Oligonucleotide-mediated knockdown of ACVR2a
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SOUFFLÉ THERAPEUTICS INC
- Filing Date
- 2025-12-05
- Publication Date
- 2026-08-06
AI Technical Summary
Existing treatments for obesity and metabolic disorders, such as GLP-1RAs, often lead to undesirable side effects like reduced muscle mass and cardiovascular issues, while systemic blockade of ACVR2A can affect testicular growth and spermatogenesis.
The use of oligonucleotides, specifically antisense strands complementary to ACVR2A mRNA, to selectively inhibit ACVR2A expression, thereby preserving or increasing muscle mass and improving metabolic health without systemic side effects.
This approach effectively inhibits ACVR2A expression, promoting muscle mass preservation and enhancing metabolic health, while minimizing adverse effects on reproductive systems.
Abstract
Description
OLIGONUCLEOTIDE-MEDIATED KNOCKDOWN OF ACVR2ACROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit under 35 U. S. C. §119(e) of U. S. Provisional Application No. 63 / 728, 379 filed on December 5, 2024, and U. S. Provisional Application No.63 / 866, 558 filed on August 19, 2025, the entirety of each of which is incorporated herein by reference.INCORPORATION BY REFERENCE OF SEQUENCE LISTING
[0002] The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled 360770-0004_SeqList_ST26.xml, created December 04, 2025, which is 26,821,861 bytes in size. The information in the electronic format of the Sequence Listing is incorporated herein by reference in its entirety.BACKGROUND
[0003] GLP-lRAs induce weight loss and improve metabolic health with remarkable efficiency. To further maximize weight loss strategies, an emerging goal for new anti-obesity approaches is to preserve and increase muscle mass and enhance loss of fat mass, which may lead to longer term weight management and additional improvements in metabolic and skeletomuscular function. TGFb-like ligands myostatin (GDF-8) and Activin A are negative regulators of skeletal muscle mass. These ligands signal via the activin type II A and B receptors (ACVR2) which form complexes with transmembrane type I activin receptor-like kinases (ALK4 or ALK5). Inhibition of ACVR2 signaling through genetic deletion of muscle ACVR2A / B, antibody blockade of ACVR2A / B, or treatment with a soluble ACVR2A decoy receptor all lead to significant increases in muscle mass. In the long term, alleviation of the severity of metabolic stress by blocking AcvR2A may potentially reduce cardiovascular pathology, such as the development of metabolic / obesity-related heart failure. However, systemic blockade of ACVR2 has been reported to have long-term effects on testicular growth and spermatogenesis when given to young mice. Selective knockdown of ACVR2A can be a beneficial strategy to address the issues and improve the outcomes.SUMMARY
[0004] In some embodiments, the present disclosure provides an oligonucleotide for inhibiting expression of ACVR2A, wherein the oligonucleotide comprises an antisense strand comprising atleast 14 contiguous nucleotides substantially complementary to a sequence of nucleotides encoding ACVR2A, with no more than 4 mismatched nucleotides.
[0005] In some embodiments, the present disclosure provides a pharmaceutical composition comprising an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient.
[0006] In some embodiments, the present disclosure provides methods of using provided oligonucleotides. In some embodiments, the present disclosure provides a method for inhibiting ACVR2A expression or treating an ACVR2A related disorder in a subject, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0007] In some embodiments, the present disclosure provides a method of treating obesity in a subject in need thereof, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0008] In some embodiments, the present disclosure provides a method of preserving or increasing muscle mass in a subject in need of treatment for weight loss, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0009] In some embodiments, the present disclosure provides a method of preserving or increasing muscle mass in a subject in need of treatment for reduction of excess body weight or for maintenance of weight reduction, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0010] In some embodiments, the present disclosure provides a method of preserving or increasing muscle mass in a subject in need of treatment for a reduction of major adverse cardiovascular events (e.g., cardiovascular death, non-fatal myocardial infarction, or non-fatal stroke), the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0011] In some embodiments, the present disclosure provides a method of preserving or increasing muscle mass in a subject in need of treatment for type 2 diabetes, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically oacceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0012] In some embodiments, the present disclosure provides a method of inhibiting ActRII (e.g., through inhibition of ACVR2A expression) in a subject experiencing weight loss, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.DETAILED DESCRIPTION
[0013] Provided herein are oligonucleotides for inhibiting the expression of Activin receptor 2A (" ACVR2A"). In some embodiments, the oligonucleotide comprises an antisense strand substantially complementary to a sequence encoding ACVR2A. In some embodiments, the antisense strand comprises at least 14 contiguous nucleotides (for example, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 contiguous nucleotides) substantially complementary to the sequence of nucleotides encoding ACVR2A, with no more than 4 mismatched nucleotides.
[0014] The term ‘-antisense strand” refers to an oligonucleotide having a nucleotide sequence substantially complementary to a target sequence in a transcript, e.g., an mRNA encoding ACVR2A. In embodiments wherein the oligonucleotide is an RNAi agent, the term antisense strand may be used interchangeably with the term “guide strand”. In some embodiments, an antisense strand disclosed herein is 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length.
[0015] The term “sense strand” refers to an oligonucleotide having a nucleotide sequence substantially complementary to an antisense strand, e.g., the antisense strand of an RNAi agent herein. Tire term “sense strand” may be used interchangeably with the term “passenger strand.” In some embodiments, a sense strand disclosed herein is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39 or 40 nucleotides in length. For example, each of the sense strands in Tables 1A-1C is 19 nucleotides in length and substantially complementary to the corresponding antisense strand shown in the same row.
[0016] As used herein, and unless otherwise indicated, the term “complementary / ,” when used to describe a first nucleotide sequence in relation to a second nucleotide sequence, refers to the ability of an oligonucleotide comprising the first nucleotide sequence to hybridize and form a duplex structure under certain conditions with an oligonucleotide comprising the second nucleotide sequence, as will be understood by the skilled person. In some embodiments, a duplex structuredisclosed herein is 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 base pairs in length.
[0017] The terms “complementary,"’ “completely complementary” and “substantially complementary ” herein can be used with respect to the base matching between the antisense strand of an oligonucleotide, e.g., an RNAi agent, and a target sequence, or between the sense strand and the antisense strand of an RNAi agent, as will be understood from the context of their use. Complementary^ sequences, e.g., between an antisense strand and a target sequence in a target transcript, or between the sense and antisense strand of an siRNA, include base-pairing of the oligonucleotide or polynucleotide comprising a first nucleotide sequence to an oligonucleotide or polynucleotide comprising a second nucleotide sequence over the entire length of one or both nucleotide sequences. Such sequences can be referred to as “completely complementary” yvith respect to each other when there are 0 mismatched base pairs upon hybridization of the two sequences. However, where a first sequence is referred to as “substantially complementary” with respect to a second sequence herein, the two sequences can be completely complementary, or they can form one or more, but generally not more than 5, 4, 3, 2, or 1 mismatched base pairs upon hybridization for a duplex up to 30 base pairs, while retaining the ability to hybridize under the conditions most relevant to their ultimate application, e.g., inhibition of gene expression via a RNA-induced silencing complex (RISC) pathway. Hoyvever, yvhere two oligonucleotides are designed to form, upon hybridization, one or more single stranded overhangs, such overhangs shall not be regarded as mismatches with regard to the determination of complementarity. For example, an siRNA comprising one oligonucleotide 21 nucleotides in length and another oligonucleotide 19 nucleotides in length, wherein the longer oligonucleotide comprises a sequence of 19 nucleotides that is fully complementary to the shorter oligonucleotide, can yet be referred to as “completely complementary” for the purposes described herein.
[0018] “Complementary'” sequences, as used herein, can also include, or be formed entirely from, non-Watson -Crick base pairs or base pairs formed from non-natural and modified nucleotides, in so far as the above requirements yvith respect to their ability to hybridize are fulfilled. Such non- Watson-Crick base pairs include, but are not limited to, G: U Wobble or Hoogsteen base pairing.
[0019] If an RNA strand contains one or more thymidines (“T”s) in the sequence, the thymidines (“T”s) represent uridines (“U”s). For example, the nucleotide “T”, as used in the unmodified siRNAs sense and antisense strands in Table 1A, for example, SEQ ID Nos: 1-654, 1312-1735, and 1737-2197, represents RNA uridine, and the corresponding RNA sense and antisense strands are listed in Table 1C.
[0020] In some embodiments, the present disclosure provides an oligonucleotide or RNAi agent, as described herein, or a pharmaceutically acceptable salt thereof. As used herein, the term “■pharmaceutically acceptable salt” refers to those salts which are, within the scope of sound medical judgment, suitable for use in contact with the tissues of humans and lower animals without undue toxicity, irritation, allergic response and the like, and are commensurate with a reasonable benefit / risk ratio. Pharmaceutically acceptable salts are well known in the field. For example, S. M. Berge et al., describe pharmaceutically acceptable salts in detail in, J. PHARMACEUTICAL SCIENCES, 1977, (66); 1-19, incorporated herein by reference. Pharmaceutically acceptable salts of the nucleic acids and analogues thereof of this disclosure include those derived from suitable inorganic and organic acids and bases. Salts derived from appropriate bases include alkali metal, alkaline earth metal, ammonium, and tetra alkyl ammonium (e.g., N+(C1–4alkyl)4) salts. In some embodiments, a pharmaceutically acceptable salt is the sodium salt. In some embodiments, a pharmaceutically acceptable salt is the potassium salt.
[0021] In some embodiments, the oligonucleotide comprises an antisense strand comprising at least 14 contiguous nucleotides (for example, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or 40 contiguous nucleotides) substantially complementary to a sequence of nucleotides within a transcript encoding ACVR2A. In some embodiments, the antisense strand has no more than 5 mismatched nucleotides to the sequence of nucleotides within the transcript encoding ACVR2A. In some embodiments, the antisense strand has no more than 4 mismatched nucleotides to the sequence of nucleotides within the transcript encoding ACVR2A. In some embodiments, the antisense strand has no more than 3 mismatched nucleotides to the sequence of nucleotides within the transcript encoding ACVR2A. In some embodiments, the antisense strand has no more than 2 mismatched nucleotides to the sequence of nucleotides within the transcript encoding ACVR2A. In some embodiments, the antisense strand has no more than 1 mismatched nucleotides to the sequence of nucleotides within the transcript encoding ACVR2A. In some embodiments, the antisense strand is completely complementary to the sequence of nucleotides within the transcript encoding ACVR2A (e.g., 0 mismatches).
[0022] ACVR2A, or activin A receptor type 2A, is a transcription factor comprising a single protein. Exemplary’ sequences of ACVR2A may be found for example at NCBI RefSeq ID NM__001278579.2 (SEQ ID NO: 1309). In some embodiments, the ACVR2A comprises a nucleotide sequence corresponding to the transcript having the NCBI RefSeq ID NM_001616.5 (SEQ ID NO: 1310). In some embodiments, the ACVR2. A comprises a nucleotide sequence corresponding to the transcript having the NCBI RefSeq ID NM_001278580.2 (SEQ ID NO: 1311).
[0023] In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 75% nucleotide sequence identity to any one of SEQ ID NOs: 1309-1311. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 80% nucleotide sequence identity to any one of SEQ ID NOs: 1309-1311. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 85% nucleotide sequence identity to any one of SEQ ID NOs: 1309-1311. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 90% nucleotide sequence identity to any one of SEQ ID NOs: 1309-1311. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 95% nucleotide sequence identity to any one of SEQ ID NOs: 1309-1311. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 99% nucleotide sequence identity to any one of SEQ ID NOs: 1309-1311.
[0024] In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 75% nucleotide sequence identity to SEQ ID NO: 1309. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 80% nucleotide sequence identity to SEQ ID NO: 1309. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 85% nucleotide sequence identity to SEQ ID NO: 1309. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 90% nucleotide sequence identity to SEQ ID NO: 1309. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 95% nucleotide sequence identity to SEQ ID NO: 1309. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 99% nucleotide sequence identity to SEQ ID NO: 1309.
[0025] In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 75% nucleotide sequence identity to SEQ ID NO: 1310. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 80% nucleotide sequence identity to SEQ ID NO: 1310. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 85% nucleotide sequence identity to SEQ ID NO: 1310. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 90% nucleotide sequence identity to SEQ ID NO: 1310. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 95% nucleotidesequence identity to SEQ ID NO: 1310. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 99% nucleotide sequence identity to SEQ ID NO: 1310.
[0026] In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 75% nucleotide sequence identity to SEQ ID NO: 1311. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 80% nucleotide sequence identity to SEQ ID NO: 1311. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 85% nucleotide sequence identity to SEQ ID NO: 1311. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 90% nucleotide sequence identity to SEQ ID NO: 1311. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 95% nucleotide sequence identity to SEQ ID NO: 1311. In some embodiments, the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 99% nucleotide sequence identity to SEQ ID NO: 1311.
[0027] In some embodiments, the antisense strand is substantially complementary to a sequence of nucleotides corresponding to an untranslated region of the ACVR2A transcript. In some embodiments, the antisense strand is substantially complementary’ to the sequence of nucleotides corresponding to an untranslated region of the ACVR2A transcript with no more than 5, 4, 3, 2, 1, or 0 mismatches. In some embodiments, the antisense strand is completely complementary to the sequence of nucleotides corresponding to an untranslated region of tire ACVR2A transcript.RNAi Agents
[0028] In some embodiments, the oligonucleotide is an RNAi agent or RNAi trigger for inhibiting expression of ACVR2A. As used herein, an “RNAi agent” or “RNAi trigger” refers to an oligonucleotide molecule capable of inducing RNA interference (RNAi), which mediates the targeted cleavage of an RNA transcript via an RNA-induced silencing complex (RISC) pathway. The RNAi agents disclosed herein include but are not limited to: short (or small) interfering RNAs (siRNAs), double stranded RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates (e.g., DsiRNAs).
[0029] In some embodiments, the RNAi agent is a double stranded RNA molecule comprising an antisense strand and a sense strand that are complementary to one another and hybridize to form a duplex or double stranded region. One strand of the RNAi agent, the antisense strand or guide strand, includes a region of complementarity to a target sequence in ACVR2A. The other strand,the sense strand or passenger strand, includes a region that is complementary to the antisense strand, such that the two strands hybridize and form a duplex structure when combined under suitable conditions. In some embodiments, the double stranded RNA molecule may be formed by base pairing between two separate molecules of RNA (e.g., an antisense strand and a sense strand). In some embodiments, the double stranded RNA molecule is a self-complementary molecule formed by intramolecular base pairing between two separate regions of a single RNA molecule (e.g., an antisense region linked to a sense strand through an unpaired RNA linker forming a loop or hairpin loop).
[0030] Where the two strands are part of a self-complementary molecule, the connecting RNA chain is referred to as a “hairpin loop.” A hairpin loop can comprise at least one unpaired nucleotide. In some embodiments, the hairpin loop can comprise at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 20, at least 23 or more unpaired nucleotides or nucleotides not directed to the target site of the dsRNA. In some embodiments, the hairpin loop can be 10 or fewer nucleotides. In some embodiments, the hairpin loop can be 8 or fewer unpaired nucleotides. In some embodiments, the hairpin loop can be 4-10 unpaired nucleotides. In some embodiments, the hairpin loop can be 4-8 nucleotides. In some embodiments, the hairpin loop can contain 1-4 oligoethylene glycols, including ethylene glycol, diethylene glycol, triethylene glycol, tetraethylene glycol, hexaethylene glycol, or any combination thereof,
[0031] Where the two substantially complementary strands of a double stranded RNA molecule comprise separate RNA molecules, those molecules need not, but can be covalently connected. In certain embodiments, where the two strands are connected covalently by means other than an uninterrupted chain of nucleotides between the 3 ’-end of one strand and the 5 ’-end of the respective other strand forming the duplex structure, the connecting structure is referred to as a “linker” (though it is noted that certain other structures defined elsewhere herein can also be referred to as a “linker”). The RNA strands may have the same or a different number of nucleotides. The maximum number of base pairs is the number of nucleotides in the shortest strand of the double stranded RNA molecule minus any overhangs that are present in the duplex.
[0032] In some embodiments, the RNAi agent is an siRNA.
[0033] In some embodiments, the RNAi agent is a shRNA,
[0034] In some embodiments, the RNAi agent is a dicer substrate (e.g., a Dicer-substrate siRNA).
[0035] In some embodiments, the sense and antisense strands of the dsRNA are each independently about 15 to about 30 nucleotides in length, or about 25 to about 30 nucleotides in length, e.g, each strand is independently between 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15-17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24,18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19- 21, 19-20, 20-30, 20-29, 20-28, 20-27, 20-26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21-24, 21-23, or 21-22 nucleotides in length.
[0036] In some embodiments, the duplex structure is between 1 and 30 base pairs in length, e.g., between, 15-29, 15-28, 15-27, 15-26, 15-25, 15-24, 15-23, 15-22, 15-21, 15-20, 15-19, 15-18, 15- 17, 18-30, 18-29, 18-28, 18-27, 18-26, 18-25, 18-24, 18-23, 18-22, 18-21, 18-20, 19-30, 19-29, 19-28, 19-27, 19-26, 19-25, 19-24, 19-23, 19-22, 19-21, 19-20, 20-30, 20-29, 20-28, 20-27, 20- 26, 20-25, 20-24, 20-23, 20-22, 20-21, 21-30, 21-29, 21-28, 21-27, 21-26, 21-25, 21- 24, 21-23, or 21-22 base pairs in length.
[0037] An RNAi agent as described herein can further include one or more single-stranded nucleotide overhangs, e.g., an overhang of 1, 2, 3, or 4 nucleotides. RNAi agent having at least one nucleotide overhang can have unexpectedly superior inhibitory properties relative to their blunt-ended counterparts. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide, an inverted deoxynucleotide or an inverted abasic nucleotide. The overhang(s) can be on the sense strand, the antisense strand or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end or both ends of either antisense or sense strand of the RNAi agent. In certain embodiments, longer, extended overhangs are possible,
[0038] In some embodiments, the antisense strand is 21 nucleotides in length and the sense strand is 19 nucleotides in length. In some embodiments, the antisense strand is 19 nucleotides in length, and the sense strand is 19 nucleotides in length.
[0039] The oligonucleotides disclosed herein may be unmodified or modified (e.g., chemically modified or conjugated). A modified oligonucleotide as disclosed herein comprises an identical nucleobase sequence as compared to a corresponding unmodified oligonucleotide, but further comprises one or more modifications as disclosed herein,
[0040] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides from any one of the antisense strand sequences of Tables 1 A- 1 C. In some embodiments, the antisense strand differs by no more than 3 nucleotides from any one of the antisense strand sequences of Tables 1A-1C. In some embodiments, the antisense strand differs by no more than 2 nucleotides from any one of the antisense strand sequences of Tables 1A-1C. In some embodiments, the antisense strand differs by no more than 1 nucleotide from any one of the antisense strand sequences of Tables 1A-1C. In some embodiments, the antisense strandcomprises a sequence of any one of the antisense strands of Tables 1 A- 1 C. In some embodiments, the antisense strand consists of a sequence of any one of the antisense strands of Tables 1A-1C.
[0041] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105. In some embodiments, the antisense strand differs by no more than 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105. In some embodiments, the antisense strand differs by no more than 2 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105. In some embodiments, the antisense strand differs by no more than 1 nucleotide from the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105. In some embodiments, the antisense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105. in some embodiments, the antisense strand consists of the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105.
[0042] In some embodiments, the antisense strand comprises a nucleotide sequence having at least 90% nucleotide sequence identity (for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity) to a portion of the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105. In some embodiments, the antisense strand comprises a nucleotide sequence having at least 90% nucleotide sequence identity (for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity) to the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105.
[0043] In some embodiments, the antisense strand consists of a nucleotide sequence having the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105.
[0044] In some embodiments, the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides from any one of the sense strand sequences of Tables 1A-1C. In some embodiments, the sense strand differs by no more than 3 nucleotides from any one of the sense strand sequences of Tables 1A-1C. In some embodiments, the sense strand differs by no more than 2 nucleotides from any one of the sense strand sequences of Tables 1A-1C. In some embodiments, the sense strand differs by no more than 1 nucleotide from any one of the sense strand sequences of Tables 1 A-1C. In some embodiments, the sense strand comprises any one ofthe sense strand sequences of Tables 1A-1C. In some embodiments, the sense strand consists of any one of the sense strand sequences of Tables 1A-1C.
[0045] In some embodiments, the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640. In some embodiments, the sense strand differs by no more than 3 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640. In some embodiments, the sense strand differs by no more than 2 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640. In some embodiments, the sense strand differs by no more than 1 nucleotide from the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640. In some embodiments, the sense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640. In some embodiments, the sense strand consists of the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640.
[0046] In some embodiments, the sense strand comprises a nucleotide sequence having at least 90% nucleotide sequence identity (for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity) to a portion of the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640. In some embodiments, the sense strand comprises a nucleotide sequence having at least 90% nucleotide sequence identity (for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity) to the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312- 1754, or 2198-2640.
[0047] In some embodiments, the sense strand consists of a nucleotide sequence having the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640.
[0048] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105, and the sense strand comprises a nucleotide sequence at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640.
[0049] In some embodiments, the antisense strand comprises a nucleotide sequence having at least 90% nucleotide sequence identity (for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity) to a portion of the nucleotide sequence ofany one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105, and the sense strand comprises a nucleotide sequence having at least 90% nucleotide sequence identity (for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity) to a portion of the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640.
[0050] In some embodiments, the antisense strand comprises a nucleotide sequence having at least 90% nucleotide sequence identity (for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity) to the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105, and the sense strand comprises a nucleotide sequence having at least 90% nucleotide sequence identity (for example, at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% nucleotide sequence identity) to the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640.
[0051] In some embodiments, the antisense strand consists of a nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105, and the sense strand consists of a nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640.
[0052] In some embodiments, the oligonucleotide of the present disclosure targets a sequence of nucleotides corresponding to any one of positions 386-404, 412-430, 414-432, 417-435, 422-440, 466-484, 467-485, 470-488, 471-489, 472-490, 473-491, 479-497, 480-498, 481-499, 482-500, 483-501, 484-502, 485-503, 486-504, 501-519, 502-520, 503-521, 511-529, 523-541, 524-542, 526-544, 527-545, 528-546, 530-548, 531-549, 541-559, 542-560, 570-588, 586-604, 590-608, 625-643, 646-664, 679-697, 680-698, 681-699, 682-700, 690-708, 703-721, 724-742, 727-745, 728-746, 733-751, 734-752, 744-762, 745-763, 833-851, 834-852, 848-866, 849-867, 850-868, 851-869, 867-885, 918-936, 919-937, 942-960, 944-962, 968-986, 970-988, 977-995, 978-996, 982-1000, 987-1005, 988-1006, 990-1008, 991-1009, 992-1010, 1009-1027, 1010-1028, 1011- 1029, 1012-1030, 1013-1031, 1036-1054, 1037-1055, 1043-1061, 1044-1062, 1066-1084, 1067-1085, 1094-1112, 1095-1113, 1096-1114, 1097-1115, 1099-1117, 1100-1118, 1105-1123, 1110- 1128, 1111-1129, 1112-1130, 1113-1131, 1114-1132, 1115-1133, 1116-1134, 1117-1135, 1188- 1206, 1196-1214, 1197-1215, 1210-1228, 1211-1229, 1222-1240, 1232-1250, 1233-1251, 1235- 1253, 1236-1254, 1237-1255, 1238-1256, 1239-1257, 1241-1259, 1242-1260, 1243-1261, 1244-1262, 1245-1263, 1246-1264, 1247-1265, 1248-1266, 1257-1275, 1258-1276, 1261-1279, 1264- 1282, 1265-1283, 1268-1286, 1274-1292, 1275-1293, 1295-1313, 1331-1349, 1365-1383, 1372- 1390, 1376-1394, 1377-1395, 1384-1402, 1386-1404, 1408-1426, 1440-1458, 1457-1475, 1460- 1478, 1466-1484, 1470-1488, 1480-1498, 1482-1500, 1483-1501, 1484-1502, 1498-1516, 1499-1517, 1501-1519, 1502-1520, 1529-1547, 1531-1549, 1535-1553, 1536-1554, 1537-1555, 1538-1556, 1539-1557, 1553-1571, 1555-1573, 1556-1574, 1557-1575, 1558-1576, 1559-1577, 1560- 1578, 1561-1579, 1562-1580, 1583-1601, 1588-1606, 1589-1607, 1590-1608, 1592-1610, 1593-1611, 1594-1612, 1595-1613, 1596-1614, 1608-1626, 1613-1631, 1618-1636, 1619-1637, 1620- 1638, 1621-1639, 1622-1640, 1623-1641, 1624-1642, 1626-1644, 1627-1645, 1628-1646, 1629-1647, 1630-1648, 1631-1649, 1632-1650, 1633-1651, 1673-1691, 1679-1697, 1685-1703, 1691- 1709, 1693-1711, 1694-1712, 1696-1714, 1730-1748, 1733-1751, 1736-1754, 1741-1759, 1742- 1760, 1744-1762, 1747-1765, 1755-1773, 1766-1784, 1768-1786, 1769-1787, 1770-1788, 1771- 1789, 1772-1790, 1773-1791, 1774-1792, 1775-1793, 1776-1794, 1777-1795, 1778-1796, 1785- 1803, 1786-1804, 1788-1806, 1789-1807, 1790-1808, 1791-1809, 1792-1810, 1793-1811, 1794- 1812, 1798-1816, 1799-1817, 1800-1818, 1801-1819, 1823-1841, 1824-1842, 1825-1843, 1827- 1845, 1828-1846, 1840-1858, 1841-1859, 1842-1860, 1843-1861, 1844-1862, 1845-1863, 1849-1867, 1903-1921, 1906-1924, 1907-1925, 1911-1929, 1912-1930, 1983-2001, 2008-2026, 2009- 2027, 2010-2028, 2017-2035, 2019-2037, 2020-2038, 2021-2039, 2022-2040, 2023-2041, 2024- 2042, 2025-2043, 2026-2044, 2027-2045, 2028-2046, 2029-2047, 2030-2048, 2046-2064, 2047- 2065, 2049-2067, 2051-2069, 2052-2070, 2060-2078, 2067-2085, 2068-2086, 2069-2087, 2070-2088, 2074-2092, 2075-2093, 2076-2094, 2077-2095, 2078-2096, 2079-2097, 2082-2100, 2082- 2100, 2083-2101, 2088-2106, 2089-2107, 2090-2108, 2091-2109, 2092-2110, 2093-2111, 2099- 2117, 2101-2119, 2104-2122, 2105-2123, 2106-2124, 2107-2125, 2108-2126, 2109-2127, 2116-2134, 2117-2135, 2118-2136, 2127-2145, 2129-2147, 2133-2151, 2134-2152, 2135-2153, 2136- 2154, 2138-2156, 2138-2156, 2139-2157, 2149-2167, 2150-2168, 2151-2169, 2152-2170, 2156- 2174, 2157-2175, 2165-2183, 2166-2184, 2167-2185, 2169-2187, 2191-2209, 2192-2210, 2208- 2226, 2209-2227, 2210-2228, 2229-2247, 2230-2248, 2231-2249, 2236-2254, 2246-2264, 2248-2266, 2249-2267, 2250-2268, 2251-2269, 2252-2270, 2253-2271, 2254-2272, 2256-2274, 2265- 2283, 2266-2284, 2267-2285, 2292-2310, 2297-2315, 2300-2318, 2301-2319, 2302-2320, 2306- 2324, 2307-2325, 2311-2329, 2312-2330, 2313-2331, 2314-2332, 2315-2333, 2316-2334, 2317-2335, 2319-2337, 2320-2338, 2325-2343, 2326-2344, 2327-2345, 2328-2346, 2329-2347, 2330- 2348, 2331-2349, 2332-2350, 2334-2352, 2335-2353, 2336-2354, 2337-2355, 2338-2356, 2339- 2357, 2340-2358, 2341-2359, 2342-2360, 2343-2361, 2344-2362, 2346-2364, 2347-2365, 2348- 2366, 2351-2369, 2352-2370, 2353-2371, 2354-2372, 2356-2374, 2365-2383, 2366-2384, 2367-2385, 2368-2386, 2374-2392, 2375-2393, 2376-2394, 2377-2395, 2378-2396, 2379-2397, 2383- 2401, 2384-2402, 2385-2403, 2386-2404, 2387-2405, 2388-2406, 2396-2414, 2397-2415, 2398- 2416, 2399-2417, 2400-2418, 2401-2419, 2402-2420, 2404-2422, 2405-2423, 2406-2424, 2407- 2425, 2408-2426, 2424-2442, 2425-2443, 2426-2444, 2428-2446, 2429-2447, 2430-2448, 2431- 2449, 2435-2453, 2437-2455. 2438-2456 2439-2457, 2440-2458, 2483-2501. 2486-2504, 2506-2524, 2515-2533, 2555-2573, 2556-2574, 2558-2576, 2566-2584, 2568-2586, 2569-2587, 2572- 2590, 2576-2594, 2579-2597, 2580-2598, 2582-2600, 2601-2619, 2611-2629, 2613-2631, 2615-2633, 2634-2652, 2667-2685, 2670-2688, 2671-2689, 2672-2690, 2675-2693, 2676-2694, 2707- 2725, 2708-2726, 2769-2787, 2771-2789, 2772-2790, 2772-2790, 2773-2791, 2774-2792, 2774-2792, 2775-2793, 2776-2794, 2777-2795, 2778-2796, 2779-2797, 2780-2798, 2781-2799, 2813- 2831, 2843-2861, 2844-2862, 2845-2863, 2846-2864, 2847-2865, 2848-2866, 2849-2867, 2850- 2868, 2851-2869, 2852-2870, 2853-2871, 2854-2872, 2855-2873, 2856-2874, 2857-2875, 2858- 2876, 2859-2877, 2860-2878, 2872-2890, 2895-2913, 2896-2914, 2897-2915, 2898-2916, 2899- 2917, 2900-2918, 2905-2923, 2913-2931, 2949-2967, 2963-2981, 2966-2984, 2973-2991, 2974- 2992, 2975-2993, 2976-2994, 2977-2995, 2978-2996, 2979-2997, 2980-2998, 2981-2999, 2982- 3000, 2983-3001, 2984-3002, 2985-3003, 2988-3006, 2989-3007, 2991-3009, 2993-3011, 2996-3014, 3002-3020, 3003-3021, 3004-3022, 3005-3023, 3019-3037, 3022-3040, 3051-3069, 3052- 3070, 3053-3071, 3059-3077, 3063-3081, 3066-3084, 3067-3085, 3071-3089, 3072-3090, 3073- 3091, 3074-3092, 3116-3134, 3118-3136, 3122-3140, 3123-3141, 3124-3142, 3126-3144, 3127- 3145, 3128-3146, 3130-3148, 3131-3149, 3138-3156, 3190-3208, 3223-3241, 3225-3243, 3235-3253, 3236-3254, 3237-3255, 3238-3256, 3239-3257, 3251-3269, 3307-3325, 3416-3434, 3417- 3435, 3418-3436, 3419-3437, 3420-3438, 3421-3439, 3422-3440, 3463-3481, 3464-3482, 3482- 3500, 3483-3501, 3484-3502, 3485-3503, 3488-3506, 3533-3551, 3556-3574, 3597-3615, 3601-3619, 3602-3620, 3603-3621, 3604-3622, 3605-3623, 3606-3624, 3607-3625, 3608-3626, 3609- 3627, 3610-3628, 3636-3654, 3662-3680, 3665-3683, 3666-3684, 3793-3811, 3794-3812, 3796- 3814, 3802-3820, 3803-3821, 3804-3822, 3807-3825, 3808-3826, 3809-3827, 3810-3828, 3812- 3830, 3813-3831, 3823-3841, 3824-3842, 3825-3843, 3826-3844, 3827-3845, 3828-3846, 3831-3849, 3834-3852, 3837-3855, 3838-3856, 3839-3857, 3840-3858, 3841-3859, 3843-3861, 3844- 3862, 3854-3872, 3855-3873, 3856-3874, 3857-3875, 3858-3876, 3860-3878, 3861-3879, 3862- 3880, 3863-3881, 3866-3884, 3875-3893, 3929-3947, 3930-3948, 3939-3957, 3947-3965, 3948-3966, 3961-3979, 4007-4025, 4074-4092, 4080-4098, 4135-4153, 4136-4154, 4137-4155, 4138- 4156, 4139-4157, 4140-4158, 4141-4159, 4145-4163, 4148-4166, 4150-4168, 4163-4181, 4164- 4182, 4165-4183, 4166-4184, 4167-4185, 4168-4186, 4171-4189, 4182-4200, 4187-4205, 4203-4221, 4211-4229, 4222-4240, 4235-4253, 4236-4254, 4237-4255, 4238-4256, 4239-4257, 4254-4272, 4255-4273, 4256-4274, 4264-4282, 4272-4290, 4273-4291, 4274-4292, 4276-4294, 4277- 4295, 4278-4296, 4279-4297, 4280-4298, 4283-4301, 4284-4302, 4285-4303, 4286-4304, 4336- 4354, 4337-4355, 4338-4356, 4353-4371, 4356-4374, 4360-4378, 4362-4380, 4377-4395, 4379- 4397, 4380-4398, 4381-4399, 4382-4400, 4383-4401, 4384-4402, 4393-4411, 4394-4412, 4428- 4446, 4429-4447, 4455-4473, 4457-4475, 4458-4476 4459-4477 4460-4478. 4461-4479, 4462-4480, 4464-4482, 4471-4489, 4472-4490, 4473-4491, 4474-4492, 4480-4498, 4481-4499, 4482- 4500, 4483-4501, 4484-4502, 4487-4505, 4488-4506, 4489-4507, 4497-4515, 4498-4516, 4499- 4517, 4508-4526, 4510-4528, 4511-4529, 4512-4530, 4513-4531, 4514-4532, 4516-4534, 4517- 4535, 4518-4536, 4519-4537, 4520-4538, 4524-4542, 4552-4570, 4559-4577, 4561-4579, 4564-4582, 4565-4583, 4568-4586, 4569-4587, 4570-4588, 4571-4589, 4582-4600, 4601-4619, 4603- 4621, 4604-4622, 4605-4623, 4606-4624, 4610-4628, 4611-4629, 4615-4633, 4646-4664, 4647- 4665, 4648-4666, 4649-4667, 4650-4668, 4651-4669, 4702-4720, 4706-4724, 4735-4753, 4736- 4754, 4737-4755, 4745-4763, 4746-4764, 4748-4766, 4749-4767, 4755-4773, 4756-4774, 4796- 4814, 4797-4815, 4850-4868, 4851-4869, 4852-4870, 4853-4871, 4854-4872, 4861-4879, and 4923-4941 of SEQ ID NO: 1309 (NM_001278579.2).
[0053] In some embodiments, the oligonucleotide of the present disclosure targets a sequence of nucleotides corresponding to any one of positions 198-216, 224-242, 226-244, 229-247, 234-252, 278-296, 279-297, 282-300, 283-301, 284-302, 285-303, 291-309, 292-310, 293-311, 294-312, 295-313, 296-314, 297-315, 298-316, 313-331, 314-332, 315-333, 323-341, 335-353, 336-354, 338-356, 339-357, 340-358, 342-360, 343-361, 353-371, 354-372, 382-400, 398-416, 402-420, 437-455, 458-476, 491-509, 492-510, 493-511, 494-512, 502-520, 515-533, 536-554, 539-557, 540-558, 545-563, 546-564, 556-574, 557-575, 645-663, 646-664, 660-678, 661-679, 662-680, 663-681, 679-697, 730-748, 731-749, 754-772, 756-774, 780-798, 782-800, 789-807, 790-808, 794-812, 799-817, 800-818, 802-820, 803-821, 804-822, 821-839, 822-840, 823-841, 824-842, 825-843, 848-866, 849-867, 855-873, 856-874, 878-896, 879-897, 906-924, 907-925, 908-926, 909-927, 911-929, 912-930, 917-935, 922-940, 923-941, 924-942, 925-943, 926-944, 927-945, 928-946, 929-947, 1000-1018, 1008-1026, 1009-1027, 1022-1040, 1023-1041, 1034-1052, 1044-1062, 1045-1063, 1047-1065, 1048-1066, 1049-1067, 1050-1068, 1051-1069, 1053-1071, 1054- 1072, 1055-1073, 1056-1074, 1057-1075, 1058-1076, 1059-1077, 1060-1078, 1069-1087, 1070- 1088, 1073-1091, 1076-1094, 1077-1095, 1080-1098, 1086-1104, 1087-1105, 1107-1125, 1143-1161, 1177-1195, 1184-1202, 1188-1206, 1189-1207, 1196-1214, 1198-1216, 1220-1238, 1252- 1270, 1269-1287, 1272-1290, 1278-1296, 1282-1300, 1292-1310, 1294-1312, 1295-1313, 1296- 1314, 1310-1328, 1311-1329, 1313-1331, 1314-1332, 1341-1359, 1343-1361, 1347-1365, 1348- 1366, 1349-1367, 1350-1368, 1351-1369, 1365-1383, 1367-1385, 1368-1386, 1369-1387, 1370-1388, 1371-1389, 1372-1390, 1373-1391, 1374-1392, 1395-1413, 1400-1418, 1401-1419, 1402- 1420, 1404-1422, 1405-1423, 1406-1424, 1407-1425, 1408-1426, 1420-1438, 1425-1443, 1430- 1448, 1431-1449, 1432-1450, 1433-1451, 1434-1452, 1435-1453, 1436-1454, 1438-1456, 1439- 1457, 1440-1458, 1441-1459, 1442-1460, 1443-1461, 1444-1462, 1445-1463, 1485-1503, 1491-1509, 1497-1515, 1503-1521, 1505-1523, 1506-1524, 1508-1526, 1542-1560, 1545-1563, 1548-1566, 1553-1571, 1554-1572, 1556-1574, 1559-1577, 1567-1585, 1578-1596, 1580-1598, 1581- 1599, 1582-1600, 1583-1601, 1584-1602, 1585-1603, 1586-1604, 1587-1605, 1588-1606, 1589- 1607, 1590-1608, 1597-1615, 1598-1616, 1600-1618, 1601-1619, 1602-1620, 1603-1621, 1604- 1622, 1605-1623, 1606-1624, 1610-1628, 1611-1629, 1612-1630, 1613-1631, 1635-1653, 1636- 1654, 1637-1655, 1639-1657, 1640-1658, 1652-1670, 1653-1671, 1654-1672, 1655-1673, 1656- 1674, 1657-1675, 1661-1679, 1715-1733, 1718-1736, 1719-1737, 1723-1741, 1724-1742, 1795- 1813, 1820-1838, 1821-1839, 1822-1840, 1829-1847, 1831-1849, 1832-1850, 1833-1851, 1834- 1852, 1835-1853, 1836-1854, 1837-1855, 1838-1856, 1839-1857, 1840-1858, 1841-1859, 1842- 1860, 1858-1876, 1859-1877, 1861-1879, 1863-1881, 1864-1882, 1872-1890, 1879-1897, 1880- 1898, 1881-1899, 1882-1900, 1886-1904, 1887-1905, 1888-1906, 1889-1907, 1890-1908, 1891- 1909, 1894-1912, 1894-1912, 1895-1913, 1900-1918, 1901-1919, 1902-1920, 1903-1921, 1904- 1922, 1905-1923, 1911-1929, 1913-1931, 1916-1934, 1917-1935, 1918-1936, 1919-1937, 1920- 1938, 1921-1939, 1928-1946, 1929-1947, 1930-1948, 1939-1957, 1941-1959, 1945-1963, 1946- 1964, 1947-1965, 1948-1966, 1950-1968, 1950-1968, 1951-1969, 1961-1979, 1962-1980, 1963- 1981, 1964-1982, 1968-1986, 1969-1987, 1977-1995, 1977-1995, 1978-1996, 1978-1996, 1979- 1997, 1979-1997, 1981-1999, 2003-2021, 2004-2022, 2020-2038, 2021-2039, 2022-2040, 2041- 2059, 2042-2060, 2043-2061, 2048-2066, 2058-2076, 2060-2078, 2061-2079, 2062-2080, 2063- 2081, 2064-2082, 2065-2083, 2066-2084, 2068-2086, 2104-2122, 2109-2127, 2112-2130, 2113- 2131, 2114-2132, 2118-2136, 2119-2137, 2123-2141, 2124-2142, 2125-2143, 2126-2144, 2127- 2145, 2128-2146, 2129-2147, 2131-2149, 2132-2150, 2137-2155, 2138-2156, 2139-2157, 2140- 2158, 2141-2159, 2142-2160, 2143-2161, 2144-2162, 2146-2164, 2147-2165, 2148-2166, 2149- 2167, 2150-2168, 2151-2169, 2152-2170, 2153-2171, 2154-2172, 2155-2173, 2156-2174, 2158- 2176, 2159-2177, 2160-2178, 2163-2181, 2164-2182, 2165-2183, 2166-2184, 2168-2186, 2177- 2195, 2178-2196, 2179-2197, 2180-2198, 2186-2204, 2187-2205, 2188-2206, 2189-2207, 2190- 2208, 2191-2209, 2195-2213, 2196-2214, 2197-2215, 2198-2216, 2199-2217, 2200-2218, 2208- 2226, 2209-2227, 2210-2228, 2211-2229, 2212-2230, 2213-2231, 2214-2232, 2216-2234, 2217- 2235, 2218-2236, 2219-2237, 2220-2238, 2236-2254, 2237-2255, 2238-2256, 2240-2258, 2241- 2259, 2242-2260, 2243-2261, 2247-2265, 2249-2267, 2250-2268, 2251-2269, 2252-2270, 2295- 2313, 2298-2316, 2318-2336, 2327-2345, 2367-2385, 2368-2386, 2370-2388, 2378-2396, 2380- 2398, 2381-2399, 2384-2402, 2388-2406, 2391-2409, 2392-2410, 2394-2412, 2413-2431, 2423- 2441, 2425-2443, 2427-2445, 2446-2464, 2479-2497, 2482-2500, 2483-2501, 2484-2502, 2487- 2505, 2488-2506, 2519-2537, 2520-2538, 2581-2599, 2583-2601, 2584-2602, 2584-2602, 2585- 2603, 2586-2604, 2586-2604, 2587-2605, 2588-2606, 2589-2607, 2590-2608, 2591-2609, 2592- 2610, 2593-2611, 2625-2643. 2655-2673 2656-2674, 2657-2675, 2658-2676. 2659-2677, 2660-2678, 2661-2679, 2662-2680, 2663-2681, 2664-2682, 2665-2683, 2666-2684, 2667-2685, 2668- 2686, 2669-2687, 2670-2688, 2671-2689, 2672-2690, 2684-2702, 2707-2725, 2708-2726, 2709- 2727, 2710-2728, 2711-2729, 2712-2730, 2717-2735, 2725-2743, 2761-2779, 2775-2793, 2778- 2796, 2785-2803, 2786-2804, 2787-2805, 2788-2806, 2789-2807, 2790-2808, 2791-2809, 2792- 2810, 2793-2811, 2794-2812, 2795-2813, 2796-2814, 2797-2815, 2800-2818, 2801-2819, 2803- 2821, 2805-2823, 2808-2826, 2814-2832, 2815-2833, 2816-2834, 2817-2835, 2831-2849, 2834- 2852, 2863-2881, 2864-2882, 2865-2883, 2871-2889, 2875-2893, 2878-2896, 2879-2897, 2883- 2901, 2884-2902, 2885-2903, 2886-2904, 2928-2946, 2930-2948, 2934-2952, 2935-2953, 2936- 2954, 2938-2956, 2939-2957, 2940-2958, 2942-2960, 2943-2961, 2950-2968, 3002-3020, 3035- 3053, 3037-3055, 3047-3065, 3048-3066, 3049-3067, 3050-3068, 3051-3069, 3063-3081, 3119- 3137, 3228-3246, 3229-3247, 3230-3248, 3231-3249, 3232-3250, 3233-3251, 3234-3252, 3275- 3293, 3276-3294, 3294-3312, 3295-3313, 3296-3314, 3297-3315, 3300-3318, 3345-3363, 3368- 3386, 3409-3427, 3413-3431, 3414-3432, 3415-3433, 3416-3434, 3417-3435, 3418-3436, 3419- 3437, 3420-3438, 3421-3439, 3422-3440, 3448-3466, 3474-3492, 3477-3495, 3478-3496, 3605- 3623, 3606-3624, 3608-3626, 3614-3632, 3615-3633, 3616-3634, 3619-3637, 3620-3638, 3621- 3639, 3622-3640, 3624-3642, 3625-3643, 3635-3653, 3636-3654, 3637-3655, 3638-3656, 3639- 3657, 3640-3658, 3643-3661, 3646-3664, 3649-3667, 3650-3668, 3651-3669, 3652-3670, 3653- 3671, 3655-3673, 3656-3674, 3666-3684, 3667-3685, 3668-3686, 3669-3687, 3670-3688, 3672- 3690, 3673-3691, 3674-3692, 3675-3693, 3678-3696, 3687-3705, 3741-3759, 3742-3760, 3751- 3769, 3759-3777, 3760-3778, 3773-3791, 3819-3837, 3886-3904, 3892-3910, 3947-3965, 3948- 3966, 3949-3967, 3950-3968, 3951-3969, 3952-3970, 3953-3971, 3957-3975, 3960-3978, 3962- 3980, 3975-3993, 3976-3994, 3977-3995, 3978-3996, 3979-3997, 3980-3998, 3983-4001, 3994- 4012, 3999-4017, 4015-4033, 4023-4041, 4034-4052, 4047-4065, 4048-4066, 4049-4067, 4050- 4068, 4051-4069, 4066-4084, 4067-4085, 4068-4086, 4076-4094, 4084-4102, 4085-4103, 4086- 4104, 4088-4106, 4089-4107, 4090-4108, 4091-4109, 4092-4110, 4095-4113, 4096-4114, 4097- 4115, 4098-4116, 4148-4166, 4149-4167, 4150-4168, 4165-4183, 4168-4186, 4172-4190, 4174- 4192, 4189-4207, 4191-4209, 4192-4210, 4193-4211, 4194-4212, 4195-4213, 4196-4214, 4205- 4223, 4206-4224, 4240-4258, 4241-4259, 4267-4285, 4269-4287, 4270-4288, 4271-4289, 4272- 4290, 4273-4291, 4274-4292, 4276-4294, 4283-4301, 4284-4302, 4285-4303, 4286-4304, 4292- 4310, 4293-4311, 4294-4312, 4295-4313, 4296-4314, 4299-4317, 4300-4318, 4301-4319, 4309- 4327, 4310-4328, 4311-4329, 4320-4338, 4322-4340, 4323-4341, 4324-4342, 4325-4343, 4326- 4344, 4328-4346, 4329-4347, 4330-4348, 4331-4349, 4332-4350, 4336-4354, 4364-4382, 4371- 4389, 4373-4391, 4376-4394, 4377-4395, 4380-4398, 4381-4399, 4382-4400, 4383-4401, 4394- 4412, 4413-4431, 4415-4433. 4416-4434, 4417-4435 4418-4436, 4422-4440. 4423-4441, 4427-4445, 4458-4476, 4459-4477, 4460-4478, 4461-4479, 4462-4480, 4463-4481, 4514-4532, 4518- 4536, 4547-4565, 4548-4566, 4549-4567, 4557-4575, 4558-4576, 4560-4578, 4561-4579, 4567- 4585, 4568-4586, 4608-4626, 4609-4627, 4662-4680, 4663-4681, 4664-4682, 4665-4683, 4666- 4684, 4673-4691, and 4735-4753 of SEQ ID NO: 1310 (NM_001616.5).
