Ultra-efficient integration of gene libraries onto yeast cytosolic plasmids

Abstract

High-efficiency integration of genes of interest (GOIs) onto the p1 plasmid used in the OrthoRep system is achieved utilizing recombinases for site-specific recombination. This method significantly increases the efficiency and consistency of GOI integration onto p1, enabling seamless recombination in the cytoplasm of Saccharomyces cerevisiae, bypassing the inefficiencies associated with the native nuclear recombination machinery. This accelerates the process of preparing yeast cells for directed evolution experiments, and enhances the uniformity of gene library representation, which is important for exploring diverse fitness landscapes. The use of recombinases enables rapid, site-specific integration, which reduces waiting times for colony formation and increases overall throughput. Moreover, this method is not limited to a specific recombinase, but can leverage any suitable recombinase to achieve high-efficiency integration, making it versatile and broadly applicable.

Description

ULTRA-EFFICIENT INTEGRATION OF GENE LIBRARIES ONTO YEAST CYTOSOLIC PLASMIDS

[0001] This application claims benefit of United States provisional patent application number 63 / 726,404, filed November 29, 2024, the entire contents of which are incorporated by reference into this application.REFERENCE TO A SEQUENCE LISTING

[0002] The content of the XML file of the sequence listing named “UCI019_Seq”, which is 123 kb in size, created on November 20, 2025, and electronically submitted herewith the application, is incorporated herein by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0003] This invention was made with Government support under CA260415 and GM 136297, awarded by the National Institutes of Health. The Government has certain rights in the invention.BACKGROUND

[0004] A major challenge in synthetic biology and directed evolution is encoding large libraries inside cells. A particular challenge in these fields is encoding large libraries onto the OrthoRep system so that evolution can begin not from single or few sequences, but from a large collection of sequences. The OrthoRep directed evolution system relies on the concept of orthogonal DNA replication to independently mutate genes without affecting the genomic integrity of the host yeast cell. However, the efficiency of installing new genes of interest (GOIs) onto p1 using existing transformation and recombination methods has proven to be a limiting step. Recombination onto the cytosolic plasmid is often inefficient because the p1 plasmid is localized outside of the nucleus, where yeast's native recombination machinery resides. This inefficiency not only limits the overall speed of setting up OrthoRep experiments, it makes it difficult to start evolution from libraries of genes, for which there are many opportunities.

[0005] The current way of getting genes onto OrthoRep’s p1 plasmid has several inherent limitations. First, the p1 plasmid, being localized in the cytosol, has limited interaction with the native nuclear recombination machinery of Saccharomyces cerevisiae. This leads to generally low recombination efficiency, and the transformation efficiency is often inconsistent across experiments. Moreover, because recombination is a stochastic process, the time required for colony formation can vary widely if recombination events are rare and inefficient, with some colonies appearing days later than others. This variability complicatesdownstream applications, such as library construction, where even representation of all library members is critical.

[0006] Another drawback of the current methods is that the integration of circular or linear DNA into p1 is often labor-intensive and has a low success rate. Transforming cells with precloned p1 plasmids bearing the GOI in vitro is challenging because the plasmid's terminal proteins interfere with standard molecular cloning techniques. Consequently, this step typically requires additional laborious protocols involving linearized DNA fragments and intricate transformation conditions, reducing overall throughput and increasing the complexity of the workflows.

[0007] The use of chemical transformations, electroporation, and recombination-based approaches, have all proven to be cumbersome, with suboptimal integration rates and prolonged waiting times for colony formation. Therefore, a solution that can overcome these challenges by enhancing the integration efficiency of GOIs onto p1 and reducing variability is highly desirable. Such a solution would not only streamline the experimental workflow but also enable higher throughput and better reproducibility for directed evolution campaigns using orthogonal replication.

[0008] Furthermore, transforming DNA into eukaryotes with high efficiency is a general challenge that limits the size of gene libraries that one can construct in organisms such as yeast. Increasing the efficiency with which one can transform DNA and encoded expressed genes into cells is a continuing problem.

[0009] There thus remains a need for a more efficient, reliable, and scalable gene integration strategy.SUMMARY

[0010] Described herein are materials and methods to meet these needs by enabling high- efficiency integration of genes of interest (GOIs) onto the p1 plasmid used in the OrthoRep system, utilizing recombinases for site-specific recombination. Provided is a cytosolic p1 plasmid comprising a recombinase landing pad, wherein the recombinase landing pad comprises one or more site-specific recombination sites. In some embodiments, the p1 plasmid further comprises a plurality of selectable markers. In some embodiments, the selectable markers are on the same molecule of DNA as the site-specific recombination sites. In some embodiments the selectable markers are adjacent to the site-specific recombination sites. These selectable markers adjacent to (or on the same molecule of DNA as) the recombination sites may be referred to as “adjacent selectable markers” to distinguish them from “donor-specific selectable markers”. In some embodiments, the p1plasmid comprises p1 -specific terminal proteins (TPs) and terminal inverted repeats. In some embodiments, the site-specific recombination site is attB or attP. Representative examples of selectable markers can be found in Table 1.

[0011] Also described herein is a kit comprising a cytosolic p1 plasmid, and a donor nucleotide construct comprising a gene of interest, and one or more recombination sites, wherein the recombination sites flank the gene of interest and are compatible for recombination with the site-specific recombination sites of the p1 plasmid. Each recombinase has its cognate attachment sites. Compatibility, in this context, refers to attachment sites, in particular, site-specific recombination sites, that are suitable for use with a given recombinase. In some embodiments, the recombination sites are complementary to the site-specific recombination sites of the p1 plasmid. For example, attB and attP are complementary site-specific recombination sites, and one of attB and attP can be present on the p1 plasmid, while the other serves as the compatible recombination site flanking the gene of interest on the donor construct. In some embodiments, the nucleotide construct is a DNA construct.

[0012] In some embodiments, the kit further comprises a donor-specific selectable marker. In some embodiments, the kit further comprises a nucleotide sequence that expresses a site-specific recombinase in cytoplasm. The nucleotide sequence can be encoded on plasmids, genomic DNA, or other constructs for gene expression within cells. In some embodiments, the nucleotide sequence is a nuclear 2p plasmid or a CEN / ARS plasmid, wherein the CEN / ARS plasmid comprises an autonomously replicating sequence (ARS) and a centromere (CEN) element. In some embodiments, the recombinase is TP901 or Bxb1. In some embodiments, the donor-specific selectable marker is HIS3 or LELI2.

[0013] Also described is a yeast host cell comprising: (a) a cytosolic p1 plasmid; and (b) one or more p2 components for orthogonal replication of the p1 plasmid. The orthogonal replication can be OrthoRep, such as high error-rate OrthoRep (using, e.g., the DNA polymerases, or DNAPs, described in PCT / US24 / 31672, filed May 30, 2024, incorporated herein by reference), or low error rate OrthoRep with wild type TP-DNAP1. In some embodiments, the yeast host cell further comprises: (c) a donor DNA construct comprising a gene of interest, a pair of recombination sites, and a donor-specific selectable marker, wherein the recombination sites flank the gene of interest and are compatible for recombination at the site-specific recombination sites; and (d) a nucleotide sequence that expresses a site-specific recombinase in the cytoplasm of the yeast host cell. In some embodiments, the yeast host cell is a Saccharomyces cerevisiae cell.

[0014] Additionally described herein is a method of integrating a gene of interest onto a p1 plasmid. In some embodiments, the method comprises introducing, into a yeast host cell described above: (a) a donor nucleotide (e.g., DNA) construct comprising a gene of interest, a pair of recombination sites, and a donor-specific selectable marker, wherein the recombination sites flank the gene of interest and are compatible for recombination at the site-specific recombination sites; and (b) a nucleotide sequence that expresses a sitespecific recombinase in the cytoplasm of the yeast host cell, whereby the expressed sitespecific recombinase catalyzes recombination between the site-specific recombination sites on the recombinase landing pad and the complementary site-specific recombination sites on the donor nucleotide construct, resulting in integration of the gene of interest onto the p1 plasmid. In some embodiments, the nucleotide construct is a DNA construct. In some embodiments, the gene of interest is integrated onto the p1 plasmid with a greater than 10- fold increase in efficiency relative to relying on endogenous homologous recombination activity in the cytoplasm. In some embodiments, the integration of the GOI onto the p1 plasmid occurs with a 20-60-fold increase in efficiency. The integration of donor DNA onto the cytosolic p1 plasmid is also more efficient than transformation of intact nuclear plasmid into the nucleus of yeast. This increased efficiency is a two-fold to >10-fold increase in efficiency depending on the intact nuclear plasmid under comparison.

[0015] In some embodiments, the method results in colony formation whereby more than half of the colonies formed appear within 24 hours of the introducing. In some embodiments, the gene of interest comprises an antibody or fragment thereof. In some embodiments, the gene of interest comprises an enzyme. In some embodiments, the introducing is by electroporation.BRIEF DESCRIPTION OF THE DRAWINGS

[0016] FIGS. 1A-1C show the design of TP901 -mediated integration of donor DNA onto the p1 of the OrthoRep system. (1A) Schematic of the recombination process between the landing pad p1 and donor DNA utilizing a site-specific recombinase. The landing pad p1 with attB (SEQ ID NOs: 1 , 2) recombination sites and terminal proteins (indicated by circles) recombines with the donor DNA containing attP (SEQ ID NOs: 3, 4) sites at a specific dinucleotide (indicated with vertical line in sequence). This process, facilitated by TP901 integrase, results in a recombined p1 plasmid with newly formed attL and attR sites. (1B) Mechanism of TP901 -dependent recombination process. TP901 initially binds to the attB and attP sites as dimers, then forms a tetramer to align the sites. The attB and attP sites are cleaved, generating 3’ overhangs. Subsequently, two integrase subunits rotate, swapping the attB and attP half-sites, which are then re-ligated to form attL and attR sites. (1C) TP901-mediated integration in the context of the OrthoRep system in S. cerevisiae. Transformation allows the donor DNA containing gene of interest (GOI) to enter the cell, but replication of the donor DNA only occurs if it is integrated onto the cytosolic landing pad p1. The resulting recombinant p1 product is durably and exclusively replicated by an error-prone orthogonal DNAP at a high mutation rate to drive hypermutation of the GOI while the host genome is maintained with a low mutation rate.

[0017] FIGS. 2A-2E shows TP901 significantly enhances the efficiency of integrating GOIs onto the OrthoRep system. (2A) Comparison of transformation efficiency with or without TP901. Cells containing both the TP901 integrase and TP901 -compatible landing pad p1 yielded 25- to 60-times more colonies than comparable conditions not utilizing TP901. (2B) Comparison of transformation efficiency across different conditions. Conditions tested include the use of linearized donor DNA and the presence of attP recombination sites on the donor DNA. The highest transformation efficiency was observed with the combination of linearized donor DNA and attP recombination sites. (2C) Efficiency of TP901 -dependent integration onto p1 compared to standard transformation with circular plasmid (CEN / ARS and 2p plasmids). The TP901 system yielded higher CFLIs across different DNA amounts, outperforming conventional plasmid transformation. (2D) Accelerated colony formation with TP901 integrase. Colonies appeared more rapidly in the presence of TP901 integrase, with most colonies observed within 72 hours, in contrast to slower colony formation without integrase. (2E) Comparison of electroporation efficiency with or without TP901 integrase. By utilizing the TP901 system and electroporation, the transformation of GOI onto OrthoRep was highly efficient. Each condition was measured in duplicate biological replicates. The mean and range (error bars) are shown alongside individual measurements indicated as points.

[0018] FIGS. 3A-3B show comparison of integrase-mediated integration onto p1 across different integrases. (3A) Transformation efficiency resulting from the use of TP901, BXB1 , PhiBTI, and PhiC31 integrases compared to without integrase. TP901 is the most effective integrase among those tested. (3B) Fold change in transformation efficiency over control for each integrase. Each condition was measured in duplicate biological replicates, with mean and range (error bars) shown.

[0019] FIG. 4 shows enrichment of an RBD-binding nanobody (RBD10i14) from a mock yeast surface display nanobody library made through TP901 -assisted integration onto p1. Three mock libraries with initial RBD10i14 frequencies of 10%, 0.1%, and 0.001% were efficiently loaded onto OrthoRep using TP901 -assisted integration. Enrichment of RBD10i14 was successfully achieved through FACS over a total of 3 rounds of outgrowth and sortingperformed. The data show progressive enrichment of RBD10i14 across all three libraries, demonstrating the capability to load large libraries onto OrthoRep and enrich target binders.

[0020] FIG 5 shows transformation efficiency comparison based on auxotrophic markers. Transformation efficiency is compared between single and dual selection conditions: HIS3- only (-H only), LEU2-only (-L only), and combined HIS3 and LELI2 (-LH) auxotrophic markers. Single-marker selection conditions (-H only and -L only) showed higher transformation efficiency compared to dual-marker selection (-LH), specifically, with the HIS3 marker (-H only) yielding a higher efficiency than the LELI2 marker (-L only).

[0021] FIGS. 6A-6B show agarose gels of p1 minipreps after transformation with donor DNA mixtures. (6A) The agarose gel of p1 minipreps post-integration. Agarose gel electrophoresis of p1 minipreps from cells outgrown after integrating a gene library with variable sequence lengths. On average, 2.75 distinct integrations per cell were achieved. (6B) Agarose gel of p1 minipreps from restreaked colonies. Six re-streaked colonies are derived from one of the original colonies (indicated by arrow in panel a).

[0022] FIGS. 7A-7C show FACS plots for the enrichment of an RBD-binding nanobody (RBD10i14) from three mock libraries. Three mock libraries were successfully loaded onto OrthoRep, and the RBD10i14 nanobody was enriched by FACS. Gates indicate cells sorted to seed the next cycle. (7A) 10% RBD10i14 library. (7B) 0.1% RBD10i14 library. (7C) 0.001% RBD10i14 library.DETAILED DESCRIPTION

[0023] The materials and methods described herein enable high-efficiency integration of genes of interest (GOIs) onto the p1 plasmid used in the OrthoRep system, utilizing recombinases for site-specific recombination. By employing recombinases, such as TP901 integrase or others with similar functionality, this method significantly increases the efficiency and consistency of GOI integration onto p1. The approach enables seamless recombination in the cytoplasm of Saccharomyces cerevisiae, bypassing the inefficiencies associated with the native nuclear recombination machinery.

[0024] In practical terms, this system allows researchers to integrate target genes into the OrthoRep plasmid in a highly efficient manner. This not only accelerates the process of preparing yeast cells for directed evolution experiments, but also enhances the uniformity of gene library representation, which is important for exploring diverse fitness landscapes. The use of recombinases enables rapid, site-specific integration, which reduces waiting times for colony formation and increases overall throughput. Moreover, this method is not limited to aspecific recombinase, but can leverage any suitable recombinase to achieve high-efficiency integration, making it versatile and broadly applicable.

[0025] The usefulness of this approach lies in its ability to significantly simplify and enhance the efficiency of preparing yeast strains for continuous evolution experiments. By enabling faster and more reliable gene integration, this method supports the rapid evolution of biomolecules, including enzymes, antibodies, and other proteins, which can be used in a wide array of applications ranging from industrial biotechnology to medicine. This improvement in efficiency and scalability will enable more robust and reproducible directed evolution campaigns, advancing the field of synthetic biology.

[0026] Definitions

[0027] All scientific and technical terms used in this application have meanings commonly used in the art unless otherwise specified. As used in this application, the following words or phrases have the meanings specified.

[0028] As used herein, “parental sequence” refers to an initial sequence that is subjected to mutagenesis and selection. In the context of mutagenesis by OrthoRep , the parental sequence refers to the sequence of the gene of interest provided on a p1 integration plasmid or the protein it encodes that is to be artificially evolved to have one or more desired characteristics. Although one or more sequences on the p1 integration plasmid that are provided for effecting orthogonal replication, surface display, selection, and / or detection may also be artificially evolved by way of being integrated on the p1 expression plasmid, such a sequence is not considered part of the parental sequence unless mutations in the sequence caused by OrthoRep will be specifically selected over its original starting sequence. In the context of mutagenesis by ex vivo error-prone PCR, the parental sequence refers to the sequence that is used as an error-prone PCR template for a particular cycle of engineering.

[0029] As used herein, a “p1 plasmid” refers to a plasmid capable of orthogonal replication in yeast cells. P1 plasmids comprise recognition elements, which minimally include p1- specific terminal proteins (TPs) and terminal inverted repeats, that are needed for replication of a gene of interest by a TP-DNAP1. The terms “p1” and “P1” may be used interchangeably. A cytosolic p1 plasmid is durably replicated and maintained in the cytoplasm of a eukaryotic cell. The cytosolic p1 is distinguished from nuclear plasmids and nuclear DNA by p1 -specific TPs and terminal inverted repeats as well as specialized promoters for the expression of genes encoded on p1. In the OrthoRep system, for example, this is achieved by TP-DNAP1 and a series of other components, including some encoded on p2. Genes can also be properly transcribed from p1 in the cytoplasm.

[0030] As used herein, a “p1 integration plasmid” refers to a circular or linear plasmid that is used to insert a gene of interest into a p1 plasmid of a yeast cell by site-specific homologous recombination after transducing the yeast cell therewith.

[0031] As used herein, a “p1 expression plasmid” refers to the p1 plasmids of a yeast cell that have been modified to express a given parental sequence and copies thereof resulting from one or more OrthoRep-driven rounds of mutation and selection.

[0032] As used herein, “p2 components” refers to the components encoded on naturally occurring p2 plasmids and derivatives thereof that are needed for orthogonal replication of p1 plasmids. One or more of the p2 components need not be encoded on a p2 plasmid, but may instead be encoded in the yeast host cell’s nuclear DNA or in another plasmid (including p1 expression plasmids) found in the yeast host cell. The terms “p2” and “P2” may be used interchangeably.

[0033] As used herein, a "landing pad recombination site", or a “recombinase landing pad”, or a “landing pad for site-specific recombination”, refers to a specific DNA sequence engineered into a p1 plasmid acting as a designated location where a new piece of donor DNA, e.g., a gene of interest, can be precisely inserted using a site-specific recombinase, essentially allowing for targeted integration of genetic material at a predetermined spot within the plasmid.

[0034] As used herein, a “recombinase” refers to a DNA site-specific enzyme that can exchange DNA strands between target sequences. A representative example of such an exchange occurs when exchanging a donor DNA construct into a target site by recombination. An “integrase” is a type of site-specific recombinase.

[0035] As used herein, "integrase TP901" refers specifically to a type of recombinase derived from the TP901 bacteriophage, which functions by binding to specific DNA sequences called "attB" and "attP" sites to facilitate DNA integration at those locations.

