Spray dried formulation and related process for nitrogen fixing bacteria

WO2026128298A3PCT designated stage Publication Date: 2026-07-23PIVOT BIO INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
PIVOT BIO INC
Filing Date
2025-12-04
Publication Date
2026-07-23

AI Technical Summary

Technical Problem

Existing agricultural formulations of nitrogen fixing bacteria are cumbersome to apply and have short shelf lives, necessitating improved formulations with enhanced cell viability and stability.

Method used

A spray dried composition comprising nitrogen fixing bacteria, a bulking agent, a desiccation protectant, and a coating agent, along with a method of forming this composition by drying a liquid mixture in a chamber, which maintains microbial viability and stability.

Benefits of technology

The spray dried composition achieves improved shelf stability and microbial viability, facilitating consistent and safe application to plants, enhancing agricultural yield and reducing fertilizer use.

✦ Generated by Eureka AI based on patent content.
Patent Text Reader

Abstract

The present disclosure relates to a spray dried composition comprising nitrogen fixing bacteria, a bulking agent, a desiccation protectant, an antioxidant, and a coating agent. The present disclosure further relates to a coating composition and coated plant comprising the coating composition. The present disclosure also provides a method of forming a spray dried composition comprising contacting a liquid composition with a heated gas, wherein the liquid composition comprises water, a nitrogen fixing bacteria, a bulking agent, a desiccation protectant, an antioxidant, and a coating agent. The liquid composition is introduced into a chamber through a nozzle and dried in the chamber to provide a spray dried composition. The spray dried composition disclosed herein can maintain the viability of the nitrogen fixing bacteria for improved shelf stability.
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket No. PIV-00054 WOSPRAY DRIED FORMULATION AND RELATED PROCESS FOR NITROGEN FIXING BACTERIA CROSS REFERENCE TO A RELATED APPLICATION

[0001] This application claims priority to U. S. Provisional Patent Application No. 63 / 729,700, filed December 9, 2024, the entire contents of which are herein incorporated by reference.INCORPORATION OF THE SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (PIV-00054 WO SeqList ST26.xml; Size: 613,320 bytes; and Date of Creation: December 2, 2025) are herein incorporated by reference in their entirety.FIELD

[0003] The present disclosure relates to a spray dried composition comprising microbes (e.g, nitrogen fixing bacteria), a coating composition, a coated plant, and a method of preparing the spray dried composition. The spray dried composition disclosed herein can maintain the viability of the nitrogen fixing bacteria for improved shelf stability.BACKGROUND

[0004] Application of plant beneficial microbes, such as nitrogen fixing bacteria, to crops can increase agricultural yield, while potentially decreasing the use of fertilizers. These beneficial microbes must be cultured and transplanted to the soil near the root structure of the plant. Formulations that contain nitrogen fixing bacteria are typically in the form of dry powders, which are often cumbersome to apply in a safe and consistent manner. Liquid formulations of plant beneficial microbes have short shelf lives and therefore, are not preferred.

[0005] Thus, there continues to be a need for agricultural formulations containing microbes with improved cell viability and shelf life.SUMMARY

[0006] The disclosure provides a spray dried composition comprising microbes (e.g., nitrogen fixing bacteria), a bulking agent, a desiccation protectant, an antioxidant, and a coating agent. In some embodiments, the microbe is a nitrogen fixing bacteria that is gram-negative. In some embodiments, the nitrogen fixing bacteria comprise at least one bacterium from the group consisting of Kosakonia, Klebsiella, Citrobacter, Flavobacterium, Achromobacter,Attorney Docket No. PIV-00054 WOArthrobacter, Azospirillum, Azotobacter, Paraburkholderia, Herbaspirillum, Phytobacter, Pseudomonas, Rahnella, Gluconacetobacter, Azoarcus, Trinickia, Rhizoblum, Rhodobacter, Rubrivivax, Paenibacillus, Pseudacidovorax, Ensifer, Burkholderia, Sphingomonas, and Hydrogenophaga. In some embodiments, the nitrogen fixing bacteria comprise at least one introduced genetic variation.

[0007] The disclosure further provides a coating composition comprising water and the spray dried composition. The disclosure also provides a coated plant comprising a plant portion coated with either the spray dried composition or the coating composition.

[0008] The disclosure provides a method of forming a spray dried composition comprising contacting a liquid composition with a heated gas, wherein the liquid composition comprises water, microbes (e.g., nitrogen fixing bacteria), a bulking agent, a desiccation protectant, an antioxidant, and a coating agent; introducing the liquid composition into a chamber through a nozzle; and drying the liquid composition in the chamber to provide a spray dried composition.BRIEF DESCRIPTION OF THE FIGURES

[0009] FIG. 1 is a graph demonstrating the effects of ascorbic acid and L-ascorbic acid-phosphate on Klebsiella variicola (Kv) cell viability.

[0010] FIG. 2 is a graph showing the viable cell count (CFU / g) over time (days) of spray dried powders prepared from Formulations 1 and 8-11 that were stored in a cold room.

[0011] -FIG. 3 is a graph of the in-package stability, as measured by the viable cell count (CFU / g) over time (days), of a spray dried powder prepared from Formulation 12 stored at different temperatures: 4 °C. 21 °C, and 30 °C.

[0012] FIG. 4 is a graph of the post-spray dry g log loss of Formulas 1 and 2 with varying total solids content: 13%, 21%, and 26%.

[0013] FIG. 5 is a graph of the water activity of the spray dried powders of Formulas 1 and 2 with varying total solids content: 13%, 21%, and 26%.

[0014] FIG. 6 is a graph of the percent moisture content (MC) of the spray dried pow ders of Formulas 1 and 2 with varying total solids content: 1 %, 21%, and 26%.Attorney Docket No. PIV-00054 WO

[0015] FIG. 7 is a graph of the log loss at different inlet temperatures: 130 °C, 150 °C, and 170 °C.

[0016] FIG. 8 is a graph demonstrating the viability of Kv cells (CFU / g) formulated with Formulation 12 and spray dried at different inlet and outlet temperatures.

[0017] FIG. 9 is a graph demonstrating the percent moisture content (MC) of a spray dried powder made from Formulation 12 at different inlet and outlet temperatures.

[0018] FIG. 10 is a graph demonstrating the water activity of a spray dried powder made from Formulation 12 at different inlet and outlet temperatures.

[0019] FIGs. 11A-11C are graphs of the m-package stability, as measured by the viable cell count (CFU / g) over time (days), at 4 °C, 21 °C. and 30 °C of spray dried powder made from Formulation 12 at different inlet temperatures. The spray dried powder of FIG. 11A was produced at an inlet temperature of 130 °C. The spray dried pow der of FIG. 11B was produced at an inlet temperature of 150 °C. The spray dried powder of FIG. 11C was produced at an inlet temperature of 170 °C.

[0020] FIGs. 12A and 12B are graphs of the m-package stability’, as measured by the viable cell count (CFU / g) over time (days), at 4 °C, 21 °C, and 30 °C of spray dried pow ders made from Formulation 12 and either a cell concentrate of Kv (FIG. 12A) or w hole broth of Kv (FIG.12B).

[0021] FIG 13 is a graph of the on-seed stability, as measured by CFU / seed over time (days), of spray dried powders made from whole broth (dotted line) and cell concentrate (solid line).

[0022] FIG. 14 is a graph of the m-package stability, as measured by the viable cell count (CFU / g) over time (days), at -20 °C for freeze dried particles comprising either freshly made (solid line) or aged bacteria (dotted line) comprising the 137-1036 strain, and spray dried particles comprising freshly made bacteria comprising the 137-1036 strain (dashed line).

