssp]. [fl2r] (U) } $$S$V2.077 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNA1 {[fl2r|(A)[Ssp|.|fl2r](A)|Ssp].[fl2r](U)[n001].[fl2rl(C)|Ssp].[fl2r|(U)[Ssp|.[fl2r](U)|n001].[fl2r](U)[Ssp].|fl AAUCUUUUGU 0136901 2r](U)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2rl(U)[Ssp].m(U)[Sspl.[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ UUUAAUUUCU Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)}$$$$V2.0ASO- RNAl{[fl2r](C)[Ssp]Jfl2i|(A)|Ssp|.[fl2r](A)[n001].[fl2r](U)[Ssp|.[fl2r](C)[Ssp].|fl2r](U)|n00r|.[fl2r](LT)|Ssp].[fl CAAUCUULUG 0136902 2r](U)[Ssp].m(U)[Ssp].[fl2rl(G)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[ UUUUAAUUUC Ssp] Jfl2rl(U)[n001].[fl2r](U)[Ssp].[fl2r](U)rSsp].rfl2r](C)}$$$$V2.0ASO- RNAl{[fl2r|(G)[Ssp|.|fl2r](C)[Ssp].|fl2r](A)[n00r|.^ GCAAUCUUUU 0136903 2r](U)[Ssp].m(U)[Ssp].[f12r](U)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[ GUUUUAAUUU Ssp].[f]2r](A)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp] [fl2r](U)}$$$$V2.0ASO- RNA1 {[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl AGCAAUCUUU 0136904 2r](U)[Ssp].m(U)[Ssp].[fl2rl(U)[Ssp].m(U)[Sspl.[fl2r](G)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ UGUUUUAAUU Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](C)[Sspl.[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl CAGCAAUCUU 0136905 2r](C)[Ssp],m(U)[Ssp],[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].tn(G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ UUGUUUUAAU Ssp].[f]2r](U)[n001] [fl2r](A)[Ssp].[fl2r](A)[Ssp] [fl2r](U)}$S$$V2,0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2rl(G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl ACAGCAAUCU 0136906 2r](U)[Ssp] m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp] [fl2r](U)[Ssp].[fl2r](U)[ UUUGUUUUAA Ssp].[fl2r](U)[n001].[tl2r](U)[Ssp].[fl2r](A)[SspJ.[tl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](G)[Ssp],[fl2r](A)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp],[fl GACAGCAAUC 0136907 2r](A)[Ssp].m(U)[Ssp].[f]2r](C)[Ssp].m(U)[Ssp].[f]2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[ UUUUGUUUUA Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2rJ(A)}$$$$V2.0ASO- RNA1 {[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n00J],[fl2r](C)[Ssp],[fl2r](A)[Ssp].[fl2r](G)[n001] [fl2r](C)[Ssp].[fl AGACAGCAAU 0136908 2r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](lI)[Ssp].[fl2r](Li)[Ssp].[fl2r](G)[ CUUUUGUUUU Ssp],[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[SspJ.[fl2r](U)}$S$$V2.0ASO- RNAl{[f!2r](G)[Ssp],[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[n001] [fl2r](G)[Ssp].[fl GAGACAGCAA 0136909 2r](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(L;)[Ssp].[fl2r](C)[Ssp].m(IJ)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ UCUUUUGULU Ssp].[fl2r](G)|n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](LT)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[f]2r](G)[Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp] [fl2r](C)[n001] [fl2r](A)[Ssp].[fl UGAGACAGCA 0136910 2r](G)[Ssp] m(C)[Ssp].[fl2r](A)[Ssp] m(A)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](D)[ AUCUUUUGUU Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2rJ(A)[Ssp].[fl2r](G)[Ssp].[fl2rJ(A)[n001].[fl2r](C)[Ssp].[fl UUGAGACAGC 0136911 2r](A)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp],m(Ll)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[SspJ. Lfl2r](U)[ AAUCUUUUGUSsp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](U)}$$$$V2.078 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(A)[Ssp|.[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n00r|.[fl2r](A)[Ssp].[f AUUGAGACAG 0136912 12r](C)[Ssp].m(A)[Ssp].[fl2rl(G)[Ssp].m(C)[Ssp].[fl2rl(A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[ CAAUCUUUUG Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2rl(U)[Ssp].[fl2r](G)}$S$$V2.0ASO- RNAl{|fl2r](U)i: Ssp].[fl2r|(A)[Ssp].[fl2r](U)|n001].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001].[fl2r|(G)[Ssp].|f UAUUGAGACA 0136913 12r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[ GCAAUCUUUU Ssp],[tl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[ri00r|.[fl2r](A)[Ssp].[f AUAUUGAGAC 0136914 12r](G)[Ssp] m(A)[Sspl [fl2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ AGCAAUCUUU Ssp]. [fl 2r] (C) [nOO 1 ]. [fl2 r] (U) [Ssp]. [fl2r] (U) [Ssp], [fl2r] (U) } $$S$V2.0ASO- RN A 1 { [fl2r] (U) [Ssp]. [fl2r] ( A) [Ssp]. [fl2r] (U) [nOO 1 ]. [fl2r](A) [Ssp]. [f!2r] (U) [Ssp]. [fl2r] (U) [nOO 1 ]. [fl2r] (G) [Ssp]. [f UAUAUUGAGA 0136915 12r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp],m(G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[ CAGCAAUCUU Ssp], [f!2r] (U) [n 001 ]. [fl2r](C) [Ssp], [f!2r] (U) [Ssp]. [fl 2r] (U) } $$$$V2, 0ASO- RNA 1 { [fl 2r] (A) [Ssp]. [fl2r] (U) [Ssp]. [fl2r] ( A) [nOO 1 ]. [fl2r](U) [Ssp]. [fl2r] (A) [Ssp]. [fl 2r] (U) [nOO 1 ] [fl2r] (U) [Ssp]. [f AUAUAUUGAG 0136916 12r](G)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ ACAGCAAUCU Ssp]. [fl 2r] (A) [nOO 1 ] [fl2r](U) [Ssp]. [t!2r] (C) [Ssp], [f!2r] (U) } $$S$V2.0ASO- RNAl {[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2rl(U)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n0011.[fl2r](U)[Ssp].[f GAUAUAUUGA 0136917 12r](U)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp] [fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[Ssp],[fl2r](C)[ GACAGCAAUC Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2rJ(U)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001],[fl2r](A)[Ssp].[f AGAUAUAUUG 0136918 12r](U)[Ssp],m(U)[Ssp].[fl2r](G)[Ssp].ni(A)[Ssp].[fl2r](G)[Ssp].in(A)[Ssp].[fl2r](C)[Ssp],[fl2r](A)[Ssp].[fl2r](G)[ AGACAGCAAU Ssp].[fl2r](C)[n001J.[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)}$$S$V2.0ASO- RNAl {[fl2r](A)[Ssp].[fl2r](A)[Ssp],[fl2r](G)[n001],[fl2r](A)[Ssp].[fl2r](U)[Ssp] [fl2r](A)[n001].[fl2r](U)[Ssp].[f AAGAUAUAUU 0136919 12r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)[ GAGACAGCAA Ssp],[fl2r](G)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNAl{[f!2r](U)[Ssp],[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001],[fl2r](A)[Ssp].[f UAAGAUAUAU 0136920 12r](U)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2i](C)[ UGAGACAGCA Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$$S$V2.0ASO- RNAl {[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](G)[Ssp] [fl2r](A)[n001].[fl2r](U)[Ssp].[f AUAAGAUAUA 0136.921 12r](A)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2rJ(A)[SspJ.[fl2r](G)[SspJ.[fl2r](A)[ UUGAGACAGC Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](C)}$$$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](A)[Ssp].[f UAUAAGAUAU 0136922 12r](L))[SspJ.m(A)[Ssp],[fl2r](U)[Ssp].m(A)[SspJ.[fl2r](ll)[Sspj.m(U)[Ssp].[fl2r](G)[Ssp].[fl2rj(A)[Ssp].[fl2r](G)[ AUUGAGACAGSsp].[fl2r](A)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](G)}$$$$V2.079 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RN A 1 { [fl2r |(A) [Ssp]. |f!2r] (U ) [Ssp]. [fl2r| (A) [nOO 1 ]. |fl2r](U) | Ssp ]. [ fl2r] (A) [ Ssp ]. | fl2r] ( A) | nOO 1 ]. |112r] (G) [Ssp]. [f AUAUAAGAUA 0136923 12r](A)[Ssp].m(U)[Ssp].[fl2r](A)[SsP].m(U)[Ssp].[fl2r](A)[Ssp].m(U)[Sspl.[fl2r](U)[SsP].[fl2r](G)[Sspl.[fl2r](A)[ UAUUGAGACA Ssp].[fl2r](G)[n00i].[fl2r](A)[Ssp].[fl2r](C)[Ssp] [fl2r](A)]$$$$V2.0ASO- RNAl{|fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r|(A)[Ssp|.[f AAUAUAAGAU 0136924 12r](G)[SsP].m(A)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](U)[SsP].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[SsP].[fl2r](G)[ AUAUUGAGAC Ssp],[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](C)}$$S$V2.0ASO- RM A 1 { [fl2r| (A) [Ssp ]. [fl2r] (A) [Ssp]. [H2r] (A) [nOO 1 ]. |fl2r](U) | Ssp]. [fl2r] (A) [ Ssp ]. |fl2r] (U) | nOO 1 ]. [fl2r](A)|Ssp].[f AAAUAUAAGA 0136925 12r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ UAUAUUGAGA Ssp].[fl2r](G)[n001],[fl2r](A)[Ssp].[fl2r](G)[Ssp] [fl2r](A)}$S$$V2.0ASO- RNAl {[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[f UAAAUAUAAG 0136926 12r](A)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2ri(U)[Ssp].[fl2r](A)[Ssp].[f12r](U)[ AUAUAUUGAG Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](G)}$S$$V2.0ASO- RNAl{[f]2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001] [fl2r](A) [Ssp]. [f AUAAAUAUAA 0136927 12r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp],m(U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp],[fl2r](A)[ GAUAUAUUGA Ssp].[f]2r](U)[n001] [fl2r](U)[Ssp].[fl2r](G)[Ssp] [fl2r](A)}$S$$V2,0ASO- RN A 1 { [fl2r] (A) [Ssp]. [fl2r] ( A) [Ssp]. [f!2r] (U) [nOO 1 ]. [fl2r](A) [Ssp]. [fl2r] ( A) [Ssp]. [fl2r] (A) [nOO 1 ]. [fl2r] (U) [Ssp]. [f AAUAAAUAUA 0136928 12r](A)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp] [fl2r](G)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ AGAUAUAUUG Ssp].[fl2r](A)[n001].[tl2r](U)[Ssp].[fl2r](U)[Ssp].[tl2r](G)[$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001],[fl2r](A)[Ssp].[f UAAUAAAUAU 0136929 ]2r](U)[Ssp],m(A)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp] [fl2r](A)[Ssp].[fl2r](U)[Ssp],[fl2r](A)[ AAGAUAUAUU Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)}$$$$V2.0ASO- RNAl {[fl2r](A)[Ssp].[fl2r](U)[Ssp],[fl2r](A)[n001],[fl2r](A)[Ssp].[fl2r](U)[Ssp] [fl2r](A)[n001].[fl2r](A)[Ssp].[f AUAAUAAAUA 0136930 12r](A)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ UAAGAUAUAU Ssp],[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[f]2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp],[fl2r](A)[Ssp].[fl2r](U)[n001],[fl2r](A)[Ssp].[f AAUAAUAAAU 0136931 12r](A)[SsP].m(A)[Ssp].[fl2r](U)[SsP].m(A)[Ssp].[fl2r](U)[SsP].m(A)[Ssp].[fl2r](A)[SsP].[fl2r](G)[SsP].[fl2r](A)[ ALTAAGAUAUA Ssp].[fl2r](U)[n001].[tl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl {[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp] [fl2r](A)[n001].[fl2r](U)[Ssp].[f AAAUAAUAAA 0136932 12r](A)[Ssp].m(A)[Ssp].[fl2r](A)[SsP].m(U)[SsP].[fl2r](A)[SsP].m(U)[Ssp].[fl2rJ(A)[SsPJ.[fl2r](A)[SsPJ.[fl2r](G)[ UAUAAGAUAD Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNA 1 { [fl2r] (LT) [Ssp]. [fl2r] (A) [Ssp]. [i!2r] (A) [nOO 1 ]. [fl2r](A) [Ssp]. [fl2r] (U) [Ssp]. [fL2 rj (A) [nOO 1 ]. [fl2r] (A) [Ssp]. [f UAAAUAAUAA 0136933 12r](L))[SspJ.m(A)[Ssp],[fl2r](A)[Ssp].m(A)[SspJ.[fl2r](ll)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[ AUAUAAGAUASsp].[fl2r](G)[n001].[fl2r](A)[SsP].[fl2r](U)[Ssp].[fl2r](A)}$$$$V2.0380 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(G)[Ssp].|fl2r](G)|Ssp].[fl2r](U)[n001].[fl2rl(A)|Ssp].[fl2r](A)[Ssp].[fl2r](A)[n00r|.|lI2r](U)|Ssp].[f GGUAAAUAAU 0136934 12r](A)[Ssp].m(A)[Ssp].[fl2r](U)[SsP].m(A)[Ssp].[fl2r](A)[Ssp].m(A)[Sspl.[fl2r](U)[SsP].[fl2r](A)[Sspl.[fl2r](U)[ AAAUAUAAGA SsP].[fl2r](A)[n00i].[fl2r](A)[Ssp].