Methods for maintaining or improving the health of manure treated soil

A synergistic blend of microbial and chemical additives in manure addresses greenhouse gas emissions and zoonotic pathogens, enhancing soil health and safety by reducing microbial activity and pathogen levels.

WO2026114766A1PCT designated stage Publication Date: 2026-06-04SOCIETE DES PRODUITS NESTLE SA

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
SOCIETE DES PRODUITS NESTLE SA
Filing Date
2025-11-21
Publication Date
2026-06-04

Smart Images

  • Figure IMGF000019_0001
    Figure IMGF000019_0001
  • Figure IMGF000018_0001
    Figure IMGF000018_0001
  • Figure IMGF000018_0002
    Figure IMGF000018_0002
Patent Text Reader

Abstract

The present invention relates to a method for maintaining or improving the health of manure treated soil, in particular through the management of zoonotic pathogens in manure by application of manure additives. The invention therefore also relates to a method of improving plant growth. The invention further relates to a method of reducing the level of zoonotic pathogens in manure, particularly throughout storage of manure.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Methods for maintaining or improving the health of manure treated soil

[0002] Field of the invention

[0003] The present invention relates to a method for improving or reducing the environmental impact of manure. In particular, the invention relates to methods for maintaining or improving the health of manure treated soil, in particular through the management of zoonotic pathogens in manure by the application of manure additives. The invention further relates to a method of reducing the level of zoonotic pathogens in manure, particularly throughout storage of manure. Finally, the invention also relates to methods for reducing greenhouse gas emissions.

[0004] Background

[0005] It is widely accepted that animal manure is an excellent organic fertilizer. For example, it is known that the addition of animal manure to soil can provide nutrients, such as phosphorous, potassium and nitrogen, which are essential for plant growth, neutralize soil acidity and increase the carbon content of soil. However, particularly during storage, animal manure is degraded by microorganisms leading to the emission of greenhouses gases (GHG) such as methane and nitrous oxide, as well as other gases, such as ammonia and hydrogen sulfide.

[0006] A number of mitigation strategies exist to reduce GHC emissions, including manure additives. The currently recommended and scientifically proven additive for odour and emissions reduction is sulfuric acid. Nevertheless, this compound may lead to operational hazards at the farm level and therefore requires a specific application system, which can be expensive. Other compounds, such as nitric acid, effectively reduce methane but lead to higher nitrogen emissions, particularly the greenhouse gas nitrous oxide.

[0007] Other products are commercially available, yet many do not demonstrate effectiveness based on scientific research. Their efficacy may be based on non-substantiated claims and farmer experiences. These additives consist of various chemical and biological compounds as well as minerals and other types of ingredients. The active ingredients are often not disclosed and the mode of action of the products remains unclear. Few commercially available additives are found to be effective in reducing odours and greenhouse gas emissions based on scientific evidence.

[0008] EP 3863 776 B1 relates to a method for treating organic waste comprising: contacting organic waste with a composition that is capable of generating a reactive species; wherein the composition comprises an oxidizing agent, and wherein the reactive species are generated from a source of iodide (G) and the oxidizing agent.

[0009] Biological degradation of manure is the breakdown by microbes (e.g. bacteria, archaea, fungi, etc.) of valuable and useful organic compounds into less valuable smaller organic compounds, which are then further degraded and lost from the waste as gases (e.g. CH4, NH3, CO2, N2, etc.). The larger organic compounds in non-degraded organic waste are useful and valuable because they can act as slow-release sources of fertilizing compounds and as fiber sources to improve biodiversity and soil health. There is therefore a need to provide methods for treating manure that reduce biological degradation.

[0010] Typical dosages of standard acidifying manure additives are in the range of 3-25 kg per m3(approximately 500-1000 kg with dry matter 5-10%) slurry every two to four weeks. For example: Sulfuric acid (H2SO4): 3.5-15 I for a target pH of 5.5; nitric acid (HNO3): IQ- 25 I for a target pH of 5.5; and acetic acid (CH3COOH): 3-14 I for a target pH of 5.5.

[0011] These additives function by acidifying the manure, which reduces microbial activity and diminishes emissions specifically from a pH of 5.5 and below. Although there is a large body of evidence demonstrating that manure acidification is efficient in managing emissions and odours, the operational costs and hazards limit a large-scale application.

[0012] Notwithstanding the above, animal manure is also recognized as a source of infectious agents, ranging from bacteria to protozoa to viruses, and can lead to zoonotic disease. In particular, when manure is applied to agricultural land, any pathogens within the manure can be transmitted to the soil, leach into waterways and ultimately contaminate crops intended for consumption, as well as the environment. As such, minimizing levels of zoonotic pathogens in manure and preventing the spread of such pathogens in the agricultural system is equally as important as reducing GHG emissions. It would therefore be desirable to prevent the spread or reduce the levels of harmful pathogens in manure. Such methods can be used to maintain or even improve soil health and consequently plant growth.

[0013] Any reference to prior art documents in this specification is not to be considered an admission that such prior art is widely known or forms part of the common general knowledge in the field.

[0014] Summary of the Invention

[0015] In one aspect of the invention, there is provided a manure additive comprising a combination of a microbial additive and at least one chemical additive, wherein the chemical additive is or comprises calcium cyanamide (CaCN2) and / or wherein the chemical additive is or comprises hydrogen peroxide (H2O2).

[0016] The microbial additive may comprise or consist of at least one bacteria and at least one fungus, wherein preferably, the microbial additive comprises at least one Bacillus bacteria and at least one Aspergillus fungus

[0017] In one embodiment, the manure additive comprises a microbial additive and a chemical additive, wherein the chemical additive is or comprises calcium cyanamide (CaCN2).

[0018] In an alternative embodiment, the manure additive comprises a microbial additive and a chemical additive, wherein the chemical additive is or comprises hydrogen peroxide (H2O2).