[0023] FIG. 15 is a graph of the m-package stability, as measured by the viable cell count (CFU / g) over time (days), at 4 °C for freeze dried particles comprising either freshly made (solid line) or aged bacteria (dotted line) comprising the 137-1036 strain, and spray dried particles comprising freshly made bacteria comprising the 137-1036 strain (dashed line).

[0024] FIG. 16 is a graph of the in-package stability, as measured by the viable cell count (CFU / g) over time (days), at 21 °C for freeze dried particles comprising either freshly madeAttorney Docket No. PIV-00054 WO(solid line) or aged bacteria (dotted line) comprising the 137-1036 strain, and spray dried particles comprising freshly made bacteria comprising the 137-1036 strain (dashed line).

[0025] FIG. 17 is a graph of the in-package stability, as measured by the viable cell count (CFU / g) over time (days), at 30 °C for freeze dried particles comprising either freshly made (solid line) or aged bacteria (dotted line) comprising the 137-1036 strain, and spray dried particles comprising freshly made bacteria comprising the 137-1036 strain (dashed line).[00261 FIG. 18 is a graph showing the application log loss on-seed stability (CFU / g) over time (days) of spray dried powders prepared from Formulation 12 and either the 137-1036 strain (dashed lined) or 137-2253 strain (solid line) and applied to wheat and com.

[0027] FIG. 19 is a graph showing the on-seed stability (CFU / seed) over time (days) of Return OS (solid line) compared to a spray dried powder (dotted line) prepared from Formulation 12 and the 137-1036 stain, as applied to wheat. The horizontal line at 1E3 CFU / seed represents a preferred minimum viability.

[0028] FIG. 20 is a graph of the on-seed stability at 4 °C and 21 °C. as measured by CFU / seed over time (days), of freeze dried and spray dried powders comprising the 137-1036 stain. The horizontal line at 1E3 CFU / seed represents a preferred minimum viability.

[0029] FIG. 21 is a graph of the one month decay rate estimate using linear regression for freeze dried and spray dried powders comprising the 137-1036 stain. The horizontal line at 1E3 CFU / seed represents a preferred minimum viability’.

[0030] FIG. 22 is a graph of the on-seed stability at 21 °C, as measured by CFU / seed over time (days), of liquid (dotted line), freeze dried (dashed-dotted line), and spray dried (solid line) applications comprising the 137-1036 stain. The horizontal line at 1E3 CFU / seed represents a preferred minimum viability.

[0031] FIGs. 23 A and 23B are graphs of the particle size distribution of freeze dried powder (FIG. 23 A) and spray dried powder (FIG. 23B) comprising the 137-1036 strain,DET AILED DESCRIPTION

[0032] The present disclosure provides a spray dried composition comprising microbes (e.g., nitrogen fixing bacteria), a coating composition formed from the spray dried composition, a coated plant, and a method of producing the spray dried composition.Attorney Docket No. PIV-00054 WODefinitions

[0033] The use of the terms “a” and "‘an’’ and “the” and similar referents in the context of describing the disclosure (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context. The terms “comprising,” “having,” “including.” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted. Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if the range 10-15 is disclosed, then 11, 12, 13, and 14 are also disclosed. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (e.g.. “such as”) provided herein, is intended merely to better illuminate the disclosure and does not pose a limitation on the scope of the disclosure unless otherwise claimed No language in the specification should be construed as indicating any non-claimed element as essential to the practice of the disclosure.

[0034] Throughout this application, the term “about” is used to indicate that a value includes the inherent variation of error for the device or the method being employed to determine the value, or the variation that exists among the samples being measured Unless otherwise stated or otherwise evident from the context, the term “about” means within 10% above or below the reported numerical value (except where such number would exceed 100% of a possible value or go below 0%). When used in conjunction with a range or series of values, the term “about” applies to the endpoints of the range or each of the values enumerated in the series, unless otherwise indicated. As used in this application, the terms “about” and “approximately” are used as equivalents.

[0035] As used herein, the term “agronomically stable” refers to a composition (e.g., the spray dried composition, corresponding coating composition, or corresponding coated plant) that maintains the viability of the microorganisms over time. In some embodiments, the compositions disclosed herein can exhibit a decline in the bacterial concentration over time, but at a reduced rate compared to a comparable freeze dried formulation and / or compared to a comparable spray dried composition in the absence of one or more of the bulking agent.Attorney Docket No. PIV-00054 WOdesiccation protectant, antioxidant, and coating agent. Loss of live bacterial concentration can be measured in log loss (e.g., log reduction) of CFU per unit over time.

[0036] As used herein the term "‘amino acid” includes natural (e.g., alpha-amino acids) and unnatural or synthetic amino acids, including both the D or L optical isomers, amino acid analogs, and peptidomimetics. Amino acids can be positively charged or negatively charged. Amino acids can be not positively charged or not negatively charged. Amino acids can contain or lack sulfur. Non-limiting examples of unnatural amino acids include beta-amino acids, homo-amino acids, proline derivatives, pyruvic acid derivatives, 3-substituted alanine derivatives, glycine derivatives, ring substituted phenylalanine, tyrosine derivatives, linear core amino acids, and N-methyl amino acids. An amino acid analog can be an amino acid resulting from a reaction at an amino group, carboxy group, side-chain functional group, or from the replacement of any hydrogen by a heteroatom.

[0037] As used herein, the terms “applying,” “coating,” and “treating” agricultural plant tissues or the environs thereof with a composition comprising live microbes includes any means by which the plant tissues or the environs thereof are made to come into contact with (i.e., are exposed to) a composition (e.g., a dispersion) comprising live microbes. In some embodiments, “applying” refers to placing or distributing the composition of live microbes onto an area, volume, or quantity of agricultural plant tissues or the environs thereof. Consequently, “applying” includes any of the following means of exposure to a dispersion of live microbes: spraying, dripping, submerging, hand broadcast, machine spreading, brushing, machine broadcasting, irrigating, top dressing vehicle, and the like, onto agricultural plant tissues or the environs thereof, applying as a seed coat, applying to a field that will then be planted with seed, applying to a field already planted with seed, etc.

[0038] As used herein, “application log loss” refers to a measurement of microbial adherence to seed or plant propagating material and is calculated by using the following equation:LOG((Day 0 treatment titers in CFU / ml) x (ml / seed application rate)) - LOG(Day 0 CFU / seed). Conceptionally this can be thought of as LOG(of theoretical microbial load per seed as determined by treatment titer and rate of application)- LOG(of actual microbial titer, empirically measured). Lower log loss values indicate higher microbial adherence.

[0039] As used herein, the term “diazotroph” is a microbe that fixes atmospheric nitrogen gas into a more usable form, such as ammonia. A diazotroph is a microorganism that can grow without external sources of fixed nitrogen. All diazotrophs contain at least one of three typesAttorney Docket No. PIV-00054 WOof nitrogenase: molybdenum nitrogenase (e.g., iron-molybdenum nitrogenase), iron nitrogenase, or vanadium nitrogenase (e g., iron- vanadium nitrogenase).

[0040] In some embodiments, the increase of nitrogen fixation and / or the production of 1% or more of the nitrogen in the plant are measured relative to control plants, which have not been exposed to the bacteria of the present disclosure. AH increases or decreases in bacteria are measured relative to control bacteria. All increases or decreases in plants are measured relative to control plants

[0041] The term ‘‘biologically pure culture” or ‘‘substantially pure culture” refers to a culture of a bacterial species described herein containing no other bacterial species in quantities sufficient to interfere with the replication of the culture or be detected by normal bacteriological techniques.

[0042] As used herein, “carrier.” “acceptable carrier,” or “agriculturally acceptable carrier” refers to a diluent, adjuvant, excipient, or vehicle with which the microbe can be administered, which does not detrimentally affect the microbe or the plant.