[fl2rl(G)[Ssp].ifl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](U)|Ssp].[fl2r|(G)[Ssp|.|fl2r](G)|n001].[fl2r](U)[Ssp].|fl2r|(A)|Ssp|.[fl2r](A)[n001].[fl2r|(A)[Ssp|.|f UGGUAAAUAA 0136935 12r](U)[SsP].m(A)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](A)[SsP].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[ UAAAUAUAAG Ssp] Jfl2rl(U)[n001].[fl2r](A)[Ssp].[fl2r](A)rSsp].rfl2r](G)}$S$$V2.0ASO- RNAl{[fl2r|(U)[Ssp|.|fl2r](U)|Ssp].[fl2r](G)[n001].[fl2r](G)|Ssp].[fl2r](LT)[Ssp].[fl2rl(A)[ii00r|.|112r](A)|Ssp].[f UUGGUAAAUA 0136936 12r](A)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[SsP].[fl2r](U)[ AUAAAUAUAA Ssp].[f]2r](A)[n001],[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp].[fl2r](U)[Sspl.[fl2r](U)[n001].[fl2r](G)[Sspl.[fl2r](G)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[f UUUGGUAAAU 0136937 12r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Sspl.m(A)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2ri(A)[Ssp].[fl2r](A)[Ssp].[f12r](A)[ AAUAAAUAUA Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[f]2r](A)[Sspl.[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2rl(G)[Ssp].[fl2r](G)[n001] [fl2r](U)[Ssp].[f AUUUGGUAAA 0136938 12r](A)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp],m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp],[fl2r](A)[ UAAUAAAUAU Ssp].[f]2r](A)[n001] [fl2r](U)[Ssp].[fl2r](A)[Ssp] [fl2r](U)}$S$$V2,0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](A)[Sspl.[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2rl(G)[Ssp].[f AAUUUGGUAA 0136939 12r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp] [fl2r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[ AUAAUAAAUA Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2rJ(U)[SspJ.[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp],[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp],[fl2r](U)[Ssp].[fl2r](U)[n001],[fl2r](G)[Ssp].[f UAAUUUGGUA 0136940 ]2r](G)[Ssp],m(U)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp] [fl2r](A)[Ssp].[fl2r](A)[Ssp],[fl2r](U)[ AAUAAUAAAU Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2rJ(U)}$$$$V2.0ASO- RNA1 {[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n00J],[fl2r](A)[Ssp].[fI2r](U)[Ssp] [fl2r](U)[n001].[fl2r](U)[Ssp].[f AUAAUUUGGU 0136941 12r](G)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Sspj.[fl2r](A)[Ssp].[fl2r](A)[ AAAUAAUAAA Ssp],[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](A)[SspJ.[fl2r](A)}$S$$V2.0ASO- RNAl{[f]2r](A)[Ssp].[fl2r](A)[Ssp].[f]2r](U)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[n001],[fl2r](U)[Ssp].[f AAUAAUUUGG 0136942 12r](LT)[Ssp].m(G)[Ssp].[fl2r](G)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(A)[SspJ.[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[ UAAAUAAUAA SsP].[fl2r](A)|n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNA1 {[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp] [G2r](A)[n001 ]. [fl 2r](U)[Ssp]. [f GAAUAAUUUG 0136943 12r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].m(A)[Ssp].[fl2rJ(A)[SspJ.[fl2r](A)[Ssp].[fl2r](U)[ GUAAAUAAUA Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001].[fl2rJ(A)[Ssp].[fl2r](U)[Ssp].[fl2rJ(A)[n001].[fl2r](A)[Ssp].[f AGAAUAAUUD 0136944 12r](U)[Ssp].m(Ll)[Sspj,[fl2r](U)[Sspj.m(G)[Ssp].[fl2rj(G)[Sspj,m(U)[Sspj.[fl2rj(A)[Ssp].[fl2rj(A)[Sspj.[fl2rj(A)[ GGUAAAUAAUSsp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)}$$$$V2.081 of 46113113958V]Attorney Docket No,: 2010581-1550ASO- RNAl{[fl2r|(U)[Ssp|.[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](A)|Ssp].[fl2r](A)[Ssp].[fl2r](U)[n00r|.[fl2r](A)[Ssp].[f UAGAAUAAUU 0136945 12r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](G)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[ UGGUAAAUAA Ssp].[fl2r](A)[n00i].[fl2r](U)[Ssp].[fl2rl(A)[Ssp].ifl2r](A)}$S$$V2.0ASO- RNAl{|fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r|(U)[Ssp|.[f UUAGAAUAAU 0136946 12r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[ UUGGUAAAUA Ssp],[tl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](C)[Sspl.[fl2r](U)[Ssp].[fl2r](U)[ii001].[fl2r](A)|Ssp].[fl2r](G)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl CUUAGAAUAA 0136947 2r](U)[Ssp].m(A)[Ssp].[f12r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].m(U)[Sspl.[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2r](U)[ UUUGGUAAAU Ssp].[fl2r](A)[n001],[fl2r](A)[Ssp].[fl2r](A)[Ssp] [fl2r](U)]$S$$V2.0ASO- RNAl {[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](A)[Ssp].[fl UCUUAGAAUA 0136948 2r](A)[Ssp].m(U)[Ssp].[fl2rl(A)[Ssp].m(A)[Sspl.[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](G)[ AUUUGGUAAA Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fI2r](A)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[n00l].[fl2r](U)[Sspl [fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](G)[Ssp].[fl CUCUUAGAAU 0136949 2r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp],m(A)[Ssp],[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[ AAUUUGGUAA Ssp].[fl2r](G)[n001] [fl2r](U)[Ssp].[fl2r](A)[Ssp] [fl2r](A)}$S$$V2,0ASO- RNA1 {[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](C)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl ACUCUUAGAA 0136950 2r](G)[Ssp].m(A)[Ssp],[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp] m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ UAAUUUGGUA Ssp].[fl2r](G)[n001].[fl2r](G)[Ssp].[fl2r](U)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](U)[Ssp],[fl2r](A)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp],[fl UACUCUUAGA 0136951 2r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp] m(A)[Ssp],[fl2r](U)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)[ AUAAUUUGGU Ssp].[fl2r](U)[n001].[fl2r](G)[Ssp].[fl2r](G)[Ssp].[fl2rJ(U)}$$$$V2.0ASO- RN A 1 { [fl2r] (A) [Ssp]. [fl 2 r] (U) [Ssp], [f!2r] ( A) [nOO 1 ], [fl2r](C) [Ssp]. [f!2r] (U) [Ssp]. [fl 2r] (C) [nOO 1 ] [fl2r] (U) [Ssp]. [fl AUACUCUUAG 0136952 2r](U)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](U)[ AAUAAUUUGG Ssp],[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2rj(G)[Ssp].[fl2r](G)}$S$$V2.0ASO- RNAl{[f!2r](A)[Ssp],[fl2r](A)[Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](U)[n001] [fl2r](C)[Ssp],[fl AAUACUCUUA 0136953 2r](U)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].m(G)[Ssp].[fl2r](A)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[ GAAUAAUUUG Ssp].[fl2r](U)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)}$S$$V2.0ASO- RNAl {[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp] [fl2r](C)[n001] [fl2r](U)[Ssp].[fl AAAUACUCUU 0136954 2r](C)[Ssp].m(L')[Ssp].[fl2r](LT)[Ssp] m(A)[Ssp].[fl2r](G)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].[fl2r](Li)[Ssp].[fl2r](A)[ AGAAUAAUUU Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[fl2r](G)[Ssp].[fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](A)[n001].[fl2r](C)[Ssp].[fl GAAAU AC UCU 0136955 2r](U)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp],m(G)[Ssp].[fl2r](A)[SspJ.[fl2r](A)[Ssp].[fl2rJ(U)[ UAGAAUAAUUSsp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp].[fl2r](U)]$$$$V2.082 of 46113113958V]Attorney Docket No.: 2010581-1550ASO- RN A 1 { [fl2r |(A) [Ssp ]. |f!2r] (G ) [Ssp]. [fl2r] (A) [nOO 1 ]. [fl2r](A) | Ssp ]. [ fl2r] (A) [ Ssp ]. | fl2r] (U) | nOO 1 ]. |112r] (A) [Ssp]. [f AGAAAUACUC 0136956 12r](C)[Ssp].m(U)[Ssp].[fl2rKC)[Ssp].m(U)[Ssp].[fl2rl(U)[Ssp].m(A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[Sspl.[fl2r](A)[ UUAGAAUAAU Ssp].[fl2r](U)[n001].[fl2r](A)[Ssp].[fl2rl(A)[Ssp].[fl2r](U)}$S$$V2.0ASO- RNAl{[fl2r](A)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[n001].[fl2r](A)[Ssp].|fl2r](A)[Ssp].[fl2r](A)[n001].[fl2r|(U)[Ssp|.[f AAGAAAUACU 0136957 12r](A)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(C)[Sspl.[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](A)[Ssp].[fl2r](G)[Ssp].[fl2r](A)[ CUUAGAAUAA Ssp].[fl2r](A)[n001].[fl2r](U)[Ssp].[fl2r](A)[Ssp].[fl2r](A)}$S$$V2.0ASO- RM A 1 { [fl2r |(G) [Ssp]. [fl2r] (A) [Ssp]. [fl2r] (A) [nOO 1 ]. [f!2r](G) | Ssp |.[fl2r] (A) [ Ssp ]. [fl2r] (A) | nOO 1 ]. [fl2r](A)|Ssp].[f GAAGAAAUAC 0136958 12r](U)[Ssp] m(A)[Ssp] [fl2r](C)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(U)[Ssp].[fl2r](U)[Sspl.[fl2r](A)[Ssp].[fl2r](G)[ UCUUAGAAUASsp].[fl2r](A)[n001].[fl2r](A)[Ssp].[fl2r](U)[Ssp] [fl2r](A)}$S$$V2.0Table IB, Example oligonucleotides and / or compositions.ID HELM Description Base Sequence ASO- RNAl{[moe]([ni5C])]sp].[moe]([m5C])p.[nioe](T)p.[moe](T)p.[moe]([m5C])[sp].d(C)[sp].d(C)[sp].d(T)[sp].d(G) CCTTCCCTGAA 0110796 [sp].d(A)[sp].d(A)[sp].d(G)[sp].d(G)[sp].d(T)|sp].d(T)[sp].m(C)[sp].m(C)[sp|.m(U)[sp].m(C)[sp].m(C)}$S$$V2.0 GGTTCCUCC ASO- RNAl{[fl2r](U)[Ssp].[fl2r](C)[Ssp].[fl2rJ(C)[n001].[fl2r](U)[Ssp].[fl2rJ(U)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl UCCUUGUCAA 0136851 2r|(C)[Ssp].in(A)[Ssp].[fl2r|(A)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp|.[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[ CUGUGCCACA Ssp].[fl2r](C)[n00i].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}S$$$V2.0ASO- RNAl{[fl2r|(A)[Ssp|.|fl2r](U)[Ssp].[fl2r](C)[n001].[fl2r](C)[Ssp|.|fl2r](U)|Ssp].[fl2r](Ll)[n001].[fl2r|(G)[Sspntl AUCCUUGUCA 0136852 2r](U)[Ssp].m(C)[Ssp|.|fl2r](A)[Ssp].m(A)[Ssp].[fl2r|(C)|Ssp].m(U)|Ssp].[fl2r](G)[Ssp].|fl2r](U)|Ssp].[fl2r](G)[ ACUGUGCCAC Sspl.[fl2rl(C)[n001].[fl2r](C)[Ssp].[fl2r](A)[Ssp].[fl2r](C)}$S$$V20ASO- RNAl{[fl2r](U)|n001].[fl2r](C)[Ssp].[fl2r](C)[ii001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r|(G)[n001|.|fl2r](U)|Ssp].[ UCCUUGUCAA 0139937 fl2r](C)[Ssp] m(A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C) CUGUGCCACA [Ssp].[fl2r](C)[n001].[fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNAl{m(U)[n001].[fl2r](C)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp].[fl2r UCCUUGUCAA 0139938 ](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Sspl.[fl2rl(C)[Ss CUGUGCCACA p].[fl2r](C)[n001].[f]2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$$$$V2.0ASO- RNAl {[fl2r](U)[n001].m(C)[Ssp].[fl2r](C)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001].[fl2r](U)[Ssp] [fl2r UCCUUGUCAA 0139939 ](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(G)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ss CUGUGCCACA p].[fl2r](C)[n001] [fl2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$S$$V2.0ASO- RNAl{[fl2r](U)[n001].[fl2r](C)[Ssp].m(C)[n001].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](G)[n001] [fl2rj(U)[Ssp].[fl2r UCCUUGUCAA 0139940 ](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[f]2r](U)[Ssp].m(G)[Ssp],[fl2r](U)[Ssp].[fl2r](G)[Ssp].[fl2r](C)[Ss CUGUGCCACAp].[fl2r](C)[n001].[f]2r](A)[Ssp].[fl2r](C)[Ssp].[fl2r](A)}$$$$V2.083 of 46113113958V]Attorney Docket No,: 20105...