[0054] In some embodiments, the oligonucleotide of the present disclosure targets a sequence of nucleotides corresponding to any one of positions 189-207, 215-233, 217-235, 220-238, 225-243, 269-287, 270-288, 273-291, 274-292, 275-293, 276-294, 282-300, 283-301, 284-302, 285-303, 286-304, 287-305, 288-306, 289-307, 304-322, 305-323, 306-324, 314-332, 326-344, 327-345, 329-347, 330-348, 331-349, 333-351, 334-352, 344-362, 345-363, 373-391, 389-407, 393-411, 428-446, 449-467, 482-500, 483-501, 484-502, 485-503, 493-511, 506-524, 527-545, 530-548, 531-549, 536-554, 537-555, 547-565, 548-566, 636-654, 637-655, 651-669, 652-670, 653-671, 654-672, 670-688, 721-739, 722-740, 745-763, 747-765, 771-789, 773-791, 780-798, 781-799, 785-803, 790-808, 791-809, 793-811, 794-812, 795-813, 812-830, 813-831, 814-832, 815-833, 816-834, 839-857, 840-858, 846-864, 847-865, 869-887, 870-888, 897-915, 898-916, 899-917, 900-918. 902-920. 903-921. 908-926. 913-931. 914-932. 915-933. 916-934. 917-935. 918-936 919-937, 920-938, 991-1009, 999-1017, 1000-1018, 1013-1031, 1014-1032, 1025-1043, 1035- 1053, 1036-1054, 1038-1056, 1039-1057, 1040-1058, 1041-1059, 1042-1060, 1044-1062, 1045- 1063, 1046-1064, 1047-1065, 1048-1066, 1049-1067, 1050-1068, 1051-1069, 1060-1078, 1061-1079, 1064-1082, 1067-1085, 1068-1086, 1071-1089, 1077-1095, 1078-1096, 1098-1116, 1134- 1152, 1168-1186, 1175-1193, 1179-1197, 1180-1198, 1187-1205, 1189-1207, 1211-1229, 1243- 1261, 1260-1278, 1263-1281, 1269-1287, 1273-1291, 1283-1301, 1285-1303, 1286-1304, 1287- 1305, 1301-1319, 1302-1320, 1304-1322, 1305-1323, 1332-1350, 1334-1352, 1338-1356, 1339-1357, 1340-1358, 1341-1359, 1342-1360, 1356-1374, 1358-1376, 1359-1377, 1360-1378, 1361- 1379, 1362-1380, 1363-1381, 1364-1382, 1365-1383, 1386-1404, 1391-1409, 1392-1410, 1393- 1411, 1395-1413, 1396-1414, 1397-1415, 1398-1416, 1399-1417, 1411-1429, 1416-1434, 1421-1439, 1422-1440, 1423-1441, 1424-1442, 1425-1443, 1426-1444, 1427-1445, 1429-1447, 1430- 1448, 1431-1449, 1432-1450, 1433-1451, 1434-1452, 1435-1453, 1436-1454, 1476-1494, 1482- 1500, 1488-1506, 1494-1512, 1496-1514, 1497-1515, 1499-1517, 1533-1551, 1536-1554, 1539-1557, 1544-1562, 1545-1563, 1547-1565, 1550-1568, 1558-1576, 1569-1587, 1571-1589, 1572-1590, 1573-1591, 1574-1592, 1575-1593, 1576-1594, 1577-1595, 1578-1596, 1579-1597, 1580- 1598, 1581-1599, 1588-1606, 1589-1607, 1591-1609, 1592-1610, 1593-1611, 1594-1612, 1595-1613, 1596-1614, 1597-1615, 1601-1619, 1602-1620, 1603-1621, 1604-1622, 1626-1644, 1627- 1645, 1628-1646, 1630-1648, 1631-1649, 1643-1661, 1644-1662, 1645-1663, 1646-1664, 1647-1665, 1648-1666, 1652-1670, 1706-1724, 1709-1727, 1710-1728, 1714-1732. 1715-1733, 1786-1804, 1811-1829, 1812-1830, 1813-1831, 1820-1838, 1822-1840, 1823-1841, 1824-1842, 1825-1843, 1826-1844, 1827-1845, 1828-1846, 1829-1847, 1830-1848, 1831-1849, 1832-1850, 1833- 1851, 1849-1867, 1850-1868, 1852-1870, 1854-1872, 1855-1873, 1863-1881, 1870-1888, 1871-1889, 1872-1890, 1873-1891, 1877-1895, 1878-1896, 1879-1897, 1880-1898, 1881-1899, 1882-1900, 1885-1903, 1885-1903, 1886-1904, 1891-1909, 1892-1910, 1893-1911, 1894-1912, 1895- 1913, 1896-1914, 1902-1920, 1904-1922, 1907-1925, 1908-1926, 1909-1927, 1910-1928, 1911- 1929, 1912-1930, 1919-1937, 1920-1938, 1921-1939, 1930-1948, 1932-1950, 1936-1954, 1937- 1955, 1938-1956, 1939-1957, 1941-1959, 1941-1959, 1942-1960, 1952-1970, 1953-1971, 1954- 1972, 1955-1973, 1959-1977, 1960-1978, 1968-1986, 1968-1986, 1969-1987, 1969-1987, 1970- 1988, 1970-1988, 1972-1990, 1994-2012, 1995-2013, 2011-2029, 2012-2030, 2013-2031, 2032- 2050, 2033-2051, 2034-2052, 2039-2057, 2049-2067, 2051-2069, 2052-2070, 2053-2071, 2054-2072, 2055-2073, 2056-2074, 2057-2075, 2059-2077, 2095-2113, 2100-2118, 2103-2121, 2104- 2122, 2105-2123, 2109-2127, 2110-2128, 2114-2132, 2115-2133, 2116-2134, 2117-2135, 2118- 2136, 2119-2137, 2120-2138, 2122-2140, 2123-2141, 2128-2146, 2129-2147, 2130-2148, 2131- 2149, 2132-2150, 2133-2151, 2134-2152, 2135-2153, 2137-2155, 2138-2156, 2139-2157, 2140-2158, 2141-2159, 2142-2160, 2143-2161, 2144-2162, 2145-2163, 2146-2164, 2147-2165, 2149- 2167, 2150-2168, 2151-2169, 2154-2172, 2155-2173, 2156-2174, 2157-2175, 2159-2177, 2168- 2186, 2169-2187, 2170-2188, 2171-2189, 2177-2195, 2178-2196, 2179-2197, 2180-2198, 2181-2199, 2182-2200, 2186-2204, 2187-2205, 2188-2206, 2189-2207, 2190-2208, 2191-2209, 2199- 2217, 2200-2218, 2201-2219, 2202-2220, 2203-2221, 2204-2222, 2205-2223, 2207-2225, 2208- 2226, 2209-2227, 2210-2228, 2211-2229, 2227-2245, 2228-2246, 2229-2247, 2231-2249, 2232- 2250, 2233-2251, 2234-2252, 2238-2256, 2240-2258, 2241-2259, 2242-2260, 2243-2261, 2286-2304, 2289-2307, 2309-2327, 2318-2336, 2358-2376, 2359-2377, 2361-2379, 2369-2387, 2371- 2389, 2372-2390, 2375-2393, 2379-2397, 2382-2400, 2383-2401, 2385-2403, 2404-2422, 2414- 2432, 2416-2434, 2418-2436, 2437-2455, 2470-2488, 2473-2491, 2474-2492, 2475-2493, 2478-2496, 2479-2497, 2510-2528, 2511-2529, 2572-2590, 2574-2592, 2575-2593, 2575-2593, 2576- 2594, 2577-2595, 2577-2595, 2578-2596, 2579-2597, 2580-2598, 2581-2599, 2582-2600, 2583- 2601, 2584-2602, 2616-2634, 2646-2664, 2647-2665, 2648-2666, 2649-2667, 2650-2668, 2651- 2669, 2652-2670, 2653-2671, 2654-2672, 2655-2673, 2656-2674, 2657-2675, 2658-2676, 2659-2677, 2660-2678, 2661-2679, 2662-2680, 2663-2681, 2675-2693, 2698-2716, 2699-2717, 2700- 2718, 2701-2719, 2702-2720, 2703-2721, 2708-2726, 2716-2734, 2752-2770, 2766-2784, 2769- 2787, 2776-2794, 2777-2795, 2778-2796, 2779-2797, 2780-2798, 2781-2799, 2782-2800, 2783- 2801, 2784-2802, 2785-2803, 2786-2804, 2787-2805, 2788-2806, 2791-2809, 2792-2810, 2794- 2812, 2796-2814, 2799-2817. 2805-2823 2806-2824, 2807-2825, 2808-2826. 2822-2840, 2825-2843, 2854-2872, 2855-2873, 2856-2874, 2862-2880, 2866-2884, 2869-2887, 2870-2888, 2874-2892, 2875-2893, 2876-2894, 2877-2895, 2919-2937, 2921-2939, 2925-2943, 2926-2944, 2927-2945, 2929-2947, 2930-2948, 2931-2949, 2933-2951, 2934-2952, 2941-2959, 2993-3011, 3026- 3044, 3028-3046, 3038-3056, 3039-3057, 3040-3058, 3041-3059, 3042-3060, 3054-3072, 3110-3128, 3219-3237, 3220-3238, 3221-3239, 3222-3240, 3223-3241, 3224-3242, 3225-3243, 3266- 3284, 3267-3285, 3285-3303, 3286-3304, 3287-3305, 3288-3306, 3291-3309, 3336-3354, 3359- 3377, 3400-3418, 3404-3422, 3405-3423, 3406-3424, 3407-3425, 3408-3426, 3409-3427, 3410- 3428, 3411-3429, 3412-3430, 3413-3431, 3439-3457, 3465-3483, 3468-3486, 3469-3487, 3596- 3614, 3597-3615, 3599-3617, 3605-3623, 3606-3624, 3607-3625, 3610-3628, 3611-3629, 3612- 3630, 3613-3631, 3615-3633, 3616-3634, 3626-3644, 3627-3645, 3628-3646, 3629-3647, 3630- 3648, 3631-3649, 3634-3652, 3637-3655, 3640-3658, 3641-3659, 3642-3660, 3643-3661, 3644-3662, 3646-3664, 3647-3665, 3657-3675, 3658-3676, 3659-3677, 3660-3678, 3661-3679, 3663- 3681, 3664-3682, 3665-3683, 3666-3684, 3669-3687, 3678-3696, 3732-3750, 3733-3751, 3742- 3760, 3750-3768, 3751-3769, 3764-3782, 3810-3828, 3877-3895, 3883-3901, 3938-3956, 3939- 3957, 3940-3958, 3941-3959, 3942-3960, 3943-3961, 3944-3962, 3948-3966, 3951-3969, 3953-3971, 3966-3984, 3967-3985, 3968-3986, 3969-3987, 3970-3988, 3971-3989, 3974-3992, 3985- 4003, 3990-4008, 4006-4024, 4014-4032, 4025-4043, 4038-4056, 4039-4057, 4040-4058, 4041- 4059, 4042-4060, 4057-4075, 4058-4076, 4059-4077, 4067-4085, 4075-4093, 4076-4094, 4077-4095, 4079-4097, 4080-4098, 4081-4099, 4082-4100, 4083-4101, 4086-4104, 4087-4105, 4088- 4106, 4089-4107, 4139-4157, 4140-4158, 4141-4159, 4156-4174, 4159-4177, 4163-4181, 4165- 4183, 4180-4198, 4182-4200, 4183-4201, 4184-4202, 4185-4203, 4186-4204, 4187-4205, 4196- 4214, 4197-4215, 4231-4249, 4232-4250, 4258-4276, 4260-4278, 4261-4279, 4262-4280, 4263-4281, 4264-4282, 4265-4283, 4267-4285, 4274-4292, 4275-4293, 4276-4294, 4277-4295, 4283- 4301, 4284-4302, 4285-4303, 4286-4304, 4287-4305, 4290-4308, 4291-4309, 4292-4310, 4300- 4318, 4301-4319, 4302-4320, 4311-4329, 4313-4331, 4314-4332, 4315-4333, 4316-4334, 4317-4335, 4319-4337, 4320-4338, 4321-4339, 4322-4340, 4323-4341, 4327-4345, 4355-4373, 4362- 4380, 4364-4382, 4367-4385, 4368-4386, 4371-4389, 4372-4390, 4373-4391, 4374-4392, 4385- 4403, 4404-4422, 4406-4424, 4407-4425, 4408-4426, 4409-4427, 4413-4431, 4414-4432, 4418- 4436, 4449-4467, 4450-4468, 4451-4469, 4452-4470, 4453-4471. 4454.4472, 4505-4523, 4509-4527, 4538-4556, 4539-4557, 4540-4558, 4548-4566, 4549-4567, 4551-4569, 4552-4570, 4558- 4576, 4559-4577, 4599-4617, 4600-4618, 4653-4671, 4654-4672, 4655-4673, 4656-4674, 4657- 4675, 4664-4682, and 4726-4744 of SEQ ID NO: 131 (NM 001278580.2).
[0055] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides)differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3084, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 843. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3084, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 843. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3084, and the sense strand comprises the nucleotide sequence SEQ ID NO: 843. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3084, and the sense strand consists of the nucleotide sequence SEQ ID NO: 843,
[0056] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3085, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2223. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3085, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2223. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3085, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2223. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3085, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2223.
[0057] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3086, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2264. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3086, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2264. In some embodiments, the antisense strand comprises thenucleotide sequence SEQ ID NO: 3086, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2264. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3086, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2264.
[0058] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3087, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2267. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3087, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2267. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3087, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2267. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3087, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2267.
[0059] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3088, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2286. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3088, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2286. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3088, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2286. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3088, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2286.
[0060] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3089, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2291. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3089, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2291. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3089, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2291. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3089, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2291.
[0061] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3090, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2298. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3090, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2298, In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3090, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2298. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3090, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2298.
[0062] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3091, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2309. in some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3091, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2309. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3091, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2309, In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3091, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2309.
[0063] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO:3092, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2317. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3092, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2317. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3092, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2317. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3092, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2317.
[0064] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3093, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 919. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3093, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 919. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3093, and the sense strand comprises the nucleotide sequence SEQ ID NO: 919. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3093, and the sense strand consists of the nucleotide sequence SEQ ID NO: 919.
[0065] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3094, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 933. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3094, and the sense strand comprises anucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 933. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3094, and the sense strand comprises the nucleotide sequence SEQ ID NO: 933. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3094, and the sense strand consists of the nucleotide sequence SEQ ID NO: 933.
[0066] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3095, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2326. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3095, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2326. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3095, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2326. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3095, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2326.
[0067] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3096, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2330. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3096, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2330. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3096, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2330. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3096, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2330.
[0068] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO:3097, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2336. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3097, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2336. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3097, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2336. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3097, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2336.
[0069] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3098, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2337. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3098, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2337. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3098, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2337. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3098, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2337.
[0070] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3099, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2340. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3099, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2340, In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3099, and the sense strand comprises the nucleotide sequenceSEQ ID NO: 2340. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3099, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2340.
[0071] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3100, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2346. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3100, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2346. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3100, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2346. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3100, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2346.
[0072] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3101, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2347. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3101, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2347, In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3101, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2347. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3101, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2347.
[0073] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3102, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 955. In some embodiments,the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3102, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 955, In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3102, and the sense strand comprises the nucleotide sequence SEQ ID NO: 955. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3102, and the sense strand consists of the nucleotide sequence SEQ ID NO: 955.
[0074] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3103, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2378. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3103, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2378. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3103, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2378. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3103, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2378.
[0075] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3104, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2384. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3104, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 2384. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3104, and the sense strand comprises the nucleotide sequence SEQ ID NO: 2384. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3104, and the sense strand consists of the nucleotide sequence SEQ ID NO: 2384.
[0076] In some embodiments, the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3105, and the sense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, or 19 contiguous nucleotides) differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 964. In some embodiments, the antisense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 3105, and the sense strand comprises a nucleotide sequence differing by no more than 4 nucleotides (for example, 1, 2, 3, or 4 nucleotides) from SEQ ID NO: 964. In some embodiments, the antisense strand comprises the nucleotide sequence SEQ ID NO: 3105, and the sense strand comprises the nucleotide sequence SEQ ID NO: 964. In some embodiments, the antisense strand consists of the nucleotide sequence SEQ ID NO: 3105, and the sense strand consists of the nucleotide sequence SEQ ID NO: 964.
[0077] An ACVR2A RNAi agent described herein can contain one or more mismatches to the target sequence (e.g., a sequence of between 15 and 30 nucleotides in length). In some embodiments, an ACVR2A RNAi agent as described herein contains no more than 4 mismatches (e.g., no more than 4, 3, 2, 1, or 0 mismatches to the target sequence). If the antisense strand of the RNAi agent contains mismatches to a target sequence, it may be preferable that the area of mismatch is not located in the center of the region of complementarity. If the antisense strand of the RNAi agent contains mismatches to the target sequence, it may be preferable that the mismatch be restricted to be within the last 5 nucleotides from either the 5’- or 3’-end of the region of complementarity. For example, for a 21 nucleotide RNAi agent, the strand which is complementary to a region of, e.g., ACVR2A, generally does not contain any mismatch within the central 11 nucleotides. The methods described herein or methods known in the art can be used to determine whether an RNAi agent containing a mismatch to a target sequence is effective in inhibiting the expression of ACVR2A Consideration of the efficacy of RNAi agents with mismatches in inhibiting expression of a target gene is important, especially if the particular region of complementarity in a target gene is known to have polymorphic sequence variation within the population,
[0078] In some embodiments, any one of the RNAi agents described herein can reduce expression levels of ACVR2A. In some embodiments, reduction in expression levels is assayed using an RT-qPCR assay to perform relative quantification of ACVR2A mRNA in Hepa 1-6 cell line. The skilled artisan will appreciate that various approaches to quantify knockdown of ACVR2A expression for assessing RNAi agent activity may be used in the art, including commerciallyavailable kits, e.g., from Thermo. In some embodiments, any one of the RNAi agents described herein can reduce expression levels of an ACVR2A mRNA when assayed in cultured cells. Any suitable cells known in the art may be used to assess the RNAi agents. In some embodiments, the cultured cells are Hepa 1-6 cells. In some embodiments, administration of any one of the RNAi agents disclosed herein to a cultured cell results in a reduction in expression level of an ACVR2A. In some embodiments, administration of the RNAi agent results in at least a 55% reduction in expression levels of the ACVR2A mRNA. In some embodiments, administration of the RNAi agent results in at least a 60% reduction in expression levels of tire ACVR2A mRNA. In some embodiments, administration of the RNAi agent results in at least a 65% reduction in expression levels of the ACVR2A mRNA. In some embodiments, administration of tire RNAi agent results in at least a 70% reduction in expression levels of the ACVR2A mRNA. In some embodiments, administration of the RNAi agent results in at least a 75% reduction in expression levels of the ACVR2A mRNA. In some embodiments, administration of the RNAi agent results in at least an 80% reduction in expression levels of the ACVR2A mRNA. In some embodiments, administration of the RNAi agent results in at least an 85% reduction in expression levels of the ACVR2A mRNA, In some embodiments, administration of the RNAi agent results in at least a 90% reduction in expression levels of the ACVR2A mRNA. In some embodiments, administration of the RNAi agent results in at least a 95% reduction in expression levels of the ACVR2 A mRNA.Single-stranded antisense oligonucleotides
[0079] In some embodiments, the oligonucleotide is a single-stranded antisense oligonucleotide, or “ASO.” ASOs comprise an antisense strand with at least partial complementary’ to a target sequence in an RNA. Upon binding to a target sequence, downregulation of the RNA may be achieved through various mechanisms, including, but not limited to, sterically blocking translation or recruitment of RNase H,
[0080] In some embodiments, the ASO comprises a nucleic acid sequence of at least 14 contiguous nucleotides (for example, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) that differ by no more than 1, 2, 3, or 4 nucleotides from any one of SEQ ID NOs: 328-654, 982-1308, 1755- 2197 or 2641-3105. In some embodiments, the ASO comprises a nucleic acid sequence of at least 14 contiguous nucleotides that differ by no more than 1, 2, 3, or 4 nucleotides from any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105. In some embodiments, the ASO comprises a nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105.
[0081] In some embodiments, the ASO comprises 2'-deoxy ribonucleotides and phosphorothioate internucleoside linkages.
[0082] In some embodiments, the ASO is a “gapmer” ASO comprising a 2'-deoxy "gap" region flanked by "wings" having nucleotides with 2'-modified ribonucleotides. In some embodiments, the ASO is an " MOE gapmer" in which the 2'-modified ribonucleotide is a 2'-O-methoxyethyl (2'-MOE or simply MOE) modification, and each of the intemucleoside linkages is a phosphorothioate.Modified Nucleotides
[0083] The oligonucleotides disclosed herein may be modified or unmodified. In some embodiments, any one of the oligonucleotides contain one or more modifications. As used herein, a modification to a nucleotide or ‘‘modified nucleotide” refers to any nucleotide other than the canonical ribonucleotides adenine, guanine, cytosine, and uracil.
[0084] In some embodiments, the oligonucleotide comprises one or more modified nucleotides. In some embodiments, no more than 1, 2, 3, 4, or 5 of the nucleotides of the oligonucleotide are unmodified nucleotides. In some embodiments, all nucleotides of the oligonucleotide are modified nucleotides.
[0085] In some embodiments, wherein the oligonucleotide is an RNAi agent, the antisense strand comprises one or more modified nucleotides. In some embodiments, no more than 1, 2, 3, 4, or 5 of the nucleotides of the antisense strand are unmodified nucleotides. In some embodiments, all nucleotides of the antisense strand are modified nucleotides.
[0086] In some embodiments, wherein the oligonucleotide is an RNAi agent, the sense strand comprises one or more modified nucleotides. In some embodiments, no more than 1, 2, 3, 4, or 5 of the nucleotides of the sense strand are unmodified nucleotides. In some embodiments, all nucleotides of the sense strand are modified nucleotides,
[0087] Modified nucleotides include, but are not limited to 2'-modified nucleotides, 3' to 3' linkages (inverted) nucleotides, bridged nucleotides, 2',3'-seco nucleotide mimics (e.g, unlocked nucleobase analogues (UNAs), locked nucleotides (LNAs), 5'-(S)-methyl-2’-deoxy-2’-fluoronucleotide (5’Me-Nf), vinyl phosphonate deoxyribonucleotides, vinyl phosphonate nucleotides, a nucleotide comprising a 5'-phosphorothioate group, a nucleotide comprising a 5'- methylphosphonate group, a nucleotide comprising a 5’ phosphate or 5’ phosphate mimic and N-(methane sulfonyl) phosphoramidate group. In some embodiments, 2'-modified nucleotides (e.g., a nucleotide with a group other than a hydroxyl group at the 2' position of the five-membered sugar ring) include, but are not limited to, 2'-O-methyl nucleotides (represented herein as a lower caseletter n in a nucleotide sequence), 2'-deoxy-2'-fluoro nucleotides (represented herein as Nf, also represented herein as 2'-fluoro nucleotide). In some embodiments, a modified nucleotide is a nucleotide comprising a 5'-methylphosphate group. In some embodiments, a modified nucleotide is a nucleotide comprising a 5'-C-methylphosphate group.
[0088] In some embodiments, modified nucleotides include, but are not limited to, deoxyribonucleotides, nucleotide mimics, abasic nucleotides, 5' to 5' linkages (inverted) nucleotides, non-natural base-comprising nucleotides, peptide nucleic acids (PMAs), 3'-O-methoxy (2' intemucleoside linked) nucleotides, 2’-deoxy-2’-fluoro-arabino nucleotides, cyclopropyl phosphonate nucleotides (cPrpN), vinyl phosphonate 2 ’-(methoxyethyl) unlocked nucleotides, a nucleotide comprising 2-hydroxymethyl-tetraliydrofurane-5-phosphate, 2'-deoxy nucleotides (represented herein as dN), 2'-methoxy ethyloxy (2'-O-(2 -methoxylethyl)) nucleotides, 2'-amino nucleotides, and 2'-alkyl nucleotides. It is not necessary for all positions in a given compound to be uniformly modified. Conversely, more than one modification may be incorporated in a single oligonucleotide. Modification at one nucleotide is independent of modification at another nucleotide,
[0089] In some embodiments, the nucleotide modification comprises a deoxyribonucleotide, a 3’-terminal deoxythymidine (dT) nucleotide, an abasic nucleotide, a 2'-modified nucleotide, a 3' to 3' linkages (inverted) nucleotide, a 5' to 5' linkages (inverted) nucleotide, a non-natural basecomprising nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a nucleotide comprising a 5'-methylphosphonate group, a nucleotide comprising a 5’ phosphate or 5’ phosphate mimic, a nucleotide comprising 2-hydroxymethyl-tetrahydrofurane-5-phosphate, or a nucleotide comprising a / V-(methane sulfonyl) phosphoramidate group. In some embodiments, the nucleotide modification comprises a nucleotide comprising a 5'-methylphosphate group. In some embodiments, a modified nucleotide is a nucleotide comprising a 5'-C-methylphosphate group. In some embodiments, the oligonucleotide composes a modified nucleotide selected from the group consisting of a deoxy nucleotide, a 3 ’-terminal deoxythymidine (dT) nucleotide, a 3' -3' inverted nucleotide linkage, a 5 ’-5’ inverted nucleotide linkage, a 5'-(E)-vinylphosphonate-2’-O-methyl-uridine-3 ’-phosphate, a 5'-(E)-vinylphosphonate-2'-O-methyl-uridine-3’-phosphorothioate, and a combination thereof,
[0090] In some embodiments, the one or more modifications is selected from a ribose modification, a backbone modification, a nucleobase modification, or a combination thereof. In some embodiments, the one or more modifications is a combination of a ribose modification, a backbone modification, and / or a nucleobase modification.
[0091] In some embodiments, the ribose modification comprises a locked nucleic acid (LNA), a tricyclo-DNA (tcDNA), 2'-deoxy-2' -fluoro, 2'-O-methyl, 2'-methoxyethyl (2'-M0E), 2'-deoxy-2'-arabino-fluoro, 2'-O-benzyl, 2'-O-methyl-4-pyridine, 2' cyclic ethyl (cET), phosphorodiamidate morpholino (PMO), glycol nucleic acid (GNA), unlocked nucleic acid (UNA), a threose nucleic acid (TNA), or a combination thereof. In some embodiments, the ribose modification comprises a 2'-deoxy-2'-fluoro, 2'-O-methyl, 2'-methoxyethyl (2'-M0E), glycol nucleic acid (GNA), unlocked nucleic acid (UNA), a threose nucleic acid (TNA), or a combination thereof. In some embodiments, the ribose modification comprises a 2'-deoxy-2'-fluoro, 2'-O-methyl, glycol nucleic acid (GNA), unlocked nucleic acid (UNA), a threose nucleic acid (TN A), or a combination thereof. In some embodiments, the ribose modification is 2'-deoxy-2'-fluoro modification, a 2'-O-methyl modification, or a combination thereof.
[0092] In some embodiments, the oligonucleotide comprises one or more nucleobase modifications. Nucleobase modifications include, for example, synthetic and natural nucleobases, such as 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, (e.g., 2 -aminopropyladenine, 5-propynyluracil, or 5-propynylcytosine), 5 -methyl cytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2 -aminoadenine, 6-alkyI (e.g., 6-methyl, 6-ethyl, 6-isopropyl, or 6-n-butyl) derivatives of adenine and guanine, 2-alkyl (e.g., 2 -methyl, 2- ethyl, 2-isopropyl, or 2-n-butyl) and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouraciI, cytosine, 5-propynyI uracil, 5-propynyl cytosine, 6- azo uracil, 6-azo cytosine, 6-azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines, 5-halo (e.g., 5-bromo), 5 -tri fluoromethyl, and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, and 3-deazaadenine, or combinations thereof.
[0093] In some embodiments, the oligonucleotide comprises one or more backbone modification or non-standard linkages (e.g., modified intemucleoside linkages). In some embodiments, a backbone modification is a non-phosphate-containing covalent internucleoside linkage. Modified intemucleoside linkages or backbones include, but are not limited to, 5’-phosphorothioate groups (represented herein as a lower case “s”), chiral phosphorothioates, thiophosphates, phosphorodithioates, phosphotriesters, aminoalkyl-phosphotriesters, alkyl phosphonates (e.g., methyl phosphonates or 3'-alkylene phosphonates), chiral phosphonates, phosphinates, phosphoramidates e.g., 3'-amino phosphoramidate, aminoalkylphosphoramidates, or thionophosphoramidates), thionoalkyl-phosphonates, thionoalkylphosphotriesters, morpholino linkages, boranophosphates having normal 3 '-5' linkages, 2'-5' linked analogs ofboranophosphates, or boranophosphates having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3 '-5 ' to 5 '-3 ' or 2' -5 ' to 5 '-2'. In some embodiments, a modified backbone or modified internucleoside linkage lacks a phosphorus atom. Modified intemucleoside linkages lacking a phosphorus atom include, but are not limited to, short chain alkyl or cycloalkyl intersugar linkages, mixed heteroatom and alkyl or cycloalkyl inter-sugar linkages, or one or more short chain heteroatomic or heterocyclic inter-sugar linkages. In some embodiments, modified intemucleoside backbones include, but are not limited to, siloxane backbones, sulfide backbones, sulfoxide backbones, sulfone backbones, formacetyl and thioform acetyl backbones, methylene formacetyl and thioform acetyl backbones, alkene-containing backbones, sulfamate backbones, methyleneimino and methylenehydrazino backbones, sulfonate and sulfonamide backbones, amide backbones, and other backbones having mixed N, O, S, and CH2 components.
[0094] In some embodiments, the backbone modification comprises phosphorothioate.
[0095] In some embodiments, any one of the oligonucleotides disclosed herein further comprise a sequence of 3 ’-terminal deoxythymidine (df) nucleotides. In some embodiments, any one of the antisense strands described herein further comprises at least one terminal dT nucleotide. In some embodiments, any one of the antisense strands described herein further comprises 2 or more terminal dT nucleotides, e.g., 2, 3, 4, or more terminal dT nucleotides. In some embodiments, wherein the oligonucleotide is an RNAi agent, any one of the sense strands described herein further comprises at least one terminal dT nucleotide. In some embodiments, any one of the sense strands described herein further comprises 2 or more terminal dT nucleotides, e.g., 2, 3, 4, or more terminal df nucleotides. In some embodiments, the antisense and sense strand of an RNAi agent herein each contain one or more terminal dT nucleotides.
[0096] In some embodiments, any one of the oligonucleotides disclosed herein further comprises at least one phosphorothioate internucleoside or phosphorodithioate internucleoside linkage. In some embodiments, any one of the oligonucleotides disclosed herein further comprises at least one phosphorothioate intemucleoside linkage. In some embodiments, at least one phosphorothioate intemucleoside linkage is at the 5’ end of the antisense strand. In some embodiments, the oligonucleotide comprises at least 2 phosphorothioate intemucleoside linkages at the 5 ’ end of the antisense strand. In some embodiments, at least one phosphorothioate intemucleoside linkage is at the 3’ end of the antisense strand. In some embodiments, the oligonucleotide comprises at least 2 phosphorothioate intemucleoside linkages at the 3’ end of the antisense strand. In some embodiments, wherein the oligonucleotide is an RNAi agent, the at least one phosphorothioate intemucleoside linkage is at the 5’ end of the sense strand. In some embodiments, the oligonucleotide comprises at least 2 phosphorothioate intemucleoside linkages at the 5’ end of thesense strand. In some embodiments, the at least one phosphorothioate intemucleoside linkage is at the 3’ end of the sense strand. In some embodiments, the oligonucleotide comprises at least 2 phosphorothioate intemucleoside linkages at the 3’ end of the sense strand.
[0097] In some embodiments, any one of the oligonucleotides disclosed herein further comprises a terminal, chiral modification. In some embodiments, the terminal chiral modification is at the first intemucleoside linkage at the 3’ end of the sense and / or antisense strand. In some embodiments, the terminal chiral modification is at tire first and second intemucleoside linkage at the 3’ end of the sense and / or antisense strand. In some embodiments, the chiral modification comprises a phosphorus atom of the intemucleoside linkage being in either Rp or Sp configuration. In some embodiments, the siRNA agent further comprises a terminal, chiral modification occurring at the first intemucleoside linkage at the 3 ’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleoside linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp configuration or Sp configuration. In some embodiments, the siRNA agent further comprises a terminal, chiral modification occurring at the first and second intemucleoside linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first intemucleoside linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleoside linkage at tire 5 ’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration. In some embodiments, the siRNA agent further comprises a terminal, chiral modification occurring at the first, second, and third intemucleoside linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first intemucleoside linkage at the 5’ end of the antisense s trand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration. In some embodiments, the siRNA agent further comprises a terminal, chiral modification occurring at the first and second intemucleoside linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the third intemucleoside linkages at the 3 ’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, a terminal, chiral modification occurring at the first intemucleoside linkage at the 5’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, anda terminal, chiral modification occurring at the first intemucleoside linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration. In some embodiments, the siRNA agent further comprises a terminal, chiral modification occurring at the first and second intemucleoside linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first and second intemucleoside linkages at tlie 5 ’ end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleoside linkage at the 5’ end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.
[0098] In some embodiments, any one of the oligonucleotides disclosed herein further comprises a phosphate or phosphate mimic at the 5 ’-end of the antisense strand. In some embodiments, a phosphate or phosphate mimic at the 5 ’-end of the antisense strand is a 5 ’-vinyl phosphonate (VP), in some embodiments, a phosphate or phosphate mimic at the 5 ’-end of the antisense strand is a 5’-(E)-vinyl phosphonate (VP).RNAi Agent Modification Motifs
[0099] In some embodiments, any one of the antisense or sense strands disclosed herein are modified according to a modification motif or pattern.
[0100] In some embodiments, an antisense strand disclosed herein comprises a modification pattern nsNfsnnnNfnNfNfnnnnNfnNfnnnsnsn, wherein ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3’ -phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphate.
[0101] In some embodiments, an antisense strand disclosed herein comprises a modification pattern vpUsNfsnnnNfnNfNfnnnnNfnNfnnsnsn, wherein vpUs is a 5'-vinylphosphonate-2'-O-methyl-uridine-3’-phosphorothioate; ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphate.
[0102] In some embodiments, a sense strand disclosed herein comprises a modification pattern nsnsnnNfnNfNfNfnnnnnnnnn, wherein ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro- nucleoside-3 '-phosphate.
[0103] In some embodiments, a sense strand disclosed herein comprises a modification pattern NfsnsNfnNfnNfnNfnNfnNfnNfnNfnNf, wherein ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucIeoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3 '-phosphate.
[0104] In some embodiments, an RNAi agent disclosed herein comprises a sense strand and an antisense strand, wherein the sense strand comprises a modification pattern nsnsnnNfnNfNfNfnnnnnnnnn, and the antisense strand comprises a modification pattern nsNfsnnnNfhNfNfnnnnNfnNfnnnsnsn, wherein ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucIeoside-3'-phosphate.
[0105] In some embodiments, an RNAi agent disclosed herein comprises a sense strand and an antisense strand, wherein the sense strand comprises a modification pattern nsnsnnNfnNfNfNfnnnnnnnnn, and the antisense strand comprises a modification pattern vpUsNfsnnnNfnNfNfnnnnNfnNfnnnsnsn, wherein vpUs is a 5'-vinylphosphonate-2'-O-methyl- uridine-3 ’-phosphorothioate; ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; Nfs is a 2'- deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3‘-phosphate; and Nfis a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphate.
[0106] In some embodiments, a strand of an RNAi agent comprises a modification pattern according to Nfsa(nNf)bnscn, wherein n is a 2'-O-methyl-nucleoside-3’-phosphate; Nfs is a 2'- deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphate; and ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; and wherein a is at least 1, b is 5-10, and c is at least 1. In some embodiments, a is at least 2, b is at least 8, and c is at least 2. In some embodiments, a is 2, b is 8, and c is 2. In some embodiments, the strand of the RNAi agent comprises the modification pattern NfsNfsnNfnNfnNfnNfnNfnNfnNfnNfnsnsn. In some embodiments, the strand is the antisense strand. In some embodiments, the antisense strand comprises the sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105. In some embodiments, the strand is the sense strand. In some embodiments, the sense strand comprises the sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640.
[0107] In some embodiments, a strand of an RNAi agent comprises a modification pattern according nsd(Nfn)eNf, wherein n is a 2'-O-methyl-nucleoside-3 ’-phosphate; Nf is a 2'-deoxy-2'-fhioro-nucleoside-3'-phosphate; and ns is a 2'-O-methyl-nucleoside-3 '-phosphorothioate; and wherein d is at least 1, and e is 5-10. In some embodiments, d is at least 2 and e is at least 8. In some embodiments, the RNAi agent comprises the modification pattern nsnsNfnNfnNfnNfnNfnNfnNfnNfnNf. In some embodiments, the strand is the sense strand. In some embodiments, the sense strand comprises the sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640. In some embodiments, the sense strand corresponds to theunmodified sense strand sequences in Table 1C. In some embodiments, the RNAi agent comprises the modification pattern nsnsNfnNfnNfnNfnNfnNfnNfnNfnNfnsn. In some embodiments, the strand is the antisense strand. In some embodiments, the antisense strand comprises the sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105. In some embodiments, the antisense strand corresponds to the unmodified antisense strand sequences in Table 1C.
[0108] In some embodiments, the antisense strand comprises a modification pattern according to Nfsa(nNf)bnscn, wherein n is a 2'-O-methyl-nucleoside-3’-phosphate; Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'- phosphate; and ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; and wherein a is at least 1, b is 5-10, and c is at least 1, and the sense strand comprises a modification pattern according nsd(Nfh)eNf, wherein n is a 2'-O-methyl-nucleoside-3 ’-phosphate; Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphate; and ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; and wherein d is at least 1, and e is 5-10. In some embodiments, the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105. In some embodiments, the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640. In some embodiments, the antisense strand corresponds to the unmodified antisense strand sequences in Table 1C. In some embodiments, the sense strand corresponds to the unmodified sense strand sequences in Table 1C.
[0109] In some embodiments, any one of the RNAi agents disclosed herein comprises a modification pattern wherein the antisense strand comprises the motif F(SF)nSnn, wherein n is from 2 to about 20, nn is 0 or 1, one of F and S is a 2'-deoxy-2‘-fluoro modified nucleoside and the other of F and S is a 2'-O-methyl modified nucleoside. In some embodiments, each of the antisense and the sense strand is 17-23 nucleotides in length. In some embodiments, the antisense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 328-654 or 1755-2197. In some embodiments, the sense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 1-327 or 1312-1754. In some embodiments, the antisense strand corresponds to the unmodified antisense strand sequences in Table 1C. In some embodiments, the sense strand corresponds to the unmodified sense strand sequences in Table 1C.
[0110] In some embodiments, any one of the RNAi agents disclosed herein comprises a modification pattern wherein the antisense strand comprises the chemical modification pattern of nNfnnnNfnNfNfnnnnNfnNfnnnnn and the sense strand comprises the chemical modification nnnnnnNfnNfNfNfnnnnnnn, wherein n is a 2’-O-methyl-nucleoside and Nf is a 2’-deoxy-2’-fluoro-nucleoside. In some embodiments, the antisense strand corresponds to the unmodifiednucleobase sequence according to any one of SEQ ID NOs: 328-654 or 1755-2197. In some embodiments, the sense strand corresponds to the unmodified nucleobase sequence of any one according to SEQ ID NOs: 1-327 or 1312-1754. In some embodiments, the antisense strand corresponds to the unmodified antisense strand sequences in Table 1C. In some embodiments, the sense strand corresponds to the unmodified sense strand sequences in Table 1C.
[0111] In some embodiments, any one of the RNAi agents disclosed herein comprises a modification pattern wherein the antisense strand comprises a region having the formula X1-Y-X2, wherein Y is a subregion of from about 5 to about 12 linked nucleosides and each of XI subregion and X2 subregion is, independently, a plurality of linked nucleosides having the formula FSFS, where one of F and S is a 2'-deoxy-2’-fluoro modified nucleoside and the other of F and S is a 2'-O-methyl modified nucleoside; and each intemucleoside linkage of said XI subregion and X2 subregion is, independently, a phosphodiester or a phosphorothioate intemucleoside linkage. In some embodiments, each of the antisense and the sense strand is 20-23 nucleotides in length. In some embodiments, the antisense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 328-654 or 1755-2197. In some embodiments, the sense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 1-327 or 1312-1754. In some embodiments, the antisense strand corresponds to the unmodified antisense strand sequences in Table 1C, In some embodiments, the sense strand corresponds to the unmodified sense strand sequences in Table 1C.
[0112] In some embodiments, any one of the RNAi agents disclosed herein comprises a modification pattern wherein the antisense strand comprises a contiguous sequence of linked nucleosides that define an alternating motif of the formula: 5'-Q(-L-Z-L-Q)n(-L-Z)nn-3', wherein: each L is an intemucleoside linking group; either each Q is a 2 '-deoxy-2’ -fluoro nucleoside and each Z is a 2'-O-methyl nucleoside; or each Q is a 2'-O-methyl nucleoside and each Z is a 2'-deoxy -2 ’-fluoro nucleoside; and n is from 8 to 14 and nn is 0 or 1. In some embodiments, the antisense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 328-654 or 1755-2197. In some embodiments, the antisense strand corresponds to the unmodified antisense strand sequences in Table 1C. In some embodiments, the sense strand corresponds to the unmodified sense strand sequences in Table 1C.
[0113] In some embodiments, any one of the RNAi agents disclosed herein comprises a modification pattern wherein the antisense strand is represented by the formula:wherein, Bl', B2', B3', and B4' each independently represent a nucleotide containing a modification selected from the group consisting of 2'-0-alkyl, 2'-substituted alkoxy, 2'-substituted alkyl, 2'-halo, ENA, and BNA / LNA; IT, T2', and T3' each independently represent a nucleotide comprising a chemical modification selected from the group consisting of DNA, RNA, LNA, 2’-deoxy-2’-fluoronucleotide, and 5'-(S)-methyl2’-deoxy-2’-fluoronucleotide; ql is 4 to 15 nucleotides in length; q3 or q7 is independently 1-6 nucleotide(s) in length; q2 or q6 is independently 1-3 nucleotide(s) in length; q4 is 0-3 nucleotide(s) in length; and q5 is 0-10 nucleotide(s) in length; and wherein: the antisense strand has 2 ’-deoxy-2 ’-fluoro modifications, and wherein the 2’-deoxy-2’-fluoro modifications on the antisense strand consist of four, and only four, 2 ’-deoxy-2 ’-fluoro modifications or six, and only six, 2 ’-deoxy-2 ’-fluoro modifications. In some embodiments, the antisense strand is 19-25 nucleotides in length. In some embodiments, the antisense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 328-654 or 1755-2197. In some embodiments, the sense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 1-327 or 1312-1754. In some embodiments, the antisense strand corresponds to the unmodified antisense strand sequences in Table 1C. In some embodiments, the sense strand corresponds to the unmodified sense strand sequences in Table 1C.