[0043] As used herein, a “buffer,” also known as a “pH buffer” or “hydrogen ion buffer,” consists of a mixture of a weak acid and its conjugate base, or a weak base and its conjugate acid. As used herein, the term “buffer” can refer to either a chemical compound used to buffer a formulation or to a buffering system comprising a combination of acids, bases, and / or salts.

[0044] As used herein, the term “colony forming unit’ ’ or “CFU” is a unit used to estimate the number of viable microbial cells in a sample. Viable is defined as the ability to multiply under the controlled conditions. Counting colony-forming units requires culturing the microbes and counting only viable cells, in contrast with microscopic examination which counts all cells, living or dead. The visual appearance of a colony in a cell culture requires significant growth and may result from the growth of individual or multiple viable cells.

[0045] As used herein, the term “complementarity ” refers to the ability of a nucleic acid to form hydrogen bond(s) with another nucleic acid sequence by base pairing such as Watson-Crick base-pairing. A percent complementarity indicates the percentage of residues in a nucleic acid molecule that can form hydrogen bonds (e.g, Watson-Crick base pairing) with a second nucleic acid sequence (e.g., 5, 6, 7, 8, 9, 10 out of 10 being 50%, 60%, 70%, 80%, 90%, and 100% complementary, respectively). As used herein, the term “perfectly complementary” means that all the contiguous residues of a nucleic acid sequence will hydrogen bond with the same number of contiguous residues in a second nucleic acid sequence. As used herein, theAttorney Docket No. PIV-00054 WOterm ’‘substantially complementary” as used herein refers to a degree of complementarity that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% over a region of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 40, 45, 50, or more nucleotides, or refers to two nucleic acids that hybridize under stringent conditions.

[0046] As used herein, the term “control sequence” refers to an operator, promoter, silencer, or terminator.

[0047] In some embodiments, native or endogenous control sequences of genes of the present disclosure are replaced with one or more intragenenic control sequences.

[0048] As used herein, the term “constitutive promoter” is a promoter that is active under most conditions and / or during most developmental stages. There can be several advantages to using constitutive promoters in expression vectors used in biotechnology’. Such advantages can include a high level of production of proteins used to select transgenic cells or organisms; a high level of expression of reporter proteins or scorable markers that can allow easy detection and quantification; a high level of production of a transcription factor that is part of a regulatory transcription system; production of compounds that requires ubiquitous activity in the organism; and production of compounds that are required during all stages of development. Non-limiting exemplary constitutive promoters include, CaMV 35S promoter, opine promoters, ubiquitin promoter, alcohol dehydrogenase promoter, etc.[00491 As used herein, the term “CWT” or “centum weight” is used in the context that is known in the art, as hundredweight for seed. Thus, an amount of treatment per CWT would refer to the amount used to treat 100 pounds of seed.

[0050] As used herein, the term “dispersion of live microbes” or “microbial dispersion” refers to the composition obtained by contacting a spray dried composition disclosed herein with a liquid. In some embodiments, the liquid is water or an aqueous solution. In some embodiments, the dispersion of live microbes comprises liquid, microbes that were contained in a spray dried composition and one or more of the components of the spray dried composition.

[0051] As used herein, the term “the environs” of agricultural plant tissues includes the elements of the vicinity around the agricultural plant tissues that contact the agricultural plant tissues. For example, application to the environs of agricultural plant tissues would include soil application and in-furrow application means.Attorney Docket No. PIV-00054 WO

[0052] As used herein, the term “exogenous nitrogen” refers to non-atmospheric nitrogen readily available in the soil, field, or growth medium that is present under non-nitrogen limiting conditions, including ammonia, ammonium, nitrate, nitrite, urea, uric acid, an ammonium acid, and other nitrogen species that include an ammonium ion. etc. Fertilizers and exogenous nitrogen of the present disclosure can comprise the following nitrogen-containing molecules: ammonium, nitrate, nitrite, ammonia, glutamine, etc. Nitrogen sources of the present disclosure can include anhydrous ammonia, ammonia sulfate, urea, diammonium phosphate, urea-form, monoammonium phosphate, ammonium nitrate, nitrogen solutions, calcium nitrate, potassium nitrate, sodium nitrate, etc.

[0053] As used herein, the term “expression” refers to the process by which a polynucleotide is transcribed from a DNA template (such as into an mRNA or other RNA transcript) and / or the process by which a transcribed mRNA is subsequently translated into a peptide, polypeptide, or protein. Transcripts and encoded polypeptides can be collectively referred to as “gene product,” as that term is used herein. If the polynucleotide is derived from genomic DNA, expression can include splicing of the mRNA in a eukaryotic cell.

[0054] As used herein, the term “genetic modification” or “genetic variation”' refers to any change introduced into a polynucleotide sequence relative to a reference polynucleotide, such as a reference genome or portion thereof, or reference gene or portion thereof. A genetic modification or genetic variation can be referred to as a “mutation,” and a sequence or organism comprising a genetic modification or genetic variation can be referred to as a “genetic variant,” “mutant,” or “engineered.” Genetic modifications introduced into microbes can be classified as transgenic, cisgenic, intragenomic, intrageneric, intergeneric, synthetic, evolved, rearranged, or single nucleotide polymorphisms (SNPs).

[0055] As used herein, the term “hybridization” refers to the annealing of one or more polynucleotides to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues. The hydrogen bonding can occur by Watson Crick base pairing, Hoogsteen binding, or in any other sequence specific manner according to base complementarity. The complex can comprise two strands forming a duplex structure, three or more strands forming a multi stranded complex, a single self-hybridizing strand, or any combination thereof. Hybridization can be a step in a more extensive process, such as the initiation of PCR. or the enzymatic cleavage of a polynucleotide by an endonuclease. A second sequence that is complementary to a first sequence is referred to as the “complement” of theAttorney Docket No. PIV-00054 WOfirst sequence. As used herein, the term “hybridizable” as applied to a polynucleotide refers to the ability of the polynucleotide to form a complex that is stabilized via hydrogen bonding between the bases of the nucleotide residues.

[0056] As used herein, the term “in planta refers to in the plant, on the plant, or intimately associated with the plant, depending upon the context of usage (e.g., endophytic, epiphytic, or rhizospheric associations). As used herein, the terra “plant” includes plant parts, tissue, leaves, roots, root hairs, rhizomes, stems, seeds, ovules, pollen, flowers, fruit, etc. Thus, when the disclosure discusses providing a plurality of com plants to a particular locus, it is understood that this can entail planting a corn seed at a particular locus,

[0057] As used herein, the term “individual isolates” should be taken to mean a composition, or culture, comprising a predominance of a single genera, species, or strain, of microorganism, following separation from one or more other microorganisms.

[0058] As used herein, the term “intergeneric microorganism” is a microorganism formed by the deliberate combination of genetic material originally isolated from organisms of different taxonomic genera. The term “intergeneric mutant” can be used interchangeably with “intergeneric microorganism.” An exemplary “intergeneric microorganism” includes a microorganism containing a mobile genetic element that was first identified in a microorganism in a genus different from the recipient microorganism. Further explanation can be found, inter alia, in 40 C. F. R. § 725.3. In some embodiments, microbes taught herein are “non- intergeneric,” which means that the microbes are not intergeneric.

[0059] As used herein, the term “intrageneric microorganism” is a microorganism formed by the deliberate combination of genetic material originally isolated from organisms of the same taxonomic genera. The term “intrageneric mutant” can be used interchangeably with “intrageneric microorganism.”[00601 As used herein, the term “intragenic microorganism” is a microorganism that is engineered to comprise a genetic edit, genetic modification, genetic element, or genetic material (e.g, a nucleic acid sequence), each of which has been sourced from within the organism's own genome.