[0019] In an alternative embodiment, the manure additive comprises a microbial additive, a first chemical additive wherein the first chemical additive is or comprises hydrogen peroxide (H2O2), and a second chemical additive wherein the second chemical additive is or comprises calcium cyanamide (CaCN2).

[0020] In one embodiment, the manure additive comprises 0.5 - 1.7 wt. % calcium cyanamide (CaCN2), preferably 0.5 - 1.5 wt. % of calcium cyanamide (CaCN2).

[0021] In one embodiment, the manure additive comprises 5 - 15 wt. % of hydrogen peroxide (H2O2), preferably and 5.5 - 14.5 wt. % hydrogen peroxide (H2O2). In one embodiment, the manure additive may further comprise additives selected from the group consisting of calcium hydroxide, calcium carbonate, magnesium carbonate, or a combination thereof.

[0022] In another aspect of the invention, there is provided a method of maintaining or improving the health of manure-treated soil, the method comprising administering to the manure or the manure-treated soil, the combination of manure additives as described herein.

[0023] In one embodiment, maintaining the health of manure-treated soil comprises maintaining the level of one or more zoonotic pathogens in manure below a level harmful to human health. In another embodiment, improving the health of manure-treated soil comprises reducing the level of one or more zoonotic pathogen in manure below the level of the zoonotic pathogen present in untreated manure. Preferably, the zoonotic pathogen is selected from Escherichia coli and / or the genus Shigella.

[0024] In one embodiment, the method further comprises reducing the emission of at least one greenhouse gas from manure, wherein preferably the greenhouse gas is selected from nitrous oxide (NO2), methane (CH4) and carbon dioxide (CO2).

[0025] In another aspect of the invention, there is provided a method of reducing the level of at least one zoonotic pathogen in manure, the method comprising administering comprising administering to the manure or the manure-treated soil, the combination of manure additives as described herein.

[0026] In another (or additional) aspect of the invention, there is provided a method of reducing the level of at least one nitrifying bacteria in manure, or manure-treated soil, the method comprising administering to the manure or the manure-treated soil, the manure additive of the invention. In one embodiment, the nitrifying bacteria is selected from one or more of Nitrosomonas, Nitrosococcus, Nitrobacter, Nitrospira and Nitrospina.

[0027] In another (or additional) aspect of the invention, there is provided a method of reducing the level of at least one nitrifying bacteria in manure, or manure-treated soil, the method comprising administering to the manure or the manure-treated soil, the manure additive of the invention. In one embodiment, the nitrifying bacteria is selected from one or more of Nitrosomonas, Nitrosococcus, Nitrobacter, Nitrospira and Nitrospina. In another aspect of the invention, there is provided a method of reducing the level of at least one methanogen in manure, or manure-treated soil, the method comprising administering to the manure or the manure-treated soil, the manure additive of the invention.

[0028] In one embodiment, the methanogen is selected from Candidatus Methanogranum, Candidatus Methanoperedens, Candidatus Methanoplasma, Methanobrevibacter, Methanocorpusculum, Methanolobus, Methanomethylovorans and Methanomicrobium. In another embodiment, the methanogen is selected from an aerobic methanotrophic bacteria, preferably selected from Methylobacter, Methylocaldum, Methylocystis, Methylogaea, Methylomonas, Methyloterricola and Methylovulum.

[0029] Brief Description of the figures

[0030] The invention is further described in the following non-limiting figures:

[0031] Figure 1 shows a selection of samples for pathogenic and amplicon analyses from treatments and controls.

[0032] Figure 2 shows a displaying the counts of the colony-forming unit per grams (cfu / g) of those microorganisms that were analysed in the laboratory in manure and soil. CFU: colony forming units.T0Pathogens analysed at time 0 of manure mixed with soil.T23Pathogens analysed after 23 days of manure mixed with soil.0 / o(S'TO)% removal of pathogens at TO compared to original slurry S1-6.%<S-T23) % removal of pathogens at T23 compared to original slurry S1-6. ND: not detected. CN is calcium cyanamide (CaCN2), HO is hydrogen peroxide (H2O2), HS is Sulfuric acid (H2SO4), MA is a microbial additive, and MACNHO is combination of hydrogen peroxide (H2O2), a microbial additive, and calcium cyanamide (CaCN2).

[0033] Figure 3 shows a table displaying the relative abundance of main pathogens genera detected via amplicon sequencing.aPathogens analysed at time 0.bPathogens analysed at time 23.c% removal of pathogens in treatments compared to untreated manure at time 0.d% removal of pathogens of the same treatment from time 23 compared to time 0. * This indicates that significant differences were found using an ANOVA test at p<0.05. CN is calcium cyanamide (CaCN2), HO is hydrogen peroxide (H2O2), MA is a microbial additive, MACN is a combination of calcium cyanamide (CaCN2) and a microbial additive, MAHO is a combination of hydrogen peroxide (H2O2) and a microbial additive, and MACNHO is combination of hydrogen peroxide (H2O2), a microbial additive, and calcium cyanamide (CaCIXh) .

[0034] Figure 4 shows levels of nitrous oxide emissions using different manure additives.

[0035] Figure 5 shows levels of methane emissions using different manure additives.

[0036] Figure 6 shows levels of carbon dioxide emissions using different manure additives.

[0037] Figure 7 shows changes in manure microbiome by the addition of additives from metagenome sequencing.aNitrifying genera analysed via shotgun in the original slurry (time 0).bNitrifying genera analysed via shotgun after the storage for 28 days (UM) and treatment for 28 days.c% removal of nitrifying genera in UM and treatments compared to slurry at time 0.d% removal of nitrifying genera in treatments compared to the untreated manure of each trial at time 28. * This indicates that significant differences were found using a Post-hoc Games-Howell test at p<0.05.

