Method for producing l-valine

Abstract

Provided is a modified bacterium for producing L-valine, wherein, compared with an unmodified bacterium, the genome contains a LeuDHV22I mutation and / or one or more modifications that enhance the activity of ilvC, ilvD and / or ilvE, and the modified bacterium can be produced under both anaerobic and aerobic conditions. In addition, further provided is a method for increasing the yield of L-valine by using the modified bacterium.

Description

A method for producing L-valine

[0001] priority

[0002] This application claims the rights and priority of Chinese application No. 2024118454125, filed on December 13, 2024. The entire contents of Chinese application No. 2024118454125 are incorporated herein by reference for all purposes. Technical Field

[0003] This disclosure pertains to the field of bacterial fermentation, and particularly relates to a method for producing L-valine by using bacterial fermentation. Background Technology

[0004] L-valine is a natural essential amino acid widely used in animal feed. Therefore, there is an urgent need to improve L-valine production to reduce its production costs, ensure feed supply, and replace soybean meal, which is of great significance to national food security.

[0005] There are several methods for producing L-valine, including extraction, synthesis, and fermentation. Extraction is costly and unsuitable for modern industrial production; chemical synthesis is not only costly and complex with numerous steps, but also produces many byproducts; fermentation, which utilizes microbial fermentation to produce L-valine, has advantages such as low raw material costs, mild reaction conditions, and the ability to be produced on a large scale, making it a very economical production method.

[0006] L-valine synthesis begins with pyruvate and involves four enzymes: acetohydroxy acid synthase (AHAS), acetohydroxy acid isomeroreductase (AHAIR), dihydroxy acid dehydratase (DHAD), and branched-chain amino acid transaminase (BCAATA). AHAS is the key enzyme, condensing two pyruvate molecules to form α-acetolactate. It is subject to feedback inhibition by the terminal product and can be induced to become an anti-feedback inhibition version, IlvN. G156E IlvN G20D，I21D，I21F and IlvH G41A，C50T AHAIR catalyzes the isomerization and reduction of α-acetolactate to α,β-dihydroxyisovalerate. Its cofactors favor NADPH, and protein engineering can be used to make it favor NADH, such as IlvC. s34G，L48E，R49F With IlvC L67E，R68F，K75EDHAD catalyzes the dehydration of dihydroxyisovalerate to α-ketoisovalerate. Finally, BCAATA or other non-specific transaminases convert α-ketoisovalerate to L-valine, requiring glutamate as an amino donor and consuming one molecule of NADPH; alternatively, leucine dehydrogenases, such as those derived from Bacillus lysine, can directly add ammonia, consuming one molecule of NADH.

[0007] There are many strains that produce L-valine, with Corynebacterium glutamicum and Escherichia coli being the most frequently reported. Hasegawa et al. used the AHAS mutant in Corynebacterium glutamicum to remove the feedback inhibition of L-valine production by overexpressing AHAS, AHAIR, DHAD, and BCAATA. They used the AHAIR mutant, which is cofactor-biased towards NADH, and introduced leuDH, encoded by Bacillus lysine, to replace ilvE, thus converting the cofactor required for L-valine synthesis from NADPH to NADH. The final strain produced 1,470 mM of L-valine during the 24-hour anaerobic phase, with a conversion rate of 0.63 mol / mol glucose. After 48 hours, the L-valine production reached 1,940 mM, but a large amount of succinic acid was produced as a byproduct (Hasegawa, S., Uematsu, K., Natsuma, Y., Suda, M., Hiraga, K., & Jojima, T., et al. (2012). Improvement of the redox balance increases-valine production by under oxygen deprivation conditions. Applied & Environmental Microbiology, 78(3), 865-875.). To address this, they knocked out the phosphoenolpyruvate carboxylase gene ppc and additionally inactivated the acetic acid synthesis pathway that produces NADH; they also overexpressed the glycolysis pathway genes gapA, pyk, pfkA, pgi, and tpi. Knocking out L-alanine transaminase avtA inhibited L-alanine production, resulting in a slight decrease in L-valine production to 1,280 mM L-valine (24-hour anaerobic), but the conversion rate increased to 0.88 mol / mol glucose (Satoshi, Hasegawa, Masako, Suda, Kimio, & Uematsu, et al. (2012). Engineering of corynebacterium glutamicum for high-yield L-valine production under oxygen deprivation conditions. Applied & Environmental Microbiology.).

[0008] In *Escherichia coli*, the synthesis pathway of L-valine is similar to that of *Corynebacterium glutamicum*. To improve the conversion rate, *E. coli* can also produce L-valine using a two-stage fermentation method. Xie Xixian et al. introduced AHAS from *Bacillus subtilis*, which is resistant to feedback inhibition; used the NADH-dependent AHAIR mutant and NADH-dependent leucine dehydrogenase, and overexpressed the transhydrogenase gene pntAB to promote the conversion of NADH to NADPH; and introduced L-valine efflux protein from *Corynebacterium glutamicum* (Yanan Hao, et al. "High-yield production of L-valine in engineered *Escherichia coli* by a novel two-stage fermentation." *Metabolic Engineering* 62 (2020): 198-206.). The obtained strain, using a two-stage fermentation method similar to that of *Corynebacterium glutamicum*, produced 84 g / L of L-valine in a 5 L fermenter, with a conversion rate of 0.41 g / g glucose (0.63 mol / mol glucose) and a production intensity of 2.33 g / L / hour. Overall, the two-stage fermentation method did not account for the sugar consumption in the first stage, and the total production time for both stages was relatively long. The *E. coli* L-valine synthesis pathway can achieve reducing power balance and has an ATP surplus, suggesting that it should be possible to produce L-valine using a completely anaerobic method, but this has not yet been achieved.

[0009] Anaerobic growth rescue has transformed E. coli from mixed acid fermentation to homologous fermentation of n-butanol, D-lactic acid, succinic acid, ethanol, and L-alanine. The principle is to block the NADH consumption pathway in E. coli, thus depriving it of its anaerobic growth ability, and then introduce the NADH consumption pathway, thereby rescuing it from anaerobic growth. This is a highly efficient breeding method. Summary of the Invention

[0010] On the one hand, this disclosure provides a modified bacterium for producing L-valine, wherein the modified bacterium contains LeuDH compared to unmodified bacteria. V22I .

[0011] In one specific implementation, the modified bacteria, wherein the LeuDH is derived from lysine-containing Bacillus.

[0012] In one specific implementation, the modified bacteria comprises one or more LeuDH cells. V22I Gene copies are preferably two to eleven, such as two, three, four, five, six, seven, eight, nine, ten, or eleven copies, with eight copies being more preferred.

[0013] In one specific embodiment, the modified bacteria further comprises one or more modifications that enhance the activity of ilvC, ilvD, and / or ilvE.

[0014] In one specific implementation, the modified bacteria contains one or more copies of the ilvC gene, preferably two to ten copies, such as two, three, four, five, six, seven, eight, nine, or ten copies, with five copies being more preferred.

[0015] In one specific implementation, the modified bacteria contains one or more copies of the ilvD gene, preferably two to ten copies, such as two, three, four, five, six, seven, eight, nine, or ten copies, with four copies being more preferred.

[0016] In one specific implementation, the modified bacteria contains one or more copies of the ilvE gene, preferably two to ten copies, such as two, three, four, five, six, seven, eight, nine, or ten copies, with three copies being more preferred.

[0017] In one specific embodiment, the modified bacteria further includes an amino acid sequence mutation of the acetylhydroxy acid synthase IlvBN, preferably, the mutation being selected from IlvBN. G20D IlvBN V21D and IlvBN M22F .

[0018] In one specific implementation, the modified bacteria further includes modifications to reduce the production of byproducts.

[0019] In one specific embodiment, the modified bacteria, wherein the modification for reducing byproduct production is selected from all knockouts, truncations and simultaneous repair of frameshift mutations to wild type, or other truncations that reduce activity by more than 10%, of avtA, ldhA, mgsA, frd, pflB, adhE, ackA, alaA and / or alaC.

[0020] In one specific implementation, the modified bacteria contain a modification that enhances the activity of the transhydrogenase pntAB gene.

[0021] In one specific implementation, the modified bacteria contain a modification that enhances the activity of the nadK gene.

[0022] In one specific implementation, the modified bacteria are grown under anaerobic or aerobic conditions.

[0023] On the other hand, the use of the modified bacteria described in this disclosure in increasing L-valine production is provided.

[0024] On the other hand, a method for producing L-valine is provided, comprising culturing the modified bacteria described in this disclosure in a culture medium.

[0025] In one specific embodiment, the culture medium contains glucose.

[0026] In one specific embodiment, the method further includes separating L-valine.