[0061] As used herein, the term “introduced” refers to the introduction by means of modern biotechnology, and not a naturally occurring introduction.Attorney Docket No. PIV-00054 WO

[0062] As used herein, the term '‘introduced genetic material” refers to genetic material that is added to, and remains as a component of, the genome of the recipient,

[0063] As used herein, the terms “isolate,” “isolated,” “isolated microbe,” and similar terms, are intended to mean that the one or more microorganisms has been separated from at least one of the materials with which it is associated in a particular environment (e.g., soil, water, plant tissue, etc.). Thus, an “isolated microbe” does not exist in its naturally occurring environment rather, it is through the various techniques described herein that the microbe has been removed from its natural setting and placed into a non-naturally occurring state of existence. Thus, the isolated strain or isolated microbe can exist as, for example, a biologically pure culture, or as spores (or other forms of the strain).

[0064] In some embodiments, the isolated microbes exist as “isolated and biologically pure cultures.” It will be appreciated by one of ordinary skill in the art, that an isolated and biologically pure culture of a particular microbe, denotes that said culture is substantially free of other living organisms and contains only the individual microbe in question. As used herein, “cultured microorganism” or “cultured microbes” refers to microbes that have been isolated and cultured. The culture can contain varying concentrations of said microbe. The present disclosure notes that isolated and biologically pure microbes often “necessarily differ from less pure or impure materials.”

[0065] Fertilizers and exogenous nitrogen of the present disclosure can comprise one or more of the following nitrogen-containing molecules: ammonium, nitrate, nitrite, ammonia, glutamine, etc. Nitrogen sources of the present disclosure can include, e.g., anhydrous ammonia, ammonia sulfate, urea, diammonium phosphate, urea-form, monoammonium phosphate, ammonium nitrate, nitrogen solutions, calcium nitrate, potassium nitrate, sodium nitrate, etc.

[0066] As used herein, the term “microorganism” or “microbe” should be taken broadly. These terms, used interchangeably, include but are not limited to, the two prokaryotic domains, Bacteria and Archaea. The term can also encompass eukaryotic fungi and protists.

[0067] As used herein, when the disclosure discusses a particular microbial deposit by accession number, it is understood that the disclosure also contemplates a microbial strain having all the identifying characteristics of the deposited microbe and / or a mutant thereof.

[0068] In some embodiments, the isolated microbes exist as “isolated and biologically pure cultures ” It will be appreciated by one of ordinary skill in the art that an isolated andAttorney Docket No. PIV-00054 WObiologically pure culture of a particular microbe denotes that the culture is substantially free of other living organisms and contains only the individual microbe in question. The culture can contain varying concentrations of the microbe. The present disclosure notes that isolated and biologically pure microbes often "necessarily differ from less pure or impure materials.” See, e.g. In re Bergstrom, 427 F.2d 1394 (CCPA 1970) (discussing purified prostaglandins), In re Bergy, 596 F.2d 952 (CCPA 1979) (discussing purified microbes), and Parke-Davis & Co. v. H. K. Mulford & Co., 189F. 95 (S. D. N. Y. 1911) (Learned Hand discussing purified adrenaline), affd in part, rev’d in part, 196 F. 496 (2d Cir. 1912), each of which is incorporated herein by reference. Furthermore, in some embodiments, the disclosure provides for certain quantitative measures of the concentration or purity limitations that must be found within an isolated and biologically pure microbial culture. The presence of these purity values, in certain embodiments, is a further attribute that distinguishes the presently disclosed microbes from those microbes existing in a natural state. See. e.g, Merck & Co. v. Olin Ma hieson Chemical Corp, 253 F.2d 1 6 (4th Cir. 1958) (discussing purity limitations for vitamin B12 produced by microbes), which is incorporated herein by reference for all purposes.

[0069] Microbes of the present disclosure can include spores and / or vegetative cells In some embodiments, microbes of the present disclosure include microbes in a viable but non-culturable (VBNC) state. As used herein, the term "spore” or "spores” refers to structures produced by bacteria and fungi that are adapted for survival and dispersal. Spores are generally characterized as dormant structures; however, spores are capable of differentiation through the process of germination. Germination is the differentiation of spores into vegetative cells that are capable of metabolic activity, growth, and reproduction. The germination of a single spore results in a single fungal or bacterial vegetative cell. Fungal spores are units of asexual reproduction, and in some embodiments are necessary structures in fungal life cycles. Bacterial spores are structures for surviving conditions that can ordinarily be nonconducive to the survival or growth of vegetative cells.

[0070] As used herein, the term "microbial composition” refers to a composition comprising one or more microbes of the present disclosure. In some embodiments, a microbial composition is administered to plants (including various plant parts) and / or in agricultural fields.

[0071] As used herein, the term “microbial consortia” or “microbial consortium” refers to a subset of a microbial community of individual microbial species, or strains of a species, whichAttorney Docket No. PIV-00054 WOcan be described as carrying out a common function, or can be described as participating in, or leading to, or correlating with, a recognizable parameter, such as a phenotypic trait of interest.

[0072] As used herein, the term “microbial community’’ refers to a group of microbes comprising two or more species or strains. Unlike microbial consortia, a microbial community does not have to be carrying out a common function, or does not have to be participating in or leading to or correlating with, a recognizable parameter, such as a phenotypic trait of interest.

[0073] As used herein, the term “MRTN” is an acronym for maximum return to nitrogen and is utilized as an experimental treatment in the examples. MRTN was developed by Iowa State University and information can be found at: https: / / www.cornnratecalc.org / . The MRTN is the nitrogen rate where the economic net return to nitrogen application is maximized. The approach to calculating the MRTN is a regional approach for developing com nitrogen rate guidelines in individual states. The nitrogen rate trial data was evaluated for Illinois, Iowa, Michigan, Minnesota, Ohio, and Wisconsin, where an adequate number of research trials were available for com plantings following soybean and com plantings following com. The trials were conducted with spring, sidedress, or split preplant / sidedress applied nitrogen, and sites were not irrigated except for those that were indicated for irrigated sands in Wisconsin, MRTN was developed by Iowa State University due to apparent differences in methods for determining suggested nitrogen rates required for corn production, misperceptions pertaining to nitrogen rate guidelines, and concerns about application rates. By calculating the MRTN, practitioners can determine the following: (1) the nitrogen rate where the economic net return to nitrogen application is maximized, (2) the economic optimum nitrogen rate, which is the point where the last increment of nitrogen returns a yield increase large enough to pay for the additional nitrogen, (3) the value of com grain increase attributed to nitrogen application, and the maximum yield, which is the yield where application of more nitrogen does not result in a com yield increase. Thus, the MRTN calculations provide practitioners with the means to maximize com crops in different regions while maximizing financial gains from nitrogen applications.

[0074] As used herein, the term “non-constitutive promoter” is a promoter which is active under certain conditions, in certain types of cells, and / or during certain development stages. For example, tissue-specific promoters, tissue-preferred promoters, cell type-specific promoters, cell type-preferred promoters, inducible promoters, and promoters under developmental control are non-constitutive promoters. Examples of promoters underAttorney Docket No. PIV-00054 WOdevelopmental control include promoters that preferentially initiate transcription in certain tissues.

[0075] As used herein, the term “non-nitrogen limiting conditions’’ refers to non-atmospheric nitrogen available m the soil, field, media at concentrations greater than about 4 mM nitrogen, as disclosed by Kant et al. (J. Exp Biol, 2010, 62(4): 1499-1509), which is incorporated herein by reference for all purposes.

[0076] As used herein, the term “neutral pH” refers to a pH value of between 6 and 7.5 (e.g., between 6.5-7.5, between 6.75-7.25, or about 7).