[0038] Figure 8 shows the activity of different Bacteria genus.

[0039] Figure 9A is a schematic of the methane cycle. Figure 26B is a schematic of methane metabolism by different microorganisms.

[0040] Figure 10 shows methanogenic archeal genera detected via shotgun metagenomics, a Methanogenic genera analysed via shotgun in the original slurry (time 0). b Methanogenic genera analysed via shotgun after the storage for 28 days (UM) and treatment for 28 days, c % removal of methanogenic genera in UM and treatments compared to slurry at time 0. d % removal of methanogenic genera in treatments compared to the untreated manure of each trial at time 28. * This indicates that significant differences were found using a Post-hoc Games-Howell test at p<0.05. CN is calcium cyanamide (CaCN2), CN is calcium cyanamide (CaCN2), HO is hydrogen peroxide (H2O2), MA is a microbial additive, MACN is a combination of calcium cyanamide (CaCN2) and a microbial additive, MAHO is a combination of hydrogen peroxide (H2O2) and a microbial additive, and MACNHO is combination of hydrogen peroxide (H2O2), a microbial additive, and calcium cyanamide (CaCN2).

[0041] Figure 11 shows aerobic methanotrophic genera detected via shotgun metagenomics.aAerobic methanotrophic genera analysed via shotgun in the original slurry (time 0).b Aerobic methanotrophic genera analysed via shotgun after the storage for 28 days (UM) and treatment for 28 days.c% removal of methanotrophic genera in UM and treatments compared to slurry at time 0.d% removal of methanotrophic genera in treatments compared to the untreated manure of each trial at time 28. * This indicates that significant differences were found using a Post-hoc Games-Howell test at p<0.05. CN is calcium cyanamide (CaCIXh), HO is hydrogen peroxide (H2O2), MA is a microbial additive, MACN is a combination of calcium cyanamide (CaCIXh) and a microbial additive, MAHO is a combination of hydrogen peroxide (H2O2) and a microbial additive, and MACNHO is combination of hydrogen peroxide (H2O2), a microbial additive, and calcium cyanamide (CaCN2).

[0042] Detailed description of the invention

[0043] The following embodiments apply to all aspects of the invention.

[0044] The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.

[0045] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botany, microbiology, tissue culture, molecular biology, chemistry and biochemistry, which are within the skill of the art. Such techniques are explained fully in the literature.

[0046] The objective of the present invention is to maintain or improve the health of manure treated soil, in particular through the management of zoonotic pathogens in the manure. A further objective of the invention is to reduce greenhouse gas emissions from manure or manure-treated soil. Through these combinations of benefits, the invention provides a method of reducing any environmental impact of manure. Or put another way, the invention maximises the agricultural and environmental benefits of manure. It is hoped that the above additional benefits, in combination with an improvement to soil health, will facilitate a broader adoption of this technology.

[0047] Accordingly, in one aspect of the invention, there is provided a manure additive comprising a microbial additive and at least one chemical additive. In one embodiment, the microbial additive comprises or consists of at least one bacteria and at least one fungus.

[0048] In one embodiment, the at least one bacteria comprises at least one bacteria selected from the Bacillus genus. In a further embodiment, the microbial additive also comprises at least one further bacteria selected from Brevibacillus and Bacillales.

[0049] In one embodiment, the at least one fungus is selected from the genus Aspergillus. In a further embodiment, the microbial additive also comprises at least one fungus selected from the following fungal genera: Candida, Meyerozyma, Exobasidiomycetes and Pleosporales.

[0050] A microbial additive comprising at least one Bacillus bacteria and at least one Aspergillus fungus may be referred to herein as “MA”.

[0051] In one embodiment, the microbial additive may comprise at least one bacteria selected from each of Bacillus, Brevibacillus and Bacillales and at least on fungus selected from each of Aspergillus, Candida, Meyerozyma, Exobasidiomycetes and Pleosporales.

[0052] In another embodiment, the chemical additive is or comprises calcium cyanamide (CaCN2), which may be referred to in the Examples and Figures as “CN”. In an alternative embodiment, the chemical additive is or comprises hydrogen peroxide (H2O2), which may be referred to in the Examples and Figures as “HO”.

[0053] Accordingly, in one embodiment, there is provided a manure additive comprising or consisting of a microbial additive, as described above and a chemical additive that is or comprises calcium cyanamide (CaCIXh). This combination may be referred to the Examples and Figures as “MACN”.

[0054] In another embodiment, there is provided a manure additive comprising or consisting of a microbial additive, as described above and a chemical additive that is or comprises hydrogen peroxide (H2O2). This combination may be referred to the Examples and Figures as “MAHO”.

[0055] In a further embodiment, there is provided a manure additive comprising or consisting of a microbial additive, as described above and a chemical additive that is or comprises hydrogen peroxide (H2O2) and a chemical additive that is or comprises calcium cyanamide (CaCIXh). This combination may be referred to the Examples and Figures as “MACNHO”.

[0056] In any of the above-described embodiments, the manure additive according to the invention may comprise 5 - 15 wt. % of hydrogen peroxide (H2O2), preferably 5.5 - 14.5 wt. % of hydrogen peroxide (H2O2). In one embodiment, the amount of hydrogen peroxide added in at least 75%, or at least 50%, or at least 25% of the recommended dose of hydrogen peroxide. The recommended dose is shown in Table 1.

[0057] In any of the above-described embodiments, the manure additive may comprise 0.5 - 1.7 wt. % calcium cyanamide (CaCN2), preferably 0.5 - 1.5 wt. % of calcium cyanamide (CaCN2). In another preferred embodiment of the invention, the manure additive comprises 0.5 - 1.4 wt. % of calcium cyanamide (CaCN2). In one embodiment, the amount of hydrogen peroxide added in at least 75%, or at least 50%, or at least 25% of the recommended dose of hydrogen peroxide. The recommended dose is shown in Table 2.