[0114] In some embodiments, any one of the RNAi agents disclosed herein comprises a modification pattern wherein the antisense strand and the sense strand are represented by the formula:(I^3 >...........,wherein Bl, Bl', B2', B3', and B4' each independently represent a nucleotide containing a modification selected from the group consisting of 2'-O-alkyl, 2 / -substituted alkoxy, 2'-substituted alkyl, 2'-halo, ENA, and BNA / LNA; Cl is a thermally destabilizing nucleotide, selected from the group consisting of i) a nucleotide that forms a mismatch pair with the opposing nucleotide in theantisense strand, ii) a nucleotide having an abasic modification, and iii) a nucleotide having a sugar modification, and placed at a site opposite to the seed region (positions 2-8) of the antisense strand; IT, T2', and T3' each independently represent a nucleotide comprising a modification providing the nucleotide a steric bulk that is less than or equal to the steric bulk of a 2'-0Me modification, wherein the modification is at the 2'-position of a ribose sugar of the nucleotide or at a position of a non-ribose nucleotide similar to the 2'-position of a ribose sugar; each n1, and q1 is independently 4 to 15 nucleotides in length; each q3, and q7 is independently 1-6 nucleotide(s) in length; each q2 and q6 is independently 1-3 nucleotide(s) in length; q5 is 0-10 nucleotide(s) in length; each n4, and q4 is independently 0-3 nucleotide(s) in length; n2 is 3 nucleotides in length, and T1 each are 2’-deoxy-2’-fluoronucleotides; n3 is 7 nucleotides in length, and B2 each are 2'-OMe nucleotides; and n5 is 3 nucleotides in length, and B3 each are 2'-OMe nucleotides. In some embodiments, the antisense strand and sense strand are each 14 to 40 nucleotides. In some embodiments, the antisense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 328-654 or 1755-2197. In some embodiments, the sense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 1-327 or 1312-1754. In some embodiments, the antisense strand corresponds to the unmodified antisense strand sequences in Table 1C. In some embodiments, the sense strand corresponds to the unmodified sense strand sequences in Table 1C.
[0115] In some embodiments, any one of the RNAi agents disclosed herein comprises a modification pattern wherein the antisense strand is represented by the formula:(Is)wherein: Bl, B2, and B3 each independently represent a nucleotide containing a modification selected from the group consisting of 2'-0-alkyl, 2'-substituted alkoxy, 2'-substituted alkyl, 2'- halo, ENA, and BNA / LNA; Cl is a thermally destabilizing nucleotide, selected from the group consisting of i) a nucleotide that forms a mismatch pair with the opposing nucleotide in the antisense strand, ii) a nucleotide having an abasic modification, and iii) a nucleotide having a sugar modification, and placed at a site opposite to the seed region (positions 2-8) of the antisense strand; T1 represents a nucleotide comprising a 2 ’-deoxy-2 ’-fluoro modification; nl or n3 is independently 4 to 15 nucleotides in length; n5 is 1-6 nucleotide(s) in length; n2 is 3; n4 is 0-3 nucleotide(s) in length; and wherein the sense strand has 2 ’-deoxy-2 ’-fluoro modifications, and wherein the 2 ’-deoxy-2 ’-fluoro modifications on the sense strand consist of four, and only four,2 ’-deoxy-2 ’-fluoro modifications, wherein the four 2 ’-deoxy-2 ’-fluoro modifications are at positions 7 and 9-11 from the 5 '-end of the sense strand. In some embodiments, the antisense strand and sense strand are each 19-25 nucleotides. In some embodiments, the antisense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 328-654 or 1755-2197. In some embodiments, the sense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 1-327 or 1312-1754. In some embodiments, the antisense strand corresponds to the unmodified antisense strand sequences in Table 1C. In some embodiments, the sense strand corresponds to the unmodified sense strand sequences in Table 1C.
[0116] In some embodiments, any one of the RNAi agents disclosed herein comprises a modification pattern wherein the antisense strand is complementary to at least one portion of a mRNA of the target gene (e.g., ACVR2A), wherein the oligonucleotide is represented by the formula:cr3fwherein: Bl', B2', B3', and B4' each independently represent a nucleotide containing a modification selected from the group consisting of 2'-0 -methyl and 2"-deoxy-2’-fluoro; each B1, B2, and B3 is 2'-OMe; Cl is glycerol nucleic acid (GNA) placed at a site opposite to the seed region (positions 2-8) of the antisense strand; IT, T2', and T3' are each 2’-deoxy-2’- fluoronucleotides, wherein: IT is at position 14 from the 5' end of the antisense strand, and q2 is 1; and 1’3 ' is at position 2 from the 5' end of the antisense strand, and q6 and q7 are 1; each nl, n3, and ql is independently 4 to 15 nucleotides in length; each n5 and q3 is independently 1-6 nucleotide(s) in length; q5 is 0-10 nucleotide(s) in length; each n4 and q4 is independently 0-3 nucleotide(s) in length; n2 is 3 nucleotides in length, and T1 each are 2 ‘-deoxy-2’ -fluoro nucleotides, and wherein (a) the oligonucleotide is covalently conjugated to at least one ligand; and (b) one of the T1 nucleotides is at position 11 from the 5' end of the sense strand. In some embodiments, the sense strand comprises 19-22 nucleotides and the antisense strand comprises 19-25 nucleotides. In some embodiments, the antisense strand corresponds to the unmodifiednucleobase sequence according to any one of SEQ ID NOs: 328-654 or 1755-2197. In some embodiments, the sense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 1-327 or 1312-1754. In some embodiments, the antisense strand corresponds to the unmodified antisense strand sequences in Table 1C, In some embodiments, the sense strand corresponds to the unmodified sense strand sequences in Table 1C.
[0117] In some embodiments, any one of the RNAi agents disclosed herein comprises a modification pattern wherein the oligonucleotide is represented by the formula:(I)wherein Bl', B2', B3', and B4' each independently represent a nucleotide containing a modification selected from the group consisting of 2'-O-methyl and 2’-deoxy-2’-fluoro; each B1, B2, and B3 is 2'-Ome nucleotides; Cl is glycerol nucleic acid (GNA) placed at a site opposite to the seed region (positions 2-8) of the antisense strand; Tl', T2', and T3' are each 2 ’-deoxy-2 ’-fluoro nucleotides, wherein: Tl' is at position 14 from the 5' end of the antisense strand, and q2 is 1; and T3' is at position 2 from the 5' end of the antisense strand, and q6 and q7 are 1; each nl, n3, and ql is independently 4 to 15 nucleotides in length; each n5 and q3 is independently 1-6 nucleotide(s) in length; q5 is 0-10 nucleotide(s) in length; each n4 and q4 is independently 0-3 nucleotide(s) in length; n2 is 3 nucleotides in length, and Tl each are 2 ’-deoxy-2 ’-fluoro nucleotides, and wherein (a) the oligonucleotide is covalently conjugated to at least one ligand; and (b) one of the T1 nucleotides is at a position in the sense strand that is opposite to position 11 from the 5' end of the antisense strand; and (c) the oligonucleotide comprises at least one phosphorothioate internucleoside linkage. In some embodiments, the sense strand comprises 19-22 nucleotides and the antisense strand comprises 19-25 nucleotides. In some embodiments, the antisense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 328-654 or 1755-2197. In some embodiments, the sense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 1-327 or 1312-1754. In some embodiments, the antisense strand corresponds to the unmodified antisense strand sequences inTable 1C. In some embodiments, the sense strand corresponds to the unmodified sense strand sequences in Table 1C.
[0118] In some embodiments, any one of the RNAi agents disclosed herein comprises a modification pattern wherein the antisense strand has sufficient complementarity to a target sequence to mediate RNA interference, wherein said sense strand comprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5' region of the antisense strand or a precursor thereof, wherein the antisense strand further comprises one or both of the following characteristics: (i) 2, 3, 4, 5 or 62'-deoxy-2'-fluoro modifications; and (ii) 1, 2, 3, 4 or 5 phosphorothioate internucleoside linkages; and said sense strand comprises one, two or three of the following characteristics: (iii) 2, 3, 4, or 5 2'-deoxy-2'-fluoro modifications; and (iv) 1, 2, 3, 4 or 5 phosphorothioate internucleoside linkages. In some embodiments, the antisense strand and sense strand are each 14 to 40 nucleotides. In some embodiments, the antisense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 328-654 or 1755-2197. In some embodiments, the sense strand corresponds to the unmodified nucleobase sequence according to any one of SEQ ID NOs: 1-327 or 1312-1754, In some embodiments, the antisense strand corresponds to the unmodified antisense strand sequences in Table 1C. In some embodiments, the sense strand corresponds to the unmodified sense strand sequences in Table 1C.Synthesis, Purification, and Analysis of the Oligonucleotides Described Herein
[0119] Oligomer synthesis of modified and unmodified nucleosides and nucleotides can be routinely performed according to literature procedures for DNA (Protocols for Oligonucleotides and Analogs, Ed. Agrawal (1993), Humana Press) and / or RNA (Scaringe, Methods (2001), 23, 206-217. Gait el al., Applications of Chemically synthesized RNA in RNA: Protein Interactions, Ed. Smith (1998), 1-36. Gallo et al., Tetrahedron (2001), 57, 5707-5713). The oligonucleotides provided herein can be conveniently and routinely made through the well-known technique of solid phase synthesis. Equipment for such synthesis is sold by several vendors including, for example, LGC (Alexandria, MN). Any other means for such synthesis known in the art may additionally or alternatively be employed. It is well known to use similar techniques to prepare oligonucleotides such as the phosphorothioates and alkylated derivatives. Methods of purification and analysis of oligomeric compounds are known to those skilled in the art. Analysis methods include capillary electrophoresis (CE), reverse-phase high performance liquid chromatography (RP-HPLC), and electrospray-mass spectroscopy (ESI-MS). Such synthesis and analysis methods can be performed in multi-well plates. The oligonucleotides of the invention can be prepared usingsolution -phase or solid- phase organic synthesis, or enzymatically by methods known in the art. Organic synthesis offers the advantage that the oligomeric strands comprising non-natural or modified nucleotides can be easily prepared. Any other means for such synthesis known in the art can additionally or alternatively be employed, It is also known to use similar techniques to prepare other oligonucleotides, such as those comprising phosphorothioates, phosphorodithioates and alkylated derivatives of intemucleoside linkages. The double-stranded oligonucleotides of the invention can be prepared using a two- step procedure. First, the individual strands of the double¬ stranded oligonucleotides are prepared separately. Then, the component strands are annealed. Regardless of the method of synthesis, the oligonucleotides can be prepared in a solution (e.g., an aqueous and / or organic solution) that is appropriate for formulation. For example, the oligonucleotides preparation can be precipitated and redissolved in pure double-distilled water, and lyophilized. The dried oligonucleotides can then be resuspended in a solution appropriate for the intended formulation process. Teachings regarding the synthesis of particular modified oligonucleotides can be found in the following U. S. patents or pending patent applications: U. S. Pat. Nos. 5,138,045 and 5,218,105, drawn to polyamine conjugated oligonucleotides; U. S. Pat, No. 5,212,295, drawn to monomers for the preparation of oligonucleotides having chiral phosphorus linkages; U. S. Pat. Nos. 5,378,825 and 5,541,307, drawn to oligonucleotides having modified backbones; U. S. Pat. No. 5,386,023, drawn to backbone-modified oligonucleotides and the preparation thereof through reductive coupling; U. S. Pat. No. 5,457,191, drawn to modified nucleobases based on the 3-deazapurine ring system and methods of synthesis thereof; U. S. Pat. No. 5,459,255, drawn to modified nucleobases based on N-2 substituted purines; U. S. Pat. No.5,521,302, drawn to processes for preparing oligonucleotides having chiral phosphorus linkages; U. S. Pat. No. 5,539,082, drawn to peptide nucleic acids; U. S. Pat. No. 5,554,746, drawn to oligonucleotides having beta-lactam backbones; U. S. Pat. No. 5,571,902, drawn to methods and materials for the synthesis of oligonucleotides; U. S. Pat. No, 5,578,718, drawn to nucleosides having alkylthio groups, wherein such groups can be used as linkers to other moieties attached at any of a variety of positions of the nucleoside; U. S. Pat. Nos. 5,587,361 and 5,599,797, drawn to oligonucleotides having phosphorothioate linkages of high chiral purity; U. S. Pat. No. 5,506,351, drawn to processes for the preparation of 2'-O-alkyl guanosine and related compounds, including 2,6-diaminopurine compounds; U. S. Pat. No. 5,587,469, drawn to oligonucleotides having N-2 substituted purines; U. S. Pat. No. 5,587,470, drawn to oligonucleotides having 3-deazapurines; U. S. Pat. No. 5,223,168, and U. S. Pat. No. 5,608,046, both drawn to conjugated 4'-desmethyl nucleoside analogs; U. S. Pat. Nos. 5,602,240, and 5,610,289, drawn to backbone-modified oligonucleotide analogs; and U. S. Pat. Nos. 6,262,241, and 5,459,255, drawn to, inter alia.methods of synthesizing 2'-deoxy-2’-fluoro-oligonucleotides. In some embodiments, the oligonucleotides described herein are chemically synthesized using a phosphoramidite approach, e.g., the method by Roy et al. Molecules. 2013; 18(11): 14268-14284; Hayakawa et al. Journal of the American Chemical Society. 1998;120(48): 12395-401; Beaucage, S, L. (1993). Oligodeoxyribonucleotides synthesis: Phosphoramidite approach. In Protocols for Oligonucleotides and Analogs: Synthesis and Properties (pp. 33-61). Humana Press, each of which is hereby incorporated by reference.Pharmaceutical Compositions
[0120] The present disclosure also includes pharmaceutical compositions and formulations comprising the oligonucleotides (e.g., an RNAi agent or ASO) described herein, or a pharmaceutically acceptable salt thereof. In one embodiment, provided herein are pharmaceutical compositions comprising an oligonucleotide (e.g., an RNAi agent or ASO), as described herein, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient. The pharmaceutical compositions comprising the oligonucleotides described herein are useful for treating or preventing a condition or symptoms associated with ACVR2A expression. Such pharmaceutical compositions are formulated based on the mode of delivery. One example is compositions that are formulated for systemic administration via parenteral delivery, e.g., by subcutaneous (SC), intramuscular (IM), or intravenous (IV) delivery. In some embodiments, an oligonucleotide is formulated in buffer solutions such as phosphate-buffered saline solutions, liposomes, micellar structures, and capsids. In some embodiments, naked oligonucleotides or conjugates thereof are formulated in water or in an aqueous solution (e.g., water with pH adjustments). In some embodiments, naked oligonucleotides or conjugates thereof are formulated in basic buffered aqueous solutions (e.g., PBS). The pharmaceutical compositions of the invention may be administered in dosages sufficient to inhibit expression of the target gene.
[0121] A “pharmaceutically acceptable carrier or excipient” is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert vehicle for delivering one or more oligonucleotides to a subject. The excipient can be liquid or solid and is selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with the oligonucleotide and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesiumstearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, com starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents e.g., sodium lauryl sulphate, etc.),
[0122] In some embodiments, the present disclosure also includes a pharmaceutical composition suitable for injectable use, which comprises sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersions. For intravenous or subcutaneous administration, suitable carriers include physiological saline, bacteriostatic water, Cremophor EL® (BASF, Parsippany, N. J.) or phosphate buffered saline (PBS). The carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), and suitable mixtures thereof. In many cases, it will be preferable to include isotonic agents, for example, sugars, polyalcohols such as mannitol, sorbitol, and sodium chloride in the composition. Sterile injectable solutions can be prepared by incorporating the oligonucleotides in a required amount in a selected solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
[0123] Formulations for topical administration of oligonucleotides can include sterile and non- sterile aqueous solutions, non-aqueous solutions in common solvents such as alcohols, or solutions of the oligonucleotides in liquid or solid oil bases. The solutions can also contain buffers, diluents and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non-parenteral administration which do not deleteriously react with nucleic acids can also be used to formulate the compositions of the present disclosure. Suitable pharmaceutically acceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone and the like,
[0124] In some embodiments, the oligonucleotides herein are conjugated to one or more non- nucleotide groups including, but not limited to, a targeting group / targeting moiety, linking group, delivery polymer, or a delivery vehicle. The non-nucleotide group can enhance targeting, delivery, or attachment of the oligonucleotide.
[0125] In some embodiments, at least one nucleotide of the oligonucleotide herein is conjugated to one or more targeting ligands, such as a carbohydrate, amino sugar, cholesterol, polypeptide, or lipid. Exemplary targeting ligands include, but are not limited to, thyrotropin, melanotropin, lectin, a glycoprotein, surfactant protein A, mucin carbohydrate, a multivalent lactose moiety, a multivalent galactose moiety, a N -acetylgalactosamine (GalNAc) moiety, a N-acetyl-glucosamine moiety, a multivalent mannose moiety, a multivalent fucose moiety, a glycosylated polypeptide, transferrin or an antibody, antibody fragment, protein, peptide, or aptamer capable of binding the transferrin receptor, bisphosphonate, polyglutamate, polyaspartate, cholesterol, bile acid, folate, vitamin B12, biotin, an RGD peptide, or an RGD peptide mimetic. In some embodiments, the targeting ligand comprises a N-acetylgalactosamine (GalNAc) moiety. In some embodiments, the GalNAc moiety comprises a monovalent GalNAc moiety, a bivalent GalNAc moiety, a tri valent GalNAc moiety, or a tetravalent GalNAc moiety.
[0126] The non-nucleotide group can be covalently linked to the 3' and / or 5' end of either the antisense strand and / or the sense strand, when present. In some embodiments, when the oligonucleotide is an RNAi agent, the RNAi agent contains a non-nucleotide group linked to the 3' and / or 5' end of the sense strand. In some embodiments, a non-nucleotide group is linked to the 5' end of an ACVR2A RNAi agent sense strand. A non-nucleotide group may be linked directly or indirectly to the oligonucleotide via a linker / linking group, in some embodiments, a non- nucleotide group is linked to the oligonucleotide via a labile, cleavable, or reversible bond or linker.
[0127] In some embodiments, the targeting moiety is a targeting ligand. In some embodiments, the targeting ligand is small molecule-based, sugar-based (e.g., saccharide-based), fatty acid-based, protein-based, or nucleic acid-based targeting ligand. In some embodiments, the targeting moiety is a protein-based targeting ligand. In some embodiments, the protein-based targeting ligand is an antibody, nanobody, affibody, a peptibody, or a peptide. In some embodiments, the protein-based targeting ligand is an antibody, a functional fragment thereof, or an antigen-binding fragment thereof.
[0128] Various formulations have been developed to facilitate oligonucleotide use. For example, oligonucleotides can be delivered to a subject or a cellular environment using a formulation that minimizes degradation, facilitates delivery' and / or uptake, or provides another beneficial property to the oligonucleotides in the formulation. In some embodiments, an oligonucleotide herein is formulated in buffer solutions such as phosphate buffered saline solutions, liposomes, micellar structures and capsids. Formulations of oligonucleotides with cationic lipids can be used to facilitate transfection of the oligonucleotides into cells. For example, cationic lipids, such as lipofectin, cationic glycerol derivatives, and polycationic molecules (e.g., polylysine), can be used. Suitable lipids include Oligofectamine, Lipofectamine (Life Technologies), NC388 (Ribozyme Pharmaceuticals, Inc., Boulder, Colo.), or FuGene 6 (Roche), all of which can be used according to the manufacturer's instructions. Accordingly, in some embodiments, a formulation herein comprises a lipid nanoparticle. In some embodiments, anexcipient comprises a liposome, a lipid, a lipid complex, a microsphere, a microparticle, a nanosphere or a nanoparticle, or may be otherwise formulated for administration to the cells, tissues, organs, or body of a subject in need thereof (see, e.g., Remington: THE SCIENCE AND PRACTICE OF PHARMACY, 22nd edition, Pharmaceutical Press, 2013). In some embodiments, the formulations herein comprise an excipient. In some embodiments, an excipient confers to a composition improved stability, improved absorption, improved solubility and / or therapeutic enhancement of the active ingredient. In some embodiments, an excipient is a buffering agent (e.g., sodium citrate, sodium phosphate, a tris base, or sodium hydroxide) or a vehicle (e.g., a buffered solution, petrolatum, dimethylsulfoxide or mineral oil). In some embodiments, an oligonucleotide is lyophilized for extending its shelf-life and then made into a solution before use (e.g., administration to a subject). Accordingly, an excipient in a composition comprising any one of the oligonucleotides described herein may be a lyoprotectant (e.g., mannitol, lactose, polyethylene glycol or polyvinylpyrrolidone) or a collapse temperature modifier (e.g., dextran, Ficoll® or gelatin).Methods of Treatment
[0129] The present disclosure also provides methods of using any one of the oligonucleotides disclosed herein, or a pharmaceutically acceptable salt thereof, or any one of the pharmaceutical compositions as described herein to reduce or inhibit ACVR2A expression in a subject. The methods include contacting one or more cells in a subject with an oligonucleotide of the disclosure, or a pharmaceutically acceptable salt thereof, or any one of the pharmaceutical compositions as described herein thereby inhibiting expression of ACVR2A in the cells. The present disclosure also provides use of any one of the oligonucleotides disclosed herein, or a pharmaceutically acceptable salt thereof, or any one of the pharmaceutical compositions as described herein, in the manufacture of a medicament for reducing or inhibiting ACVR2A expression in a subject, or for preventing or treating an ACVR2A related disorder in a subject. In some embodiments, the terms “'inhibiting ACVR2A expression” and “reducing ACVR2A expression” are interchangeable.
[0130] Reduction in ACVR2A expression can be assessed by any methods known in the art. For example, a reduction in the expression of ACVR2A may be determined by determining the mRNA expression level of ACVR2A using methods routine to one of ordinary skill in the art, e.g., northern blotting, qRT-PCR; by determining the protein level of ACVR2A using methods routine to one of ordinary skill in the art, such as western blotting, immunological techniques. In some embodiments, the reduction of ACVR2A expression is determined by measuring ACVR2Aexpression in a population of cardiomyocytes or muscle cells derived from the subject. In some embodiments, the reduction of ACVR2A expression is determined by measuring ACVR2A expression in a tissue (e.g., myocardium tissue or muscle tissue) derived from the subject. In some embodiments, the reduction of ACVR2A expression is determined by measuring expression of ACVR2A biomarkers (e.g., activin A, lactate) in serum derived from tire subject.|00131| Tire present disclosure further provides methods of treatment of a subject in need thereof. The methods of treatment include administering an oligonucleotide of the disclosure to a subject, e.g., a subject that would benefit from inhibition of ACVR2A expression, in a therapeutically effective amount of an oligonucleotide targeting an ACVR2A gene or a pharmaceutical composition comprising an oligonucleotide targeting an ACVR2A gene. In some embodiments, a method of the present di sclosure comprises administering an oligonucleotide of the disclosure to a subject that would benefit for inhibition of ACVR2A expression or that suffers from a disease or disorder that involves aberrant activin / SMAD signaling relative to a healthy patient. In some embodiments, a method of the present disclosure comprises administering an oligonucleotide of the disclosure to a subject that would benefit for inhibition of ACVR2A expression or that suffers from a metabolic disorder (e.g., obesity) or disease involving muscular atrophy.
[0132] In some embodiments, the present disclosure provides a method of treating obesity in a subject in need thereof, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0133] In some embodiments, the present disclosure provides a method of preserving or increasing muscle mass in a subject in need of treatment for weight loss, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0134] In some embodiments, the present disclosure provides a method of preserving or increasing muscle mass in a subject in need of treatment for reduction of excess body weight or for maintenance of weight reduction, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0135] In some embodiments, the present disclosure provides a method of preserving or increasing muscle mass in a subject in need of treatment for type 2 diabetes, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceuticallyacceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0136] In some embodiments, the present disclosure provides a method of inhibiting ACVR2A expression in a subject experiencing weight loss, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0137] In some embodiments, the present disclosure provides a method of inhibiting ACVR2A expression in a subject with spinal muscular atrophy (SMA), the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0138] In some embodiments, the present disclosure provides a method of inhibiting ACVR2A expression in a subject with obesity, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0139] In some embodiments, the present disclosure provides a method of inhibiting ACVR2A expression in a subject with cachexia, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0140] In some embodiments, the present disclosure provides a method of inhibiting ACVR2 expression in a subject with muscle wasting, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0141] In some embodiments, the present disclosure provides a method of inhibiting ACVR2A expression in a subject with antiandrogen induced muscle loss, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0142] In some embodiments, the present disclosure provides a method of inhibiting ACVR2A expression in a subject with glucocorticoid-induced muscle loss, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceuticallyacceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0143] In some embodiments, the present disclosure provides a method of inhibiting ACVR2A expression in a subject with chronic kidney disease-associated muscle loss, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0144] In some embodiments, the present disclosure provides a method of inhibiting ACVR2A expression in a subject with cast or immobilization associated muscle loss, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0145] In some embodiments, the present disclosure provides a method of inhibiting ACVR2A expression in a subject with cancer associated muscle loss, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0146] In some embodiments, the present disclosure provides a method of inhibiting ACVR2A expression in a subject with heart-failure associated muscle loss, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject,
[0147] In some embodiments, the present disclosure provides a method of preserving muscle mass in a subject in need thereof, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0148] In some embodiments, the present disclosure provides a method of increasing muscle mass in a subject in need thereof, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0149] In some embodiments, the present disclosure provides a method of increasing muscle strength in a subject in need thereof, the method comprising administering an effective amount of an oligonucleotide described herein, or a pharmaceutically acceptable salt thereof, or a pharmaceutical composition comprising an oligonucleotide described herein to the subject.
[0150] The in vivo methods of the disclosure may include administering to a subject a composition containing an oligonucleotide disclosed herein, or a pharmaceutically acceptable salt, wherein the oligonucleotide includes a nucleotide sequence that is complementary to at least a part of a sequence of nucleotides encoding ACVR2 A of the subject to be treated.
[0151] The oligonucleotide can be administered by any means known in the art including, but not limited to oral, intraperitoneal, or parenteral routes, including intracranial (e.g., intraventricular, intraparenchymal, and intrathecal), intravenous, intramuscular, intravitreal, subcutaneous, transdermal, airway (aerosol), nasal, rectal, and topical (including buccal and sublingual) administration. In certain embodiments, the compositions are administered by intravenous infusion or injection. In certain embodiments, the compositions are administered by subcutaneous injection. In certain embodiments, the compositions are administered by intrathecal injection. Tire administration of the oligonucleotide may be repeated over a period of time. Tire administration may be repeated on a regular basis. In some embodiments, after an initial treatment regimen, the treatments can be administered on a less frequent basis. A repeat-dose regimen may include administration of a therapeutic amount of an oligonucleotide on a regular basis,
[0152] An oligonucleotide of the disclosure may be administered as a “free oligonucleotide.” A free oligonucleotide is administered in the absence of a pharmaceutical composition. In some embodiments, a free oligonucleotide is administered in the absence of a transfection agent. Tire naked oligonucleotide may be in a suitable buffer solution. The buffer solution may comprise acetate, citrate, prolamine, carbonate, or phosphate, or any combination thereof. In one embodiment, the buffer solution is phosphate buffered saline (PBS), The pH and osmolarity of the buffer solution containing the oligonucleotide can be adjusted such that it is suitable for administering to a subject. Alternatively, an RNAi agent of the disclosure may be administered as a pharmaceutical composition, such as a dsRNA liposomal formulation.
[0153] The present disclosure also provides methods of using any one of the oligonucleotides disclosed herein, or a pharmaceutically acceptable salt thereof, to treat or prevent an ACVR2A-related disorder in a subject. Non-limiting examples of ACVR2A related disorders include obesity, including sarcopenic obesity; sarcopenia; type 2 diabetes; fibrodysplasia ossificans progressiva; and muscle wasting diseases, such as cachexia (muscle wasting disorder associated with cancer or chronic illnesses), muscular dystrophy, muscle atrophy, spinal muscular atrophy (SMA), amyotrophic lateral sclerosis (ALS), sporadic inclusion body myositis; and muscle loss, such as antiandrogen induced muscle loss, glucocorticoid induced muscle loss, chronic kidney disease associated muscle loss, cast associated muscle loss, cancer associated muscle loss, immobilization associated muscle loss, and heart failure associated muscle loss.
[0154] In some embodiments, the present disclosure provides a method of treating obesity, comprising administering an oligonucleotide disclosed herein, or a pharmaceutically acceptable salt thereof, to a subject in need thereof.
[0155] In some embodiments, an ACVR2A related disorder is a muscle wasting disease. Non-limiting examples of a muscle wasting disease include muscular dystrophy, amyotrophic lateral sclerosis (ALS), and cachexia (muscle wasting disorder associated with cancer or chronic illnesses). In some embodiments, a muscle wasting disease is muscle atrophy, or spinal muscular atrophy (SMA).
[0156] In some embodiments, an oligonucleotide disclosed herein, or a pharmaceutically acceptable salt, promotes muscle growth and prevents atrophy. In some embodiments, an oligonucleotide disclosed herein, or a pharmaceutically acceptable salt, slows or reverses muscle degeneration. In some embodiments, the present disclosure provides a method of using any one of the oligonucleotides disclosed herein, or a pharmaceutically acceptable salt thereof, to treat or prevent muscle atrophy, e.g., while wearing an orthopedic cast.