Claims

1. Attorney Docket No: 2010581-15502.CLAIMS3.1, An oligonucleotide, wherein the oligonucleotide is selected from:4.RNAl{m(G)[n00lR].[fl2r](C)[Ssp].[fl2r](A)[n001R] [fl2r](Lfi[Ssp].[fl2r](U)[Sspl.rn(C)[n001R].[fl 2r](A)[Ssp].[fl2r](C)[Ssp].m(A)p.[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp|.m(U)[Ss p].m(U)p.[fl2r](C)[n001R|.[fl2r](U)[Ssp].[fl2r](L)[Ssp].[fl2r](C)}$$$$V2.0,5.RNA 1 {m(G) [nOO 1 RJ. [fl2r] (C) [Ssp] [112 r] (A) [nOO 1 R]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp],m(C) [nOO 1 R]. [fl 2r](A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp],[fl2r](C)[Ssp].in(A)p.[fl2r](U)[Ssp].m(U)[Ss p].m(U)p.[fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)}$$$$V2.0, RNAl {m(G)|n001R].[fl2r](C)[Ssp|.[fl2r](A)|n001R].[fl2r|(U)[Ssp].|fl2r](U)|Ssp].m(C)[n001R].|fl 2r](A)[Ssp] [fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)p.[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp] m(Li)[Ss p] m(U)p.[fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[Ssp] [fl2r](C)}$$S$V2.0,6.RNAI {m(G)[n00lR].[fl2r](C)[Ssp].[fl2r](C)[n001R].[fl2r](G)[Ssp].[fl2r](C)[Ssp].m(A)[n001R].[fl2 r](U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(U)p.[fl2r](L)[Ssp|.[fi2r](C)[ Ssp].m(A)p.m(D)[n001R].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)}$$$$V2.0, RNAl ]m(G)[n00IR].[fl2r](C)[SspJ.[fl2r](C)[n001R] [fl2r](G)[Ssp].ni(C)[Sspj.rn(A)[n001R].[fl2r]( U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(C)p.[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp] [fl2r](C)[Ss p].m(A)p.[fl2r](U)[n001R].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)}$$$$V2.0;7.RNA 1 {m(U) [nOO 1 R]. [fl2r J (C) [Ssp]. [fl2r] (C) [nOO 1 R]. [fl2r] (U) [Ssp]. [f!2r] (U) [Ssp],m(G) [nOO 1 R]. [fl 2r](U)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp],[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp],m(G)p.[fl2r](U)[Ssp],m(G)[Ss pl m(C)p. [f!2r] (C) [nOO 1 R]. [fl2r] (A)[Ssp]. [fl2r] (C) [nOO 1 R]. [f!2r]( A) } $$$SV2.0.8.RNAl]m(G)[n001R].[fl2r](C)|Ssp].[fl2r](C)[n001R].[fl2r](G)[Ssp|.[fl2r](C)|Ssp].m(A)[n001R].[fl2 rJ(U)[Ssp].[fl2r](U)[Ssp].m(C)[Sspj.[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(U)p.[fl2r](L)[SspJ.[fl2r](C)[ Ssp] m(A)p,m(U) [nOO 1 R]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp].m (C) } $$S$V2.0, RNAl {m(G)[n001R].[fl2r](C)[Ssp].[fl2r](C)[n001R] [fl2r](G)[Ssp].[fl2r](C)[Ssp].m(A)[n001R].[fl2 r](U)[Ssp].[fl2r](U)[Ssp],m(C)[Ssp].[fl2r](A)[Ssp],m(C)[Ssp].[fl2r](A)[Ssp].m(U)p.[fl2r](U)[Ssp].[fl2r](C)[9.

10. Ssp].m(A)p.m(U)[n001R].[fl2r](U)[Ssp|.[fl2r](U)[n001R].m(C)}$$$$V2.

0. and RNA 1 {m(G) [nOO 1 R]. [I12r] (C) [ Ssp]. [f!2r] (C) [nOO 1 R]. [fl2r] (G) [Ssp]. [f!2r] (C) [Ssp],m(A) [nOO 1 R]. [fl2 r](U)[Ssp] [fl2r](U)[Ssp].m(C)p [fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(U)p.[fl2r](U)[Ssp],[fl2r](C)[Ssp].m(A)p.m(U)[n001R].[fl2r](U)[Ssp].[fl2r](U)[Ssp].m(C)}$$$$V2.0,11.or a pharmaceutically acceptable salt thereof, wherein:12.[fl2r] represents a2’-F modified nucleoside;13.m represents a 2 -OMe modified nucleoside;14.p represents a phosphodiester;15.| Ssp] represents a phosphorothioate in the Sp configuration; and16.437 of 46117.13113958vl Attorney Docket No: 2010581-155018. / 19.N20., 021." KiZ'Rw22.[nOOIR] represents23.

24. wherein the phosphorus is of the / <?p configuration.

2. An oligonucleotide, wherein the oligonucleotide is selected from:26.mG[n001R][fl2r]C[Ssp][fl2r]A[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC[n001R][fl2r]A[Ssp][fl2r]C[Ssp] mAp[fl2r]U[Ssp]mU[Ssp][fl2r]C[Ssp]mAp[fl2r]U[Ssp]mU[Ssp]mU[Ssp] [fl2r]C[n001R][fl2r]U[Ssp] [fl2r]U[ Ssp][fl2r]C, mG[n001R][fl2r]C[Ssp][fl2r]A[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC[n001R][fl2r]A[Ssp][fl2r]C[Ssp] Hi?\p[fl2r]U[Ssp|mU|Ssp]|fl2rjC|Ssp]mA[Ssp]|fl2r]U|Ssp]mLI|SsplmLip|fl2rjC|n001Rj[fl2r]U[Ssp|[fI2r|LI[ Ssp] [fl2r]C, mG[n001R][fl2r]C[Ssp][fl2r]A[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC[n001R][fl2r]A[Ssp][fl2r]C[Ssp] mA[Ssp][fl2r]U[Ssp]mU[Ssp][fl2r]C[Ssp]mAp[fl2r]U[Ssp]mU[Ssp]mUp[fl2r]C[n001R][fl2r]U[Ssp][fl2r]U[ Ssp][fl2r]C, mG[n001R][fl2r]C[Ssp][fl2r]A[n001R][fl2r]U[Ssp][fl2r]L![Ssp]mC[n001R][fl2r]A[Ssp][fl2r]C[Ssp] mA[Ssp][fl2r]U[SspjmUp[fl2r]C[Ssp]mA[Ssp][fl2r]ll[Ssp]mlJpmll[Ssp][fl2r]C[n001R][fl2r]U[Ssp] [fl2r]U[ Ssp][fl2r]C, mG[n001R][fl2r]C[Ssp][fl2r]A[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC[n001R|[fl2r]A[Ssp][fl2r]C[Ssp] mA[Ssp] [fl2r] U [SspjmUp[fl2r] C[Ssp]mA[Ssp] [fl2r] U[Ssp]mU[Ssp]mUp[fl2r] C[nOO 1R] [fl2r]L![Ssp] [fl2r]U[ Ssp][fl2r]C,27.mG[nOO 1 R] [fl2r]C[Ssp] [f!2r] C[nOO 1 R] [fl2r]G[Ssp] [fl2r] C[Ssp]mA [nOO I R] [fl2r]U[Ssp] [f!2r]U[Ssp] mCp[fl2r|A[Ssp|mC|Ssp]|fl2rJA[Ssp]mL,p|fl2r]Li|Ssp]|fl2r]C|Ssp]mA[Ssp|mU[ii001R|[fl2r|LI[Ssp)[tl2r]U| Ssp] [f!2r]C, mG[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]G[Ssp][fl2r]C[Ssp]mA[n001R][fl2r]U[Ssp][f]2r]U[Ssp] mCp[fl2r]A[Ssp]mC[Ssp][fl2r]A[Ssp]mU[Ssp][fl2r]U[Ssp][fl2r]C[Ssp]mApmU[n001R][fl2r]U[Ssp][fl2r]U[ Ssp]|fl2r]C, mG[n001R][fl2r]C[Ssp][fl2r]C[ii001R][fl2r]G[Ssp][fl2r]C[Ssp]mA[n001R][fl2r]U[Ssp][fl2r]U[Ssp] mC[Ssp] [fl2r] A[Ssp]mC[Ssp] [fl2r]A[Ssp]mUp[fl2r] U [Ssp] [fl2r]C[Ssp]mApmU[n001R] [f!2r] U[Ssp] [fl2r] U [ Ssp][fl2r]C, mG[n00IR][fl2r]C[Ssp][fl2r]C[n001R][fl2r]G[Ssp]mCpmA[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC[Ss p]|fl2r]A[Ssp]mC[Ssp][fl2r]A[Ssp]mUp[fl2r]U[Ssp][fl2r]C[Ssp]mA[Ssp][fl2r]U[n001R][fl2r]U[Ssp][fl2r]U [Ssp][fl2r]C,28.mG[n()01R] [f!2r]C[Ssp] [fl2r]C[n001R][fl2r]G[Ssp]mC[Ssp]mA[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC [Ssp][fl2r]A[Ssp]mC[Ssp][fl2r]A[Ssp]mUp[f]2r]U[Ssp][fl2r]C[Ssp]mAp[fl2r]U[n001R][fl2r]U[Ssp][fl2r]U[ Ssp][fl2r]C,29.438 of 46130.13113958vl Attorney Docket No: 2010581-1550 mG[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]G[Ssp]mC|Ssp]mA n001R] fl2r]U[Ssp][fl2r U[Ssp]mC [Ssp] [fl2r]A[Ssp]mCp[fl2r]A[Ssp]mU[Ssp] [fl2r] U[Ssp][fl2r]C[Ssp]mAp[fl2r]U [nOO 1 R] [fl2r]U[Ssp] fl2r] U [ Ssp][fl2r]C, mU[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mG[n001R][fl2r]U[Ssp][fl2r]C[Ssp] mAp[fl2r]A[Ssp]mC[Ssp][fl2r]U[Ssp]mG[Ssp]|fl2r]U[Ssp]mGpmC[Ssp][fl2r]C[n001R]|fl2r]A[Ssp][fl2r]C[ n001R]|fl2r]A,31.mU[n001R] [fl2r]C[Ssp] [fl2r]C[n001R] [fl2r]U[Ssp][fl2r]U[Ssp]mG[n001R] [fl2r]U [SspJ [fl2rJC[SspJ mAp[fl2r]A[Ssp]mC[Ssp][fl2r]U[Ssp]mG[Ssp][fl2r]U[Ssp]mG[Ssp]mCp[fl2r]C[n001R][fl2r]A[Ssp][fl2r]C[ n001R][fl2r]A, mU[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]Ll|Ssp]|fl2r]U[Ssp]mG[n001R][fl2r]U[Ssp][fl2r]C|Ssp] mA[Ssp][fl2r]A[Ssp]mC[Ssp][fl2r]U[Ssp]mGp[fl2r]D[Ssp]mG[Ssp]mCp[fl2r]C[n00rR][fl2r]A[Ssp][fl2r]C[ n001R][fl2r]A, mU[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mG[n001R][fl2r]U[Ssp][fl2r]C[Ssp] mAp[fl2r]A[Ssp]mC[Ssp][fl2r]U[Ssp]mG[Ssp][fl2r]U[Ssp]mGpmC[Ssp][fl2r]C[n001R][fl2r]A[Ssp][fl2r]C[ n001R]mA,32.mU[n001 R][fl2r]C[Ssp][fl2r]C[n001 R] [fl2rj U [Ssp] [fl2r] U[Ssp]mG[n001 R][fl2r]U[Ssp][fl2rjC[Ssp] mAp[fl2r]A[Ssp]mC[Ssp][fl2r]U[Ssp]mG[Ssp][fl2r]U[Ssp]mG[Ssp]mCp[fl2r]C[n001R][fl2r]A[Ssp][fl2r]C[ nOOl R|mA, mU[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mG[n001R][fl2r]U[Ssp][fl2r]C[Ssp] mA[Ssp][fl2r]A[Ssp]mC[Ssp][fl2r]U[Ssp]mGp[fl2r]U[Ssp]iiiG[Ssp]mCp[fl2r]C[n00 ]R][fl2r]A[Ssp][fl2r]C[ n001R]mA, mG|n001R]|fl2rjC|Ssp]|fl2rjAlti001R|[fl2r|LI[Ssp][tl2rjL!|SspjmC[n001R|lfl2r|AlSsp|[fl2r]C[Sspl mAp[fl2r]Li[Ssp]mU[Ssp][fl2r]C[Ssp]mAp[fl2rJU[Ssp]mU[SspJmU[Ssp] [fl2r]C[n001 R] [f32r]U [Ssp] [f!2rjU[ Ssp]mC.33.mG[n001R][fl2r]C[Ssp][fl2r]A[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC[n00]R][fl2r]A[Ssp][fl2r]C[Ssp] mAp[fl2r]U[Ssp]mU[Ssp][fl2r]C[Ssp]mA[Ssp][fl2r]U[Ssp]mU[Ssp]mUp[fl2r]C[n001R][fl2r]U[Ssp] [f!2r]U[ Ssp|mC mG[n001R][fl2r]C[SspJ[fl2rjC[n001RJ[fl2r]G[Ssp][fl2r]C[Ssp]mA[n001R][fl2rJU[Ssp][fl2r]U[Ssp] mC[Ssp][fl2r]A[Ssp]mC[Ssp][fl2r]A[Ssp]mUp[fl2r]U[Ssp][fl2r]C[Ssp]mApmU[n001R][fl2r]U[Ssp][fl2r]LT[ Ssp]mC.34.mG[n001R][fl2r]C[Ssp][fl2r]Cjn001R][fl2r]G[Ssp][fl2r]C[Ssp]mA[n001R][fl2r]U[Ssp][fl2r]U[Ssp] mC[Ssp][fl2r]A[Ssp]mC[Ssp][fl2r]A[Ssp]mUp[fl2r]U[Ssp][fl2r]C[SspJmApniU[ii001R][fl2r]U[Ssp][fl2i]U[ n001R]mC.35.mG[n001 R] [fl2r] C [ S sp] [fl2r] C[n001 R] [fl2r]G[Ssp] [fl2r] C[Ssp]m A [nOO 1 R] [fl2r]U[Ssp] [fl2r]U[Ssp] mCp[fl2r]A[Ssp|mC[Ssp][fl2r]A[Ssp]mUp[fl2r]U[Ssp][fl2r]C[Ssp]mApmU[n001R][fl2r|Li[Ssp][fl2r|U[Ssp ]mC,36.439 of 46137.13113958vl Attorney Docket No: 2010581-1550 m(G)[ii001R][fl2r](C)[Ssp][fl2r](A)[n001R][fl2r](U)[Ssp][fl2r](U)[Ssp]m(C)[n001R][fl2r](A)[Ssp][ fl2r](C)[Ssp]m(A)p[fl2r](U)[Ssp]m(U)[Ssp][fl2r](C)[Sspjm(A)[Ssp][fl2r](U)[Ssp]m(CI)[Ssp]m(U)p[fl2r](C) [nOO ]R][fl2r](U)[Ssp][fl2r](U)[Ssp][fl2r](C).38.m(G)[n001R][fl2r](C)[Ssp][fl2r](A)[n00]R][fl2rl(lJ)[Ssp][fl2rl(U)[Ssp]rn(C)[n001R][fl2r](A)[Ssp][ fl2r](C)[Sspim(A)[Ssp][fl2r](U)[Ssp]m(U)ISsp][fl2r](C)[Ssp]m(A)p[fl2r](U)[Ssp]m(U)[Ssp]m(U)p[fl2r](C) [n001R][fl2r](U)[Ssp][fl2r](U)[Ssp][fl2r](C),39.m(G)[n001R] [f!2r] (C) [S spj [fl2r] (A) [nOO 1 R] [fl2r](U) [Ssp] [f!2r](U)[Ssp]m(C)[n001R] [fl2r] (A) [Ssp] [ fl2r](C)[Ssp]m(A)[Ssp][tl2r](U)[Ssp]m(U)p[fl2r](C)[Ssp]m(A)[Ssp][fl2r](U)[Ssp]m(U)[Ssp]m(U)p[fl2r](C) [n001R][f12r](U)[Ssp][fl2r](U)[Ssp][fl2r](C), m(G)[n001R][fl2rKC)[Ssp][fl2r](C)|n001R][fl2r](G)[Ssp][fl2r|(C)|Ssp]m(A)[n001R|[fl2r|(U)[Ssp][ fl2r](L;)[Ssp]m(C)[Ssp][fl2r](A)[SspJm(C)[Ssp][fl2r](A)[Ssp]m(U)p[fl2r](U)[Ssp][fl2r](C) Ssp]m(A)pm(U) [n001R][fl2r](U)[Ssp][fl2r](U)[Ssp][fl2r](C), m(G)[n001R][f!2r](C)[Ssp][fl2r](C)[n001R][fl2r](G)[Ssp]m(C)[Ssp]m(A)[n001R][fl2r](U)[Ssp][fl2r ](U)[Ssp]m(C)[Ssp][fl2r](A)[Ssp]m(C)p[fl2r](A)[Ssp]m(U)[Ssp|[fl2r|(U)[Ssp][fl2r|(C)[Ssp|m(A)p[fl2r](U)[ 11001R] [fl2r](U)[Ssp] [fl2r] (U) [Ssp] [fl2r](C), m(U)[n001R][fl2r](C)[Ssp][fl2r](C)[n001R][fl2r](U)[Ssp][fl2r](U)[Ssp]m(G)[n001R][fl2r](U)[Ssp][ fl2r](C)[Ssp]m(A)[Ssp][fl2rl(A)[Ssp]m(C)[Ssp][fl2r](U)[Ssp]m(G)p[fl2r](U)[Ssp]m(G)[Ssp]m(C)p[fl2r](C) | nOO 1 R] [fl2r] (A) [Ssp] [fl 2 r | (C) [nOO 1 R] [f!2r] (A), m(G)[n001R][fl2r](C)[Ssp][fl2r](C)[n001R][fl2r](G)[Ssp][fl2r](C)[Ssp]m(A)[n001R][fl2r](U)[Ssp][ fl2r](U)[Ssp]m(C)[Ssp][fl2r](A)[Ssp]m(C)[Ssp][fl2r](A)[Ssp]m(U)p[fl2r](U)[Ssp][fl2r](C)[Ssp]ni(A)pm(U) [n001R][fl2r](U)[Ssp][fl2r](U)[Ssp]m(C).40.m(G)|ii001R][fl2r](C)[Ssp)[fl2r](C)[n001R|[fl2r|(G)[Ssp|[fl2r](C)[Ssp|m(A)[n001RJ[fl2r](Li)[Ssp]| fl2r](U)[Ssp]m(C)[Ssp][fl2r](A)[Ssp]ni(C)[Ssp][fl2r](A)[Ssp]m(U)p[fl2r](U)[Ssp][fl2r](C)[Sspjm(A)pm(U) [nOO 1 R] [fl 2 r] (LT) [Ssp] [fl 2 r] (U) [nOO 1 R]m(C), m(G)[n001R][fl2r](C)[Ssp][f]2r](C)[n001R][fl2r](G)[Ssp][fl2r](C)[Ssp]m(A)[ii001R][fl2r](U)[Ssp][ fl2r](U)[Ssp]m(C)p[fl2r](A)[Ssp]m(C)[Ssp] [fl2r](A)[Ssp]m(U)p[fl2r](U)[Ssp][fl2r](C)[Ssp]m(A)pm(U)[n00 lR][fl2r](U)[Ssp]|fl2r](U)[Ssp]m(C), and mG[n001R][fl2r]C[Ssp][fl2rjC[ii001RJ[fl2r]G[Ssp][fl2r]C[Ssp]mA[ii001R][fl2rJU[Ssp][fl2r]U[Ssp] mCp[fl2r]A[Ssp]mC[Ssp] [fl2r]A[Ssp]mUp[fl2r]LT[Ssp][fl2r]C[Ssp]mApmlT[n001R][fl2r]U[Ssp][fl2r]U[n00 lR]mC,41.or a salt thereof, wherein:42.[fl2r] represents a2'-F modified nucleoside;43.m represents a 2’-OMe modified nucleoside;44.p represents a phosphodiester;45.| Ssp] represents a phosphorothioate in the Sp configuration; and46.440 of 46147.13113958vl Attorney Docket No: 2010581-155048. / 49.N50.N _, 051.[nOOIR] represents52.