[0058] In one embodiment, the method may comprise adding 0.17 - 0.35g of calcium cyanamide (CaCN2), preferably, 0.17 - 0.3g of calcium cyanamide (CaCN2) per 1kg manure.

[0059] In another embodiment, the method may comprise adding 1 .7-3.5g of hydrogen peroxide (H2O2), preferably 1.7 - 2.8g of hydrogen peroxide (H2O2) per 1kg manure.

[0060] The manure additive according to the invention may be in a liquid or powder form.

[0061] The first and second manure, and optionally third manure additives may be added (or administered, such terms are interchangeable) to the manure sequentially or concurrently. The manure may then be added to soil in a desired ratio. In one embodiment, the manure and at least one manure additive is distributed onto fields, preferably by spray irrigation, surface spreading, injection, or broadcasting.

[0062] The chemical additives may be added to the manure first and mixed thoroughly, and the microbial additive is added subsequently - or vice versa. The mixture is appropriately added to the respective amount of manure. Furthermore, the manure additive according to the invention may comprise additives selected from the group consisting of calcium hydroxide, calcium carbonate, magnesium carbonate, or a combination thereof. The manure additive may be mixed with other components before the distribution of the manure additive into the manure. The manure additive may also comprise a filler.

[0063] In the present context, manure preferably refers to livestock manure from ruminants and swine, chicken manure. Preferably, the manure is cow manure.

[0064] The manure may be stored for a period of time before being added to the soil. For example, the manure may be stored for at least 1 , at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10 weeks before being added to the soil to be treated. The manure may be stored under anaerobic or aerobic conditions.

[0065] In a further aspect of the invention, there is provided a method of maintaining or improving the health of manure-treated soil, the method comprising administering a manure additive comprising a microbial additive and at least one chemical additive, as described above, to manure or manure-treated soil. In other words, there is provided a method of improving the safety of manure using a manure additive comprising a microbial additive and at least one chemical additive, as described above.

[0066] Soil health is defined as “the continued capacity of soil to function as a living ecosystem that sustains plants, animals, and humans”. As discussed above, manure is an excellent fertilizer and can significantly contribute to soil health. However, pathogens, and in particular bacterial pathogens, within manure can negatively affect soil health, and lead to disease in humans and animals.

[0067] By “maintaining” soil health is meant that the addition of the at least one manure additive as described herein does not increase the number of at least one (type of) pathogen and in particular zoonotic pathogens, in the manure, or the manure-treated soil. The number or level of pathogens in a manure or manure-treated soil sample can be determined using standard techniques in the art. For example, using the methods described in the example section, which describe determining pathogen numbers using wet lab techniques to establish the numbers of colony forming units / g. Alternatively, culture-free methods, such as metagenomics next generation sequencing may be used to identify pathogens in a sample. Alternative techniques would also be known to the skilled person. By “improving” soil health is meant that the addition of at least one manure additive as described herein decreases the number of at least one (type of) pathogen, and in particular zoonotic pathogens, in the manure or the manure-treated soil. Again, the number of level of pathogens in a manure or manure-treated soil sample can be determined using standard techniques in the art. By a “decrease” herein may be meant a decrease of at least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more, or 100% compared to level or number of pathogens in the slurry, manure or the manure-treated soil without any manure additives.

[0068] In another aspect of the invention, there is provided a method of reducing the level of one or more zoonotic pathogens in manure, the method comprising administering a manure additive comprising a microbial additive and at least one chemical additive, as described above, to manure or manure-treated soil. The level of a given bacterium (bacteria) may be measured by measuring colony-forming units per gram of substrate (e.g. manure or manure-treated soil). Alternatively, levels of a given bacterium (bacteria) may be measured using an amplicon based sequencing method or shotgun metagenomics sequencing methods.

[0069] By “zoonotic pathogen” is meant any pathogen that is capable of causing disease in humans or animals. There are several bacterial pathogens present in manure that are capable of causing disease in humans. In one embodiment, the pathogen is bacteria, such as Escherichia coli, Listeria, Campylobacter, Salmonella, Escherichia, Yersinia, Klebsiella, Enterobacter, Citrobacter and Staphylococcus.

[0070] In one embodiment, the pathogen is Escherichia coli. In another embodiment, the pathogen is selected from the Shigella genus, such as Shigella dysenteriae, Shigella flexneri, Shigella boydii and Shigella sonnei.

[0071] In one embodiment, the pathogen is Escherichia coli. For example, the Escherichia coli may be the strain O157:H7.

[0072] In a further or additional aspect of the invention, there is provided a method of reducing the emission of at least one greenhouse gas (GHG), the method comprising administering a manure additive comprising a microbial additive and at least one chemical additive, as described above, to manure or manure-treated soil. Advantageously, while prior art products are able to address only one of these challenges associated with manure application - e.g. greenhouse emission reduction (and associated odours) or management of levels of zoonotic pathogens in manure, the present invention addresses both these aspects simultaneously.

[0073] The Applicant has also found that the effect of addition of at least two of the described additives on greenhouse gas emissions is synergistic. That is, the effect of a combination of at least two manure additives selected from a microbial additive and a chemical additive, as described above, on GHG emission is greater than the effect of any one of calcium cyanamide (CaCIXh), hydrogen peroxide (H2O2) or a microbial additive alone. This synergy means that each additive can be applied at a much lower amount than the amount ordinarily applied to achieve the same effect on GHG emissions with a single additive. This is particularly important because the additives can be hazardous to handle. As such, lower doses are also safer for the user.

[0074] Thus, this invention addresses the major problems related to long-term livestock manure storage by leveraging the synergistic effects of the combination of additives. These additives consistently limit the production of GHG emissions compared to the control at anaerobic, aerobic, and atmospheric conditions. Additionally, the selected combination at BELOW the STANDARD dose also diminishes unwanted odors from manure storage.