[0036] As used herein, a “desired characteristic” refers to a structure or function that one desires a given protein to obtain that it does not already possess. Such desired characteristics include: affinity; selectivity; agonism; antagonism; inhibition; irreversible binding; enhancement; a different affinity, avidity, and / or specificity for a target the protein is already capable of binding; an ability to bind a new target; an ability to catalyze a given reaction it is already capable of catalyzing but with a different efficiency and / or under different reaction conditions; an ability to catalyze a new reaction that gives a new product or the same reaction product it already produces but by way of a different synthetic pathway; a change in its resistance or susceptibility to a given condition, e.g., heat, moisture, a given pH, a given chemical or other biomolecule (e.g., protease), degradation, agglutination; achange in a structural domain, a structural motif, a protein fold, and / or supersecondary structure; and the like.

[0037] As used herein, an “affinity reagent” refers to a compound (e.g., an antibody or fragment thereof, a receptor, an enzyme, etc.) that specifically binds a given target (e.g., a compound or composition, a protein, a nucleic acid molecule, etc.), or vice versa. For example, an affinity reagent may an enzyme that binds with a protein substrate or the affinity reagent may be the protein substrate that binds with the enzyme.

[0038] As used herein, a given percentage of “sequence identity” refers to the percentage of nucleotides or amino acid residues that are the same between sequences, when compared and optimally aligned for maximum correspondence over a given comparison window, as measured by visual inspection or by a sequence comparison algorithm in the art, such as the BLAST algorithm, which is described in Altschul et al., (1990) J Mol Biol 215:403-410. Software for performing BLAST (e.g., BI_ASTP and BI_ASTN) analyses is publicly available through the National Center for Biotechnology Information (ncbi.nlm.nih.gov). The comparison window can exist over a given portion, e.g., a functional domain, or an arbitrarily selection a given number of contiguous nucleotides or amino acid residues of one or both sequences. Alternatively, the comparison window can exist over the full length of the sequences being compared. For purposes herein, where a given comparison window (e.g., over 80% of the given sequence) is not provided, the recited sequence identity is over 100% of the given sequence. Additionally, for the percentages of sequence identity of the proteins provided herein, the percentages are determined using BI_ASTP 2.8.0+, scoring matrix BLOSUM62, and the default parameters available at blast.ncbi.nlm.nih.gov / Blast.cgi. See also Altschul, et al., (1997) Nucleic Acids Res 25:3389-3402; and Altschul, et al., (2005) FEBS J 272:5101-5109.

[0110] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv Appl Math 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J Mol Biol 48:443 (1970), by the search for similarity method of Pearson & Lipman, PNAS USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wl), or by visual inspection.

[0039] As used herein, the terms “protein”, “polypeptide” and “peptide” are used interchangeably to refer to two or more amino acids linked together. Groups or strings of amino acid abbreviations are used to represent peptides. Except when specifically indicated, peptides are indicated with the N-terminus on the left and the sequence is written from the N-terminus to the C-terminus.

[0040] Polypeptides may be made using methods known in the art including chemical synthesis, biosynthesis or in vitro synthesis using recombinant DNA methods, and solid phase synthesis. See, e.g., Kelly & Winkler (1990) Genetic Engineering Principles and Methods, vol. 12, J. K. Setlow ed., Plenum Press, NY, pp. 1-19; Merrifield (1964) J Amer Chem Soc 85:2149; Houghten (1985) PNAS USA 82:5131-5135; and Stewart & Young (1984) Solid Phase Peptide Synthesis, 2ed. Pierce, Rockford, IL, which are herein incorporated by reference. Polypeptides may be purified using protein purification techniques known in the art such as reverse phase high-performance liquid chromatography (HPLC), ion-exchange or immunoaffinity chromatography, filtration or size exclusion, or electrophoresis. See, e.g., Olsnes and Pihl (1973) Biochem. 12(16):3121-3126; and Scopes (1982) Protein Purification, Springer-Verlag, NY, which are herein incorporated by reference. Alternatively, the polypeptides may be made by recombinant DNA techniques known in the art.

[0041] As used herein, “antibody” refers to naturally occurring and synthetic immunoglobulin molecules and immunologically active portions thereof (i.e., molecules that contain an antigen binding site that specifically bind the molecule to which antibody is directed against, such as minibodies and nanobodies). As such, the term antibody encompasses not only whole antibody molecules, but also antibody multimers and antibody fragments as well as variants (including derivatives) of antibodies, antibody multimers and antibody fragments. Examples of molecules which are described by the term “antibody” herein include: single chain Fvs (scFvs), nanobodies, Fab fragments, Fab’ fragments, F(ab’)2, disulfide linked Fvs (sdFvs), Fvs, and fragments comprising or alternatively consisting of, either a VL or a VH domain.

[0042] As used herein, a compound (e.g., receptor or antibody) “specifically binds” a given target (e.g., ligand or epitope) if it reacts or associates more frequently, more rapidly, with greater duration, and / or with greater binding affinity with the given target than it does with a given alternative, and / or indiscriminate binding that gives rise to nonspecific binding and / or background binding. As used herein, “non-specific binding” and “background binding” refer to an interaction that is not dependent on the presence of a specific structure (e.g., a given epitope). An example of a compound that specifically binds a given target is an antibody that binds its target antigen with greater affinity, avidity, more readily, and / or with greater duration than it does to other compounds. As used herein, an “epitope” is the part of a molecule that is recognized by an antibody. Epitopes may be linear epitopes or three-dimensional epitopes. As used herein, the terms “linear epitope” and “sequential epitope” are used interchangeably to refer to a primary structure of an antigen, e.g., a linear sequence of consecutive amino acid residues, that is recognized by an antibody. As used herein, theterms “three-dimensional epitope” and “conformational epitope” are used interchangeably to refer a three-dimensional structure that is recognized by an antibody, e.g., a plurality of nonlinear amino acid residues that together form an epitope when a protein is folded.

[0043] As used herein, “binding affinity” refers to the propensity of a compound to associate with (or alternatively dissociate from) a given target and may be expressed in terms of its dissociation constant, Kd. In some embodiments, the antibodies have a Kd of 10-5or less, 10-6or less, preferably 10-7or less, more preferably 10-8 or less, even more preferably 10-9or less, and most preferably 10'10or less, to their given target. Binding affinity can be determined using methods in the art, such as equilibrium dialysis, equilibrium binding, gel filtration, immunoassays, surface plasmon resonance, and spectroscopy using experimental conditions that exemplify the conditions under which the compound and the given target may come into contact and / or interact. Dissociation constants may be used determine the binding affinity of a compound for a given target relative to a specified alternative. Alternatively, methods in the art, e.g., immunoassays, in vivo or in vitro assays for functional activity, etc., may be used to determine the binding affinity of the compound for the given target relative to the specified alternative.

[0044] “Nucleotide sequence” refers to a heteropolymer of deoxyribonucleotides, ribonucleotides, or peptide-nucleic acid sequences that may be assembled from smaller fragments, isolated from larger fragments, or chemically synthesized de novo or partially synthesized by combining shorter oligonucleotide linkers, or from a series of oligonucleotides, to provide a sequence which is capable of expressing the encoded protein.

[0045] As used herein, “a” or “an” means at least one, unless clearly indicated otherwise.

[0046] Nucleic Acid Constructs

[0047] Described herein is a p1 plasmid and an associated recombinase landing pad system used for gene integration. Specifically, the constructs incorporate recombination sites, such as attB and attP, which are used by various recombinases to facilitate efficient gene integration. The recombinases used in this system, such as TP901 , Bxb1 , and others, perform site-specific recombination, enabling the precise integration of the gene of interest (GOI) onto the p1 plasmid in Saccharomyces cerevisiae. The p1 plasmid itself is engineered to include the necessary recombination landing pads, while the recombinase is expressed from a nuclear 2p plasmid, a genomic locus, a CEN / ARS plasmid, another DNA source such as the p2 (pGKL2) plasmid, or introduced as a co-transformed DNA construct during the GOI integration. This combination provides a highly efficient and modular platform for gene integration.

[0048] As is known in the art, a CEN / ARS plasmid is a type of yeast plasmid maintained in yeast cells. It comprises an Autonomously Replicating Sequence (ARS) for DNA replication and a CEN (centromere) element to ensure proper segregation during cell division. This combination makes CEN / ARS plasmids stable, low-copy plasmids with a regulated copy number, typically around one copy per cell.

[0049] A cytosolic p1 plasmid, as described herein, comprises a recombinase landing pad, wherein the recombinase landing pad comprises one or more site-specific recombination sites. The landing pad allows for site-specific recombination by comprising one or more sites recognized by a site-specific recombinase. In some embodiments, the p1 plasmid further comprises a plurality of selectable markers. In some embodiments, the selectable markers are on the same molecule of DNA as the site-specific recombination sites. In some embodiments the selectable markers are adjacent to the site-specific recombination sites. These selectable markers adjacent to (or on the same molecule of DNA as) the recombination sites may be referred to as “adjacent selectable markers” to distinguish them from “donor-specific selectable markers”. In some embodiments, the p1 plasmid comprises p1-specific terminal proteins (TPs) and terminal inverted repeats. In some embodiments, the site-specific recombination site is attB or attP. Representative examples of selectable markers can be found in Table 1.

[0050] The p1 plasmid comprises a landing pad containing specific recombination sites, such as attB, flanked by selectable markers. In this system, the p1 plasmid is cytosolic and comprises a landing pad that allows for site-specific recombination using a donor DNA construct containing complementary recombination sites, such as attP. The donor DNA construct optionally comprises a selectable marker, such as HIS3, or LELI2, to facilitate the selection of successful integrants. To achieve high-efficiency integration, the recombinase, e.g., TP901, is expressed for localization in the cytoplasm where the p1 plasmid resides, ensuring that recombination can occur without the limitation of restricted access to the nuclear compartment.

[0051] The integration construct, also referred to herein as a donor construct, consists of a linear or circular donor nucleotide sequence, e.g. DNA, containing the GOI flanked by recombination sites, such as attP. The donor construct can be a single DNA sequence or a library of DNA sequences. These constructs are co-transformed into Saccharomyces cerevisiae cells containing a p1 plasmid along with a nuclear plasmid expressing the recombinase. These constructs can also be transformed into Saccharomyces cerevisiae cells containing a p1 plasmid and already expressing the recombinase. The inventors have also tested other recombinases, such as Bxb1 , to demonstrate the versatility of the system. Once the donor DNA is introduced, the recombinase catalyzes recombination between thecorresponding site-specific recombination (e.g., attB) sites on the p1 landing pad and the site-specific recombination (e.g., attP) sites on the donor DNA, resulting in efficient integration of the GOI onto p1.

[0052] Efficiency Level

[0053] The efficiency of GOI integration onto the p1 plasmid is significantly improved with this system compared to traditional homologous recombination-based methods for insertion of genes onto p1. Specifically, the inclusion of recombinases, such as TP901 , has led to a 20-60-fold increase in the number of colonies obtained following transformation compared to our previous state-of-the-art approach that relied solely on homologous recombination . When electroporation is used to deliver the donor DNA and recombinase plasmid, the efficiency can be further increased, yielding up to 100-fold more colonies compared to traditional methods using chemical transformation.

[0054] Additionally, the variation in colony formation time is greatly reduced with this approach. With TP901 -mediated integration, for example, 64% of eventual colonies appear on the first day of colony formation, whereas the previous method resulted in only 25% of colonies appearing on the first day. This improvement in both efficiency and consistency means that large libraries of GOIs can be integrated more uniformly and rapidly, which is important for high-throughput directed evolution experiments. Moreover, side-by-side comparisons with standard nuclear plasmid transformations demonstrate that TP901- mediated integration onto p1 produces 3.3- to 15-fold more colonies, depending on the selectable marker and nuclear plasmid used. This translates to the introduction of higher diversity DNA libraries into yeast compared to transformation of nuclear plasmid libraries.

[0055] Kits

[0056] Provided is a kit comprising a cytosolic p1 plasmid, and a donor nucleotide construct comprising a gene of interest, and one or more recombination sites, wherein the recombination sites flank the gene of interest and are compatible for recombination with the site-specific recombination sites of the p1 plasmid. Each recombinase has its cognate attachment sites. Compatibility, in this context, refers to attachment sites, in particular, sitespecific recombination sites, that are suitable for use with a given recombinase. In some embodiments, the recombination sites are complementary to the site-specific recombination sites of the p1 plasmid. For example, attB and attP are complementary site-specific recombination sites, and one of attB and attP can be present on the p1 plasmid, while the other serves as the compatible recombination site flanking the gene of interest on the donor construct. In some embodiments, the nucleotide construct is a DNA construct.

[0057] In some embodiments, the kit further comprises a donor-specific selectable marker. In some embodiments, the kit further comprises a nucleotide sequence that expresses a site-specific recombinase in cytoplasm. The nucleotide sequence can be encoded on plasmids, genomic DNA, or other constructs for gene expression within cells. In some embodiments, the nucleotide sequence is a nuclear 2p plasmid or a CEN / ARS plasmid, wherein the CEN / ARS plasmid comprises an autonomously replicating sequence (ARS) and a centromere (CEN) element. In some embodiments, the recombinase is TP901 or Bxb1. In some embodiments, the donor-specific selectable marker is HIS3 or LELI2.

[0058] Host Cells

[0059] Also provided is a yeast host cell comprising: (a) a cytosolic p1 plasmid; and (b) one or more p2 components for orthogonal replication of the p1 plasmid. The orthogonal replication of p1 can be carried out by various orthogonal DNA polymerases from the OrthoRep ecosystem, such as by the high error-rate OrthoRep DNA polymerases (using, e.g., the DNA polymerases, or DNAPs, described in PCT / US24 / 31672, filed May 30, 2024, incorporated herein by reference), or low error rate OrthoRep DNA polymerases such as the wild type TP-DNAP1. The OrthoRep DNA polymerase can be encoded as a nuclear plasmid or expressed from a genomic locus or any other DNA cassette previously or concurrently introduced into host yeast cells. In some embodiments, the yeast host cell further comprises: (c) a donor DNA construct comprising a gene of interest, a pair of recombination sites, and a donor-specific selectable marker, wherein the recombination sites flank the gene of interest and are compatible for recombination at the site-specific recombination sites; and (d) a nucleotide sequence that expresses a site-specific recombinase in the cytoplasm of the yeast host cell. In some embodiments, the yeast host cell is a Saccharomyces cerevisiae cell.

[0060] Methods

[0061] Provided is a method of integrating a gene of interest onto a p1 plasmid. In some embodiments, the method comprises introducing, into a yeast host cell described above: (a) a donor nucleotide (e.g., DNA) construct comprising a gene of interest, a pair of recombination sites, and a donor-specific selectable marker, wherein the recombination sites flank the gene of interest and are compatible for recombination at the site-specific recombination sites; and (b) a nucleotide sequence that expresses a site-specific recombinase in the cytoplasm of the yeast host cell, whereby the expressed site-specific recombinase catalyzes recombination between the site-specific recombination sites on the recombinase landing pad and the complementary site-specific recombination sites on the donor nucleotide construct, resulting in integration of the gene of interest onto the p1plasmid. In some embodiments, the nucleotide construct is a DNA construct. In some embodiments, the gene of interest is integrated onto the p1 plasmid with a greater than 10- fold increase in efficiency relative to relying on endogenous homologous recombination activity in the cytoplasm. In some embodiments, the integration of the GOI onto the p1 plasmid occurs with a 20-60-fold increase in efficiency. The integration of donor DNA onto the cytosolic p1 plasmid is also more efficient than transformation of intact nuclear plasmid into the nucleus of yeast. This increased efficiency is a two-fold to >10-fold increase in efficiency depending on the intact nuclear plasmid under comparison.

[0062] In some embodiments, the method results in colony formation whereby more than half of the colonies formed appear within 24 hours of the introducing. In some embodiments, the gene of interest comprises an antibody or fragment thereof. In some embodiments, the gene of interest comprises an enzyme. In some embodiments, the nucleic acid constructs are introduced into the host cell by electroporation.EXAMPLES

[0063] The following examples are presented to illustrate the present invention and to assist one of ordinary skill in making and using the same. The examples are not intended in any way to otherwise limit the scope of the invention.Example 1: Ultra-efficient Integration of Gene Libraries onto Yeast Cytosolic Plasmids

[0064] Efficient methods for diversifying genes of interest (GOIs) are essential in protein engineering. For example, OrthoRep, a yeast-based orthogonal DNA replication system that achieves the rapid in vivo diversification of GOIs encoded on a cytosolic plasmid (p 1 ), has been successfully used to drive numerous protein engineering campaigns. However, OrthoRep-based GOI evolution has almost always started from single GOI sequences, limiting the number of locations on a fitness landscape from where evolutionary search begins. This Example presents a simple approach for the high-efficiency integration of GOI libraries onto OrthoRep. By leveraging integrases, we demonstrate recombination of donor DNA onto the cytosolic p1 plasmid at exceptionally high transformation efficiencies, even surpassing the transformation efficiency of standard circular plasmids into yeast. We demonstrate our method’s utility through the straightforward construction of mock nanobody libraries encoded on OrthoRep, from which rare binders were reliably enriched. Overall, integrase-assisted manipulation of yeast cytosolic plasmids enhance the versatility of OrthoRep in continuous evolution experiments and support the routine construction of large GOI libraries in yeast in general.

[0065] Introduction

[0066] Orthogonal DNA replication is an architecture that enables the continuous hypermutation and evolution of user-selected genes in vivo'-6. In the yeast instantiation of orthogonal DNA replication called OrthoRep, genes of interest (GOIs) are encoded onto a cytosolic DNA plasmid (p1) that is durably and exclusively replicated by an error-prone orthogonal DNA polymerase (DNAP)2. The DNAP only replicates p1 such that GOIs experience a high mutation rate, while the Saccharomyces cerevisiae host genome is maintained at its normal and necessarily low mutation rates. When selection pressures are imposed, the hypermutating GOI can rapidly adapt to achieve new or improved biomolecular function. OrthoRep has been applied to biosynthetic enzyme engineering7'9, antibody generation10 11, transcription factor evolution12, gene editor evolution13, plant enzyme engineering14'16, and other biomolecular engineering problems17. It has also been applied to the broad exploration of fitness landscapes in the interest of understanding mutational pathways to drug resistance2, detecting meaningful patterns of conservation and change during protein evolution18 19, and producing large synthetic evolutionary datasets that may be useful as probes of and training sets for ML models1920. However, OrthoRep-driven GOI evolution campaigns have almost always started from a single or few GOI sequences encoded on p1 , representing evolutionary search from limited locations on a fitness landscape. To expand the search space that OrthoRep-driven GOI evolution experiments access, it would be desirable to start from a large diversity of GOI sequences ( / .e., libraries) rather than a few. To enable this, we present a strategy for high-efficiency integration of GOIs onto p1 and demonstrate the advantages of this strategy in both routine OrthoRep workflows and through the straightforward generation of mock antibody libraries from which productive binders can be selected. Notably, the efficiency of integrating GOIs onto p1 with our strategy is exceptionally high and exceeds even the efficiency of transforming standard DNA plasmids into yeast21 22. This finding predicts the extension of our strategy’s value beyond OrthoRep-driven continuous evolution into yeast-based protein engineering and yeast genetics at large.