[0027] On the other hand, a bioreactor includes the modified bacteria described in this disclosure. Beneficial effects

[0028] The genetically engineered bacteria disclosed herein have a high valine conversion rate. Attached Figure Description

[0029] This disclosure can be more fully understood with reference to the following figures.

[0030] Figure 1 illustrates the anaerobic valine metabolic pathway in Escherichia coli.

[0031] Figure 2 shows LeuDH and LeuDH V22I Gel image of purified protein. WC: whole cells; S: supernatant; FL: flow-through; WB: washing buffer; EB: elution buffer.

[0032] Figure 3 shows the specific activity of LeuDH and its mutants and the yield of the corresponding strains. Detailed Implementation

[0033] The following description of this disclosure is merely intended to illustrate various embodiments of the disclosure. Therefore, the specific modifications discussed should not be construed as limiting the scope of this disclosure. It will be apparent to those skilled in the art that various equivalents, changes, and modifications can be made without departing from the scope of this disclosure, and it should be understood that these equivalent embodiments are included herein. All references cited herein, including publications, patents, and patent applications, are incorporated herein by reference in their entirety.

[0034] To enable those skilled in the art to better understand the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present disclosure, and not all embodiments.

[0035] Experimental Materials and Methods

[0036] (1) Strains and culture media

[0037] Plasmids were constructed using *Escherichia coli* DH5α as the cloning host, and *E. coli* Synthesized 1.0 was used as the starting strain for modification. The cultures were incubated at 37°C on LB broth (liquid or solid). The LB broth formulation consisted of 5 g / L yeast extract, 10 g / L peptone, and 10 g / L sodium chloride. 1.5-2% agar powder was added to the solid culture. The working concentrations of the antibiotics used were: kanamycin 50 μg / mL, spectinomycin 100 μg / mL, chloramphenicol 25 μg / mL, and bleomycin 50 μg / mL. L-rhamnose and L-arabinose were added at a concentration of 10 mM.

[0038] NBSA and AM1A media supplemented with 2-12% (w / v) glucose were used as acclimatization and fermentation media, respectively. The media formulations are shown in Table 1. Taking 2% glucose supplementation as an example, the medium is called NBSAG20 or AM1AG20, where G represents glucose and 20 represents the glucose concentration (g / L). In the initial acclimatization for valine production, the strain was grown in antibiotic-free NBSA inorganic salt medium at 37°C, with 100 mM ammonium sulfate, 1 mM betaine, and 2% (w / v) glucose added. The strains involved in this disclosure are shown in Table 3.

[0039] Table 1. Formulations of NBS and AM1 culture media

[0040] Table 2. Micronutrient formulation

[0041] Table 3. Strains used

[0042] (2) Construction methods of strains and plasmids

[0043] The pTargetF series plasmids were constructed by replacing the N20-1 sequence (catcgccgcagcggtttcag) on ​​pTargetF (Addgene: 62226) using QuickChange. The pTargetF plasmid names and their corresponding N20 sequences used in strain construction are shown in Table 4.

[0044] Table 4. Plasmids used in this disclosure

[0045] Table 5. Primers used in this disclosure

[0046] (3) Anaerobic acclimatization

[0047] Incubate in a fully enclosed anaerobic environment (300 or 500 mL) at 37°C, maintaining a pH of 7.0 using 30-50% concentrated ammonia. Subculture every 48 or 24 hours, using an inoculum of 1% (v / v). As growth accelerates, appropriately increase the glucose concentration in the acclimatization medium.

[0048] (4) Anaerobic fermentation in acclimatization bottles

[0049] Single colonies of the acclimatized bacteria were streaked and inoculated into 4 mL LB broth, incubated at 37°C and 240 rpm for 24 h. 1% was then transferred to 250 mL sealed Erlenmeyer flasks and cultured on NBS AG50 medium, incubated at 37°C and 120 rpm for 18 h. Finally, 10% was inoculated into 500 mL sealed Erlenmeyer flasks on AMI AG100 medium, incubated at 37°C and 500 rpm, with the pH adjusted to 7.0 using 30-50% concentrated ammonia, and cultured for 24 h.

[0050] (5) Determination of valine yield by high performance liquid chromatography

[0051] Using a UV spectrophotometer at 600 nm (OD) 600 E. coli biomass was determined by absorbance at a specific temperature. Glucose concentration was determined using an SBA-40C biosensor (Shandong Academy of Sciences, China) or high-performance liquid chromatography (HPLC). L-valine concentration was determined by HPLC after derivatization with phthalaldehyde. The mobile phase consisted of an acetonitrile / water (50:50, v / v) mixture and 50 mM sodium acetate at a flow rate of 1 mL / min, and the UV detection wavelength was 360 nm.

[0052] (6) Genomic sample preparation and analysis methods

[0053] Single clones requiring whole-genome sequencing were cultured overnight in LB medium. The next day, 2 mL of bacterial culture was centrifuged, the supernatant was discarded, and the bacterial pellet was stored at -80°C. Genomic DNA was extracted by Beijing Novogene Technology Co., Ltd., and genome sequencing was performed using the Novaseq 6000 platform. The library type was Novaseq PE150, and the data volume was 1 GB. The *E. coli* ATCC 8739 genome sequence (CP000946) was used as the reference genome, and alignment analysis was performed using snippy v3.1 (https: / / github.com / tseemann / snippy). Since the starting strain was Synthesized 1.0, if mutations existed in both the evolutionary strain and the TYS8789 genome, they were considered to be due to differences in the initial strain or mutations introduced during construction and were not included in functional analysis.

[0054] (7) Expression and purification of LeuDH

[0055] The LeuDH expression cassette was constructed on pET-28a, with the His-tag located at the C-terminus of LeuDH, and then transformed into BL21(DE3) for expression. Single colonies grown on the plate were inoculated into test tubes, cultured overnight at 37°C, and then transferred to 1L shake flasks. 600 At a concentration of 1.0, enzyme expression was induced overnight at 16°C for 16 h with 1 mM IPTG, and cells (3 g, wet weight) were harvested by centrifugation. Cells were resuspended in 30 mL of lysis buffer (50 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0) and lysed using a French press. The lysed cells were centrifuged at 40,000 rpm for 1 h, and the supernatant was loaded onto a Ni-NTA agarose gel column (2 mL gel slurry, 1.7 x 14 cm). The cells were washed three times with 4 mL of wash buffer (50 mM NaH2PO4, 1 M NaCl, 20 mM imidazole, pH 6.5), followed by elution with a buffer containing 50 mM NaH2PO4, 300 mM NaCl, and 250 mM imidazole (pH 8.0, 0.7 mL each time). The fraction containing purified protein was collected and desalted using a Millipore (10 K MWCO) concentrator. (Li, H., Zhu, D., Hyatt, BA, Malik, FM, Biehl, ER, & Hua, L.. (2009). Cloning, protein sequence clarification, and substrate specificity of a leucine dehydrogenase from bacillus sphaericus atcc4525. Applied Biochemistry &Biotechnology, 158(2), 343-351.)

[0056] (8) Method for determining the activity of leucine dehydrogenase (LeuDH)

[0057] Two mL of cells cultured overnight were centrifuged at 4000 rpm for 10 min at 4 °C and resuspended in 1 mL of lysis buffer (100 mM Tris / HCl, pH 7.5). The cell suspension was sonicated on ice for 2 min, or lysed using a tissue homogenizer with 1 mm glass beads. The amount of NADH consumed during the reduction of ketovaline by LeuDH was determined using a Tacan Spark microplate reader, and the absorbance change was monitored at 340 nm. The reaction mixture (200 μL) contained ketovaline (4.5 mM), NH4OH-NH4Cl (900 mM, pH 9.5), NADH (0.2 mM), and crude or purified enzyme solution (2.5 mg / L). The reaction was carried out at 30 °C for 2 min, and the absorbance change at 340 nm was recorded every 10 s. One unit of LeuDH enzyme activity was defined as the amount of enzyme required to catalyze the consumption of 1 μM NADH per minute under experimental conditions.Protein concentration was determined by Bradford method at room temperature using bovine serum albumin as standard (Tao, R., Jiang, Y., Zhu, F., & Yang, S.. (2014). A one-pot system for production of l-2-aminobutyric acid from l-threonine by l-threonine deaminase and a nadh-regeneration system based on l-leucine dehydrogenase and formate dehydrogenase. Biotechnology Letters (4); Zhu, L., Wu, Z., Jin, JM, & Tang, SY. (2016). Directed evolution of leucine dehydrogenase for improved efficiency of l-tert-leucine synthesis. Appl Microbiol Biotechnol, 100(13), 5805-5813; Zhou, JunpingWang, YalingChen, JiajieXu, MeijuanYang, TaoweiZheng, JunxianZhang, XianRao, Zhiming. (2019). Rational engineering of bacillus cereus leucine dehydrogenase towards alpha-keto acid reduction for improving unnatural amino acid production. Biotechnology Journal: Healthcare, Nutrition, Technology, 14(3).).