[0157] In some embodiments, cachexia is a complex metabolic syndrome characterized by severe muscle wasting and weight loss. In some embodiments, the present disclosure provides a method of using any one of the oligonucleotides disclosed herein, or a pharmaceutically acceptable salt thereof, to treat or prevent cachexia in a subject.
[0158] In some embodiments, sarcopenia is an age-related loss of muscle mass and function. In some embodiments, the present disclosure provides a method of using any one of the oligonucleotides disclosed herein, or a pharmaceutically acceptable salt thereof, to treat or prevent sarcopenia,
[0159] In some embodiments, an ACVR2A related disorder is Fibrodysplasia Ossificans Progressiva. In some embodiments, an ACVR2A related disorder is heterotaxy.
[0160] In some embodiments, the present disclosure provides a method of using any one of the oligonucleotides disclosed herein, or a pharmaceutically acceptable salt thereof, to treat or prevent sarcopenic obesity.
[0161] In some embodiments, the present disclosure provides a method of using any one of the oligonucleotides disclosed herein, or a pharmaceutically acceptable salt thereof, to treat or prevent muscle waste-associated disorders.
[0162] In some embodiments, the present disclosure provides a method of using any one of the oligonucleotides disclosed herein, or a pharmaceutically acceptable salt thereof, to treat or prevent sporadic inclusion body myositis.
[0163] In some embodiments, the present disclosure provides a method of using any one of the oligonucleotides disclosed herein, or a pharmaceutically acceptable salt thereof, to treat or prevent muscle waste, e.g., after a broken hip.
[0164] In some embodiments, the methods herein may further comprise administering to the subject an additional agent or therapy suitable for treatment or prevention of an ACVR2A related disorder. Non-limiting examples of such additional agents or therapies include anti-ACVR2A antibodies, anti-ACVR2B antibodies, anti-Myostatin antibodies, and anti-Activin A antibodies.
[0165] The term "‘about” as used herein refers to the usual error range for the respective value readily known to the skilled person in this technical field. Reference to “about” a value or parameter herein includes (and describes) embodiments that are directed to that value or parameter per se.
[0166] As used herein, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. For example, “a” or “an” means “at least one” or “one or more,”
[0167] Unless defined otherwise, all terms of art, notations and other technical and scientific terms or terminology used herein are intended to have the same meaning as is commonly understood by one of ordinary skill in the art to which the claimed subject matter pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and / or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. All publications, including patent documents, scientific articles and databases, referred to in this application are incorporated by reference in their entirety for all purposes to the same extent as if each individual publication were individually incorporated by reference. If a definition set forth herein is contrary to or otherwise inconsistent with a definition set forth in the patents, applications, published applications and other publications that are herein incorporated by reference, the definition set forth herein prevails over the definition that is incorporated herein by reference.
[0168] Hie section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.Exemplary Embodiments:I. An oligonucleotide for inhibiting expression of ACVR2A, wherein the oligonucleotide comprises an antisense strand comprising at least 14 contiguous nucleotides substantiallycomplementary to a sequence of nucleotides encoding ACVR2A, with no more than 4 mismatched nucleotides.The oligonucleotide of Embodiment 1, wherein the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 90% nucleotide sequence identity to any one of SEQ ID NOs: 1309-1311.The oligonucleotide of Embodiment 1 or 2, wherein the oligonucleotide targets a sequence of nucleotides corresponding to positions of SEQ ID NO: 1309, SEQ ID NO: 1310, or SEQ ID NO: 1311 selected from those described in the specification.The oligonucleotide of any one of Embodiments 1-3, wherein the antisense strand is substantially or completely complementary to a sequence of nucleotides corresponding to an untranslated region of the ACVR2A transcript.The oligonucleotide of any one of Embodiments 1-4, wherein the oligonucleotide is an RNAi agent.The oligonucleotide of Embodiment 5, wherein the RNAi agent is a double stranded small interfering RNA, a short hairpin RNA, or a Dicer-substrate siRNA (DsiRNA).The oligonucleotide of Embodiment 6, wherein the oligonucleotide is a double-stranded small interfering RNA (siRN A) further comprising a sense strand, wherein the sense strand and antisense strand form a double stranded region.The oligonucleotide of any one of Embodiments 1-7, wherein the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4, 3, 2, or 1 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105, or a nucleotide sequence having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105.The oligonucleotide of any one of Embodiments 1-8, wherein the antisense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105.The oligonucleotide of any one of Embodiments 7-9, wherein the sense strand comprises a nucleotide sequence differing by no more than 4, 3, 2, or 1 nucleotides from the nucleotide sequence ofany one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640 ora nucleotide sequence having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640.The oligonucleotide of any one of Embodiments 7-10, wherein the sense strand composes the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640.The oligonucleotide of any one of Embodiments 7-11, wherein the antisense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641-3105 and the sense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640.Tire oligonucleotide of any one of Embodiments 7-12, wherein each strand is no more than 30 nucleotides in length, or 19-30 nucleotides in length, or 19-23 nucleotides in length, or 19-21 nucleotides in length.The oligonucleotide of any one of Embodiments 7-13, wherein at least one strand comprises a 3’ overhang of at least 1 nucleotide, or at least 2 nucleotides.Tire oligonucleotide of any one of Embodiments 7-14, wherein at least one strand comprises a 5’ overhang of at least 1 nucleotide, or at least 2 nucleotides.The oligonucleotide of any one of Embodiments 7-15, wherein the double stranded region is 15-30 nucleotide pairs in length, or 15-23 nucleotide pairs in length, or 17-25 nucleotide pairs in length, or 19-23 nucleotide pairs in length, or 19-21 nucleotide pairs in length.The oligonucleotide of any one of Embodiments 7-16, wherein the antisense strand is 21 nucleotides in length and the sense strand is 19 nucleotides in length.The oligonucleotide of any one of Embodiments 1-4, wherein the oligonucleotide is a singlestranded antisense oligonucleotide (ASO).The oligonucleotide of Embodiment 18, wherein the ASO comprises a nucleic acid sequence comprising at least 14 contiguous nucleotides (for example, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) that differ by no more than 1, 2, 3, or 4 nucleotides from any one of SEQ ID NOs: 328-654 or 1755-2197.The oligonucleotide of Embodiment 18 or 19, wherein the ASO comprises a nucleic acid sequence comprising at least 14 contiguous nucleotides (for example, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) that differ by no more than 1, 2, 3 or 4 nucleotides from any one of SEQ ID NOs: 982-1308 or 2641-3105.The oligonucleotide of any one of Embodiments 1-20, wherein the oligonucleotide comprises one or more modifications.The oligonucleotide of Embodiment 21, wherein the one or more modifications is selected from a ribose modification, a backbone modification, a nucleobase modification, or a combination thereof.The oligonucleotide of Embodiment 22, wherein the ribose modification comprises a locked nucleic acid (LNA), a tricyclo-DNA (tcDNA), 2'-deoxy-2'-fluoro, 2'-O-methyl, 2'-methoxyethyl (2'-M0E), 2'-deoxy-2'-arabino-fhioro, 2'-O-benzyl, 2'-O-methyl-4-pyridine, 2' cyclic ethyl (cET), phosphorodiamidate morpholino (PMO), glycol nucleic acid (GNA), unlocked nucleic acid (UN A), or a combination thereof.Tire oligonucleotide of Embodiment 23, wherein the ribose modification comprises a 2'- deoxy-2'-fluoro, 2'-O-methyl, glycol nucleic acid (GNA), unlocked nucleic acid (UNA), a threose nucleic acid (TNA), or a combination thereof.The oligonucleotide of Embodiment 23 or 24, wherein the ribose modification is a 2'-deoxy-2'-fluoro, 2'-O-methyl modification, or a combination thereof.The oligonucleotide of any one of Embodiments 22-25, wherein the backbone modification comprises phosphorothioate, phosphorodithioate, methylphosphonate, methyoxypropyl-phosphonate, 5'-(E)-vinylphosphonate, 5'-methyl phosphonate, 5'-methylphosphate, 5'-phosphorothioate, peptide nucleic acid (PNA), or a combination thereof.The oligonucleotide of Embodiment 26, wherein the backbone modification comprises a phosphorothioate.The oligonucleotide of any one of Embodiments 22-27, wherein the backbone modification comprises a phosphorothioate modification.Tire oligonucleotide of any one of Embodiments 22-28, wherein the nucleobase modification comprises 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, 5 -methylcytosine (5-Me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, N6-alkyl derivatives, N2-alkyl, 2 -thiouracil, 2-thiothymine, 2-thiocytosine, 5-halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6- azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxy, 5-halo, 5 -trifluoromethyl, N7-methylguanine, N7-methyladenine, 8-azaguanine, 8-azaadenine, 7 -deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, or any combination thereof.The oligonucleotide of Embodiment 29, wherein the oligonucleotide compri ses at least one modified nucleotide selected from the group consisting of a deoxy nucleotide, a 3 ’-terminal deoxythymidine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a 2’-5 ’-linked ribonucleotide (3’-RNA), a locked nucleotide, an unlocked nucleotide, a conformation ally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2’-O-allyl-modified nucleotide, 2’-C-alkyl-modified nucleotide, 2’-hydroxyl-modified nucleotide, a 2’-O-(methoxy ethyl) modified nucleotide, a 2 ’-O-alkyl -modified nucleotide, a morpholino nucleotide, a phosphoramidate morpholino, anon-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, acyclohexenyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a nucleotide comprising a 5'-methylphosphonate group, a nucleotide comprising a 5'- methylphosphate group, a nucleotide comprising a 5 ’ phosphate or 5 ’ phosphate mimic, a nucleotide comprising vinyl phosphonate, a glycol nucleic acid (GNA), a glycol nucleic acid S-Isomer (S-GNA), a nucleotide comprising 2-hydroxymethyl-tetrahydrofurane-5-phosphate, a nucleotide comprising 2’-deoxythymidine-3 ’phosphate, a nucleotide comprising 2’-deoxyguanosine-3 ’-phosphate; a cytidine-2'-phosphate, a guanosine-2'-phosphate, a uridine-2'-phosphate, an adenosine-2'-phosphate, a 2'-O-hexadecyI-adenosine-3'-phosphaie, a 2'-O- hexadecyl-cytidine-3'-phosphate, a 2'-O-hexadecyl-guanosine-3'-phosphate, and a 2'-O-hexadecyl-uridine-3’-phosphate, a 3'-3' inverted nucleotide linkage, a 5 ’-5’ inverted nucleotide linkage, INA, and combinations thereof.The oligonucleotide of Embodiment 30, wherein the oligonucleotide comprises a modified nucleotide selected from the group consisting of a deoxy nucleotide, a 3 ’-terminal deoxythymidine (dT) nucleotide, a 3' -3' inverted nucleotide linkage, a 5 ’-5’ inverted nucleotide linkage, a 5'-(E)-vinylphosphonate-2’-O-methyl-uridine-3’-phosphate, and a combination thereof.The oligonucleotide of Embodiment 30 or 31, wherein the oligonucleotide comprises 5'-(E)~ v inylphosphonate -2 ’ -O-methyl-uridine -3 ’ -phosphate.The oligonucleotide of Embodiment 21, wherein at least one of the modifications is a thermally destabilizing nucleotide modification.The oligonucleotide of Embodiment 33, wherein the thermally destabilizing nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in the duplex; destabilizing sugar modification, a 2’-deoxy modification, an acyclic nucleotide, an unlocked nucleic acids (UNA); a glycerol nucleic acid (GNA), and a combination thereof,The oligonucleotide of Embodiment 31, wherein the modification comprises a short sequence of 3 ’-terminal deoxythymidine nucleotide (dT).The oligonucleotide of any one of Embodiments 21-35, wherein the modifications on the nucleotides are 2,-O-methyl and 2’deoxy-2’-fluoro modifications.The oligonucleotide of any one of Embodiments 21-36, wherein the oligonucleotide comprises at least one phosphorothioate intemucleoside or phosphorodithioate internucleoside linkage.Tire oligonucleotide of Embodiment 37, wherein the oligonucleotide comprises 6-8 phosphorothioate internucleoside linkages.The oligonucleotide of Embodiments 37 or 38, wherein the oligonucleotide comprises at least 1, or at least 2, phosphorothioate intemucleoside linkage at a 5’ end of the sense strand.The oligonucleotide of any one of Embodiments 37-39, wherein the oligonucleotide comprises at least 1 phosphorothioate intemucleoside linkage at a 3’ end of the sense strand,The oligonucleotide of any one of Embodiments 37-40, wherein the oligonucleotide comprises at least 1, or at least 2, phosphorothioate intemucleoside linkage at a 5’ end of the antisense strand.The oligonucleotide of any one of Embodiments 37-41, wherein the oligonucleotide comprises at least 1 phosphorothioate intemucleoside linkage at a 3’ end of the antisense strand.The oligonucleotide of any one of Embodiments 21-42, wherein no more than five of the nucleotides of the antisense strand are unmodified nucleotides.The oligonucleotide of any one of Embodiments 21-43, wherein all the nucleotides of the antisense strand are modified oligonucleotides.The oligonucleotide of any one of Embodiments 21-44, wherein no more than five of the nucleotides of the sense strand are unmodified nucleotides.The oligonucleotide of any one of Embodiments 21-45, wherein all the nucleotides of the sense strand are modified nucleotides.The oligonucleotide of any one of Embodiments 7-46, wherein the antisense strand comprises a chemical modification pattern according to (Nfs)a(nNf)b(ns)cn, wherein: n is a 2'-O-methyl-nucleoside-3 ’-phosphate;Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphorothioate;Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphate;ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate;a is at least 1;b is 5-10; andc is at least 1.The oligonucleotide of Embodiment 47, wherein the antisense strand comprises a chemical modification pattern NfsNfsnNfnNfnNfnNfnNfnNfnNfnNfnsnsn,The oligonucleotide of any one of Embodiments 7-48, wherein the sense strand comprises a chemical modification pattern according to (ns)d(Nfn)eNf, wherein:n is a 2’-O-methyl-nucleoside-3 ’-phosphate;Nf is a 2’-deoxy-2'-fluoro-nucleoside-3’-phosphate;ns is a 2’-O-methyl-nucleoside-3’-phosphorothioate;d is at least 1; ande is 5-10.The oligonucleotide of Embodiment 49, wherein the sense strand comprises the chemical modification pattern nsnsNfnNfnNfnNfnNfnNfnNfnNfnNf.The oligonucleotide of any one of Embodiments 7-50, wherein each of the antisense and the sense strand is independently 17-23 nucleotides in length, wherein the antisense strand comprises the motif F(SF)nSnn, wherein n is from 2 to about 20, nn is 0 or 1, one of F and S is a 2'-deoxy-2’-fluoro modified nucleoside and the other of F and S is a 2'-O-methyl modified nucleoside.The oligonucleotide of any one of Embodiments 7-51, wherein the antisense strand comprises the chemical modification pattern of nNfnnnNfnNfNfnnnnNfnNfnnnnn and the sense strand comprises the chemical modification nnnnnNfnNfNfNfnnnnnnnn, wherein n is a 2’-O-methyl-nucleoside and Nf is a 2’-deoxy-2’-fluoro-nucleoside,The oligonucleotide of any one of Embodiments 7-52, wherein each of the antisense and the sense strand is independently 20-23 nucleotides in length, wherein the antisense strand comprises a region having the formula XI -Y-X2, wherein Y is a subregion of from about 5 to about 12 linked nucleosides and each of XI subregion and X2 subregion is, independently, a plurality of linked nucleosides having the formula FSFS, where one of F and S is a 2'-deoxy-2' -fluoro modified nucleoside and the other of F and S is a 2'-O-methyl modified nucleoside; and each intemucleoside linkage of said XI subregion and X2 subregion is, independently, a phosphodiester or a phosphorothioate intemucleoside linkage.Tire oligonucleotide of any one of Embodiments 7-53, wherein each of the antisense and the sense strand is independently 17-23 nucleotides in length, wherein the antisense strand comprises a contiguous sequence of linked nucleosides that define an alternating motif of the formula:5 '-Q(-L-Z-L-Q)n(-L-Z)nn-3'wherein:each L is an intemucleoside linking group;either each Q is a 2'-deoxy-2’-fluoro-nucleoside and each Z is a 2'-O-methyl nucleoside; or each Q is a 2'-O-methyl nucleoside and each Z is a 2'-deoxy-2’-fluoro nucleoside; and n is from 8 to 14 and nn is 0 or 1.The oligonucleotide of any one of Embodiments 7-54, wherein the antisense strand is 19-25 nucleotides in length and is represented by the formula:wherein:Bl', B2', B3', and B4' each independently represent a nucleotide containing a modification selected from the group consisting of 2'-O-alkyl, 2 '-substituted alkoxy, 2'-substituted alkyl, 2'-halo, ENA, and BNA / LNA;Tl', T2', and T3' each independently represent a nucleotide comprising a chemical modification selected from the group consisting of DNA, RNA, LNA, 2'-deoxy-2'-fluoro, and 5'-methyl-2'-deoxy-2’-fluoro nucleotides;ql is 4 to 15 nucleotides in length;q3 or q7 is independently 1-6 nucleotide(s) in length;q2 or q6 is independently 1-3 nucleotide(s) in length;q4 is 0-3 nucleotide(s) in length; andq5 is 0-10 nucleotide(s) in length; andwherein:the antisense strand has 2'-deoxy-2’ -fluoro modifications, and wherein tire 2'-deoxy - 2’-fluoro modifications on the antisense strand consist of four, and only four, 2'-deoxy-2’-fluoro modifications or six, and only six, 2'-deoxy-2’-fluoro modifications.Hie oligonucleotide of any one of Embodiments 7-55, wherein the antisense strand and sense strand are each 14 to 40 nucleotides, and are represented by the formula:CIwherein:Bl, Bl', B2', B3', and B4' each independently represent a nucleotide containing a modification selected from the group consisting of 2'-O-alkyl, 2'-substituted alkoxy, 2'- substituted alkyl, 2'-halo, ENA, and BNA / LNA;C 1 is a thermally destabilizing nucleotide, selected from the group consisting of i) a nucleotide that forms a mismatch pair with the opposing nucleotide in the antisense strand, ii) a nucleotide having an abasic modification, and iii) a nucleotide having a sugar modification, and placed at a site opposite to the seed region (positions 2-8 ) of the antisense strand;T1', T2', and T3' each independently represent a nucleotide comprising a modification providing the nucleotide a steric bulk that is less than or equal to the steric bulkof a 2'-0Me modification, wherein the modification is at the 2'-position of a ribose sugar of the nucleotide or at a position of a non-ribose nucleotide similar to the 2'-position of a ribose sugar;each nl, and ql is independently 4 to 15 nucleotides in length;each q3, and q7 is independently 1-6 nucleotide(s) in length;each q2 and q6 is independently 1-3 nucleotide(s) in length;q5 is 0-10 nucleotide(s) in length;each n4, and q4 is independently 0-3 nucleotide(s) in length;n2 is 3 nucleotides in length, and T1 each are 2'-deoxy-2’-fluoro nucleotides; n3 is 7 nucleotides in length, and B2 each are 2'-OMe nucleotides; andn5 is 3 nucleotides in length, and B3 each are 2'-0Me nucleotides.The oligonucleotide of any one of Embodiments 7-56, wherein the antisense strand and sense strand are each 19-25 nucleotides in length, wherein tire antisense strand is represented by the formula:(Is)wherein:B1, B2, and B3 each independently represent a nucleotide containing a modification selected from the group consisting of 2'-O-alkyl, 2'-substituted alkoxy, 2'-substituted alkyl, 2'-halo, ENA, and BNA / LNA;Cl is a thermally destabilizing nucleotide, selected from the group consisting of i) a nucleotide that forms a mismatch pair with the opposing nucleotide in the antisense strand, ii) a nucleotide having an abasic modification, and iii) a nucleotide having a sugar modification, and placed at a site opposite to the seed region (positions 2-8) of the antisense strand;T1 represents a nucleotide comprising a 2'-deoxy-2’-fluoro modification;nl or n3 is independently 4 to 15 nucleotides in length;n5 is 1-6 nucleotide(s) in length;n2 is 3;n4 is 0-3 nucleotide(s) in length; andwherein the sense strand has 2 '-deoxy-2’ -fluoro modifications, and wherein the 2'- deoxy-2’ -fluoro modifications on the sense strand consist of four, and only four, 2'-deoxy-2’-fluoro modifications, wherein the four 2'-deoxy-2’-fluoro modifications are at positions 7 and 9-11 from the 5 '-end of the sense strand., The oligonucleotide of any one of Embodiments 7-57, wherein the antisense strand is complementary to at least one portion of a mRNA of the target gene (e.g., ACVR2A), wherein:the sense strand comprises 19-22 nucleotides,the antisense strand comprises 19-25 nucleotides; andthe oligonucleotide is represented by the formula:3' ywherein:Bl', B2', B3', and B4' each independently represent a nucleotide containing a modification selected from the group consisting of 2'-O-methyl and 2'-deoxy-2’ -fluoro;each Bl, B2, and B3 is 2'-O-methyl nucleotide;Cl is glycerol nucleic acid (GNA) placed at a site opposite to the seed region (positions 2-8) of the antisense strand;Tl', T2', and T3' are each 2'-F, wherein:Tl' is at position 14 from the 5' end of the antisense strand, and q2 is 1; and T3' is at position 2 from tire 5' end of the antisense strand, and q6 and q7 are 1; each nl, n3, and ql is independently 4 to 15 nucleotides in length;each n5 and q3 is independently 1-6 nucleotide(s) in length;q5 is 0-10 nucleotide(s) in length;each n4 and q4 is independently 0-3 nucleotide(s) in length;n2 is 3 nucleotides in length, and Tl each are 2'-deoxy-2’-fluoro nucleotides, wherein(a) the oligonucleotide is covalently conjugated to at least one ligand; and (b) one of the Tl nucleotides is at position 11 from the 5' end of the sense strand.. Tire oligonucleotide of any one of Embodiments 7-58, wherein the sense strand comprises 19-22 nucleotides, the antisense strand comprises 19-25 nucleotides; and the oligonucleotide is represented by the formula:illq'wherein:Bl', B2', B3', and B4' each independently represent a nucleotide containing a modification selected from the group consisting of 2'-O-methyl and 2'-deoxy-2’ -fluoro; each B1, B2, and B3 is 2'-OMe;Cl is glycerol nucleic acid (GNA) placed at a site opposite to the seed region (positions 2-8) of the antisense strand;IT, T2', and T3' are each 2'-deoxy-2’-fluoro, wherein:IT is at position 14 from the 5' end of the antisense strand, and q2 is 1; and T3' is at position 2 from the 5' end of the antisense strand, and q6 and q7 are 1; each nl, n3, and ql is independently 4 to 15 nucleotides in length;each n5 and q3 is independently 1-6 nucleotide(s) in length;q5 is 0-10 nucleotide(s) in length;each n4 and q4 is independently 0-3 nucleotide(s) in length;n2 is 3 nucleotides in length, and T1 each is 2'-deoxy-2’ -fluoro, andwherein(a) the oligonucleotide is covalently conjugated to at least one ligand;(b) one of the T1 nucleotides is at a position in the sense strand that is opposite to position 11 from the 5' end of the antisense strand; and(c) the oligonucleotide comprises at least one phosphorothioate intemucleoside linkage., The oligonucleotide of any one of Embodiments 7-59, wherein the antisense strand and sense strand are each 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to a target sequence to mediate RNA interference, wherein said sense strandcomprises at least one thermally destabilizing modification of the duplex within the first 9 nucleotide positions of the 5' region of the antisense strand or a precursor thereof, wherein the antisense strand further comprises one or both of the following characteristics:(i) 2, 3, 4, 5 or 6 2'-deoxy-2’ -fluoro modifications; and(ii) 1, 2, 3, 4 or 5 phosphorothioate intemucleoside linkages; andsaid sense strand comprises one or both of the following characteristics:(iii) 2, 3, 4, or 5 2'-deoxy-2’-fluoro modifications; and(iv) 1, 2, 3, 4 or 5 phosphorothioate internucleoside linkages.The oligonucleotide of any one of Embodiments 7-46, wherein the antisense strand comprises a modification pattern nsNfsnnnNfnNfNfnnnnNfnNfnnsnsn, wherein ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucIeoside-3'- phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3 '-phosphate.Tire oligonucleotide of any one of Embodiments 7-46, wherein the antisense strand disclosed herein comprises a modification pattern vpUsNfsnnnNfnNfNfnnnnNfnNfnnnsnsn, wherein vpUs is a 5'-vinylphosphonate-2'-O-methyl-uridine-3 ’-phosphorothioate; ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'- phosphate.Tire oligonucleotide of any one of Embodiments 7-46, wherein the sense strand disclosed herein comprises a modification pattern nsnsnnNfnNfNfNfnnnnnnnnnn, wherein ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphate.The oligonucleotide of any one of Embodiments 7-46, wherein the sense strand disclosed herein comprises a modification pattern NfsnsNfnNfnNfnNfnNfnNfnNfnNfnNf, wherein ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3’-phosphate; and Nf is a 2'-deoxy-2'- fluoro-nucleoside-3 '-phosphate.The oligonucleotide of any one of Embodiments 7-46, wherein the sense strand comprises a modification pattern nsnsnnNfnNfNfNfnnnnnnnnn, and the antisense strand comprises a modification pattern nsNfsnnnNfnNfNfnnnnNfnNfhnnsnsn, wherein ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fhioro-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphate.Tire oligonucleotide of any one of Embodiments 7-46, wherein the sense strand comprises a modification pattern nsnsnnNfnNfNfNfnnnnnnnnn, and the antisense strand comprises a modification pattern vpUsNfsnnnNfnNfNfnnnnNfnNfnnnsnsn, wherein vpUs is a 5'-vinylphosphonate-2'-O-niethyl-uridme-3’-phosphorothioate; ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphate.Tire oligonucleotide of any one of Embodiments 7-66, wherein the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 982-1308 or 2641-3105.The oligonucleotide of Embodiment 67, wherein the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 655-981 or 2198-2640.Tire oligonucleotide of any one of Embodiments 7-68, further comprising a terminal, chiral modification occurring at the first intemucleoside linkage at the 3 ’-end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the sense strand, having the linkage phosphorus atom in either Rp configuration or Sp configuration.Tire oligonucleotide of any one of Embodiments 7-69, further comprising a terminal, chiral modification occurring at the first and second intemucleoside linkages at the 3 ’-end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiralmodification occurring at the first intemucleoside linkage at the 5 ’-end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.The oligonucleotide of any one of Embodiments 7-70, further comprising a terminal, chiral modification occurring at tire first, second and third intemucleoside linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.The oligonucleotide of any one of Embodiments 7-71, further comprising a terminal, chiral modification occurring at the first, and second intemucleoside linkages at the 3 ’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the third intemucleoside linkages at the 3 ’-end of the antisense strand, having the linkage phosphorus atom in Rp configuration, a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the antisense strand, having the linkage phosphoms atom in Rp configuration, and a terminal, chiral modification occurring at tire first intemucleoside linkage at the 5 ’-end of the sense strand, having the linkage phosphoms atom in either Rp or Sp configuration.Tire oligonucleotide of any one of Embodiments 7-72, further comprising a terminal, chiral modification occurring at the first, and second intemucleoside linkages at the 3 ’-end of the antisense strand, having tlie linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first, and second intemucleoside linkages at the 5 ’-end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the sense strand, having tire linkage phosphoms atom in either Rp or Sp configuration.Tire oligonucleotide of any one of Embodiments 7-73, further comprising a phosphate or phosphate mimic at the 5 ’-end of the antisense strand.The oligonucleotide of Embodiment 74, wherein the phosphate mimic is a 5 ’-vinyl phosphonate (VP).The oligonucleotide of any one of Embodiments 1-75, further comprising a targeting ligand.The oligonucleotide of Embodiment 76, wherein the targeting ligand is a small moleculebased, sugar-based (e.g., saccharide-based), fatty acid-based, protein-based, or nucleic acidbased targeting ligand.Tire oligonucleotide of Embodiment 77, wherein the protein-based targeting ligand is an antibody, nanobody, affibody, peptibody, or a peptide.An oligonucleotide selected from the sense strands, antisense strands, and RNAi agents as listed in Tables 1A and IB, or a pharmaceutically acceptable salt thereof.A pharmaceutical composition comprising the oligonucleotide of any one of Embodiments 1-79, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient.A method for inhibiting ACVR2A expression or treating an ACVR2A related disorder in a subject, the method comprising administering an effective amount of the oligonucleotide of any one of Embodiments 1-79, or a pharmaceuti cally acceptable salt thereof, or the pharmaceutical composition of Embodimen t 80 to the subject.Tire method of Embodiment 81, wherein the subject is a human.The method of Embodiment 81 or 82, wherein the reduction of ACVR2A mRNA or protein expression levels is measured in a population of myocytes or cardiomyocytes derived from the subject.The method of any one of Embodiments 81-83, wherein tire reduction of ACVR2A mRNA or protein expression levels is measured in tissues derived from the subject.The method of any one of Embodiments 81-84, wherein the ACVR2A-related disorder is obesity', sarcopenia, muscle waste, muscle atrophy, cachexia, fibrodysplasia ossificans progressiva, heterotaxy, sarcopenic obesity, or sporadic inclusion body myositis.The method of any one of Embodiments 81-85, further comprising administering to the subject an additional agent or a therapy suitable for treatment or prevention of an ACVR2A related disorder.A method of treating obesity in a subject in need thereof, the method comprising administering an effective amount of the oligonucleotide of any one of Embodiments 1-79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of Embodiment 80 to the subject.A method of preserving or increasing muscle mass in a subject in need of treatment for weight loss, the method comprising administering an effective amount of the oligonucleotide of any one of Embodiments 1-79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of Embodiment 80 to the subject.A method of preserving or increasing muscle mass in a subject in need of treatment for reduction of excess body weight or for maintenance of weight reduction, the method comprising administering an effective amount of the oligonucleotide of any one of Embodiments 1-79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of Embodiment 80 to the subject.A method of preserving or increasing muscle mass in a subject in need of treatment for a reduction of major adverse cardiovascular events (e.g., cardiovascular death, non-fatal myocardial infarction, or non-fatal stroke), the method comprising administering an effective amount of the oligonucleotide of any one of Embodiments 1-79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of Embodiment 80 to the subject.A method of preserving or increasing muscle mass in a subject in need of treatment for type 2 diabetes, the method comprising administering an effective amount of the oligonucleotide of any one of Embodiments 1-79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of Embodiment 80 to the subject.A method of inhibiting ActRII (e.g., through inhibition of ACVR2A expression) in a subject experiencing weight loss, the method comprising administering an effective amount of theoligonucleotide of any one of Embodiments 1-79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of Embodiment 80 to the subject.93, The method of any one of Embodiments 81-92, wherein the subject is receiving or has received a GLP-1 receptor agonist (e.g., semaglutide, dulaglutide, liraglutide, exenatide, tirzepatide).EXAMPLES
[0169] The following examples are provided to further illustrate some embodiments of the present disclosure, but are not intended to limit the scope of the disclosure; it will be understood by their exemplary' nature that other procedures, methodologies, or techniques known to those skilled in the art may alternatively be used.Example 1: ACVR2A siRNA Design and Evaluation
[0170] A set of siRNAs were designed to target ACVR2A (shown here as SEQ ID NOs: 1309-1311). A detailed list of the unmodified siRNA sense and antisense strand sequences is shown in Tables 1 A and 1C below. A detailed list of modified siR As is shown in Table IB below. Table 2 provides names for the nucleotide abbreviations used in the nucleic acid sequences herein. Oligonucleotides are chemically synthesized using phosphoramidite approach and after quality control using UV- and mass-spectroscopy sense and antisense strands were annealed to perform screening. Table 3 provides exemplary sequences of ACVR2. A mRNA transcripts.