[0067] Results

[0068] Rationale. Currently, installing GOIs onto OrthoRep’s p1 plasmid is done by transforming S. cerevisiae cells with a linear donor DNA cassette containing the GOI1 23. This cassette is flanked by homologous sequences that support recombination onto a landing pad p1 already present inside cells. Selection for successful recombinants results in the isolation of the desired OrthoRep strain encoding the GOI on p1. Our reliance on transformation and recombination to install donor DNA onto p1 , versus ex vivo cloning of GOIs onto p1 followed by transformation into cells, stems from the fact that replication-active pls have terminal proteins (TPs) covalently linked to their 5’ ends1’2425. These TPs make it challenging to workwith p1 in a test tube26, since standard molecular cloning procedures and ingredients are designed for DNA, not DNA-protein conjugates. However, the need for recombination onto a landing pad p1 comes with its own challenge. The p1 plasmid is cytosolic and likely has little access to yeast’s endogenous recombination machinery localized in the nuclear compartment27’28. Thus, the efficiency with which GOIs are installed onto p1 is generally low. We reasoned that by deliberately expressing DNA recombinases in the cytosol where p1 resides, we could achieve high levels of donor DNA integration onto p1 (Fig. 1c).

[0069] Specific design and testing. Serine integrases are site-specific recombinases that mediate the exchange and rejoining of DNA at attachment sites29(Fig. 1A and Fig. 1 B). We wished to test whether the highly active serine integrase, TP901 , could achieve recombination between attachment sites in donor DNA and landing pad pls in the yeast cytosol. To do so, we 1) cloned donor DNA constructs where attP directional recombination sites flanked our GOI and a selectable auxotrophic marker (e.g., LEU2), 2) created yeast strains that maintain a landing pad p1 with complementary attB recombination sites flanking a URA3 selectable auxotrophic marker, and 3) made a nuclear 2p plasmid that encodes TP901 for cytosolic expression. When aftP-containing donor DNA constructs were transformed into chemically competent TP901 -expressing strains with atfB-containing landing pad pls, we observed efficient integration. Specifically, the number of colonies that successfully integrated the donor DNA was 20- to 60-fold higher when TP901 was expressed (Fig. 2A). It is important to note that our aftP-containing donor DNA was flanked by the same homologous sequences we historically used for TP901 -independent recombination onto p11. Therefore, the large TP901 -dependent increase in the number of successful integrants (Fig. 2b) should be interpreted as improvement over the previous state-of-the-art (SOTA) onto p1 where successful integration was already substantial. We conclude that TP901 supports the efficient cytosolic recombination of donor DNA onto p1 .

[0070] We next investigated practical variations for implementing TP901 -assisted integration onto p1. A simple variation is to introduce the TP901 expression plasmid at the same time as donor DNA is transformed (co-transformation). This variation resulted in a modest boost in efficiency (~2.5-fold over the previous SOTA) than if the TP901 plasmid was already expressed in all the recipient cells (Fig. 2A). A second variation we explored was whether we could transform donor DNA as a circular plasmid rather than as a linear cassette. As shown in Fig. 2b, when the donor DNA contained attP sites and the recipient cell expressed TP901 , circular form donor DNA resulted in efficient integration. However, when the donor DNA did not contain attP sites, no productive integration occurred for the circular form even though homology flanks for recombination onto the landing pad p1 were present. This is presumably because the homology flanks need to be revealed at the ends of a linear cassette to supportTP901-independent recombination. In short, circular or linear donor DNA with attP sites were both suitable for TP901 -dependent integration of GOIs onto landing pad pls containing attB sites whereas only linear donor DNA with homologous arms achieved integration in the absence of TP901. We also observed that the efficiency of TP901 -dependent recombination was 6-fold lower for a#P-containing donor DNA in the circular versus linear form, but both forms supported much higher integration efficiencies than our previous TP901 -independent SOTA method.

[0071] Efficiency over standard transformation of nuclear plasmids into yeast. We wished to test TP901 -dependent integration of GOIs onto p1 against the transformation efficiency of standard nuclear plasmids, which is typically how gene libraries are introduced into yeast in traditional directed evolution, library screening, and yeast genetics experiments that don’t use OrthoRep. As shown in Fig. 2c representing side-by-side transformation experiments, TP901 -dependent integration of a selectable marker onto landing pad pls led to the appearance of 3.3-fold or 6.3-fold more colonies than the transformation of a 2p plasmid containing the same marker at the 1 pg and 2 pg concentrations, respectively. And compared to the transformation of a CEN / ARS plasmid, TP901 -dependent integration onto p1 led to the appearance of 9-fold and 15-fold more colonies. We therefore suggest that TP901 -dependent integration onto p1 may be the most efficient way of introducing GOIs into yeast.

[0072] Time to colony formation. When transforming library DNA into cells, colonies of successful transformants should ideally be the same size to ensure an even representation of library members. However, this is not typically the case with GOI integration onto p1 using our previous TP901 -independent integration strategy. What we often observe is the first appearance of colonies ( / .e., successful integrants) on day 3-4 after transformation followed by new colonies continuing to appear until day 7, resulting in large colony size variation that creates undesired biases in library composition. Large variation in the waiting times to colonies may be explained by the inefficiency of recombination onto p1. Assume that it is only after the first integration of donor DNA onto p1 that the cell can exponentially expand to form a colony. If recombination is inefficient, the average waiting time to the crucial first integration event may be similar to or even exceed yeast cell division times. The expected variation in waiting times to integration, a Poisson process, will then be characterized on cell division timescales, causing large variation in colony sizes, as those are also governed by cell division time. This is consistent with our previous observations.

[0073] Since TP901 -mediated recombination is highly efficient, we reasoned that TP901- dependent integration may have short average waiting times. Should the expected waiting time be much shorter than cell division timescales governing colony formation, then waitingtime variation will have little impact on colony formation time, colonies should appear faster within a smaller time window, and less variation in colony sizes should result. To test these predictions, we assessed the timing of colony formation for TP901 -dependent transformation (Fig. 2d). With our previous TP901-independent SOTA method for GOI integration onto p1, only 25% of eventual colonies appeared on the first day of colony formation (day 3). With TP901 -dependent GOI integration, 64% of eventual colonies appeared on the first day of colony formation, supporting our model (Fig. 2d). One notable detail to modify our model stems from the observation that transformation efficiency using different selection markers, for example, HIS3 versus LELI2, results in different number of colonies after selection, for example, donor DNA marked with HIS3 yielded approximately 4x more colonies than with LELI2 (Fig. 5). We suspect that this is due to differential sensitivity of yeast to amino acid deprivation for different amino acids, which renders inviable certain waiting times to integration in an amino acid dependent manner. Overall, our data suggest that TP901- dependent GOI integration supports the creation of evenly represented libraries while also improving the practical ease of encoding GOIs onto OrthoRep for evolution campaigns.

[0074] Multiple integrations per cell. Since TP901 -mediated recombination is highly efficient and since the landing pad p1 is maintained at high copy number, we suspected that multiple integration events could occur in the same cell, providing an extra boost in the number of library members installed onto OrthoRep, all else equal. To assess this, we transformed collections of different a#P-containing donor DNA whose sizes are distinguishable on an agarose gel. We observed that single colonies usually contained ~3 and up to 7 different pls after TP901 -mediated integration (Fig. 6A). When these single colonies containing multiple pls were diluted and plated for single colonies again, we found that each subsequent colony only contained one p1 size (Fig. 6B). To further confirm that cells receiving DNA tend to integrate more than one p1 on average, we tested co-transformation of two p1 integration donor marked by two different selection markers, HIS3 and LEU2. We found that number of colonies surviving selection for both markers was only slightly lower than the number of colonies surviving selection for only one or the other marker, suggesting that transformed cells commonly integrate more than one molecule of donor DNA (Fig. 5). Therefore, our overall model is that single cells uptake many molecules of donor DNA, the recombination efficiency of TP901 integrates them onto different copies of the landing pad pls, and then early cell division events segregate those integrated copies into different cells. While the parameters governing how many different pTs are generated per cell and how they segregate into sublineages have not been fully worked out, it is easy to imagine how this “multiplier” effect might be an advantage for building large libraries.

[0075] Electroporation. The experiments described so far utilize chemical transformation to deliver donor DNA into strains for integration. However, it is known that electroporation can lead to higher transformation efficiency. We therefore wished to ensure that electroporation was compatible with TP901 -dependent integration. As shown in Fig. 2e, integration efficiency was increased around 100-fold in the presence of TP901 such that in a routine single electroporation with 2 pg of donor DNA, we can obtain 6 x 107colony-forming units (CFLIs). As each CFU represents an average of ~3 unique integrants (Fig. 6A), we should be able to construct libraries nearing 2 x 108members in only a single transformation. For comparison, the highest published transformation efficiencies for yeast claim ~1 x 108CFLI / pg DNA30and likely involve detailed optimization of electroporation conditions that our experiments lacked.

[0076] Other integrases. The TP901 serine recombinase was chosen from a list of relatively equivalent options29. To test whether other integrases also support recombination onto p1 , we constructed recipient strains with four other landing pads, donor DNA constructs containing the corresponding appropriate attachment sites, and 2p plasmids expressing recombinases Bxb1, PhiBTI, PhiC31 , and R431'34. The R4 recombinase landing pad p1 consistently failed to receive donor DNA, likely driven by self-circularization of p1 owing to specific idiosyncrasies of R4 attachment sites. For the other three integrases, the efficiencies of integration were consistently higher than without integrase expression (Fig. 3).

[0077] Library construction and selection. As a proof-of-concept for using TP901 -dependent integration to generate GOI libraries that can be subject to functional selection, we carried out a mock nanobody (Nb) evolution experiment. The experiment mimics the loading of large nanobody libraries onto p1 followed by the enrichment of binders for further OrthoRep-driven evolution. Specifically, we mixed DNA encoding a previously described high-affinity Nb (RBD10i14)10against the SARS-CoV-2 spike protein’s receptor binding domain (RBD) with DNA encoding a Nb that does not bind RBD (Nb.b201)35. 4 pg of total DNA representing molar ratios of 1:10, 1:1,000, and 1:100,000 of RBD10i14:Nb.b201 were transformed into strains harboring landing pad pls. Nbs were encoded such that they would display on the cell surface when they are expressed from p1, as previously described11. The resulting populations were then subjected to fluorescence-activated cell sorting (FACS) for binding to fluorescently labeled RBD. Even for the 1:100,000 RBD10i14:Nb.b201 mixture, clones encoding RBD10i14 were detectably enriched after just one round of sorting. After the second round of sorting, RBD10i14 clones dominated the population (Fig. 4 and Fig. 7). High-throughput sequencing revealed that after the third round of sorting for the 1:100,000 RBD10i14:Nb.b201 mixture, the population was almost exclusively composed of RBD10i14 (94.8%). This mock evolution experiment demonstrates that TP901 -assisted generation ofp1 -encoded GOI libraries is reliable for the enrichment of rare binders. This system can be used for the construction of large antibody libraries encoded on p1 for the rapid generation of potent antibodies.

[0078] Discussion

[0079] TP901 -dependent high-efficiency integration of GOIs onto p1 expands utility for those using OrthoRep by increasing the speed and consistency of installing single genes onto OrthoRep for evolution. It also accesses the ability to install large gene libraries onto OrthoRep, which furthers the power of continuous evolution in exploring and navigating fitness landscapes. Moreover, the combination of high-efficiency integration with our recent BadBoy OrthoRep DNAPs that mutate p1 at 10'4substitutions per base19 20will allow for the generation of unprecedented synthetic gene diversity in yeast. For example, if one were to encode ~108diverse variants of a 1 kb GOI onto p1 , which can be done in a single routine transformation, and then expand cells for 10 generations (2 days), one could yield a gene library of ~1011variants under realistic assumptions.

[0080] Beyond the OrthoRep-specific utility of TP901 -dependent integration of gene libraries, it should be appreciated that the transformation efficiencies we achieved exceed those of standard plasmid transformation and gene library construction methods in yeast. Therefore, the novel strategy should find broad utility in yeast genetics and protein engineering. Without being bound by any particular theory, we hypothesize that our high efficiencies stem from that fact that it is easier for donor DNA to enter the cytoplasm, where p1 resides, versus the nucleus, where standard plasmids and DNA constructs need to be for replication and expression. It will be interesting to explore other genetic engineering benefits of pTs cytosolic localization (e.g., its potential protection from epigenetic modification and chromitinization) that make it orthogonal in ways beyond its orthogonal replication36.

[0081] References

[0082] 1. Ravikumar, A., et al. An orthogonal DNA replication system in yeast. Nature Chemical Biology 10, 175-177 (2014).

[0083] 2. Ravikumar, A., et al. Scalable, Continuous Evolution of Genes at Mutation Rates above Genomic Error Thresholds. Cell 175, 1946-1957.e1913 (2018).

[0084] 3. Arzumanyan, G. A., et al. Mutually Orthogonal DNA Replication Systems In Vivo. ACS Synthetic Biology 7, 1722-1729 (2018).

[0085] 4. Tian, R. et al. Establishing a synthetic orthogonal replication system enables accelerated evolution in E. coli. Science 383, 421-426 (2024).

[0086] 5. Diercks, C. S. et al. An Orthogonal T7 Replisome for Continuous Hypermutation and Accelerated Evolution in E. coli. bioRxiv (2024).

[0087] 6. Tian, R. et al. Engineered bacterial orthogonal DNA replication system for continuous evolution. Nature Chemical Biology (2023).

[0088] 7. Rix, G. et al. Scalable continuous evolution for the generation of diverse enzyme variants encompassing promiscuous activities. Nature Communications 11, 5644 (2020).

[0089] 8. Zhong, Z. et al. Automated Continuous Evolution of Proteins in Vivo. ACS Synthetic Biology 9, 1270-1276 (2020).

[0090] 9. Jensen, E. D. et al. Integrating continuous hypermutation with high-throughput screening for optimization of cis.cis-muconic acid production in yeast. Microbial Biotechnology 14, 2617-2626 (2021).

[0091] 10. Wellner, A. et al. Rapid generation of potent antibodies by autonomous hypermutation in yeast. Nature Chemical Biology 17, 1057-1064 (2021).

[0092] 11. Paulk, A. M., Williams, R. L. & Liu, C. C. Rapidly Inducible Yeast Surface Display for Antibody Evolution with OrthoRep. ACS Synthetic Biology 13, 2629-2634 (2024).

[0093] 12. Javanpour, A. A. & Liu, C. C. Evolving Small-Molecule Biosensors with Improved Performance and Reprogrammed Ligand Preference Using OrthoRep. ACS Synthetic Biology 10, 2705-2714 (2021).

[0094] 13. Weber, Y. et al. Enhancing prime editor activity by directed protein evolution in yeast. Nature Communications 15, 2092 (2024).

[0095] 14. Garcia-Garcia, J. D. et al. Potential for Applying Continuous Directed Evolution to Plant Enzymes: An Exploratory Study. Life (Basel) 10 (2020).

[0096] 15. Garcia-Garcia, J. D. et al. Using continuous directed evolution to improve enzymes for plant applications. Plant Physiology 188, 971-983 (2021).

[0097] 16. Gelder, K. V. et al. Directed Evolution of Aerotolerance in Sulfide-Dependent Thiazole Synthases. ACS Synthetic Biology 12, 963-970 (2023).

[0098] 17. Molina, R. S. et al. In vivo hypermutation and continuous evolution. Nature Reviews Methods Primers 2, 36 (2022).

[0099] 18. Karapanagioti, F., et al. Fitness landscape of substrate-adaptive mutations in evolved amino acid-polyamine-organocation transporters. Elife 13, RP93971 (2024).

[0100] 19. Rix, G. et al. Continuous evolution of user-defined genes at 1 million times the genomic mutation rate. Science 386, eadm9073 (2024).

[0101] 20. Rix, G. et al. Continuous evolution of user-defined genes at 1-million-times the genomic mutation rate. bioRxiv, 2023.2011.2013.566922 (2023).

[0102] 21. Gietz, R. D. & Schiestl, R. H. High-efficiency yeast transformation using the LiAc / SS carrier DNA / PEG method. Nature Protocols 2, 31-34 (2007).

[0103] 22. Gietz, D., et al. Improved method for high efficiency transformation of intact yeast cells. Nucleic Acids Res 20, 1425 (1992).

[0104] 23. Kamper, J., et al. Heterologous gene expression on the linear DNA killer plasmid from Kluyveromyces lactis. Curr Genet 19, 109-118 (1991).

[0105] 24. Klassen, R. & Meinhardt, F. in Microbial Linear Plasmids (eds Friedhelm Meinhardt & Roland Klassen) 187-226 (Springer Berlin Heidelberg, 2007).

[0106] 25. Gunge, N. & Sakaguchi, K. Intergeneric transfer of deoxyribonucleic acid killer plasmids, pGKI1 and pGKI2, from Kluyveromyces lactis into Saccharomyces cerevisiae by cell fusion. Journal of bacteriology 147, 155-160 (1981).

[0107] 26. Stam, J. C., , et al. Efficient isolation of the linear DNA killer plasmid of Kluyveromyces lactis: evidence for location and expression in the cytoplasm and characterization of their terminally bound proteins. Nucleic Acids Res 14, 6871-6884 (1986).

[0108] 27. Boder, E. T., Midelfort, K. S. & Wittrup, K. D. Directed evolution of antibody fragments with monovalent femtomolar antigen-binding affinity. Proceedings of the National Academy of Sciences 97, 10701-10705 (2000).

[0109] 28. Krogh, B. O. & Symington, L. S. Recombination Proteins in Yeast. Annual Review of Genetics 38, 233-271 (2004).

[0110] 29. Xu, Z. & Brown, W. R. A. Comparison and optimization of ten phage encoded serine integrases for genome engineering in Saccharomyces cerevisiae. BMC Biotechnology 16, 13 (2016).

[0111] 30. Loock, M. et al. High-Efficiency Transformation and Expression of Genomic Libraries in Yeast. Methods and Protocols 6, 89 (2023).

[0112] 31. Ghosh, P., et al. The Orientation of Mycobacteriophage Bxb1 Integration Is Solely Dependent on the Central Dinucleotide of <em>attP< / em> and <em>attB< / em>. Molecular Cell 'l , 1101-1111 (2003).

[0113] 32. Gregory, M. A., et al. Integration site for Streptomyces phage phiBTI and development of site-specific integrating vectors. J Bacteriol 185, 5320-5323 (2003).