[0058] Example

[0059] To enable those skilled in the art to better understand the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present disclosure, and not all embodiments.

[0060] Example 1: Construction of Synthesized 1.0 strain

[0061] L-valine exhibits feedback inhibition of acetylhydroxyl synthase, the first-step enzyme derived from pyruvate. Acetylhydroxyl synthase is a heterodimer encoded by IlvB and IlvN. Mutations in IlvN (G20D, V21D, M22F) can relieve the feedback inhibition of L-valine (JH Park 2011, BB). The second-step enzyme, acetylhydroxyl isomerase, is encoded by ilvC, with a cofactor preference of NADPH. The third-step enzyme, dihydroxylase, is encoded by ilvD. The final enzyme is a branched-chain aminotransferase encoded by ilvE, with a NADPH preference for the synthesis of the amino donor L-glutamate. In addition to introducing feedback-resistant ilvBN from *E. coli* ATCC 8739, this disclosure also includes overexpression of one copy of ilvED via the tac promoter, as well as NADH-preferring ilvC from *Corynebacterium glutamicum* and leuDH from *Bacillus lysinus*. The key enzymes adhE, ackA, ldhA, mgsA, frd, pflB, and avtA in the pathways of ethanol, acetic acid, lactic acid, succinic acid, and formic acid were also knocked out. Additionally, ygaZH, encoding branched-chain amino acid efflux proteins, and the global regulatory factor lrp were enhanced using the tac promoter. Two more alanine synthesis-related aminotransferases, alaA and alaC, were knocked out, and the terminal pathway was further enhanced by integrating five expression cassettes: PldhA-ilvCcg, PldhA-leuDH, PldhA-ilvBN (G20D, V21D, M22F), PldhA-ilvD, and Ptac-ilvC. PldhA-nadK and Ptac-pntAB were integrated to obtain Synthesized 1.0 (Figure 1). The specific construction of the Synthesized 1.0 strain is as follows:

[0062] 1.1 Insertion of Ptac-ilvBN at the adhE site mut

[0063] (1) Construction of pEcgRNA-adhE plasmid:

[0064] The synthesized oligosaccharide nucleic acids adhE-F / adhE-R were annealed and self-assembled to form a double-stranded sequence. The reaction system consisted of: 5 μl T4 ligase buffer, 5 μl primer adhE-F (20 μM), 5 μl primer adhE-R (20 μM), and 35 μl ddH2O. The reaction conditions were: incubation at 95℃ for 5 min, decreasing the temperature by 5–10℃ per minute, followed by incubation at 16℃ for 10 min. The self-assembled double-stranded sequence was diluted 200-fold, and 1 μl of the linearized fragment of pEcgRNA (Addgene: 166581) digested with BsaI was ligated using T4 ligase. The ligation product was transformed into DH5α chemocompetent cells, and the recovered bacterial culture was plated on LB agar plates containing spectinomycin (final concentration 50 μg / mL) to obtain transformants containing the pEcgRNA-adhE plasmid.

[0065] (2) Preparation of electroporation fragments:

[0066] Following the method described in patent document CN112662607A, the plasmid pTargetT-Ptac-stlA(exo) was constructed using the following steps:

[0067] Using the genome of *E. coli* Nissle 1917 as a template, PCR amplification was performed using primers exo-F1 / exo-R1 and exo-F2 / exo-R2 to obtain exo-UP and exo-DN fragments, each approximately 600 bp. Using p57-tac plasmid as a template, PCR amplification was performed using primers tac(exo)-F / tac-R to obtain the tac(exo) fragment, approximately 2.1 kb. Using pTargetT-Ptac-stlA(rhtC) plasmid as a template, PCR amplification was performed using primers stlA(rhtC)-F / stlA(exo)-R to obtain the stlA(exo) fragment, approximately 1.6 kb. The exo-UP, tac(exo), stlA(exo), and exo-DN fragments were then assembled using DNA assembly methods. The kit was purchased from TransGen. The pTargetF-exo (modified from Addgene: 62226, with the N20-1 sequence (catcgccgcagcggtttcag changed to N20: tttattgatatatttacgtc) was cloned into the EcoRI / HindIII site to obtain the pTargetT-Ptac-stlA(exo) plasmid.

[0068] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using primers adhE-F1(KO) / adhE-R1(KO), adhE-F2(KO) / adhE-R2(KO), ilvBNm-F1 / ilvBNm-R1, and ilvBNm-F2 / ilvBNm-R2 to obtain the following fragments: adhE-UP, adhE-DN, ilvBNm-1, and ilvBNm-2, with approximate values ​​of 530 bp, 550 bp, and 1.8 kb, respectively. b and 400bp; using pTargetT-Ptac-stlA(exo)(CN112662607A) plasmid as template and Ptac-F(TY) / Ptac-R as primers, PCR amplification yielded a Ptac fragment of approximately 200bp; using adhE-UP, adhE-DN, ilvBNm-1, ilvBNm-2, and Ptac fragments as templates and adhE-F1(KO) / adhE-R2(KO) as primers, overlap PCR amplification yielded a Ptac-ilvBNm(adhE) fragment of approximately 3.4kb.

[0069] (3) Preparation of competent cells:

[0070] The pEcCas(MC_0101208) plasmid was transformed into *E. coli* ATCC 8739 chemically competent cells. Transformants were obtained by screening on LB agar plates containing kanamycin (50 μg / mL) (the method for preparing chemically competent cells is described in *Molecular Cloning: A Laboratory Manual*, 3rd edition). Single colonies of ATCC8739 / pEcCas were picked and placed in 4 mL LB tubes containing kanamycin (50 μg / mL). The cells were incubated at 37°C and 220 rpm. When the OD600 reached 0.4, 10 mM arabinose was added for induction. The cells were incubated for another hour to prepare electrotransformation competent cells (the method for preparing electrotransformation competent cells is described in reference Li, 2021, *Acta Biochim Biophys Sin. ibid.*).

[0071] (4) Electrostatic transfer:

[0072] The Ptac-ilvBNm(adhE) fragment and pEcgRNA-adhE plasmid were electroporated into ATCC8739 / pEcCas competent cells (electroporation conditions: 2.5kV, 200Ω, 25μF). The cells were plated on LB plates containing spectinomycin (50μg / ml) and kanamycin (50μg / ml) and incubated overnight at 37°C. Single colonies were grown and colony PCR was performed using the adhE-VF / ilvBN-VR primers to verify the colony. The positive fragment was approximately 1kb.

[0073] (5) Loss of pEcgRNA-adhE plasmid:

[0074] Single colonies that were positive for PCR were picked and inoculated into LB tubes containing kanamycin (final concentration 50 μg / ml), along with 10 mM rhamnose, and incubated overnight at 37°C. The next day, the bacterial culture was streaked directly onto LB agar plates containing kanamycin (final concentration 50 μg / ml) and incubated overnight at 37°C. The following day, single colonies were picked and transferred to LB agar plates containing spectinomycin (final concentration 50 μg / ml). If no growth was observed, it indicated that the pEcgRNA-avtA plasmid had been lost, yielding ATCC8739 (ΔadhE::Ptac-ilvBN). mut ) / pEcCas strain.

[0075] (6) pEcCas plasmid loss:

[0076] Pick ATCC 8739(ΔadhE::Ptac-ilvBN mut Positive clones of pEcCas were directly cultured overnight at 37°C on an antibiotic-free LB medium using a shaker. A small amount of the bacterial culture was streaked onto 10 g / L sucrose LB agar plates for single colony agarization. Single colonies were identified on LB agar plates containing kanamycin (50 μg / mL) to verify pEcCas plasmid elimination. ATCC8739(ΔadhE::Ptac-ilvBN) was obtained. mut ).

[0077] 1.2. Insertion of Ptac-leuDH at the avtA site

[0078] (1) Construction of pEcgRNA-avtA plasmid:

[0079] The synthesized oligosaccharide nucleic acids avtA-F / avtA-R were annealed and self-assembled to form a double-stranded sequence. The reaction system consisted of: 5 μl T4 ligase buffer, 5 μl primer avtA-F (20 μM), 5 μl primer avtA-R (20 μM), and 35 μl ddH2O. The reaction conditions were: incubation at 95℃ for 5 min, decreasing the temperature by 5–10℃ per minute, followed by incubation at 16℃ for 10 min. The self-assembled double-stranded sequence was diluted 200-fold, and 1 μl of the sequence was ligated with the BsaI-digested linearized fragment of pEcgRNA using T4 ligase. The ligation product was transformed into DH5α chemocompetent cells, and the recovered bacterial culture was plated on LB agar plates containing spectinomycin (final concentration 50 μg / mL) to obtain transformants containing the pEcgRNA-avtA plasmid.