[0075] Thus, application of the combination of manure additives of the invention to manure also provides the following additional benefits:

[0076] 1) Greenhouse gases and odours are reduced under atmospheric conditions

[0077] 2) Greenhouse gases and odours are reduced under anaerobic conditions

[0078] 3) Greenhouse gases and odours are reduced under aerobic conditions

[0079] 4) Nitrogen and carbon is retained in the manure due to reduced emissions

[0080] 5) Ammonia (NH3) fixation improved increasing further the fertilizing power of manure

[0081] 6) Reduction of odours because of lower hydrogen sulfide (H2S) emissions

[0082] In one embodiment, the greenhouse gas (GHG) may be selected from one or more of nitrous oxide (N2O), methane (CH4) and carbon dioxide (CO2), hydrogen sulphide (H2S), ammonia (NH3) and nitrogen (N2) or a combination thereof. In one embodiment, the GHG is nitrous oxide. By a “reduction in GHG emissions” is meant a reduction of at least one green-house gas by least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% or more, compared to the level of at least one greenhouse gas emitted from slurry, untreated manure or manure-treated soil. The level of a greenhouse gas can be measured using standard techniques in the art. In one embodiment, the at least one greenhouse gas may be reduced in strict anaerobic or aerobic conditions, or atmospheric conditions.

[0083] In an further aspect, the invention also provides a method of reducing the level of at least one nitrifying bacteria in manure, or manure-treated soil, the method comprising administering to the manure or the manure-treated soil, the manure additive of the invention. For example, the nitrifying bacteria may be selected from one or more of Nitrosomonas, Nitrosococcus, Nitrobacter, Nitrospira and Nitrospina. By a “reduction in the level of ” is meant a reduction of least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more, or 100% or more compared to the level of at least of the same nitrifying bacteria in slurry, untreated manure or manure- treated soil. Alternatively, or additionally, the method may comprise increasing the level of Nitrococcus. By a “increase in the level of ” is meant an increase of least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99%, 100% or more, compared to the level of at least of the same nitrifying bacteria in slurry, untreated manure or manure-treated soil.

[0084] In another aspect of the invention, there is provided a method of reducing the level of at least one methanogen (or methane producing microbe) in slurry, manure, or manure- treated soil, the method comprising administering to the manure or the manure-treated soil, the manure additive of the invention. For example, the methanogen may be selected from Candidatus Methanogranum, Candidatus Methanoperedens, Candidatus Methanoplasma, Methanobrevibacter, Methanocorpusculum, Methanolobus, Methanomet hylovorans and Methanomicrobium. Alternatively, the methanogen is selected from an aerobic methanotrophic bacteria, preferably selected from Methylobacter, Methylocaldum, Methylocystis, Methylogaea, Methylomonas, Methyloterricola and Methylovulum. By a “reduction in the level of ” is meant a reduction of least 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, 99% or more, or 100% or more compared to the level of at least of the same nitrifying bacteria in slurry, untreated manure or manure-treated soil. The level of a given bacterium (bacteria) may be measured by measuring colony-forming units per gram of substrate (e.g. manure or manure-treated soil). Alternatively, levels of a given bacterium (bacteria) may be measured using an amplicon based sequencing method or shotgun metagenomics sequencing methods.

[0085] In summary, this invention addresses the major problems related to long-term livestock manure storage by leveraging the synergistic effect on GHG emissions achieved when the above-described manure additives are combined, together with the effect of these combinations of manure additives on zoonotic pathogen levels. Hence, this invention can not only reduce the carbon footprint associated with livestock farming, but can also positively contribute to soil health, ensuing benefits on plant growth and crop production.

[0086] While the foregoing disclosure provides a general description of the subject matter encompassed within the scope of the present invention, including methods, as well as the best mode thereof, of making and using this invention, the following examples are provided to further enable those skilled in the art to practice this invention and to provide a complete written description thereof. However, those skilled in the art will appreciate that the specifics of these examples should not be read as limiting on the invention, the scope of which should be apprehended from the claims and equivalents thereof appended to this disclosure. Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure.

[0087] Unless context dictates otherwise, the descriptions and definitions of the features set out above are not limited to any particular aspect or embodiment of the invention and apply equally to all aspects and embodiments, which are described.

[0088] The invention is now described in the following non-limiting examples.

[0089] Example 1

[0090] 1.1. Materials and methods : Experimental design

[0091] Over the course of a year, six batches of fresh manure, containing both faeces and urine, were collected, covering all seasonal periods (autumn, winter, spring, and summer). All assays were performed batch wise under aerobic conditions in 2.1-L gas-tight bottles sealed with butyl-septa and aluminium screw caps (Fisher Scientific, France). The assays were conducted in duplicate with controls and additives to study the effect of treated and untreated manure on GHG emissions, physicochemical parameters, and microbial communities via shotgun metagenomics. The incubation was carried out at 25°C for a duration of 28 days. At the end of the 28-day incubation period, the stored manure, both treated and untreated, was mixed with 50% universal substrate for plants. This mixture was used for grass growth assays and to analyse pathogenic and microbial communities via cultivation methods and amplicon sequencing after the 28-day storage period. For pathogenic analysis, duplicates of each control and treatment, as well as the original fresh manure, were sent as the initial point (Day 0). For community assessment, biological triplicates were sent for amplicon sequencing after each treatment as the initial point (Day 0). The grass growth assays were conducted for 23 days. Upon completion, new samples in duplicate were sent for pathogenic assessment, and biological triplicates were taken for DNA extraction and amplicon sequencing (Day 23). Figure 1 depicts the workflow followed during this research.