[0114] 33. Smith, M. C., et al. Site-specific recombination by phiC31 integrase and other large serine recombinases. Biochem Soc Trans 38, 388-394 (2010).

[0115] 34. Olivares, E. C., et al. Phage R4 integrase mediates site-specific integration in human cells. Gene 278, 167-176 (2001).

[0116] 35. McMahon, C. et al. Yeast surface display platform for rapid discovery of conformationally selective nanobodies. Nature Structural & Molecular Biology 25, 289-296 (2018).

[0117] 36. Liu, C. C., et al. Toward an orthogonal central dogma. Nature Chemical Biology 14, 103-106 (2018).2: Materials and Methods for Ultra-efficient Integration of Gene Libraries onto Yeast ic Plasmids

[0118] This Example details the materials and methods that were employed in the studies described in Example 1 above.

[0119] DNA plasmid construction

[0120] Key plasmids used in this study are listed in Table 1. All DNA templates for PCR were obtained from previous studies or ordered from gBIocks from IDT, and all primers used in this study were ordered from IDT. PCR was performed to generate amplicons by PrimeSTAR GXL DNA polymerase (TaKaRa). Plasmid construction was done via Gibson Assembly or Golden Gate Assembly (all enzymes ordered from NEB) and transformed into chemically competent Escherichia coli strain TOP10 (ThermoFisher). Clonal plasmids were sequence-verified through whole-plasmid sequencing (Plasmidsaurus).

[0121] Yeast strain construction and media

[0122] All yeast strains used in this study are listed in Table 2. The parent strain for this study, yOP109, has landing pad p1 that contains a MET15 selectable auxotrophic marker but lacks the attB recombination sites. To engineer a strain suitable for TP901 -assisted integration, a Seal-linearized donor DNA from pYY13, which contains the attB sites, a URA3 selectable auxotrophic marker, and homology flanks matching the landing pad p1 in yOP109 was transformed into yOP109. After selection for successful integrants, the deletion of the original landing pad p1 containing the MET15 marker was performed as previously described37, using the spacer sequence GCTAAGAAGTATCTATCTAA (SEQ ID NO: 5). This yielded the yeast strain yYY20. A 2p plasmid encoding the gene of TP901 integrase (pYY10) was then transformed into yYY20, resulting in yeast strain yYY22.

[0123] For the construction of strain yYY235, we began with strain BJ5465 (ATCC: 208289). First, the selectable auxotrophic marker, TRP1 , was fully deleted from the genome as previously described37, using the spacer sequence ATGTCTGTTATTAATTTCAC (SEQ ID NO: 6). Next, a linearized donor DNA encoding wild-type TP-DNAP1 , along with URA3 and CAN1 markers, was transformed and integrated into the Lyp1 locus. Finally, a linearized donor DNA containing p-estradiol inducible promoter driving Agal p, together with the synthetic transcription factor that is responsible for induction, and a Hygromycin resistance marker, was transformed and integrated into the Aga1 locus, following the protocol described by Paulk et al11. The landing pad p1 with attP sites and TRP1 selectable auxotrophic marker was transported into this engineered strain by abortive mating38with p1 donor strain yYY64 to create strain yYY206. Briefly, equal numbers of p1 -containing cells (yYY64) and recipient cells were mixed, spun down, and plated on YPD for 6 hours at 30°C.After 6 hours, the mated cells were restreaked on an SC-HUWK plate supplemented with 50 pg / mL S-Aminoethyl-l-cysteine (Sigma Aldrich). After 3 days, a single colony was picked into SC-HLIW media for growth. Finally, a 2p plasmid encoding TP901 integrase (pYY10) was transformed into yYY206, resulting in yeast strain yYY235. All genomic integration and the p1 transport were validated by a full yeast miniprep, PCR, agarose gel electrophoresis, and sequencing (Plasmidsaurus).

[0124] Yeast strains were grown in standard media, including yeast extract peptone dextrose (YPD) (10 g / L bacto yeast extract; 20 g / L bacto peptone; 20 g / L dextrose) and appropriate synthetic drop-out media (yeast nitrogen base w / o amino acids (US Biological), drop-out mix synthetic minus the appropriate nutrients w / o yeast nitrogen base (US Biological), and dextrose).

[0125] Yeast p1 miniprep

[0126] Yeast minipreps to isolate p1 were performed as previously describedl. 1.5 mL of saturated yeast culture was centrifuged, and the supernatant was discarded. The pellet was washed with 1 mL of 0.9% NaCI and resuspened in 250 pL of Zymolyase solution (0.9M sorbitol (Sigma Aldrich), 0.1 M EDTA (Sigma Aldrich), 10U / mL Zymolyase (US Biological)) before incubating at 37 °C for 1 hour with rotation. After incubation, the tube was centrifuged, the supernatant was discarded, and the pellet was resuspended in 280.5 pL of proteinase K solution (250 pL of TE buffer(50 mM Tris-HCI pH 7.5, 20 mM EDTA), 25 pL 10% SDS (Sigma Aldrich), and 5.5 pL 10mg / mL proteinase K (ThermoFisher)). The sample was incubated at 65 °C for 30 minutes, followed by the addition of 75 pL of 5 M potassium acetate (ThermoFisher) and incubated on ice for 30 minutes. The tube was centrifuged at 12,000 xg for 10 minutes, and the supernatant was collected and mixed with two volumes of 100% ethanol. After another centrifugation, the ethanol was removed, and the pellet was airdried at room temperature. The pellet was then resuspended in 150 pL of TE buffer (50 mM Tris-HCI pH 7.5, 20 mM EDTA), followed by the addition of 8 pL of 1 mg / mL RNase A and incubated at 37 °C for 30 minutes. Next, 1 volume of isopropanol was added, and the tube was centrifuged at 12,000 xg for 15 minutes. The supernatant was discarded, and the pellet was air-dried at room temperature. The dry pellet was then resuspended in 30 pL of water, 20 uL of which was loaded onto a 0.9% agarose gel and run at 80V for 2 hours.

[0127] Frozen competent cell preparation39

[0128] All yeast chemical transformations for testing efficiency in this study used cells prepared in this manner.

[0129] Yeast strains for transformation were grown in selective media at 30 °C with shaking at 200 rpm until near saturation. The OD6oo of the yeast culture was measured using ahemacytomer. Approximately 2.5 x 109cells were inoculated into 500 mL of YPD, and the culture was grown in the shaking incubator at 30 °C for 4-6 hours until reaching a cell density of 2 x 107cells / mL. Yeast cells were harvested by centrifugation at 3,000 x g for 5 minutes and washed with 0.5 volumes of sterile water, followed by a second wash with 0.01 volumes of sterile water. The cell pellet was resuspended in 0.01 volumes of filter sterile frozen competent cell solution (5% glycerol, 10% DMSO, both from ThermoFisher), and 50 pL aliquots were dispensed into 1.5 mL microcentrifuge tubes. These tubes were placed in a styrofoam container and stored at -80 °C.

[0130] Transformation efficiency assessment

[0131] To evaluate transformation efficiency, we employed a chemical transformation protocol using frozen competent cells prepared as mentioned above. Before transformation, we determined the number of viable cells in the frozen stocks by plating aliquots on YPD plates. The average viable cell count across three independent samples was (3.45 ± 0.30) x 107CFU per sample.

[0132] Frozen competent cells were thawed in a 37 °C water bath for 30 seconds and pelleted by centrifugation at 13,000 x g for 2 minutes. Frozen competent cell transformation mix (260 pL of 50% w / v PEG 3350 (ThermoFisher), 36 pL of 1 M LiAc (ThermoFisher), 50 pL of 2.0 mg / mL single-stranded carrier DNA (ThermoFisher), 14 pL of DNA plus sterile water) was added to the cell pellet, and the mixture was vortexed vigorously to resuspend the cells. The tube was then incubated in a 42 °C water bath for 30 minutes. After incubation, the cells were pelleted by centrifugation at 13,000 x g for 30 seconds, and the supernatant was removed. 1 mL of sterile water was added to resuspend the cells. Serial dilutions of the transformed cells were plated on appropriate SC drop-out plates, selecting for p1 integration to measure the transformation efficiency. Formed colonies on plates were counted at 72 hr, 96 hr, and 120 hr.

[0133] For specific assessments: (1) we tested the efficiency of different amounts of DNA with or without the use of TP901 integrase. 0.5, 1 , 2, and 4 pg of pYY12 plasmid was digested by Seal and validated by agarose gel electrophoresis. Those donor DNA were transformed into three yeast strains: yOP109 (without TP901), yYY22 (contained the TP901 plasmid, pYY10), and yYY20, which was co-transformed with 1 pg of TP901 plasmid, pYY10. Serial dilutions of the transformed cells were plated on SC-L plates, and colonies on the plates were counted on day 5 (Fig. 2A, Fig. 2D. (2) We also compared p1 integration efficiencies using linearized versus circular donor DNA from pYY12 (with attP sites) and pOP96 (without attP sites) into strains yOP109 (without TP901) and yYY22 (with TP901 plasmid pre-transformed). Serial dilutions of the transformed cells were plated on SC-LUCI.019WQU1 plates and colonies on the plates were counted on day 5 (Fig. 2B). (3) We assessed TP901- mediated p1 integration efficiency using l-Ceul-digested pOP318 donor DNA in yYY22, comparing it to transformations with standard circular CEN / ARS (pOP188) and 2p (pOP69) plasmids, as well as their linear split-fragments versions, that have the same selectable marker (HIS3) into the same yeast strain yYY22. Specifically, the linear fragments for both plasmids (pOP188 and pOP69) were generated by PCR using primer set 5’- ggatcatctcgcaagagagatcacc-3’ (SEQ ID NO: 7) and 5’-TCTGCGCGTAATCTGCTGCTT-3’ (SEQ ID NO: 8) and primer set 5’-gcttttaaagaggccctaggggc-3’ (SEQ ID NO: 9) and 5’- TAGGCGGTGCTACAGAGTTCTTG-3’ (SEQ ID NO: 10), producing two pieces of DNA with 175bp homology region. Each condition used a total of 0.5 pg DNA. Serial dilutions of transformed cells were plated and colonies were counted on day 5 (Fig. 2C). All experiments were conducted in duplicate or triplicate biological replicates, with mean values and ranges (error bars) presented alongside individual measurements.

[0134] Note that for transformations into strains with TP901 (either co-transformed or pretransformed), we did not select for G418 resistance. Since TP901 facilitates the recombination process, its continued presence in the cell was not necessary postrecombination. By omitting G418 selection, we allowed for the natural loss (or curing) of the TP901 plasmid from the cells.

[0135] Multi-p1 integration test

[0136] To test the phenomena of multiple p1 integrations occurring in one cell, we cloned a mock library composed of random length DNA fragments ranging from 0.1 kb to 4 kb, into the pYY12 plasmid in place of the mKate gene using Gibson Assembly. The mock library plasmid was linearized with Seal and 2 pg that linearized donor DNA was transformed into TP901 pre-transformed strain yYY22, and the product of transformation was streaked on an SC-L plate to get single colonies. 16 colonies were picked from a plate and grown to saturation in SC-L media, and DNA was prepared by a full yeast p1 miniprep for agarose gel electrophoresis. One colony with many visible pTs was selected for further characterization, and the liquid culture of that colony was re-streaked on a SC-L plate. Six colonies were grown up in liquid SC-L media and DNA was prepared by a full p1 miniprep followed by agarose gel electrophoresis.

[0137] Electroporation30

[0138] A semi-saturated yeast culture of yYY22 was diluted into 100 mL of YPD to reach an ODeoo of 0.3 and grown at 30 °C for around 8 hours to reach an ODeoo of 1.6. Cells were harvested by centrifugation at 3000 rpm for 3 minutes at 4 °C, and the supernatant was discarded. The cell pellet was washed twice with 50 mL of ice-cold sterile water and oncewith 50 mL of ice-cold electroporation buffer (1 M sorbitol (Sigma Aldrich), 1 mM CaCh (Sigma Aldrich)). The pellet was then resuspended in 20 mL of condition buffer (0.1 M LiAc (Sigma Aldrich), 10 mM DTT (Sigma Aldrich)) and incubated at 30 °C with shaking at 200 rpm. After conditioning, the cells were collected by centrifugation and washed again with 50 mL of ice-cold electroporation buffer. Finally, the cell pellet was resuspended in 1.2 mL of electroporation buffer, resulting in a cell density of approximately 2 x 109cells / mL, which was sufficient for 6 electroporation reactions of 200 pL each. The cells were kept on ice until electroporation.

[0139] For each electroporation, 8 mL of a 1 :1 mix of 1 M sorbitol and 2x YPD was prepared and kept on ice. The p1 donor DNA was linearized from pYY12 by Seal (NEB), and the digestion was confirmed by agarose gel electrophoresis. For each electroporation sample, 200 pL of electrocompetent cells, linearized p1 donor DNA, and 25 pg salmon sperm DNA (ThermoFisher) were gently mixed and incubated on ice for 5 minutes. The mixture was transferred to a pre-chilled BioRad GenePulser 0.2 cm cuvette and electroporated at 2.5 kV, 25 pF. 1 mL of pre-chilled sorbitol / YPD was added immediately to the cuvette after electroporation, and the contents were transferred to the prepared 1 :1 sorbitol / YPD mix. The cells were incubated on a platform shaker at 200 rpm at 30 °C for 1 hour to recover. Following recovery, the cells were collected by centrifugation and washed with 0.9% NaCI. Serial dilutions of the cells were plated SC-L plates selected for p1 integration to measure the electroporation efficiency.

[0140] Alternate integrase tests

[0141] Strains with new landing pad pls containing different attB sites from corresponding integrases (Bxb1 , PhiBTI , PhiC31 , and R4) were made by using an appropriate donor cassette with URA3 markers. Specifically, strains with new landing pad pls were transformed with a Scal-lineared donor cassette with homology flanks streaked onto an SC- U plate from which colonies were picked, grown up, and screened by p1 miniprep and sequencing (Plasmidsaurus). For each integrase, a colony containing the landing pad p1 with corresponding attB sites and URA3 marker was then transformed with a 2p plasmid constitutively expressing the integrase with the same RNR2 promoter as used for TP901 . One colony for each integrase was grown up and passaged 3x in SC-U + G418 before being used for a frozen competent cell preparation as mentioned above. Transformations of donor DNA using appropriate attachment sites were done in duplicate, side by side with control that lacked the attachment sites but contained flanking homology to the landing pad p1. 2 pg of linearized donor DNA was transformed per transformation. Colonies were counted after 5 days.

[0142] Mock library construction and selection by fluorescence-activated cell sorting (FACS)

[0143] The sequences for nanobody fragments, RBD10i14 and Nb.b201 , were amplified by PCR using primers designed with overhangs compatible with Golden Gate Assembly. A Golden Gate Assembly reaction was then performed with the p1 donor vector plasmid (pYY62) and the nanobody sequence, along with Bsal-HF-V2 (NEB), T4 ligase (NEB), and T4 ligation buffer (NEB). The reaction was incubated at 50 °C for 1 hour. The assembled products were transformed into chemically competent E. coli strain TOP10 (ThermoFisher). Clonal plasmids (pYY82 for RBD10i14 and pYY83 for Nb.b201) were verified through whole plasmid sequencing (Plasmidsaurus). Plasmid concentrations were measured using Qubit Assays (ThermoFisher). Three plasmid libraries were created by mixing pYY82 and pYY83 in molar ratios of 1 :10, 1:1000, and 1:100,000 for subsequent transformation.

[0144] 4 pg of each mock library was linearized by Seal and integrated into yeast strain yYY235 with LELI2 as the selectable marker for recombinant p1. The transformants were directly inoculated into liquid SC-L media after transformation and grown for 2-3 days until the culture approached saturation. The yeast culture was then passaged at a 1 :100 dilution into the induction media (SC-L with 200 nM p-estradiol) and grown at 30 °C with shaking at 200 rpm overnight. Approximately 5 x 107 induced yeast cells were harvested from the induction culture, washed twice with ice-cold HBSBM buffer (20 mM Tris-HCI pH 7.5, 100 mM NaCI, 0.1% BSA, and 5 mM maltose), and stained in 250 pL of a primary staining solution containing HBSBM buffer with 10 nM biotinylated-RBD (SinoBiological, 40592- V08B-B) at 4 °C for 1 hour with rotation. After primary staining, the cells were washed once with HBSBM buffer and stained with 250 pL of secondary staining solution containing HBSBM buffer with 0.5 pL of 1 mg / mL streptavidin-AF647 (ThermoFisher) and 20 nM of anti- HA-AF488 (R&D system) for 20 minutes at 4 °C with rotation. Next, cells were washed twice with HBSBM buffer and resuspended in 4 mL of HBSBM buffer for sorting. FACS (Sony SH800) was used to sort 300 cells from the gated population of each sample (Fig. 7) into 3 mL of SC-L media. Sorted cells were grown at 30 °C with shaking at 200 rpm until reaching near-saturation (approximately 3 days). This process of induction, staining, sorting, and growth was repeated for a total of 3 rounds.

[0145] When the sorted cells from the final round grew up, 100 pL of culture was collected and pelleted by centrifugation. The cell pellet was then resuspended in 100 pL of 5% Chelex 100 (Sigma Aldrich) and half total sample volume of the glass beads was added. The mixture was vortexed at high speed for 5 minutes, followed by incubation at 95 °C for 2 minutes. After centrifugation at high speed for 1 minute, 1 pL of the S6 supernatant was used as the template for PCR reaction along with forward primer 5’- ATGAGATTCCCATCTATCTTCACCG-3’ (SEQ ID NO: 11) and reverse primer 5’-GCCATTATTAGGATTCAAAAAACATACTGTGTG-3’ (SEQ ID NO: 12). The PCR product was purified using a column (Zymo research) and quantified by Nanodrop. The sample was then submitted to Plasmidsaurus to perform Primer PCR sequencing. A total of 3000 raw reads per sample was acquired and subsequent analysis was performed using Python.

[0146] References

[0147] 37. Ryan, O. W. & Cate, J. H. D. in Methods in Enzymology Vol. 546 (eds Jennifer A. Doudna & Erik J. Sontheimer) 473-489 (Academic Press, 2014).

[0148] 38. Georgieva, B. & Rothstein, R. in Methods in Enzymology Vol. 350 (eds Christine Guthrie & Gerald R. Fink) 278-289 (Academic Press, 2002).

[0149] 39. Gietz, R. D. & Schiestl, R. H. Frozen competent yeast cells that can be transformed with high efficiency using the LiAc / SS carrier DNA / PEG method. Nature Protocols 2, 1-4 (2007).

[0150] Throughout this application various publications are referenced. The disclosures of these publications in their entireties are hereby incorporated by reference into this application in order to describe more fully the state of the art to which this invention pertains.