[0171] Hepal-6 cells (ATCC, CRL-1830) cells were maintained by biweekly passing in DMEM supplemented with 10% FBS, 20 mM L -glutamine, 10 mM IIEPES pH 7.2, 1 mM sodium pyruvate, lx MEM non-essential amino acids, and lx Pen / Strep (DMEM complete). Hepal-6 cells were purchased and cultured as described to produce frozen stocks in 10% DMSO in complete media. Briefly, each vial of cells was thawed in 37°C water bath and transferred to a 50 mL centrifuge tube filled with complete DMEM. Tire tube was then centrifuged at 200g for 5 minutes, the media aspirated, and the cells resuspended to appropriate density and seeded for continuous culture. A layout for transfection was designed and siRNA were transferred to a secondary’ plate of the same layout. On the day of transfection, Hepal-6 cells were dissociated as described and seeded into 96 well plates at 10,000 cells / well in 80 pL of complete media. Transfection mixes were prepared by adding 5 pL of 5 pM siRNA to 45 pL of fresh OptiMEM® media (ThermoFisher, 31985062) in a v-bottom polypropylene 96 well plate (USA Scientific, 1833-9610). A master mix of Lipofectamine® RNAiMax (ThermoFisher, 13778150) and OptiMEM® media was created at aratio of 0.3 pL RNAiMax and 10 pL of OptiMEM® per reaction. 50 pL of RNAiMax master mix was added to each 50 pL of siRNA / OptiMEM® and the plate was sealed with sterile plate tape (USA Scientific, 2920-0010). Each transfection mix plate was then rotated at 400 rpm for 5 minutes, then removed and allowed to sit at room temperature in the tissue culture hood for 15 minutes. Following incubation, 20 pL of each siRNA / RNAiMax was added to respective wells of die Hepal-6 cells, in triplicate. This created a final concentration of 50 nM siRNA per well. At 48 hours post transfection, 50 pL of fresh complete media was added to the cells for feeding. Transfections were allowed to incubate for 72 hours prior to harvest and RNA isolation.
[0172] Multiple dose validation screens were performed just as the initial screens with small changes to preparation and final siRNA dosing. Individual siRNA at 5 pM were diluted appropriately into OptiMEM® media to make a highest dose. Serial dilutions were prepared in ei ier separate plates (3-dose screens), vertically down (7-dose screens), or horizontally across (12 dose screens) using fresh OptiMEM®. Just as with the single dose screens, 50 pL of RNAiMax master mix (0.3 pL RNAiMax to 10 pL OptiMEM®) was added to each diluted siRNA. Each plate was then taped, rotated at 400 rpm for 5 minutes, and allowed to incubate at room temperature for 15 minutes. 20 pL of each siRNA reaction was then added to pre-plated Hepal-6 cells. Transfections were allowed to incubate for 72 prior to harvest and RNA isolation. 72 hours post transfection, cells were harvested, and RNA isolated using the Quick-RNA 96 Kit (Zymo Research, R1053) according to the manufacturer protocol using vacuum manifolds for washing and eluting via swing bucket centrifuging at 1500g. Harvested RNA was assayed for ACVR2A expression via Taqman® qPCR using the Luna Universal Probe One-Step RT-qPCR Kit (NEB, E3006). Untransfected controls from each transfection plate were pooled together and a 1:5 dilution series is produced for each qPCR assay plate for direct normalization. A single qPCR assay was performed for each sample using a mouse ACVR2A Taqman® probe set (Mm01331097_ml-FAM) multiplexed with a common GAPDH-VIC probe (ThermoFisher, 4352339E) according to the manufacturer instructions for a combined primer / probe set. Thermocycling and data acquisition was performed with an Applied Biosystems QuantStudio 3 / 5 Real-Time PCR System.Quantification of Target mRNA and Knockdown Efficiency:
[0173] The mRNA levels of the target gene and the efficiency of siRNA-mediated knockdown were assessed using relative quantification. Cq values for both the target and reference (housekeeping) genes were obtained via quantitative PCR (qPCR) for each sample. The relative expression of the target gene was calculated using the 2^(-ΔCq) method, where ACq represents the difference between the Cq values of the target and reference genes, and if applicable, therelative expression of the target gene is calculated using the 2^(-ΔΔCq) method, where ΔΔCq refers to the difference between the ΔCq values for treatment samples and only lipofectamine treated control samples.Determination of IC50 for siRNA:
[0174] IC 50 values were determined by plotting the percentage of target gene depletion against the logarithm of siRNA concentrations. A sigmoidal dose-response (variable slope) curve was fitted to the data using the Curve Fitting function in GraphPad Prism (version 7.0). The ICso value was defined as the siRNA concentration resulting in 50% gene knockdown.
[0175] Table 1A provides exemplary siRNAs with the sequences of the sense strand and the antisense strand. The position in transcript listed in columns 1-3 is tire beginning position of the target sequence in the transcript. The target sequence is 19 nucleotide long starting from the beginning position. For example, column 1 row 1 shows that the beginning position of the target sequence is 1801, which means that the target sequence is the sequence corresponding to positions 1801-1819 of ACVR2A RefSeq ID NM_001278579.2 (SEQ ID NO: 1309). The sequences of the sense strands and antisense strands are shown from the 5’ end to the 3’ end.Table 1APosition in Position in Position inSEQ SEQtranscript transcript transcriptID Sense strand ID Antisense strand NM NM NM NO NO001278579.2 001616.5 001278580.2CTAGTCTATGATG CGCAACCATCATA1801 1613 1604 1 328GTTGCG GACTAG ATGGGACTCTGA CTCCAGTTCAGAG1840 1652 1643 2 329ACTGGAG TCCCAT TGGGACTCTGAA GCTCCAGTTCAGA1841 1653 1644 3 330CTGGAGC GTCCCA GGGACTCTGAAC AGCTCCAGTTCAG1842 1654 1645 4 331TGGAGCT AGTCCC GGACTCTGAACT CAGCTCCAGTTCA1843 1655 1646 5 332GGAGCTG GAGTCC GACTCTGAACTG GCAGCTCCAGTTC1844 1656 1647 6 333GAGCTGC AGAGTC ACTCTGAACTGG AGCAGCTCCAGTT1845 1657 1648 7 334AGCTGCT CAGAGT TGAACTGGAGCT GCTTAGCAGCTCC1849 1661 1652 8 335GCTAAGC AGTTCA AAATCAAGGATCT TCCAAAAGATCCTT2082 1894 1885 9 336TTTGGA GATTI AGGATCTTTTGGA GCCAGGTCCAAAA2088 1900 1891 10 337CCTGGC GATCCT GGATCTTTTGGAC AGCCAGGTCCAAA2089 1901 1892 11 338CTGGCT AGATCCGATCTTTTGGACC TAGCCAGGTCCAA 2090 1902 1893 12 339TGGCTA AAGATC ATCTTTTGGACCT TTAGCCAGGTCCA2091 1903 1894 13 340GGCTAA AAAGAT TCTTTTGGACCTG ATTAGCCAGGTCC2092 1904 1895 14 341GCTAAT AAAAGA CTTTTGGACCTGG CATTAGCCAGGTC2093 1905 1896 15 342CTAATG CAAAAG TCTTAATGTCTGT CTTCTGACAGACAT2138 1950 1941 16 343CAGAAG TAAGA CTTAATGTCTGTC TCTTCTGACAGACA2139 1951 1942 17 344AGAAGA TTAAG AAATGACTATTGT GGCATTACAATAGT2265 1977 1968 18 345AATGCC CATTT AATGACTATTGTA TGGCATTACAATAG2266 1978 1969 19 346ATGCCA TCATT ATGACTATTGTAA TTGGCATTACAATA2267 1979 1970 20 347TGCCAA GTCAT TTGTGAATGTTTA GCACACTAAACATT2297 2109 2100 21 348GTGTGC CACAA TGAATGTTTAGTG GCAGCACACTAAA2300 2112 2103 22 349TGCTGC CATTCA GAATGTTTAGTGT AGCAGCACACTAA2301 2113 2104 23 350GCTGCT ACATTC AATGTTTAGTGTG CAGCAGCACACTA2302 2114 2105 24 351CTGCTG AACATT TTTAGTGTGCTGC AGAACAGCAGCAC2306 2118 2109 25 352TGTTCT ACTAAA TTAGTGTGCTGCT CAGAACAGCAGCA2307 2119 2110 26 353GTTCTG CACTAA TGTGCTGCTGTTC TACACAGAACAGC2311 2123 2114 27 354TGTGTA AGCACA GTGCTGCTGTTCT GTACACAGAACAG2312 2124 2115 28 355GTGTAC CAGCAC TGCTGCTGTTCTG TGTACACAGAACA2313 2125 2116 29 356TGTACA GCAGCA GCTGCTGTTCTGT ATGTACACAGAAC2314 2126 2117 30 357GTACAT AGCAGC CTGCTGTTCTGTG TATGTACACAGAAC2315 2127 2118 31 358TACATA AGCAG AAGTCATCAAAGT TACCCCACTTTGAT2334 2146 2137 32 359GGGGTA GACTT AGTCATCAAAGTG GTACCCCACTTTG2335 2147 2138 33 360GGGTAC ATGACT GTCATCAAAGTG TGTACCCCACTTTG2336 2148 2139 34 361GGGTACA ATGAC TCATCAAAGTGG CTGTACCCCACTTT2337 2149 2140 35 362GGTACAG GATGA CATCAAAGTGGG ACTGTACCCCACT2338 2150 2141 36 363GTACAGT TTGATGATCAAAGTGGGG TACTGTACCCCAC 2339 2151 2142 37 364TACAGTA TTTGAT TCAAAGTGGGGT TTACTGTACCCCA2340 2152 2143 38 365ACAGTAA CTTTGA CAAAGTGGGGTA TTTACTGTACCCCA2341 2153 2144 39 366CAGTAAA CTTTG AAAGTGGGGTAC CTTTACTGTACCCC2342 2154 2145 40 367AGTAAAG ACTTT AAGTGGGGTACA TCTTTACTGTACCC2343 2155 2146 41 368GTAAAGA CACTT AGTGGGGTACAG CTCTTTACTGTACC2344 2156 2147 42 369TAAAGAG CCACT TGGGGTACAGTA GCCTCTTTACTGTA2346 2158 2149 43 370AAGAGGC CCCCA GGGGTACAGTAA AGCCTCTTTACTGT2347 2159 2150 44 371AGAGGCT ACCCC GGGTACAGTAAA AAGCCTCTTTACTG2348 2160 2151 45 372GAGGCTT TACCC TACAGTAAAGAG TGGAAGCCTCTTTA2351 2163 2154 46 373GCTTCCA CTGTA ACAGTAAAGAGG TTGGAAGCCTCTTT2352 2164 2155 47 374CTTCCAA ACTGT CAGTAAAGAGGC CTTGGAAGCCTCTT2353 2165 2156 48 375TTCCAAG TACTG AGTAAAGAGGCTT GCTTGGAAGCCTC2354 2166 2157 49 376CCAAGC TTIACT TTCCAAGCATTAC GTTAAAGTAATGCT2365 2177 2168 50 377TTTAAC TGGAA TCCAAGCATTACT GGTTAAAGTAATGC2366 2178 2169 51 378TTAACC TTGGA CCAAGCATTACTT AGGTTAAAGTAATG2367 2179 2170 52 379TAACCT CTTGG CAAGCATTACTTT GAGGTTAAAGTAAT2368 2180 2171 53 380AACCTC GCTTG TTACTTTAACCTC TTGAGGGAGGTTA2374 2186 2177 54 381CCTCAA AAGTAA TACTTTAACCTCC GTTGAGGGAGGTT2375 2187 2178 55 382CTCAAC AAAGTA ACTTTAACCTCCC TGTTGAGGGAGGT2376 2188 2179 56 383TCAACA TAAAGT TTTAACCTCCCTC CTTGTTGAGGGAG2378 2190 2181 57 384AACAAG GIT AAA TTAACCTCCCTCA CCTTGTTGAGGGA2379 2191 2182 58 385ACAAGG GGTTAA CCTCCCTCAACA TATACCTTGTTGAG2383 2195 2186 59 386AGGTATA GGAGG CTCCCTCAACAA GTATACCTTGTTGA2384 2196 2187 60 387GGTATAC GGGAG TCCCTCAACAAG GGTATACCTTGTTG2385 2197 2188 61 388GTATACC AGGGACCCTCAACAAGG AGGTATACCTTGTT 2386 2198 2189 62 389TATACCT GAGGG CCTCAACAAGGT GAGGTATACCTTGT2387 2199 2190 63 390ATACCTC TGAGG GGTATACCTCAGT CGTGGAACTGAGG2396 2208 2199 64 391TCCACG TATACC GTATACCTCAGTT CCGTGGAACTGAG2397 2209 2200 65 392CCACGG GTATAC TATACCTCAGTTC ACCGTGGAACTGA2398 2210 2201 66 393CACGGT GGTATA ATACCTCAGTTCC AACCGTGGAACTG2399 2211 2202 67 394ACGGTT AGGTAT TACCTCAGTTCCA CAACCGTGGAACT2400 2212 2203 68 395CGGTTG GAGGTA ACCTCAGTTCCA GCAACCGTGGAAC2401 2213 2204 69 396CGGTTGC TGAGGT CCTCAGTTCCAC AGCAACCGTGGAA2402 2214 2205 70 397GGTTGCT CTGAGG TCAGTTCCACGG TTAGCAACCGTGG2404 2216 2207 71 398TTGCTAA AACTGA CAGTTCCACGGT TTTAGCAACCGTG2405 2217 2208 72 399TGCTAAA GAACTG AGTTCCACGGTT ATTTAGCAACCGTG2406 2218 2209 73 400GCTAAAT GAACT GTTCCACGGTTG AATTTAGCAACCGT2407 2219 2210 74 401CTAAATT GGAAC TTCCACGGTTGCT TAATTTAGCAACCG2408 2220 2211 75 402AAATTA TGGAA AGCTATGCTTAGT GTTGGCACTAAGC2515 2327 2318 76 403GCCAAC ATAGCT GCTGGCTTGTAAT CCCTACATTACAA2576 2388 2379 77 404GTAGGG GCCAGC GGCTTGTAATGTA TTTCCCTACATTAC2579 2391 2382 78 405GGGAAA AAGCC GCTTGTAATGTAG TTTICCCTACATTA2580 2392 2383 79 406GGAAAA CAAGC CAGTTCCCAAAAT ATGCAAATTTTGGG2670 2482 2473 80 407TTGCAT AACTG AGTTCCCAAAATT TATGCAAATTTTGG2671 2483 2474 81 408TGCATA GAACT GTTCCCAAAATTT GTATGCAAATTTTG2672 2484 2475 82 409GCATAC GGAAC CCAAAATTTGCAT GTAAGTATGCAAAT2676 2488 2479 83 410ACTTAC TTTGG GTGAGCTGTGAC TTCCAGTGTCACA2769 2581 2572 84 411ACTGGAA GCTCAC GAGCTGTGACAC CTTTCCAGTGTCAC2771 2583 2574 85 412TGGAAAG AGCTC AGCTGTGACACT GCTTTCCAGTGTCA2772 2584 2575 86 413GGAAAGC CAGCTGCTGTGACACTG AGCTTTCCAGTGTC 2773 2585 2576 87 414GAAAGCT ACAGC CTGTGACACTGG GAGCTTTCCAGTG2774 2586 2577 88 415AAAGCTC TCACAG2775 TGTGACACTGGA AGAGCTTTCCAGT 2587 2578 89 416AAGCTCT GTCACA GTGACACTGGAA AAGAGCTTTCCAGT2776 2588 2579 90 417AGCTCTT GTCAC TGACACTGGAAA GAAGAGCTTTCCA2777 2589 2580 91 418GCTCTTC GTGTCA GACACTGGAAAG TGAAGAGCTTTCCA2778 2590 2581 92 419CTCTTCA GTGTC ACACTGGAAAGC ATGAAGAGCTTTCC2779 2591 2582 93 420TCTTCAT AGTGT CACTGGAAAGCT AATGAAGAGCTTTC2780 2592 2583 94 421CTTCATT CAGTG TCTTTTCACCAAA ACACTGTTTGGTGA2853 2665 2656 95 422CAGTGT AAAGA CTTTTCACCAAAC CACACTGTTTGGT2854 2666 2657 96 423AGTGTG GAAAAG TTTTCACCAAACA ACACACTGTTTGGT2855 2667 2658 97 424GTGTGT GAAAA TTTCACCAAACAG CACACACTGTTTG 2856 2668 2659 98 425TGTGTG GTGAAA TTCACCAAACAGT CCACACACTGTTT2857 2669 2660 99 426GTGTGG GGTGAA TCACCAAACAGT CCCACACACTGTT2858 2670 2661 100 427GTGTGGG TGGTGA CACCAAACAGTG TCCCACACACTGT2859 2671 2662 101 428TGTGGGA TTGGTG ACCAAACAGTGT GTCCCACACACTG2860 2672 2663 102 429GTGGGAC TTTGGT TTAGGATCACCTC CTTCCTGAGGTGA2895 2707 2698 103 430AGGAAG TCCTAA TAGGATCACCTC ACTTCCTGAGGTG2896 2708 2699 104 431AGGAAGT ATCCTA AGGATCACCTCA CACTTCCTGAGGT2897 2709 2700 105 432GGAAGTG GATCCT GGATCACCTCAG ACACTTCCTGAGG2898 2710 2701 106 433GAAGTGT TGATCC GATCACCTCAGG GACACTTCCTGAG2899 2711 2702 107 434AAGTGTC GTGATC ATCACCTCAGGA CGACACTTCCTGA2900 2712 2703 108 435AGTGTCG GGTGAT GACTTGTAACTTT AGTGATAAAGTTAC2949 2761 2752 109 436ATCACT AAGTC TCTGCTTGGTGC CAAGATGGCACCA2973 2785 2776 110 437CATCTTG AGCAGA CTGCTTGGTGCC ACAAGATGGCACC2974 2786 2777 111 438ATCTTGT AAGCAGTGCTTGGTGCCAT GACAAGATGGCAC 2975 2787 2778 112 439CTTGTC CAAGCA GCTTGGTGCCAT TGACAAGATGGCA2976 2788 2779 113 440CTTGTCA CCAAGC CTTGGTGCCATCT CTGACAAGATGGC2977 2789 2780 114 441TGTCAG ACCAAG TTGGTGCCATCTT TCTGACAAGATGG2978 2790 2781 115 442GTCAGA CACCAA TGGTGCCATCTTG CTCTGACAAGATG2979 2791 2782 116 443TCAGAG GCACCA GGTGCCATCTTGT ACTCTGACAAGAT2980 2792 2783 117 444CAGAGT GGCACC GTGCCATCTTGTC TACTCTGACAAGAT2981 2793 2784 118 445AGAGTA GGCAC TGCCATCTTGTCA TTACTCTGACAAGA2982 2794 2785 119 446GAGTAA TGGCA GCCATCTTGTCA ATTACTCTGACAAG2983 2795 2786 120 447GAGTAAT ATGGC CCATCTTGTCAGA TATTACTCTGACAA2984 2796 2787 121 448GTAATA GATGG CATCTTGTCAGAG ATATTACTCTGACA2985 2797 2788 122 449TAATAT AGATG CTTGTCAGAGTAA CAAATATTACTCTG2988 2800 2791 123 450TATTTG ACAAG GTCAGAGTAATAT CATCAAATATTACT2991 2803 2794 124 451TTGATG CTGAC ATTTGATGTCTGT CATATCACAGACAT3002 2814 2805 125 452GATATG CAAAT TTTGATGTCTGTG ACATATCACAGAC3003 2815 2806 126 453ATATGT ATCAAA TTGATGTCTGTGA TACATATCACAGAC3004 2816 2807 127 454TATGTA ATCAA TGATGTCTGTGAT TTACATATCACAGA3005 2817 2808 128 455ATGTAA CATCA ACTTTAAGCAGAT TCTGAAATCTGCTT3051 2863 2854 129 456TTCAGA AAAGT CTTTAAGCAGATT ATCTGAAATCTGCT3052 2864 2855 130 457TCAGAT TAAAG TTTAAGCAGATTT CATCTGAAATCTGC3053 2865 2856 131 458CAGATG TTAAA AGTTCATGCCTTA CAAGGATAAGGCA3225 3037 3028 132 459TCCTTG TGAACT GTCAGGAGCTCA TTCACAGTGAGCT3482 3294 3285 133 460CTGTGAA CCTGAC TCAGGAGCTCAC ATTCACAGTGAGCT3483 3295 3286 134 461TGTGAAT CCTGA CAGGAGCTCACT CATTCACAGTGAG3484 3296 3287 135 462GTGAATG CTCCTG AGGAGCTCACTG ACATTCACAGTGA3485 3297 3288 136 463TGAATGT GCTCCTCAATACATAGGTC TCTGTTGACCTATG 3601 3413 3404 137 464AACAGA TATTG AATACATAGGTCA GTCTGTTGACCTAT3602 3414 3405 138 465ACAGAC GTATT ATACATAGGTCAA AGTCTGTTGACCTA3603 3415 3406 139 466CAGACT TGTAT TACATAGGTCAAC AAGTCTGTTGACCT3604 3416 3407 140 467AGACTT ATGTA ACATAGGTCAAC AAAGTCTGTTGACC3605 3417 3408 141 468AGACTTT TATGT ATAGGTCAACAG TTAAAGTCTGTTGA3607 3419 3410 142 469ACTTTAA CCTAT TAGGTCAACAGA CTTAAAGTCTGTTG3608 3420 3411 143 470CTTTAAG ACCTA AGGTCAACAGAC GCTTAAAGTCTGTT3609 3421 3412 144 471TTTAAGC GACCT ATAAGAATGTTCC GTCACTGGAACATT4135 3947 3938 145 472AGTGAC CTTAT TAAGAATGTTCCA AGTCACTGGAACA4136 3948 3939 146 473GTGACT TTCTTA AAGAATGTTCCAG TAGTCACTGGAAC4137 3949 3940 147 474TGACTA ATTCTT AGAATGTTCCAGT GTAGTCACTGGAA4138 3950 3941 148 475GACTAC CATTCT GAATGTTCCAGTG GGTAGTCACTGGA4139 3951 3942 149 476ACTACC ACATTC AATGTTCCAGTGA AGGTAGTCACTGG4140 3952 3943 150 477CTACCT AACATT ATGTTCCAGTGAC CAGGTAGTCACTG4141 3953 3944 151 478TACCTG GAACAT TACCTAGTCTTGT GTTTTAACAAGACT4166 3978 3969 152 479TAAAAC AGGTA ACCTAGTCTTGTT AGTTTTAACAAGAC4167 3979 3970 153 480AAAACT TAGGT CCTAGTCTTGTTA AAGTTTTAACAAGA4168 3980 3971 154 481AAACTT CTAGG TAGTGTTTGGTTTA GACTGTAAACCAA4203 4015 4006 155 482CAGTC ACACTA TTTTGCCTTTCTG GGGTATCAGAAAG4381 4193 4184 156 483ATACCC GCAAAA TTTGCCTTTCTGA TGGGTATCAGAAA4382 4194 4185 157 484TACCCA GGCAAA TTGCCTTTCTGAT ATGGGTATCAGAA4383 4195 4186 158 485ACCCAT AGGCAA GAATGCTTTATGA AGTTGATCATAAAG4458 4270 4261 159 486TCAACT CATTC CATAGGACTGAT TTAATCCATCAGTC4480 4292 4283 160 487GGATTAA CTATG ATAGGACTGATG GTTAATCCATCAGT4481 4293 4284 161 488GATTAAC CCTATTAGGACTGATGG GGTTAATCCATCAG 4482 4294 4285 162 489ATTAACC TCCTA AGGACTGATGGA TGGTTAATCCATCA4483 4295 4286 163 490TTAACCA GTCCT GGACTGATGGAT CTGGTTAATCCATC4484 4296 4287 164 491TAACCAG AGTCC CTGATGGATTAAC ACACTGGTTAATCC4487 4299 4290 165 492CAGTGT ATCAG TGATGGATTAACC AACACTGGTTAATC4488 4300 4291 166 493AGTGTT CATCA GATGGATTAACCA GAACACTGGTTAAT4489 4301 4292 167 494GTGTTC CCATC TTTATTTGAAGTCT GGCATAGACTTCA4511 4323 4314 168 495ATGCC AATAAA TTATTTGAAGTCTA GGGCATAGACTTC4512 4324 4315 169 496TGCCC AAATAA TATTTGAAGTCTAT AGGGCATAGACTT4513 4325 4316 170 497GCCCT CAAATA ATTTGAAGTCTAT CAGGGCATAGACT4514 4326 4317 171 498GCCCTG TCAAAT TTGAAGTCTATGC TGCAGGGCATAGA4516 4328 4319 172 499CCTGCA CTTCAA TGAAGTCTATGCC GTGCAGGGCATAG4517 4329 4320 173 500CTGCAC ACTTCA GAAGTCTATGCC TGTGCAGGGCATA4518 4330 4321 174 501CTGCACA GACTTC AAGTCTATGCCCT CTGTGCAGGGCAT4519 4331 4322 175 502GCACAG AGACTT AGTCTATGCCCT GCTGTGCAGGGCA4520 4332 4323 176 503GCACAGC TAGACTTTTTAGCATGTG ACACATCACATGC 4568 4380 4371 177 504ATGTGT TAAAAA TTTTAGCATGTGA CACACATCACATG4569 4381 4372 178 505TGTGTG CTAAAA TTAGCATGTGATG ATCACACATCACAT4571 4383 4374 179 506TGTGAT GCTAA TAGGTACCTTGTG GGAATTCACAAGG4604 4416 4407 180 507AATTCC TACCTA AGGTACCTTGTGA TGGAATTCACAAG4605 4417 4408 181 508ATTCCA GTACCT GGTACCTTGTGAA CTGGAATTCACAA4606 4418 4409 182 509TTCCAG GGTACC TATTTCTGGTTCC TTCAATGGAACCA467 279 270 183 510ATTGAA GAAATA TTCTGGTTCCATT TATTTCAATGGAAC 470 282 273 184 511GAAATA CAGAA TCTGGTTCCATTG CTATTTCAATGGAA471 283 274 185 512AAATAG CCAGA CTGGTTCCATTGA ACTATTTCAATGGA472 284 275 186 513AATAGT ACCAGTGGTTCCATTGAA CACTATTTCAATGG 473 285 276 187 514ATAGTG AACCA GTTGGCTGGATG TTGATATCATCCAG502 314 305 188 515ATATCAA CCAAC TTGGCTGGATGAT GTTGATATCATCCA503 315 306 189 516ATCAAC GCCAA ATGATATCAACTG TCATAGCAGTTGAT511 323 314 190 517CTATGA ATCAT CTATGACAGGAC ACAATCAGTCCTGT524 336 327 191 518TGATTGT CATAG AGGGCAATATGT TCATTACACATATT586 398 389 192 519GTAATGA GCCCT CAATATGTGTAAT CTTTTCATTACACA590 402 393 193 520GAAAAG TATTG AGATGGAAGTCA GGCTGTGTGACTT625 437 428 194 521CACAGCC CCATCT TTGTCATTTGTGC CAAAATGCACAAAT727 539 530 195 522ATTTTG GACAA TGTCATTTGTGCA CCAAAATGCACAA728 540 531 196 523TTTTGG ATGACA TTGTGCATTTTGG GTACACCCAAAAT734 546 537 197 524GTGTAC GCACAA GTTAGAAGTGAAA CCTTGCTTTCACTT851 663 654 198 525GCAAGG CTAAC AGGGGAAGATTT CACAACCAAATCTT 867 679 670 199 526GGTTGTG GCCCT GCTGTCAAAATAT TTGGAAATATTTTGA918 730 721 200 527TTCCAA CAGC CTGTCAAAATATTT ATTGGAAATATTTTG919 731 722 201 528CCAAT ACAG GGAATGAAGCAT TGTTCTCATGCTTC987 799 790 202 529GAGAACA ATTCC GAATGAAGCATG ATGTTCTCATGCTT988 800 791 203 530AGAACAT CATTC TACAGTTCATTGG TCTGCACCAATGA1009 821 812 204 531TGCAGA ACTGTA ACAGTTCATTGGT CTCTGCACCAATG1010 822 813 205 532GCAGAG AACTGT TCACAGCATTTCA TTTTCATGAAATGC1066 878 869 206 533TGAAAA TGTGA CACAGCATTTCAT CTTTTCATGAAATG1067 879 870 207 534GAAAAG CTGTG GTCAGACTTTCTT AGCCTTAAGAAAGT1094 906 897 208 535AAGGCT CTGAC CAGACTTTCTTAA TTAGCCTTAAGAAA1096 908 899 209 536GGCTAA GTCTG AGACTTTCTTAAG ATTAGCCTTAAGAA1097 909 900 210 537GCTAAT AGTCT ACTTTCTTAAGGC ACATTAGCCTTAAG1099 911 902 211 538TAATGT AAAGTCTTTCTTAAGGCT CACATTAGCCTTAA 1100 912 903 212 539AATGTG GAAAG TTAAGGCTAATGT GAGACCACATTAG1105 917 908 213 540GGTCTC CCTTAA CTAATGTGGTCTC TTCCAAGAGACCA1111 923 914 214 541TTGGAA CATTAG AATGTGGTCTCTT CATTCCAAGAGAC1113 925 916 215 542GGAATG CACATT ATGTGGTCTCTTG TCATTCCAAGAGA1114 926 917 216 543GAATGA CCACAT TGTGGTCTCTTGG TTCATTCCAAGAGA1115 927 918 217 544AATGAA CCACA GTGGTCTCTTGG GTTCATTCCAAGAG1116 928 919 218 545AATGAAC ACCAC TGGTCTCTTGGAA AGTTCATTCCAAGA1117 929 920 219 546TGAACT GACCA GACATCAAAAGTA CATTTTTACTTTTGA 1233 1045 1036 220 547AAAATG TGTC CATCAAAAGTAAA CACATTTTTACTTTT 1235 1047 1038 221 548AATGTG GATG ATCAAAAGTAAAA GCACATTTTTACTTT 1236 1048 1039 222 549ATGTGC TGAT TCAAAAGTAAAAA AGCACATTTTTACT1237 1049 1040 223 550TGTGCT TTTGA CAAAAGTAAAAAT CAGCACATTTTTAC1238 1050 1041 224 551GTGCTG TTTTG AAAAGTAAAAATG ACAGCACATTTTTA1239 1051 1042 225 552TGCTGT CTTTT AAGTAAAAATGTG CAACAGCACATTTT1241 1053 1044 226 553CTGTTG TACTT AGTAAAAATGTGC TCAACAGCACATTT1242 1054 1045 227 554TGTTGA TTACT GTAAAAATGTGCT TTCAACAGCACATT1243 1055 1046 228 555GTTGAA TTTAC TAAAAATGTGCTG TTTCAACAGCACAT1244 1056 1047 229 556TTGAAA TTTTA AAAAATGTGCTGT TTTTCAACAGCACA1245 1057 1048 230 557TGAAAA ATTTT AAAATGTGCTGTT TTTTTCAACAGCAC 1246 1058 1049 231 558GAAAAA ATTTT AAATGTGCTGTTG GTTTTTCAACAGCA 1247 1059 1050 232 559AAAAAC CATTT AATGTGCTGTTGA TGTTTTTCAACAGC1248 1060 1051 233 560AAAACA ACATT AGCTTGCATTGCT AAAGTCAGCAATG1274 1086 1077 234 561GACTTT CAAGCT GCTTGCATTGCTG CAAAGTCAGCAAT1275 1087 1078 235 562ACTTTG GCAAGC AGGGTGCTATAAA TGGAAGTTTATAGC1384 1196 1187 236 563CTTCCA ACCCTCCAGCATCCATC TTCAAGAGATGGAT 1529 1341 1332 237 564TCTTGAA GCTGG AGCATCCATCTCT TCTTCAAGAGATG1531 1343 1334 238 565TGAAGA GATGCT GCAGGAAGTTGT ATGCACAACAACTT1553 1365 1356 239 566TGTGCAT CCTGC AGGAAGTTGTTGT TTATGCACAACAAC1555 1367 1358 240 567GCATAA TTCCT GGAAGTTGTTGTG TTTATGCACAACAA1556 1368 1359 241 568CATAAA CTTCC GAAGTTGTTGTGC TTTTATGCACAACA1557 1369 1360 242 569ATAAAA ACTTC AAGTTGTTGTGCA TTTTTTATGCACAAC 1558 1370 1361 243 570TAAAAA AACTT AGTTGTTGTGCAT TTTTTTTATGCACAA 1559 1371 1362 244 571AAAAAA CAACT GTTGTTGTGCATA TTTTTTTTATGCACAA1560 1372 1363 245 572AAAAAA CAAC TTTAAGAGATTATT CTGCCAATAATCTC1589 1401 1392 246 573GGCAG TTAAA TTAAGAGATTATT TCTGCCAATAATCT1590 1402 1393 247 574GGCAGA CTTAA AAG AG ATT ATT G G TTTCTGCCAATAAT1592 1404 1395 248 575CAGAAA CTCTT AGAGATTATTGGC GTTTCTGCCAATAA1593 1405 1396 249 576AGAAAC TCTCT GAGATTATTGGCA TGTTTCTGCCAATA1594 1406 1397 250 577GAAACA ATCTC AGATTATTGGCAG ATGTTTCTGCCAAT1595 1407 1398 251 578AAACAT AATCT GAATGGCAATGC TCACAGAGCATTG1618 1430 1421 252 579TCTGTGA CCATTC AATGGCAATGCT TTCACAGAGCATTG1619 1431 1422 253 580CTGTGAA CCATT ATGGCAATGCTCT TTTCACAGAGCATT1620 1432 1423 254 581GTGAAA GCCAT TGGCAATGCTCT GTTTCACAGAGCAT1621 1433 1424 255 582GTGAAAC TGCCA GGCAATGCTCTG CGTTTCACAGAGC1622 1434 1425 256 583TGAAACG ATTGCC CAGGTTATCAGCT ACATCCAGCTGAT1673 1485 1476 257 584GGATGT AACCTG TGGATGTGTAGGT TCTTTCACCTACAC1685 1497 1488 258 585GAAAGA ATCCA CAGAGGACATTG ACTGTTACAATGTC1741 1553 1544 259 586TAACAGT CTCTG AGAGGACATTGTA CACTGTTACAATGT1742 1554 1545 260 587ACAGTG CCTCT ACATTGTAACAGT GTGACCACTGTTA1747 1559 1550 261 588GGTCAC CAATGTTGGTGACAAATGT AAGTCAACATTTGT 1768 1580 1571 262 589TGACTT CACCA GGTGACAAATGTT AAAGTCAACATTTG 1769 1581 1572 263 590GACTTT TCACC GTGACAAATGTTG GAAAGTCAACATTT1770 1582 1573 264 591ACTTTC GTCAC TGACAAATGTTGA GGAAAGTCAACATT1771 1583 1574 265 592CTTTCC TGTCA GACAAATGTTGAC AGGAAAGTCAACA1772 1584 1575 266 593TTTCCT TTTGTC ACAAATGTTGACT GAGGAAAGTCAAC1773 1585 1576 267 594TTCCTC ATTTGT CAAATGTTGACTT GGAGGAAAGTCAA1774 1586 1577 268 595TCCTCC CATTTG AAATGTTGACTTT GGGAGGAAAGTCA1775 1587 1578 269 596CCTCCC ACATTT AATGTTGACTTTC TGGGAGGAAAGTC1776 1588 1579 270 597CTCCCA AACATT ATGTTGACTTTCC TT GGGAGGAAAGT1777 1589 1580 271 598TCCCAA CAACAT TGTTGACTTTCCT TTTGGGAGGAAAG1778 1590 1581 272 599CCCAAA TCAACA TTTCCTCCCAAAG TAGATTCTTTGGGA1785 1597 1588 273 600AATCTA GGAAA TTCCTCCCAAAG CTAGATTCTTTGGG1786 1598 1589 274 601AATCTAG AGGAA CCTCCCAAAGAA GACTAGATTCTTTG1788 1600 1591 275 602TCTAGTC GGAGG CTCCCAAAGAAT AGACTAGATTCTTT1789 1601 1592 276 603CTAGTCT GGGAG TCCCAAAGAATCT TAGACTAGATTCTT1790 1602 1593 277 604AGTCTA TGGGA CCCAAAGAATCT ATAGACTAGATTCT1791 1603 1594 278 605AGTCTAT TTGGG CCAAAGAATCTA CATAGACTAGATTC1792 1604 1595 279 606GTCTATG TTTGG CAAAGAATCTAGT TCATAGACTAGATT1793 1605 1596 280 607CTATGA CTTTG AAAGAATCTAGTC ATCATAGACTAGAT1794 1606 1597 281 608TATGAT TOUT AATCTAGTCTATG CACCATCATAGAC1798 1610 1601 282 609ATGGTG TAGATT CCCTCTCCAAATC ATCCTTGATTTGGA2074 1886 1877 283 610CAAGGAT GAGGG CCTCTCCAAATC GATCCTTGATTTGG2075 1887 1878 284 611AAGGATC AGAGG CTCTCCAAATCAA AGATCCTTGATTTG2076 1888 1879 285 612GGATCT GAGAG TCTCCAAATCAAG AAGATCCTTGATTT2077 1889 1880 286 613GATCTT GGAGACTCCAAATCAAG AAAGATCCTTGATT 2078 1890 1881 287 614GATCTTT TGGAG TCCAAATCAAGG AAAAGATCCTTGAT2079 1891 1882 288 615ATCTTTT TTGGA AAATCAAGGATCT TCCAAAAGATCCTT2082 1894 1885 289 616TTTGGA GATTT AATCAAGGATCTT GTCCAAAAGATCC2083 1895 1886 290 617TTGGAC TTGATT ATTTGAAAACTGA CTGATGTCAGTTTT2116 1928 1919 291 618CATCAG CAAAT TTTGAAAACTGAC TCTGATGTCAGTTT2117 1929 1920 292 619ATCAGA TCAAA TTGAAAACTGACA ATCTGATGTCAGTT2118 1930 1921 293 620TCAGAT TTCAA CATCAGATTTCTT GACATTAAGAAATC2129 1941 1932 294 621AATGTC TGATG AGATTTCTTAATGT GACAGACATTAAG2133 1945 1936 295 622CTGTC AAATCT GATTTCTTAATGT TGACAGACATTAAG2134 1946 1937 296 623CTGTCA AAATC ATTTCTTAATGTCT CTGACAGACATTAA2135 1947 1938 297 624GTCAG GAAAT TTTCTTAATGTCTG TCTGACAGACATTA2136 1948 1939 298 625TCAGA AGAAA TCTTAATGTCTGT CTTCTGACAGACAT2138 1950 1941 299 626CAGAAG TAAGA GTCAGAAGACAC GGAATTAGTGTCTT2149 1961 1952 300 627TAATTCC CTGAC TCAGAAGACACT AGGAATTAGTGTCT2150 1962 1953 301 628AATTCCT TCTGA CAGAAGACACTA AAGGAATTAGTGTC2151 1963 1954 302 629ATTCCTT TTCTG AGAAGACACTAAT TAAGGAATTAGTGT2152 1964 1955 303 630TCCTTA CTTCT GACACTAATTCCT CATTTAAGGAATTA2156 1968 1959 304 631TAAATG GTGTC ACACTAATTCCTT TCATTTAAGGAATT2157 1969 1960 305 632AAATGA AGTGT CCTTAAATGAACT AGCAGTAGTTCATT2166 1978 1969 306 633ACTGCT TAAGG CTTAAATGAACTA TAGCAGTAGTTCAT2167 1979 1970 307 634CTGCTA TTAAG TTTGCTGTTGTTTC TTATAGAAACAACA 2248 2060 2051 308 635TATAA GCAAA TTGCTGTTGTTTCT TTTATAGAAACAAC2249 2061 2052 309 636ATAAA AGCAA TGCTGTTGTTTCT ATTTATAGAAACAA2250 2062 2053 310 637ATAAAT CAGCA GCTGTTGTTTCTA CATTTATAGAAACA2251 2063 2054 311 638TAAATG ACAGCCTGTTGTTTCTATA TCATTTATAGAAAC 2252 2064 2055 312 639AATGA AACAG TGTTGTTTCTATAA GTCATTTATAGAAA2253 2065 2056 313 640ATGAC CAACA TGTTTCTATAAATG ATAGTCATTTATAG2256 2068 2059 314 641ACTAT AAACA TAAAGAGGCTTC ATGCTTGGAAGCC2356 2168 2159 315 642CAAGCAT TCTTTA CTTAACCTCCCT TTGTTGAGGGAGG2377 2189 2180 316 643CAACAA TTAAAG AAAATTGAAAACA TGTTAGTGTTTTCAA2428 2240 2231 317 644CTAACA TTTI AAATTGAAAACAC CTGTTAGTGTTTTC2429 2241 2232 318 645TAACAG AATTT AGCTGTGACACT GCTTTCCAGTGTCA2772 2584 2575 319 646GGAAAGC CAGCT CTGTGACACTGG GAGCTTTCCAGTG2774 2586 2577 320 647AAAGCTC TCACAG CTTCTTTTCACCA ACTGTTTGGTGAAA2851 2663 2654 321 648AACAGT AGAAG TTCTTTTCACCAA CACTGTTTGGTGAA2852 2664 2655 322 649ACAGTG AAGAA CAGAGTAATATTT GACATCAAATATTA2993 2805 2796 323 650GATGTC CTCTG AGTAATATTTGAT ACAGACATCAAATA2996 2808 2799 324 651GTCTGT TTACT ATAGTTCATGCCT AGGATAAGGCATG3223 3035 3026 325 652TATCCT AACTAT CAAACAATACATA TTGACCTATGTATT3597 3409 3400 326 653GGTCAA GTTTG CATAGGTCAACA TAAAGTCTGTTGAC3606 3418 3409 327 654GACTTTA CTATG AGACAGAACCAA AGTTTGATTGGTTC386 198 189 1312 1755TCAAACT TGTCT AACCGTGTTATGG TTGTCACCATAACA412 224 215 1313 1756TGACAA CGGTT CCGTGTTATGGT CTTIGTCACCATAA414 226 217 1314 1757GACAAAG CACGG TGTTATGGTGACA TATCTTTGTCACCA417 229 220 1315 1758AAGATA TAACA TGGTGACAAAGAT CCGTTTATCTTTGT422 234 225 1316 1759AAACGG CACCA ATATTTCTGGTTC TCAATGGAACCAG466 278 269 1317 1760CATTGA AAATAT CATTGAAATAGTG TTGTTTCACTATTTC 479 291 282 1318 1761AAACAA AATG ATTGAAATAGTGA CTTGTTTCACTATTT480 292 283 1319 1762AACAAG CAAT TTGAAATAGTGAA CCTTGTTTCACTAT481 293 284 1320 1763ACAAGG TTCAATGAAATAGTGAAA ACCTTGTTTCACTA 294 285 1321 1764CAAGGT TTTCA GAAATAGTGAAAC AACCTTGTTTCACT295 286 1322 1765AAGGTT ATTTC AAATAGTGAAACA CAACCTTGTTTCAC296 287 1323 1766AGGTTG TATTT AATAGTGAAACAA ACAACCTTGTTTCA297 288 1324 1767GGTTGT CTATT ATAGTGAAACAAG AACAACCTTGTTTC298 289 1325 1768GTTGTT ACTAT TGTTGGCTGGAT TGATATCATCCAGC313 304 1326 1769GATATCA CAACA GCTATGACAGGA CAATCAGTCCTGT335 326 1327 1770CTGATTG CATAGC ATGACAGGACTG ACACAATCAGTCC338 329 1328 1771ATTGTGT TGTCAT TGACAGGACTGA TACACAATCAGTC339 330 1329 1772TTGTGTA CTGTCA GACAGGACTGAT CTACACAATCAGT340 331 1330 1773TGTGTAG CCTGTC CAGGACTGATTGT TTCTACACAATCAG342 333 1331 1774GTAGAA TCCTG AGGACTGATTGT TTTCTACACAATCA343 334 1332 1775GTAGAAA GTCCT GTGTAGAAAAAAA CTGTCTTTTTTTCT 353 344 1333 1776AGACAG ACAC TGTAGAAAAAAAA GCTGTCTTTTTTTC 354 345 1334 1777GACAGC TACA TATTTTTGTTGCTG CCTCACAGCAACA 382 373 1335 1778TGAGG AAAATA CTTCAAATCCAGT GGTGTAACTGGATT458 449 1336 1779TACACC TGAAG ACAACATCCTGC GAATAGAGCAGGA491 482 1337 1780TCTATTC TGTTGT CAACATCCTGCT GGAATAGAGCAGG492 483 1338 1781CTATTCC ATGTTG AACATCCTGCTCT AGGAATAGAGCAG493 484 1339 1782ATTCCT GATGTT ACATCCTGCTCTA AAGGAATAGAGCA494 485 1340 1783TTCCTT GGATGT CTCTATTCCTTGG GTGGCACCAAGGA502 493 1341 1784TGCCAC ATAGAG TGCCACTTATGTT GCAATTAACATAAG515 506 1342 1785AATTGC TGGCA GGATTGTCATTTG AATGCACAAATGA536 527 1343 1786TGCATT CAATCC TTTGTGCATTTTG TACACCCAAAATG 545 536 1344 1787GGTGTA CACAAA TGGGTGTACAGG TGTGATGCCTGTA556 547 1345 1788CATCACA CACCCAGGGTGTACAGGC TTGTGATGCCTGTA 745 557 548 1346 1789ATCACAA CACCC TTTGAAACCACTG TAACTGCAGTGGTT833 645 636 1347 1790CAGTTA TCAAA TTGAAACCACTG ATAACTGCAGTGG834 646 637 1348 1791CAGTTAT TTTCAA GTTATTAGAAGTG TGCTTTCACTTCTA848 660 651 1349 1792AAAGCA ATAAC TTATTAGAAGTGA TTGCTTTCACTTCT849 661 652 1350 1793AAGCAA AATAA TATTAGAAGTGAA CTTGCTTTCACTTC850 662 653 1351 1794AGCAAG TAATA GACAAACAGTCA TTTGCCATGACTGT942 754 745 1352 1795TGGCAAA TTGTC CAAACAGTCATG ATTTTGCCATGACT944 756 747 1353 1796GCAAAAT GTTTG CGAAGTCTACAG AGGCAAACTGTAG968 780 771 1354 1797TTTGCCT ACTTCG AAGTCTACAGTTT CCAGGCAAACTGT970 782 773 1355 1798GCCTGG AGACTT CAGTTTGCCTGG CTTCATTCCAGGC977 789 780 1356 1799AATGAAG AAACTG AGTTTGCCTGGAA GCTTCATTCCAGG978 790 781 1357 1800TGAAGC CAAACT TGCCTGGAATGA TCATGCTTCATTCC982 794 785 1358 1801AGCATGA AGGCA ATGAAGCATGAG ATATGTTCTCATGC990 802 793 1359 1802AACATAT TTCAT TGAAGCATGAGA AATATGTTCTCATG991 803 794 1360 1803ACATATT CTTCA GAAGCATGAGAA TAATATGTTCTCAT992 804 795 1361 1804CATATTA GCTTC CAGTTCATTGGTG TTTCTGCACCAATG1011 823 814 1362 1805CAGAAA AACTG AGTTCATTGGTGC TTTTTCTGCACCAAT1012 824 815 1363 1806AGAAAA GAACT GTTCATTGGTGCA TTTTTCTGCACCAA1013 825 816 1364 1807GAAAAA TGAAC GCACCAGTGTTG TCCACATCAACAC1036 848 839 1365 1808ATGTGGA TGGTGC CACCAGTGTTGAT ATCCACATCAACA1037 849 840 1366 1809GTGGAT CTGGTG TGTTGATGTGGAT CCAAAGATCCACA1043 855 846 1367 1810CTTTGG TCAACA GTTGATGTGGATC GCCAAAGATCCAC1044 856 847 1368 1811TTTGGC ATCAAC TCAGACTTTCTTA TAGCCTTAAGAAAG1095 907 898 1369 1812AGGCTA TCTGA GCTAATGTGGTCT TCCAAGAGACCAC1110 922 913 1370 1813CTTGGA ATTAGCTAATGTGGTCTCT ATTCCAAGAGACC 1112 924 915 1371 1814TGGAAT ACATTA ATACCTGGCCTA CATCTTTTAGGCCA1188 1000 991 1372 1815AAAGATG GGTAT CCTAAAAGATGG TTTGTGGCCATCTT1196 1008 999 1373 1816CCACAAA TTAGG CTAAAAGATGGC GTTTGTGGCCATCT1197 1009 1000 1374 1817CACAAAC TTTAG ACAAACCTGCCA TGAGATATGGCAG1210 1022 1013 1375 1818TATCTCA GTTTGT CAAACCTGCCAT GTGAGATATGGCA1211 1023 1014 1376 1819ATCTCAC GGTTTG TATCTCACAGGG TTGATGTCCCTGTG1222 1034 1025 1377 1820ACATCAA AGATA GGACATCAAAAG ATTTTTACTTTTGAT 1232 1044 1035 1378 1821TAAAAAT GTCC TTGAAAAACAACC CTGTCAGGTTGTTT1257 1069 1060 1379 1822TGACAG TTCAA TGAAAAACAACCT GCTGTCAGGTTGTT1258 1070 1061 1380 1823GACAGC TTTCA AAAACAACCTGA CAAGCTGTCAGGT1261 1073 1064 1381 1824CAGCTTG TGTTTT ACAACCTGACAG ATGCAAGCTGTCA1264 1076 1067 1382 1825CTTGCAT GGTTGT CAACCTGACAGC AATGCAAGCTGTC1265 1077 1068 1383 1826TTGCATT AGGTTG CCTGACAGCTTG AGCAATGCAAGCT1268 1080 1071 1384 1827CATTGCT GTCAGG GTTGGCCTTAAAA CTCAAATTTTAAGG1295 1107 1098 1385 1828TTTGAG CCAAC CGATACCCATGG AACCTGTCCATGG1331 1143 1134 1386 1829ACAGGTT GTATCG ATGGCTCCAGAG CTAATACCTCTGGA1365 1177 1168 1387 1830GTATTAG GCCAT CAGAGGTATTAGA GCACCCTCTAATA1372 1184 1175 1388 1831GGGTGC CCTCTG GGTATTAGAGGG TATAGCACCCTCTA1376 1188 1179 1389 1832TGCTATA ATACC GTATTAGAGGGT TTATAGCACCCTCT1377 1189 1180 1390 1833GCTATAA AATAC GGTGCTATAAACT TTTGGAAGTTTATA1386 1198 1189 1391 1834TCCAAA GCACC ATGCATTTTTGAG TCTATCCTCAAAAA 1408 1220 1211 1392 1835GATAGA TGCAT GGATTAGTCCTAT GTTCCCATAGGAC1440 1252 1243 1393 1836GGGAAC TAATCC ACTGGCTTCTCG AGTACAGCGAGAA1457 1269 1260 1394 1837CTGTACT GCCAGT GGCTTCTCGCTG AGCAGTACAGCGA1460 1272 1263 1395 1838TACTGCT GAAGCCTCGCTGTACTGCT ATCTGCAGCAGTA 1466 1278 1269 1396 1839GCAGAT CAGCGA TGTACTGCTGCA GTCCATCTGCAGC1470 1282 1273 1397 1840GATGGAC AGTACA CAGATGGACCTG TCATCTACAGGTC1480 1292 1283 1398 1841TAGATGA CATCTG GATGGACCTGTA ATTCATCTACAGGT1482 1294 1285 1399 1842GATGAAT CCATC ATGGACCTGTAG TATTCATCTACAGG1483 1295 1286 1400 1843ATGAATA TCCAT TGGACCTGTAGAT GTATTCATCTACAG1484 1296 1287 1401 1844GAATAC GTCCA AATACATGTTGCC TCAAATGGCAACAT1498 1310 1301 1402 1845ATTTGA GTATT ATACATGTTGCCA CTCAAATGGCAAC1499 1311 1302 1403 1846TTTGAG ATGTAT ACATGTTGCCATT TCCTCAAATGGCA1501 1313 1304 1404 1847TGAGGA ACATGT CATGTTGCCATTT CTCCTCAAATGGC1502 1314 1305 1405 1848GAGGAG AACATG TCCATCTCTTGAA CATGTCTTCAAGAG1535 1347 1338 1406 1849GACATG ATGGA CCATCTCTTGAAG GCATGTCTTCAAGA1536 1348 1339 1407 1850ACATGC GATGG CATCTCTTGAAGA TGCATGTCTTCAAG1537 1349 1340 1408 1851CATGCA AGATG ATCTCTTGAAGAC CTGCATGTCTTCAA1538 1350 1341 1409 1852ATGCAG GAGAT TCTCTTGAAGACA CCTGCATGTCTTCA1539 1351 1342 1410 1853TGCAGG AGAGA TTGTTGTGCATAA TTTTTTTTATGCACA 1561 1373 1364 1411 1854AAAAAA ACAA TGTTGTGCATAAA CTTTTTTTATGCAC 1562 1374 1365 1412 1855AAAAAG AACA GCCTGTTTTAAGA ATAATCTCTTAAAA1583 1395 1386 1413 1856GATTAT CAGGC TTTTAAGAGATTAT TGCCAATAATCTCT1588 1400 1391 1414 1857TGGCA TAAAA GATTATTGGCAGA CATGTTTCTGCCAA1596 1408 1399 1415 1858AACATG TAATC AAACATGCTGGA TTGCCATTCCAGC1608 1420 1411 1416 1859ATGGCAA ATGTTT TGCTGGAATGGC GAGCATTGCCATT1613 1425 1416 1417 1860AATGCTC CCAGCA GCAATGCTCTGT TGGTTTCACAGAG1623 1435 1426 1418 1861GAAACCA CATTGC CAATGCTCTGTGA ATGGTTTCACAGA1624 1436 1427 1419 1862AACCAT GCATTG ATGCTCTGTGAAA CAATGGTTTCACAG1626 1438 1429 1420 1863CCATTG AGCATTGCTCTGTGAAAC TCAATGGTTTCACA 1627 1439 1430 1421 1864CATTGA GAGCA GCTCTGTGAAAC TTCAATGGTTTCAC1628 1440 1431 1422 1865CATTGAA AGAGC CTCTGTGAAACC CTTCAATGGTTTCA1629 1441 1432 1423 1866ATTGAAG CAGAG TCTGTGAAACCAT TCTTCAATGGTTTC1630 1442 1433 1424 1867TGAAGA ACAGA CTGTGAAACCATT TTCTTCAATGGTTT1631 1443 1434 1425 1868GAAGAA CACAG TGTGAAACCATTG ATTCTTCAATGGTTT1632 1444 1435 1426 1869AAGAAT CACA GTGAAACCATTGA CATTCTTCAATGGT1633 1445 1436 1427 1870AGAATG TTCAC ATCAGCTGGATGT ACCTACACATCCA1679 1491 1482 1428 1871GTAGGT GCTGAT TGTAGGTGAAAG GGTAATTCTTTCAC1691 1503 1494 1429 1872AATTACC CTACA TAGGTGAAAGAAT TGGGTAATTCTTTC1693 1505 1496 1430 1873TACCCA ACCTA AG GT G AAAG AATT CTGGGTAATTCTTT1694 1506 1497 1431 1874ACCCAG CACCT GTGAAAGAATTAC ATCTGGGTAATTCT1696 1508 1499 1432 1875CCAGAT TTCAC TATTATTACCACA GTCCTCTGTGGTA1730 1542 1533 1433 1876GAGGAC ATAATA TATTACCACAGAG AATGTCCTCTGTG1733 1545 1536 1434 1877GACATT GTAATA TACCACAGAGGA TACAATGTCCTCTG1736 1548 1539 1435 1878CATTGTA TGGTA AGGACATTGTAAC ACCACTGTTACAAT1744 1556 1547 1436 1879AGTGGT GTCCT ACAGTGGTCACA TCACCATTGTGAC1755 