[0092] 1.2 Pathogens analysis through cultivation methods

[0093] The pathogenic species analysed were selected based on the European legislation's maximum limits for microorganisms in growing media of organic origin and fertilizers (ECDC), 2019). The targeted pathogen was Escherichia coli. Samples of fresh manure, and of the mixture of the stored manure with plant substrate (Day 0) and at the end of the growth assay (Day 23) were sent for their analysis to the quality control and analysis laboratory (Labdial, Spain). E. coli detection employed the ISO-GRID hydrophobic grid membrane filter method. The membrane filter, retaining bacterial cells, was subsequently incubated on SD-39 agar medium. For enzymatic enhancement, 5 mL of a 10-fold diluted homogenate was combined with 1 mL of B-glucuronidase and incubated for 20-30 minutes in a water bath at 35°C. The detection and quantification of E. coli is represented as colony-forming units per gram of substrate (CFU -g-1).

[0094] 1.3 Amplicon metagenomic analysis of the microbial community

[0095] The community structure of the bacterial biomass present in the control samples and treated samples was determined at the end of the GHG assay after mixing 50:50 % (v / v) of the stored manure and the substrate for plants (Time 0) and at the end of the growth assay (Time 23). The DNA was extracted from each biological triplicate with a FastDNA™ SPIN Kit for Soil (MP Biomedicals, USA). PCR amplification of regions 16S- V4-V5 was performed with the primers GTGCCAGCMGCCGCGGTAA (SEQ ID NO: 1), CCGTCAATTCCTTTGAGTTT (SEQ ID NO: 2) connecting with barcodes. Libraries were checked with Qubit and real-time PCR for quantification, while a bioanalyzer was used for size distribution detection. Quantified libraries were pooled and sequenced on a paired-end Illumina platform to generate 250bp paired-end raw reads in Novogene UK (Cambridge, UK). Paired- end reads were assigned to samples based on their unique barcodes and truncated by cutting off the barcodes and primer sequences. The whole process was performed through Python (V3.6.13) and adaptors were removed through cutadapt (V3.3). Paired-end reads were merged using FLASH (V1.2.11 , http: / / ccb.jhu.edu / software / FLASH / ; Magoc & Salzberg, 2011). Data filtration and chimera removal were performed using the fastp (VO.23.1) software and the UCHIME Algorithm (http: / / www.drive5.com / usearch / manual / uchime_algo.html) (Edgar et al., 2011). Clustering of the sequences into Operational Taxonomic Units (OTUs) was based on the gene reference database SILVA (V138.1) and the ribosomal data base project (V18) (Quast et al., 2013) using QIIME (V 1.9.1). The sequences obtained have been deposited in Genbank as Bioproject PRJNA1020663. Bar graphs and heatmaps were plotted with R using the package ggplot2 (Wickham et al., 2019) and R pheatmap (Kolde, 2019). Alpha diversity was calculated with QIIME (V 1.9.1) and displayed with R software (V 4.0.3) (Bolyen et al., 2018). Function prediction according to marker genes was performed with the R package PICRUSt2 (V2.3.0) (Douglas et al., 2020).

[0096] Based on literature searches across multiple articles and databases such as Integrated Microbial Genomes and Microbiomes (IMG / M) of the Joint Genome Institute (JGI), and the laboratory results for the detection and quantification of pathogenic bacteria and protozoa through cultivation methods. The .txt files with the species and genes relative abundance (Unigenes. relative. ko / ec.xls & Unigenes. relative. s.xls) were analysed using RStudio software. Some RScript were designed using package “Tidyverse” (Wickham et al., 2019), while heatmaps were performed with the function “pheatmap” (version 1.0.12) (Kolde, 2019). Moreover, a sequence similarity search of E. coli toxin genes in proteins predicted from metagenomics data was performed. A blast database was created with each of the 2 toxin files using the following command line: “makeblastdb -dbtype prot -in toxins. file -out toxins”. For each protein sequence file in each metagenomics sample, the following BlastP command line was run: “blastp -query sample. protein. fa -out sample. protein_vs_toxins.blastP-best-hit.tab” -db toxins -outfmt '6 qaccver saccver pident length qstart qend qlen sstart send slen evalue bitscore stitle' -max_target_seqs 1 -evalue 1e-3 -qcov_hsp_perc 80 -num_threads 16. Then, the results file for all replicates of an experiment were merged. On the merged files, query coverage and subject coverage added, filtered with the following thresholds: percent identity (pident) > 80%, query coverage (qcov) > 70% and subject coverage (scov) > 70%.

[0097] 1.4 Methods for measuring greenhouse gas emissions All laboratory tests are performed batch-wise under both aerobic and anaerobic conditions and three different dosages in duplicate in 2.1 I gas-tight bottles. The additive is applied to 1.5 kg of fresh manure contained in 10 I vessels. Then, 20 g of the mixture (manure + additive) is transferred into 2.1 I bottles. The headspace atmosphere of anaerobic tests is flushed with nitrogen gas (N2) for at least 10 minutes. Afterwards, both aerobic and anaerobic bottles are pressurized up to 500 mbar using compressed air and N2, respectively. Headspace conditions are restored by flushing and pressurization whenever the pressure drops under 100 mbar and / or oxygen (O2) concentration drops below 10 % for aerobic tests. Trials are run together with controls (untreated manure with no presence of additive) in a temperature-controlled room at 25°C for 28 days.

[0098] 1.5 Trial design; application dosages

[0099] Table 1 : Application dosages of hydrogen peroxide (H2O2) for 1.5 kg of manure.

[0100] Considerations: Hydrogen peroxide (H2O2) is applied directly to the manure and stirred vigorously.

[0101] Table 2: Application dosages of calcium cyanamide (CaCIXh) for 1.5 kg of manure.

[0102] Considerations: Calcium cyanamide (CaCIXh) is crushed / ground before application.