53. wherein the phosphorus is of the Rp configuration.

3. An oligonucleotide, wherein the oligonucleotide is a compound of Formula A or a salt thereof.

4. An oligonucleotide, wherein the oligonucleotide is a compound of Formula A-i.

5. An oligonucleotide, wherein the oligonucleotide is a compound of Formula B or a salt thereof.

6. An oligonucleotide, wherein the oligonucleotide is a compound of Formula B-i.56.An oligonucleotide, wherein:57.the base sequence of the oligonucleotide comprises 10 or more (e.g., 10-20.

10.

11. 12, 13, 14, 15, 16, 17. 18, 19, 20, etc.) contiguous nucleobases of a complement of a STMN2 transcript: and58.the oligonucleotide comprises a chirally controlled intemucleotidic linkage.

8. Tire oligonucleotide of claim 7, wherein the base sequence of the oligonucleotide comprises 15, 16, 17, 18, 19. 20 or more contiguous nucleobases of a complement of a STMN2 transcript; and / or the base sequence of the oligonucleotide is the same as an equal length portion in a complement of a STMN2 transcript,9. An oligonucleotide, wherein:61.the base sequence of the oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15.62.16, 17, 18, 19, 20, etc.) contiguous nucleobases that are complementary to an equal length portion in a STMN2 transcript; and63.the oligonucleotide comprises a chirally controlled intemucleotidic linkage.

10. The oligonucleotide of claim 9, wherein the base sequence of the oligonucleotide comprises 15. 16, 17. 18, 19, 20 or more contiguous nucleobases that are complementary to an equal length portion in a STMN2 transcript.

11. An oligonucleotide, wherein:66.the oligonucleotide can hybridize to an equal length portion in a STMN2 transcript; and67.the oligonucleotide comprises a chirally controlled intemucleotidic linkage.

12. An oligonucleotide, wherein:69.the base sequence of the oligonucleotide comprises 10 or more (e.g.. 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of a complement of a STMN2 transcript; and70.the oligonucleotide comprises a non-negatively charged intemucleotidic linkage.

13. lire oligonucleotide of claim 12, wherein the base sequence of the oligonucleotide comprises 15, 16, 17, 18, 19. 20 or more contiguous nucleobases of a complement of a STMN2 transcript: and / or the base sequence of the oligonucleotide is the same as an equal length portion in a complement of a STMN2 transcript.

14. An oligonucleotide, wherein:73.441 of 46174.13113958vl Attorney Docket No: 2010581-155075.the base sequence of the oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18. 19, 20, etc.) contiguous nucleobases that are complementary to an equal length portion in a STMN2 transcript and76.the oligonucleotide comprises a non-negatively charged intemucleotidic linkage.

15. The oligonucleotide of claim 14. wherein the base sequence of the oligonucleotide comprises 15, 16, 17, 18. 19, 20 or more contiguous nucleobases that are complementary to an equal length portion in a STMN2 transcript; and / or the base sequence of the oligonucleotide is the same as an equal length portion in a complement of a STMN2 transcript.

16. An oligonucleotide, wherein:79.the oligonucleotide can hybridize to an equal length portion in a STMN2 transcript: and80.the oligonucleotide comprises a non-negatively charged intemucleotidic linkage.

17. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises a PN intemucleotidic linkage.

18. An oligonucleotide, wherein:83.the base sequence of the oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19.

20. etc.) contiguous nucleobases of a complement of a STMN2 transcript; and84.the oligonucleotide comprises a PN intemucleotidic linkage.

19. The oligonucleotide of claim 18, wherein the base sequence of the oligonucleotide comprises 15, 16, 17, 18, 19, 20 or more contiguous nucleobases of a complement of a STMN2 transcript; and / or the base sequence of the oligonucleotide is the same as an equal length portion in a complement of a STMN2 transcript.

20. An oligonucleotide, wherein:87.the base sequence of the oligonucleotide comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 1.88.16, 17. 18, 19, 20, etc.) contiguous nucleobases that are complementary to an equal length portion in a STMN2 transcript; and89.the oligonucleotide comprises a PN intemucleotidic linkage.

21. The oligonucleotide of claim 20, wherein the base sequence of the oligonucleotide comprises 15, 16, 17, 18, 19. 20 or more contiguous nucleobases that are complementary to an equal length portion in a STMN2 transcript; and / or the base sequence of the oligonucleotide is complementary to the base sequence of an equal length portion in a STMN2 transcript.

22. An oligonucleotide, wherein:92.the oligonucleotide can hybridize to an equal length portion in a STM 2 transcript; and93.the oligonucleotide comprises aPN intemucleotidic linkage.

23. The oligonucleotide of any one of claims 18-22, w herein the oligonucleotide comprises a chirally controlled intemucleotidic linkage.95.442 of 46196.13113958vl Attorney Docket No: 2010581-155024. The oligonucleotide of any one of the preceding claims, wherein the STMN2 transcript is a STMN2 pre-mRNA and / or the STMN2 transcript or a wild-type version thereof encodes stathmin-2.

25. The oligonucleotide of any one of the preceding claims, wherein each nucleobase is independently an optionally substituted nucleobase selected from A, T. C, G and U, or an optionally substituted tautomer of a nucleobase selected from A, T. C, G and U; and / or wherein each nucleobase is independently A, T, C, 5mC, G or U.

26. The oligonucleotide of any one of the preceding claims, wherein the length of the oligonucleotide is 20 or more nucleobases and / or the length of the oligonucleotide is 20 nucleobases.

27. The oligonucleotide of any one of the preceding claims, wherein:101.(i) the oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14. 15, 16, 17, 18, 19 or more chirally controlled intemucleotidic linkages;102.(ii) the oligonucleotide comprises 2, 3, 4, 5 or more non-negatively charged intemucleotidic linkages; and / or103.(iii) the oligonucleotide comprises 2, 3, 4, 5 or more PN intemucleotidic linkages.

28. The oligonucleotide of any one of the preceding claims, wherein:105.(i) the oligonucleotide comprises a p PN intemucleotidic linkage;106.(ii) the oligonucleotide comprises 2, 3, 4, 5 or more Rp PN intemucleotidic linkages; and / or (iii) each PN intemucleotidic linkage is Rp.