[0080] (2) Preparation of electroporation fragments:

[0081] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers avtA-F1(KO) / avtA-R1(KO) and avtA-F2(KO) / avtA-R2(KO) to obtain avtA-UP and avtA-DN fragments, approximately 500 bp each. Using the pTargetT-Ptac-stlA(exo) plasmid (CN112662607A) as a template, and primers Ptac-F(avtA) / Ptac-R, the fragments were amplified. The Ptac(avtA) fragment, approximately 200 bp, was obtained by PCR amplification. Using pUC-leuDH plasmid (synthesized by GenScript) as a template and leuDH-F / leuDH-R as primers, the leuDH fragment was amplified by PCR. The leuDH gene sequence is shown in Table 6 and is approximately 1.1 kb. Using avtA-UP, avtA-DN, Ptac(avtA), and leuDH fragments as templates and avtA-F1(KO) / avtA-R2(KO) as primers, the Ptac-leuDH(avtA) fragment, approximately 2.3 kb, was obtained by overlap PCR amplification.

[0082] (3) Preparation of competent cells:

[0083] The pEcCas(Addgene: 62225) plasmid was transformed into E. coli ATCC 8739(ΔadhE::Ptac-ilvBN). mut ATCC 8739 (ΔadhE::Ptac-ilvBN) was obtained by screening competent cells on LB agar plates containing kanamycin (50 μg / mL). mut Competent cells / pEcCas transformants (for the preparation of competent cells through chemical transformation, refer to *Molecular Cloning: A Laboratory Manual* (3rd edition)). Pick ATCC 8739 (ΔadhE::Pttac-ilvBN). mut A single colony of ) / pEcCas was cultured in a 4 mL LB tube containing kanamycin (50 μg / mL) at 37°C and 220 rpm. The bacterial concentration was determined by OD0.05. 600 When the concentration was 0.4, arabinose was added to a final concentration of 10 mM for induction, and the cells were cultured for another hour to prepare electrocompetent cells (for the preparation method of electrocompetent cells, refer to Li, 2021, Acta Biochim Biophys Sin.ibid.).

[0084] (4) Electrostatic transfer:

[0085] The Ptac-leuDH(avtA) fragment and pEcgRNA-avtA plasmid were electroporated into ATCC 8739 (ΔadhE::Ptac-ilvBN). mutSingle colonies were grown in leuDH-VF / avtA-VR primers and verified by colony PCR. The positive fragment was about 1.3kb.

[0086] (5) Loss of pEcgRNA-avtA plasmid:

[0087] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN). mut ,ΔavtA::Ptac-leuDH) / pEcCas strain.

[0088] 1.3. Insertion of Ptac-ilvC at the ldhA site cg

[0089] (1) Construction of pEcgRNA-ldhA plasmid:

[0090] The two synthesized oligosaccharide nucleic acids ldhA-F / ldhA-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-ldhA plasmid.

[0091] (2) Preparation of electroporation fragments:

[0092] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers ldhA-F1(KO) / ldhA-R1(KO) and ldhA-F2(KO) / ldhA-R2(KO) to obtain ldhA-UP and ldhA-DN fragments, each approximately 500 bp in size. Using the pTargetT-Ptac-stlA(exo)(CN112662607A) plasmid as a template, and primers Ptac-F(ldhA) / Ptac-R,... PCR amplification yielded the Ptac(ldhA) fragment, approximately 200 bp. Using the pUC-ilvCcg plasmid (synthesized by GenScript) as a template and ilvCcg-F / ilvCcg-R as primers, PCR amplification was performed on the ilvCcg fragment. The ilvCcg gene sequence is shown in Table 6, approximately 1 kb. Using ldhA-UP, ldhA-DN, Ptac(ldhA), and ilvCcg fragments as templates and ldhA-F1(KO) / ldhA-R2(KO) as primers, overlap PCR amplification yielded the Ptac-ilvCcg(ldhA) fragment, approximately 2.3 kb.

[0093] (3) Electrostatic transfer:

[0094] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-ilvCcg(ldhA) fragment and pEcgRNA-ldhA plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mut In competent cells, single colonies were verified by colony PCR using primers ldhA-VF / ilvCcg-VR, and the positive fragment was approximately 1.2 kb.

[0095] (4) Loss of pEcgRNA-ldhA plasmid:

[0096] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN). mut ,ΔavtA::Ptac-leuDH,ΔldhA::Ptac-ilvCcg) / pEcCas strain.

[0097] Table 6. Gene Sequences

[0098] 1.4. mgsA site insertion into Ptac-lrp

[0099] (1) Construction of pEcgRNA-mgsA plasmid:

[0100] The synthesized two oligosaccharide nucleic acids mgsA-F / mgsA-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as in Example 1, 1.1(1), to obtain the pEcgRNA-mgsA plasmid.

[0101] (2) Preparation of electroporation fragments:

[0102] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers mgsA-F1(KO) / mgsA-R1(KO), mgsA-F2(KO) / mgsA-R2(KO), and lrp-F / lrp-R to obtain mgsA-UP, mgsA-DN, and lrp fragments, approximately 450bp, 400bp, and 600bp, respectively. Using the pTargetT-Ptac-stlA(exo)(CN112662607A) plasmid as a template, PCR amplification was performed using primers Ptac-F(TY) / Ptac-R to obtain the Ptac fragment, approximately 200bp. Using the mgsA-UP, mgsA-DN, lrp, and Ptac fragments as templates, and primers mgsA-F1(KO) / mgsA-R2(KO), overlap... PCR amplification yielded a Ptac-lrp(mgsA) fragment, approximately 1.7 kb.

[0103] (3) Electrostatic transfer:

[0104] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-lrp(mgsA) fragment and pEcgRNA-mgsA plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mut In competent cells, single colonies were verified by colony PCR using the mgsA-VF / lrp-VR primers. The positive fragment was approximately 1 kb.

[0105] (4) Loss of pEcgRAN-mgsA plasmid:

[0106] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN). mut , ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp) / pEcCas strain.

[0107] 1.5. FRD site insertion of Ptac-ygaZH

[0108] (1) Construction of pEcgRNA-frd plasmid:

[0109] The synthesized two oligosaccharide nucleic acids, frd-F and frd-R, were annealed to form a double-stranded sequence. The method was the same as in Example 1, section 1.1.

[0110] (1) Obtain the pEcgRNA-frd plasmid.

[0111] (2) Preparation of electroporation fragments:

[0112] Using the Escherichia coli ATCC 8739 genome as a template, PCR amplification was performed using primers frd-F1(KO) / frd-R1(KO), frd-F2(KO) / frd-R2(KO), and ygaZH-F / ygaZH-R to obtain frd-UP, frd-DN, and ygaZH fragments, approximately 500bp, 450bp, and 1.1kb, respectively. Using frd-UP, frd-DN, ygaZH, and Ptac fragments as templates, and frd-F1(KO) / frd-R2(KO) as primers, overlap PCR amplification was performed to obtain the Ptac-ygaZH(frd) fragment, approximately 2.3kb.

[0113] (3) Electrostatic transfer:

[0114] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-ygaZH(frd) fragment and pEcgRNA-frd plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mut In competent cells, single colonies were verified by colony PCR using the primers frd-VF / ygaZH-VR. The positive fragment was approximately 1.2 kb.

[0115] (4) Loss of pEcgRNA-frd plasmid:

[0116] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN). mut , ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp, Δfrd::Ptac-ygaZH) / pEcCas strain.

[0117] 1.6. pflB gene knockout

[0118] (1) Construction of pEcgRNA-pflB plasmid:

[0119] The synthesized two oligosaccharide nucleic acids, pflB-F / pflB-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-pflB plasmid.

[0120] (2) Preparation of electroporation fragments:

[0121] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using pflB-F1(KO) / pflB-R1(KO) and pflB-F2(KO) / pflB-R2(KO) as primers to obtain pflB-UP and pflB-DN fragments, each approximately 400 bp. Using pflB-UP and pflB-DN fragments as templates, overlap PCR amplification was performed using pflB-F1(KO) / pflB-R2(KO) as primers to obtain the pflB(KO) fragment, approximately 800 bp.

[0122] (3) Electrostatic transfer:

[0123] The method is the same as 1.1(3) and (4) in Example 1. The pflB(KO) fragment and pEcgRNA-pflB plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mutIn competent cells, single colonies were verified by colony PCR using primers pflB-VF / pflB-R2(KO), and the positive fragment was approximately 1 kb.