1567 1558 1437 1880ATGGTGA CACTGT AATGGTGACAAAT GTCAACATTTGTCA1766 1578 1569 1438 1881GTTGAC CCATT ATCTAGTCTATGA CAACCATCATAGA1799 1611 1602 1439 1882TGGTTG CTAGAT TCTAGTCTATGAT GCAACCATCATAG1800 1612 1603 1440 1883GGTTGC ACTAGA TCTGTGCACACTA ATTTCTTAGTGTGC1823 1635 1626 1441 1884AGAAAT ACAGA CTGTGCACACTA CATTTCTTAGTGTG1824 1636 1627 1442 1885AGAAATG CACAG TGTGCACACTAA CCATTTCTTAGTGT1825 1637 1628 1443 1886GAAATGG GCACA TGCACACTAAGA TCCCATTTCTTAGT1827 1639 1630 1444 1887AATGGGA GTGCA GCACACTAAGAA GTCCCATTTCTTAG1828 1640 1631 1445 1888ATGGGAC TGTGCATGAGTAGGATGT CAAGAGACATCCT 1903 1715 1706 1446 1889CTCTTG ACTCAT AGTAGGATGTCTC TTCCAAGAGACAT1906 1718 1709 1447 1890TTGGAA CCTACT GTAGGATGTCTCT TTTCCAAGAGACAT1907 1719 1710 1448 1891TGGAAA CCTAC GATGTCTCTTGGA AACATTTCCAAGAG1911 1723 1714 1449 1892AATGTT ACATC ATGTCTCTTGGAA TAACATTTCCAAGA1912 1724 1715 1450 1893ATGTTA GACAT CCGACAGCACA TTCACATCTGTGCT1983 1795 1786 1451 1894GATGTGAA GTCGG GAGACTAAGAGA CAAGGTTTCTCTTA2008 1820 1811 1452 1895AACCTTG GTCTC AGACTAAGAGAA GCAAGGTTTCTCTT2009 1821 1812 1453 1896ACCTTGC AGTCT GACTAAGAGAAA TGCAAGGTTTCTCT2010 1822 1813 1454 1897CCTTGCA TAGTC AGAAACCTTGCA TAGAGTTTGCAAG2017 1829 1820 1455 1898AACTCTA GTTTCT AAACCTTGCAAA TATAGAGTTTGCAA2019 1831 1822 1456 1899CTCTATA GGTTT AACCTTGCAAACT TTATAGAGTTTGCA2020 1832 1823 1457 1900CTATAA AGGTT ACCTTGCAAACT TTTATAGAGTTTGC2021 1833 1824 1458 1901CTATAAA AAGGT CCTTGCAAACTCT CTTTATAGAGTTTG2022 1834 1825 1459 1902ATAAAG CAAGG CTTGCAAACTCTA TCTTTATAGAGTTTG2023 1835 1826 1460 1903TAAAGA CAAG TTGCAAACTCTAT TTCTTTATAGAGTTT2024 1836 1827 1461 1904AAAGAA GCAA TGCAAACTCTATA TTTCTTTATAGAGTT2025 1837 1828 1462 1905AAGAAA TGCA GCAAACTCTATAA GTTTCTTTATAGAGT2026 1838 1829 1463 1906AGAAAC TTGC CAAACTCTATAAA AGTTTCTTTATAGA2027 1839 1830 1464 1907GAAACT GTTTG AAACTCTATAAAG AAGTTTCTTTATAGA2028 1840 1831 1465 1908AAACTT GTTT AACTCTATAAAGA AAAGTTTCTTTATAG2029 1841 1832 1466 1909AACTTT AGTT ACTCTATAAAGAA AAAAGTTTCTTTATA2030 1842 1833 1467 1910ACTTTT GAGT TTTGAAAAAGTGT TCATGTACACTTTTT 2046 1858 1849 1468 1911ACATGA CAAA TTGAAAAAGTGTA TTCATGTACACTTTT2047 1859 1850 1469 1912CATGAA TCAA GAAAAAGTGTACA TCTTCATGTACACT2049 1861 1852 1470 1913TGAAGA TTTTCAAAAGTGTACATG ATTCTTCATGTACA 2051 1863 1854 1471 1914AAGAAT CTTTT AAAGTGTACATGA CATTCTTCATGTAC2052 1864 1855 1472 1915AGAATG ACTTT CATGAAGAATGTA GAGGGCTACATTC2060 1872 1863 1473 1916GCCCTC TTCATG AATGTAGCCCTCT ATTTGGAGAGGGC2067 1879 1870 1474 1917CCAAAT TACATT ATGTAGCCCTCT GATTTGGAGAGGG2068 1880 1871 1475 1918CCAAATC CTACAT TGTAGCCCTCTC TGATTTGGAGAGG2069 1881 1872 1476 1919CAAATCA GCTACA GTAGCCCTCTCC TTGATTTGGAGAGG2070 1882 1873 1477 1920AAATCAA GCTAC GACCTGGCTAAT ACACTCCATTAGC2099 1911 1902 1478 1921GGAGTGT CAGGTC CCTGGCTAATGG AAACACTCCATTAG2101 1913 1904 1479 1922AGTGTTT CCAGG GGCTAATGGAGT TTCAAACACTCCAT2104 1916 1907 1480 1923GTTTGAA TAGCC GCTAATGGAGTG TTTCAAACACTCCA2105 1917 1908 1481 1924TTTGAAA TTAGC CTAATGGAGTGTT TTTTCAAACACTCC2106 1918 1909 1482 1925TGAAAA ATTAG TAATGGAGTGTTT GTTTTCAAACACTC2107 1919 1910 1483 1926GAAAAC CATTA AATGGAGTGTTTG AGTTTTCAAACACT2108 1920 1911 1484 1927AAAACT CCATT ATGGAGTGTTTGA CAGTHTCAAACAC2109 1921 1912 1485 1928AAACTG TCCAT GACATCAGATTTC CATTAAGAAATCTG2127 1939 1930 1486 1929TTAATG ATGTC TCCTTTAAATGAAC GCAGTAGTTCATTT2165 1977 1968 1487 1930TACTGC AAGGA TAAATGAACTACT AATAGCAGTAGTTC2169 1981 1972 1488 1931GCTATT ATTTA TTTAAATCAAAAA GAAAAGTHTTGA’IT 2191 2003 1994 1489 1932CTTTTC TAAA TTAAATCAAAAAC TGAAAAGTTTTGAT 2192 2004 1995 1490 1933TTTTCA TTAA TCATTTCAGATTTT TTTTTAAAATCTGAA 2208 2020 2011 1491 1934AAAAA ATGA CATTTCAGATTTTA CTTTTTTAAAATCTGA 2209 2021 2012 1492 1935AAAAG AATG ATTTCAGATTTAA CCTTTTTTAAAATCT 2210 2022 2013 1493 1936AAAGG GAAAT GTAACTTGTTTTTA TGCAATAAAAACAA2229 2041 2032 1494 1937TTGCA GTTAC TAACTTGTTTTTTAT ATGCAATAAAAACA2230 2042 2033 1495 1938TGCAT AGTTAAACTTGTTTTTTAT AATGCAATAAAAAC 2231 2043 2034 1496 1939GCATT AAGTT GTTTTTATTGCATT CAGCAAATGCAAT2236 2048 2039 1497 1940TGCTG AAAAAC CATTTGCTGTTGT ATAGAAACAACAG2246 2058 2049 1498 1941TTCTAT CAAATG GTTGTTTCTATAAA AGTCATTTATAGAA2254 2066 2057 1499 1942TGACT ACAAC ACAGCTTGTGAAT CTAAACATTCACAA2292 2104 2095 1500 1943GTTTAG GCTGT TGCTGTTCTGTGT TTATGTACACAGAA2316 2128 2119 1501 1944ACATAA CAGCA GCTGTTCTGTGTA TTTATGTACACAGA2317 2129 2120 1502 1945CATAAA ACAGC TGTTCTGTGTACA ACTTTATGTACACA2319 2131 2122 1503 1946TAAAGT GAACA GTTCTGTGTACAT GACTTTATGTACAC2320 2132 2123 1504 1947AAAGTC AGAAC GTGTACATAAAGT TTGATGACTTTATGT2325 2137 2128 1505 1948CATCAA ACAC TGTACATAAAGTC TTTGATGACTTTATG2326 2138 2129 1506 1949ATCAAA TACA GTACATAAAGTCA CTTTGATGACTTTAT2327 2139 2130 1507 1950TCAAAG GTAC TACATAAAGTCAT ACTTTGATGACTTT2328 2140 2131 1508 1951CAAAGT ATGTA ACATAAAGTCATC CACTTTGATGACTT2329 2141 2132 1509 1952AAAGTG TATGT CATAAAGTCATCA CCACTTTGATGACT2330 2142 2133 1510 1953AAGTGG TTATG ATAAAGTCATCAA CCCACTTTGATGA2331 2143 2134 1511 1954AGTGGG CTTTAT TAAAGTCATCAAA CCCCACTTTGATG2332 2144 2135 1512 1955GTGGGG ACTTTA CTCAACAAGGTAT TGAGGTATACCTTG2388 2200 2191 1513 1956ACCTCA TTGAG TTATAAAATTGAAA AGTGTTTTCAATTTT2424 2236 2227 1514 1957ACACT ATAA TATAAAATTGAAAA TAGTGTTTTCAATTT2425 2237 2228 1515 1958CACTA TATA ATAAAATTGAAAA TTAGTGTTTTCAATT2426 2238 2229 1516 1959CACTAA TTAT AATTGAAAACACT TTTGTTAGTGTTTTC2430 2242 2233 1517 1960AACAAA AATT ATTGAAAACACTA TTTTGTTAGTGTTTT2431 2243 2234 1518 1961ACAAAA CAAT AAAACACTAACAA CAAATTTTGTTAGT2435 2247 2238 1519 1962AATTTG GTTTT AACACTAACAAAA TTCAAATTTTGTTAG2437 2249 2240 1520 1963TTTGAA TGTTACACTAACAAAAT ATTCAAATTTTGTTA 2438 2250 2241 1521 1964TTGAAT GTGT CACTAACAAAATT TATTCAAATTTTGTT 2439 2251 2242 1522 1965TGAATA AGTG ACTAACAAAATIT TTATTCAAATTTTGT2440 2252 2243 1523 1966GAATAA TAGT AATTCACTGTGTT TTAAATAACACAGT2483 2295 2286 1524 1967ATTTAA GAATT TCACTGTGTTATTT TCCTTAAATAACAC2486 2298 2289 1525 1968AAGGA AGTGA AAAAAGGTAAGCT AAGCATAGCTTAC2506 2318 2309 1526 1969ATGCTT CTTTTTT CAGTGTTTTAGCA AAGAAATGCTAAAA2555 2367 2358 1527 1970TTTCTT CACTG AGTGTTTTAGCAT CAAGAAATGCTAAA2556 2368 2359 1528 1971TTCTTG ACACT TGTTTTAGCATTTC CACAAGAAATGCT2558 2370 2361 1529 1972TTGTG AAAACA CATTTCTTGTGCT CAAGCCAGCACAA2566 2378 2369 1530 1973GGCTTG GAAATG TTTCTTGTGCTGG TACAAGCCAGCAC2568 2380 2371 1531 1974CTTGTA AAGAAA TTCTTGTGCTGGC TTACAAGCCAGCA2569 2381 2372 1532 1975TTGTAA CAAGAA TTGTGCTGGCTTG ACATTACAAGCCA2572 2384 2375 1533 1976TAATGT GCACAA TTGTAATGTAGGG TTTTTTCCCTACATT 2582 2394 2385 1534 1977AAAAAA ACAA AGTGCTGTTTTTTT CTTTTCAAAAAACA 2601 2413 2404 1535 1978GAAAAG GCACT TITGAAAAGATGG ATGACACCATCTTT2611 2423 2414 1536 1979TGTCAT TCAAA TGAAAAGATGGT AAATGACACCATCT2613 2425 2416 1537 1980GTCATTT TTTCA AAAAGATGGTGTC GGAAATGACACCA2615 2427 2418 1538 1981ATTTCC TCTTTT CCCTTCTTCCCAT TAAAACATGGGAA2634 2446 2437 1539 1982GTTTTA GAAGGG ATCCAGTTCCCA CAAATTTTGGGAAC2667 2479 2470 1540 1983AAATTTG TGGAT CCCAAAATTTGCA TAAGTATGCAAATT2675 2487 2478 1541 1984TACTTA TTGGG TTTAGGTGTGCTG CAAACACAGCACA2707 2519 2510 1542 TGTTTG 1985CCTAAA TTAGGTGTGCTGT CCAAACACAGCAC2708 2520 2511 1543 1986GTTTGG ACCTAA ACTGGAAAGCTC AAATGAAGAGCTTT2781 2593 2584 1544 1987TTCATTT CCAGT AGAGTTTTTTTCTAT TATAAATAGAAAAA2813 2625 2616 1545 1988TTATA ACTCTGTAGTGTATTTCTT GTGAAAAGAAATAC 2843 2655 2646 1546 1989TTCAC ACTAC TAGTGTATTTCTTT GGTGAAAAGAAAT2844 2656 2647 1547 1990TCACC ACACT AGTGTATTTCTTTT TGGTGAAAAGAAAT2845 2657 2648 1548 1991CACCA ACACT GTGTATTTCTTTTC TTGGTGAAAAGAAA2846 2658 2649 1549 1992ACCAA TACAC TGTATTTCTTTTCA TTTGGTGAAAAGAA2847 2659 2650 1550 1993CCAAA ATACA GTATTTCTTTTCAC GTTTGGTGAAAAGA2848 2660 2651 1551 1994CAAAC AATAC TATTTCTTTTCACC TGTTTGGTGAAAAG2849 2661 2652 1552 1995AAACA AAATA ATTTCTTTTCACCA CTGTTTGGTGAAAA2850 2662 2653 1553 1996AACAG GAAAT GTGGGACATTCTT GTGATAAAGAATGT2872 2684 2675 1554 1997TATCAC CCCAC CTCAGGAAGTGT GGTAACGACACTT2905 2717 2708 1555 1998CGTTACC CCTGAG GTGTCGTTACCC GAATTCTGGGTAA2913 2725 2716 1556 1999AGAATTC CGACAC TCACTATACTTCT CCAAGCAGAAGTA2963 2775 2766 1557 2000GCTTGG TAGTGA CTATACTTCTGCT GCACCAAGCAGAA 2966 2778 2769 1558 2001TGGTGC GTATAG TTGTCAGAGTAAT TCAAATATTACTCT2989 2801 2792 1559 2002ATTAGA GACAA TGTAAAGAATTAT CCTAGGATAATTCT3019 2831 2822 1560 2003CCTAGG TTACA AAAGAATTATCCT TATCCTAGGATAAT3022 2834 2825 1561 2004AGGATA TCTTT CAGATTTCAGATG CAGTAACATCTGAA3059 2871 2862 1562 2005TTACTG ATCTG TTTCAGATGTTAC AAAGCAGTAACAT3063 2875 2866 1563 2006TGCTTT CTGAAA CAGATGTTACTGC TTTAAAGCAGTAAC3066 2878 2869 1564 2007TTTAAA ATCTG AGATGTTACTGCT TTTTAAAGCAGTAA3067 2879 2870 1565 2008TTAAAA CATCT GTTACTGCTTTAA TTTGTTTTAAAGCA3071 2883 2874 1566 2009AACAAA GTAAC TTACTGCTTTAAAA ATTTGTTTTAAAGCA3072 2884 2875 1567 2010CAAAT GTAA TACTGCTTTAAAA GATTTGTTTTAAAG3073 2885 2876 1568 2011CAAATC CAGTA ACTGCTTTAAAAC TGATTTGTTTAAAG 3074 2886 2877 1569 2012AAATCA CAGT CTTAAAATATGCA TGTCATTGCATATTT3116 2928 2919 1570 2013ATGACA TAAGTAAAATATGCAAT AATGTCATTGCATA 3118 2930 2921 1571 2014GACATT TTTTA ATATGCAATGACA TCTAAATGTCATTG3122 2934 2925 1572 2015TTTAGA CATAT TATGCAATGACAT CTCTAAATGTCATT3123 2935 2926 1573 2016TTAGAG GCATA ATGCAATGACATT CCTCTAAATGTCAT3124 2936 2927 1574 2017TAGAGG TGCAT GCAATGACATTTA TACCTCTAAATGTC3126 2938 2929 1575 2018GAGGTA ATTGC CAATGACATTTAG TTACCTCTAAATGT3127 2939 2930 1576 2019AGGTAA CATTG AATGACATTIAGA GTTACCTCTAAATG3128 2940 2931 1577 2020GGTAAC TCATT TGACATTTAGAGG TGGTTACCTCTAAA3130 2942 2933 1578 2021TAACCA TGTCA GACATTTAGAGGT TTGGTTACCTCTAA3131 2943 2934 1579 2022AACCAA ATGTC AGAGGTAACCAA ATCAACATTGGTTA3138 2950 2941 1580 2023TGTTGAT CCTCT TGCTTTTACAACT AGTGTTAGTTGTAA3190 3002 2993 1581 2024AACACT AAGCA TTATCCTTGCTAA ATTTTCTTAGCAAG3235 3047 3038 1582 2025GAAAAT GATAA TATCCTTGCTAAG CATTTTCTTAGCAA3236 3048 3039 1583 2026AAAATG GGATA ATCCTTGCTAAGA CCATITTCTTAGCA3237 3049 3040 1584 2027AAATGG AGGAT TCCTTGCTAAGAA TCCATTTTCTTAGC3238 3050 3041 1585 2028AATGGA AAGGA CCTTGCTAAGAAA TTCCATTTCTTAG3239 3051 3042 1586 2029ATGGAA CAAGG AATGGAATTGATG GCCTACCATCAATT3251 3063 3054 1587 2030GTAGGC CCATT AATACAATTGGAT GGAAGAATCCAATT3307 3119 3110 1588 2031TCTTCC GTATT GTGTATTTCTGTC TGACCTGACAGAA3416 3228 3219 1589 2032AGGTCA ATACAC TGTATTTCTGTCA ATGACCTGACAGA3417 3229 3220 1590 2033GGTCAT AATACA GTATTTCTGTCAG AATGACCTGACAG3418 3230 3221 1591 2034GTCATT AAATAC TATTTCTGTCAGG AAATGACCTGACA3419 3231 3222 1592 2035TCATTT GAAATA ATTTCTGTCAGGT AAAATGACCTGAC3420 3232 3223 1593 2036CATTTT AGAAAT TTTCTGTCAGGTC TAAAATGACCTGAC3421 3233 3224 1594 2037ATTTTA AGAAA TTCTGTCAGGTCA TTAAAATGACCTGA3422 3234 3225 1595 2038TTTTAA CAGAAGAAI I I I I IACATG AGTGACATGTAAAA 3463 3275 3266 1596 2039TCACT AATTC AATTTTTTACATGT CAGTGACATGTAAA3464 3276 3267 1597 2040CACTG AAATT AGCTCACTGTGA AACACATTCACAGT3488 3300 3291 1598 2041ATGTGTT GAGCT AGTACACTACATT ATGTAAAATGTAGT3533 3345 3336 1599 2042TTACAT GTACT GTACGTAATCTCT ATTCCCAGAGATTA3556 3368 3359 1600 2043GGGAAT CGTAC GGTCAACAGACT TGCTTAAAGTCTGT3610 3422 3413 1601 2044TTAAGCA TGACC AAAGAAGAGTAAT GACGCTATTACTCT3636 3448 3439 1602 2045AGCGTC TGTT TGCAGACCATTC CAGTTCTGAATGGT3662 3474 3465 1603 2046AGAACTG CTGCA AGACCATTCAGA TGACAGTTCTGAAT3665 3477 3468 1604 2047ACTGTCA GGTCT GACCATTCAGAA GTGACAGTTCTGA3666 3478 3469 1605 2048CTGTCAC ATGGTC TTTGCTTCCATTTA Gi l I I IAAATGGAA 3793 3605 3596 1606 2049AAAAC GCAAA TTGCTTCCATTTAA AGTTTTTAAATGGA3794 3606 3597 1607 2050AAACT AGCAA GCTTCCATTTAAA TTAGI I I I IAAATGG3796 3608 3599 1608 2051AACTAA AAGC ATTTAAAAACTAAT TCTTGATTAG 11 111 3802 3614 3605 1609 2052CAAGA AAAT TTTAAAAACTAATC TTCTTGATTAGTTTT3803 3615 3606 1610 2053AAGAA TAAA TTAAAAACTAATC CTTCTTGATTAGTTT3804 3616 3607 1611 2054AAGAAG TTAA AAAACTAATCAAG TCCCTTCTTGATTA3807 3619 3610 1612 2055AAGGGA GTTTT AAACTAATCAAGA TTCCCTTCTTGATT3808 3620 3611 1613 2056AGGGAA AGTTT AACTAATCAAGAA TTTCCCTTCTTGATT3809 3621 3612 1614 2057GGGAAA AGTT ACTAATCAAGAAG TTTTCCCTTCTTGAT3810 3622 3613 1615 2058GGAAAA TAGT TAATCAAGAAGG TATTTTCCCTTCTTG3812 3624 3615 1616 2059GAAAATA ATTA AATCAAGAAGGG ATATTTTCCCTTCTT3813 3625 3616 1617 2060AAAATAT GATT GGAAAATATTGAG CACATTCTCAATAT3823 3635 3626 1618 2061AATGTG TTTCC GAAAATATTGAGA GCACATTCTCAATA3824 3636 3627 1619 2062ATGTGC TTTTC AAAATATTGAGAA TGCACATTCTCAAT3825 3637 3628 1620 2063TGTGCA ATTTTAAATATTGAGAAT ATGCACATTCTCAA 3826 3638 3629 1621 2064GTGCAT TATT AATATTGAGAATG TATGCACATTCTCA3827 3639 3630 1622 2065TGCATA ATATT ATATTGAGAATGT GTATGCACATTCTC3828 3640 3631 1623 2066GCATAC AATAT TTGAGAATGTGCA CTTGTATGCACATT3831 3643 3634 1624 2067TACAAG CTCAA AGAATGTGCATAC TTTCTTGTATGCAC3834 3646 3637 1625 2068AAGAAA ATTCT ATGTGCATACAAG GATTTTCTTGTATG3837 3649 3640 1626 2069AAAATC CACAT TGTGCATACAAGA TGATTTTCTTGTATG3838 3650 3641 1627 2070AAATCA CACA GTGCATACAAGA ATGATTTTCTTGTAT3839 3651 3642 1628 2071AAATCAT GCAC TGCATACAAGAAA AATGATTTTCTTGTA3840 3652 3643 1629 2072ATCATT TGCA GCATACAAGAAA TAATGATTTTCTTGT3841 3653 3644 1630 2073ATCATTA ATGC ATACAAGAAAATC ATTAATGATTTTCTT3843 3655 3646 1631 2074ATTAAT GTAT TACAAGAAAATCA AATTAATGATTTTCT3844 3656 3647 1632 2075TTAATT TGTA TCATTAATTTCCTG ATCTTCAGGAAATT3854 3666 3657 1633 2076AAGAT AATGA CATTAATTTCCTG CATCTTCAGGAAAT3855 3667 3658 1634 2077AAGATG TAATG ATTAATTTCCTGAA TCATCTTCAGGAAA3856 3668 3659 1635 2078GATGA TTAAT TTAATTTCCTGAA TTCATCTTCAGGAA3857 3669 3660 1636 2079GATGAA ATTAA TAATTTCCTGAAG ATTCATCTTCAGGA3858 3670 3661 1637 2080ATGAAT AATTA ATTTCCTGAAGAT AAATTCATCTTCAG3860 3672 3663 1638 2081GAATTT GAAAT TTTCCTGAAGATG GAAATTCATCTTCA3861 3673 3664 1639 2082AATTTC GGAAA TTCCTGAAGATGA AGAAATTCATCTTC3862 3674 3665 1640 2083ATTTCT AGGAA TCCTGAAGATGAA TAGAAATTCATCTT3863 3675 3666 1641 2084TTTCTA CAGGA TGAAGATGAATTT AGGTAGAAATTCAT3866 3678 3669 1642 2085CTACCT CTTCA ATTTCTACCTGTT GTTCACAACAGGT3875 3687 3678 1643 2086GTGAAC AGAAAT ACAAGGGATATTA TCATCATAATATCC3929 3741 3732 1644 2087TGATGA CTTGT CAAGGGATATTAT TTCATCATAATATC3930 3742 3733 1645 2088GATGAA CCTTGTTATGATGAATGTT AGCCAAACATTCAT 3939 3751 3742 1646 2089TGGCT CATAA AATGTTTGGCTTA CTCACATAAGCCA3947 3759 3750 1647 2090TGTGAG AACATT ATGTTTGGCTTAT ACTCACATAAGCC3948 3760 3751 1648 2091GTGAGT AAACAT GTGAGTACTAGA TTTTATCTCTAGTAC3961 3773 3764 1649 2092GATAAAA TCAC AAATGTTTTCAAG TTCTAACTTGAAAA4007 3819 3810 1650 2093TTAGAA CATTT TTTAAAACTTGTAT AAAGAATACAAGTT4074 3886 3877 1651 2094TCTTT TTAAA ACTTGTATTCTTTT TTCTCAAAAGAATA4080 3892 3883 1652 2095GAGAA CAAGT TCCAGTGACTAC AGGACAGGTAGTC4145 3957 3948 1653 2096CTGTCCT ACTGGA AGTGACTACCTGT ATAAGGACAGGTA4148 3960 3951 1654 2097CCTTAT GTCACT TGACTACCTGTC GTATAAGGACAGG4150 3962 3953 1655 2098CTTATAC TAGTCA TTATACCTAGTCTT TTAACAAGACTAGG4163 3975 3966 1656 2099GTTAA TATAA TATACCTAGTCTT TTTAACAAGACTAG4164 3976 3967 1657 2100GTTAAA GTATA ATACCTAGTCTTG TTTTAACAAGACTA4165 3977 3968 1658 2101TTAAAA GGTAT AGTCTTGTTAAAA AGAAAGTTTTAACA4171 3983 3974 1659 2102CTTTCT AGACT AACTTTCTTTTGCA TACCCTGCAAAAG4182 3994 3985 1660 2103GGGTA AAAGTT TCTTTTGCAGGGT CTAAATACCCTGC4187 3999 3990 1661 2104ATTTAG AAAAGA GGTTTACAGTCAG TCTGCACTGACTGT4211 4023 4014 1662 2105TGCAGA AAACC AGTGCAGAGTGG AACTTGCCCACTC4222 4034 4025 1663 2106GCAAGTT TGCACT CAAGTTAACAGAA CAAACTTTCTGTTA4235 4047 4038 1664 2107AGTTTG ACTTG AAGTTAACAGAAA TCAAACTTTCTGTT4236 4048 4039 1665 2108GTTTGA AACTT AGTTAACAGAAAG CTCAAACTTTCTGT4237 4049 4040 1666 2109TTTGAG TAACT GTTAACAGAAAGT GCTCAAACTTTCTG4238 4050 4041 1667 2110TTGAGC TTAAC TTAACAGAAAGTT AGCTCAAACTTTCT4239 4051 4042 1668 2111TGAGCT GTTAA AGCTAGAGATACT TTTTCCAGTATCTC 4254 4066 4057 1669 2112GGAAAA TAGCT GCTAGAGATACTTTTTCCAGTATCT4255 4067 4058 1670 2113GGAAAAA CTAGCCTAGAGATACTGTTTTTCCAGTATCT 4256 4068 4059 1671 2114GAAAAAA CTAG ACTGGAAAAAAAA GATCTTTTTTTTTC 4264 4076 4067 1672 2115AAGATC CAGT AAAAAAAGATCAA CATICTTTGATCTTT4272 4084 4075 1673 2116AGAATG TTT AAAAAAGATCAAA TCATTCTTTGATCTT4273 4085 4076 1674 2117GAATGA TTTT AAAAAGATCAAAG CTCATTCTTTGATC4274 4086 4077 1675 2118AATGAG TTTTT AAAGATCAAAGAA TTCTCATTCTTTGAT4276 4088 4079 1676 2119TGAGAA CTTT AAGATCAAAGAAT TTTCTCATTCTTTGA4277 4089 4080 1677 2120GAGAAA TCTT AGATCAAAGAATG TTTCTCATTCTTTG 4278 4090 4081 1678 2121AGAAAA ATCT GATCAAAGAATGA TTTTTCTCATTCTTT 4279 4091 4082 1679 2122GAAAAA GATC ATCAAAGAATGAG ATTTTTCTCATTCTT 4280 4092 4083 1680 2123AAAAAT TGAT AAAGAAT GAGAAA ACCATTTTTCTCATT 4283 4095 4086 1681 2124AATGGT CTTT AAGAATGAGAAAA CACCATTTTTCTCA4284 4096 4087 1682 2125ATGGTG TTCTT AGAATGAGAAAAA TCACCATTTTTCTC 4285 4097 4088 1683 2126TGGTGA ATTCT GAATGAGAAAAAT ATCACCATTTTTCT 4286 4098 4089 1684 2127GGTGAT CATTC AACTCTTTCCTCA TACACATGAGGAA4336 4148 4139 1685 2128TGTGTA AGAGTT ACTCTTTCCTCAT ATACACATGAGGA4337 4149 4140 1686 2129GTGTAT AAGAGT CTCTTTCCTCATG CATACACATGAGG 4338 4150 4141 1687 2130TGTATG AAAGAG TATGGTGCTCCTC AGTCATGAGGAGC4353 4165 4156 1688 2131ATGACT ACCATA GGTGCTCCTCAT ACGAGTCATGAGG4356 4168 4159 1689 2132GACTCGT AGCACC CTCCTCATGACT CAAGACGAGTCAT4360 4172 4163 1690 2133CGTCTTG GAGGAG CCTCATGACTCG TACAAGACGAGTC4362 4174 4165 1691 2134TCTTGTA ATGAGG TGTATTTTGCCTTT ATCAGAAAGGCAA4377 4189 4180 1692 2135CTGAT AATACA TATTTTGCCTTTCT GTATCAGAAAGGC4379 4191 4182 1693 2136GATAC AAAATA ATTTTGCCTTTCT GGTATCAGAAAGG4380 4192 4183 1694 2137GATACC CAAAAT TGCCTTTCTGATA GATGGGTATCAGA4384 4196 4187 1695 2138CCCATC AAGGCAGATACCCATCAG AGCAGTTCTGATG 4393 4205 4196 1696 2139AACTGCT GGTATC ATACCCATCAGA CAGCAGTTCTGAT4394 4206 4197 1697 2140ACTGCTG GGGTAT CTCTTTACCTTGC ATCTGGGCAAGGT4428 4240 4231 1698 2141CCAGAT AAAGAG TCTTTACCTTGCC GATCTGGGCAAGG4429 4241 4232 1699 2142CAGATC TAAAGA AAGGAATGCTTTA TGATCATAAAGCAT4455 4267 4258 1700 2143TGATCA TCCTT GGAATGCTTTATG GTTGATCATAAAGC4457 4269 4260 1701 2144ATCAAC ATTCC AATGCTTTATGAT AAGTTGATCATAAA4459 4271 4262 1702 2145CAACTT GCATT ATGCTTTATGATC CAAGTTGATCATAA4460 4272 4263 1703 2146AACTTG AGCAT TGCTTTATGATCA GCAAGTTGATCATA4461 4273 4264 1704 2147ACTTGC AAGCA GCTTTATGATCAA GGCAAGTTGATCA4462 4274 4265 1705 2148CTTGCC TAAAGC TTTATGATCAACTT ATGGCAAGTTGAT4464 4276 4267 1706 2149GCCAT CATAAA TCAACTTGCCATA CAGTCCTATGGCA4471 4283 4274 1707 2150GGACTG AGTTGA CAACTTGCCATA TCAGTCCTATGGC4472 4284 4275 1708 2151GGACTGA AAGTTG AACTTGCCATAG ATCAGTCCTATGG4473 4285 4276 1709 2152GACTGAT CAAGTT ACTTGCCATAGG CATCAGTCCTATG4474 4286 4277 1710 2153ACTGATG GCAAGT AACCAGTGTTCG ATAAAGCCGAACA4497 4309 4300 1711 2154GCTTTAT CTGGTT ACCAGTGTTCGG AATAAAGCCGAAC4498 4310 4301 1712 2155CTTTATT ACTGGT CCAGTGTTCGGC AAATAAAGCCGAA4499 4311 4302 1713 2156TTTATTT CACTGG GGCTTTATTTGAA ATAGACTTCAAATA4508 4320 4311 1714 2157GTCTAT AAGCC CTTTATTTGAAGT GCATAGACTTCAAA4510 4322 4313 1715 2158CTATGC TAAAG TATGCCCTGCAC AAGAGCTGTGCAG4524 4336 4327 1716 2159AGCTCTT GGCATA TTAGATGCTAGAA AAAAACTTCTAGCA4552 4364 4355 1717 2160GTTTTT TCTAA CTAGAAGTTTTTTT ATGCTAAAAAAACT 4559 4371 4362 1718 2161AGCAT TCTAG AGAAGI H I H IAG ACATGCTAAAAAAA4561 4373 4364 1719 2162CATGT CTTCT AGTTTTTTT AGCAT ATCACATGCTAAAA 4564 4376 4367 1720 2163GTGAT AAACTGTTTTTTT AGCATG CATCACATGCTAAA 4565 4377 4368 1721 2164TGATG AAAAC TTTAGCATGTGAT TCACACATCACAT4570 4382 4373 1722 2165GTGTGA GCTAAA TGTGTGATTCTTG TTCAAACAAGAATC4582 4394 4385 1723 2166TTTGAA ACACA TTCTAGGTACCTT ATTCACAAGGTAC4601 4413 4404 1724 2167GTGAAT CTAGAA CTAGGTACCTTGT GAAUCACAAGGTA4603 4415 4406 1725 2168GAAUC CCTAG CCTTGTGAAUCC UTTCTGGAAUCA4610 4422 4413 1726 2169AGAAAA CAAGG CTTGTGAATTCCA TTTTTCTGGAATTCA 4611 4423 4414 1727 2170GAAAAA CAAG TGAATTCCAGAAA TCTCTTTTTCTGGA 4615 4427 4418 1728 2171AAGAGA ATTCA ATTGTTAGTCCCA AGTTCATGGGACT4646 4458 4449 1729 2172TGAACT AACAAT TTGTTAGTCCCAT AAGTTCATGGGAC4647 4459 4450 1730 2173GAACTT TAACAA TGTTAGTCCCATG CAAGTTCATGGGA4648 4460 4451 1731 2174AACTTG CTAACA GTTAGTCCCATGA GCAAGTTCATGGG4649 4461 4452 1732 2175ACTTGC ACTAAC TTAGTCCCATGAA TGCAAGTTCATGG4650 4462 4453 1733 2176CTTGCA GACTAA TAGTCCCATGAA GTGCAAGTTCATG4651 4463 4454 1734 2177CTTGCAC GGACTA CAATCAGGAAAA TTGGGTTTTTCCT4702 4514 4505 1735 2178AACCCAA GATTG CAGGAAAAAACC GGTGTTGGGTTITT4706 4518 4509 1736 2179CAACACC TCCTG AAAATAGAATCAT CATGATATGATTCT4735 4547 4538 1737 2180ATCATG ATTTT AAATAGAATCATA TCATGATATGAUC4736 4548 4539 1738 2181TCATGA TATT AATAGAATCATAT TTCATGATATGATT4737 4549 4540 1739 2182CATGAA CTATT CATATCATGAAAT TTTAAATTTCATGA4745 4557 4548 1740 2183TTAAAA TATG ATATCATGAAATTT TTTTTAAATTTCATG 4746 4558 4549 1741 2184AAAAA ATAT ATCATGAAATTTAA TCTTTTTAAATTTCA 4748 4560 4551 1742 2185AAAGA TGAT TCATGAAAUTAAA TTCTTTTTAAATTTC4749 4561 4552 1743 2186AAGAA ATGA AAUTAAAAAGAAT AAGAGATTCTTTTTA 4755 4567 4558 1744 2187CTCTT AAU ATTTAAAAAGAAT GAAGAGATTCTTTT4756 4568 4559 1745 2188CTCTTC TAAATAGTAACAGCTAC CTTAAATGTAGCTG 4796 4608 4599 1746 2189ATTTAAG TTACT GTAACAGCTACAT ACTTAAATGTAGCT4797 4609 4600 1747 2190TTAAGT GTTAC GAGATGGTGGTTT TCCACTAAACCAC4850 4662 4653 1748 2191AGTGGA CATCTC AGATGGTGGTTTA TTCCACTAAACCA4851 4663 4654 1749 2192GTGGAA CCATCT GATGGTGGTTTAG ATTCCACTAAACCA4852 4664 4655 1750 2193TGGAAT CCATC ATGGTGGTTTAGT TATTCCACTAAACC4853 4665 4656 1751 2194GGAATA ACCAT TGGTGGTTTAGT G TTATTCCACTAAAC4854 4666 4657 1752 2195GAATAA CACCA TTAGTGGAATAAA AATCAGTTTATTCC4861 4673 4664 1753 2196CTGATT ACTAA TCATCACAGATAC TGGAAAGTATCTGT4923 4735 4726 1754 2197TTTCCA GATGA|00176| Table IB provides exemplary IC50, arid Knockdown, for certain siRNAs comprising modified sense strand and modified antisense strand. The position in transcript listed in column 1 is the beginning position of the target sequence in the transcript. The target sequence is 19 nucleotide long starting from the beginning position. For example, column 1 row 1 shows that the beginning position of the target sequence is 1801, which means that the target sequence is the sequence corresponding to positions 1801-1819 of ACVR2A RefSeq ID NM_001278579.2 (SEQ ID NO: 1309). In Table IB, the sequences are shown from the 5’ end to the 3’ end, The modified sense strands each have 19 nucleotides, and the modified antisense strands each have 21 nucleotides. The knockdown (“KD”) results are shown as % mRNA expression at 10 nM dosage.Table IBPosition inmRNAtranscriptSEQ SEQ expression 1C50 NM_ Sense strand Antisense strandID NO ID NO % at 10 (pM) 001278579.nM2csusagUfclIfAfllf usGfscaaCfcAfUfcaua1801 655 982 44.9±2.2gaugguugca GfaCfuagsusuasusggGfaCfUfCf usUfsccaGfuUfCfagag1840 656 983 40.4±1.5ugaacuggaa UfcCfcaususuusgsggAfcUfCfUf usCfsuccAfgUfUfcaga1841 657 984 55.3±3.8gaacuggaga GfuCfccasusugsgsgaCfuCfUfGf usGfscucCfaGfUfucag1842 658 985 64.5±0.8 aacuggagca AfgUfcccsusu gsgsacUfcUfGfAf usAfsgcuCfcAfGfuuca1843 659 986 63.9±2.0 acuggagcua GfaGfuccsusu gsascuCfuGfAfAf usCfsagcUfcCfAfguuc1844 660 987 43.0±0.7 cuggagcuga AfgAfgucsusu ascsucUfgAfAfCf usGfscagCfuCfCfaguu1845 661 988 41.3±0.9 uggagcugca CfaGfagususu usgsaaCfuGfGfAf usCfsuuaGfcAfGfcucc1849 662 989 44.1±2.3 gcugcuaaga AfgUfucasusu asasauCfaAfGfGf usCfscaaAfaGfAfuccu2082 663 990 23.7±0.8 aucuuuugga UfgAfuuususu asgsgaUfcUfUfUf usCfscagGfuCfCfaaaa2088 664 991 41.2±2.4 uggaccugga GfaUfccususu gsgsauCfullfUfUf usGfsccaGfgUfCfcaaa2089 665 992 56.4±2.9 ggaccuggca AfgAfuccsusu gsasucUfulifUfGf usAfsgccAfgGfUfccaaA 2090 666 993 64.1±0.7 gaccuggcua AAfaGfaucsusu asuscuUfullfGfGf usUfsagcCfaGfGfucca 2091 667 994 49.3±1.3 accuggcuaa AfaAfgaususu uscsuuUfuGfGfAf usUfsuagCfcAfGfgucc2092 668 995 50.1±1.9 ccuggcuaaa AfaAfagasusu csusuullfgGfAfCf usAfsuuaGfcCfAfgguc2093 669 996 34.5±0.4 cuggcuaaua CfaAfaagsusu uscsuuAfaUfGfUf usUfsucuGfaCfAfgaca2138 670 997 32.7±4.1 cugucagaaa UfuAfagasusu csusuaAfuGfUfCf usCfsuucUfgAfCfagac2139 671 998 21.1±1.0 ugucagaaga AfuUfaagsusu asasauGfaCfUfAf usGfscauUfaCfAfauag2265 672 999 38.1±0.9 uuguaaugca UfcAfuuususu asasugAfcUfAfUf usGfsgcaUfuAfCfaaua2266 673 1000 38.8±2.1 uguaaugcca GfuCfauususu asusgaCfuAfUfUf usUfsggcAfuUfAfcaauA 2267 674 1001 41.6±1.0 guaaugccaa AAfgUfcaususuususguGfaAfUfGf usCfsacaCfuAfAfacau2297 675 1002 72.6±0.6 uuuaguguga UfcAfcaasusu usgsaaUfgUfUfUf usCfsagcAfcAfCfuaaa2300 676 1003 76.2±4.4 agugugcuga CfaUfucasusu gsasauGfuUfUfAf usGfscagCfaCfAfcuaa2301 677 1004 79.6±5.6 gugugcugca AfcAfuucsusu asasugUfuUfAfGf u sAf sgc a Gf cAf Cf a c u a2302 678 1005 48.0±3.9 ugugcugcua AfaCfauususu ususuaGfuGfUfGf usGfsaacAfgCfAfgcacA 2306 679 1006 88.9±6.2 cugcuguuca fcUfUfaaasusu ususagUfgUfGfCf usAfsgaaCfaGfCfagca2307 680 1007 33.5±1.0 ugcuguucua CfaCfuaasusu usgsugCfuGfCfUf usAfscacAfgAfAfcagcA2311 681 1008 66.2±0.4 guucugugua AfgCfacasusu gsusgcUfgCfUfGf usUfsacaCfaGfAfacag2312 682 1009 42.3±1.1 uucuguguaa CfaGfcacsusu usgscuGfcUfGfUf usGfsuacAfcAfGfaaca2313 683 1010 60.0±0.6 ucuguguaca GfcAfgcasusu gscsugCfuGfUfUf usUfsguaCfaCfAfgaac2314 684 1011 43.5±2.0 cuguguacaa AfgCfagcsusu csusgcUfgUfUfCf usAfsuguAfcAfCfagaaC 2315 685 1012 41.9±1.5 uguguacaua AfaGfcagsusu asasguCfaUfCfAf usAfscccCfaCfUfuuga2334 686 1013 35.2±3.3 aaguggggua UfgAfcuususu asgsucAfuCfAfAf usUfsaccCfcAfCfuuug2335 687 1014 34.4±0.7 agugggguaa AfuGfacususu gsuscaUfcAfAfAfg usGfsuacCfcCfAfcuuu2336 688 1015 67.9±4.2 ugggguaca GfaUfgacsusu uscsauCfaAfAfGf usUfsguaCfcCfCfacuu2337 689 1016 41.6±0.3 ugggguacaa UfgAfugasusu csasucAfaAfGfUf usCfsuguAfcCfCfcacu2338 690 1017 38.3±0.4 gggguacaga UfuGfaugsusu asuscaAfaGflifGf usAfscugUfaCfCfccac2339 691 1018 55.1±0.2 ggguacagua UfuUfgaususuuscsaaAfglifGfGf uslifsacuGfuAfCfccca2340 692 1019 70.7±4.2 gguacaguaa CfuUfugasusu csasaaGfuGfGfGf usUfsuacllfgUfAfcccc2341 693 1020 75.6±1.2 guacaguaaa AfcUfuugsusu asasagUfgGfGfGf uslIfsuuaCfuGfUfaccc 2342 694 1021 50.7±2.0 uacaguaaaa CfaCfuuususu asasguGfgGfGfUf usCfsuuuAfcUfGfuacc2343 695 1022 41.7±1.3 acaguaaaga CfcAfcuususu asgsugGfgGfUfAf usUfscuuUfaCfUfguac2344 696 1023 57.2±3.3 caguaaagaa CfcCfacususu usgsggGfuAfCfAf usCfscucUfullfAfcugu2346 697 1024 54.8±2.3 guaaagagga AfcCfccasusu gsgsggUfaCfAfGf usGfsccuCfuUfUfacug 2347 698 1025 59.6±1.8 uaaagaggca UfaCfcccsusu gsgsguAfcAfGfUf usAfsgccUfcUfUfuacu2348 699 1026 78.8±1.6 aaagaggcua GfuAfcccsusu usascaGfuAfAfAf usGfsgaaGfcCfUfcuuu 2351 700 1027 45.2±2.9 gaggcuucca AfcUfguasusu ascsaglifaAfAfGf uslifsggaAfgCfCfucuu2352 701 1028 35.0±2.5 aggcuuccaa UfaCfugususu csasguAfaAfGfAf usUfsuggAfaGfCfcucu2353 702 1029 41.0±1.9 ggcuuccaaa UfuAfcugsusu asgsuaAfaGfAfGf usCfsuugGfaAfGfccuc2354 703 1030 42.0±0.9 gcuuccaaga Ufullfacususu ususccAfaGfCfAf usUfsuaaAfgllfAfaugc2365 704 1031 39.0±1.4 uuacuuuaaa UfuGfgaasusu uscscaAfgCfAfUf usGfsuuaAfaGfUfaaug2366 705 1032 38.1±2.2 uacuuuaaca CfuUfggasusu cscsaaGfcAfUfUf usGfsguuAfaAfGfuaau2367 706 1033 49.7±2.6 acuuuaacca GfcUfuggsusu csasagCfallfUfAf u sAf sggu Uf a Af Af gu a a U 2368 707 1034 40.3±0.8 cuuuaaccua fgCfuugsusu ususacUfullfAfAf uslifsgagGfgAfGfguua2374 708 1035 55.5±3.5 ccucccucaa AfaGfuaasusuusascullfuAfAfCf uslifsugaGfgGfAfgguu2375 709 1036 46.5±0.8 cucccucaaa AfaAfguasusu ascsuulifaAfCfCf usGfsuugAfgGfGfaggu2376 710 1037 36.5±1.6 ucccucaaca UfaAfagususu ususuaAfcCfUfCf uslifsuguUfgAfGfggag2378 711 1038 74.8±4.6 ccucaacaaa Gfullfaaasusu ususaaCfcUfCfCf usCfsuugUfuGfAfggga2379 712 1039 45.8±4.5 cucaacaaga GfgUfuaasusu cscsucCfcUfCfAf usAfsuacCfuUfGfuuga2383 713 1040 54.5±1.1 acaagguaua GfgGfaggsusu csusccCfuCfAfAf usUfsauaCfcUfUfguug2384 714 1041 42.6±2.0 caagguauaa AfgGfgagsusu uscsccUfcAfAfCf usGfsuauAfcCfUfuguii2385 715 1042 73.8±1.8 aagguauaca GfaGfggasusu cscscuCfaAfCfAf usGfsguaUfaCfCfuugu2386 716 1043 44.8±1.2 agguauacca UfgAfgggsusu cscsucAfaCfAfAf usAfsgguAfuAfCfcuugU2387 717 1044 37.6±1.2 gguauaccua fuGfaggsusu gsgsuallfaCfCfllf usGfsuggAfaCfUfgagg2396 718 1045 45.9±2.8 caguuccaca UfaUfaccsusu gsusauAfcCfUfCf usCfsgugGfaAfCfugag2397 719 1046 69.2±8.2 aguuccacga GfuAfuacsusu usasuaCfcUfCfAf usCfscguGfgAfAfcuga2398 720 1047 110.2±4.5 guuccacgga GfgUfauasusu asusacCfuCfAfGf u sAf sc cgUf gGf Af a c u gA2399 721 1048 52.7±3.8 uuccacggua fgGfuaususu usasccUfcAfGfUf usAfsaccGfuGfGfaacu2400 722 1049 43,4*2.5 uccacgguua GfaGfguasusu ascscuCfaGfUfUf usCfsaacCfgUfGfgaac2401 723 1050 46.5±2.2 ccacgguuga UfgAfggususu cscsucAfgUfUfCf usGfscaaCfcGfUfggaa2402 724 1051 39.3±1.4 cacgguugca CfuGfaggsusu uscsagUfuCfCfAf usUfsagcAfaCfCfguggA2404 725 1052 39.0±1.4 cgguugcuaa faCfugasusucsasguUfcCfAfCf uslIfsuagCfaAfCfcgug2405 726 1053 50.5±1.6 gguugcuaaa GfaAfcugsusu asgsuuCfcAfCfGf usUfsuuaGfcAfAfccgu2406 727 1054 67.5±4.2 guugcuaaaa GfgAfacususu gsusucCfaCfGfGf usAfsuuuAfgCfAfaccgU2407 728 1055 57.8±1.3 uugcuaaaua fgGfaacsusu ususccAfcGfGfUf usAfsauuUfaGfCfaacc2408 729 1056 50.3±1.8 ugcuaaauua GfuGfgaasusu asgscuAfuGfCfUf usUfsuggCfaCfUfaagc2515 730 1057 59.9±3.8 uagugccaaa AfuAfgcususu gscsugGfclIfUfGf usCfscuaCfaUfUfacaa2576 731 1058 83.5±2.0 uaauguagga GfcCfagcsusu gsgscullfgUfAfAf usUfsuccCfuAfCfauua2579 732 1059 85,2*3.9 uguagggaaa CfaAfgccsusu gscsuuGfuAfAfUf usUfsuucCfcUfAfcauu2580 733 1060 94.2±3.9 guagggaaaa AfcAfagcsusu csasguUfcCfCfAf usUfsgcaAfaUfUfuugg2670 734 1061 92.8±3.5 aaauuugcaa GfaAfcugsusu asgsuuCfcCfAfAf usAfsugcAfaAfUfuuug2671 735 1062 104.9±2.3 aauuugcaua GfgAfacususu gsusucCfcAfAfAf usUfsaugCfaAfAfuuuu2672 736 1063 107.8±5.1 auuugcauaa GfgGfaacsusu cscsaaAfallfUfUf usUfsaagUfaUfGfcaaa2676 737 1064 97.7*2.8 gcauacuuaa Ufullfuggsusu gsusgaGfclIfGfUf usUfsccaGfuGfUfcaca2769 738 1065 69.1*2.6 gacacuggaa Gfcllfcacsusu gsasgclIfgllfGfAf usUfsuucCfaGfUfguca2771 739 1066 68.0*1.0 cacuggaaaa CfaGfcucsusu asgscuGfuGfAfCf usCfsuuuCfcAfGfuguc277r> 740 1067 78.5*5.8 acuggaaaga AfcAfgcususu gscsugUfgAfCfAf usGfscuullfcCfAfgugu2773 741 1068 93.1*2.5 cuggaaagca CfaCfagcsusu csusguGfaCfAfCf usAfsgcuUfuCfCfagug2774 742 1069 84.1*3.4 uggaaagcua UfcAfcagsusuusgsugAfcAfCflif usGfsagcUfuUfCfcagu2775 743 1070 86.5*4.3 ggaaagcuca GfuCfacasusu gsusgaCfaCfUfGf usAfsgagCfullfUfccag2776 744 1071 71.1*3.9 gaaagcucua UfgUfcacsusu usgsacAfcUfGfGf usAfsagaGfcUfUfucca2777 745 1072 66.2*4.0 aaagcucuua GfuGfucasusu gsascaCfuGfGfAf usGfsaagAfgCfUfuucc2778 746 1073 37.9±1.4 aagcucuuca AfgUfgucsusu ascsacUfgGfAfAf usUfsgaaGfaGfCfuuuc2779 747 1074 62.8±2.5 agcucuucaa CfaGfugususu csascuGfgAfAfAf usAfsugaAfgAfGfcuuu2780 748 1075 52.3±1.6 gcucuucaua CfcAfgugsusu uscsuuUfuCfAfCf usCfsacuGfuUfUfggug2853 749 1076 72,9*4.2 caaacaguga AfaAfagasusu csusuuUfcAfCfCf usAfscacUfgUfUfuggu2854 750 1077 70.7±3.2 aaacagugua GfaAfaagsusu ususuuCfaCfCfAf usCfsacaCfuGfUfuugg2855 751 1078 50.0±1.9 aacaguguga UfgAfaaasusu ususucAfcCfAfAf usAfscacAfclIfGfuuug2856 752 1079 83.1±2.0 acagugugua GfuGfaaasusu ususcaCfcAfAfAf usCfsacaCfaCfUfguuu2857 753 1080 65.8±2.9 caguguguga GfgUfgaasusu uscsacCfaAfAfCf usCfscacAfcAfCfuguu2858 754 1081 60.5*3.0 agugugugga UfgGfugasusu csasccAfaAfCfAf usCfsccaCfaCfAfcugu2859 755 1082 54.9*2.3 guguguggga UfuGfgugsusu ascscaAfaCfAfGf usUfscccAfcAfCfacug2860 756 1083 76.8*2.3 ugugugggaa Ufullfggususu ususagGfaUfCfAf usUfsuccUfgAfGfguga2895 757 1084 67.7*4.1 ccucaggaaa UfcCfuaasusu usasggAfuCfAfCf usCfsuucCfuGfAfggug2896 758 1085 63.8*2.4 cucaggaaga AfuCfcuasusu asgsgallfcAfCfCf usAfscuuCfcUfGfaggu2897 759 1086 57.8*1.8 ucaggaagua GfaUfccususugsgsauCfaCfCfUf usCfsacuUfcCfUfgagg2898 760 1087 56.8±5.9 caggaaguga UfgAfuccsusu gsasucAfcCfUfCf usAfscacUfuCfCfugag2899 761 1088 49.0±6.3 aggaagugua GfuGfaucsusu asuscaCfcUfCfAf usGfsacaCfuUfCfcuga2900 762 1089 34.4±2.4 ggaaguguca GfgUfgaususu gsascuUfgUfAfAf usGfsugaUfaAfAfguua2949 763 1090 54.2±5.6 cuuuaucaca CfaAfgucsusu uscsugCfuUfGfGf usAfsagaUfgGfCfacca2973 764 1091 50.7±4.6 ugccaucuua AfgCfagasusu csusgclIfuGfGfUf usCfsaagAfuGfGfcacc2974 765 1092 69.9±2.5 gccaucuuga AAfaGfcagsusu usgscuUfgGfUfGf usAfscaaGfaUfGfgcac2975 766 1093 74.1±3.2 ccaucuugua CfaAfgcasusu gscsuuGfgUfGfCf usGfsacaAfgAfUfggca2976 767 1094 79.7±2.6 caucuuguca CfcAfagcsusu csusugGfuGfCfCf usllf sgacAf aGf Af uggcA2977 768 1095 70.3±1.8 aucuugucaa fcCfaagsusu ususggUfgCfCfAf usCfsugaCfaAfGfaugg2978 769 1096 55.3±2.1 ucuugucaga CfaCfcaasusu usgsguGfcCfAfUf usUfscugAfcAfAfgaugG2979 770 1097 72.1±5.3 cuugucagaa fcAfccasusu gsgsugCfcAfUfCf usCfsucuGfaCfAfagau2980 771 1098 95.5±1.3 uugucagaga GfgCfaccsusu gsusgcCfaUfCfUf u sAf sc u c Uf gAf Of a a ga2981 772 1099 86.0±6.1 ugucagagua UfgGfcacsusu usgsccAfuCfllfUf usUfsacuCfuGfAfcaag2982 773 1100 96,3*12.0 gucagaguaa AfuGfgcasusu gscscaUfcUfUfGf usUfsuacUfcUfGfacaa2983 774 1101 83.9±2.9 ucagaguaaa GfaUfggcsusu cscsauCfuUfGfUf usAfsuuaCfuCfUfgaca2984 775 1102 62.2±2,1 cagaguaaua AfgAfuggsusu csasucUfuGfUfCf uslifsauuAfcUfCfugac2985 776 1103 71.5±5.4 agaguaauaa AfaGfaugsusucsusugUfcAfGfAf usAfsaauAfuUfAfcucu2988 777 1104 73.0±2.5 guaauauuua GfaCfaagsusu gsuscaGfaGfUfAf usAfsucaAfallfAfuuac2991 778 1105 63.5±1.6 auauuugaua UfcUfgacsusu asusuuGfalifGfUf usAfsuauCfaCfAfgaca3002 779 1106 54.2±1.9 cugugauaua UfcAfaaususu ususugAfuGfUfCf usCfsauallfcAfCfagac3003 780 1107 53.0±0.4 ugugauauga AfuCfaaasusu ususgaUfgUfCfUf usAfscauAfuCfAfcaga3004 781 1108 62.8±2.6 gugauaugua Cfallfcaasusu usgsauGfuCfUfGf usUfsacaUfaUfCfacag3005 782 1109 73.0±1.5 ugauauguaa AfcAfucasusu ascsuuUfaAfGfCf usCfsugaAfaUfCfugcu3051 783 1110 79,9*2.0 agauuucaga UfaAfagususu csusuuAfaGfCfAf usUfscugAfaAfUfcugc3052 784 1111 79.6±1.3 gauuucagaa UfuAfaagsusu ususuaAfgCfAfGf usAfsucuGfaAfAfucug3053 785 1112 78.6±0.9 auuucagaua Cfullfaaasusu asgsuuCfaUfGfCf usAfsaggAfuAfAfggcali 3225 786 1113 91.7±1.6 cuuauccuua fgAfacususu gsuscaGfgAfGfCf usUfscacAfgUfGfagcu3482 787 1114 58.7±3.1 ucacugugaa CfcUfgacsusu uscsagGfaGfCfUf usUfsucaCfaGfUfgagc3483 788 1115 45.0*1.9 cacugugaaa UfcCfugasusu csasggAfgCfUfCf usAfsuucAfcAfGfugag3484 789 1116 62.5*1.6 acugugaaua CfuCfcugsusu asgsgaGfcUfCfAf usCfsauuCfaCfAfguga3485 790 1117 68.0*1.5 cugugaauga Gfcllfccususu csasauAfcAfUfAf usCfsuguUfgAfCfcuau3601 791 1118 52.5*1.1 ggucaacaga GfuAfuugsusu asasuaCfaUfAfGf usUfscugUfuGfAfccua3602 792 1119 47.8*0.7 gucaacagaa UfgUfauususu asusacAfuAfGfGf usGfsucuGfullfGfaccu3603 793 1120 57.9*2.4 ucaacagaca AfuGfuaususuusascallfaGfGfUf usAfsguclIfgUfUfgacc3604 794 1121 48.8±5.1 caacagacua UfaUfguasusu ascsauAfgGfUfCf usAfsaguCfuGflifugac3605 795 1122 50.6±2.1 aacagacuua CfuAfugususu asusagGfuCfAfAf uslIfsaaaGfuCfUfguug3607 796 1123 41.3±1.7 cagacuuuaa AfcCfuaususu usasggUfcAfAfCf usUfsuaaAfgllfCfuguu3608 797 1124 51.8±1.9 agacuuuaaa GfaCfcuasusu asgsguCfaAfCfAf usCfsuuaAfaGfUfcugu3609 798 1125 46.8±2.4 gacuuuaaga UfgAfccususu asusaaGfaAfUfGf usUfscacUfgGfAfacau4135 799 1126 42.8±1.5 uuccagugaa UfcUfuaususu usasagAfallfGfUf usGfsucaCfuGfGfaaca 4136 800 1127 41.2±1.8 uccagugaca UfuCfuuasusu asasgaAfuGfUfUf usAfsgucAfcUfGfgaacA 4137 801 1128 47.4±2.2 ccagugacua fuUfcuususu asgsaaUfgUfUfCf usUfsaguCfaCfUfggaa4138 802 1129 52.3±4.4 cagugacuaa CfaUfucususu gsasauGfuUfCfCf usGfsuagUfcAfCfugga4139 803 1130 60.8±2.1 agugacuaca AfcAfuucsusu asasugUfuCfCfAf usGfsguaGfuCfAfcugg4140 804 1131 63.4±3.5 gugacuacca AfaCfauususu asusguUfcCfAfGf usAfsgguAfgUfCfacug4141 805 1132 47.8±0.6 ugacuaccua GfaAfcaususu usasccUfaGfUfCf