[0151] Those skilled in the art will appreciate that the conceptions and specific embodiments disclosed in the foregoing description may be readily utilized as a basis for modifying or designing other embodiments for carrying out the same purposes of the present invention. Those skilled in the art will also appreciate that such equivalent embodiments do not depart from the spirit and scope of the invention as set forth in the appended claims.

[0152] Table 1. Key plasmids used in this study.TGCTCCTCTGAAAATAGTATTGGGGCATAAGAGGAAAGACGGCAGTAGGACAATGAAATATCATTGTGCCAATAGGTTCCCGCGTAAAACAAAAGGGATTACCGTTTATAATGATAATAAGAAGTGCGACAGCGGCACATATGATTTAAGCAACCTGGAAAATACTGTGATCGACAACCTGATCGGTTTCCAAGAGAATAATGATTCCCTTTTAAAAATCATCAATGGTAATAACCAGCCAATACTAGACACAAGCTCATTCAAGAAGCAAATTTCCCAAATAGACAAGAAAATCCAAAAAAATAGCGACCTATACTTAAATGACTTTATCACAATGGATGAGTTAAAAGACAGAACTGATAGCTTACAGGCAGAAAAGAAATTACTGAAGGCGAAGATATCAGAGAACAAGTTCAACGACTCAACTGACGTATTCGAACTAGTAAAAACCCAACTGGGCAGCATACCAATAAATGAACTGTCATACGACAACAAGAAGAAGATCGTGAACAATCTTGTAAGTAAGGTGGACGTGACAGCAGATAATGTTGATATAATCTTCAAGTTCCAGTTAGCATAATAAATCCGCTCTAACCGAAAAGGAAGGAGTTAGACAACCTGAAGTCTAGGTCCCTATTTATTTTTTTATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAATTTTTCTTTTTTTTCTGTACAGACGCGTGTACGCATGTAACATTATACTGAAAACCTTGCTTGAGAAGGTTTTGGGACGCTCGAAGCCGCGGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACACTAGTCGAAGCATCTGTGCTTCATTTTGTAGAACAAAAATGCAACGCGAGAGCGCTAATTTTTCAAACAAAGAATCTGAGCTGCATTTTTACAGAACAGAAATGCAACGCGAAAGCGCTATTTTACCAACGAAGAATCTGTGCTTCATTTTTGTAAAACAAAAATGCAACGCGAGAGCGCTAATTTTTCAAACAAAGAATCTGAGCTGCATTTTTACAGAACAGAAATGCAACGCGAGAGCGCTATTTTACCAACAAAGAATCTATACTTCTTTTTTGTTCTACAAAAATGCATCCCGAGAGCGCTATTTTTCTAACAAAGCATCTTAGATTACTTTTTTTCTCCTTTGTGCGCTCTATAATGCAGTCTCTTGATAACTTTTTGCACTGTAGGTCCGTTAAGGTTAGAAGAAGGCTACTTTGGTGTCTATTTTCTCTTCCATAAAAAAAGCCTGACTCCACTTCCCGCGTTTACTGATTACTAGCGAAGCTGCGGGTGCATTTTTTCAAGATAAAGGCATCCCCGATTATATTCTATACCGATGTGGATTGCGCATACTTTGTGAACAGAAAGTGATAGCGTTGATGATTCTTCATTGGTCAGAAAATTATGAACGGTTTCTTCTATTTTGTCTCTATATACTACGTATAGGAAATGTTTACATTTTCGTATTGTTTTCGATTCACTCTATGAATAGTTCTTACTACAATTTTTTTGTCTAAAGAGTAATACTAGAGATAAACATAAAAAATGTAGAGGTCGAGTTTAGATGCAAGTTCAAGGAGCGAAAGGTGGATGGGTAGGTTATATAGGGATATAGCACAGAGATATATAGCAAAGAGATACTTTTGAGCAATGTTTGTGGAAGCGGTATTCGCAATATTTTAGTAGCTCGTTACAGTCCGGTGCGTTTTTGGTTTTTTGAAAGTGCGTCTTCAGAGCGCTTTTGGTTTTCAAAAGCGCTCTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCAAAGCGTTTCCGAAAACGAGCGCTTCCGAAAATGCAACGCGAGCTGCGCACATACAGCTCACTGTTCACGTCGCACCTATATCTGCGTGTTGCCTGTATATATATATACATGAGAAGAACGGCATAGTGCGTGTTTATGCTTAAATGCGTATATGTGTTATGTATAGGTCTAGAGATCTGTTTAGGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTGCCACCTGACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCCCTTTCGTCTCACGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGAGTACTATAATATATGAATTACATTATTAATTTAAAAGATACTAGATGGTGCAGCAGCAGCAGCAGCAGTAGTAGGGCCAGTATTGGCGTTTCCCCCTCCTGACTTGAACAACCCTTTTAACGACTTTGAAATAGATAGAGACCTCTTCAAAGAGCTTTCTCTGGAAATACGGGGCTCAGAAGAGTCCACATTAGATGAAGCCATTATGGATTGCGAGTTTTTATTTCGTTTATTCAAATTAAGGTAACTAAAAAACTCCTTTTTTAAGCAAGGATTTTCTTAACTTCTTCGGCGACAGCATCACCGACTTCGGTGGTACTGTTGGAACCACCTAAATCACCAGTTCTGATACCTGCATCCAAAACCTTTTTAACTGCATCTTCAATGGCCTTACCTTCTTCAGGCAAGTTCAATGACAATTTCAACATCATTGCAGCAGACAAGATAGTGGCGATAGGGTTGACCTTATTCTTTGGCAAATCTGGAGCAGAACCGTGGCATGGTTCGTACAAACCAAATGCGGTGTTCTTGTCTGGCAAAGAGGCCAAGGACGCAGATGGCAACAAACCCAAGGAACCTGGGATAACGGAGGCTTCATCGGAGATGATATCACCAAACATGTTGCTGGTGATTATAATACCATTTAGGTGGGTTGGGTTCTTAACTAGGATCATGGCGGCAGAATCAATCAATTGATGTTGAACCTTCAATGTAGGGAATTCGTTCTTGATGGTTTCCTCCACAGTTTTTCTCCATAATCTTGAAGAGGCCAAAACATTAGCTTTATCCAAGGACCAAATAGGCAATGGTGGCTCATGTTGTAGGGCCATGAAAGCGGCCATTCTTGTGATTCTTTGCACTTCTGGAACGGTGTATTGTTCACTATCCCAAGCGACACCATCACCATCGTCTTCCTTTCTCTTACCAAAGTAAATACCTCCCACTAATTCTCTGACAACAACGAAGTCAGTACCTTTAGCAAATTGTGGCTTGATTGGAGATAAGTCTAAAAGAGAGTCGGATGCAAAGTTACATGGTCTTAAGTTGGCGTACAATTGAAGTTCTTTACGGATTTTTAGTAAACCTTGTTCAGGTCTAACACTACCGGTACCCCATTTAGGACCACCCACAGCACCTAACAAAACGGCATCAGCCTTCTTGGAGGCTTCCAGCGCCTCATCTGGAAGTGGAACACCTGTAGCATCGATAGCAGCACCACCAATTAAATGATTTTCGAAATCGAACTTGACATTGGAACGAACATCAGAAATAGCTTTAAGAACCTTAATGGCTTCGGCTGTGATTTCTTGACCAACGTGGTCACCTGGCAAAACGACGATCTTCTTAGGAACGTGCATTTATAATCATAAACTATTAAATCATATTAAGAATCATTCAATTGATTTTTGGGATTTGGATTATATAGAAAAGTATGACCTAATTGACTCCGGCGAAAAAGCATGCTTATCTGTGCCCCAGTTTGCTAGGGAGGTCGCAGTATCTGGCCACAGCCACCTCGTGCTGCTCGACGTAGGTCTCTTTGTCGGCCTCCTTGATTCTTTCCAGTCTTCTGTCCACATAGTAGACGCCGGGCATCTTGAGGTTCTTAGCGGGTTTCTTGGATCTGTATGTGGTCTTCAAGTTGCAGATCAGGTGGCCCCCGCCCACGAGCTTCAGGGCCATGTCGGCTCTGCCTTCCAGGCCGCCGTCAGCGGGGTACAGGGTCTCGGTGGAGGCCTCCCAGCCGAGTGTTTTCTTCTGCATCACAGGGCCGTTGGATGGGAAGTTCACCCCTCTGATCTTGACGTTGTAGATGAGGCAGCCGTCCTGGAGGCTGGTGTCCTGGGTAGCGGTCAGCACGCCCCCGTCTTCGTATGTGGTGACTCTCTCCCATGTGAAGCCCTCGGGGAAGGACTGCTTAAAGAAGTCGGGGATGCCCTGGGTGTGGTTGATGAAGGTTTTGCTGCCGTACATGAAGCTGGTAGCCAGGATGTCGAAGGCGAAGGGGAGAGGGCCGCCCTCGACCGCCTTGATTCTCATGGTCTGGGTGCCCTCGTAGGGCTTGCCTTCGCCCTCGGATGTGCACTTGAAGTGGTGGTTGTTCACGGTGCCCTCCATGTACAGCTTCATGTGCAACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATAGTACTATCTATTTTTTCAGTACATAATTTAATTAAATCATCATGACCTTTATCTAATTTTACATCTCTTCTACCAAGACCTAATTCTTTATTAATACTATCAAAATCTGTTATTCTATTGCCTTGAGGATCTTTGAAACACCAATCTGAGTCTGAGGGCATGCAACACAATTAACATCTCAATCAAGGTAAATGCTTTTATATGAAAGTTTTTATAATAATTATAAAATGTCTGTTATTAATTTCACAGGTAGTTCTGGTCCATTGGTGAAAGTTTGCGGCTTGCAGAGCACAGAGGCCGCAGAATGTGCTCTAGATTCCGATGCTGACTTGCTGGGTATTATATGTGTGCCCAATAGAAAGAGAACAATTGACCCGGTTATTGCAAGGAAAATTTCAAGTCTTGTAAAAGCATATAAAAATAGTTCAGGCACTCCGAAATACTTGGTTGGCGTGTTTCGTAATCAACCTAAGGAGGATGTTTTGGCTCTGGTCAATGATTACGGCATTGATATCGTCCAACTGCATGGAGATGAGTCGTGGCAAGAATACCAAGAGTTCCTCGGTTTGCCAGTTATTAAAAGACTCGTATTTCCAAAAGACTGCAACATACTACTCAGTGCAGCTTCACAGAAACCTCATTCGTTTATTCCCTTGTTTGATTCAGAAGCAGGTGGGACAGGTGAACTTTTGGATTGGAACTCGATTTCTGACTGGGTTGGAAGGCAAGAGAGCCCCGAAAGCTTACATTTTATGTTAGCTGGTGGACTGACGCCAGAAAATGTTGGTGATGCGCTTAGATTAAATGGCGTTATTGGTGTTGATGTAAGCGGAGGTGTGGAGACAAATGGTGTAAAAGACTCTAACAAAATAGCAAATTTCGTCAAAAATGCTAAGAAATGAAAATCAGCAAATGAAGATATCAAATATGAAATAAAACAACAAGGAAACGTTTAAAACTCTAGAAATCTGATATCAAAATGATCGTTAAACCTATCGCTTCCCTAAGTGTTGTCAACGTACGAAAGGGTGCCTTGCTTATATGTTTTTTAAAAAACCCTCTTTGATATGATATTTTACCCTTTGATTTAGAAATCGCTTATTGATCTTATTAGATAAAATAAACGCAAAACACTTGTTGATTAAGCAGAATAATGCCAGAATATCAGAATTGCAACTATCGAAACTGCAATCGCTAGTGTAAATCCTAGTATTTTCCTTCCCTTTCTCTAAGTAAGATGGGTTTTCCCGGAAAATACGATATTGTTTTCCCTTTAAAAGTTTAGAACAGAAGCAAACTAAAAGCGAGAACTTGAAATCAGACCCAAAAAAACACGTTTAAGTTTATGCACAACCTAATAGCATCAACCAGCGATGCTAATCTAGCCAAAAAACGTAATGCAGCAACTGAACTGGTAGACACAAGCCTCTAAACTGTTTCAAGTTGTTGTTATATATGGGAAAAAAACCTTTAAAAATTTGTTTAAATGATCTTCTTTGAAAAATAAGGCTTGTAATGTTGCAATTACGTATTGTGAGGCTGCAATTTATAGATCAGGGAAAAGGAAAAGGAAAGGGTTCTTCCATGCGTCAGCGAGGGGCCCAGGGGCTGGGCAGTGGCTGAACAAAGCTCGTATGAGTTGAGAAGGAATGCTTGTGGGAATATTGAATATGTGTATATGTGTTGTATATGTGAGAGAATTGTGTAAAGTGGGCTATCAGTAGTTGGATCATTTGGTTATAGCGATACGATCTGATGCACGAAGTCTTTTATGGGCCCTATCGAACTTAGGATAACCATTATTGCACCGTATAAGACGAAGGAAAGGGAGCTGATAGCAGCAGCTCTTCTATCTACTGTTAAGAGGTAGCTGGTGGCGATGGCACCGCAGTTACAGCCTAGAGTTAGGCCTCTGGTGACGAAATCATCGCGAGGTACTCTGAAGAAGTCAAGCATGGGACCTCCGGATAGTGCACCTACGATACCACTTAGCACTGTAATGACAGCCATTACGGTAACGGATCCTTCGAAATTTTCGATGACGGGCATCCCCAAGGCTAAAGTGATGCTTCTTCCAATGAATCCAATGGAGTTATATGAGCTGATACCGATGTTGTAGCATATAAAGGGATTTAACATTAGAGTGGCAGCACATAAAGAGATGGTTGGGATAAGAAGCACGACAAAATGTTTCTTTAGATCGCTTCTGTAAGTGTACATGGGCATCGATAATGCGACAATAGAGACGTCCATACAGGAGGAAAAAATATCACCGGCGCCAGGCCAGTTCTTGTTTGGACCTGATACACTAGTATTTGTGAATAATGTTAAGTATGTTGTACCAACCTTGTATTCACGAAGATCCGAGAGGAAATATTTGATTTGGCGATGTTTAATGAGTGATGAGATCAATTCAACGATCCAGAATAGAGCCACTGAACAAATAACAGGATGCAAGAATTTCTTATACTTAGGATTTGGCAATAATGGTGCATCGGTGACGATGAAGAACATGCAAATGGCGGTAAATAGTTGGAAAGGCATGATGTACCATGAAAAATAGTATGTGAATATAGTTGCGAAAAACCCCAATCCGTATAGAACATGATGCAAGTGATCGTGCCACATGTTTACGGTGAAAAGATGTTCCATTCTGTGAGAGAACTGCCTGGTGATGGCTCTTTCACACTCTACCTCTCTATTTCTATCAGAAAATTGATCATGAGAGGTAGATCCACAGAAACGTTTCGATGCCATTGGAACCATGGCTGCATTATTACGAGAATGTATCAGAGCAGGCTGTAATAACAACTGATTTGTTTCAGCAGTTGAGTCAGATCCATGAGTGTTATCCTCGTCATAAATGTCCTGCACATTTTGAGTGATCCCTAATCCCTTGTCGTTAGGAAGTCCAATTTCACTACCTCTTAGAATGTCAGCATCTAAATTAGCAGTATCACCCATTGCCAAATGATGAGTAAGATTTGTACGAGTTCTTTGCAATGGGAACCCACTATTTGAAGCAACGTTGACTAATTGGAAATCTTCAACATCAGGATCCGAGAAAATGTCAGCAAAACTATGAATATCATCATCGTCTTCGTTTATGTCCAGTGTACTTTCTTCTTCAGTAGCATCTTCATCCGCAGAACTGTATCCATTCTCAGCATCACGAAGAATATCCTCTTTACTGCCGAGTAAAGAAGTCCGTTTCCTTCCATTCGACCTACCAAGGTGGCCAGTAGCCAGTGCAAACAGCTTTTGACCAAATATAGTTACGTATGCCAAACAAAACCCGGTGATTATGTACATGAACACGAACGAGGCAGCTATTAACATAGCTTCTCTAAAAGATATCCAGGGACTCAAAGGTAAAGTGACAAACGCTGGTGTAAAGAATAAATTCATCCATCTCAAAGCCCAACTTAAAGGAACATCGATGACACCAACAATCTTCTGAGTTAAGTTCTCATTAATCATAGATAAAACACATAAGAAACAGAAATTTACCAACATTACAGCAACTGATGCAGGAAATTTGATCCCTATCACATCTTTAATTAATATATTAACTCCATATAAGATCATCATGATCAATATCACACCGATTGGAACGAAAACGTACTGTTTCAACAAACTGTACTTATAAATATGCAAAAAATCAACGAATGATCCGGTATGAAAGCATTTACCTTGATTTGGATGTTAATTGTGTTAATCCATAATGGCTTCATCTAATGTGGACTCTTCTGAGCCCCGTATTTCCAGAGAAAGCTCTTTGAAGAGGTCTCTATCTATTTCAAAGTCGTTAAAAGGGTTGTTCAAGTCAGGAGGGGGAAACGCCAATACTGGCCCTACTACTGCTGCTGCTGCTGCTGCACCATCTAGTATCTTTTAAATTAATAATGTAATTCATATATTATAGTACTCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGTGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCATACCCATACGACGTTCCAGACTACGCTCTGCAGGCTAGTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGCTAGCGACGTCCAGGAACTGACAACTATATGCGAGCAAATCCCCTCACCAACTTTAGAATCGACGCCGTACTCTTTGTCAACGACTACTATTTTGGCCAACGGGAAGGCAATGCAAGGAGTTTTTGAATATTACAAATCAGTAACGTTTGTCAGTAATTGCGGTTCTCACCCCTCAACAACTAGCAAAGGCAGCCCCATAAACACACAGTATGTTTTTTGAATCCTAATAATGGCCGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCTGTCACCGGATGTGTTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGGACTAGGCTGCGAATTTCTTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTCTTAGGTTTTAAAACGAAAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTTAAGCAAGGATTTTCTTAACTTCTTCGGCGACAGCATCACCGACTTCGGTGGTACTGTTGGAACCACCTAAATCACCAGTTCTGATACCTGCATCCAAAACCTTTTTAACTGCATCTTCAATGGCCTTACCTTCTTCAGGCAAGTTCAATGACAATTTCAACATCATTGCAGCAGACAAGATAGTGGCGATAGGGTTGACCTTATTCTTTGGCAAATCTGGAGCAGAACCGTGGCATGGTTCGTACAAACCAAATGCGGTGTTCTTGTCTGGCAAAGAGGCCAAGGACGCAGATGGCAACAAACCCAAGGAACCTGGGATAACGGAGGCTTCATCGGAGATGATATCACCAAACATGTTGCTGGTGATTATAATACCATTTAGGTGGGTTGGGTTCTTAACTAGGATCATGGCGGCAGAATCAATCAATTGATGTTGAACCTTCAATGTAGGAAATTCGTTCTTGATGGTTTCCTCCACAGTTTTTCTCCATAATCTTGAAGAGGCCAAAACATTAGCTTTATCCAAGGACCAAATAGGCAATGGTGGCTCATGTTGTAGGGCCATGAAAGCGGCCATTCTTGTGATTCTTTGCACTTCTGGAACGGTGTATTGTTCACTATCCCAAGCGACACCATCACCATCGTCCTCCTTTCTCTTACCAAAGTAAATACCTCCCACTAATTCTCTGACAACAACGAAGTCAGTACCTTTAGCAAATTGTGGCTTGATTGGAGATAAGTCTAAAAGAGAGTCGGATGCAAAGTTACATGGTCTTAAGTTGGCGTACAATTGAAGTTCTTTACGGATTTTTAGTAAACCTTGTTCAGGTCTAACACTACCGGTTCCCCATTTAGGACCACCCACAGCACCTAACAAAACGGCATCAGCCTTCTTGGAGGCTTCCAGCGCCTCATCTGGAAGTGGAACACCTGTAGCATCGATAGCAGCACCACCAATTAAATGATTTTCGAAATCGAACTTGACATTGGAACGAACATCAGAAATAGCTTTAAGAACCTTAATGGCTTCGGCTGTGATTTCTTGACCAACGTGGTCACCTGGCAAAACGACGATCTTCTTAGGGGCAGACATTTTATAATTATTATAAAAACTTTCATATAAAAAGGAGTTTTTTAGTTACCTTAATTGAAATAAACGAAATAAAAACTCGCCCTCAGACTCAGATTGGTGTTTCAAAGATCCTCAAGGCAATAGAATAACAGATTTTGATAGTATTAATAAAGAATTAGGTCTTGGTAGAAGAGATGTAAAATTAGATAAAGGTCATGATGATTTAATTAAATTATGTACTGAAAAAATAGATAGTACTATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAAAATTTGTTGCCACTATTGCTGACGGTAGTAGTACCAATTATGCGGGTAGCGTGAAAGGCCGCTTTACCATTAGCCGCGATAACGCGAAAAACACCGTGTATCTGCAGATGAACAGCCTGAAACCGGAAGATACCGCGGTGTATTATTGCGCGGCTCTGGGTCAGGTTTCTGAATACAACTCTGCTTCTTACGAATGGACTTATCCGTATTGGGGCCAGGGCACCCAGGTGACCGTGAGCAGCGGTTCCAAGGACAATAGCTCGACGATTGAAGGTAGATACCCATACGACGTTCCAGACTACGCTCTGCAGGCTAGTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGCTAGCGACGTCCAGGAACTGACAACTATATGCGAGCAAATCCCCTCACCAACTTTAGAATCGACGCCGTACTCTTTGTCAACGACTACTATTTTGGCCAACGGGAAGGCAATGCAAGGAGTTTTTGAATATTACAAATCAGTAACGTTTGTCAGTAATTGCGGTTCTCACCCCTCAACAACTAGCAAAGGCAGCCCCATAAACACACAGTATGTTTTTTGAATCCTAATAATGGCCGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCTGTCACCGGATGTGTTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGGACTAGGCTGCGAATTTCTTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTCTTAGGTTTTAAAACGAAAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTTAAGCAAGGATTTTCTTAACTTCTTCGGCGACAGCATCACCGACTTCGGTGGTACTGTTGGAACCACCTAAATCACCAGTTCTGATACCTGCATCCAAAACCTTTTTAACTGCATCTTCAATGGCCTTACCTTCTTCAGGCAAGTTCAATGACAATTTCAACATCATTGCAGCAGACAAGATAGTGGCGATAGGGTTGACCTTATTCTTTGGCAAATCTGGAGCAGAACCGTGGCATGGTTCGTACAAACCAAATGCGGTGTTCTTGTCTGGCAAAGAGGCCAAGGACGCAGATGGCAACAAACCCAAGGAACCTGGGATAACGGAGGCTTCATCGGAGATGATATCACCAAACATGTTGCTGGTGATTATAATACCATTTAGGTGGGTTGGGTTCTTAACTAGGATCATGGCGGCAGAATCAATCAATTGATGTTGAACCTTCAATGTAGGAAATTCGTTCTTGATGGTTTCCTCCACAGTTTTTCTCCATAATCTTGAAGAGGCCAAAACATTAGCTTTATCCAAGGACCAAATAGGCAATGGTGGCTCATGTTGTAGGGCCATGAAAGCGGCCATTCTTGTGATTCTTTGCACTTCTGGAACGGTGTATTGTTCACTATCCCAAGCGACACCATCACCATCGTCCTCCTTTCTCTTACCAAAGTAAATACCTCCCACTAATTCTCTGACAACAACGAAGTCAGTACCTTTAGCAAATTGTGGCTTGATTGGAGATAAGTCTAAAAGAGAGTCGGATGCAAAGTTACATGGTCTTAAGTTGGCGTACAATTGAAGTTCTTTACGGATTTTTAGTAAACCTTGTTCAGGTCTAACACTACCGGTTCCCCATTTAGGACCACCCACAGCACCTAACAAAACGGCATCAGCCTTCTTGGAGGCTTCCAGCGCCTCATCTGGAAGTGGAACACCTGTAGCATCGATAGCAGCACCACCAATTAAATGATTTTCGAAATCGAACTTGACATTGGAACGAACATCAGAAATAGCTTTAAGAACCTTAATGGCTTCGGCTGTGATTTCTTGACCAACGTGGTCACCTGGCAAAACGACGATCTTCTTAGGGGCAGACATTTTATAATTATTATAAAAACTTTCATATAAAAAGGAGTTTTTTAGTTACCTTAATTGAAATAAACGAAATAAAAACTCGCCCTCAGACTCAGATTGGTGTTTCAAAGATCCTCAAGGCAATAGAATAACAGATTTTGATAGTATTAATAAAGAATTAGGTCTTGGTAGAAGAGATGTAAAATTAGATAAAGGTCATGATGATTTAATTAAATTATGTACTGAAAAAATAGATAGTACTATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTACGCTGCTGCTTTGCCATTGTCTAACTCTACCAACAACGGTTTGTCTTCTACCAACACCACCATCGCTTCTATCGCTGCTAAGGAAGAAGGTGTTCAATTGGACAAGAGAGAAGCTGACGCACAGGTGCAGCTGCAGGAAAGCGGCGGCGGCCTGGTGCAGGCGGGCGGCAGCCTGCGCCTGAGCTGCGCGGCGAGCGGCTATATTTCTGACGCTTACTACATGGGCTGGTATCGCCAGGCGCCGGGCAAAGAACGCGAATTTGTTGCCACTATTACTCATGGTACTAATACCTATTATGCGGATAGCGTGAAAGGCCGCTTTACCATTAGCCGCGATAACGCGAAAAACACCGTGTATCTGCAGATGAACAGCCTGAAACCGGAAGATACCGCGGTGTATTATTGCGCGGTTCTGGAAACTCGTTCTTACTCTTTTCGTTATTGGGGCCAGGGCACCCAGGTGACCGTGAGCAGCGGTTCCAAGGACAATAGCTCGACGATTGAAGGTAGATACCCATACGACGTTCCAGACTACGCTCTGCAGGCTAGTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGGTGGTGGTGGTTCTGCTAGCGACGTCCAGGAACTGACAACTATATGCGAGCAAATCCCCTCACCAACTTTAGAATCGACGCCGTACTCTTTGTCAACGACTACTATTTTGGCCAACGGGAAGGCAATGCAAGGAGTTTTTGAATATTACAAATCAGTAACGTTTGTCAGTAATTGCGGTTCTCACCCCTCAACAACTAGCAAAGGCAGCCCCATAAACACACAGTATGTTTTTTGAATCCTAATAATGGCCGCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAACCTGTCACCGGATGTGTTTTCCGGTCTGATGAGTCCGTGAGGACGAAACAGGACTAGGCTGCGAATTTCTTATGATTTATGATTTTTATTATTAAATAAGTTATAAAAAAAATAAGTGTATACAAATTTTAAAGTGACTCTTAGGTTTTAAAACGAAAATTCTTATTCTTGAGTAACTCTTTCCTGTAGGTCAGGTTGCTTTCTCAGGTATAGCATGAGGTCGCTCTTAAGCAAGGATTTTCTTAACTTCTTCGGCGACAGCATCACCGACTTCGGTGGTACTGTTGGAACCACCTAAATCACCAGTTCTGATACCTGCATCCAAAACCTTTTTAACTGCATCTTCAATGGCCTTACCTTCTTCAGGCAAGTTCAATGACAATTTCAACATCATTGCAGCAGACAAGATAGTGGCGATAGGGTTGACCTTATTCTTTGGCAAATCTGGAGCAGAACCGTGGCATGGTTCGTACAAACCAAATGCGGTGTTCTTGTCTGGCAAAGAGGCCAAGGACGCAGATGGCAACAAACCCAAGGAACCTGGGATAACGGAGGCTTCATCGGAGATGATATCACCAAACATGTTGCTGGTGATTATAATACCATTTAGGTGGGTTGGGTTCTTAACTAGGATCATGGCGGCAGAATCAATCAATTGATGTTGAACCTTCAATGTAGGAAATTCGTTCTTGATGGTTTCCTCCACAGTTTTTCTCCATAATCTTGAAGAGGCCAAAACATTAGCTTTATCCAAGGACCAAATAGGCAATGGTGGCTCATGTTGTAGGGCCATGAAAGCGGCCATTCTTGTGATTCTTTGCACTTCTGGAACGGTGTATTGTTCACTATCCCAAGCGACACCATCACCATCGTCCTCCTTTCTCTTACCAAAGTAAATACCTCCCACTAATTCTCTGACAACAACGAAGTCAGTACCTTTAGCAAATTGTGGCTTGATTGGAGATAAGTCTAAAAGAGAGTCGGATGCAAAGTTACATGGTCTTAAGTTGGCGTACAATTGAAGTTCTTTACGGATTTTTAGTAAACCTTGTTCAGGTCTAACACTACCGGTTCCCCATTTAGGACCACCCACAGCACCTAACAAAACGGCATCAGCCTTCTTGGAGGCTTCCAGCGCCTCATCTGGAAGTGGAACACCTGTAGCATCGATAGCAGCACCACCAATTAAATGATTTTCGAAATCGAACTTGACATTGGAACGAACATCAGAAATAGCTTTAAGAACCTTAATGGCTTCGGCTGTGATTTCTTGACCAACGTGGTCACCTGGCAAAACGACGATCTTCTTAGGGGCAGACATTTTATAATTATTATAAAAACTTTCATATAAAAAGGAGTTTTTTAGTTACCTTAATTGAAATAAACGAAATAAAAACTCGCCCTCAGACTCAGATTGGTGTTTCAAAGATCCTCAAGGCAATAGAATAACAGATTTTGATAGTATTAATAAAGAATTAGGTCTTGGTAGAAGAGATGTAAAATTAGATAAAGGTCATGATGATTTAATTAAATTATGTACTGAAAAAATAGATAGTACTATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCAAAATTTGTTTACTAAAAACACATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTATCCGCCAAGTACAATTTTTTACTCTTCGAGGACAGAAAATTTGCTGACATTGGTAATACAGTCAAATTGCAGTACTCTGCGGGTGTATACAGAATAGCAGAATGGGCAGACATTACGAATGCACACGGTGTGGTGGGCCCAGGTATTGTTAGCGGTTTGAAGCAGGCGGCAGAAGAAGTAACAAAGGAACCTAGAGGCCTTTTGATGTTAGCAGAATTGTCATGCAAGGGCTCCCTATCTACTGGAGAATATACTAAGGGTACTGTTGACATTGCGAAGAGCGACAAAGATTTTGTTATCGGCTTTATTGCTCAAAGAGACATGGGTGGAAGAGATGAAGGTTACGATTGGTTGATTATGACACCCGGTGTGGGTTTAGATGACAAGGGAGATGCATTGGGTCAACAGTATAGAACCGTGGATGATGTGGTTTCTACAGGATCTGACATTATTATTGTTGGAAGAGGACTATTTGCAAAGGGAAGGGATGCTAAGGTAGAGGGTGAACGTTACAGAAAAGCAGGCTGGGAAGCATATTTGAGAAGATGCGGCCAGCAAAACTAACGCGCCCGGGGAGCCCGTGGGCACGCCCTGGCACAATCCATAATGGCTTCATCTAATGTGGACTCTTCTGAGCCCCGTATTTCCAGAGAAAGCTCTTTGAAGAGGTCTCTATCTATTTCAAAGTCGTTAAAAGGGTTGTTCAAGTCAGGAGGGGGAAACGCCAATACTGGCCCTACTACTGCTGCTGCTGCTGCTGCACCATCTAGTATCTTTTAAATTAATAATGTAATTCATATATTATAGTACTCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTCACCGTCATCACCGAAACGCGTGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGTTAGCTTTATAAGTAGTTTTAAAATCAGCCAAATATCTACCACCATCTTTCAATCTCAAAGCCATTTTAATATCACCTTTCAAAACACCATCTTCAGGATACAATCTTTCAGTAGAAGCTTCCCAACCCATAGTTTTTTTTTGCATAACAGGACCATCAGGTGGAAAATTAGTACCTCTCAATTTAACTTTATAAATCAAAGTACCATCTTCCAAAGAAGTATCTTGAGTAACAGTAACAGCACCACCATCTTCAAAATTCATAACTCTTTCCCATTTAAAACCTTCAGGAAAAGATTGTTTATAATAATCAGGAATATCAGCAGGATGTTTAATAAAAGCTCTAGAACCATACATAAATTGTGGAGACAAAATATCCCAAGAAAATGGCAATGGACCACCTTTAGTAACTTTCAATTTAGCAGTTTGAGTACCTTCATAAGGTCTACCTTCACCTTCACCTTCAATTTCAAATTCATGACCATTCATAGAACCTTCCATGTGAACTTTAAATCTCATAAATTCTTTAATAACAGCTTCACCTTTAGAAACCATATTTTTATATGTCTATGAGCTTATCACATGTTTCTATATTTTTCTGATATTTGAAAGTTATTAATCTTTTTGTTTCTATAGATCTTCCTATGTATAGGTCATCCGTTATCGTCTCAAGCAGTACAGAAAATTAATTTCTAATGTGAACACTAGTGAGATAGCTAAAGATCTTAATTGTGAAAACAATATTGAAAGTATAATAAATACATTAAAAGAACAAAATAGATATTTTGACAAACAAATTGAATATATGTCTGCCCCTAAGAAGATCGTCGTTTTGCCAGGTGACCACGTTGGTCAAGAAATCACAGCCGAAGCCATTAAGGTTCTTAAAGCTATTTCTGATGTTCGTTCCAATGTCAAGTTCGATTTCGAAAATCATTTAATTGGTGGTGCTGCTATCGATGCTACAGGTGTTCCACTTCCAGATGAGGCGCTGGAAGCCTCCAAGAAGGCTGATGCCGTTTTGTTAGGTGCTGTGGGTGGTCCTAAATGGGGAACCGGTAGTGTTAGACCTGAACAAGGTTTACTAAAAATCCGTAAAGAACTTCAATTGTACGCCAACTTAAGACCATGTAACTTTGCATCCGACTCTCTTTTAGACTTATCTCCAATCAAGCCACAATTTGCTAAAGGTACTGACTTCGTTGTTGTCAGAGAATTAGTGGGAGGTATTTACTTTGGTAAGAGAAAGGAGGACGATGGTGATGGTGTCGCTTGGGATAGTGAACAATACACCGTTCCAGAAGTGCAAAGAATCACAAGAATGGCCGCTTTCATGGCCCTACAACATGAGCCACCATTGCCTATTTGGTCCTTGGATAAAGCTAATGTTTTGGCCTCTTCAAGATTATGGAGAAAAACTGTGGAGGAAACCATCAAGAACGAATTTCCTACATTGAAGGTTCAACATCAATTGATTGATTCTGCCGCCATGATCCTAGTTAAGAACCCAACCCACCTAAATGGTATTATAATCACCAGCAACATGTTTGGTGATATCATCTCCGATGAAGCCTCCGTTATCCCAGGTTCCTTGGGTTTGTTGCCATCTGCGTCCTTGGCCTCTTTGCCAGACAAGAACACCGCATTTGGTTTGTACGAACCATGCCACGGTTCTGCTCCAGATTTGCCAAAGAATAAGGTCAACCCTATCGCCACTATCTTGTCTGCTGCAATGATGTTGAAATTGTCATTGAACTTGCCTGAAGAAGGTAAGGCCATTGAAGATGCAGTTAAAAAGGTTTTGGATGCAGGTATCAGAACTGGTGATTTAGGTGGTTCCAACAGTACCACCGAAGTCGGTGATGCTGTCGCCGAAGAAGTTAAGAAAATCCTTGCTTAAAAGAGAGTGAGGGTTTGTACCGTACACCACTGAGAGCGCGGTGGTTGACCAGACAAACCTCTATTTCAAAGTCGTTAAAAGGGTTGTTCAAGTCAGGAGGGGGAAACGCCAATACTGGCCCTACTACTGCTGCTGCTGCTGCTGCACCATCTAGTATCTTTTAAATTAATAATGTAATTCATATATTATAGTGCGGCCGCGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGGCGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACGAAACCATATTTTTATATGTCTATGAGCTTATCACATGTTTCTATATTTTTCTGATATTTGAAAGTTATTAATCTTTTTGTTTCTATAGATCTTCCTATGTATAGGTCATCCGTTATCGTCTCAAGCAGTACAGAAAATTAATTTCTAATGTGAACACTAGTGAGATAGCTAAAGATCTTAATTGTGAAAACAATATTGAAAGTATAATAAATACATTAAAAGAACAAAATAGATATTTTGACAAACAAATTGAATATATGTCTGCCCCTAAGAAGATCGTCGTTTTGCCAGGTGACCACGTTGGTCAAGAAATCACAGCCGAAGCCATTAAGGTTCTTAAAGCTATTTCTGATGTTCGTTCCAATGTCAAGTTCGATTTCGAAAATCATTTAATTGGTGGTGCTGCTATCGATGCTACAGGTGTTCCACTTCCAGATGAGGCGCTGGAAGCCTCCAAGAAGGCTGATGCCGTTTTGTTAGGTGCTGTGGGTGGTCCTAAATGGGGAACCGGTAGTGTTAGACCTGAACAAGGTTTACTAAAAATCCGTAAAGAACTTCAATTGTACGCCAACTTAAGACCATGTAACTTTGCATCCGACTCTCTTTTAGACTTATCTCCAATCAAGCCACAATTTGCTAAAGGTACTGACTTCGTTGTTGTCAGAGAATTAGTGGGAGGTATTTACTTTGGTAAGAGAAAGGAGGACGATGGTGATGGTGTCGCTTGGGATAGTGAACAATACACCGTTCCAGAAGTGCAAAGAATCACAAGAATGGCCGCTTTCATGGCCCTACAACATGAGCCACCATTGCCTATTTGGTCCTTGGATAAAGCTAATGTTTTGGCCTCTTCAAGATTATGGAGAAAAACTGTGGAGGAAACCATCAAGAACGAATTTCCTACATTGAAGGTTCAACATCAATTGATTGATTCTGCCGCCATGATCCTAGTTAAGAACCCAACCCACCTAAATGGTATTATAATCACCAGCAACATGTTTGGTGATATCATCTCCGATGAAGCCTCCGTTATCCCAGGTTCCTTGGGTTTGTTGCCATCTGCGTCCTTGGCCTCTTTGCCAGACAAGAACACCGCATTTGGTTTGTACGAACCATGCCACGGTTCTGCTCCAGATTTGCCAAAGAATAAGGTCAACCCTATCGCCACTATCTTGTCTGCTGCAATGATGTTGAAATTGTCATTGAACTTGCCTGAAGAAGGTAAGGCCATTGAAGATGCAGTTAAAAAGGTTTTGGATGCAGGTATCAGAACTGGTGATTTAGGTGGTTCCAACAGTACCACCGAAGTCGGTGATGCTGTCGCCGAAGAAGTTAAGAAAATCCTTGCTTAAAAGAGAGTGAGCCCCCAACTGAGAGAACTCGTAGGTTACCCCAGTTGGGGCTCTATTTCAAAGTCGTTAAAAGGGTTGTTCAAGTCAGGAGGGGGAAACGCCAATACTGGCCCTACTACTGCTGCTGCTGCTGCTGCACCATCTAGTATCTTTTAAATTAATAATGTAATTCATATATTATAGTGCGGCCGCGTGTTACAACCAATTAACCAATTCTGATTAGAAAAACTCATCGAGCATCAAATGAAACTGCAATTTATTCATATCAGGATTATCAATACCATATTTTTGAAAAAGCCGTTTCTGTAATGAAGGAGAAAACTCACCGAGGCAGTTCCATAGGATGGCAAGATCCTGGTATCGGTCTGCGATTCCGACTCGTCCAACATCAATACAACCTATTAATTTCCCCTCGTCAAAAATAAGGTTATCAAGTGAGAAATCACCATGAGTGACGACTGAATCCGGTGAGAATGGCAAAAGCTTATGCATTTCTTTCCAGACTTGTTCAACAGGCCAGCCATTACGCTCGTCATCAAAATCACTCGCATCAACCAAACCGTTATTCATTCGTGATTGCGCCTGAGCGAGGCGAAATACGCGATCGCTGTTAAAAGGACAATTACAAACAGGAATCGAATGCAACCGGCGCAGGAACACTGCCAGCGCATCAACAATATTTTCACCTGAATCAGGATATTCTTCTAATACCTGGAATGCTGTTTTCCCGGGGATCGCAGTGGTGAGTAACCATGCATCATCAGGAGTACGGATAAAATGCTTGATGGTCGGAAGAGGCATAAATTCCGTCAGCCAGTTTAGTCTGACCATCTCATCTGTAACATCATTGGCAACGCTACCTTTGCCATGTTTCAGAAACAACTCTGGCGCATCGGGCTTCCCATACAATCGATAGATTGTCGCACCTGATTGCCCGACATTATCGCGAGCCCATTTATACCCATATAAATCAGCATCCATGTTGGAATTTAATCGCGGCCTGGAGCAAGACGTTTCCCGTTGAATATGGCTCATAACACCCCTTGTATTACTGTTTATGTAAGCAGACAGTTTTATTGTTCATGATGATATATTTTTATCTTGTGCAATGTAACATCAGAGATTTTGAGACACAACGTGGCTTTGTTGAATAAATCGAACTTTTGCTGAGTTGAAGGATCAGTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAATATCTGCGTGTTGCCTGTATATATATATACATGAGAAGAACGGCATAGTGCGTGTTTATGCTTAAATGCGTATATGTGTTATGTATAGGTCTAGAGATCTGTTTAGCTTGCCTCGTCCCCGCCGGGTCACCCGGCCAGCGACATGGAGGCCCAGAATACCCTCCTTGACAGTCTTGACGTGCGCAGCTCAGGGGCATGATGTGACTGTCGCCCGTACATTTAGCCCATACATCCCCATGTATAATCATTTGCATCCATACATTTTGATGGCCGCACGGCGCGAAGCAAAAATTACGGCTCCTCGCTGCAGACCTGCGAGCAGGGAAACGCTCCCCTCACAGACGCGTTGAATTGTCCCCACGCCGCGCCCCTGTAGAGAAATATAAAAGGTTAGGATTTGCCACTGAGGTTCTTCTTTCATATACTTCCTTTTAAAATCTTGCTAGGATACAGTTCTCACATCACATCCGAACATAAACAACCATGGGTAAGGAAAAGACTCACGTTTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGCAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGTACTGACAATAAAAAGATTCTTGTTTTCAAGAACTTGTCATTTGTATAGTTTTTTTATATTGTAGTTGTTCTATTTTAATCAAATGTTAGCGTGATTTATATTTTTTTTCGCCTCGACATCATCTGCCCAGATGCGAAGTTAAGTGCGCAGAAAGTAATATCATGCGTCAATCGTATGTGAATGCTGGTCGCTATACTGCTGTCGATTCGATACTAACGCCGCCATCCAGTGTCGAAAACGAGCTCTCGAGAACCCTTAATGTCGACAGTCGAACAAGAAGCAGGCAAAGTTTAGAGCACTGCCCCTCCGCACTCAAAAAAGAAAAAACTAGGAGGAAAATAAAATTCTCAACCACACAAACACATAAACACATACAAATACAAATACAAGCTTATTTACTTGACATCGCGCGATCTTCCACTATTCAGCGCCGTCCGCCCTCTCTCGTGTTTTTTGTTTACGCGACAACTATGCGAAATCCGGAGCAACGGGCAACCGTTTGGGGAAAGACCACACCCACGCGCGATCGCCATGGCAACGAGGTCGCACACGCCCCACACCCAGACCTCCCTGCGAGCGGGCATGGGTACAATGTCCCCGTTGCCACAGACACCACTTCGTAGCACAGCGCAGAGCGTAGCGTGTTGTTGCTGCTGACAAAAGAAAATTTTTCTTAGCAAAGCAAAGGAGGGGAAGCACGGGCAGATAGCACCGTACCATACCCTTGGAAACTCGAAATGAACGAAGCAGGAAATGAGAGAATGAGAGTTTTGTAGGTATATATAGCGGTAGTGTTTGCGCGTTACCATCATCTTCTGGATCTATCTATTGTTCTTTTCCTCATCACTTTCCCCTTTTTCGCTCTTCTTCTTGTCTTTTATTTCTTTCTTTTTTTTAATTGTTCCCTCGATTGGCTATCTACCAAAGAATCCAAACTTAATACACGTATTTATTTGTCCAATTACCATGGTGAGAGCCCTGGTAGTCATCCGCCTGTCCCGCGTCACCGATGCTACGACTTCACCGGAGCGTCAGCTGGAGTCTTGCCAGCAGCTCTGCGCCCAGCGCGGCTGGGACGTCGTCGGGGTAGCGGAGGATCTGGACGTCTCCGGGGCGGTCGATCCGTTCGACCGGAAGCGCAGACCGAACCTGGCCCGGTGGCTAGCGTTCGAGGAGCAACCGTTTGACGTGATCGTGGCGTACCGGGTAGATCGGTTGACCCGATCGATCCGGCATCTTCAGCAGCTGGTCCACTGGGCCGAGGACCACAAGAAGCTGGTCGTCTCCGCGACCGAAGCGCACTTCGATACGACGACGCCGTTTGCGGCGGTATCCCGAGAGCGCTATTTTTCTAACAAAGCATCTTAGATTACTTTTTTTCTCCTTTGTGCGCTCTATAATGCAGTCTCTTGATAACTTTTTGCACTGTAGGTCCGTTAAGGTTAGAAGAAGGCTACTTTGGTGTCTATTTTCTCTTCCATAAAAAAAGCCTGACTCCACTTCCCGCGTTTACTGATTACTAGCGAAGCTGCGGGTGCATTTTTTCAAGATAAAGGCATCCCCGATTATATTCTATACCGATGTGGATTGCGCATACTTTGTGAACAGAAAGTGATAGCGTTGATGATTCTTCATTGGTCAGAAAATTATGAACGGTTTCTTCTATTTTGTCTCTATATACTACGTATAGGAAATGTTTACATTTTCGTATTGTTTTCGATTCACTCTATGAATAGTTCTTACTACAATTTTTTTGTCTAAAGAGTAATACTAGAGATAAACATAAAAAATGTAGAGGTCGAGTTTAGATGCAAGTTCAAGGAGCGAAAGGTGGATGGGTAGGTTATATAGGGATATAGCACAGAGATATATAGCAAAGAGATACTTTTGAGCAATGTTTGTGGAAGCGGTATTCGCAATATTTTAGTAGCTCGTTACAGTCCGGTGCGTTTTTGGTTTTTTGAAAGTGCGTCTTCAGAGCGCTTTTGGTTTTCAAAAGCGCTCTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCAAAGCGTTTCCGAAAACGAGCGCTTCCGAAAATGCAACGCGAGCTGCGCACATACAGCTCACTGTTCACGTCGCACCTATATCTGCGTGTTGCCTGTATATATATATACATGAGAAGAACGGCATAGTGCGTGTTTATGCTTAAATGCGTATATGTGTTATGTATAGGTCTAGAGATCTGTTTAGCTTGCCTCGTCCCCGCCGGGTCACCCGGCCAGCGACATGGAGGCCCAGAATACCCTCCTTGACAGTCTTGACGTGCGCAGCTCAGGGGCATGATGTGACTGTCGCCCGTACATTTAGCCCATACATCCCCATGTATAATCATTTGCATCCATACATTTTGATGGCCGCACGGCGCGAAGCAAAAATTACGGCTCCTCGCTGCAGACCTGCGAGCAGGGAAACGCTCCCCTCACAGACGCGTTGAATTGTCCCCACGCCGCGCCCCTGTAGAGAAATATAAAAGGTTAGGATTTGCCACTGAGGTTCTTCTTTCATATACTTCCTTTTAAAATCTTGCTAGGATACAGTTCTCACATCACATCCGAACATAAACAACCATGGGTAAGGAAAAGACTCACGTTTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGCAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGTACTGACAATAAAAAGATTCTTGTTTTCAAGAACTTGTCATTTGTATAGTTTTTTTATATTGTAGTTGTTCTATTTTAATCAAATGTTAGCGTGATTTATATTTTTTTTCGCCTCGACATCATCTGCCCAGATGCGAAGTTAAGTGCGCAGAAAGTAATATCATGCGTCAATCGTATGTGAATGCTGGTCGCTATACTGCTGTCGATTCGATACTAACGCCGCCATCCAGTGTCGAAAACGAGCTCTCGAGAACCCTTAATGTCGACAGTCGAACAAGAAGCAGGCAAAGTTTAGAGCACTGCCCCTCCGCACTCAAAAAAGAAAAAACTAGGAGGAAAATAAAATTCTCAACCACACAAACACATAAACACATACAAATACAAATACAAGCTTATTTACTTGACATCGCGCGATCTTCCACTATTCAGCGCCGTCCGCCCTCTCTCGTGTTTTTTGTTTACGCGACAACTATGCGAAATCCGGAGCAACGGGCAACCGTTTGGGGAAAGACCACACCCACGCGCGATCGCCATGGCAACGAGGTCGCACGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTGCGGCCGCCCCTGAATTCGCATCTAGAACGCACAAGGTCAGGGCACTCATGCGACAATCAACTCGATGCATGATCCGCACCATTGTCGAGGGGCCAGCGTCAATAGTGCCGATGACCACAGACCCGGTTAAGACATAGCCGAATGGAGCCGCGCCGACCACAGAATGATACGTCTCAAAGTCAGTTCGAGTTTATCATTATCAATACTGCCATTTCAAAGAATACGTAAATAATTAATAGTAGTGATTTTCCTAACTTTATTTAGTCAAAAAATTAGCCTTTTAATTCTGCTGTAACCCGTACATGCCCAAAATAGGGGGCGGGTTACACAGAATATATAACATCGTAGGTGTCTGGGTGAACAGTTTATTCCTGGCATCCACTAAATATAATGGAGCCCGCTTTTTAAGCTGGCATCCAGAAAAAAAAAGAATCCCAGCACCAAAATATTGTTTTCTTCACCAACCATCAGTTCATAGGTCCATTCTCTTAGCGCAACTACAGAGAACAGGGGCACAAACAGGCAAAAAACGGGCACAACCTCAATGGAGTGATGCAACCTGCCTGGAGTAAATGATGACACAAGGCAATTGACCCACGCATGTATCTATCTCATTTTCTTACACCTTCTATTACCTTCTGCTCTCTCTGATTTGGAAAAAGCTGAAAAAAAAGGTTGAAACCAGTTCCCTGAAATTATTCCCCTACTTGACTAATAAGTATATAAAGACGGTAGGTATTGATTGTAATTCTGTAAATCTATTTCTTAAACTTCTTAAATTCTACTTTTATAGTTAGTCTTTTTTTTAGTTTTAAAACACCAAGAACTTAGTTTCGAATAAACACACATAAACAAACAAAATGAAGGAGAAGAGTGCTTGTCCTAAAGATCCAGCCAAACCTCCGGCCAAGGCACAAGTTGTGGGATGGCCACCGGTGAGATCATACCGGAAGAACGTGATGGTTTCCTGCCAAAAATCAAGCGGTGGCCCGGAGGCGGCGGCGTTCGTGAAGGTATCAATGGACGGAGCACCGTACTTGAGGAAAATCGATTTGAGGATGTATAAAGCTAGCATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACAACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGACGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGTCCGCCCTGAGCAAAGACCCCAACGAGAAGCGCGATCACATGGTCCTGCTGGAGTTCGTGACCGCCGCCGGGATCACTCTCGGCATGGACGGCTGTACAAGTAAAGCTTTTGATTAAGCCTTCTAGTCCAAAAAACACGTTTTTTTGTCATTTATTTCATTTTCTTAGAATAGTTTAGTTTATTCATTTTATAGTCACGAATGTTTTATGATTCTATATAGGGTTGCAAACAAGCATTTTTCATTTTATGTTAAAACAATTTCAGGTTTACCTTTTATTCTGCTTGTGGTGACGCGTGTATCCGCCCGCTCTTTTGGTCACCCATGTATGGTATGAGACGGCCTGCACTAGACGAACTAGGCAAGATGCGTCCAATCCGTCTAAACATGGTGACAACGCTGGACAGATGACGTAACACCGAGCCACATCCTGAAATCGAGGCAGGCTAACCGAAACCGTGACAATGCAAAGAGACAGCCTGACACTAGTGCACTGCAGTACAAACACAGTCCTTTCCCGCAATTTTCTTTTTCTATTACTCTTGGCCTCCTCTAGTACACTCTATATTTTTTTATGCCTCGGTAATGATTTTCATTTTTTTTTTTCCACCTAGCGGATGACTCTTTTTTTTTCTTAGCGATTGGCATTATCACATAATGAATTATACATTATATAAAGTAATGTGATTTCTTCGAAGAATATACTAAAAAATGAGCAGGCAAGATAAACGAAGGCAAAGATGACAGAGCAGAAAGCCCTAGTAAAGCGTATTACAAATGAAACCAAGATTCAGATTGCGATCTCTTTAAAGGGTGGTCCCCTAGCGATAGAGCACTCGATCTTCCCAGAAAAAGAGGCAGAAGCAGTAGCAGAACAGGCCACACAATCGCAAGTGATTAACGTCCACACAGGTATAGGGTTTCTGGACCATATGATACATGCTCTGGCCAAGCATTCCGGCTGGTCGCTAATCGTTGAGTGCATTGGTGACTTACACATAGACGACCATCACACCACTGAGGACTGCGGGATTGCTCTCGGTCAAGCTTTTAAAGAGGCCCTAGGGGCCGTGCGTGGAGTAAAAAGGTTTGGATCAGGATTTGCGCCTTTGGATGAGGCACTTTCCAGAGCGGTGGTTGATCTTTCGAACAGGCCGTACGCAGTTGTCGAACTTGGTTTGCAAAGGGAGAAAGTAGGTGATCTCTCTTGCGAGATGATCCCGCATTTTCTTGAAAGCTTTGCAGAGGCTAGCAGAATTACCCTCCACGTTGATTGTCTGCGAGGCAAGAATGATCATCACCGTAGTGAGAGTGCGTTCAAGGCTCTTGCGGTTGCCATAAGAGAAGCCACCTCGCCCAATGGTACCAACGATGTTCCCTCCACCAAAGGTGTTCTTATGTAGTGACACCGATTATTTAAAGCTGCTGCATACGATATATATACATGTGTATATATGTATACCTATGAATGTCAGTAAGTATGTATACGAACAGTATGATACTGAAGATGACAAGGTAATGCATCATTCTATACGTGTCATTCTGAACGAGGCGCGCTTTCCTTTTTTCTTTTTGCTTTTTCTTTTTTTTTCTCTTGAACTCGACGGATCATAGAGTAACGAAGCATCTGTGCTTCATTTTGTAGAACAAAAATGCAACGCGAGAGCGCTAATTTTTCAAACAAAGAATCTGAGCTGCATTTTTACAGAACAGAAATGCAACGCGAAAGCGCTATTTTACCAACGAAGAATCTGTGCTTCATTTTTGTAAAACAAAAATGCAACGCGAGAGCGCTAATTTTTCAAACAAAGAATCTGAGCTGCATTTTTACAGAACAGAAATGCAACGCGAGAGCGCTATTTTACCAACAAAGAATCTATACTTCTTTTTTGTTCTACAAAAATGCATCCCGAGAGCGCTATTTTTCTAACAAAGCATCTTAGATTACTTTTTTTCTCCTTTGTGCGCTCTATAATGCAGTCTCTTGATAACTTTTTGCACTGTAGGTCCGTTAAGGTTAGAAGAAGGCTACTTTGGTGTCTATTTTCTCTTCCATAAAAAAAGCCTGACTCCACTTCCCGCGTTTACTGATTACTAGCGAAGCTGCGGGTGCATTTTTTCAAGATAAAGGCATCCCCGATTATATTCTATACCGATGTGGATTGCGCATACTTTGTGAACAGAAAGTGATAGCGTTGATGATTCTTCATTGGTCAGAAAATTATGAACGGTTTCTTCTATTTTGTCTCTATATACTACGTATAGGAAATGTTTACATTTTCGTATTGTTTTCGATTCACTCTATGAATAGTTCTTACTACAATTTTTTTGTCTAAAGAGTAATACTAGAGATAAACATAAAAAATGTAGAGGTCGAGTTTAGATGCAAGTTCAAGGAGCGAAAGGTGGATGGGTAGGTTATATAGGGATATAGCACAGAGATATATAGCAAAGAGATACTTTTGAGCAATGTTTGTGGAAGCGGTATTCGCAATATTTTAGTAGCTCGTTACAGTCCGGTGCGTTTTTGGTTTTTTGAAAGTGCGTCATCAGAGCGCTTTTGGTTTTCAAAAGCGCTCTGAAGTTCCTATACTTTCTAGCTAGAGAATAGGAACTTCCCGAGCGGCCGCGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCTCAGGTTTAGCATCTCATTCTCATCATGAAAATGCTAAGAAGTATCTATCTAACGGTTTCGGTGGTGTCTTATCTTTCGGTGTAAAAGACTTACCAAATGCCGACAAGGAAACTGACCCATTCAAACTTTCTGGTGCTCAAGTTGTTGACAATTTAAAGCTTGCCTCTAACTTGGCCAATGTTGGTGATGCCAAGACCTTAGTCATTGCTCCATACTTCACTACCCACAAACAATTAAATGACAAAGAAAAGTTGGCATCTGGTGTTACCAAGGACTTAATTCGTGTCTCTGTTGGTATCGAATTTATTGATGACATTATTGCAGACTTCCAACAATCTTTTGAAACTGTTTTCGCTGGCCAAAAACCATGAAAAACTGTATTATAAGTAAATGCATGTATACTAAACTCACAAATTAGAGCTTCAATTTAATTATATCAGTTATTACCCGTCGACAACACAGTCCTTTCCCGCAATTTTCTTTTTCTATTACTCTTGGCCTCCTCTAGTACACTCTATATTTTTTTATGCCTCGGTAATGATTTTCATTTTTTTTTTTCCACCTAGCGGATGACTCTTTTTTTTTCTTAGCGATTGGCATTATCACATAATGAATTATACATTATATAAAGTAATGTGATTTCTTCGAAGAATATACTAAAAAATGAGCAGGCAAGATAAACGAAGGCAAAGATGACAGAGCAGAAAGCCCTAGTAAAGCGTATTACAAATGAAACCAAGATTCAGATTGCGATCTCTTTAAAGGGTGGTCCCCTAGCGATAGAGCACTCGATCTTCCCAGAAAAAGAGGCAGAAGCAGTAGCAGAACAGGCCACACAATCGCAAGTGATTAACGTCCACACAGGTATAGGGTTTCTGGACCATATGATACATGCTCTGGCCAAGCATTCCGGCTGGTCGCTAATCGTTGAGTGCATTGGTGACTTACACATAGACGACCATCACACCACTGAGGACTGCGGGATTGCTCTCGGTCAAGCTTTTAAAGAGGCCCTAGGGGCCGTGCGTGGAGTAAAAAGGTTTGGATCAGGATTTGCGCCTTTGGATGAGGCACTTTCCAGAGCGGTGGTTGATCTTTCGAACAGGCCGTACGCAGTTGTCGAACTTGGTTTGCAAAGGGAGAAAGTAGGTGATCTCTCTTGCGAGATGATCCCGCATTTTCTTGAAAGCTTTGCAGAGGCTAGCAGAATTACCCTCCACGTTGATTGTCTGCGAGGCAAGAATGATCATCACCGTAGTGAGAGTGCGTTCAAGGCTCTTGCGGTTGCCATAAGAGAAGCCACCTCGCCCAATGGTACCAACGATGTTCCCTCCACCAAAGGTGTTCTTATGTAGTGACACCGATTATTTAAAGCTGCTGCATACGATATATATACATGTGTATATATGTATACCTATGAATGTCAGTAAGTATGTATACGAACAGTATGATACTGAAGATGACAAGGTAATGCATCATTCTATACGTGTCATTCTGAACGAGGCGCGCTTTCCTTTTTTCTTTTTGCTTTTTCTTTTTTTTTCTCTTGAACTCGACGGATCATACTCGAGATCTGATAACAACAGTGTAGATGTAACAAAATCGACTTTGTTCCCACTGTACTTTTAGCTCGTACAAAATACAATATACTTTTCATTTCTCCGTAAACAACATGTTTTCCCATGTAATATCCTTTTCTATTTTTCGTTCCGTTACCAACTTTACACATACTTTATATAGCTATTCACTTCTATACACTAAAAAACTAAGACAATTTTAATTTTGCTGCCTGCCATATTTCAATTTGTTATAAATTCCTATAATTTATCCTATTAGTAGCTAAAAAAAGATGAATGTGAATCGAATCCTAAGAGAATTGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACAAAATATTAACGTTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTATTTCACACCGCATAGATCGGCAAGTGCACAAACAATACTTAAATAAATACTACTCAGTAATAACTATGGTGCACTCTCAGTACAATCTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAACGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATAGTACTATCTATTTTTTCAGTACATAATTTAATTAAATCATCATGACCTTTATCTAATTTTACATCTCTTCTACCAAGACCTAATTCTTTATTAATACTATCAAAATCTGTTATTCTATTGCCTTGAGGATCTTTGAAACACCAATCTGAGTCTGAGGGCATGCCCAGGTTTTTGACGAAAGTGATCCAGATGATCCAGCTTTTTCGCCGGAGTCAATTAGGTCATACTTTTCTATATAATCCAAATCCCAAAAATCAATTGAATGATTCTTAATATGATTTAATAGTTTATGATTATAAATGTCGAAAGCTACATATAAGGAACGTGCTGCTACTCATCCTAGTCCTGTTGCTGCCAAGCTATTTAATATCATGCACGAAAAGCAAACAAACTTGTGTGCTTCATTGGATGTTCGTACCACCAAGGAATTACTGGAGTTAGTTGAAGCATTAGGTCCCAAAATTTGTTTACTAAAAACACATGTGGATATCTTGACTGATTTTTCCATGGAGGGCACAGTTAAGCCGCTAAAGGCATTATCCGCCAAGTACAATTTTTTACTCTTCGAGGACAGAAAATTTGCTGACATTGGTAATACAGTCAAACAAGATAAAGGCATCCCCGATTATATTCTATACCGATGTGGATTGCGCATACTTTGTGAACAGAAAGTGATAGCGTTGATGATTCTTCATTGGTCAGAAAATTATGAACGGTTTCTTCTATTTTGTCTCTATATACTACGTATAGGAAATGTTTACATTTTCGTATTGTTTTCGATTCACTCTATGAATAGTTCTTACTACAATTTTTTTGTCTAAAGAGTAATACTAGAGATAAACATAAAAAATGTAGAGGTCGAGTTTAGATGCAAGTTCAAGGAGCGAAAGGTGGATGGGTAGGTTATATAGGGATATAGCACAGAGATATATAGCAAAGAGATACTTTTGAGCAATGTTTGTGGAAGCGGTATTCGCAATATTTTAGTAGCTCGTTACAGTCCGGTGCGTTTTTGGTTTTTTGAAAGTGCGTCTTCAGAGCGCTTTTGGTTTTCAAAAGCGCTCTGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCGGAATAGGAACTTCAAAGCGTTTCCGAAAACGAGCGCTTCCGAAAATGCAACGCGAGCTGCGCACATACAGCTCACTGTTCACGTCGCACCTATATCTGCGTGTTGCCTGTATATATATATACATGAGAAGAACGGCATAGTGCGTGTTTATGCTTAAATGCGTATATGTGTTATGTATAGGTCTAGAGATCTGTTTAGCTTGCCTCGTCCCCGCCGGGTCACCCGGCCAGCGACATGGAGGCCCAGAATACCCTCCTTGACAGTCTTGACGTGCGCAGCTCAGGGGCATGATGTGACTGTCGCCCGTACATTTAGCCCATACATCCCCATGTATAATCATTTGCATCCATACATTTTGATGGCCGCACGGCGCGAAGCAAAAATTACGGCTCCTCGCTGCAGACCTGCGAGCAGGGAAACGCTCCCCTCACAGACGCGTTGAATTGTCCCCACGCCGCGCCCCTGTAGAGAAATATAAAAGGTTAGGATTTGCCACTGAGGTTCTTCTTTCATATACTTCCTTTTAAAATCTTGCTAGGATACAGTTCTCACATCACATCCGAACATAAACAACCATGGGTAAGGAAAAGACTCACGTTTCGAGGCCGCGATTAAATTCCAACATGGATGCTGATTTATATGGGTATAAATGGGCTCGCGATAATGTCGGGCAATCAGGTGCGACAATCTATCGATTGTATGGGAAGCCCGATGCGCCAGAGTTGTTTCTGAAACATGGCAAAGGTAGCGTTGCCAATGATGTTACAGATGAGATGGTCAGACTAAACTGGCTGACGGAATTTATGCCTCTTCCGACCATCAAGCATTTTATCCGTACTCCTGATGATGCATGGTTACTCACCACTGCGATCCCCGGCAAAACAGCATTCCAGGTATTAGAAGAATATCCTGATTCAGGTGAAAATATTGTTGATGCGCTGGCAGTGTTCCTGCGCCGGTTGCATTCGATTCCTGTTTGTAATTGTCCTTTTAACAGCGATCGCGTATTTCGTCTCGCTCAGGCGCAATCACGAATGAATAACGGTTTGGTTGATGCGAGTGATTTTGATGACGAGCGTAATGGCTGGCCTGTTGAACAAGTCTGGAAAGAAATGCATAAGCTTTTGCCATTCTCACCGGATTCAGTCGTCACTCATGGTGATTTCTCACTTGATAACCTTATTTTTGACGAGGGGAAATTAATAGGTTGTATTGATGTTGGACGAGTCGGAATCGCAGACCGATACCAGGATCTTGCCATCCTATGGAACTGCCTCGGTGAGTTTTCTCCTTCATTACAGAAACGGCTTTTTCAAAAATATGGTATTGATAATCCTGATATGAATAAATTGCAGTTTCATTTGATGCTCGATGAGTTTTTCTAATCAGTACTGACAATAAAAAGATTCTTGTTTTCAAGAACTTGTCATTTGTATAGTTTTTTTATATTGTAGTTGTTCTATTTTAATCAAATGTTAGCGTGATTTATATTTTTTTTCGCCTCGACATCATCTGCCCAGATGCGAAGTTAAGTGCGCAGAAAGTAATATCATGCGTCAATCGTATGTGAATGCTGGTCGCTATACTGCTGTCGATTCGATACTAACGCCGCCATCCAGTGTCGAAAACGAGCTCTCGAGAACCCTTAATGTCGACAGTCGAACAAGAAGCAGGCAAAGTTTAGAGCACTGCCCCTCCGCACTCAAAAAAGAAAAAACTAGGAGGAAAATAAAATTCTCAACCACACAAACACATAAACACATACAAATACAAATACAAGCTTATTTACTTGACATCGCGCGATCTTCCACTATTCAGCGCCGTCCGCCCTCTCTCGTGTTTTTTGTTTACGCGACAACTATGCGAAATCCGGAGCAACGGGCAACCGTTTGGGGAAAGACCACACCCACGCGCGATCGCCATGGCAACGAGGTCGCACACGCCCCACACCCAGACCTCCCTGCGAGCGGGCATGGGTACAATGTCCCCGTTGCCACAGACACCACTTCGTAGCACAGCGCAGAGCGTAGCGTGTTGTTGCTGCTGACAAAAGAAAATTTTTCTTAGCAAAGCAAAGGAGGGGAAGCACGGGCAGATAGCACCGTACCATACCCTTGGAAACTCGAAATGAACGAAGCAGGAAATGATTGAGATCCTTTTTTTCTGCGCGTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGGATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGCGTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCTCGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATAGTTAACTATAACGGTCCTAAGGTAGCGAAACTATCTATTTTTTCAGTACATAATTTAATTAAATCATCATGACCTTTATCTAATTTTACATCTCTTCTACCAAGACCTAATTCTTTATTAATACTATCAAAATCTGTTATTCTATTGCCTTGAGGATCTTTGAAACACCAATCTGAGTCTGAGGGCGAGTTTTTATTTCGTTTATTTCAATTAAGGTAACTAAAAAACTCCTTTTGATGACCTATACATAGGAAGATCTATAGAAACAAAAAGATTAATAACTTTCAAATATCAGAAAAATATAGAAACATGTGATAAGCTCATAGACATATAAAAAATGAGCAAGGGGGAAGAGTTGTTCACTGGTGTTGTGCCTATATTGGTCGAATTGGATGGAGATGTTAATGGTCATAAGTTTTCAGTCTCCGGCGAGGGCGAAGGAGATGCGACTTACGGTAAGCTGACTCTCAAGTTTATCTGTACCACAGGAAAGTTACCAGTACCATGGCCAACTTTGGTGACTACGTTATGTTATGGCGTACAATGCTTTGCTAGATACCCAGACCACATGAAACAACATGATTTCTTCAAATCTGCAATGCCTGAAGGTTATGTGCAGGAGCGTACAATCTTTTTCAAAGATGACGGTAATTACAAAACAAGAGCTGAAGTTAAGTTCGAAGGTGATACCCTTGTTAATAGAATCGAATTGAAAGGTATCGATTTTAAGGAGGACGGTAATATTCTAGGGCACAAATTGGAATACAACTACAATTCACACAACGTCTACATCATGGCTGACAAACAGAAAAATGGAATTAAAGCCAACTTTAAAACAAGGCATAACATTGAAGATGGTTCAGTCCAATTAGCCGATCATTATCAACAAAATACTCCAATTGGGGATGGCCCTGTTCTGCTACCTGACAATCATTACCTTTCTACACAATCTGCTTTAAGTAAAGACCCAAACGAAAAGAGAGATCACATGGTTCTATTAGAGTTTGTAACAGCAGCAGGAATAACACATGGCATGGATGAACTTTACAAATAACATGCTTTTTCGCCGGAGTCAATTAGGTCATACTTTTCTATATAATCCAAATCCCAAAAATCAATTGAATGATTCTTAATATGATTTAATAGTTTATGATTATAAATGACAGAGCAGAAAGCCCTAGTAAAGCGTATTACAAATGAAACCAAGATTCAGATTGCGATCTCTTTAAAGGGTGGTCCCCTAGCGATAGAGCACTCGATCTTCCCAGAAAAAGAGGCAGAAGCAGTAGCAGAACAGGCCACACAATCGCAAGTGATTAACGTCCACACAGGTATAGGGTTTCTGGACCATATGATACATGCTCTGGCCAAGCATTCCGGCTGGTCGCTAATCGTTGAGTGCATTGGTGACTTACACATAGACGACCATCACACCACTGAGGACTGCGGGATTGCTCTCGGTCAAGCTTTTAAAGAGGCCCTAGGGGCCGTGCGTGGAGTAAAAAGGTTTGGATCAGGATTTGCGCCTTTGGATGAGGCACTTTCCAGAGCGGTGGTTGATCTTTCGAACAGGCCGTACGCAGTTGTCGAACTTGGTTTGCAAAGGGAGAAAGTAGGTGATCTCTCTTGCGAGATGATCCCGCATTTTCTTGAAAGCTTTGCAGAGGCTAGCAGAATTACCCTCCACGTTGATTGTCTGCGAGGCAAGAATGATCATCACCGTAGTGAGAGTGCGTTCAAGGCTCTTGC[000142] Table 2. Key strains used in this study.