[0124] (4) Loss of pEcgRNA-pflB plasmid:

[0125] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN). mut , ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp, Δfrd::Ptac-ygaZH, ΔpflB) / pEcCas strain.

[0126] 1.7. ackA site insertion Ptac-ilvED

[0127] (1) Construction of pEcgRNA-ackA plasmid:

[0128] The synthesized two oligosaccharide nucleic acids, ackA-F / ackA-R, were annealed to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-ackA plasmid.

[0129] (2) Preparation of electroporation fragments:

[0130] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers ackA-F1(KO) / ackA-R1(KO), ackA-F2(KO) / ackA-R2(KO), and ilvED-F / ilvED-R to obtain ackA-UP, ackA-DN, and ilvED fragments, approximately 550bp, 500bp, and 2.8kb, respectively. Using ackA-UP, ackA-DN, ilvED, and Ptac fragments as templates, and primers ackA-F1(KO) / ackA-R2(KO), overlap PCR amplification was performed to obtain the Ptac-ilvED(ackA) fragment, approximately 4.2kb.

[0131] (3) Electrostatic transfer:

[0132] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-ilvED(ackA) fragment and pEcgRNA-ackA plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mutIn competent cells, single colonies were verified by colony PCR using primers ackA-VF / ilvED-VR. The positive fragment was approximately 1.6 kb.

[0133] (4) Loss of pEcgRNA-ackA plasmid:

[0134] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN) mut , ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp, Δfrd::Ptac-ygaZH, ΔpflB, ΔackA::Ptac-ilvED) / pEcCas strain.

[0135] (5) pEcCas plasmid loss:

[0136] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN). mut , ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp, Δfrd::Ptac-ygaZH, ΔpflB, ΔackA::Ptac-ilvED), named TYS8975.

[0137] 1.8. alaA gene knockout

[0138] (1) Construction of pEcgRNA-alaA plasmid:

[0139] The two synthesized oligosaccharide nucleic acids alaA-F / alaA-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-alaA plasmid.

[0140] (2) Preparation of electroporation fragments:

[0141] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using alaA-F1(KO) / alaA-R1(KO) and alaA-F2(KO) / alaA-R2(KO) as primers to obtain alaA-UP and alaA-DN fragments of approximately 500bp and 400bp, respectively. Using alaA-UP and alaA-DN fragments as templates, and alaA-F1(KO) / alaA-R2(KO) as primers, overlap PCR amplification was performed to obtain the alaA(KO) fragment of approximately 900bp.

[0142] (3) Electrostatic transfer:

[0143] The method is the same as in Example 1, 1.1(3)(4). The alaA(KO) fragment and pEcgRNA-alaA plasmid were electroporated into TYS8975 / pEcCas competent cells. Single colonies were verified by colony PCR using alaA-VF / alaA-R2(KO) primers. The positive fragment was approximately 1.1 kb.

[0144] (4) Loss of pEcgRNA-alaA plasmid

[0145] The method was the same as in Example 1, 1.1(5), to obtain the TYS8975(ΔalaA) / pEcCas strain.

[0146] (5) pEcCas plasmid loss:

[0147] The method was the same as in Example 1, 1.1(5), to obtain the TYS8975(ΔalaA) strain.

[0148] 1.9.alaC gene knockout

[0149] (1) Construction of pISFba1reRNA-alaC plasmid:

[0150] The two synthesized oligosaccharide nucleic acids alaC-F / alaC-R were used to replace the spacer sequence (CTGATGGTCCATGTCTGTTA) on pISFba1reRNA (Addgene: 226822) using QuickChange to obtain the pISFbalreRNA-alaC plasmid.

[0151] (2) Preparation of electroporation fragments:

[0152] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using alaC-F1(KO) / alaC-R1(KO) and alaC-F2(KO) / alaC-R2(KO) as primers to obtain alaC-UP and alaC-DN fragments, approximately 600bp and 500bp, respectively. Using alaC-UP and alaC-DN fragments as templates, and alaC-F1(KO) / alaC-R2(KO) as primers, overlap PCR amplification was performed to obtain the alaC(KO) fragment, approximately 1.1kb.

[0153] (3) Electrostatic transfer:

[0154] 300 ng of pISFbal (Addgene: 226820) plasmid was transformed into E. coli TYS8975(ΔalaA) electrocompetent cells. Transformants were obtained by screening on LB agar plates containing kanamycin (50 μg / mL). TYS8975(ΔalaA) / pISFbal transformants were inoculated into LB tubes containing 5 mL of kanamycin and cultured overnight at 37°C and 220 rpm. The overnight culture was then transferred at a 1% inoculum to fresh LB tubes containing kanamycin and a final concentration of 10 mM L-arabinose, and cultured at 37°C and 220 rpm until OD500 was reached. 600 The concentration was 0.6-0.8. Electroporation competent cells were prepared. The alaC(KO) fragment and pISFbalreRNA-alaC plasmid were electroporated into TYS8975(ΔalaA) / pISFbal competent cells. Single colonies were verified by colony PCR using alaC-VF / alaA-R2(KO) primers. The positive fragment was approximately 1.3kb.

[0155] (4) Loss of pISFbalreRNA-alaC and pISFbal plasmid:

[0156] Positive clones were inoculated into LB medium containing rhamnose (10 mM) and kanamycin and incubated overnight at 37°C. They were then diluted and plated or streaked onto solid LB agar plates containing kanamycin and incubated overnight at 37°C. Clones were randomly selected and spotted onto LB agar plates containing kanamycin and spectinomycin, respectively, for selection. Clones sensitive to spectinomycin successfully eliminated the plasmid. Next, to eliminate the pISFbal plasmid, spectinomycin-sensitive strains were inoculated into liquid LB medium and incubated overnight at 37°C. The bacterial culture was streaked onto LB agar plates containing 10 g / L sucrose and incubated overnight at 37°C. Single colonies were then randomly selected and selected on LB agar plates containing and without kanamycin. Colonies sensitive to kanamycin successfully eliminated the plasmid. After complete plasmid elimination, strain TYS8975 (ΔalaA, ΔalaC) was obtained and named strain TYS8976.

[0157] 1.10. Insert PldhA-ilvC at the lacZ site. cg

[0158] (1) Construction of pEcgRNA-ilvCcg(lacZ) plasmid:

[0159] The two synthesized oligosaccharide nucleic acids lacZ-F / lacZ-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-lacZ plasmid.

[0160] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers lacZ-F1(ld) / lacZ-R1(ld), lacZ-F2(ld) / lacZ-R2(ld), lacZ-F3(ld) / lacZ-R3(ld), Pldh-F / Pldh-R, and ilvCcg-F(ld) / ilvCcg-R(ld) to obtain lacZ1(ld), lacZ2(ld), lacZ3(ld), PldhA, and ilvCcg(ld) fragments, approximately 730bp, 500bp, 470bp, 830bp, and 1kb, respectively. The lacZ1(ld), lacZ2(ld), lacZ3(ld), PldhA, and ilvCcg(ld) fragments were then cloned into the EcoRI / Hind array of pEcgRNA-lacZ using a DNA assembly method (DNA assembly kit purchased from TransGen). At site III, the pEcgRNA-ilvCcg(lacZ) plasmid was obtained.

[0161] (2) Electrostatic transfer:

[0162] The method is the same as 1.1(3) and (4) in Example 1. pEcCas was electroporated into TYS8976 to obtain TYS8976 / pEcCas / . The pEcgRNA-ilvCcg(lacZ) plasmid was electroporated into TYS8976 / pEcCas competent cells. Single colonies were verified by colony PCR using lacZ-VF / ilvCcg-V-R2 primers. The positive fragment was about 2.1kb.

[0163] (3) Loss of pEcgRNA-ilvCcg(lacZ) plasmid:

[0164] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg ) / pEcCas strain.

[0165] 1.11. Insert PldhA-leuDH at the lacI site

[0166] (1) Construction of pEcgRNA-leuDH(lacI) plasmid:

[0167] The two synthesized oligosaccharide nucleic acids lacI-F / lacI-R were annealed to form a double-stranded sequence. The method was the same as in Example 1, 1.1(1), to obtain the pEcgRNA-lacI plasmid.

[0168] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers lacI-F1(ld) / lacI-R1(ld), lacI-F2(ld) / lacI-R2(ld), lacI-F3(ld) / lacI-R3(ld), and leuDH-F(ld) / leuDH-R(ld) to obtain lacI1(ld), lacI2(ld), lacI3(ld), and leuDH(ld) fragments, approximately 670bp, 500bp, 400bp, and 1.1kb, respectively. The lacI1(ld), lacI2(ld), lacI3(ld), PldhA, and leuDH(ld) fragments were cloned into the EcoR I / Hind III site of pEcgRNA-lacI using DNA assembly (DNA assembly kit purchased from TransGen), to obtain the pEcgRNA-leuDH(lacI) plasmid.