[0077] As used herein, the term “operably linked” refers to the association of nucleic acid sequences on a single nucleic acid fragment such that the function of one is regulated by the other. For example, a promoter is operably linked with a coding sequence when it is capable of regulating the expression of that coding sequence (i.e., the coding sequence is under the transcriptional control of the promoter). Coding sequences can be operably linked to regulatory sequences in a sense or antisense orientation. In some embodiments, complementary RNA regions of the disclosure are operably linked either directly or indirectly, for example, 5' to the target mRNA, 3' to the target mRNA, or within the target mRNA. In some embodiments, a first complementary region is 5' and its complement is 3' to the target mRNA.

[0078] As used herein, the term “plant tissues,” as used herein, refers to any part of the plant during any aspect of the growing cycle, including seeds, seedlings, plants, or plant parts. Plant parts include leaves, roots, root hairs, rhizomes, stems, seed, ovules, pollen, flowers, fruit, cuttings, tubers, bulbs, etc. An agricultural plant tissue “comprising” a dispersion of live microbes disclosed herein includes agricultural plant tissues to which the dispersion of live microbes has been applied by any of the methods set forth herein, e.g., spraying, in-furrow application, seed treatment, etc.

[0079] As used herein, the term “plant productivity” refers generally to any aspect of growth or development of a plant that is a reason for which the plant is grown. For food crops, such as grains or vegetables, “plant productivity” can refer to the yield of grain or fruit harvested from a particular crop. As used herein, improved plant productivity refers broadly to improvements in yield of grain, fruit, flowers, or other plant parts harvested for various purposes, improvements in growth of plant parts, including stems, leaves and roots, promotion of plant growth, maintenance of high chlorophyll content in leaves, increasing fruit or seed numbers, increasing fruit or seed unit weight, and similar improvements of the growth andAttorney Docket No. PIV-00054 WOdevelopment of plants. In some embodiments, plant productivity is determined by comparing the productivity (e.g., yield) of a treated plant (e.g., via in furrow application of a dispersion of live microbes disclosed herein), versus a plant to which the dispersion of live microbes has not been applied, and no additional fertilizer beyond what is provided to the treated plant. Thus, in some embodiments, the dispersion of live microbes results in a reduction in NO₂ emission as a result of reduced nitrogen fertilizer usage.

[0080] Microbes in and around food crops can influence the traits of those crops. Plant traits that can be influenced by microbes include, for example, yield (e.g., grain production, biomass generation, fruit development, and / or flower set), nutrition (e.g., nitrogen, phosphorus, potassium, iron, and / or micronutrient acquisition); abiotic stress management (e.g., drought tolerance, salt tolerance, heat tolerance), and biotic stress management (e.g., pest, weeds, insects, fungi, and / or bacteria). Strategies for altering crop traits include, for example, increasing key metabolite concentrations, changing temporal dynamics of microbe influence on key metabolites, linking microbial metabolite production / degradation to new environmental cues, reducing negative metabolites, and improving the balance of metabolites or underlying proteins,[0081 J As used herein, the terms “'polynucleotide,’" “nucleotide sequence,"’ “nucleic acid,” and “oligonucleotide” can be used interchangeably. These terms refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides, or analogs thereof. Polynucleotides can have any three dimensional structure, and can perform any function, known or unknown. The following are non-limiting examples of polynucleotides: coding or non-coding regions of a gene or gene fragment, loci (locus) defined from linkage analysis, exons, introns, messenger RNA (mRNA), transfer RNA (tRNA), ribosomal RNA (rRNA), short interfering RNA (siRNA), short-hairpin RNA (shRNA), micro-RNA (miRNA), ribozymes, copy DNA (cDNA), recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA of any sequence, isolated RNA of any sequence, nucleic acid probes, and primers. A polynucleotide can comprise one or more modified nucleotides, such as methylated nucleotides and nucleotide analogs. If present, modifications to the nucleotide structure can be imparted before or after assembly of the polymer. The sequence of nucleotides can be interrupted by non-nucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component.Attorney Docket No. PIV-00054 WO

[0082] As used herein, the terms “polypeptide ’ “peptide,” and “protein” can be used interchangeably herein to refer to polymers of amino acids of any length. Tire amino acid polymer can be linear or branched, can comprise modified amino acids, and / or can be interrupted by non-amino acid moieties. The terms also encompass an amino acid polymer that has been modified with, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component.

[0083] As used herein, in the context of non-intergeneric microorganisms, the term “remodeled” is used synonymously with the term “engineered." Consequently, a “non-intergeneric remodeled microorganism” has a synonymous meaning to “non-intergeneric engineered microorganism / ’ and will be utilized interchangeably. Further, the disclosure can refer to an “engineered strain” or “engineered derivative” or “engineered non-intergeneric microbe,” these terms are used synonymously with “remodeled strain” or “remodeled derivative” or “remodeled non-intergeneric microbe.” An engineered microorganism contains in its genome at least one genetic modification.

[0084] As used herein, the term “seed coating” refers to any coating on a seed or plant propagatin g m ateri a!.

[0085] As used herein, the term “seed treatment” refers to a substance that can be applied to agricultural seeds. The seed treatment can provide one or more benefits to the seed and / or plant resulting from the seed. Without limitation, seed treatments can include the dispersion of microbes disclosed herein, biologicals disclosed herein, compositions disclosed herein, pesticides, herbicides, insecticides, nematicides, plant growth-promoting factors, fertilizers, and the like. A seed treatment can also be a seed coating.

[0086] As used herein, the term “sequence identity ” refers to an exact nucleotide-to-nucleotide or amino acid-to-ammo acid correspondence of two polynucleotides or polypeptide sequences, respectively. Typically, techniques for determining sequence identity include determining the nucleotide sequence of a poly nucleotide and / or determining the amino acid sequence encoded thereby and comparing these sequences to a second nucleotide or amino acid sequence. Two or more sequences (polynucleotide or amino acid) can be compared by7determining their “percent identity ” The percent identity of two sequences, whether nucleic acid or amino acid sequences, can be calculated as the number of exact matches between tw o aligned sequences divided by the length of the shorter sequence and multiplied by 100. In some embodiments,Attorney Docket No. PIV-00054 WOthe percent identity of a test sequence and a reference sequence, whether nucleic acid or amino acid sequences, can be calculated as the number of exact matches between two aligned sequences divided by the length of the reference sequence and multiplied by 100. Percent identity can also be determined, for example, by comparing sequence information using the advanced BLAST (Basic Local Alignment Search Tool) computer program, including version 2.2.9, available from the National Institutes of Health. The BLAST program is based on the alignment method of Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 1990, 87:2264-2268 and as discussed in Altschul et al., J. Mol. Biol., 1990. 215:403-410; Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 1993, 90:5873-5877; and Altschul et al., Nucleic Acids Res., 1997, 25: 3389-3402. Briefly, the BLAST program defines identity as the number of identical aligned symbols (generally nucleotides or amino acids), divided by the total number of symbols in the shorter of the two sequences. The program can be used to determine percent identity over the entire length of the proteins being compared. Default parameters are provided to optimize searches with short query sequences in, for example, with the BLASTP program. The program also allows use of an SEG filter to mask-off segments of the query’ sequences as determined by the SEG program of Wootton and Federhen, Computers and. Chemistry, 1993, 17:149-163. Ranges of desired degrees of sequence identity are approximately 80% to 100% and integer values there between. Typically, the percent identities between a disclosed sequence and a claimed sequence are at least 80%. at least 85%. at least 90%, at least 95%, at least 98%, or at least 99%.