[0103] Table 3: Characterization of the fresh manure pH 7.34 ± 0.01

[0104] Total solids (%) 21.8 ± 0.5

[0105] Volatile solids (%) 9.4 ± 0.2

[0106] N-NH4+(mg kg-1 sample) 2026.9 ± 50.0

[0107] TKN (g kg-1 sample) 4.9 ± 0.2 CODt (g O2L-1) 121.8 ± 1.9

[0108] NO , NO3- (mg L-1) 0

[0109] 2. Results:

[0110] As raw manure samples were not analysed by amplicon, they were omitted from the shotgun results for this analysis.

[0111] CN is calcium cyanamide (CaCN2), HO is hydrogen peroxide (H2O2), HS is Sulfuric acid (H2SO4), MA is a microbial additive, MACN is a combination of calcium cyanamide (CaCN2) and a microbial additive, MAHO is a combination of hydrogen peroxide (H2O2) and a microbial additive, and MACN HO is combination of hydrogen peroxide (H2O2), a microbial additive, and calcium cyanamide (CaCN2) .

[0112] 2.1 Pathogenic protozoa and zoonotic bacteria via cultivation

[0113] In Figure 2 the logarithm of the colony forming units per gram (CFU / g) of E. coli analysed in the laboratory through cultivation is depicted, displaying together their abundance at time 0 (beginning of the growth assay) and time 23 (end of the growth assay). The level of Campylobacter found was below the maximum limits of these microorganisms in growing media of organic origin and fertilizers (Campylobacter. 101 38 log (<25) CFU / g).

[0114] As shown in Figure 2, E. coli was undetectable at T23 in the manure mixed with soil and treated with a combination of a microbial additive, hydrogen peroxide (H2O2) and calcium cyanamide (CaCN2) (MACNHO). That is, the level of reduction from TO to T23 in the manure treated with MACNHO was 100%. This result was not observed in any of the controls - e.g. the untreated manure, or in either the hydrogen peroxide (H2O2) (HO) only or calcium cyanamide (CaCN2)(CN) only treated samples, where E. coli could still capable be detected at T23. Of further note, levels of pathogenic E. coli actually increased in the samples treated with sulfuric acid (H2SO4), which is currently the recommended additive for reducing odour and greenhouse gas emissions. As such, the present invention provides a significant advantage over the currently approved manure additives.

[0115] Pathogenic zoonotic bacteria via amplicon In Figure 3 it can be seen that the relative abundance of Escherichia-Shigella genera was high before the growth assay, taking its highest values in the H2SO4 treatment (1.86 ± 6.28- 10'1%) and the combined treatment of calcium cyanamide (CaCN2) and hydrogen peroxide (H2O2) (referred to herein as EMG) (1.7 ± 4.12 - 1 O'1%). However, its levels decreased after the end of the growth assay. In terms of Campylobacter genera, its relative abundance was nearly null, before and after the growth assay. T2 here represents T23, as described above.

[0116] As shown in Figure 3, the level of reduction of E.coli amplicons from TO to T23 in the manure treated with MACN was 88.5%, 89.9% with MAHO and 91.5% with MACNHO.

[0117] This level of reduction was significantly higher than that seen in the controls - e.g. the untreated manure, or in the microbial additive (MA)-only treated samples or the calcium cyanamide (CaCN2)(CN) only treated samples.

[0118] Conclusion

[0119] In all cases, pathogens were not detected at a dangerous level in the treated manure or soil mixed with the treated manure. In general, the treated manure had lower doses of potential pathogens as detected from all techniques in comparison to the untreated manure and therefore the treatment of manure with additives brings a microbial safety effect.

[0120] 2.2 . Reduction of greenhouse gases

[0121] CH4, CO2, and O2concentrations of 100 pL samples drawn from the headspace with a Hamilton® GASTIGHT® syringe (Hamilton Co., USA) were analysed in an Agilent 8860 gas chromatograph (GC) coupled with a thermal conductivity detector (TCD) (Agilent, Santa Clara, USA). The GC-TCD was equipped with a Varian CP-Molsieve 5A capillary column (15 m x 0.53 mm x 15 pm) interconnected with a Varian CPPoreBOND Q capillary column (25 m x 0.53 mm x 10 pm). The oven, injector, and TCD detector temperatures were maintained at 55, 150, and 200 °C, respectively. Helium was used as the carrier gas at 20 mL min-1.

[0122] N2O gas concentration was determined using a Bruker Scion 436 gas chromatograph (Palo Alto, USA) equipped with an Electron Capture Detector and a HS-Q packed column (1m x 2 mm ID x 3.18 mm OD) (Bruker, USA). Injector, detector, and oven temperatures were set at 50, 300, and 50°C, respectively. As shown in Figure 4, N2O emissions represented the highest values in the treatments with MA (Bioma) (1.65 ± 0 mg -g'1), Bioprana (1.18 ± 0.2 mg -g'1) and Biochar (0.22 ± 0.07 mg -g'1) additives. In contrast, CN and its combinations did not show N2O emissions (0 mg -g-1), with the exception of the triple combination (MACNHO), which showed low N2O emissions (0.023 ± 0.006 mg -g'1).

[0123] After the batch test in 2.1 L gas-tight bottles, CH4emissions and the different species of volatile fatty acids (VFAs) were analysed. As shown in Figure 5 Biochar treatment produce the highest emissions of CH4(Figure 5 0.30 ± 0.01 mg - L1). On the other hand, Figure 5 shows that HO completely inhibited CH4production (0 mg - L1), while in combination (MAHO = 0.02 ± 0.01 mg - L1and EMG = 0.01 mg - L1, MACNHO= 0.06 ± 0.02 mg - L1) exhibited lower emissions to their controls. Regarding CN treatment, its emissions are lower to its control alone and in combination with MA (0.2 ± 0.01 and 0.11 ± 0.03 mg - L1, respectively).