29. The oligonucleotide of any one of the preceding claims, wherein:108.(i) the oligonucleotide comprises a phosphoryl guanidine intemucleotidic linkage;109.(ii) the oligonucleotide comprises 2. 3, 4, 5 or more phosphoryl guanidine intemucleotidic linkages; and / or110.(iii) each PN intemucleotidic linkage is independently a phosphory l guanidine intemucleotidic linkage.

30. The oligonucleotide of any one of the preceding claims, wherein:112.(i) the oligonucleotide comprises a / / p phosphoryl guanidine intemucleotidic linkage;113.(ii) the oligonucleotide comprises 2. 3, 4, 5 or more Rp phosphoryl guanidine intemucleotidic linkages; and / or114.(iii) each phosphoryl guanidine intemucleotidic linkage is / <p.

31. Tire oligonucleotide of any one of the preceding claims, wherein:116.(i) the oligonucleotide comprises a nOOl intemucleotidic linkage;117.(ii) the oligonucleotide comprises 2. 3, 4, 5 or more nOOl intemucleotidic linkages; and / or118.(iii) each phosphoryl guanidine intemucleotidic linkage is independently a nOOl intemucleotidic linkage.

32. The oligonucleotide of any one of the preceding claims, wherein:120.(i) the oligonucleotide comprises a / ^p nOOl intemucleotidic linkage;121.443 of 461122.13113958vl Attorney Docket No: 2010581-1550123.(ii) the oligonucleotide comprises 2, 3, 4, 5 or more Rp nOOl internucleotidic linkages; and / or (iii) each nOOl internucleotidic linkage is Rp.

33. The oligonucleotide of any one of the preceding claims, wherein the internucleotidic linkage between the first and the second nucleosides, the third and the fourth nucleosides, the sixth and the seventh nucleosides, the 17th and the 18th nucleosides, and / or the last two nucleosides is a PN linkage (unless otherwise noted, 5’ to 3’ direction).

34. The oligonucleotide of any one of the preceding claims, wherein:126.(i) the number of nOOl internucleotidic linkages in the oligonucleotide is 4;127.(ii) the number of Rp nOOl internucleotidic linkages in the oligonucleotide is 4;128.(iii) the number of phosphoryl guanidine internucleotidic linkages in the oligonucleotide is 4;129.(iv) the number of p phosphoryl guanidine internucleotidic linkages in the oligonucleotide is 4: (v) the number of PN internucleotidic linkages in the oligonucleotide is 4; and / or130.(vi) the number of rip PN internucleotidic linkages in the oligonucleotide is 4.

35. The oligonucleotide of any one of the preceding claims, wherein:132.(i) the number of nOOl internucleotidic linkages in the oligonucleotide is 5;133.(ii) the number of Rp nOOl internucleotidic linkages in the oligonucleotide is 5;134.(iii) the number of phosphoryl guanidine internucleotidic linkages in the oligonucleotide is 5;135.(iv) the number of Rp phosphoryl guanidine internucleotidic linkages in the oligonucleotide is 5; (v) the number of PN internucleotidic linkages in the oligonucleotide is 5; and / or136.(vi) the number of rip PN internucleotidic linkages in the oligonucleotide is 5.

36. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises a PS internucleotidic linkage and / orthe oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more PS internucleotidic linkages.

37. The oligonucleotide of any one of the preceding claims, wherein:139.(i) the oligonucleotide comprises a rip PS internucleotidic linkage;140.(ii) the oligonucleotide comprises 2. 3, 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more Sp PS internucleotidic linkages; and / or141.(iii) each PS internucleotidic linkage is rip.

38. The oligonucleotide of any one of claims 36-37, wherein each PS internucleotidic linkage is independently a phosphorothioate internucleotidic linkage.

39. Hie oligonucleotide of an ' one of the preceding claims, wherein the oligonucleotide comprises a phosphorothioate internucleotidic linkage and / orthe oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15. 16 or more phosphorothioate internucleotidic linkages.

40. The oligonucleotide of any one of the preceding claims, wherein:145.(i) the oligonucleotide comprises a rip phosphorothioate internucleotidic linkage:146.444 of 461147.13113958vl Attorney Docket No: 2010581-1550148.(ii) the oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16 or more Sp phosphorothioate intemucleotidic linkages; and / or149.(iii) each phosphorothioatc intemucleotidic linkage is independently 5p.

41. The oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between the first and the second nucleosides and / or the last two nucleosides, if it is not a PN linkage, is a PS intemucleotidic linkage.

42. The oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between the second and the third nucleosides, the fourth and the fifth nucleosides, the fifth and the sixth nucleosides, the seventh and the eighth nucleosides, the eighth and the ninth nucleosides, the ninth and the tenth nucleosides, the 10th and the 11th nucleosides, the 11th and the 12th nucleosides, the 12th and the 13th nucleosides, the 13th and the 14th nucleosides, the 14th and the 15th nucleosides, the 15th and the 16th nucleosides, the 16th and the 17th nucleosides, and / or the 18th and the 19th nucleosides is a PS intemucleotidic linkage.

43. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises a PO intemucleotidic linkage and / or the oligonucleotide comprises 2, 3 or more PO intemucleotidic linkages.

44. The oligonucleotide of any one of the preceding claims, wherein the intemucleotidic linkage between the fifth and the sixth nucleosides, the ninth and the tenth nucleosides, the 11th and the 12th nucleosides, the 13th and the 14th nucleosides, the 15th and the 16th nucleosides, and / or the 16th and the 17th nucleosides is a PO intemucleotidic linkage.

45. The oligonucleotide of any one of the preceding claims, w herein the PO intemucleotidic linkage is a natural phosphate linkage.

46. The oligonucleotide of any one of the preceding claims, wherein:155.(i) the PO intemucleotidic linkage is bonded to 3' of a 2’-ORakmodified sugar, wherein Rakis optionally substituted Ci e aliphatic;156.(ii) the PO intemucleotidic linkage is bonded to 3’ of a 2'-0Mc modified sugar;157.(iii) the PO intemucleotidic linkage is bonded io 5’ of a 2’-ORakmodified sugar, wherein Rdkis optionally substituted Ci.g aliphatic;158.(iv) the PO intemucleotidic linkage is bonded to 5’ of a 2'-OMe modified sugar;159.(v) the PO intemucleotidic linkage is bonded to 3’ of a first 2 -ORakmodified sugar and 5’ of a second 2’-ORakmodified sugar, wherein each Rakis independently optionally substituted Ci-6 aliphatic;160.(vi) the PO intemucleotidic linkage is bonded to 3 / of a first 2 ‘-0Mc modified sugar and 5’ of a second 2’-OMe modified sugar; and / or161.(vii) the PO intemucleotidic linkage is bonded to a 2’-F modified sugar.

47. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises a sugar modification.163.445 of 461164.13113958vl Attorney Docket No: 2010581-155048. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises a X- modified sugar and / or the oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more 2’ -modified sugars,49. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide comprises a X- F modified sugar and / or the oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8. 9, 10. 11, 12, 13, 14, 15, 16, 17 or more 2’-F modified sugars.

50. The oligonucleotide of any one of the preceding claims, wherein:168.(i) the sugar of nucleosides 2, 3, 4, 5, 7, 8, 10, 12, 14, 15, 18, and 19 are each a 2’-F modified sugar; (ii) the sugar of nucleosides 2. 3, 4, 5, 7. 8, 10, 12.

14. 15, 18, 19, and 20 are each a 2'-F modified sugar;169.(iii) the sugar of nucleosides 2, 3, 4, 7, 8, 10. 12, 14, 15, 17, 18, and 19 are each a 2'-F modified sugar; or170.(iv) the sugar of nucleosides 2, 3, 4, 7, 8, 10, 12. 14, 15, 17, 18, 19, and 20 are each a 2’-F modified sugar.

51. The oligonucleotide of any one of the preceding claims, wherein:172.(i) the oligonucleotide comprises a 2 -OR modified sugar, wherein R is optionally substituted Ci-Cg aliphatic;173.(ii) the oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8 or more 2 ’-OR modified sugars, wherein Ris optionally substituted Ci-Ce aliphatic;174.(iii) the sugar at position 1, 5, 6, 9, 11, 13, 15, 16, 17, and / or 20 of an oligonucleotide orapoition thereof (the sugar in the first nucleoside, from 5’ to 3’, is at position 1; numbering increases tow'ard 3’) is a 2 ’-OR modified sugar, wherein Ris optionally substituted Ci-Cs aliphatic; and / or175.(iv) R is optionally substituted Ci g alkyl.

52. The oligonucleotide of claim 51, wherein the sugar at position 1 is the sugar of the 5 ’-end nucleoside of the oligonucleotide.

53. The oligonucleotide of any one of the preceding claims, wherein:178.(i) the sugars at positions 1, 5. 6, 9, 11, 13, find 16 are independently 2’-OR modified sugars, w'herein R is optionally substituted Ci-Ct, aliphatic;179.(ii) the sugars at positions 1, 5. 6, 9, 11, 13, 16, and 20 are independently 2’-OR modified sugars, wherein R is optionally substituted Ci-Cc aliphatic;180.(iii) the sugars at positions 1, 6, 9, 11, 13, 16, and 17 arc independently 2’-OR modified sugars, wherein R is optionally substituted Ci-Cs aliphatic; or181.(iv) the sugars at positions 1, 6, 9. 11, 13, 16, 17, and 20 are independently 2 -OR modified sugars, w'herein R is optionally substituted Ci-Cs aliphatic.

54. The oligonucleotide of any one of the preceding claims, w'herein:183.446 of 461184.13113958vl Attorney Docket No: 2010581-1550185.(i) each sugar is independently a 2’-0R modified sugar wherein R is Ci-o aliphatic or a 2'-F modified sugar;186.(ii) each 2’ -OR modified sugar is a 2 -OMe modified sugar;187.( iii) the oligonucleotide comprises a 2'-0Me modified sugar;188.(iv) the oligonucleotide comprises 2, 3, 4, 5, 6, 7, 8 or more 2 -OMe modified sugars; and / or (v) each sugar is independently a 2’-0Me or a 2’-F modified sugar.

55. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide can hybridize to a region of a STMN2 transcript,56. The oligonucleotide of claim 55, wherein the region of the STMN2 transcript comprises GAAGAAAUGAAUGUGAAUGC, GAAAUGAAUGUGAAUGCGGC, UGUGGCACAGUUGACAAGGA, AAUGUGAAUGCGGCUUGUGG, UUCGAGAGAAAGGUAGAAAA, GUGUGCGAGAGAGAGAGACA, GCCUAAGAAGAAAUGAAUGU, UGAAUGUGAAUGCGGCUUGU, GAAUGUGAAUGCGGCUUGUG, GUGGCACAGULIGACAAGGAU, CAGUUGACAAGGAUGAUAAA. or GAUGAUAAAUCAAUAAUGCA. wherein each U is optionally and independently replaced with T.

57. The oligonucleotide of claim 55, wherein the region of the STMN2 transcript is intron 1.

58. The oligonucleotide of claim 55, wherein the region of the STMN2 transcript is193.U GC AGGAC U C GGC AGA AGACCUU CGAGAGA AAGG U AGAAAAU AA, CUCUGUGUGAGCAUGUGUGCGUGUGUGCGAGAGAGAGAGACAGACAGCCUG, or AGCCUGCCUAAGAAGAAAUGAAUGUGAAUGCGGCUUGUGGCACAGUUGACAAGGAUGAUAA AUCAAUAAUGCA, wherein each U is optionally and independently replaced with T.

59. The oligonucleotide of any one of the preceding claims, wherein the base sequence comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.), 15 or more, or 20 or more contiguous nuclcobascs complementary to 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.), 15 or more, or 20 or more contiguous nucleobases of a STMN2 transcript,195.optionally w herein the contiguous nucleobases of a STMN2 transcript are in intron 1.

60. The oligonucleotide of any one of the preceding claims, w herein the base sequence comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.), 15 ormore, or 20 ormore contiguous nucleobases complementary to 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.), 15 or more, or 20 ormore contiguous nuclcobascs of GAAGAAAUGAAUGUGAAUGC, GAAAUGAAUGUGAAUGCGGC. UGUGGCACAGUUGACAAGGA, AAUGUGAAUGCGGCUUGUGG. UUCGAGAGAAAGGUAGAAAA, GUGUGCGAGAGAGAGAGACA, GCCUAAGAAGAAAUGAAUGU, UGAAUGUGAAUGCGGCUUGU, GAAUGUGAAUGCGGCUUGUG, GUGGCACAGULIGACAAGGAU, CAGUUGACAAGGAUGAUAAA,197.447 of 461198.13113958vl Attorney Docket No: 2010581-1550199.GAUGAUAAAUCAAUAAUGCA,200.U GC AGGAC U C GGC AGAAGACCUU CGAGAGA AAGG U AGAAAAU AA, CUCUGUGUGAGCAUGUGUGCGUGUGUGCGAGAGAGAGAGACAGACAGCCUG, or AGCCUGCCUAAGAAGAAAUGAAUGUGAAUGCGGCUUGUGGCACAGUUGACAAGGAUGAUAA AUCAAUAAUGCA, wherein each U is optionally and independently replaced with T.