[0087] Sequences can be aligned using an algorithm including but not limited to the Needleman-Wunsch algorithm (see e.g,, the EMBOSS Needle aligner available at ebi.ac.uk / Tools / psa / emboss_needle / nucleotide.html on the World Wide Web, optionally with default settings), the BLAST algorithm (see e.g., the BLAST alignment tool available at blast.ncbi.nlm.nih.gov / Blast.cgi, optionally with default settings), or the Smith-Waterman algorithm (see e.g., the EMBOSS Water aligner available at ebi.ac.uk / Tools / psa / emboss_water / nucleotide.html on the World Wide Web, optionally with default settings). Optimal alignment can be assessed using any suitable parameters of a chosen algorithm, including default parameters

[0088] As used herein, the term “spore"’ or “spores” refer to structures produced by bacteria and fungi that are adapted for survival and dispersal. Spores are generally characterized as dormant structures, however, spores are capable of differentiation through the process of germination. Germination is the differentiation of spores into vegetative cells that are capableAttorney Docket No. PIV-00054 WOof metabolic activity, growth, and reproduction. The germination of a single spore results in a single fungal or bacterial vegetative cell Fungal spores are units of asexual reproduction, and in some cases are necessary structures in fungal life cycles. Bactenal spores are structures for surviving conditions that may ordinarily be non-conducive to the survival or growth of vegetative cells.

[0089] In general, the term ‘'stringent conditions’" for hybridization refer to conditions under which a nucleic acid having complementarity to a target sequence predominantly hybridizes with a target sequence and substantially does not hybridize to non-target sequences. Stringent conditions are generally sequence-dependent and vary depending on a number of factors. In general, the longer the sequence, the higher the temperature at which the sequence specifically hybridizes to its target sequence. Non-limiting examples of stringent conditions are described in detail in Tijssen (1993), Laboratory Techniques in Biochemistry and Molecular Biology- Hybridization with Nucleic Acid Probes Part I, Second Chapter “Overview of principles of hybridization and the strategy of nucleic acid probe assay,” Elsevier. N. Y., the contents of which are herein incorporated by reference in their entirety.

[0090] As used herein, the term “transgenic microorganism” refers to a microorganism that is engineered to comprise a genetic edit, or genetic modification, or genetic element, or genetic material (e.g., a nucleic acid sequence), that has been sourced from outside the organism’s taxonomic species.

[0091] As used herein, the term “wild type microbe” (e g., a “wild type bacterium”) refers to a microbe that has not been genetically modified. Wild type (WT) microbes can be isolated and cultivated from a natural source. Wild type microbes can be selected for specific naturally occurring traits.

[0092] In some embodiments, the bacteria of the present disclosure have been modified such that they are not naturally occurring bacteria.Microbes

[0093] The spray dried composition disclosed herein comprises at least one type of microbes, such as nitrogen fixing bacteria. In some embodiments, the nitrogen fixing bacteria are diazotrophic bacteria. In some embodiments, the nitrogen fixing bacteria are gram-negative. In some embodiments, the nitrogen fixing bacteria are gram-positive. In some embodiments, the microbes are in granular form. In some embodiments, the microbes are in the form of a dry microbial powderAttorney Docket No. PIV-00054 WO

[0094] In some embodiments, the microbes are obtained from any suitable source. In some embodiments, the microbes are spore forming bacteria. In some embodiments, the microbes are diazotrophs. In some embodiments, the microbes are not diazotrophs.

[0095] In some embodiments, the microbes comprise a gene homologous to a known NifH gene. Sequences of known NifH genes can be found in, for example, the Zehr lab NifH database, (www.zehr.pmc.ucsc.edu / nifH_Database_Public / , April 4, 2014), or the Buckley lab NifH database (https: / 7blogs. comell edu / buckley / nifh-sequence-database / or www.css.cornell.edu / faculty / bucklev7nifh.htm, and Gaby, John Christian, and Daniel H. Buckley. “A comprehensive aligned nifH gene database: a multipurpose tool for studies of nitrogen fixing bacteria.” Database 2014 (2014): bauOOl.). In some embodiments, the bacteria comprise a sequence that encodes a polypeptide with at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a sequence from the Zehr lab NifH database, (www.zehr.pmc.ucsc.edu / nifH Database Public / . April 4, 2014). In some embodiments, the microbes comprise a sequence which encodes a polypeptide with at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% sequence identity to a sequence from the Buckley lab NifH database, (Gaby, John Christian, and Daniel H. Buckley. “A comprehensive aligned nifH gene database: a multipurpose tool for studies of nitrogen fixing bacteria.” Database 2014 (2014): bauOOl.).

[0096] In some embodiments, the microbes can self-propagate efficiently on the leaf surface, root surface, or inside plant tissues without inducing a damaging plant defense reaction, or bacteria that are resistant to plant defense responses. In some embodiments, the microbes described herein are isolated by culturing a plant tissue extract or leaf surface wash in a medium with no added nitrogen.

[0097] In some embodiments, the microbes described herein are an endophyte or an epiphyte or comprise a bacterium inhabiting the plant rhizosphere (rhizospheric bacteria). Endophytes are organisms that enter the interior of plants without causing disease symptoms or eliciting the formation of symbiotic structures and are of agronomic interest because they can enhance plant growth and improve the nutrition of plants (e.g., through nitrogen fixation). The microbes can be a seed-borne endophyte. Seed-borne endophytes include bacteria associated with or derived from the seed of a grass or plant, such as a seed-borne bacterial endophyte found in mature, dry, undamaged (e.g., no cracks, visible fungal infection, or prematurely germinated)Attorney Docket No. PIV-00054 WOseeds. The seed-borne bacterial endophyte can be associated with or derived from the surface of the seed; alternatively, or in addition, it can be associated with or derived from the interior seed compartment (e.g., of a surface-sterilized seed). In some embodiments, a seed-borne bacterial endophyte can replicate within the plant tissue, for example, the interior of the seed. Also, in some embodiments, the seed-borne bacterial endophyte can survive desiccation.

[0098] Bacteria that can be used in the spray dried composition and methods disclosed herein include at least one gram-negative, nitrogen fixing bacteria. For example, the bacteria can be selected from a genus selected from Kosakonia, Klebsiella, Citrobacter, Flavobacterium, Achromobacter, Arthrobacter, Azospirillum, Azotobacter, Paraburkholderia, Herbaspirillum, Phytobacter, Pseudomonas. Rahnella, Gluconacetobacter, Azoarcus, Trinickia, Rhizobium, Rhodobacter, Rubrivivax, Paenibacillus, Pseudacidovorax, Ensifer, Burkholderia, Sphingomonas, Hydrogenophaga, and any combination thereof.