[0124] As shown in Figure 6, CN (57.7 ± 0.85 mg / g) and its combinations (EMG = 56 ± 2.65 mg / g, MACN = 58.3 ± 2.82 mg / g, MACNHO = 69.1 ± 2.65 mg / g) have the lowest CO2 emissions.

[0125] As shown in Figure 8, a reduction in the levels of the bacteria Nitrosomonas and / or Nitrosococcus lead to a reduction or mitigation in N2O formation. Similarly, a reduction in Nitrobacter, Nitrospira and / or Nitrospina lead to a reduction or mitigation of N2O formation, whereas, conversely, the presence of Nitrococcus is favorable for mitigating N2O formation as it produces Nitrite. As shown in Figure 7, CN alone, as well as the combination of the manure additives MACNHO, MACN and MAHO reduced levels of the nitrifying bacteria Nitrosomonas, Nitrospira, Nitrosococcus, Nitrobacter, and Nitrospina compared to controls (i.e slurry or untreated manure). This is shown as an increase in % reduction from untreated manure to treated manure at T28. As also shown in Figure 7, the combination of the manure additives MACNHO and MAHO also increased levels of Nitrococcus compared to untreated manure (shown as a less than 0% reduction in levels).

[0126] In summary, the combination “MACN” when used as a manure additive led to a notable absence of N2O production. The Applicant has further found that this effect arises, in part at least, from an effect of CN on ammonia monooxygenase, which reduced the presence of denitrifiers, such as Nitrosomonas and Nitrosococcus genera. This combination also decreased methane emissions. As CN alone inhibits aerobic methanotrophy, the reduction in methane consumption cannot explain this decrease. It may be that an increase in pH promoted by CN reduced methanogenic activity. The combination “MAHO” also decreased N2O emissions, in part from the effect of MA, which promotes the growth of nitrifying and denitrifying bacteria, such as Nitrosomonas and Nitrosococcus, and enhances their metabolism, including the genes needed to oxidize NH4+(amoC) and produce N2O (norB). In addition, in this combination, methane emissions were completed inhibited. The inhibition observed in this case may come from the strong oxidative character of HO that inhibited anaerobic organisms. This was observed by the reduction of volatile fatty acids (VFAs) formation and lack of methane production even if methanogens were present.

Claims

22CLAIMS:1 . A manure additive comprising a combination of a microbial additive and at least one chemical additive, wherein the chemical additive is or comprises calcium cyanamide (CaCN2) and / or wherein the chemical additive is or comprises hydrogen peroxide (H2O2).

2. The manure additive of claim 1 , wherein the microbial additive comprises at least one bacteria and at least one fungus, wherein preferably, the microbial additive comprises at least one Bacillus bacteria and at least one Aspergillus fungus3. The manure additive of claim 1 or 2, wherein the manure additive comprises a microbial additive and a chemical additive, wherein the chemical additive is or comprises calcium cyanamide (CaCN2).

4. The manure additive of claim 1 or 2, wherein the manure additive comprises a microbial additive and a chemical additive, wherein the chemical additive is or comprises hydrogen peroxide (H2O2).

5. The manure additive of claim 1 or 2, wherein the manure additive comprises a microbial additive, a first chemical additive wherein the first chemical additive is or comprises hydrogen peroxide (H2O2), and a second chemical additive wherein the second chemical additive is or comprises calcium cyanamide (CaCN2).

6. The manure additive of claim 3 or 5, wherein the manure additive comprises 0.5 - 1.7 wt. % calcium cyanamide (CaCN2), preferably 0.5 - 1.5 wt. % of calcium cyanamide (CaCN2).

7. The manure additive of claim 4 or 5, wherein the manure additive comprises 5 - 15 wt. % of hydrogen peroxide (H2O2), preferably and 5.5 - 14.5 wt. % hydrogen peroxide (H2O2).

8. A method of maintaining or improving the health of manure-treated soil, the method comprising administering to the manure or the manure-treated soil, the manure additive of any of claims 1 to 7.

9. The method of claim 8, wherein maintaining the health of manure-treated soil comprises maintaining the level of one or more zoonotic pathogens in manure below a level harmful to human health.

10. The method of claim 8, wherein improving the health of manure-treated soil comprises reducing the level of one or more zoonotic pathogen in manure below the level of the zoonotic pathogen present in untreated manure.11 . The method of any of claims 8 to 10, wherein the zoonotic pathogen is selected from Escherichia coli and / or the genus Shigella.

12. The method of any of claims 8 to 11 , wherein the method further comprises reducing the emission of at least one greenhouse gas from manure, wherein preferably the greenhouse gas is selected from nitrous oxide (NO2), methane (CH4) and carbon dioxide (CO2).

13. A method of reducing the level of at least one zoonotic pathogen in manure, the method comprising administering to the manure or the manure-treated soil, the manure additive of any of claims 1 to 7.

14. A method of reducing the level of at least one nitrifying bacteria in manure, or manure-treated soil, the method comprising administering to the manure or the manure-treated soil, the manure additive of any of claims 1 to 7.

15. The method of claim 14, wherein the nitrifying bacteria is selected from one or more of Nitrosomonas, Nitrosococcus, Nitrobacter, Nitrospira and Nitrospina.

16. A method of reducing the level of at least one methanogen in manure, or manure- treated soil, the method comprising administering to the manure or the manure- treated soil, the manure additive of any of claims 1 to 7.

17. The method of claim 16, wherein the methanogen is selected from Candidatus Methanogranum, Candidatus Methanoperedens, Candidatus Methanoplasma, Methanobrevibacter, Methanocorpusculum, Methanolobus, Methanomethylovorans and Methanomicrobium, or wherein the methanogen is selected from an aerobic methanotrophic bacteria, preferably selected fromMethylobacter, Methylocaldum, Methylocystis, Methylogaea, Methylomonas, Methyloterricola and Methylovulum.

18. An organic fertilizer comprising manure and manure additive according to claims 1 to 7.