usUfsuuuAfaCfAfagac4166 806 1133 35.5±0.5 uuguuaaaaa UfaGfguasusu ascscuAfgllfCfUf usGfsuuuUfaAfCfaaga4167 807 1134 36,9*0.8 uguuaaaaca CfuAfggususu cscsuaGfuCfUfUf usAfsguuUfuAfAfcaagA 4168 808 1135 50.9±1.5 guuaaaacua fcllfaggsusu usasguGfuUflifGf usAfscugUfaAfAfccaaA 4203 809 1136 52.4±1.1 guuuacagua fcAfcuasusu ususuuGfcCfUfUf usGfsguaUfcAfGfaaag4381 810 1137 57.9±1.6 ucugauacca GfcAfaaasusuususugCfcUfUfUf usGfsgguAfuCfAfgaaa4382 811 1138 95.8*1.6 cugauaccca GfgCfaaasusu ususgcCfuUfUfCf usUfsgggUfallfCfagaa4383 812 1139 95.2±8.2 ugauacccaa AfgGfcaasusu gsasauGfcUfUflif usGfsuugAfuCfAfuaaa4458 813 1140 69.6±2.0 augaucaaca GfcAfuucsusu csasuaGfgAfCfUf usUfsaauCfcAfUfcagu4480 814 1141 86.1±2.9 gauggauuaa CfcUfaugsusu asusagGfaCfUfGf usUfsuaaUfcCfAfucag4481 815 1142 93.0±3.7 auggauuaaa UfcCfuaususu usasggAfcUfGfAf usGfsuuaAfuCfCfauca4482 816 1143 50.7±2.5 uggauuaaca GfuCfcuasusu asgsgaCfuGfAfUf usGfsguuAfaUfCfcauc4483 817 1144 59,7*0.7 ggauuaacca AfgUfccususu gsgsacUfgAfUfGf usUfsgguUfaAfUfccau4484 818 1145 68.2±3.4 gauuaaccaa CfaGfuccsusu csusgaUfgGfAfUf usCfsacuGfgUfUfaauc 4487 819 1146 80.3±5.3 uaaccaguga CfaUfcagsusu usgsauGfgAfUfUf usAfscacUfgGfUfuaau4488 820 1147 63.6±2.3 aaccagugua CfcAfucasusu gsasugGfallfUfAf usAfsacaCfuGfGfuuaa4489 821 1148 49.5±1.9 accaguguua UfcCfaucsusu ususuaUfuUfGfAf usGfscauAfgAfCfuuca4511 822 1149 87.5*1.7 agucuaugca AfaUfaaasusu ususauUfuGfAfAf usGfsgcaUfaGfAfcuuc4512 823 1150 76.2*2.9 gucuaugcca AfaAfuaasusu usasuuUfgAfAfGf usGfsggcAfuAfGfacuu4513 824 1151 76.3*1.4 ucuaugccca CfaAfauasusu asusuuGfaAfGfUf u sAf sgggCf a Uf Afga c u U 4514 825 1152 71.5*1.7 cuaugcccua fcAfaaususu ususgaAfgUfCfUf usGfscagGfgCfAfuaga4516 826 1153 86.5*2.1 augcccugca Cfullfcaasusu usgsaaGfuCfUfAf uslIfsgcaGfgGfCfauag4517 827 1154 92.3*5.7 ugcccugcaa AfcUfucasusugsasagUfcUfAflif usGfsugcAfgGfGfcaua4518 828 1155 98.1*3.7 gcccugcaca GfaCfuucsusu asasguCfuAfUfGf usUfsgugCfaGfGfgcau4519 829 1156 90.2±2.1 cccugcacaa AfgAfcuususu asgsucUfaUfGfCf usCfsuguGfcAfGfggca4520 830 1157 63.3±3.3 ccugcacaga UfaGfacususu ususuuUfaGfCfAf usCfsacaUfcAfCfaugc4568 831 1158 67.0±1.8 ugugauguga UfaAfaaasusu ususuuAfgCfAfUf usAfscacAfuCfAfcaug4569 832 1159 96.4±1.2 gugaugugua CfuAfaaasusu ususagCfaUfGfUf usUfscacAfcAfUfcaca4571 833 1160 89.2±6.1 gaugugugaa UfgCfuaasusu usasggUfaCfCfUf usGf sa a u Uf cAfCfa agg4604 834 1161 59,3*2.6 ugugaauuca UfaCfcuasusu asgsguAfcCfUfUf usGfsgaaUfuCfAfcaag4605 835 1162 48.1±0.9 gugaauucca GfuAfccususu gsgsuaCfcUfUfGf usUfsggaAfuUfCfacaa4606 836 1163 89.4±1.5 ugaauuccaa GfgUfaccsusu usasuuUfcUfGfGf uslifscaaUfgGfAfacca467 837 1164 23.4±1.5 uuccauugaa GfaAfauasusu ususcuGfgUfUfCf usAfsuuuCfaAfUfggaa470 838 1165 48.8±1.6 cauugaaaua CfcAfgaasusu uscsugGfuUfCfCf usUfsauuUfcAfAfuggaA471 839 1166 65.9*1.1 auugaaauaa fcCfagasusu csusggUfuCfCfAf usCfsuauUfuCfAfaugg472 840 1167 24.9*0.9 uugaaauaga AfaCfcagsusu usgsguUfcCfAfUf usAfscuaUfuUfCfaaug473 841 1168 24.3*1.2 ugaaauagua GfaAfccasusu gsusugGfcUfGfGf usUfsgauAfuCfAfucca502 842 1169 69.0*2.1 augauaucaa GfcCfaacsusu ususggCfuGfGfAf usUfsugaUfallfCfaucc503 843 1170 19.7*1.6 ugauaucaaa AfgCfcaasusu asusgaUfallfCfAf usCfsa uaGfcAfGfu uga511 844 1171 61.6*1.3 acugcuauga UfaUfcausiisiicsusauGfaCfAfGf usCfsaauCfaGfUfccug524 845 1172 24.3±0.8 gacugauuga UfcAfuagsusu asgsggCfaAfUfAf usCfsauuAfcAfCfauau586 846 1173 17.9±0.5 uguguaauga UfgCfccususu csasauAfuGfUfGf usUfsuuuCfaUfUfacac590 847 1174 30.4±0.7 uaaugaaaaa AfuAfuugsusu asgsauGfgAfAfGf usGfscugUfgUfGfacuu625 848 1175 109.2±3.4 ucacacagca CfcAfucususu ususguCfaUfUfUf usAfsaaaUfgCfAfcaaa727 849 1176 43.5±1.4 gugcauuuua UfgAfcaasusu usgsucAfuUfUfGf usCfsaaaAfuGfCfacaa728 850 1177 39.0±0.7 ugcauuuuga AfuGfacasusu ususguGfcAfUfUf usUfsacaCfcCfAfaaau734 851 1178 72.1±1.0 uuggguguaa GfcAfcaasusu gsusuaGfaAfGfUf usCfsuugCfuUfUfcacu851 852 1179 85.8±1.1 gaaagcaaga UfcUfaacsusu asgsggGfaAfGfAf u sAf sc a a Of c Af Af a u c u867 853 1180 16.9±1.1 uuugguugua UfcCfccususu gscsugUfcAfAfAfa usUfsggaAfaUfAfuuuu918 854 1181 74.1±0.7 uauuuccaa GfaCfagcsusu csusguCfaAfAfAf usUfsuggAfaAfUfauuu919 855 1182 20.7±1.5 uauuuccaaa UfgAfcagsusu gsgsaallfgAfAfGf usGfsuucUfcAfUfgcuu987 856 1183 58.6±3.3 caugagaaca Cfallfuccsusu gsasauGfaAfGfCf usUfsguuCfuCfAfugcu988 857 1184 23.6±0.5 augagaacaa UfcAfuucsusu usascaGfullfCfAf usCfsugcAfcCfAfaugaA1009 858 1185 57,8*2.6 uuggugcaga fcUfguasusu ascsagUfuCfAfUf usUfscugCfaCfCfaaiig1010 859 1186 61.7±2.2 uggugcagaa AfaCfugususu uscsacAfgCfAfUf usUfsuucAfuGfAfaaug1066 860 1187 31.7±1.2 uucaugaaaa CfuGfugasusu csascaGfcAfUfUf uslIfsuuuCfaUfGfaaau1067 861 1188 64.3±4.8 ucaugaaaaa GfcUfgugsusugsuscaGfaCfUfUf usGfsccullfaAfGfaaag 100.2±15.1094 862 1189ucuuaaggca UfcUfgacsusu 0 csasgaCfulifUfCf usUfsagcCfuUfAfagaa1096 863 1190 37.1±0.5 uuaaggcuaa AfgUfcugsusu asgsacUfuUfCfUf uslifsuagCfcUfUfaaga1097 864 1191 37.4±0.8 uaaggcuaaa AfaGfucususu ascsuuUfcUfllfAf usCfsauuAfgCfCfuuaa1099 865 1192 78.9±3.9 aggcuaauga GfaAfagususu csusuuCfuUfAfAf usAf sea u Ufa GfCfcu ua1100 866 1193 53.5±2.2 ggcuaaugua AfgAfaagsusu ususaaGfgCfUfAf usAfsgacCfaCfAfuuag1105 867 1194 73.2±3.1 auguggucua CfcUfuaasusu csusaaUfgUfGfGf usUfsccaAfgAfGfacca1111 868 1195 31.0±2.0 ucucuuggaa CfaUfuagsusu asasugUfgGfUfCf usAfsuucCfaAfGfagac1113 869 1196 41.5±0.1 ucuuggaaua CfaCfauususu asusguGfgUfCfUf usCf sa u u Of cAf Afgaga1114 870 1197 54.3±3.7 cuuggaauga CfcAfcaususu usgsugGfuCfUfCf usUfscauUfcCfAfagag1115 871 1198 32.7±1.9 uuggaaugaa AfcCfacasusu gsusggUfcUfCfUf usUfsucaUfuCfCfaaga1116 872 1199 30.0±l.l uggaaugaaa GfaCfcacsusu usgsguCfuCfUfUf usGfsuucAfuUfCfcaag1117 873 1200 27.6±2.3 ggaaugaaca AfgAfccasusu gsascaUfcAfAfAfa usAfsuuuUfuAfCfuuuu1233 874 1201 37.5±0.8 guaaaaaua GfaUfgucsusu csasucAfaAfAfGf usAfscauUfuUfUfacuu1235 875 1202 22.8±3.1 uaaaaaugua UfuGfaugsusu asuscaAfaAfGfUf usCfsacaUfuUfUfuacu1236 876 1203 93.9±4.2 aaaaauguga UfuUfgaususu uscsaaAfaGfUfAf usGfscacAfuUfUfuuac1237 877 1204 70.1±1.2 aaaaugugca UfuUfugasusu csasaaAfgUfAfAf usAf sgea Cf a UfUf uuua1238 878 1205 75.0±2.5 aaaugugcua CfuUfuugsusuasasaaGfuAfAfAf usCfsagcAfcAfUfuuuu1239 879 1206 55.9±1.0 aaugugcuga AfcUfuuususu asasguAfaAfAfAfu u sAf sa ca Gf cAf Of a u u u1241 880 1207 26.8±0.6 gugcuguua UfuAfcuususu asgsuaAfaAfAfUfg usCfsaacAfgCfAfcauu1242 881 1208 42.1±1.3 ugcuguuga Ufullfacususu gsusaaAfaAfUfGf usUfscaaCfaGfCfacau1243 882 1209 19.4±1.0 ugcuguugaa UfuUfuacsusu usasaaAfaUfGfUf usUfsucaAfcAfGfcaca1244 883 1210 41.8±1.6 gcuguugaaa Ufullfuuasusu asasaaAfuGfUfGf usUfsuucAfaCfAfgcac1245 884 1211 21.4±0.8 cuguugaaaa Afullfuuususu asasaaUfgUfGfCf usllfsu u u Of a Af Cf a gc a1246 885 1212 15.4±1.4 uguugaaaaa CfaUfuuususu asasauGfuGfCfUf usUfsuuuUfcAfAfcagc1247 886 1213 35.5±4.2 guugaaaaaa AfcAfuuususu asasugUfgCfUfGf usGfsuuuUfuCfAfacag1248 887 1214 31.1±4.0 uugaaaaaca CfaCfauususu asgscuUfgCfAfUf usAfsaguCfaGfCfaaug1274 888 1215 39.0±1.2 ugcugacuua CfaAfgcususu gscsuuGfcAfUfUf usAfsaagUfcAfGfcaau1275 889 1216 104.2±7.0 gcugacuuua GfcAfagcsusu asgsggUfgCfUfAf usGfsgaaGfuUfUfauag1384 890 1217 23.5±1.7 uaaacuucca CfaCfccususu cscsagCfaUfCfCf usUfscaaGfaGfAfugga1529 891 1218 25.6±0.0 aucucuugaa UfgCfuggsusu asgscaUfcCfAfUf usCfsuucAfaGfAfgaug1531 892 1219 25.9±1.9 cucuugaaga GfaUfgcususu gscsagGfaAfGfUf usUfsgcaCfaAfCfaacu1553 893 1220 10.4±0.5 uguugugcaa UfcCfugcsusu asgsgaAfgUfUfGf usUfsaugCfaCfAfacaa1555 894 1221 23.9±1.7 uugugcauaa Cfullfccususu gsgsaaGfuUfGfUf usUfsuauGfcAfCfaaca1556 895 1222 20.0±1.7 ugugcauaaa AfcUfuccsusugsasagUfuGfUfUf usUfsuuallfgCfAfcaac1557 896 1223 17.4±0.4 gugcauaaaa AfaCfuucsusu asasguUfgUfUfGf usUfsuuuAfuGfCfacaa1558 897 1224 11.6±0.8 ugcauaaaaa CfaAfcuususu asgsuuGfullfGfUf usUfsuuullfaUfGfcaca1559 898 1225 14.4±0.3 gcauaaaaaa AfcAfacususu gsusugUfuGfllfGf usUfsuuullfuAfUfgcac1560 899 1226 20.7±0.1 cauaaaaaaa AfaCfaacsusu ususuaAfgAfGfAf usUfsgccAfaUfAfaucu1589 900 1227 76.5±1.6 uuauuggcaa CfuUfaaasusu ususaaGfaGfAfUf usCfsugcCfaAfUfaauc1590 901 1228 31.9±0.2 uauuggcaga UfcUfuaasusu asasgaGfaUfUfAf usUfsucuGfcCfAfauaa1592 902 1229 40.2±1.1 uuggcagaaa UfcUfcuususu asgsagAfuUfAfUf usUfsuucUfgCfCfaaua1593 903 1230 19.4±1.6 uggcagaaaa AfuCfucususu gsasgallfuAfUfUf usGfsuuuCfuGfCfcaau1594 904 1231 63.3±3.5 ggcagaaaca AfaUfcucsusu asgsauUfallfUfGf uslifsguuUfclifGfccaa1595 905 1232 67.8±0.7 gcagaaacaa UfaAfucususu gsasauGfgCfAfAf usCfsacaGfaGfCfauug1618 906 1233 28.2±1.2 ugcucuguga CfcAfuucsusu asasugGfcAfAfUf usUfscacAfgAfGfcauu1619 907 1234 86.5±1.2 gcucugugaa GfcCfauususu asusggCfaAfUfGf usUfsucaCfaGfAfgcau1620 908 1235 24.1±1.1 cucugugaaa UfgCfcaususu usgsgcAfaUfGfCf usUfsuucAfcAfGfagca1621 909 1236 33,3*2.8 ucugugaaaa UfuGfccasusu gsgscaAfuGfCfUf usGfsuuuCfaCfAfgagc1622 910 1237 35.3±0.9 cugugaaaca Afullfgccsusu csasggUfuAflifCf usCfsaucCfaGfCfugau1673 911 1238 52.5±0.4 agcuggauga AfaCfcugsusu usgsgalifglifGfUf usCfsuuuCfaCfCfuaca1685 912 1239 32.4±1.4 aggugaaaga CfaUfccasusucsasgaGfgAfCfAf usCfsuguUfaCfAfaugu1741 913 1240 17.6±0.4 uuguaacaga CfcUfcugsusu asgsagGfaCfAfUf usAfscugUfuAfCfaaug1742 914 1241 17.5±0.8 uguaacagua UfcCfucususu ascsaullfgUfAfAf uslifsgacCfaCfUfguua1747 915 1242 60.8±1.7 caguggucaa CfaAfugususu usgsguGfaCfAfAf usAfsgucAfaCfAfuuug1768 916 1243 29.5±0.1 auguugacua UfcAfccasusu gsgsugAfcAfAfAfu usAfsaguCfaAfCfauuu1769 917 1244 22.3±1.7 guugacuua GfuCfaccsusu gsusgaCfaAfAfUf usAf sa agUf cAfAfca u u U1770 918 1245 31.3±1.2 guugacuuua fgUfcacsusu usgsacAfaAfUfGf usGfsaaaGfuCfAfacau1771 919 1246 14.5±0.1 uugacuuuca UfuGfucasusu gsascaAfaUfGfUf usGfsgaaAfgUfCfaaca1772 920 1247 29.3±1.7 ugacuuucca UfuUfgucsusu ascsaaAfuGfUfUf usAfsggaAfaGflifcaacA1773 921 1248 69.0±2.0 gacuuuccua fuUfugususu csasaaUfgUflifGf usGfsaggAfaAfGfucaa1774 922 1249 40.0±1.9 acuuuccuca CfaUfuugsusu asasauGfuUfGfAf usGfsgagGfaAfAfgucaA1775 923 1250 51.9±5.0 cuuuccucca fcAfuuususu asasugUfuGfAfCf u sGf sgga GfgAf Af a gu c A1776 924 1251 35.9±0.6 uuuccuccca faCfauususu asusguUfgAfCfllf usUfsgggAfgGfAfaaguC1777 925 1252 21.2±0.4 uuccucccaa faAfcaususu usgsuuGfaCfUfUf usUfsuggGfaGfGfaaag1778 926 1253 106.4*7.1 uccucccaaa UfcAfacasusu ususucCfuCfCfCf usAfsgauUfcUfUfugggA1785 927 1254 28.4*1.2 aaagaaucua fgGfaaasusu ususccUfcCfCfAf usUfsagaUfuCfUfuugg1786 928 1255 25.1*1.1 aagaaucuaa GfaGfgaasusu cscsucCfcAfAfAf usAfscuaGfaUfUfcuuu1788 929 1256 76.3*1.4 gaaucuagua GfgGfaggsusucsusccCfaAfAfGf usGfsacuAfgAfUfucuu1789 930 1257 45.4±3.2 aaucuaguca UfgGfgagsusu uscsccAfaAfGfAf usAfsgacUfaGfAfuucu1790 931 1258 21.7±1.7 aucuagucua UfuGfggasusu cscscaAfaGfAfAf uslifsagaCfuAfGfauuc1791 932 1259 105.4±6.5 ucuagucuaa Ufullfgggsusu cscsaaAfgAfAfUfc usAfsuagAfcUfAfgauu1792 933 1260 16.4±1.0 uagucuaua CfuUfuggsusu csasaaGfaAfllfCf usCfsauaGfaCfUfagau1793 934 1261 18.5±0.3 uagucuauga UfcUfuugsusu asasagAfaUfCfllf usUfscauAfgAfCfuaga1794 935 1262 45.1±0.7 agucuaugaa UfuCfuuususu asasucUfaGfUfCf usAfsccaUfcAfUfagac1798 936 1263 14.1±0.6 uaugauggua UfaGfauususu cscscuCfuCfCfAf usUfsccuUfgAfUfuugg2074 937 1264 43.6±1.1 aaucaaggaa AfgAfgggsusu cscsucUfcCfAfAf usAfsuccUfuGfAfuuug2075 938 1265 55.2±1.4 aucaaggaua GfaGfaggsusu csuscuCfcAfAfAf usGfsaucCfuUfGfauuu2076 939 1266 83.3±1.2 ucaaggauca GfgAfgagsusu uscsucCfaAfAfUf usAfsgauCfcUfUfgauu2077 940 1267 67.6±2.8 caaggaucua UfgGfagasusu csusccAfaAfUfCf usAfsagaUfcCfUfugau2078 941 1268 49.3±2.8 aaggaucuua UfuGfgagsusu uscscaAfaUfCfAf usAfsaagAfuCfCfuuga2079 942 1269 35.7±1.0 aggaucuuua UfuUfggasusu asasauCfaAfGfGf usCfscaaAfaGfAfuccu2082 943 1270 30.9±l.l aucuuuugga UfgAfuuususu asasucAfaGfGfAf usUfsccaAfaAfGfaucc2083 944 1271 34.4±0.3 ucuuuuggaa UfuGfauususu asusuuGfaAfAfAf usUfsgauGfuCfAfguuu2116 945 1272 53.9±3.5 cugacaucaa UfcAfaaususu ususugAfaAfAfCf usCfsugaUfgUfCfaguu2117 946 1273 34.3±5.2 ugacaucaga UfuCfaaasusuususgaAfaAfCfUf uslIfscugAfuGfUfcagu2118 947 1274 33.8±0.9 gacaucagaa UfuUfcaasusu csasucAfgAfUfUf usAfscauUfaAfGfaaau2129 948 1275 35.0±2.2 ucuuaaugua CfuGfaugsusu asgsauUfuCfUfUf usAfscagAfcAfUfuaagA 2133 949 1276 29.8±0.5 aaugucugua faAfucususu gsasuuUfcUfUfAf usGfsacaGfaCfAfuuaa2134 950 1277 35.2±1.8 augucuguca GfaAfaucsusu asusuuCfuUfAfAf usUfsga cAf gAf Cf a u u a A 2135 951 1278 41.0±0.6 ugucugucaa fgAfaaususu ususucUfuAfAfUf usCfsugaCfaGfAfcauu2136 952 1279 33.1±1.6 gucugucaga AfaGfaaasusu uscsuuAfaUfGfUf usUfsucuGfaCfAfgaca2138 953 1280 41.3±1.5 cugucagaaa UfuAfagasusu gsuscaGfaAfGfAf usGfsaauUfaGfUfgucu 2149 954 1281 28.2±0.6 cacuaauuca UfcUfgacsusu uscsagAfaGfAfCf usGfsgaaUfuAfGfuguc2150 955 1282 24.0±0.4 acuaauucca UfuCfugasusu csasgaAfgAfCfAfc usAfsggaAfuUfAfguguC 2151 956 1283 30.0±0.5 uaauuccua fuUfcugsusu asgsaaGfaCfAfCf usAfsaggAfaUfllfagugU 2152 957 1284 25.8±2.3 uaauuccuua fcUfucususu gsascaCfuAfAfUf usAfsuuuAfaGfGfaauu2156 958 1285 37.4±2.3 uccuuaaaua AfgUfgucsusu ascsacUfaAfUfUf usCfsa uu UfaAfGfgaa u2157 959 1286 38.5±0.3 ccuuaaauga UfaGfugususu cscsuuAfaAfUfGf usGfscagUfaGfUfucau2166 960 1287 38.3±1.4 aacuacugca UfuAfaggsusu csusuaAfaUfGfAf usAfsgcaGfuAfGfuuca2167 961 1288 52.0±3.3 acuacugcua UfuUfaagsusu ususugCfuGfUfUf usUfsauaGfaAfAfcaac2248 962 1289 32.5±2.3 guuucuauaa AfgCfaaasusu ususgcUfgUfUfGf uslifsuauAfgAfAfacaa2249 963 1290 35.2±1.9 uuucuauaaa CfaGfcaasusuusgscuGfuUfGfUf usUfsuuallfaGfAfaaca2250 964 1291 23.5±0.3 uucuauaaaa AfcAfgcasusu gscsugUfuGfUfUf usAfsuuuAfuAfGfaaac2251 965 1292 21.1±0.7 ucuauaaaua AfaCfagcsusu csusguUfgUfUfUf usCfsauullfaUfAfgaaa2252 966 1293 28.1±0.5 cuauaaauga CfaAfcagsusu usgsuuGfuUfUfCf usUfscauUfuAfllfagaa2253 967 1294 28.9±0.7 uauaaaugaa AfcAfacasusu usgsuuUfcUfAfUf usUfsaguCfaUfUfuaua2256 968 1295 54.2±2.6 aaaugacuaa GfaAfacasusu usasaaGfaGfGfCf usUfsgcullfgGfAfagcc2356 969 1296 38.5±2.1 uuccaagcaa UfcUfuuasusu csusuuAfaCfCfUf usUfsguuGfaGfGfgagg2377 970 1297 55,3*6.4 cccucaacaa UfuAfaagsusu asasaaUfuGfAfAf usGfsuuaGfuGfUfuuuc2428 971 1298 42.3±0.7 aacacuaaca AfaUfuuususu asasaullfgAfAfAf usUfsguuAfgUfGfuuuu2429 972 1299 51.4±3.8 acacuaacaa CfaAfuuususu asgscuGfuGfAfCf usCfsuuuCfcAfGfuguc2772 973 1300 98.3±4.5 acuggaaaga AfcAfgcususu csusguGfaCfAfCf usAfsgcuUfuCfCfagug2774 974 1301 56.0±l.l uggaaagcua UfcAfcagsusu csusucUfullfUfCf usCfsuguUfuGfGfugaa2851 975 1302 77.8*2.7 accaaacaga AfaGfaagsusu ususcuUfuUfCfAf usAfscugUfuUfGfguga2852 976 1303 87.0*5.2 ccaaacagua AfaAfgaasusu csasgaGfuAfAfUf usAfscauCfaAfAfuauu2993 977 1304 120.2*3.1 auuugaugua AfcUfcugsusu asgsuaAfuAfUfUf usCfsagaCfaUfCfaaau2996 978 1305 92.5*1.8 ugaugucuga Afullfacususu asusagUfuCfAfUf usGfsgauAfaGfGfcaug3223 979 1306 80.8*2.3 gccuuaucca AfaCfuaususu csasaaCfaAfUfAf uslifsgacCfuAfUfguau3597 980 1307 120.2*6.5 cauaggucaa UfgUfuugsusucsasuaGfgUfCfAf usAfsaagUfcUfGfuuga3606 981 1308 101.5±6.8 acagacuuua CfcUfaugsusu asgsacAfgAfAfCfc usGfsuuuGfallfUfgguu386 2198 2641 28.9±0.9 aaucaaaca CfuGfucususu asasccGfuGfUfUf uslifsgucAfcCfAfuaac412 2199 2642 67.5±0.1 auggugacaa AfcGfguususu cscsguGfuUfAfUf usUfsuugUfcAfCfcaua414 2200 2643 36.4±2.5 ggugacaaaa AfcAfcggsusu usgsuuAfuGfGfUf usAfsucuUfuGfUfcacc417 2201 2644 25.1±1.1 gacaaagaua AfuAfacasusu usgsguGfaCfAfAf usCfsguuUfaUfCfuuug422 2202 2645 20.7±0.9 agauaaacga UfcAfccasusu asusauUfuCfUfGf usCfsaauGfgAfAfccagA466 2203 2646 99.2±1.9 guuccauuga faAfuaususu csasuuGfaAfAfUf usUfsguuUfcAfCfuauu479 2204 2647 24.7±1.4 agugaaacaa UfcAfaugsusu asusugAfaAfUfAf usUfsuguUfuCfAfcuau480 2205 2648 81.3±3.3 gugaaacaaa UfuCfaaususu ususgaAfallfAfGf usCfsuugUfuUfCfacua481 2206 2649 29.7±0.8 ugaaacaaga UfuUfcaasusu usgsaaAfuAfGfUf usCfscuuGfullfUfcacu482 2207 2650 52.7±3.2 gaaacaagga Afullfucasusu gsasaallfaGfllfGf usAfsccuUfgUfUfucac483 2208 2651 37.3±2.7 aaacaaggua UfaUfuucsusu asasauAfgUfGfAf usAfsaccllfuGfUfuuca484 2209 2652 21.7±2.0 aacaagguua CfuAfuuususu asasuaGfuGfAfAf usCfsaacCfuUfGfuuuc485 2210 2653 21.0±2.4 acaagguuga AfcUfauususu asusagUfgAfAfAfc usAfscaaCfcUfUfguuu486 2211 2654 10.2±1.2 aagguugua CfaCfuaususu usgsuuGfgCfUfGf usGfsauaUfcAfUfccag501 2212 2655 49.2±2.2 gaugauauca CfcAfacasusu gscsuallfgAfCfAf usAfsaucAfgUfCfcugu523 2213 2656 66.2±3.8 ggacugauua CfaUfagcsusuasusgaCfaGfGfAf usCfsacaAfuCfAfgucc2214 2657 16.1±1.7 cugauuguga UAfgUfcaususu usgsacAfgGfAfCf usAf sea cAf a Uf Cfa gu c2215 2658 17.9±0.5 ugauugugua CfuGfucasusu gsascaGfgAfCfUf uslifsacaCfaAfUfcagu2216 2659 32.7±0.8 gauuguguaa CfcUfgucsusu csasggAfcUfGfAf usUfscuaCfaCfAfauca2217 2660 14.6±0.7 uuguguagaa GfuCfcugsusu asgsgaCfuGfAfUf u s Uf s u c u Af cAf Cf a a u c2218 2661 13.3±0.9 uguguagaaa AfgUfccususu gsusguAfgAfAfAfa usUfsgucUfuUfUfuuuu2219 2662 67.5±3.9 aaaagacaa CfuAfcacsusu usgsuaGfaAfAfAf usCfsuguCfuUfUfuuuu 2220 2663 48.1±2.3 aaaagacaga UfcUfacasusu usasuuUfuUfGfUf usCfsucaCfaGfCfaaca 2221 2664 66.4±1.1 ugcugugaga AfaAfauasusu csusucAfaAfUfCf usGfsuguAfaCfUfggau646 2222 2665 22.5±1.2 caguuacaca UfuGfaagsusu ascsaaCfallfCfCf usAfsauaGfaGfCfagga2223 2666 16.2±1.5 ugcucuauua UfgUfugususu csasacAfuCfCfUf usGfsaauAfgAfGfcaggA 2224 2667 17.6±1.1 gcucuauuca fuGfuugsusu asascaUfcCfUfGf usGfsgaaUfaGfAfgcag2225 2668 25.3±1.5 cucuauucca GfaUfguususu ascsauCfcUfGfCf usAfsggaAfuAfGfagcaG 2226 2669 27.4±0.5 ucuauuccua fgAfugususu csuscuAfuUfCfCf usUfsggcAfcCfAfaggaA 2227 2670 17.9±0.6 uuggugccaa fuAfgagsusu usgsccAfcUfUfAf usCfsaauUfaAfCfauaa2228 2671 61.3±2.7 uguuaauuga GfuGfgcasusu gsgsaullfgUfCfAf usAfsugcAfcAfAfaugaC 2229 2672 23.2±0.3 uuugugcaua faAfuccsusu ususugUfgCfAfUf usAfscacCfcAfAfaaugC 2230 2673 85.2±3.1 uuugggugua faCfaaasusuusgsggUfgUfAfCf usGfsugaUfgCfCfugua2231 2674 77.0*4.6 aggcaucaca CfaCfccasusu gsgsguGfuAfCfAf usUfsgugAfuGfCfcugu745 2232 2675 95.6*4.3 ggcaucacaa AfcAfcccsusu ususugAfaAfCfCf usAfsacuGfcAfGfuggu2233 2676 63.5*2.4 acugcaguua UfuCfaaasusu ususgaAfaCfCfAf usUfsaacUfgCfAfgugg2234 2677 24.9±1.6 cugcaguuaa UfuUfcaasusu gsusuaUfuAfGfAf usGfscuuUfcAfCfuucu2235 2678 38.7±1.3 agugaaagca AfaUfaacsusu ususauUfaGfAfAf usUfsgcuUfuCfAfcuuc2236 2679 27.5±2.1 gugaaagcaa UfaAfuaasusu usasuuAfgAfAfGf usUfsugcUfullfCfacuu2237 2680 36,0*2.3 ugaaagcaaa CfuAfauasusu gsascaAfaCfAfGf usUfsugcCfaUfGfacug2238 2681 64.1±3.4 ucauggcaaa UfuUfgucsusu csasaaCfaGfUfCf usUfsuuuGfcCfAfugac2239 2682 18.1±1.0 auggcaaaaa UfgUfuugsusu csgsaaGfuCfUfAf usGfsgcaAfaCfUfguag2240 2683 20.6±0.7 caguuugcca AfcUfucgsusu asasguCfuAfCfAf usCfsaggCfaAfAfcuguA2241 2684 52.5±1.0 guuugccuga fgAfcuususu csasguUfuGfCfCf usUfsucaUfuCfCfaggc2242 2685 16.8*0.4 uggaaugaaa AfaAfcugsusu asgsuuUfgCfCfUf usCfsuucAfuUfCfcagg2243 2686 114.7*4.8 ggaaugaaga CfaAfacususu usgsccUfgGfAfAf usCfsaugCfuUfCfauuc2244 2687 31.2*4.5 ugaagcauga CfaGfgcasusu asusgaAfgCfAfUf usUfsaugUfuCfUfcaug2245 2688 46.8*0.4 gagaacauaa CfuUfcaususu usgsaaGfcAfUfGf usAfsuauGfullfCfucau2246 2689 54.1*1.9 agaacauaua GfcUfucasusu gsasagCfaUfGfAf usAfsauaUfgUfUfcuca2247 2690 20.2*0.9 gaacauauua UfgCfuucsusucsasgullfcAfUfUf uslIfsucuGfcAfCfcaau1011 2248 2691 86.1±2.7 ggugcagaaa GfaAfcugsusu asgsuuCfaUfUfGf usUfsuucUfgCfAfccaa1012 2249 2692 72.4±1.4 gugcagaaaa UfgAfacususu gsusucAfuUfGfGf uslIfsuuuCfuGfCfacca1013 2250 2693 68.2±1.7 ugcagaaaaa AfuGfaacsusu gscsacCfaGfUfGf usCfscacAfuCfAfacac1036 2251 2694 21.1±1.2 uugaugugga UfgGfugcsusu csasccAfgUfGfUf usUfsccaCfaUfCfaaca1037 2252 2695 51.7±3.0 ugauguggaa CfuGfgugsusu usgsuuGfaUfGfUf usCfsaaaGfaUfCfcaca1043 2253 2696 35.2±1.2 ggaucuuuga UfcAfacasusu gsusugAfuGfUfGf usCfscaaAfgAfUfccacA1044 2254 2697 91.9±2.9 gaucuuugga fuCfaacsusu uscsagAfcUfUfUf usAfsgccUfuAfAfgaaaG1095 2255 2698 82.9±5.4 cuuaaggcua fuCfugasusu gscsuaAfuGfUfGf usCfscaaGfaGfAfccac1110 2256 2699 74.3±6.0 gucucuugga AfuUfagcsusu usasauGfuGfGfUf uslifsuccAfaGfAfgaccA1112 2257 2700 18.7±0.1 cucuuggaaa fcAfuuasusu asusacCfuGfGfCf usAfsucullfuUfAfggccA1188 2258 2701 53.0±1.8 cuaaaagaua fgGfuaususu cscsuaAfaAfGfAf usUfsuguGfgCfCfaucu1196 2259 2702 66.8±1.5 uggccacaaa Ufullfaggsusu csusaaAfaGfAfUf usUfsuugUfgGfCfcauc1197 2260 2703 55.7±0.8 ggccacaaaa Ufullfuagsusu ascsaaAfcCfUfGf usGfsagallfaUfGfgcag1210 2261 2704 41.9±3.9 ccauaucuca GfuUfugususu csasaaCfcUfGfCf usUfsgagAfuAfUfggcaG1211 2262 2705 21.3±1.0 cauaucucaa fgUfuugsusu usasuclIfcAfCfAf usUfsgauGfuCfCfcugu1222 2263 2706 142.1±9.5 gggacaucaa GfaGfauasusu gsgsacAfuCfAfAf usUfsuuuUfaCfUfuuug1232 2264 2707 3.1±0.5 aaguaaaaaa AfuGfuccsusuususgaAfaAfAfCf uslIfsgucAfgGfUfuguu1257 2265 2708 64.0±3.4 aaccugacaa UfuUfcaasusu usgsaaAfaAfCfAf usCfsuguCfaGfGfuugu1258 2266 2709 69.3±3.1 accugacaga UfuUfucasusu asasaaCfaAfCfCf usAfsagclIfgUfCfaggu1261 2267 2710 18.9±0.4 ugacagcuua UfgUfuuususu ascsaaCfcUfGfAf usUfsgcaAfgCfUfguca1264 2268 2711 52.6±1.5 cagcuugcaa GfgUfugususu csasacCfuGfAfCf usAfsugcAfaGfCfuguc1265 2269 2712 23.7±1.0 agcuugcaua AfgGfuugsusu cscsugAfcAfGfCf usGfscaaUfgCfAfagcu1268 2270 2713 21.2±0.2 uugcauugca GfuCfaggsusu gsusugGfcCfUfUf usUfscaaAfuUfUfiiaag1295 2271 2714 115.9*1.5 aaaauuugaa GfcCfaacsusu csgsauAfcCfCfAf usAfsccuGfuCfCfaugg1331 2272 2715 27.8*1.8 uggacaggua GfuAfucgsusu asusggCfuCfCfAf usUfsaauAfcCfUfcugg1365 2273 2716 36.4*0.7 gagguauuaa AfgCfcaususii csasgaGfgUfAfUf usCfsaccCfuCfUfaaua1372 2274 2717 56.1*1.6 uagaggguga CfcUfcugsusu gsgsuallfuAfGfAf usAfsuagCfaCfCfcucu1376 2275 2718 41.0*0.4 gggugcuaua AfaUfaccsusu gsusauUfaGfAfGf usUfsauaGfcAfCfccuc1377 2276 2719 84.2*3.4 ggugcuauaa UfaAfuacsusu gsgsugCfuAfUfAf usUfsuggAfaGfUfuuau1386 2277 2720 12.5*0.3 aacuuccaaa AfgCfaccsusu asusgcAfullfUfUf usCfsuauCfcUfCfaaaa1408 2278 2721 30.9*0.4 ugaggauaga AfuGfcaususu gsgsauUfaGfUfCf usUfsuccCfaUfAfggac1440 2279 2722 29.0*4.6 cuaugggaaa UfaAfuccsusu ascsugGfclifUfCf usGfsuacAfgCfGfagaa1457 2280 2723 30.8*1.5 ucgcuguaca GfcCfagususu gsgsculifcUfCfGf usGfscagUfaCfAfgcga1460 2281 2724 20.2*3.0 cuguacugca GfaAfgccsusuuscsgcUfgUfAfCf usUfscugCfaGfCfagua1466 2282 2725 26.8±2.4 ugcugcagaa CfaGfcgasusu usgsuaCfuGfCfUf usUfsccallfcUfGfcagc1470 2283 2726 7.2±0.9 gcagauggaa AfgUfacasusu csasgaUfgGfAfCf usCfsaucUfaGfAfgguc1480 2284 2727 10.6±0.1 cuguagauga CfaUfcugsusu gsasugGfaCfCfUf usUfsucaUfcUfAfcagg1482 2285 2728 18.8±0.4 guagaugaaa UfcCfaucsusu asusggAfcCfUfGf usAfsuucAfuCfUfacag1483 2286 2729 19.7±1.0 uagaugaaua GfuCfcaususu usgsgaCfcUfGfUf usUfsauuCfaUfCfuaca1484 2287 2730 58.3±4.8 agaugaauaa GfgUfccasusu asasuaCfaUfGfUf usCfsaaaUfgGfCfaaca1498 2288 2731 11.6±0.7 ugccauuuga UfgUfauususu asusacAfuGfUfUf usUfscaaAfuGfGfcaac1499 2289 2732 19.2±0.7 gccauuugaa AfuGfuaususu ascsauGfullfGfCf usCfscucAfaAfUfggcaA1501 2290 2733 12.1±1.4 cauuugagga faCfaugsusu csasugUfuGfCfCf usUfsccuCfaAfAfuggcA1502 2291 2734 5.6±0.4 auuugaggaa faCfaugsusu uscscaUfcUfCfUf usAfsuguCfuUfCfaaga1535 2292 2735 19.8±0.6 ugaagacaua GfaUfggasusu cscsauCfuCfUfUf usCfsaugUfclIfUfcaag1536 2293 2736 124.0±6.9 gaagacauga AfgAfuggsusu csasucUfcUfUfGf usGfscauGfuCfUfucaa1537 2294 2737 124.3±2.8 aagacaugca GfaGfaugsusu asuscuCfullfGfAf usUfsgcaUfgUfCfuuca1538 2295 2738 30,2*0.7 agacaugcaa AfgAfgaususu uscsucUfuGfAfAf usCfsugcAfuGfUfcuuc1539 2296 2739 19.8±1.2 gacaugcaga AfaGfagasusu ususguUfgUfGfCf usUfsuuuUfullfAfugca1561 2297 2740 17.3±0.1 auaaaaaaaa CfaAfcaasusu ususguUfgUfGfCf usUfsuuullfuUfUfaugc1562 2298 2741 10.6±0.7 uaaaaaaaaa AfcAfacasusugscscuGfuUfUfUf usUfsaauCfuCfUfuaaa1583 2299 2742 27.3±0.5 aagagauuaa AfcAfggcsusu ususuuAfaGfAfGf usGfsccaAfuAfAfucuc1588 2300 2743 46.8±0.4 auuauuggca UfuAfaaasusu gsasuuAfuUfGfGf usAfsuguUfuCfUfgcca1596 2301 2744 22.1±1.5 cagaaacaua AfuAfaucsusu asasacAfuGfCfUf usUfsgccAfullfCfcagc1608 2302 2745 57.5±3.3 ggaauggcaa AfuGfuuususu usgscuGfgAfAfUf usAfsgcaUfuGfCfcauu1613 2303 2746 31.0±1.9 ggcaaugcua CfcAfgcasusu usgscuGfgAfAfUf usGfsguuUfcAfCfagag1623 2304 2747 20.3±0.8 ugugaaacca CfaUfugcsusu csasauGfcllfCfUf usUfsgguUfuCfAfcaga1624 2305 2748 32,3*0.9 gugaaaccaa GfcAfuugsusu asusgcUfcUfGfUf usAfsaugGfuUfUfcaca1626 2306 2749 94.3±2.1 gaaaccauua GfaGfcaususu usgscuCfuGfUfGf usCfsaauGfgUfUfucac1627 2307 2750 104.0±2.1 aaaccauuga AfgAfgcasusu gscsuCfuGfUfGfAf usUfscaaUfgGfUfuuca1628 2308 2751 47.6±2.4 aaccauugaa CfaGfagcsusu csuscuGfuGfAfAf usUfsucaAfuGfGfuuuc1629 2309 2752 20.2±0.3 accauugaaa AfcAfgagsusu uscsugUfgAfAfAf usCfsuucAfaUfGfguuu1630 2310 2753 33.2*2.0 ccauugaaga CfaCfagasusu csusguGfaAfAfCf usUfscuuCfaAfUfgguu1631 2311 2754 27.8*1.6 cauugaagaa UfcAfcagsusu usgsugAfaAfCfCf usUfsucuUfcAfAfuggu1632 2312 2755 27.8*3.0 auugaagaaa UfuCfacasusu gsusgaAfaCfCfAf usAfsuucUfuCfAfaugg1633 2313 2756 24.2*0.5 uugaagaaua UfuUfcacsusu asuscaGfcUfGfGf usCfscuaCfaCfAfucca1679 2314 2757 58.8*0.4 auguguagga GfcUfgaususu usgsuaGfgUfGfAf usGfsuaallfuCfUfuuca1691 2315 2758 24.5*1.8 aagaauuaca CfcUfacasusuusasgglifgAfAfAfg usGfsgguAfa Uf Ufcu uu1693 2316 2759 62.1±0.7 aauuaccca CfaCfcuasusu asgsguGfaAfAfGf uslIfsgggUfaAfUfucuu1694 2317 2760 16.9±0.9 aauuacccaa UfcAfccususu gsusgaAfaGfAfAf uslifscugGfgUfAfauuc1696 2318 2761 32.4±1.0 uuacccagaa Ufullfcacsusu usasuuAfuUfAfCf usUfsccuCfuGfUfggua1730 2319 2762 16.8±1.0 cacagaggaa AfuAfauasusu usasuuAfcCfAfCf usAfsuguCfcUfCfugug1733 2320 2763 36.0±0.5 agaggacaua GfuAfauasusu usasccAfcAfGfAf usAfscaallfgUfCfcucu1736 2321 2764 52.3±2.2 ggacauugua GfuGfguasusu asgsgaCfaUfUfGf usCfscacUfgUfUfacaa1744 2322 2765 20.0±0.3 uaacagugga UfgUfccususu ascsagUfgGfUfCf usCfsaccAfuUfGfugac1755 2323 2766 35.2±0.9 acaaugguga CfaCfugususu asasugGfuGfAfCf usUfscaaCfallfUfuguc1766 2324 2767 43.3±3.8 aaauguugaa AfcCfauususu asuscuAfgUfCfUf usAfsaccAfuCfAfuaga1799 2325 2768 16.0±0.1 augaugguua CfuAfgaususu uscsuaGfuCfUfAf usCfsaacCfallfCfauag1800 2326 2769 13.4±0.6 ugaugguuga AfcUfagasusu uscsugUfgCfAfCf usUfsuucUfuAfGfugug1823 2327 2770 28.2±3.9 acuaagaaaa CfaCfagasusu csusguGfcAfCfAf usAfsuuuCfuUfAfgugu1824 2328 2771 45.6±4.4 cuaagaaaua GfcAfcagsusu usgsugCfaCfAfCf usCfsauuUfcUfUfagug1825 2329 2772 36,3*0.6 uaagaaauga UAfgCfacasusu usgscaCfaCfUfAf usCfsccaUfuUfCfuuag1827 2330 2773 15.6±0.2 agaaauggga UfgUfgcasusu gscsacAfcUfAfAfg usUfscccAfulifUfcuua1828 2331 2774 26.1±0.3 aaaugggaa GfuGfugcsusu asusgaGfuAfGfGf usAfsagaGfaCfAfuccu1903 2332 2775 26.1±0.5 augucucuua AfcUfcaususuasgsuaGfgAfUfGf uslIfsccaAfgAfGfacau1906 2333 2776 28.8±1.4 ucucuuggaa CfcUfacususu gsusagGfallfGfUf usUfsuccAfaGfAfgaca1907 2334 2777 51.9±4.4 cucuuggaaa UfcCfuacsusu gsasugUfcUfCfUf usAfscauUfuGfCfaaga1911 2335 2778 27.3±1.4 uggaaaugua GfaCfaucsusu asusguCfuCfUfUf usAfsacaUfuUfCfcaag1912 2336 2779 18.4±0.4 ggaaauguua AfgAfcaususu cscsgaCfaGfCfAf usUfscacAfuCfUfgugc1983 2337 2780 21.7±1.1 cagaugugaa UfgUfcggsusu gsasgaCfuAfAfGf usAfsaggUfuUfCfucuu2008 2338 2781 24.8±2.0 agaaaccuua AfgUfcucsusu asgsacUfaAfGfAf usCfsaagGfuUfUfcucu2009 2339 2782 33,0*3.0 gaaaccuuga UfaGfucususu gsascuAfaGfAfGf usGfscaaGfgUfUfucuc2010 2340 2783 19.8±0.4 aaaccuugca UfuAfgucsusu asgsaaAfcCfUfUf usAfsgagUfuUfGfcaag2017 2341 2784 49.7±0.8 gcaaacucua GfuUfucususu asasacCfullfGfCf usAfsuagAfgUfUfugcaA 2019 2342 2785 36.8±2.6 aaacucuaua fgGfuuususu asascclIfuGfCfAf usUfsauaGfaGfUfuugc2020 2343 2786 45.2±3.3 aacucuauaa AfaGfguususu ascscuUfgCfAfAf usUfsuauAfgAfGfuuug2021 2344 2787 37.9*3.1 acucuauaaa CfaAfggususu cscsuuGfcAfAfAf usUfsuuaUfaGfAfguuu2022 2345 2788 29.5*2.4 cucuauaaaa GfcAfaggsusu csusugCfaAfAfCf usCfsuuuAfuAfGfaguu2023 2346 2789 17.8*0.8 ucuauaaaga UfgCfaagsusu ususgcAfaAfCfUf usUfscuuUfaUfAfgagu2024 2347 2790 19.7*0.9 cuauaaagaa UfuGfcaasusu usgscaAfaCfUfCf usUfsucuUfuAfUfagag2025 2348 2791 29.2*2.4 uauaaagaaa UfuUfgcasusu gscsaaAfcUfCfUf usUfsuuclIfuUfAfuaga2026 2349 2792 36.5*1.5 auaaagaaaa GfuUfugcsusucsasaaCfuCfUfAf usGfsuuuCfuUfUfauag 2027 2350 2793 66.4±2.5 uaaagaaaca AfgUfuugsusu asasacUfcUfAfUf usAfsguuUfclifUfuaua2028 2351 2794 62.3±1.4 aaagaaacua GfaGfuuususu asascuCfuAfUfAf usAfsaguUfuCfUfuuau2029 2352 2795 65.0±3.5 aagaaacuua AfgAfguususu ascsucUfallfAfAf usAfsaagUfuUfCfuuua2030 2353 2796 36.3±0.3 agaaacuuua UfaGfagususu ususugAfaAfAfAfg usCfsaugUfaCfAfcuuu2046 2354 2797 30.5±2.3 uguacauga UfuCfaaasusu ususgaAfaAfAfGf usUfscauGfuAfCfacuu2047 2355 2798 57.8±1.1 uguacaugaa UfuUfcaasusu gsasaaAfaGfUfGf usCfsuucAfuGfUfacac2049 2356 2799 29.1±3.3 uacaugaaga Ufullfuucsusu asasaaGfuGfUfAf usUfsucuUfcAfUfguac2051 2357 2800 47.4±5.1 caugaagaaa AfcUfuuususu asasagUfgUfAfCf usAfsuuclIfuCfAfugua2052 2358 2801 80.3±4.3 augaagaaua CfaCfuuususii csasugAfaGfAfAf usAfsgggCfuAfCfauuc2060 2359 2802 33.4±1.3 uguagcccua UfuCfaugsusu asasugUfaGfCfCf usUfsuugGfaGfAfgggc2067 2360 2803 36.9±0.4 cucuccaaaa UfaCfauususu asusguAfgCfCfCf usAfsuuuGfgAfGfaggg2068 2361 2804 31.5±0.7 ucuccaaaua CfuAfcaususu usgsuaGfcCfCfUf usGfsauuUfgGfAfgagg2069 2362 2805 40.0±1.3 cuccaaauca GfcUfacasusu gsusagCfcCfUfCf usUfsgauUfuGfGfagag2070 2363 2806 42,3*2.8 uccaaaucaa GfgCfuacsusu gsasccUfgGfCfUf usCfsacuCfcAfUfuagc2099 2364 2807 58.9±0.9 aauggaguga CfaGfgucsusu cscsugGfclifAfAf usAfsacaCfuCfCfauua 2101 2365 2808 48.4±2.3 uggaguguua GfcCfaggsusu gsgscuAfallfGfGf uslifscaaAfcAfCfucca2104 2366 2809 32.4±0.7 aguguuugaa UfuAfgccsusugscsuaAfuGfGfAf usUfsucaAfaCfAfcucc2105 2367 2810 29.0±0.5 guguuugaaa Afullfagcsusu csusaaUfgGfAfGf usUfsuucAfaAfCfacuc2106 2368 2811 36.7±2.4 uguuugaaaa CfaUfuagsusu usasauGfgAfGfUf usUfsuuuCfaAfAfcacu2107 2369 2812 25.0±0.7 guuugaaaaa CfcAfuuasusu asasugGfaGfllfGf usGfsuuuUfcAfAfacac2108 2370 2813 40.4±3.7 uuugaaaaca UfcCfauususu asusggAfgUfGfUf usAfsguuUfuCfAfaaca2109 2371 2814 69.9±4.5 uugaaaacua CfuCfcaususu gsascaUfcAfGfAf usAfsuuaAfgAfAfaucuG 2127 2372 2815 28.6±0.1 uuucuuaaua faUfgucsusu uscscuUfaAfAfUf usCfsaguAfgUfUfcauu2165 2373 2816 34,4*0.7 gaacuacuga UfaAfggasusu usasaaUfgAfAfCf usAfsuagCfaGfUfaguu2169 2374 2817 39.9±1.8 uacugcuaua CfaUfuuasusu ususuaAfallfCfAf usAfsaaaGfuUfUfuuga2191 2375 2818 54.6±2.2 aaaacuuuua UfuUfaaasusu ususaaAfuCfAfAf usGfsaaaAfgUfUfuuug2192 2376 2819 34.0±1.1 aaacuuuuca AfuUfuaasusu uscsauUfuCfAfGf usUfsuuuAfaAfAfucugA 2208 2377 2820 32.0±1.0 auuuuaaaaa faAfugasusu csasuuUfcAfGfAf usUfsuuuUfaAfAfaucu2209 2378 2821 22.0*0.7 uuuuaaaaaa GfaAfaugsusu asusuuCfaGfAfUf usCfsuuuUfuAfAfaauc2210 2379 2822 26.5*0.4 uuuaaaaaga UfgAfaaususu gsusaaCfullfGfUf usGfscaaUfaAfAfaaca2229 2380 2823 36.1*1.4 uuuuauugca AfgUfuacsusu usasacUfuGfUfUf usUfsgcaAfuAfAfaaacA 2230 2381 2824 27.4*0.6 uuuauugcaa faGfuuasusu asascullfgUfUfUf usAfsugcAfaUfAfaaaaC 2231 2382 2825 76.3*3.2 uuauugcaua faAfguususu gsusuuUfuAfUfUf usAfsgcaAfallfGfcaau2236 2383 2826 48.2*1.9 gcauuugcua AfaAfaacsusucsasuuUfgCfUfGf usUfsagaAfaCfAfacag2246 2384 2827 17.4±1.0 uuguuucuaa CfaAfaugsusu gsusugUfuUfCfUf usGfsucaUfuUfAfuaga2254 2385 2828 35.3±5.0 auaaaugaca AfaCfaacsusu ascsagCfuUfGfUf usUfsaaaCfaUfUfcaca2292 2386 2829 38.6±2.0 gaauguuuaa AfgCfugususu usgscuGfuUfCfUf usUfsaugUfaCfAfcaga2316 2387 2830 93.0±5.0 guguacauaa AfcAfgcasusu gscsugUfuCfUfGf usUfsuauGfuAfCfacag2317 2388 2831 60.2±1.3 uguacauaaa AfaCfagcsusu usgsuuCfuGfUfGf usCfsuuuAfuGfUfacac2319 2389 2832 30.9±1.2 uacauaaaga AfgAfacasusu gsusucUfgUfGfUf usAfscuuUfaUfGfuaca2320 2390 2833 36.9±1.4 acauaaagua CfaGfaacsusu gsusguAfcAfUfAf usUfsgauGfaCfUfuuau 2325 2391 2834 64.6±5.2 aagucaucaa GfuAfcacsusu usgsuaCfaUfAfAf usUfsugaUfgAfCfuuua2326 2392 2835 36.3±1.0 agucaucaaa UfgUfacasusu gsusacAfuAfAfAfg usUfsuugAfuGfAfcuuu2327 2393 2836 42.6±2.7 ucaucaaaa AfuGfuacsusu usascaUfaAfAfGf usCfsuuuGfaUfGfacuu 2328 2394 2837 59.4±4.4 ucaucaaaga UfaUfguasusu ascsauAfaAfGfUf usAfscuuUfgAfUfgacu2329 2395 2838 45.0±3.3 caucaaagua UfuAfugususu csasuaAfaGfUfCf usCfsacuUfuGfAfugac2330 2396 2839 31.1±1.7 aucaaaguga UfuUfaugsusu asusaaAfgUfCfAf usCfscacUfuUfGfauga 2331 2397 2840 41.6±3.2 ucaaagugga CfuUfuaususu usasaaGfuCfAfUf usCfsccaCfuUfUfgaug2332 2398 2841 34.6±0.3 caaaguggga AfcUfuuasusu csuscaAfcAfAfGf usGfsaggUfaUfAfccuu2388 2399 2842 76.5±3.9 guauaccuca Gfullfgagsusu ususauAfaAfAfUf usGfsugugUfuUfCfaauu 2424 2400 2843 61.8±5.6 ugaaaacaca UfuAfuaasusuusasuaAfaAfUfUf usAfsgugUfuUfUfcaau2425 2401 2844 70.4±1.3 gaaaacacua UfuUfauasusu asusaaAfaUfUfGf usUfsaguGfuUfUfucaa2426 2402 2845 53.4±4.1 aaaacacuaa UfuUfuaususu asasuuGfaAfAfAf usUfsuguUfaGfUfguuu2430 2403 2846 41.0±2.5 cacuaacaaa UfcAfauususu asusugAfaAfAfCf usUfsuugUfuAfGfuguu2431 2404 2847 37.3±2.0 acuaacaaaa UfuCfaaususu asasaaCfaCfUfAf usAfsaauUfuUfGfuuag2435 2405 2848 41.2±3.7 acaaaauuua UfgUfuuususu asascaCfuAfAfCf usUfscaaAfuUfUfuguu2437 2406 2849 48.7±1.4 aaaauuugaa AfgUfguususu ascsacUfaAfCfAf usUfsucaAfaUfUfuugu2438 2407 2850 35.4±1.9 aaauuugaaa UfaGfugususu csascuAfaCfAfAf usAfsuucAfaAfUfuuug2439 2408 2851 61.5±2.6 aauuugaaua UfuAfgugsusu ascsuaAfcAfAfAfa usUfsauuCfaAfAfuuuu2440 2409 2852 119.4±8.2 uuugaauaa Gfullfagususu asasuuCfaCfUfGf usUfsaaaUfaAfCfacag2483 2410 2853 55.8±3.9 uguuauuuaa UfgAfauususu uscsacUfgUfGfUf usCfscuuAfaAfUfaaca2486 2411 2854 69.5±5.4 uauuuaagga CfaGfugasusu asasaaAfgGfUfAf usAfsgcaUfaGfCfuuac2506 2412 2855 74.8±8.0 agcuaugcua Cfullfuuususu csasguGfullfUfUf usAfsagaaAfuGfCfuaaa2555 2413 2856 54.8±3.1 agcauuucua AfcAfcugsusu asgsugUfuUfUfAf usAfsagaAfaUfGfcuaa 119.7±15.2556 2414 2857gcauuucuua AfaCfacususu 2 usgsuuUfuAfGfCf usAfscaaGfaAfAfugcuA2558 2415 2858 154.5±2.7 auuucuugua faAfacasusu csasuuUfcUfUfGf usAfsagcCfaGfCfacaa2566 2416 2859 65.1±2.5 ugcuggcuua GfaAfaugsusu ususucUfuGfUfGf usAfscaaGfcCfAfgcacA2568 2417 2860 92.3±5.4 cuggcuugua faGfaaasusuususcullfgUfGfCf usUfsacaAfgCfCfagca2569 2418 2861 65.8±4.1 uggcuuguaa CfaAfgaasusu ususguGfcUfGfGf usCfsauuAfcAfAfgcca2572 2419 2862 70.5±9.2 cuuguaauga GfcAfcaasusu ususguAfaUfGfUf usUfsuuuUfcCfCfuaca 2582 2420 2863 87.0±2.9 agggaaaaaa UfuAfcaasusu asgsugCfuGfUfUf usUfsuuuCfaAfAfaaac2601 2421 2864 64.9±9.0 uuuugaaaaa AfgCfacususu ususugAfaAfAfGf usUfsgacAfcCfAfucuu2611 2422 2865 78.3±6.9 auggugucaa UfuCfaaasusu usgsaaAfaGfAfUf usAfsaugAfcAfCfcauc2613 2423 2866 73.2±2.9 ggugucauua UfuUfucasusu asasaaGfaUfGfGf usGfsaaaUfgAfCfacca2615 2424 2867 53,3*2.6 ugucauuuca UfcUfuuususu cscscuUfcUfUfCf usAfsaaaCfaUfGfggaa2634 2425 2868 92.0±4.3 ccauguuuua GfaAfgggsusu asusccAfgUfUfCf usAfsaauUfuUfGfggaa2667 2426 2869 79.2±2.4 ccaaaauuua CfuGfgaususu cscscaAfaAfUfUf usAfsaguAfuGfCfaaau2675 2427 2870 93.3±2.9 ugcauacuua UfuUfgggsusu ususuaGfgUfGfUf usAfsaacAfcAfGfcaca2707 2428 2871 86.2±3.5 gcuguguuua CfcUfaaasusu ususagGfuGfUfGf usCfsaaaCfaCfAfgcac2708 2429 2872 48.0*4.0 cuguguuuga AfcCfuaasusu ascsugGfaAfAfGf usAfsaugAfaGfAfgcuu2781 2430 2873 85.8*3.3 cucuucauua UfcCfagususu asgsagUfuUfUfUf usAfsuaaAfuAfGfaaaaA 2813 2431 2874 65.3*1.6 ucuauuuaua faCfucususu gsusagUfgUfAfUf usUfsgaaAfaGfAfaaua2843 2432 2875 60.5*2.4 uucuuuucaa CfaCfuacsusu usasguGfuAfUfUf usGfsugaAfaAfGfaaau2844 2433 2876 62.4*1.2 ucuuuucaca AfcAfcuasusu asgsugUfaUfUfUf usGfsgugAfaAfAfgaaau 2845 2434 2877 97.7*3.5 cuuuucacca faCfacususugsusguAfuUfUfCf uslIfsgguGfaAfAfagaaA2846 2435 2878 85.3±1.7 uuuucaccaa fuAfcacsusu usgsuaUfullfCfUf usUfsuggUfgAfAfaagaA2847 2436 2879 140.2±8.3 uuucaccaaa faUfacasusu gsusauUfuCfUfUf uslifsuugGfuGfAfaaag2848 2437 2880 108.7±4.3 uucaccaaaa AfaAfuacsusu usasuullfcUfUfUf usGfsuuuGfgllfGfaaaa2849 2438 2881 101.9±0.3 ucaccaaaca GfaAfauasusu asusuuCfuUfUfUf usUfsguuUfgGfUfgaaa2850 2439 2882 71.3±5.3 caccaaacaa AfgAfaaususu gsusggGfaCfAfUf usllfsgauAfaAfGfaaug2872 2440 2883 77.0±2.4 ucuuuaucaa UfcCfcacsusu csuscaGfgAfAfGf usGfsuaaCfgAfCfacuu2905 2441 2884 46.1±1.7 ugucguuaca CfcUfgagsusu gsusguCfgUfUfAf usAfsauuCfuGfGfguaa2913 2442 2885 60.6±3.3 cccagaauua CfgAfcacsusu uscsacUfallfAfCf usCfsaagCfaGfAfagua2963 2443 2886 68.8±1.4 uucugcuuga UfaGfugasusu csusauAfcUfUfCf usCfsaccAfaGfCfagaa2966 2444 2887 124.1±7.2 ugcuugguga GfuAfuagsusu ususguCfaGfAfGf usCfsaaaUfallfUfacuc2989 2445 2888 55.3±1.2 uaauauuuga UfgAfcaasusu usgsuaAfaGfAfAf usCfsuagGfaUfAfauuc3019 2446 2889 73.4±2.6 uuauccuaga Ufullfacasusu asasagAfaUfUfAf usAfsuccUfaGfGfauaa3022 2447 2890 80.3±2.9 uccuaggaua UfuCfuuususu csasgaUfuUfCfAf usAfsguaAfcAfUfcugaA3059 2448 2891 74.6±1.7 gauguuacua fallfcugsusu ususucAfgAfUfGf usAfsagcAfgUfAfacauC3063 2449 2892 131.0±5.2 uuacugcuua fuGfaaasusu csasgallfgUfUfAf usUfsuaaAfgCfAfguaa3066 2450 2893 69.0±0.5 cugcuuuaaa CfaUfcugsusu asgsauGfuUfAfCf uslIfsuuaAfaGfCfagua3067 2451 2894 73.3±2.0 ugcuuuaaaa AfcAfucususugsusuaCfuGfCfUf uslifsuguUfuUfAfaagc3071 2452 2895 94.2±3.0 uuaaaacaaa AfgUfaacsusu ususaclIfgCfllfUf usUfsuugUfuUfUfaaag3072 2453 2896 78.9±2.3 uaaaacaaaa CfaGfuaasusu usascuGfclIfUfUf usAfsuuuGfuUfUfuaaa 137.0±12.3073 2454 2897aaaacaaaua GfcAfguasusu 4 ascsugCfuUfllfAf usGfsauuUfgUfUfuuaa 131.5±12.3074 2455 2898aaacaaauca AfgCfagususu 4 csusuaAfaAfUfAf usGfsucaUfuGfCfauau3116 2456 2899 56.8±0.5 ugcaaugaca Ufullfaagsusu usasaaAfuAfUfGf usAfsuguCfaUfUfgcau3118 2457 2900 98.8±6.7 caaugacaua Afullfuuasusu asusauGfcAfAfUf usCfsuaaAfuGfUfcauu3122 2458 2901 67,5*2.7 gacauuuaga GfcAfuaususu usasugCfaAfUfGf usUfscuaAfaUfGfucau3123 2459 2902 60.9±1.5 acauuuagaa UfgCfauasusii asusgcAfaUfGfAf usCfsucuAfaAfUfguca3124 2460 2903 71.6±1.0 cauuuagaga UfuGfcaususu gscsaalifgAfCfAf usAfsccuCfuAfAfaugu3126 2461 2904 52.9±3.0 uuuagaggua CfaUfugcsusu csasauGfaCfAfUf usUfsaccUfcUfAfaaug3127 2462 2905 56.7±1.3 uuagagguaa UfcAfuugsusu asasugAfcAfUfUf usUfsuacCfuCfUfaaau3128 2463 2906 72.6*1.1 uagagguaaa GfuCfauususu usgsacAfuUfUfAf usGfsguuAfcCfUfcuaa3130 2464 2907 58.6*1.2 gagguaacca AfuGfucasusu gsascallfuUfAfGf usUfsgguUfaCfCfucua3131 2465 2908 49.1*2.5 agguaaccaa AfaUfgucsusu asgsagGfuAfAfCf usUfscaaCfaUfUfgguu3138 2466 2909 62.3*0.7 caauguugaa AfcCfucususu usgscuUfuUfAfCf usGfsuguUfaGfUfugua3190 2467 2910 59.8*0.6 aacuaacaca AfaAfgcasusu ususauCfcUfUfGf usUfsuuuCfullfAfgcaa3235 2468 2911 121.6*3.5 cuaagaaaaa GfgAfuaasusuusasucCfullfGfCf usAfsuuuUfcUfUfagca3236 2469 2912 81.2±0.2 uaagaaaaua AfgGfauasusu asusccUfuGfCfUf usCfsauullfuCfUfuagc 119.2±13.3237 2470 2913aagaaaauga AfaGfgaususu 9 uscscuUfgCfUfAf usCfscauUfuUfCfuuag3238 2471 2914 97.6±1.5 agaaaaugga CfaAfggasusu cscsuuGfcUfAfAf usUfsccaUfullfUfcuua3239 2472 2915 90.0±2.5 gaaaauggaa GfcAfaggsusu asasugGfaAfllfUf usCfscuaCfcAfUfcaau3251 2473 2916 81.3±2.0 gaugguagga UfcCfauususu asasuaCfaAfUfUf usGfsaagAfaUfCfcaau3307 2474 2917 123.7±5.8 ggauucuuca UfgUfauususu gsusguAfuUfUfCf usGfsaccUfgAfCfagaa3416 2475 2918 66.9±1.7 uguc...