[0099] In some embodiments, the bacteria are selected from the group consisting of Kosakonia sacchari, Paraburkholderia tropica, Paraburkholderia dioscoreae, Paenibacillus polymyxa D, Rahnella aquatilis. Klebsiella variicola, Phytobacter diazotrophicus, Pseudomonas stutzeri, Pseudomonas stutzeri, Kosakonia pseudosacchari, Azospirillum palustre, Rahnella aceris, Kosakonia sacchari. Azospirillum palustre, Gluconacetobacter diazotrophicus. Paraburkholderia kururiensis, Paraburkholderia tropica, Herbaspirillum seropedicae, Kosakonia arachidis, Herbaspirillum frisingense, Azoarcus olearius, Azospirillum lipoferum, Phytobacter diazotrophicus, Azospirillum palustre, Azospirillum palustre, Azospirillum palustre. Azospirillum brasilense, Azotobacter vinelandii. Herbaspirillum seropedicae, Paraburkholderia xenovorans, Herbaspirillum aquaticum, Phytobacter diazotrophicus, Azoarcus indigens, Azoarcus communis, Azospirillum oryzae, Paraburkholderia phymatum. Paenibacillus borealis, Paenibacillus graminis. Trinickia caryophylli, Pseudomonas benzenivorans. Pseudomonas sagittaria. Rhizobium selenitireducens, Rhodobacter capsulatus, Rubrivivax gelatinosus. Paenibacillus graminis, Pseudacidovorax intermedius, Kosakonia oryzendophytica, Azospirillum oryzae, Paenibacillus ottowii, Phytobacter diazotrophicus, Azotobacter vinelandii, Azotobacter vinelandii. Azotobacter vinelandii, Azotobacter chroococcum, Azotobacter chroococcum, Azospirillum palustre. Pseudacidovorax intermedius. Pseudacidovorax intermedius, Ensifer meliloti. Azotobacter vinelandii. Pseudacidovorax intermedius. Phytobacter diazotrophicus, Kosakonia sacchari, Pseudacidovorax intermedius, Paenibacillus massiliensis, Paenibacillus zanthoxyli, Azospirillum palustre, Phytobacter diazotrophicus. Rahnella aquatilis, Azospirillum palustre,Attorney Docket No. PIV-00054 WOPhytobacter diazotrophicus, Klebsiella grimontii, Klebsiella variicola, Azospirillum palustre, Pseudacidovorax intermedius, Burkholderia vietnamiensis, Herbaspirillum rubri subalbicans, Klebsiella quasipneumoniae, Sphingomonas azotifigens, Herbaspirillum rubri subalbicans. Pseudacidovorax intermedius, Azotobacter chroococcum, Hydrogenophaga pseudoflava, Paraburkholderia dioscoreae, Hydrogenophaga taeniospiralis, Klebsiella grimontii, Kosakonia sacchari, Azotobacter salinestris, Klebsiella variicola, Phytobacter diazotrophicus, Azospirillum palustre, Pseudacidovorax intermedius, Burkholderia vietnamiensis, Azospirillum palustre, or any combination thereof.

[0100] In some embodiments, the nitrogen fixing bacteria comprise bacteria from the genera Kosakonia. Klebsiella, or both Kosakonia and Klebsiella. In some embodiments, the nitrogen fixing bacteria comprise, consist of, or consist essentially of Kosakonia sacchari. In some embodiments, the bacteria are Kosakonia sacchari 6-5687 strain. In some embodiments, the nitrogen fixing bacteria comprise, consist of, or consist essentially of Klebsiella variicola. In some embodiments, the bacteria are of the Klebsiella variicola 137-1036 strain, 137-2253 strain, or 137-3890 strain. In some embodiments, the nitrogen fixing bacteria comprise, consist of, or consist essentially of Kosakonia sacchari (e.g., 6-5687 strain) and Klebsiella variicola (e.g., 137-1036 strain, 137-2253 strain, or 137-3890 strain).

[0101] In some embodiments, the bacteria are nitrogen fixing bacteria that are gram-positive. For example, the bacteria can be from the genus Paenibacillus (e.g., Paenibacillus borealis, Paenibacillus graminis').

[0102] In some embodiments, a gram-positive microbe can have a Molybdenum-Iron nitrogenase system comprising: nifH, nifD, nifK, nifB. nifE. nifN. nifX. hesA, nifV, ni / W, nifU, nifS, nifI1, and nifI2. In some embodiments, a gram-positive microbe may have a vanadium nitrogenase system comprising: vnfDG. vnfK, vnfE, vnfN, vupC, vupB, vupA, vnfV, vnfR1. vnfH. vnfR2, vnfA (transcriptional regulator). In some embodiments, a gram-positive microbe can have an iron-only nitrogenase system comprising: anfK, anfG, anfD, anfH, anfA (transcriptional regulator). In some embodiments, a gram-positive microbe can have a nitrogenase system comprising glnB, and glnK (nitrogen signaling proteins). Some examples of enzymes involved in nitrogen metabolism in Gram-positive microbes include glnA (glutamine synthetase), gdh (glutamate dehydrogenase), bdh (3-hydroxybutyrate dehydrogenase), glutaminase. gltAB / gltB / gltS (glutamate synthase), asnA / asnB (aspartate-ammonia ligase / asparagine synthetase), and ansA / ansZ (asparaginase). Some examples ofAttorney Docket No. PIV-00054 WOproteins involved in nitrogen transport in gram-positive microbes include amlB (ammonium transporter), glnK (regulator of ammonium transport), glnPHQ / glnQHMP (ATP-dependent glutamine / glutamate transporters), glnT / alsT / yrbD / yflA (glutamine-like proton symport transporters), and gltP / gltT / yhcl / nqt (glutamate-like proton symport transporters).

[0103] Examples of gram-positive bacteria for use in the spray dried composition include Paenibacillus sp. (e.g., Paenibacillus borealis, Paenibacillus graminis, Paenibacillus polymixa, Paenibacillus riograndensis), Frankia sp., Heliobacterium sp., Heliobacterium chlorum, Heliobacillus sp., Heliophilum sp., Heliorestis sp., Clostridium acetobutylicum, Clostridium sp., Methanobacterium sp., Micrococcus sp., Mycobacterium flavum, Mycobacterium sp., Arthrobacter sp.. Agromyces sp., Corynebacterium autotrophicum, Corynebacterium sp.. Micromonospora sp., Propionibacteria sp., Streptomyces sp., Microbacterium sp., and any combination thereof.

[0104] In some embodiments, the bacteria are a probiotic. In some embodiments, the bacteria are a nitrogen fixing probiotic. In some embodiments, the probiotic is at least one selected from Lactobacillus, Bifidobacterium, Saccharomyces, Streptococcus, Enterococcus, Escherichia, and Bacillus.

[0105] Microbes of the present disclosure can be obtained from any source, including environmental and commercial sources. The bacteria (or any microbe according to the disclosure) can be obtained from any general terrestrial environment, including its soils, plants, fungi, animals (including invertebrates) and other biota, including the sediments, water and biota of lakes and rivers; from the marine environment, its biota and sediments (e.g., sea water, marine muds, marine plants, marine invertebrates (e.g.. sponges), marine vertebrates (e.g., fish)); the terrestrial and marine geosphere (regolith and rock, e.g., crushed subterranean rocks, sand, and clays); the cryosphere and its meltwater; the atmosphere (e.g., filtered aerial dusts, cloud, and rain droplets); urban, industrial and other man-made environments (e.g., accumulated organic and mineral matter on concrete, roadside gutters, roof surfaces, and road surfaces).

[0106] The plants from which the bacteria (or any microbe according to the disclosure) are obtained can be a plant having one or more desirable traits, for example, a plant which naturally grows in a particular environment or under certain conditions of interest. By way of example, a certain plant can naturally grow in sandy soil or sand of high salinity, or under extreme temperatures, or with little water, or it can be resistant to certain pests or disease present in dieAttorney Docket No. PIV-00054 WOenvironment, and it can be desirable for a commercial crop to be grown in such conditions, particularly if they are, for example, the only conditions available in a particular geographic location. By way of further example, the bactena can be collected from commercial crops grown in such environments, or more specifically from individual crop plants best displaying a trait of interest amongst a crop grown in any specific environment: for example, the fastest-growing plants amongst a crop grown in saline-limiting soils, or the least damaged plants in crops exposed to severe insect damage or disease epidemic, or plants having desired quantities of certain metabolites and other compounds, including fiber content, oil content, and the like, or plants displaying desirable colors, taste or smell. The bacteria can be collected from a plant of interest or any material occurring in the environment of interest, including fungi and other animal and plant biota, soil, water, sediments, and other elements of the environment as referred to previously.

[0107] The bacteria (or any microbe according to the disclosure) can be isolated from plant tissue. This isolation can occur from any appropriate tissue in the plant, including for example, root, stem, leaves, and plant reproductive tissues. Non-limiting examples of plant tissues include a seed, seedling, leaf, cutting, plant, bulb, tuber, root, and rhizomes. In some embodiments, microbes are isolated from a seed. In some embodiments, microbes are isolated from a root.