Claims

What is claimed is:

1. A cytosolic p1 plasmid comprising a recombinase landing pad, wherein the recombinase landing pad comprises one or more site-specific recombination sites.

2. The p1 plasmid of claim 1, further comprising a plurality of selectable markers, wherein the selectable markers are on the same molecule of DNA as the site-specific recombination sites.

3. The p1 plasmid of claim 2, wherein the selectable markers are adjacent to the sitespecific recombination sites.

4. A kit comprising:(a) the p1 plasmid of any one of claims 1, 2, or 3, and(b) a donor DNA construct comprising a gene of interest, and one or more recombination sites, wherein the recombination sites flank the gene of interest and are compatible for recombination with the site-specific recombination sites of the p1 plasmid.

5. The kit of claim 4, further comprising a donor-specific selectable marker.

6. The kit of claim 4, further comprising a nucleotide sequence that expresses a sitespecific recombinase in cytoplasm.

7. The kit of claim 6, wherein the nucleotide sequence is a nuclear 2p plasmid or a CEN / ARS plasmid, wherein the CEN / ARS plasmid comprises an autonomously replicating sequence (ARS) and a centromere (CEN) element.

8. The p1 plasmid of claim 1, wherein the site-specific recombination site is attB or attP.

9. The kit of claim 6, wherein the recombinase is TP901 or Bxb1.

10. The kit of claim 5, wherein the donor-specific selectable marker is HIS3 or Leu2.

11. A yeast host cell comprising:(a) the p1 plasmid of claim 1; and(b) one or more p2 components for orthogonal replication of the p1 plasmid.

12. The yeast host cell of claim 11 , further comprising:(c) a donor DNA construct comprising a gene of interest, a pair of recombination sites, and a donor-specific selectable marker, wherein the recombination sites flank the gene of interest and are compatible for recombination at the site-specific recombination sites; and(d) a nucleotide sequence that expresses a site-specific recombinase in the cytoplasm of the yeast host cell.

13. The yeast host cell of claim 11 or 12, which is a Saccharomyces cerevisiae cell.

14. A method of integrating a gene of interest onto a p1 plasmid, the method comprising introducing, into a yeast host cell of claim 11 :(a) a donor DNA construct comprising a gene of interest, a pair of recombination sites, and a donor-specific selectable marker, wherein the recombination sites flank the gene of interest and are compatible for recombination at the site-specific recombination sites; and(b) a nucleotide sequence that expresses a site-specific recombinase in cytoplasm of the yeast host cell, whereby the expressed site-specific recombinase catalyzes recombination between the site-specific recombination sites on the recombinase landing pad and the complementary site-specific recombination sites on the donor DNA construct, resulting in integration of the gene of interest onto the p1 plasmid.

15. The method of claim 14, wherein the gene of interest is integrated onto the p1 plasmid with a greater than 10-fold increase in efficiency relative to endogenous homologous recombination activity in the cytoplasm.

16. The method of claim 14, wherein the gene of interest is integrated onto the p1 plasmid with a greater than two-fold increase in efficiency relative to transformation of intact nuclear plasmid into yeast nuclei.

17. The method of claim 14, wherein the method results in colony formation whereby more than half of the colonies formed appear within 24 hours of the introducing.

18. The method of claim 14, wherein the gene of interest comprises an antibody or fragment thereof.

19. The method of claim 14, wherein the gene of interest comprises an enzyme.

20. The method of claim 14, wherein the introducing is by electroporation.

Images