Claims
CLAIMSWhat is claimed is:
1. An oligonucleotide for inhibiting expression of ACVR2A, wherein the oligonucleotide comprises an antisense strand comprising at least 14 contiguous nucleotides substantially complementary to a sequence of nucleotides encoding ACVR2A, with no more than 4 mismatched nucleotides.
2. The oligonucleotide of claim 1, wherein the sequence of nucleotides encoding ACVR2A comprises a nucleotide sequence having at least 90% nucleotide sequence identity to any one of SEQ ID NOs: 1309-1311.
3. The oligonucleotide of claim 1 or 2, wherein the oligonucleotide targets a sequence of nucleotides corresponding to positions of SEQ ID NO: 1309, SEQ ID NO: 1310, or SEQ ID NO: 1311 selected from those described in the specification.
4. The oligonucleotide of any one of claims 1-3, wherein the antisense strand is substantially or completely complementary to a sequence of nucleotides corresponding to an untranslated region of the ACVR2A transcript.
5. The oligonucleotide of any one of claims 1-4, wherein the oligonucleotide is an RNAi agent.
6. The oligonucleotide of claim 5, wherein the RNAi agent is a double stranded small interfering RNA, a short hairpin RNA, or a Dicer-substrate siRNA (DsiRNA).
7. The oligonucleotide of claim 6, wherein the oligonucleotide is a double-stranded small interfering RNA (siRNA) further comprising a sense strand, wherein the sense strand and antisense strand form a double stranded region.
8. The oligonucleotide of any one of claims 1-7, wherein the antisense strand comprises a nucleotide sequence comprising at least 15 contiguous nucleotides (for example, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) differing by no more than 4, 3, 2, or 1 nucleotides from the nucleotide sequence of any one ofSEQ ID NOs: 328-654, 982-1308, 1755-2197 or2641-3105, or a nucleotide sequence having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755- 2197 or 2641-3105.
9. The oligonucleotide of any one of claims 1-8, wherein the antisense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641- 3105.
10. The oligonucleotide of any one of claims 7-9, wherein the sense strand comprises a nucleotide sequence differing by no more than 4, 3, 2, or 1 nucleotides from the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640, or a nucleotide sequence having at least 90% nucleotide sequence identity to a portion of the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640.
11. The oligonucleotide of any one of claims 7-10, wherein the sense strand comprises the nucleotide sequence of any one of SEQ ID NOs: 1-327, 655-981, 1312-1754, or 2198-2640.
12. The oligonucleotide of any one of claims 7-11, wherein the antisense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 328-654, 982-1308, 1755-2197 or 2641- 3105, and the sense strand comprises a nucleotide sequence of any one of SEQ ID NOs: 1- 327, 655-981, 1312-1754, or 2198-2640.
13. The oligonucleotide of any one of claims 7-12, wherein each strand is no more than 30 nucleotides in length, or 19-30 nucleotides in length, or 19-23 nucleotides in length, or 19-21 nucleotides in length.
14. Tire oligonucleotide of any one of claims 7-13, wherein at least one strand comprises a 3’ overhang of at least 1 nucleotide, or at least 2 nucleotides.
15. The oligonucleotide of any one of claims 7-14, wherein at least one strand comprises a 5" overhang of at least 1 nucleotide, or at least 2 nucleotides.
16. The oligonucleotide of any one of claims 7-15, wherein the double stranded region is 15-30 nucleotide pairs in length, or 15-23 nucleotide pairs in length, or 17-25 nucleotide pairs in length, or 19-23 nucleotide pairs in length, or 19-21 nucleotide pairs in length.
17. The oligonucleotide of any one of claims 7-16, wherein the antisense strand is 21 nucleotides in length and the sense strand is 19 nucleotides in length.
18. The oligonucleotide of any one of claims 1-4, wherein the oligonucleotide is a single-stranded antisense oligonucleotide (ASO).
19. The oligonucleotide of claim 18, wherein the ASO comprises a nucleic acid sequence comprising at least 14 contiguous nucleotides (for example, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) that differ by no more than 1, 2, 3, or 4 nucleotides from any one of SEQ ID NOs: 328-654 or 1755-2197.
20. The oligonucleotide of claim 18 or 19, wherein the ASO comprises a nucleic acid sequence comprising at least 14 contiguous nucleotides (for example, 14, 15, 16, 17, 18, 19, 20, or 21 contiguous nucleotides) that differ by no more than 1, 2, 3 or 4 nucleotides from any one of SEQ ID NOs: 982-1308 or 2641-3105.
21. The oligonucleotide of any one of claims 1-20, wherein tire oligonucleotide comprises one or more modifications,22. The oligonucleotide of claim 21, wherein the one or more modifications is selected from a ribose modification, a backbone modification, a nucleobase modification, or a combination thereof.
23. The oligonucleotide of claim 22, wherein the ribose modification comprises a locked nucleic acid (LNA), a tricyclo-DNA (tcDNA), 2'-deoxy-2'-fluoro, 2'-O-methyl, 2'-methoxyethyl (2'- MOE), 2'-deoxy-2'-arabino-fluoro, 2'-O-benzyl, 2'-O-methyl-4-pyridine, 2' cyclic ethyl (cET), phosphorodiamidate morpholino (PMO), glycol nucleic acid (GNA), unlocked nucleic acid (UNA), or a combination thereof.
24. The oligonucleotide of claim 23, wherein the ribose modification comprises a 2'-deoxy-2'- fluoro, 2'-O-methyl, glycol nucleic acid (GNA), unlocked nucleic acid (UNA), a threose nucleic acid (TNA), or a combination thereof.
25. The oligonucleotide of claim 23 or 24, wherein the ribose modification is a 2'-deoxy-2'- fluoro, 2'-O-methyl modification, or a combination thereof.
26. The oligonucleotide of any one of claims 22-25, wherein the backbone modification comprises phosphorothioate, phosphorodithioate, methylphosphonate, methyoxypropyl-phosphonate, 5'-(E)-vinylphosphonate, 5'-methyl phosphonate, 5'-methylphosphate, 5'-phosphorothioate, peptide nucleic acid (PNA), or a combination thereof.
27. The oligonucleotide of claim 26, wherein the backbone modification comprises a phosphorothioate.
28. The oligonucleotide of any one of claims 22-27, wherein the backbone modification comprises a phosphorothioate modification.
29. The oligonucleotide of any one of claims 22-28, wherein the nucleobase modification comprises 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, 5 -methylcytosine (5-Me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2- aminoadenine, N6-alkyl derivatives, N2-alkyl, 2 -thiouracil, 2 -thiothymine, 2 -thiocytosine, 5- halouracil, cytosine, 5-propynyl uracil, 5-propynyl cytosine, 6-azo uracil, 6-azo cytosine, 6- azo thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-sulfhydryl, 8-thioalkyl, 8-hydroxy, 5-halo, 5-trifluoromethyl, N7-methylguanine, N7-methyladenine, 8-azaguanine, 8-azaadenine, 7-deazaguanine, 7-deazaadenine, 3 -deazaguanine, 3 -deazaadenine, or any combination thereof.
30. The oligonucleotide of claim 29, wherein the oligonucleotide comprises at least one modified nucleotide selected from the group consisting of a deoxy nucleotide, a 3 ’-terminal deoxythymidine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a 2’-5’-linked ribonucleotide (3’- RNA), a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2’-amino-modified nucleotide, a 2’-O-allyl-modified nucleotide, 2’-C-alkyl-modified nucleotide, 2’-hydroxyI-modified nucleotide, a 2’-O-(methoxy ethyl) modified nucleotide, a 2 ’-O-alkyl -modified nucleotide, a morpholino nucleotide, a phosphoramidate morpholino, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a 5'-phosphorothioate group, a nucleotide comprising a 5'-methylphosphonate group, a nucleotide comprising a 5'- methylphosphate group, a nucleotide comprising a 5 ’ phosphate or 5 ’ phosphate mimic, a nucleotide comprising vinyl phosphonate, a glycol nucleic acid (GNA), a glycol nucleic acid S-Isomer (S-GNA), a nucleotide comprising 2-hydroxymethyl-tetrahydrofurane-5-phosphate, a nucleotide comprising 2’-deoxythymidine-3 ’phosphate, a nucleotide comprising 2’- deoxyguanosine-3 ’-phosphate; a cytidine-2'-phosphate, a guanosine-2'-phosphate, a undine- 2'-phosphate, an adenosine-2'-phosphate, a 2'-O-hexadecyl-adenosine-3'-phosphate, a 2'-O- hexadecyl-cytidine-3'-phosphate, a 2'-O-hexadecyl-guanosine-3'-phosphate, and a 2'-O- hexadecyl-uridine-3'-phosphate, a 3'-3' inverted nucleotide linkage, a 5 ’-5’ inverted nucleotide linkage, TNA, and combinations thereof.
31. The oligonucleotide of claim 30, wherein the oligonucleotide comprises a modified nucleotide selected from the group consisting of a deoxy nucleotide, a 3 ’-terminal deoxythymidine (dT) nucleotide, a 3'-3' inverted nucleotide linkage, a 5 ’-5’ inverted nucleotide linkage, a 5'-(E)-vinylphosphonate-2’-O-methyl-uridine-3’ -phosphate, and a combination thereof.
32. The oligonucleotide of claim 30 or 31, -wherein the oligonucleotide comprises 5'-(E)- viny lphosphonate-2 ’ -O-methyl-uridine-3 ’ -phosphate.
33. The oligonucleotide of claim 21, wherein at least one of the modifications is a thermally destabilizing nucleotide modification.
34. The oligonucleotide of claim 33, wherein the thermally destabilizing nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in the duplex; destabilizing sugar modification, a 2 ’-deoxy modification, an acyclic nucleotide, an unlocked nucleic acids (UNA); a glycerol nucleic acid (GNA), and a combination thereof.
35. The oligonucleotide of claim 31, wherein tire modification comprises a short sequence of 3’- terminal deoxythymidine nucleotide (dT).
36. The oligonucleotide of any one of claims 21-35, wherein the modifications on the nucleotides are 2’-O-methyl and 2’deoxy-2’-fluoro modifications.
37. The oligonucleotide of any one of claims 21-36, wherein the oligonucleotide comprises at least one phosphorothioate internucleoside or phosphorodithioate internucleoside linkage.
38. The oligonucleotide of claim 37, wherein the oligonucleotide comprises 6-8 phosphorothioate internucleoside linkages.
39. The oligonucleotide of claim 37 or 38, wherein the oligonucleotide comprises at least 1, or at least 2, phosphorothioate intemucleoside linkage at a 5’ end of the sense strand.
40. Tire oligonucleotide of any one of claims 37-39, wherein the oligonucleotide comprises at least 1 phosphorothioate intemucleoside linkage at a 3’ end of the sense strand.
41. The oligonucleotide of any one of claims 37-40, wherein the oligonucleotide comprises at least 1, or at least 2, phosphorothioate internucleoside linkage at a 5' end of the antisense strand.
42. Tire oligonucleotide of any one of claims 37-41, wherein the oligonucleotide comprises at least 1 phosphorothioate intemucleoside linkage at a 3’ end of the antisense strand.
43. The oligonucleotide of any one of claims 21-42, wherein no more than five of the nucleo tides of the antisense strand are unmodified nucleotides.
44. The oligonucleotide of any one of claims 21-43, wherein all the nucleotides of the antisense strand are modified oligonucleotides.
45. The oligonucleotide of any one of claims 21-44, wherein no more than five of the nucleotides of the sense strand are unmodified nucleotides.
46. The oligonucleotide of any one of claims 21-45, wherein all the nucleotides of the sense strand are modified nucleotides.
47. The oligonucleotide of any one of claims 7-46, wherein the anti sense strand comprises a chemical modification pattern according to (Nfs)a(nNf)b(ns)cn, wherein:n is a 2'-O-methyl-nucleoside-3 ’-phosphate;Nfs is a 2'-deoxy-2’-fhioro-nucleoside-3’-phosphorothioate;Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphate;ns is a 2'-O-methyl-nucleoside-3'-phosphorothioate;a is at least 1;b is 5-10; andc is at least 1.
48. The oligonucleotide of claim 47, wherein the antisense strand comprises a chemical modification pattern NfsNfsnNfnNfnNfnNfnNfnNfnNfnNfnsnsn,49. The oligonucleotide of any one of claims 7-48, wherein the sense strand comprises a chemical modification pattern according to (ns)d(Nfn)eNf, wherein:n is a 2’-O-methyl-nucleoside-3 ’-phosphate;Nf is a 2’-deoxy-2'-fluoro-nucleoside-3’-phosphate;ns is a 2’-O-methyl-nucleoside-3’-phosphorothioate;d is at least 1; ande is 5-10.
50. The oligonucleotide of claim 49, wherein the sense strand comprises the chemical modification pattern nsnsNfnNfnNfnNfnNfnNfnNfnNfnNf.
51. The oligonucleotide of any one of claims 7-50, wherein each of the antisense and the sense strand is independently 17-23 nucleotides in length, wherein the antisense strand comprises the motif F(SF)nSnn, wherein n is from 2 to about 20, nn is 0 or 1, one of F and S is a 2'- deoxy-2’ -fluoro modified nucleoside and the other of F and S is a 2'-O-methyl modified nucleoside.
52. Tire oligonucleotide of any one of claims 7-51, wherein the antisense strand comprises the chemical modification pattern of nNfnnnNfnNfNfnnnnNfnNfnnnnn and the sense strand comprises the chemical modification nnnnnnNfnNfNfNfnnnnnnnn, wherein n is a 2 -0- m ethyl -nucleoside and Nf is a 2 ’-deoxy-2’ -fluoro-nucleoside.
53. The oligonucleotide of any one of claims 7-52, wherein each of the antisense and the sense strand is independently 20-23 nucleotides in length, wherein the antisense strand comprises a region having the formula X1-Y-X2, wherein Y is a subregion of from about 5 to about 12 linked nucleosides and each of XI subregion and X2 subregion is, independently, a plurality of linked nucleosides having the formula FSFS, where one of F and S is a 2'-deoxy-2'-fluoro modified nucleoside and the other of F and S is a 2'-O-methyl modified nucleoside; and each intemucleoside linkage of said XI subregion and X2 subregion is, independently, a phosphodiester or a phosphorothioate intemucleoside linkage.
54. Tire oligonucleotide of any one of claims 7-53, wherein each of the antisense and the sense strand is independently 17-23 nucleotides in length, wherein the antisense strand comprises a contiguous sequence of linked nucleosides that define an alternating motif of the formula: 5 '-Q(-L-Z-L-Q)n(-L-Z)nn-3 'wherein:each L is an intemucleoside linking group;either each Q is a 2'-deoxy-2’-fluoro-nucleoside and each Z is a 2'-O-methyl nucleoside; or each Q is a 2'-O-methyl nucleoside and each Z is a 2'-deoxy-2’-fluoro nucleoside; and n is from 8 to 14 and nn is 0 or 1.55, The oligonucleotide of any one of claims 7-54, wherein the antisense strand is 19-25 nucleotides in length and is represented by the formula:wherein:Bl', B2', B3', and B4' each independently represent a nucleotide containing a modification selected from the group consisting of 2'-0-alkyl, 2'-substituted alkoxy, 2'- substituted alkyl, 2'-halo, ENA, and BNA / LNA;TT, T2', and T3' each independently represent a nucleotide comprising a chemical modification selected from the group consisting of DNA, RNA, LNA, 2'-deoxy-2'-fluoro, and 5'-methyl-2'-deoxy-2’-fluoro nucleotides;ql is 4 to 15 nucleotides in length;q3 or q7 is independently 1-6 nucleotide(s) in length;q2 or q6 is independently 1-3 nucleotide(s) in length;q4 is 0-3 nucleotide(s) in length; andq5 is 0-10 nucleotide (s) in length; andwherein:the antisense strand has 2'-deoxy-2’ -fluoro modifications, and wherein the 2'-deoxy- 2’-fluoro modifications on the antisense strand consist of four, and only four, 2'-deoxy-2’- fluoro modifications or six, and only six, 2'-deoxy-2’-fluoro modifications.
56. The oligonucleotide of any one of claims 7-55, wherein the antisense strand and sense strand are each 14 to 40 nucleotides, and are represented by the formula:wherein:Bl, Bl', B2', B3', and B4' each independently represent a nucleotide containing a modification selected from the group consisting of 2'-0-alkyl, 2'-substituted alkoxy, 2'- substituted alkyl, 2'-halo, ENA, and BNA / LNA;Cl is a thermally destabilizing nucleotide, selected from the group consisting of i) a nucleotide that forms a mismatch pair with the opposing nucleotide in the antisense strand, ii) a nucleotide having an abasic modification, and iii) a nucleotide having a sugar modification, and placed at a site opposite to the seed region (positions 2-8) of the antisense strand;TT, T2', and T3' each independently represent a nucleotide comprising a modification providing the nucleotide a steric bulk that is less than or equal to the steric bulkof a 2'-0Me modification, wherein the modification is at the 2'-position of a ribose sugar of the nucleotide or at a position of a non-ribose nucleotide similar to the 2'-position of a ribose sugar;each nl, and ql is independently 4 to 15 nucleotides in length;each q3, and q7 is independently 1-6 nucleotide(s) in length;each q2 and q6 is independently 1-3 nucleotide(s) in length;q5 is 0-10 nucleotide(s) in length;each n4, and q4 is independently 0-3 nucleotide(s) in length;n2 is 3 nucleotides in length, and T1 each are 2'-deoxy-2’-fluoro nucleotides; n3 is 7 nucleotides in length, and B2 each are 2'-OMe nucleotides; andn5 is 3 nucleotides in length, and B3 each are 2'-0Me nucleotides.
57. The oligonucleotide of any one of claims 7-56, wherein the antisense strand and sense strand are each 19-25 nucleotides in length, wherein the antisense strand is represented by the formula:(Is)wherein:Bl, B2, and B3 each independently represent a nucleotide containing a modification selected from the group consisting of 2'-O-alkyl, 2'-substituted alkoxy, 2'-substituted alkyl, 2'-halo, EMA, and BNA / LNA;C 1 is a thermally destabilizing nucleotide, selected from the group consisting of i) a nucleotide that forms a mismatch pair with the opposing nucleotide in the antisense strand, ii) a nucleotide having an abasic modification, and iii) a nucleotide having a sugar modification, and placed at a site opposite to the seed region (positions 2-8 ) of the antisense strand;T1 represents a nucleotide comprising a 2 '-deoxy-2 ’-fluoro modification; nl or n3 is independently 4 to 15 nucleotides in length;n5 is 1-6 nucleotide(s) in length;n2 is 3;n4 is 0-3 nucleotide(s) in length; andwherein the sense strand has 2 '-deoxy-2 ’-fluoro modifications, and wherein the 2'- deoxy-2’ -fluoro modifications on the sense strand consist of four, and only four, 2'-deoxy-2’-fluoro modifications, wherein the four 2'-deoxy-2’-fluoro modifications are at positions 7 and 9-11 from the 5 '-end of the sense strand., The oligonucleotide of any one of claims 7-57, wherein the antisense strand is complementary to at least one portion of a mRNA of the targe t gene (e.g., ACVR2A), wherein:the sense strand comprises 19-22 nucleotides,the antisense strand comprises 19-25 nucleotides; andthe oligonucleotide is represented by the formula:3' 5'wherein:Bl', B2', B3', and B4' each independently represent a nucleotide containing a modification selected from the group consisting of 2'-0-methyl and 2'-deoxy-2’ -fluoro;each Bl, B2, and B3 is 2'-O-methyl nucleotide;C 1 is glycerol nucleic acid (GNA) placed at a site opposite to the seed region (positions 2-8) of the antisense strand;TT, T2', and T3' are each 2'-F, wherein:Tl' is at position 14 from the 5' end of the antisense strand, and q2 is 1; and T3' is at position 2 from the 5' end of the antisense strand, and q6 and q7 are 1; each nl, n3, and ql is independently 4 to 15 nucleotides in length;each n5 and q3 is independently 1-6 nucleotide(s) in length;q5 is 0-10 nucleotide(s) in length;each n4 and q4 is independently 0-3 nucleotide(s) in length;n2 is 3 nucleotides in length, and Tl each are 2'-deoxy-2’-fluoro nucleotides, wherein(a) the oligonucleotide is covalently conjugated to at least one ligand; and (b) one of the Tl nucleotides is at position 11 from the 5' end of the sense strand.
59. The oligonucleotide of any one of claims 7-58, wherein the sense strand comprises 19-22 nucleotides, the antisense strand comprises 19-25 nucleotides; and the oligonucleotide is represented by the formula:Ciwherein:Bl', B2', B3', and B4' each independently represent a nucleotide containing a modification selected from the group consisting of 2'-O-methyl and 2'-deoxy-2’ -fluoro; each B1, B2, and B3 is 2'-OMe;Cl is glycerol nucleic acid (GNA) placed at a site opposite to the seed region (positions 2-8) of the antisense strand;Tl', T2', and T3' are each 2'-deoxy-2’-fluoro, wherein:Tl' is at position 14 from the 5' end of the antisense strand, and q2 is 1; and T3' is at position 2 from tire 5' end of the antisense strand, and q6 and q7 are 1; each nl, n3, and ql is independently 4 to 15 nucleotides in length;each n5 and q3 is independently 1-6 nucleotide(s) in length;q5 is 0-10 nucleotide(s) in length;each n4 and q4 is independently 0-3 nucleotide(s) in length;n2 is 3 nucleotides in length, and Tl each is 2'-deoxy-2’ -fluoro, andwherein(a) the oligonucleotide is covalently conjugated to at least one ligand;(b) one of the Tl nucleotides is at a position in the sense strand that is opposite to position 11 from the 5' end of the antisense strand; and(c) the oligonucleotide comprises at least one phosphorothioate intemucleoside linkage.
60. The oligonucleotide of any one of claims 7-59, wherein the antisense strand and sense strand are each 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity toa target sequence to mediate RNA interference, wherein said sense strand comprises at least one thermally destabilizing modification of the duplex within tire first 9 nucleotide positions of the 5' region of the antisense strand or a precursor thereof, wherein the antisense strand further comprises one or both of the following characteristics:(i) 2, 3, 4, 5 or 62'-deoxy-2’ -fluoro modifications; and(ii) 1, 2, 3, 4 or 5 phosphorothioate intemucleoside linkages; andsaid sense strand comprises one or both of the following characteristics:(iii) 2, 3, 4, or 5 2'-deoxy-2’-fluoro modifications; and(iv) 1, 2, 3, 4 or 5 phosphorothioate internucleoside linkages.
61. The oligonucleotide of any one of claims 7-46, wherein the anti sense strand comprises a modification pattern nsNfsnnnNfnNfNfnnnNfnNfnnsnsn, wherein ns is a 2'-O-methyl- nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'- phosphate.
62. The oligonucleotide of any one of claims 7-46, wherein the antisense strand disclosed herein comprises a modification pattern vpUsNfsnnnNfnNfNfnnnNfnNfnnsnsn, wherein vpUs is a 5'-vinylphosphonate-2'-O-methyl-uridine-3 ’-phosphorothioate; ns is a 2'-O-methyl- nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'- phosphate.
63. The oligonucleotide of any one of claims 7-46, wherein the sense strand disclosed herein comprises a modification pattern nsnsnnNfnNfNfNfnnnnnnnnn, wherein ns is a 2'-O- methyl-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucIeoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphate.
64. Tire oligonucleotide of any one of claims 7-46, wherein the sense strand disclosed herein comprises a modification pattern NfsnsNfnNfnNfnNfnNfnNfnNfnNfnNf, wherein ns is a 2'- O-methyl-nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'- phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’ -phosphate; and Nf is a 2'-deoxy-2’- fluoro-nucleoside-3'-phosphate.
65. The oligonucleotide of any one of claims 7-46, wherein the sense strand comprises a modification pattern nsnsnnNfnNfNfNfnnnnnnnnn, and the antisense strand comprises a modification pattern nsNfsnnnNfnNfNfnnnnNfnNfhnnsnsn, wherein ns is a 2'-O-methyl- nucleoside-3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; n is a 2'-O-methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'- phosphate.
66. Tire oligonucleotide of any one of claims 7-46, wherein the sense strand comprises a modification pattern nsnsnnNfnNfNfNfnnnnnnnnn, and the antisense strand comprises a modification pattern vpUsNfsnnnNfnNfNfnnnnNfnNfnnnsnsn, wherein vpUs is a 5'- vinylphosphonate-2'-O-niethyl-uridine-3’-phosphorothioate; ns is a 2'-O-methyl-nucleoside- 3'-phosphorothioate; Nfs is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphorothioate; n is a 2'-O- methyl-nucleoside-3 ’-phosphate; and Nf is a 2'-deoxy-2'-fluoro-nucleoside-3'-phosphate.
67. Tire oligonucleotide of any one of claims 7-66, wherein the antisense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 982-1308 or 2641-3105.
68. The oligonucleotide of claim 67, wherein the sense strand comprises a nucleotide sequence according to any one of SEQ ID NOs: 655-981 or 2198-2640.
69. The oligonucleotide of any one of claims 7-68, further comprising a terminal, chiral modification occurring at the first intemucleoside linkage at the 3 ’-end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the sense strand, having the linkage phosphorus atom in either Rp configuration or Sp configuration.
70. Tire oligonucleotide of any one of claims 7-69, further comprising a terminal, chiral modification occurring at the first and second intemucleoside linkages at the 3 ’-end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the antisense strand, having the linkage phosphoms atom in Rp configuration, and a terminal, chiralmodification occurring at the first intemucleoside linkage at the 5 ’-end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.
71. The oligonucleotide of any one of claims 7-70, further comprising a terminal, chiral modification occurring at the first, second and third intemucleoside linkages at the 3’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.
72. The oligonucleotide of any one of claims 7-71, further comprising a terminal, chiral modification occurring at the first, and second intemucleoside linkages at the 3 ’ end of the antisense strand, having the linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the third intemucleoside linkages at the 3 ’-end of the antisense strand, having the linkage phosphorus atom in Rp configuration, a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at tire first intemucleoside linkage at the 5 ’-end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.
73. Tire oligonucleotide of any one of claims 7-72, further comprising a terminal, chiral modification occurring at the first, and second intemucleoside linkages at the 3 ’-end of the antisense strand, having tlie linkage phosphorus atom in Sp configuration, a terminal, chiral modification occurring at the first, and second intemucleoside linkages at the 5’-end of the antisense strand, having the linkage phosphorus atom in Rp configuration, and a terminal, chiral modification occurring at the first intemucleoside linkage at the 5 ’-end of the sense strand, having the linkage phosphorus atom in either Rp or Sp configuration.
74. Tire oligonucleotide of any one of claims 7-73, further comprising a phosphate or phosphate mimic at the 5 ’-end of the antisense strand.
75. The oligonucleotide of claim 74, wherein the phosphate mimic is a 5 ’-vinyl phosphonate (VP).
76. The oligonucleotide of any one of claims 1-75, further comprising a targeting ligand.
77. The oligonucleotide of claim 76, wherein the targeting ligand is a small molecule-based, sugar-based (e.g., saccharide-based), fatty acid-based, protein-based, or nucleic acid-based targeting ligand.
78. Tire oligonucleotide of claim 77, wherein the protein-based targeting ligand is an antibody, nanobody, affibody, peptibody, or a peptide.
79. An oligonucleotide selected from the sense strands, antisense strands, and RNAi agents as listed in Tables 1A, IB, and 1C, or a pharmaceutically acceptable salt thereof.
80. A pharmaceutical composition comprising the oligonucleotide of any one of claims 1-79, or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier or excipient.
81. A method for inhibiting ACVR2A expression or treating an ACVR2A related disorder in a subject, the method comprising administering an effective amount of the oligonucleotide of any one of claims 1 -79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 80 to the subject.
82. Tire method of claim 81, wherein the subject is a human.
83. The method of claim 81 or 82, wherein the reduction of ACVR2A mRNA or protein expression levels is measured in a population of myocytes or cardiomyocytes derived from the subject.
84. The method of any one of claims 81-83, wherein the reduction of ACVR2A mRNA or protein expression levels is measured in tissues derived from the subject.
85. The method of any one of claims 81-84, wherein the ACVR2A-related disorder is obesity, sarcopenia, muscle waste, muscle atrophy, cachexia, fibrodysplasia ossificans progressiva, heterotaxy, sarcopenic obesity’, or sporadic inclusion body myositis.
86. The method of any one of claims 81-85, further comprising administering to the subject an additional agent or a therapy suitable for treatment or prevention of an ACVR2A related disorder.
87. A method of treating obesity in a subject in need thereof, the method comprising administering an effective amount of the oligonucleotide of any one of claims 1-79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 80 to the subject.
88. A method of preserving or increasing muscle mass in a subject in need of treatment for weight loss, the method comprising administering an effective amount of the oligonucleotide of any one of claims 1-79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 80 to the subject.
89. A method of preserving or increasing muscle mass in a subject in need of treatment for reduction of excess body weight or for maintenance of weight reduction, the method comprising administering an effective amount of the oligonucleotide of any one of claims 1- 79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 80 to the subject,90. A method of preserving or increasing muscle mass in a subject in need of treatment for a reduction of major adverse cardiovascular events (e.g., cardiovascular death, non-fatal myocardial infarction, or non-fatal stroke), the method comprising administering an effective amount of the oligonucleotide of any one of claims 1-79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 80 to the subject.
91. A method of preserving or increasing muscle mass in a subject in need of treatment for type 2 diabetes, the method comprising administering an effective amount of the oligonucleotide of any one of claims 1-79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 80 to the subject.
92. A method of inhibiting ActRII (e.g., through inhibition of ACVR2A expression) in a subject experiencing weight loss, the method comprising administering an effective amount of theoligonucleotide of any one of claims 1-79, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 80 to the subject., The method of any one of claims 81-92, wherein the subject is receiving or has received a GLP-1 receptor agonist (e.g., semaglutide, dulaglutide, liraglutide, exenatide, tirzepatide).