[0169] (2) Electrostatic transfer:

[0170] The method is the same as 1.1(3) and (4) in Example 1. The pEcgRNA-leuDH(lacI) plasmid was electroporated into TYS8976(ΔlacZ::PldhA-ilvC) cgIn ) / pEcCas competent cells, single colonies were verified by colony PCR using leuDH-VF / lacI-VR primers, and the positive fragment was approximately 2.2kb.

[0171] (3) Loss of pEcgRNA-leuDH(lacI) plasmid:

[0172] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg ,ΔlacI::PldhA-leuDH) / pEcCas strain.

[0173] 1.12. Insert PldhA-ilvD at the ydjK site

[0174] (1) Construction of pEcgRNA-ilvD(ydjK) plasmid:

[0175] The synthesized two oligosaccharide nucleic acids, ydjK-F / ydjK-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-ydjK plasmid.

[0176] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers ydjK-F1(ld) / ydjK-R1(ld), ydjK-F2(ld) / ydjK-R2(ld), ydjK-F3(ld) / ydjK-R3(ld), and ilvD-F(ld) / ilvD-R(ld) to obtain fragments ydjK1(ld), ydjK2(ld), ydjK3(ld), and ilvD(ld), approximately 650 bp, 460 bp, 350 bp, and 1.9 kb, respectively. The ydjK1(ld), ydjK2(ld), ydjK3(ld), PldhA, and ilvD(ld) fragments were then cloned into the EcoRI / Hind array of pEcgRNA-ydjK using a DNA assembly method (DNA assembly kit purchased from TransGen). At site III, the pEcgRNA-ilvD(ydjK) plasmid was obtained.

[0177] (2) Electrostatic transfer:

[0178] The method is the same as in 1.1(3) and (4) of Example 1. The pEcgRNA-ilvD(ydjK) plasmid was electroporated into TYS8976(ΔlacZ::PldhA-ilvC) cgIn competent cells, single colonies were verified by colony PCR using primers ydjK-VF / ilvD-VR, and the positive fragment was approximately 1.8 kb.

[0179] (3) Loss of pEcgRNA-ilvD(ydjK) plasmid:

[0180] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg ,ΔlacI::PldhA-leuDH,ΔydjK::PldhA-ilvD) / pEcCas strain.

[0181] 1.13. Insert PldhA-nadK at the yaiT site

[0182] (1) Construction of pEcgRNA-nadK(yaiT) plasmid:

[0183] The synthesized two oligosaccharide nucleic acids, yaiT-F / yaiT-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as in 1.1(1) of Example 1, to obtain the pEcgRNA-yaiT plasmid.

[0184] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers yaiT-F1(ld) / yaiT-R1(ld), yaiT-F2(ld) / yaiT-R2(ld), yaiT-F3(ld) / yaiT-R3(ld), and nadK-F(ld) / nadK-R(ld) to obtain yaiT1(ld), yaiT2(ld), yaiT3(ld), and nadK(ld) fragments, approximately 650 bp, 460 bp, 350 bp, and 1.9 kb, respectively. The yaiT1(ld), yaiT2(ld), yaiT3(ld), PldhA, and nadK(ld) fragments were cloned into the EcoR I / Hind III site of pEcgRNA-yaiT using DNA assembly (DNA assembly kit purchased from TransGen), to obtain the pEcgRNA-nadK(yaiT) plasmid.

[0185] (2) Electrostatic transfer:

[0186] The method is the same as 1.1(3) and (4) in Example 1. The pEcgRNA-nadK(yaiT) plasmid was electroporated into TYS8976(ΔlacZ::PldhA-ilvC) cgIn competent cells, single colonies were verified by colony PCR using primers yaiT-VF / nadK-VR. The positive fragment was approximately 2.1 kb.

[0187] (3) Loss of pEcgRNA-nadK(yaiT) plasmid:

[0188] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg , ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD, ΔyaiT::PldhA-nadK) / pEcCas strain.

[0189] 1.14. Insert PldhA-ilvBN at the yihF site. mut

[0190] (1) pEcgRNA-ilvBN mut (yihF) plasmid construction:

[0191] The synthesized two oligosaccharide nucleic acids, yihF-F / yihF-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-yihF plasmid.

[0192] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers yihF-F1(ld) / yihF-R1(ld), yihF-F2(ld) / yihF-R2(ld), and yihF-F3(ld) / yihF-R3(ld) to obtain yihF1(ld), yihF2(ld), and yihF3(ld) fragments, approximately 730 bp, 510 bp, and 490 bp, respectively. Using the *Ptac-ilvBNm(adhE)* fragment as a template, PCR amplification was performed using primers ilvBN-F(ld) / ilvBN-R(ld) to obtain the ilvBNmut(ld) fragment, approximately 2.1 kb. The yihF1(ld), yihF2(ld), yihF3(ld), *PldhA*, and ilvBNmut(ld) fragments were then processed using DNA assembly methods. The kit was purchased from TransGen (Taiwan). The pEcgRNA-yihF site was cloned into the EcoR I / Hind III site to obtain pEcgRNA-ilvBN. mut (yihF) plasmid.

[0193] (2) Electrostatic transfer:

[0194] The method is the same as 1.1(3) and (4) in Example 1. pEcgRNA-ilvBN mut (yihF) plasmid was electrotransferred into TYS8976(ΔlacZ::PldhA-ilvC) cg In competent cells, single colonies were verified by colony PCR using primers yihF-VF / ilvBN-VR. The positive fragment was approximately 1.9 kb.

[0195] (3) pEcgRNA-ilvBN mut (yihF) plasmid loss:

[0196] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg ,ΔlacI::PldhA-leuDH,ΔydjK::PldhA-ilvD,ΔyaiT::PldhA-nadK,ΔyihF::PldhA-ilvBN mut ) / pEcCas strain.

[0197] 1.15. Insert Ptac-ilvC at the yjcS site

[0198] (1) Construction of pEcgRNA-yjcS plasmid:

[0199] The synthesized two oligosaccharide nucleic acids, yjcS-F / yjcS-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-yjcS plasmid.

[0200] (2) Preparation of electroporation fragments:

[0201] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers yjcS-F1 / yjcS-R1, yjcS-F2 / yjcS-R2, yjcS-F3 / yjcS-R3, and ilvC-F(yjcS) / ilvC-R(yjcS) to obtain fragments yjcS-1, yjcS-2, yjcS-3, and ilvC(yjcS), with values ​​of approximately 650 bp, 450 bp, 530 bp, and 1.6 kb, respectively. Using fragments yjcS-1, yjcS-2, yjcS-3, Ptac, and ilvC(yjcS) as templates, and primers yjcS-F1 / yjcS-R3, overlap PCR amplification was performed to obtain the Ptac-ilvC(yjcS) fragment, with a value of approximately 3.5 kb.

[0202] (3) Electrostatic transfer:

[0203] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-ilvC(yjcS) fragment and pEcgRNA-yjcS plasmid were electroporated into TYS8976(ΔlacZ::PldhA-ilvC) cg ,ΔlacI::PldhA-leuDH,ΔydjK::PldhA-ilvD,ΔyaiT::PldhA-nadK,ΔyihF::PldhA-ilvBN mut In ) / pEcCas competent cells, single colonies were verified by colony PCR using yjcS-VF / ilvC-VR primers, and the positive fragment was approximately 1.4kb.

[0204] (4) Loss of pEcgRNA-yjcS plasmid

[0205] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg ,ΔlacI::PldhA-leuDH,ΔydjK::PldhA-ilvD,ΔyaiT::PldhA-nadK,ΔyihF::PldhA-ilvBN mut ,ΔyjcS::Ptac-ilvC) / pEcCas strain.

[0206] 1.16. Insert Ptac-pntAB at the ybaP site

[0207] (1) Construction of pEcgRNA-ybaP plasmid:

[0208] The synthesized two oligosaccharide nucleic acids, ybaP-F / ybaP-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-ybaP plasmid.

[0209] (2) Preparation of electroporation fragments:

[0210] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers ybaP-F1 / ybaP-R1, ybaP-F2 / ybaP-R2, ybaP-F3 / ybaP-R3, and pntAB-F(ybaP) / pntAB-R(ybaP) to obtain ybaP-1, ybaP-2, ybaP-3, and pntAB(ybaP) fragments, approximately 670 bp, 520 bp, 560 bp, and 3.0 kb, respectively. Using ybaP-1, ybaP-2, ybaP-3, Ptac, and pntAB(ybaP) fragments as templates, and primers ybaP-F1 / ybaP-R3, overlap PCR amplification was performed to obtain the Ptac-pntAB(ybaP) fragment, approximately 5.0 kb.