61. The oligonucleotide of any one of the preceding claims, wherein the base sequence comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.), 15 or more, or 20 or more contiguous nucleobases of TTATTTTCTACCTTTCTCTCGAAGGTCTTCTGCCGAGTCCTGCA, CAGGCTGTCTGTCTCTCTCTCTCGCACACACGCACACATGCTCACACAGAG. or TGCATTATTGAT1TATCATCCTTGTC AACTGTGCCACAAGCCGCATTCACATTCATTTCTTCTTAG GCAGGCT, wherein each T is optionally and independently replaced with U.

62. The oligonucleotide of any one of the preceding claims, wherein the base sequence comprises 10 or more (e.g., 10-20, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc.) contiguous nucleobases of GCAUUCACAUUCAUUUCUUC, GCCGCAUUCACAUUCAUUUC. UCCUUGUCAACUGUGCCACA, CCACAAGCCGCAU UCACAUU, UUUUCUACCUUUCUCUCGAA. UGUCUCUCUC UCU CGCACAC, ACAUUCAUUUCUUCUUAGGC, ACAAGCCGCAUUCACAUUCA, CACAAGCCGCAUUCACAUUC, AUCCUUGUCAACUGUGCCAC, UUUAUCAUCCUUGUCAACUG. or UGCAUUAUUGAUUUAUCAUC, wherein each U is optionally and independently replaced with T.

63. The oligonucleotide of claim 62, wherein the base sequence comprises 15 or more contiguous nucleobases of GC AUUCACAUUCAUUUCUUC, GCCGCAUUCACAUUCAUUUC, UCCUUGUCAACUGUGCCACA, CCACAAGCCGCAUUCACAUU. UUUUCUACCUUUCUCUCGAA, UGUCUCUCUCUCUCGCACAC, ACAUUCAUUUCUUCUUAGGC, ACAAGCCGCAUUCACAUUCA, CACAAGCCGCAUUCACAUUC, AUCCUUGUCAACUGUGCCAC, UUUAUCAUCCUUGUCAACUG, or UGCAUUAU UGAUUUAUCAUC, wherein each U is optionally and independently replaced with T.

64. The oligonucleotide of claim 63, wherein the base sequence comprises GCAUUCACAUUCAUUUCUUC, GCCGCAUUCACAUUCAUUUC, UCCUUGUCAACUGUGCCACA, CCACAAGCCGCAUUCACAUU, UUU UCUACCU UUCUCUCGAA. UGUCUCUCUCUCUCGCACAC, ACAUUCAU U UC U UCUUAGGC, ACAAGCCGCAUUCACAUUCA, CACAAGCCGCAU UCACAU UC, AUCCUUGUCAACUGUGCCAC, UUUAUCAUCCUUGUCAACUG, or UGCAUUAUUGAUUUAUCAUC, wherein each T is optionally and independently replaced with U.

65. The oligonucleotide of claim 64, wherein the base sequence is GCAUUCACAUUCAUUUCUUC, GCCGCAUUCACAUUCAUUUC, UCCUUGUCAACUGUGCCACA. CCACAAGCCGCAUUCACAUU, UUUUCUACCUUUCUCUCGAA, UGUCUCUCUCUCUCGCACAC. ACAUUCAUUUCUUCUUAGGC, ACAAGCCGCAUUCACAUUCA. CACAAGCCGCAUUCACAUUC. AUCCUUGUCAACUGUGCCAC, UUUAUCAUCCUUGUCAACUG, or UGCAUUAUUGAUUUAUCAUC.205.448 of 461206.13113958vl Attorney Docket No: 2010581-155066. The oligonucleotide of any one of the preceding claims, wherein each chiral intemucleotidic linkage of the oligonucleotide independently has a diastereopurity of at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%. 99%.

67. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide is a pharmaceutically acceptable salt.

68. The oligonucleotide of any one of the preceding claims, wherein the oligonucleotide is a sodium salt, optionally wherein the number of sodium ions in tire sodium salt equals the total number of phosphorothioate intemucleotidic linkages and natural phosphate intemucleotidic linkages in the oligonucleotide,69. A chirally controlled oligonucleotide composition comprising an oligonucleotide of any one of the preceding claims, wherein the composition is enriched, relative to a substantially racemic preparation of the oligonucleotide, for the oligonucleotide:211.a chirally controlled oligonucleotide composition comprising a plurality of oligonucleotides each of which is an oligonucleotide of any one of the preceding claims, wherein oligonucleotides of the plurality share the same constitution and at least 5% of all oligonucleotides in the composition that share the same constitution are oligonucleotides of the plurality: or212.a chirally controlled oligonucleotide composition composing an oligonucleotide of any one of the preceding claims, wherein at least 5% of all oligonucleotides in the composition that share the same constitution as the oligonucleotide are the oligonucleotide.

70. Hie composition of claim 69, wherein at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%. 80%, 85%, 90%, or 95% of all oligonucleotides in the composition that share the same constitution are oligonucleotides of the plurality: or wherein at least 10%, 15%, 20%, 25%, 30%, 35%, 40%. 45%, 50%, 55%, 60%, 65%. 70%. 75%, 80%. 85%, 90%, or 95% of all oligonucleotides in the composition that share the same base sequence are oligonucleotides of the plural ity.

71. An oligonucleotide composition comprising a plurality of oligonucleotides, w herein oligonucleotides of the plurality share:215.1) a common base sequence; and216.2) the same linkage phosphorus stereochemistry' independently at 1. 2, 3, 4, 5. 6, 7, 8, 9.

10. 11, 12, 13, 14, 15. 16, 17, 18, 19, 20 or more chiral intemucleotidic linkages:217.wherein oligonucleotides of the plurality are an oligonucleotide of any one of claims 1-68; and w'herein at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or 90% of the oligonucleotides in the composition that share the common base sequence arc oligonucleotides of the plurality'.

72. The oligonucleotide composition of claim 71, wherein oligonucleotides of plurality7share the same linkage phosphoms stereochemistry7independently at each chiral intemucleotidic linkage.

73. An oligonucleotide composition, wherein a level of all oligonucleotides in the composition are oligonucleotides each independently having the structure of:220.449 of 461221.13113958vl Attorney Docket No: 2010581-1550222.RNA1 {m(G)[n001R].[fl2r](C)[Ssp].[fl2r](A)[n001R].[fl2r](Li)[Ssp].[fl2r](U)[Ssp].m(C)[n001R].[fl 2r](A)[Ssp].[fl2r](C)[Ssp].m(A)p.[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(lT)[Ss p] m(U)p.[fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[Ssp],[fl2r](C)}$$$$V2.0, RNAl{m(G)[n00lR].[fl2r](C)[Ssp].[fl2rl(A)[n001R] [fl2rl(U)[Ssp].[fl2r](U)[Ssp].m(C)[n001R].[fl 2r|(A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ssp].[fl2r](C)[Ssp].m(A)p.[fl2r|(Li)[Ssp].m(U)[Ss p].m(U)p.[fl2r](C)[n001R|.[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)}$$$$V2.0,223.RN A 1 {m(G) [nOO 1 RJ. [fl2r] (C) [Ssp] [fl2 r] (A) [nOO 1 R]. [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp],m(C) [nOO 1 R]. [fl 2r](A)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](U)[Ssp].m(U)p,[fl2r](C)[Ssp],m(A)[Ssp].[fl2r](U)[Ssp].m(U)[Ss p].m(U)p.[fl2r](C)[n001R].[fl2r](U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)}$$$$V2.0.224.RNAl{m(G)|n001R].[fl2r](C)[Ssp].[fl2r](C)[n001R].[fl2r](G)[Ssp].!fl2r](C)[Ssp].m(A)[n001R].[fl2 r](U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp] m(C)[Ssp].[fl2r](A)[Ssp] m((J)p.[fl2r](U)[Ssp].[fl2rJ(C)[ Ssp].m ( A)p m(U) [nOO 1 R] [fl2r] (U) [Ssp]. [fl2r] (U) [Ssp] [fl 2r] (C) } $$$$V2.0, RNAl{m(G)[n00lR].[fl2r](C)[Ssp].[fl2r](C)[n001R].[fl2r](G)[Ssp].m(C)[Ssp].m(A)[n001R].[fl2r]( U)[Ssp].[fl2r](Li)[Ssp].ni(C)[Ssp].[fl2r](A)[Ssp].m(C)p.[fl2r](A)[Ssp].m(U)[Ssp].[fl2r](U)[Ssp].[fl2r](C)[Ss p] m(A)p. [fl2r J ( U ) [nOO 1 R]. [fl2r] (U) [Ssp]. [fl2r] ( U ) [ Ssp]. [ fl2r] ( C) } $S$$V2.0,225.RNA1 ]m(ll)[n()01R].[fl2r](C)[SspJ.[fl2r](C)[n001R] [fl2r](U)[Ssp].[fl2r](U)[Ssp].m(G)[n001R].[fl 2r](U)[Ssp].[fl2r](C)[Ssp].m(A)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](U)[Ssp].m(G)p [fl2r](U)[Ssp].m(G)[SsP].m(C)p.[fl2r](C)[n001R].[fl2r](A)[Ssp].[fl2r](C)[n001R].|fl2r](A)}S$$$V2.0,226.RNA 1 {m(G) [nOO 1 R]. [fl2r] (C) [Ssp]. [fl2r] (C) [nOO 1 R]. [fl2r] (G) [Ssp]. [f!2r] (C) [Ssp],m(A) [nOO 1 R]. [fl2 r](U)[Ssp],[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp],m(C)[Ssp].[f]2r](A)[Ssp].m(U)p.[fl2r](U)[Ssp],[fl2r](C)[ Ssp].m(A)p.m(U)[n001R].[fl2r](U)[Ssp].[fl2r](U)[Ssp].m(C)}$$S$V2.0?RAiAHm(G)[n001R|.[fl2i](C)|Ssp].[fl2r](C)[n001R].[fl2r|(G)[Ssp|.[fl2r](C)|Ssp].m(A)[n001R|.[fl2 r](U)[Ssp].[fl2r](U)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(U)p.[fl2r](L)[Ssp].[fl2r](C)[ Ssp] m(A)p.m(L)[n001R].[fl2r](U)[Ssp].[fl2r](U)[n001R].m(C)}$$$$V2.0, or RNAl {m(G)[ii001R].[fl2r](C)[Ssp].[fl2r](C)[n001R] [fl2r](G)[Ssp].[fl2r](C)[Ssp].m(A)[n001R].[fl2 r](U)[Ssp].[fl2r](U)[Ssp].m(C)p.[fl2r](A)[Ssp].m(C)[Ssp].[fl2r](A)[Ssp].m(U)p.[fl2r](U)[Ssp].[fl2r](C)[Ssp].m(A)p.m(LT)[n001R].[fl2r](U)[Ssp].[fl2r](U)[Ssp].m(C)}$$$$V2.0,227.or a salt thereof, wherein:228.[f!2r] represents a 2’-F modified nucleoside;229.m represents a 2’-OMe modified nucleoside;230.p represents a phosphodicstcr;231.[Ssp] represents a pliosphorotliioate in the Sp configuration; and232. / 233.[ > N...,0234." N235.[nOOIR] represents236.