[0211] (3) Electrostatic transfer:

[0212] The method is the same as 1.1(3) and (4) in Example 1. The Ptac-pntAB(ybaP) fragment and pEcgRNA-ybaP plasmid were electroporated into TYS8976(ΔlacZ::PldhA-ilvC) cg ,ΔlacI::PldhA-leuDH,ΔydjK::PldhA-ilvD,ΔyaiT::PldhA-nadK,ΔyihF::PldhA-ilvBN mut In competent cells, single colonies were verified by colony PCR using primers ybaP-VF / pntAB-VR. The positive fragment was approximately 1.5 kb.

[0213] (4) Loss of pEcgRNA-ybaP plasmid:

[0214] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg ,ΔlacI::PldhA-leuDH,ΔydjK::PldhA-ilvD,ΔyaiT::PldhA-nadK,ΔyihF::PldhA-ilvBN mut , ΔyjcS::Ptac-ilvC, ΔybaP::Ptac-pntAB) / pEcCas strain.

[0215] (5) pEcCas plasmid loss:

[0216] The method is the same as 1.1(5) in Example 1, to obtain TYS8976ΔlacZ::PldhA-ilvC cg,ΔlacI::PldhA-leuDH,ΔydjK::PldhA-ilvD,ΔyaiT::PldhA-nadK,ΔyihF::PldhA-ilvBN mut ,ΔyjcS::Ptac-ilvC,ΔybaP::Ptac-pntAB), named Synthesized 1.0.

[0217] Table 7. List of primers used in Example 1

[0218] The Synthesized 1.0 strain exhibited the following fermentation performance under anaerobic conditions: 5.48 g / L valine production after 48 hours; OD... 600 Approximately 0.73.

[0219] Example 2: Anaerobic domestication of Synthesized 1.0 to obtain TYS8789

[0220] Synthesized 1.0 was acclimated under anaerobic conditions. After 148 transfers, valine production exceeded 25 g / L in 24 hours, with a production intensity exceeding 1 g / L / h, a glucose consumption rate exceeding 2 g / L / h, and a conversion rate exceeding 50%. Then, TYS8789 was obtained as a single strain. Fermentation of TYS8789 in acclimation bottles increased valine production to 28 g / L in 24 hours.

[0221] We compared the genome sequences of TYS8789 and Synthesized 1.0 and found that the copy number of ilvC in TYS8789 increased from 2 copies to 6 copies, while the copy numbers of ilvE and ilvD increased from 3 and 2 copies to 4 and 3 copies, respectively. The LeuDH sequence integrated at avtA underwent the point mutation V22I and doubled, increasing the total copy number to 3.

[0222] Example 3: LeuDH V22I Biochemical and genetic characterization

[0223] 3.1TYS87891euDH V22I strain construction

[0224] To verify LeuDH V22I This chapter describes the purification of LeuDH and LeuDH. V22I LeuDH was discovered V22IThe specific activity of the V22I mutation was 30% higher than that of LeuDH, indicating that the V22I mutation is the target for enhancing specific activity (Figure 3). Therefore, to verify the results, the wild-type LeuDH at the lacI site in TYS8789 was mutated to LeuDH. V22I To determine whether this would further increase L-valine production, in situ mutagenesis was performed, resulting in the construction of TYS87891euDH. V22I The specific construction process is as follows:

[0225] Using lacIUP2-F / lacIUpApr-R, Apr-F / Apr-R, and lacIDNApr-F / lacIDN-R as primers and the *E. coli* TYS8789 genome as a template, lacI-Apr LHR, Apr, and lacI-Apr RHR were amplified. Using lacIUP2-F / lacIDN-R as primers and lacI-Apr LHR, Apr, and lacI-Apr RHR as templates, the lacI-Apr homologous repair fragment was constructed via overlap extension PCR and transformed into TYS8789 / pEcCas2.0 electroporated competent cells. The recovery solution was plated on LB agar plates containing apramycin (50 μg / ml) and incubated overnight at 37°C. The knockout of Pldh-leuDH at the lacI site was verified using lacIUP2-F / lacIDN-R, yielding the TYS8789-Apr strain. pEcCas2.0 was transformed into TYS8789-Apr. Transformants were picked and inoculated into 5 mL LB tubes containing chloramphenicol. The culture was incubated overnight at 37°C and 220 rpm. The overnight culture was then transferred at a 1% inoculum volume to fresh LB tubes containing chloramphenicol and a final concentration of 10 mM L-arabinose. The culture was incubated at 37°C and 220 rpm until OD500 was reached. 600Electrocompetent cells were prepared with a pH of 0.6-0.8. Using the *E. coli* TYS8789 genome as a template, and primers lacIUP2-F / lacIUP2-R, pldhOlacI-F / leuDH-R, and lacIDNOleuDH-F / lacIDN-R, the lacI HR2, Pldh-leuDH*, and lacI HR2 fragments were amplified. Using primers lacIUP2-F / lacIDN-R and the lacI HR2, Pldh-leuDH*, and lacI HR2 fragments as templates, the Pldh-leuDH*(KI) fragment was obtained by overlap extension PCR. 300 ng pTargetF-Apr and 600 ng Pldh-leuDH*(KI) were transformed into the above electrocompetent cells. The recovery solution was plated on LB agar plates containing chloramphenicol and spectinomycin and incubated overnight at 37°C. Sequencing with lacIUP2-F / lacIDN-R primers was used to verify whether Apr had been replaced with Pldh-leuDH*, yielding TYS8789 LeuDH. V22I .

[0226] TYS87891euDH V22I The specific activity of crude enzyme solution leucine dehydrogenase and the yield of L-valine were not significantly different from those of TYS8789, therefore, 2 copies of LeuDH... V22I That's enough; any extra mutants would be excessive.

[0227] 3.2TYS87891euDH I22V strain construction

[0228] Next, to confirm the necessity of the mutant, two copies of LeuDH with the TYS8789 mutation were reversed. V22I TYS8789leuDH was constructed I22V The specific construction process is as follows:

[0229] Using avtA-UPnew-F / avtA-UPnew-R and PtacOavtAnew2-F / leuDH105-R as primers, leuDH was amplified using a synthesized 1.0 genome as a template. I22V -RHR and leuDH I22V -LHR. Using avtA-UPnew-F / leuDH105-R as primers, leuDH I22V -RHR and leuDH I22V Using LHR as a template, Overlap Extension PCR was used to construct the mutant Ptac-leuDH. V22IThe homologous repair fragment of pTargetF-avtAnew was transduced together with pTargetF-avtAnew into the aforementioned TYS8789 / pEcCas-2.0 electrocompetent cells. After 1 hour of recovery, the cells were plated on LB agar plates containing chloramphenicol and spectinomycin and incubated overnight at 37°C. PCR sequencing using avtA-UPnew-F and leuDH105-R primers verified the Ptac-leuDH... V22I Does it mutate to Ptac-leuDH? I22V The mutant strain is named TYS8789LeuDH I22V .

[0230] TYS87891euDH I22V The strain yield decreased to below 10 g / L / 24h, and the specific activity also decreased, indicating that V22I conferred higher apparent activity to LeuDH (Figure 3).

[0231] 3.3 Construction of TYS8789ΔleuDH strain

[0232] To confirm the necessity of leucine dehydrogenase, three copies of LeuDH (one wild-type and two mutant copies) of TYS8789 were knocked out, and TYS8789ΔleuDH was constructed. The specific construction process is as follows:

[0233] pEcCas-2.0 was transformed into TYS8789, and the transformants were obtained by screening on LB agar plates containing chloramphenicol. Transformants were picked and inoculated into 5 mL LB tubes containing chloramphenicol, and cultured overnight at 37°C and 220 rpm. The overnight culture was then transferred at a 1% inoculum to fresh LB tubes containing chloramphenicol and 10 mM L-arabinose, and incubated at 37°C and 220 rpm until OD500 was reached. 600 Electrocompetent cells were prepared with a pH of 0.6-0.8. Using the *E. coli* TYS8789 genome as a template, and avtALHR-F / avtALHR-R and avtARHR-F / avtARHR-R primers, the avtALHR and avtARHR fragments were amplified. Using avtALHR-F / avtARHR-R primers and the avtALHR and avtARHR fragments as templates, the Ptac-leuDH(KO) fragment was obtained via Overlap Extension PCR. 300 ng of pTargetT-deltaleuDH and 600 ng of the Ptac-leuDH(KO) fragment were transfected into the above electrocompetent cells. After 1 h of recovery, the mixture was plated on LB agar plates containing chloramphenicol and spectinomycin and incubated overnight at 37°C. The Ptac-leuDH fragment was verified using avtA-VF / avtA-VR. V22ITo determine whether the knockout was successful, use lacIUP-testF / lacZ-seqR to verify whether Pldh-leuDH was knocked out. Bacteria that were knocked out in both cases were named TYS8789ΔleuDH.