237. wherein the phosphorus is of the / p configuration.238.4350 of 461239.13113958vl Attorney Docket No: 2010581-155074. An oligonucleotide composition, wherein a level of ail oligonucleotides in the composition are oligonucleotides each independently having the structure of:241.mG[n001R][fl2r]C[Ssp][fl2r]A[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC[n001R][fl2r]A[Ssp][fl2r]C[Ssp] mAp[fl2r]U[SsplmU[Ssp][fl2r]C[Ssp]mAp[fl2r]U[Ssp]mU[Ssp]mU[Ssp] [fl2r]C[n001R][fl2r]U[Ssp] [fI2r]U[ Ssp]|fl2r]C, mG|n001R][fl2r]C|Ssp][fl2r]A[n001R|[fl2r]U[Ssp][fl2r]U[Ssp]mC[n001R|[fl2r|A[Ssp][fl2r]C[Ssp] mAp[fl2r]U[Ssp]mU[Ssp][fl2r]C[Ssp]mA[Ssp][fl2r]U[Ssp]mU[SspJmUp[fi2r]C[n001R][fl2r|lJ[Ssp] [f!2r]U[ Ssp] [fl2r]C, mG[n001R][fl2r]C[Ssp][fl2r]A[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC[n001R][fl2r]A Ssp][fl2r]C[Ssp] mA|Ssp]|fl2r]U| Ssp]mU|Ssp]|fl2r]C|Ssp]mAp[fl2r|U[Ssp]mU| Ssp|mUp[tl2r]C[n001R][fl2r]U|Ssp]|fl2r]U[ Ssp] [fl2r]C, mG[n0(flR][fl2r]C[Ssp][fl2r]A[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC[n001R][fl2r]A[Ssp][fl2r]C[Ssp] mA[Ssp][fl2r]U[SsplmUp[f!2r]C[Ssp]mA[Ssp][fl2r]U[Ssp]mUpmU[Ssp][fl2r]C[n001R][fl2r]U[Sspl[fl2r]U[ Ssp]|fl2r]C, mG[n001R][fl2r]C[Ssp][fl2r]A[n001R][fl2r]U[SspJ[fl2r]l)[Ssp]mC[n001R][fl2r]A[Ssp][fl2rjC[Ssp] mA[Sspj[fl2rJ(J[Ssp]mUp[fl2rjC[Ssp]mA[Sspj[fl2rjU[Ssp]mULSspjmUp[fl2rjC[n00lRj[fl2rjU[Ssp] |fl2r] U [ Sspl[fl2r]C, mG[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]G[Ssp]|fl2r]C[Ssp]mA[n001R][fl2r]U[Ssp][fl2r]U| Ssp] mCp[fl2r]A[Ssp]mC[Ssp] [f!2r] A[Ssp]mUp[fl2r] U[Ssp] [f!2r]C[Ssp]mA[SspJmU[n001R] [fl2r] U[SspJ [fl2r] U[ Ssp] [fl2r]C, mG[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]G[Ssp][fl2r]C[Ssp]mA[n001R][fl2r]U[Ssp][fl2r]U[Ssp] mCp|fl2r]A|SspjmC[Ssp|[fl2r|A|Ssp]mU[Ssp|[fl2r|U[Ssp]|fl2r]ClSsp]mApmU|n001R] |fl2r] U| Ssp] | fl2r |U[ Ssp][fl2r]C, mG[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]G[Ssp][fl2r]C[Ssp]mA[n001R][fl2r]U[Ssp][fl2r]U[SspJ mC[Ssp][fl2r]A[Ssp]mC[Ssp][fl2r]A[Ssp]mUp[fl2r]U[Ssp][fl2r]C[Ssp]mApmU[n001R][fl2r]U[Ssp][fl2r]U[ Ssp][fl2r]C, mG[n001R][fl2riC[Ssp][fl2r]C[n001R][fl2r]G[Ssp]mCpmA[n001R]|fl2r]U|Ssp]|fl2r]U[Ssp|inC[Ss p] fl2r]A[Ssp]mC[Sspjlfl2r]ALSsp]mUp[fl2r]U[Ssp]lfl2r]C[Ssp]mA[Ssp][fl2r]U[n001RJ fl2rjU[Ssp][fl2r]U [Ssp][fl2r]C, mG[n001R][f!2r]C[Ssp][fl2r]C[n001R][fl2r]G[SsplmC[Ssp]mA[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC [Ssp][fl2r]A[Ssp]mC[Ssp][fl2r]A[Ssp]mUp[fl2r]U[Ssp][fl2r]C[Ssp]mAp|fl2r]U[n001R][fl2r]U[Ssp][fl2rlU[ Ssp][fl2r]C, mG[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]G[Ssp]mC[Ssp]mA[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC [Ssp][fl2rlA[Ssp]mCp[fl2r]A[Ssp]mU[Ssp][fl2r]UfSsp][fl2r]C[Ssp]mAp[fl2r]U[n001R][fl2r]U[Ssp][fl2r]U[ Ssp][fl2r]C,242.451 of 461243.13113958vl Attorney Docket No: 2010581-1550 mU[n001R][fl2r]C[Ssp][fl2r]C[n001R][f]2r]U[Ssp][fl2r]U[Ssp]mG[n001R][fl2r]U[Ssp][fl2r]C[Ssp] mAp[fl2rJ A[Ssp]mC[Ssp][fl2r]U [Ssp]mG[Ssp] [fl2r]U[Ssp]mGpmC[Ssp] [fl2r]C[n001R] [fl2r] A [SspJ [fl2r] C [ n001R][fl2r]A, mU[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mG[n001R][fl2r]U[Ssp][fl2r]C[Ssp] mAp[fl2r]A[Ssp|mC[Ssp][fl2r]U|Ssp]mG[Ssp][fl2r]U|Ssp]mG[Ssp]mCp|fl2r]C[n001R]|fl2r]A|Ssp][fl2r|C| n001R]|fl2r]A,244.mU|n001R] [fl2r]C[Ssp] [fl2r]C[n001R] [fl2r]U[Ssp][fl2r]U[Ssp]mG[n001R] [fl2r]U [SspJ [fl2rj C [SspJ mA[Ssp][fl2r]A[Ssp]raC[Ssp][fl2r]U[Ssp]mGp[fl2r]U[Ssp]mG[Ssp]mCp[fl2r]C[n001R][fl2r]A[Ssp][fl2r]C[ n001R][f!2r]A.245.mU[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]Ll|Ssp]|fl2r]U[Ssp]mG[n001R][fl2r]U[Ssp][fl2r]C|Ssp] mAp[fl2rJA[Ssp]mC[Ssp][fl2r]U[Ssp]mG[Ssp][fl2r]LI[Ssp]mGpmC[Ssp][fl2r]C[n001R][fl2r]A[SspJ[fl2r]C[ n001R]m, mU[n001R][f!2r]C[Ssp][fl2r]C[n001R][fl2r]U[Sspl[fl2r]U[Ssp]mG[n001R][fl2r]U[Sspl[fl2r]C[Sspl mAp[fl2r]A[Ssp]mC[Ssp][fl2r]U[Ssp]mG[Ssp][fl2r]U[Ssp]mG[Ssp]mCp[fl2r]C[n001R]|fl2f]A[Ssp][fl2r]C[ n001R]mA,246.mUlnOO 1 R][fl2rjC[Ssp][fl2r]C[n001 R][fl2rjU[SspJ[fl2r] U[Ssp]mG[n001 Rj[fl2rJU[Ssp][fl2rjC[Ssp] mA[Ssp][fl2r]A Ssp]mC[Sspl[fl2r]U[Ssp]mGp[f]2r]U[SsplmG Ssp]mCp[fl2r]C[n001R][fl2r]A[Ssp][fl2r]C[ nOOl R|mA, mG[n001R][fl2rJC[Ssp][fl2rJA[n001R][fl2r]U[Ssp][fl2r]U[Ssp]mC[n001R][fl2r]A[Ssp][fl2r]C[Ssp] mAp[fl2r]U[Ssp]mU[Ssp][fl2r]C[Ssp]mAp[fl2r]U[Ssp]mU[Ssp]mU[Ssp] [f!2r]C[ii001R][fl2r]U[Ssp] [fl2r]U[ Ssp]mC.247.mG|n001R]|fl2rjC|Ssp]|fl2rjAlti001R|[fl2r|LI[Ssp][tl2rjL!|SspjmC[n001R|lfl2r|AlSsp|[fl2r]C[Sspl mAp[fl2r]Li[Ssp]mU[Ssp][fl2r]C[Ssp]mA[Ssp][f]2r]U[Ssp]mU[SspjmUp[fl2r]C[n()01R] fl2.r]U [Ssp] [f!2rjU[ SspJmC.248.mG[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]G[Ssp][fl2r]C[Ssp]mA[n001R][fl2r]U[Ssp][fl2r]U[Ssp] mC[Ssp][fl2r]A[Ssp]mC[Ssp][fl2r]A[Ssp]mUp[fl2r]U[Ssp][fl2r]C[Ssp]mApr!iU[n001R][fl2r]U[Ssp][fl2r]U[ Ssp|mC mG[n001RJ[fl2rjC[SspJ[fl2rjC[n001RJ fl2r]G[Ssp][fl2r]ClSsp]mA[n001R][fl2rJU Ssp][fl2r]U[Ssp] mC[Ssp][fl2r]A[Ssp]mC[Ssp][fl2r]A[Ssp]mUp[fl2r]U[Ssp][fl2r]C[Ssp]mApmU[n001R][fl2r]U[Ssp][fl2r]LT[ nOOlRJmC, mG[n001R][fl2r]C[Ssp][fl2r]Cjn001R][fl2r]G[Ssp][fl2r]C[Ssp]mA[n001R][fl2r]U[Ssp][fl2r]U[Ssp] mCp[fl2r]A[Ssp]mC[Ssp] [fl2r]A[Ssp]mUp[fl2r]U[Ssp][fl2r]C[Ssp]mApmU[n001R][fl2r]U[Ssp][fl2r]U[Ssp ]mC, m(G)[n001R][fl2r](C)[Ssp][f]2r](C)[n001R][fl2r](G)[Ssp][fl2r](C)[Ssp]m(A)[n001Rnfl2rKU)[Ssp][ fl2r](Li)[Ssp|m(C)[Ssp][fl2rj(A)[Ssp]m(C)[Ssp][fl2r](A)[Ssp]m(U)p[fl2r](U)[Ssp| [fl2r](C)|Ssp]m(A)pm(U) [n001R][fl2r](U)[Ssp][fl2r](U)[Ssp][fl2r](C),249.452 of 461250.13113958vl Attorney Docket No: 2010581-1550251.m(G)[n001R| [f!2r] (C) [Ssp] [fl2r](C)|n001 R] f!2r] (G) [Ssp] [fl2r](C)[Ssp]m(A)[n001R] [fl2r | (U) [Ssp ] [ fl2r](L!)[Ssp]m(C)[Ssp][fl2r](A)[SspJm(C)[Ssp][fl2r](A)[Ssp]m(L!)p[fl2r](U)[Ssp][fl2r](C)[Ssp]m(A)pm(U) [n001R][fl2r](U)[Ssp][fl2r](U)[Ssp]m(C). or mG[n001R][fl2r]C[Ssp][fl2r]C[n001R][fl2r]G[Ssp][fl2r]C[Ssp]mA[n001R][fl2r]U[Ssp][fl2r]U[Ssp] mCp|fl2r]A|Ssp]mC[Ssp|[fl2r|A[Ssp]mL!p[fl2r|U[Ssp][fl2r]C[Ssp]mApmU[n001R|[fl2r]U|Ssp]|fl2r]U[n00 lR]mC,252.or a pharmaceutically acceptable salt thereof, wherein:253.[f!2r] represents a 2’-F modified nucleoside;254.m represents a 2’-0Me modified nucleoside;255.p represents a phosphodiester;256.[Ssp] represents a phosphorothioate m the S'p configuration; and257.[nOOIR] represents258.

259. wherein the phosphorus is of the T^p configuration.

75. An oligonucleotide composition, wherein a level of all oligonucleotides in the composition are each independently a compound of formula A or pharmaceutically acceptable salt thereof.

76. An oligonucleotide composition, wherein a level of all oligonucleotides in the composition are each independently a compound of formula A-i.

77. An oligonucleotide composition, wherein a level of all oligonucleotides in the composition are each independently a compound of formula B or pharmaceutically acceptable salt thereof.

78. An oligonucleotide composition, wherein a level of all oligonucleotides in the composition are each independently a compound of formula B-i.

79. The composition of any one of claims 69-78, wherein:265.(i) a level is about 5%, 10%, 15%, 20%, 25%, 30%, 35%. 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more of all oligonucleotides that share the same base sequence as an oligonucleotide having the structure or a pharmaceutically acceptable salt thereof:266.(ii) a level is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%. 45%, 50%. 55%. 60%, 65%. 70%, 75%, 80%, 85%, 90%, 95% or more of all oligonucleotides that share the same constitution as an oligonucleotide having the structure or a pharmaceutically acceptable salt thereof;267.(hi) a level is about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% based on UV peak area at 260 nm;268.(iv) the level or percentage is about or at least about (DS)nc, wherein DS is about or at least about 90%, 91%. 92%, 93%, 94%. 95%, 96%, 97%. 98%, 99% or 99.5%, and nc is the number of chirally controlled intemucleotidic linkages (e.g., 1-50. 1-40, 1-30, 1-25. 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2, 3, 4, 5, 6, 7. 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23. 24, 25 or more); and / or269.453 of 461270.13113958vl Attorney Docket No: 2010581-1550271.(v) the level or percentage is about or at least about (DS)nc, wherein DS is about or at least about 90%, 91%, 92%, 93%, 94%. 95%, 96%, 97%, 98%, 99% or 99.5%, and nc is the number of chiral linkage phosphorus m an oligonucleotide of the plurality (e.g., 1-50. 1-40. 1-30, 1-25, 1-20, 5-50, 5-40, 5-30, 5-25, 5-20, 1, 2.

3. 4, 5, 6. 7, 8, 9, 10, 11, 12. 13, 14.

15.

16. 17, 18, 19, 20, 21, 22. 23.24.25 ormore).

80. A pharmaceutical composition, comprising an oligonucleotide or oligonucleotide composition of any one of the preceding claims, and a pharmaceutically acceptable carrier.

81. The pharmaceutical composition of claim 80, wherein:274.(i) the pharmaceutical composition comprises one or more pharmaceutically acceptable salts of an oligonucleotide;275.(ii) the pharmaceutical composition is a solution;276.(iii) the pharmaceutical composition comprises a buffer; and / or277.(iv) the pharmaceutical composition comprises artificial cerebrospinal fluid (aCSF).

82. A method for altering splicing of a STMN2 transcript in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of the preceding claims.

83. The method of claim 82, wherein the STMN2 transcript is a STMN2 pre-m RNA.

84. A method for providing STMN2 exon skipping in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81.

85. A method for decreasing level of a truncated STMN2 transcript in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81.

86. The method of claim 85, wherein:283.(i) the truncated STMN2 transcript is a truncated STMN2 mRNA;284.(ii) the truncated SIMN2 transcript comprises a cryptic exon or portion thereof; and / or285.(iii) the truncated STMN2 transcript comprises exon 2a or portion thereof.