[0234] The crude enzyme activity of TYS8789ΔleuDH decreased by more than 90% compared to TYS8789, and the yield was almost zero (Figure 3). Therefore, LeuDH V22I It increased the specific activity of leucine dehydrogenase, further increasing valine production.

[0235] Example 5: Reconstruction of key mutations in TYS8789 on Synthesized 1.0

[0236] This disclosure integrates the ilvXGMED expression cassette between CJZ69_19855 and 19860, and integrates ilvC and leuDH in two rounds using CRISPR-related transposases in Synthesized 1.0. V22I First, the integration of ilvC was targeted at the frd, adhE, mgsA, and ackA sites that needed to be interrupted, and strains that integrated 3 copies of ilvC at frd, adhE, and mgsA were screened. Based on this, pflB and Pldh were targeted to integrate leuDH. V22I The integrated 8-copy LeuDH was selected. V22I Synthesized 2.0 (Table 3). The specific construction process is as follows:

[0237] pEcCas (Addgene: 73227) was transformed into Synthesized 1.0 medium and screened on LB agar plates containing kanamycin to obtain Synthesized 1.0 / pEcCas transformants. Transformants were picked and inoculated into 5 mL LB tubes containing kanamycin and incubated overnight at 37°C and 220 rpm. The overnight culture was then transferred at a 1% inoculum to fresh LB liquid medium containing kanamycin (and a final concentration of 10 mM L-arabinose) and incubated at 37°C and 220 rpm until OD500. 600Electrocompetent cells were prepared with a pH of 0.6-0.8. Using the *E. coli* Synthesized 1.0 genome as a template, and with primers of site1LHR-F / site1LHR-R2, site1RHR-F / site1RHR-R2, and ilvXGMEDOvLHR-F / ilvXGMEDOvRHR-R, the site1LHR, site1RHR, and ilvXGMED fragments were amplified. Using site1LHR-F / site1RHR-F as primers, and the site1LHR, site1RHR, and ilvXGMED fragments as templates, the ilvXGMED(KI) fragment was obtained via Overlap Extension PCR. 300 ng of pTargetF-array1 and 600 ng of the ilvXGMED(KI) fragment were transfected into the above electrocompetent cells. The recovery solution was plated on LB agar plates containing spectinomycin and kanamycin and incubated overnight at 37°C. The site1LHR-F / site1RHR-F method was used to verify whether ilvXGMED was successfully integrated into the genome. The strain that was successfully integrated was named Synthesized 1.0::ilvXGMED.

[0238] Nanjing GenScript replaced the N15 sequence gagacctctggtctc of pQCasTns(Ptr)-entry(BsaI) (Addgene: 190274) with tgcaacaggtgaacgagtcctttggctttgaggtgaactgccgagtaggcagctgaagttgtgacttcattcagaaaaactacactccgtac to synthesize pQCasTns(Ptr)-ldhA-pflB, with two 32bp uppercase letter sequences. The columns represent the N32 sequences targeting ldhA and pflB, respectively; replacing them with gcaacggtaaatgcgttgacacctctatgggcgtgaactgccgagtaggcagctggaaatgttgccgaatccggcatgggtatcgtcgaagagtgaactgccgagtaggcagctggaaatatggagccgtcgcccggatggtagcgtcaacggtgaactgccgagtaggcagctggaaat tgtgcgcaggctttttcggtctttatcttgca, the resulting pQCasTns(Ptr)-frd-adhE-mgsA-ackA, where the four 32bp uppercase letter sequences represent the N32 sequences targeting ackA, adhE, frd, and mgsA, respectively. Transform pQCasTns(Ptr)-frd-adhE-mgsA-ackA and pPtrDonor-ilvC into Synthesized 1.0::ilvXGMED strain, and after resuscitating the cells in fresh LB medium at 37°C for 1 h, plate the cells onto LB agar plates containing 100 μg / mL kanamycin and 25 μg / mL chloramphenicol. After overnight growth at 37°C for 16 h, scrape several hundred colonies from the plates, resuspend a portion in fresh LB medium, and then replate them onto double-antibiotic LB agar plates supplemented with 100 μg / mL anhydrotetracycline (aTC) to induce protein expression. Culture the cells again at 37°C for 16 h, which usually results in biofilm formation, then scrape them off and resuspend them in LB medium. Re-dilute the cells appropriately, plate them onto double-antibiotic LB agar plates containing 1000 μg / mL aTC, and grow overnight at 37°C. Colony PCR analysis was then performed, and the primers used are shown in Table 5, “Verification of ilvC insertion”.

[0239] The obtained strain was deplasmidized using pFree_Zeo (Addgene ID#92053) (refer to Lauritsen, Ida, et al. "A versatile one-step CRISPR-Cas9 based approach to plasmid-curing." Microbial Cell Factories 16.1 (2017): 135.) and then transformed into pQCasTns(Ptr)-ldhA-pflB and pPtrDonor-leuDH. V22I Cells were revived in fresh LB medium at 37°C for 1 hour, then plated onto LB agar plates containing kanamycin and chloramphenicol. After overnight growth at 37°C for 16 hours, several hundred colonies were scraped from the plates, a portion of which was resuspended in fresh LB medium and then re-coated onto LB agar plates containing 100 μg / mL anhydrotetracycline (aTC) to induce protein expression. Cells were cultured at 37°C for another 16 hours, typically forming a biofilm, which was then scraped off and resuspended in LB medium. The cells were then appropriately diluted and plated onto LB agar plates containing 1000 μg / mL LaTC and grown overnight at 37°C. Colony PCR identification analysis was then performed; the primers used are shown in Table 5, “Verification of leuDH”. V22I The inserted strain was then subjected to pFree_Zeo to remove all plasmids, resulting in Synthesized 2.0.

[0240] Anaerobic fermentation was performed on three monoclonal strains of Synthesized 2.0 at production intensities of 0.24, 0.35, and 0.27 g / L / h, respectively.

[0241] By incorporating via reference

[0242] The full contents of every patent and scientific document mentioned in this article are incorporated herein by reference for all purposes.

[0243] Equivalence

[0244] This disclosure may be embodied in other specific ways without departing from its spirit or essential characteristics. Therefore, the above embodiments should be considered illustrative in all cases and not as limiting of the invention described herein. Consequently, the scope of this disclosure is defined by the appended claims rather than by the foregoing description and is intended to be encompassed therein by all variations within the equivalent meaning and scope of the claims.

Claims

1. Modified bacteria that produce L-valine, which, compared to unmodified bacteria, contain LeuDH. V22I .

2. The modified bacteria as described in claim 1, comprising one or more LeuDH cells. V22I Gene copies, preferably two to eleven, more preferably eight.

3. The modified bacteria as described in claim 1 or 2, wherein the bacteria further comprises one or more modifications that enhance the activity of ilvC, ilvD, and / or ilvE.

4. The modified bacteria as described in claim 3, comprising one or more copies of the ilvC gene, preferably two to ten copies, more preferably five copies; comprising one or more copies of the ilvD gene, preferably two to ten copies, more preferably four copies; and / or comprising one or more copies of the ilvE gene, preferably two to ten copies, more preferably three copies.

5. The modified bacteria according to any one of claims 1 to 4, further comprising an amino acid sequence mutation of acetylhydroxy acid synthase IlvBN, preferably, said mutation being selected from IlvBN. G20D IlvBN V21D and IlvBN M22F .

6. The modified bacteria according to any one of claims 1 to 5, wherein the bacteria further comprises modifications to reduce byproducts, preferably, the modifications to reduce byproduct production are selected from all knockouts, truncations and simultaneous repair of frameshift mutations to wild type, or other truncations that reduce activity by more than 10% of avtA, ldhA, mgsA, frd, pflB, adhE, ackA, alaA and / or alaC.

7. The modified bacteria according to any one of claims 1 to 6, wherein the bacteria comprises a modification that enhances the activity of the transhydrogenase pntAB gene.

8. The modified bacteria according to any one of claims 1 to 7, wherein the bacteria comprises a modification that enhances the activity of the nadK gene.

9. Use of the modified bacteria as described in any one of claims 1 to 8 in increasing L-valine production.

10. A method for producing L-valine, comprising culturing the modified bacteria as described in any one of claims 1-8 in a culture medium.

Images