87. A method for decreasing level of a STMN2 transcript (‘‘level decreasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript comprises a characteristic sequence of GACTCGGCAGAAGACCTTCGAGAGAAAGGTAGAAAATAAGAATTTGGCTCTCTGTGTGAGCAT GTGTGCGTGTGTGCGAGAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATGAATGTGAATGCG GCTTGTGGCACAGTTGACAAGGATGATAAATCAATAAI’GCAAGCTTACTATCATTTATGAATAG CAATACTGAAGAAATTAAAACAAAAGATTGCTGTCTC. wherein each T can be optionally and independently replaced with U; or287.a method for decreasing level of a STMN2 transcript (“level decreasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or 454 of 461288.13113958vl Attorney Docket No: 2010581-1550289.composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript comprises a sequence that is in GACTCGGCAGAAGACCTTCGAGAGAAAGGTAGAAAATAAGAATTTGGCTCTCTGTGTGAGCAT GTGTGCGTGTGTGCGAGAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATGAATGTGAATGCG GCTTGTGGCACAGTTGACAAGGATGATAAATCAATAATGCAAGCTTACTATCATTTATGAATAG CAATACTGAAGAAATTAAA ACA AAAGATTGCTGTCTC, wherein each T can be optionally and independently replaced with U, but is not in STMN2 exon 2, 3, 4, or 5; or290.a method for decreasing level of a STM 2 transcript (“level decreasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript comprises a characteristic sequence of STMN2 exon 2a; or291.a method for decreasing level of a STAIN 2 transcript (“level decreasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, w herein the base sequence of the STMN2 transcript comprises UGUGUGAGCAUGUGUGCGUGUGUG; or292.a method for decreasing level of a STMN2 transcript (“level decreasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript comprises UCUCUGUGUGAGCAUGUGUG; or293.a method for decreasing level of a STAIN 2 transcript (“level decreasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1- 1, w'herein the base sequence of the STMN2 transcript comprises C A A UGGG ACUCGGC AGA AGA CC UU.

88. The method of claim 87, wherein:295.(i) the Icvcl-dccrcasing STMN2 transcript is a STMN2 mRNA;296.(ii) the base sequence of the level-decreasing STMN2 transcript comprises a TDP-43 binding motif; (iii) the base sequence of the level-decreasing STMN2 transcript comprises STMN2 exon 2a; and / or (iv) the base sequence of the level-decreasing STMN2 transcript comprises297.UGUGUG AGCA UGUGUGCGUGUGUG.

89. A method for increasing level of a full-length STMN2 transcript in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any¬ one of claims 1-81.

90. The method of claim 89, wherein:300.(i) the full-length STMN2 transcript is a full-length STMN2 mRNA;301.(ii) the full-length STMN2 transcript is a w ild-type STMN2 transcript;302.(iii) the full-length STMN2 transcript is a wild-type STMN2 mRN A;303.455 of 461304.13113958vl Attorney Docket No: 2010581-1550305.(iv) the full-length STMN2 transcript does not comprise a cryptic exon or portion thereof; and / or (v) the full-length STMN2 transcript comprises exons 1, 2, 3, 4, and 5.

91. A method for increasing level of a STMN2 transcript (“level increasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript comprises a characteristic sequence of STMN2 exon 2. 3, 4, or 5; or307.a method for increasing level of a STMN2 transcript (“level increasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript does not comprise a sequence characteristic of exon 2a relative to exon 2, 3, 4 or 5; or308.a method for increasing level of a STMN2 transcript (“level increasing STM 2 transcript’ ’) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript does not comprise a characteristic sequence of GACTCGGCAGAAGACCTICGAGAGAAAGGTAGAAAATAAGAAITIGGCTCTCTGI GTGAGC AT G TGTGCGTG TGI GCGAGAG GAGAGACAG CAGCCTGCC 1AAGAAGA AA TGA ATGTGAA TGCG GCTTGTGGCACAGTTGACAAGGATGATAAATCAATAATGCAAGCTTACTATCATTTATGAATAG CAATACTGAAGAAATTAAAACAAAAGATTGCTGTCTC, wherein each T can be optionally and independently replaced with U; or309.a method for increasing level of a STMN2 transcript (“level increasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript does not compose a sequence that is in GACTCGGCAGAAGACCTTCGAGAGAAAGGTAGAAAATAAGAATTTGGCTCTCTGTGTGAGCAT GTGTGCGTGTGTGCGAGAGAGAGAGACAGACAGCCTGCCTAAGAAGAAATGAATGTGAATGCG GCTTGTGGCACAGTTGACAAGGATGATAAATCAATAATGCAAGCTTACTATCATTTATGAATAG CAATACTGAAGAAATTAAAACAAAAGATTGCTGTCTC, wherein each T can be optionally and independently replaced with U, but is not in STMN2 exon 2, 3, 4, or 5; or310.a method for increasing level of a STMN2 transcript (“level increasing STMN2 transcript’ ’) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript docs not comprise a characteristic sequence of STM 2 exon 2a; or311.a method for increasing level of a STMN2 transcript (“level increasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript does not compnse UGUGUGAGCAUGUGUGCGUGUGUG; or312.456 of 461313.13113958vl Attorney Docket No: 2010581-1550314.a method for increasing level of a STMN2 transcript (“level increasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript does not comprise UCUCUGUGUGAGCAUGUGUG; or315.a method for increasing level of a STMN2 transcript (“level increasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript does not comprise CAAUGGGACUCGGCAGAAGACCUU; or316.a method for increasing level of a STMN2 transcript (“'level increasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript comprises ACGAUGAUAUGGAAGUGAAGCAAAU; or317.a method for increasing level of a STMN2 transcript (“level increasing STMN2 transcript”) in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81, wherein the base sequence of the STMN2 transcript comprises AACAGCAAUGGCCUACAAGGAA92. The method of any one of the preceding claims, wherein the level increasing STMN2 transcript comprises a characteristic sequence of STMN2 exon 2, 3, 4, and / or 5; and / or the level increasing STMN2 transcript comprises STMN2 exon 2, 3, 4, and / or 5.

93. A method for increasing level of a STMN2 polypeptide in a system, comprising administering or delivering to tire system an effective amount of an oligonucleotide or composition of any one of claims 1-81.

94. The method of claim 93, wherein:321.(i) the STMN2 polypeptide comprises a sequence that is encoded by exon 2. 3, 4 or 5 but not exon 2a;322.(ii) the STMN2 polypeptide is a full-length stathmin-2; and / or323.(iii) the STMN2 polypeptide is a wild-type stathmin-2.

95. A method for increasing level of stathmin-2 activity in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81; or325.a method for decreasing level of Purkinje cell loss in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-81; or326.a method for delaying Purkinje cell loss in a system, comprising administering or delivering to the system an effective amount of an oligonucleotide or composition of any one of claims 1-8196. The method of any one of claims 82-95, wherein the system:328.(i) expresses STMN2 transcripts;329.457 of 461330.13113958vl Attorney Docket No: 2010581-1550331.(ii) comprises truncated STMN2 mRNA;332.(iii) comprises STMN2 mRNA comprising a cry ptic exon or portion thereof;333.(iv) comprises STMN2 mRNA comprising exon 2a or portion thereof;334.(v) comprises loss of function of TDP-43:335.(vi) comprises a mutation of TDP-43;336.(vii) comprises mislocalization of TDP-43; and / or337.(viii) comprises TDP-43 aggregates.

97. The method of any one of claims 82-96. wherein the system comprises or is:339.(i) a cell, optionally wherein the system comprises or is a neuron, motor neuron, or Purkinje cell; (ii) a tissue, optionally wherein the system comprises or is neuronal tissue;340.(iii) an organ, optionally wherein the system comprises or is a brain or spinal cord:341.(iv) a sample, optionally wherein the system comprises oris a neuronal tissue sample. CSF, or serum;342.(v) an animal, optionally wherein the system comprises or is a mouse or non-human primate, (vi) a human; or343.(vii) a subject98. A method for preventing or treating a disease, disorder or condition, comprising administering or delivering to a subject susceptible thereto or suffering therefrom an effective amount of an oligonucleotide or composition of any one of claims 1-81.

99. The method of claim 97 or 98, wherein the subject is suffering from amyotrophic lateral sclerosis (ALS), frontotemporal lobar degeneration (FTLD), frontotemporal dementia (FTD). progressive supranuclear palsy (PSP), Alzheimer’s disease (AD), Parkinson’s disease (PD), Huntington s disease (HD), multiple system proteinopathy (MSP), limbic-predominant age-related TDP-43 encephalopathy (LATE), cerebral age-related TDP-43 with sclerosis (CARTS), dementia with Lewy bodies, chronic traumatic encephalopathy (CTE), facial onset sensory and motor ncuronopathy (FOSMN), corticobasal degeneration (CBD), sporadic inclusion body myositis (sIBM), or argyrophilic grain disease (AGD).

100. The method of any one of claims 97-99. wherein:347.(i) the subject has a loss-of-function of TDP-43:348.(ii) the subject has a mutation of TDP-43; and / or349.(iii) the subject has TDP-43 aggregation.

101. The method of any one of claims 97-100, wherein:351.(i) level of axonal degeneration is decreased, optionally wherein level of axonal degeneration is decreased as compared to absence of the oligonucleotide or composition and / or as compared to administering or delivering a reference oligonucleotide or composition;352.458 of 461353.13113958vl Attorney Docket No: 2010581-1550354.(ii) level of neuromuscular junction degeneration is decreased, optionally wherein level of neuromuscular junction degeneration is decreased as compared to absence of the oligonucleotide or composition and / or as compared to administering or delivering a reference oligonucleotide or composition;355.(iii) level of Purkinje cell loss of the subject is decreased, optionally wherein level of Purkinje cell loss of the subject is decreased as compared to absence of the oligonucleotide or composition and / or as compared to administering or delivering a reference oligonucleotide or composition; and / or356.(iv) Purkinje cell loss of the subject is delayed, optionally wherein Purkinje cell loss of the subject is delayed as compared to absence of the oligonucleotide or composition and / or as compared to administering or delivering a reference oligonucleotide or composition.

102. Idle method of any one of claims 97-101, wherein the oligonucleotide or composition is administered or delivered intrathecally.358.103 The method of any one of claims 82-102, wherein:359.(i) a cryptic exon is skipped in STMN2 mRNA;360.(ii) exon 2a is skipped in STMN2 mRNA;361.(iii) the exon is skipped at an increased level compared to a reference level, optionally wherein the reference level is the skipping level in the absence of the oligonucleotide or composition or is the baseline skipping level; and / or362.(iv) exons 2, 3, 4, and 5 are included in STMN2 mRNA.

104. Idle method of any one of claims 82-103, wherein:364.(i) level of truncated STMN2 mRNA is decreased, optionally wherein level of truncated STMN2 mRNA is decreased as compared to absence of the oligonucleotide or composition and / or as compared to administering or delivering a reference oligonucleotide or composition;365.(ii) level of STMN2 mRNA comprising a cryptic exon or portion thereof is decreased, optionally wherein level of STMN2 mRNA comprising a cry ptic exon or portion thereof is decreased as compared to absence of the oligonucleotide or composition and / or as compared to administering or delivering a reference oligonucleotide or composition;366.(iii) level of STMN2 mRNA comprising exon 2a or portion thereof is decreased, optionally wherein level of SIMN2 mRNA comprising exon 2a or portion thereof is decreased as compared to absence of the oligonucleotide or composition and / or as compared to administering or delivering a reference oligonucleotide or composition;367.(iv) level of STMN2 mRNA comprising exons 1, 2, 3, 4, and 5 is increased, optionally wherein level of STMN2 mRNA comprising exons 1, 2, 3, 4, and 5 is increased as compared to absence of the oligonucleotide or composition and / or as compared to administering or delivering a reference oligonucleotide or composition;368.459 of 461369.13113958vl Attorney Docket No: 2010581-1550370.(v) level of full-length STMN2 mRNA is increased, optionally wherein level of full-length STMN2 mRNA is increased as compared to absence of the oligonucleotide or composition and / or as compared to administering or delivering a reference oligonucleotide or composition;371.( vi) level of wild-type STMN2 mRNA is increased, optionally wherein level of wild-type STMN2 mRNA is increased as compared to absence of the oligonucleotide or composition and / or as compared to administering or delivering a reference oligonucleotide or composition;372.(vii) level of full-length STMN2 polypeptide is increased, optionally wherein level of full-length STMN2 polypeptide is increased as compared to absence of the oligonucleotide or composition and / or as compared to administering or delivering a reference oligonucleotide or composition; and / or373.(viii) level of wild-type STMN2 polypeptide is increased, optionally wherein level of wild-type STMN2 polypeptide is increased as compared to absence of the oligonucleotide or composition and / or as compared to administering or delivering a reference oligonucleotide or composition.

105. Tire method of any one of claims 101-104, wherein the reference oligonucleotide or composition targets STMN2 or the reference composition comprises oligonucleotides targeting STMN2.

106. A method for preparing an oligonucleotide or composition of any one of claims 1-81, comprising utilizing a phosphorami dite (e.g., a phosphoramidite comprising chiral auxiliary’).

107. An oligonucleotide or composition of any one of claims 1-81, for use in a method of any one of claims 82-105; or377.an oligonucleotide or composition of any one of claims 1-81, for use in manufacturing a medicament for a method of any one of claims 82-105.

108. Use of an oligonucleotide or composition of any one of claims 1 -81 in a method of any one of claims 82-105; or379.use of an oligonucleotide or composition of any one of claims 1 -81 in manufacturing a medicament for a method of any one of claims 82-105109. An oligonucleotide, composition, method, or use of any one of Embodiments 1 -528.381.460 of 461382.13113958vl

Images