[0108] One of ordinary skill in the art will be familiar with techniques for recovering microbes from various environmental sources. For example, bacteria useful in the methods and spray dried compositions disclosed herein can be obtained by extracting microbes from surfaces or tissues of native plants; grinding seeds to isolate microbes; planting seeds in diverse soil samples and recovering microbes from tissues; or inoculating plants with exogenous microbes and determining which microbes appear in plant tissues. The parameters for processing samples can be varied to isolate different types of associative microbes, such as rhizospheric. epiphytes, or endophytes. By way of example, some methods for isolation from plants include the sterile excision of the plant material of interest (e.g., root, stem, leaves), surface sterilization with an appropriate solution (e.g., a 2% sodium hypochlorite solution), after which the plant material can be placed on nutrient medium for microbial growth. Alternatively, the surface-sterilized plant material can be crushed in a sterile liquid (e.g., water) and the liquid suspension, including small pieces of the crushed plant material spread over the surface of a suitable solid agar medium or media, which can be selective (e.g., contain only phytic acid as a source of phosphorus). This approach is especially useful for bacteria which form isolated colonies andAttorney Docket No. PIV-00054 WOcan be picked off individually to separate plates of nutrient medium and further purified to a single species by well-known methods. Alternatively, the plant root or foliage samples are not surface sterilized but only washed gently, thus including surface-dwelling epiphytic microorganisms in the isolation process, or the epiphytic microbes can be isolated separately, by imprinting and lifting off pieces of plant roots, stem or leaves onto the surface of an agar medium and then isolating individual colonies as above. Alternatively, the roots can be processed without washing off small quantities of soil attached to the roots, thus including microbes that colonize the plant rhizosphere. Otherwise, soil adhering to the roots can be removed, diluted, and spread out onto agar of suitable selective and non-selective media to isolate individual colonies of rhizospheric bacteria.[00109 Microbes can also be sourced from a repository, such as environmental strain collections, instead of initially isolating from a first plant. The microbes can be genotyped and phenotyped, via sequencing the genomes of isolated microbes; profiling the composition of communities in plantar, characterizing the transcriptomic functionality of communities or isolated microbes; or screening microbial features using selective or phenotypic media (e.g., nitrogen fixation or phosphate solubilization phenotypes). Selected candidate strains or populations can be obtained via sequence data, phenotype data, plant data (e.g., genome, phenotype, and / or yield data), soil data (e.g., pH, N / P / K (nitrogen / phosphorus / potassium) content, and / or bulk soil biotic communities), or any combination of these.

[0110] In some embodiments, the bacteria can naturally fix nitrogen. In some embodiments the microbe is genetically modified to fix nitrogen. In some embodiments, the organism is genetically modified to have improved nitrogen fixation capabilities. Thus, in some embodiments, the microbes comprise one or more genetic variations introduced into one or more genes regulating nitrogen fixation. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into a member selected from nifA. nifL. ntrB, ntrC, polynucleotide encoding glutamine synthetase. glnA, glnB. glnK, draT. amtB, polynucleotide encoding glutaminase, glnD, glnE, nifJ, nifH, nifD, nifK, nifY nifE, nifN, nifU, nifS, nifF, nifW, nifZ, nifM, nifF, nifB, nifQ. a gene associated with biosynthesis of a nitrogenase enzyme, and any combination thereof. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifA. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifL. in some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into ntrB In some embodiments, the nitrogen fixing bacteria comprise at least one geneticAttorney Docket No. PIV-00054 WOvariation introduced into ntrC. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into polynucleotide encoding glutamine synthetase. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into glnA. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into glnB. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into glnK. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into draT. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into amtB. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into polynucleotide encoding glutaminase. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into glnD. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into glnE. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifJ. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifH In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifD. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifK. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifY. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifE. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifN. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifU. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifS. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifV. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifW. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifZ In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifM. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifE. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifB. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into nifQ. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into a geneAttorney Docket No. PIV-00054 WOassociated with biosynthesis of a nitrogenase enzyme. In some embodiments, the nitrogen fixing bacteria comprise one genetic variation In some embodiments, the nitrogen fixing bacteria comprise more than one (e.g., 2, 3, 4, 5. 6, 7, 8, 9, 10, etc.) genetic variation.

[0111] In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into at least one gene, or non-coding polynucleotide, of the nitrogen fixation or assimilation genetic regulatory network that results in one or more of: increased expression or activity of NifA or glutaminase; decreased expression or activity of NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, AmtB; decreased adenylyl-removing activity of GlnE; and decreased uridylyl-removing activity of GlnD. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into at least one gene, or noncoding polynucleotide, of the nitrogen fixation or assimilation genetic regulatory network that results in increased expression or activity of NifA or glutaminase. In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into at least one gene, or non-coding polynucleotide, of the nitrogen fixation or assimilation genetic regulatory network that results in decreased expression or activity of NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, AmtB; decreased adenylyl-removing activity of GlnE In some embodiments, the nitrogen fixing bacteria comprise at least one genetic variation introduced into at least one gene, or non-coding polynucleotide, of the nitrogen fixation or assimilation genetic regulatory network that results in decreased uridylyl-removing activity of GlnD,

[0112] In some embodiments, the genetic variation can be a variation in a gene encoding a protein with functionality selected from the group consisting of: glutamine synthetase, glutaminase, glutamine synthetase adenylyltransferase, transcriptional activator, anti- transcriptional activator, pyruvate flavodoxin oxidoreductase, flavodoxin, and NAD+-dinitrogen-reductase ADP-D-ribosyltransferase. The genetic variation can be a mutation that results in one or more of: increased expression or activity of nifA or glutaminase; decreased expression or activity of nifL, ntrB, glutamine synthetase, glnB, glnK, draT, amtB; decreased adenylyl-removing activity of GlnE; decreased expression of GlnD; or decreased uridylyl-removing activity of GlnD. The genetic variation can be a variation in a gene selected from the group consisting of: bcsII, bcsIII. yjbE.fliAB. pehA, otsB, treZ. glsA2, and any combination thereof.

[0113] In some embodiments, the bacteria can have a disrupted (e.g., deleted or partially deleted) nifL gene. In some embodiments, the bacteria can have a nifL gene that has beenAttorney Docket No. PIV-00054 WOdisrupted with the introduction of a promoter sequence that acts on the nifA gene. In some embodiments, e.g,, when the bacteria are a strain of K variicola, the promoter can be a K. variicola PinfC promoter. In some embodiments, e.g., when the bacteria are a strain of K. sacchari. the promoter can be & K. sacchari Prm5 promoter. In some embodiments, the bacteria can have a glnE gene that has been altered to remove the adenylyl-removing (AR) domain, while leaving the coding region for the adenyltransferase (AT) domain, which is functionally expressed. In some embodiments, the bacteria can have a deletion of the glnD gene.

[0114] The genetic variation introduced into one or more bacteria of the spray dried composition can be a knock-out mutation or it can abolish a regulatory sequence of a target gene, or it can comprise insertion of a heterologous regulatory sequence, for example, insertion of a regulatory sequence found within the genome of the same bacterial species or genus. The regulatory sequence can be chosen based on the expression level of a gene in a bacterial culture or within plant tissue. The genetic variation can be produced by chemical mutagenesis. The plants grown can be exposed to biotic or abiotic stressors. However, in some embodiments, the methods disclosed herein also envision altering the impact of ATP or O2 on the circuitry, replacing the circuitry with other regulatory cascades in the cell, or altering genetic circuits other than nitrogen fixation. Gene clusters can be re-engineered to generate functional products under the control of a heterologous regulatory system. By eliminating native regulatory elements outside of, and within, coding sequences of gene clusters, and replacing them with alternative regulatory systems, the functional products of complex genetic operons and other gene clusters can be controlled and / or moved to heterologous cells, including cells of different species other than the species from which the native genes were derived. Once re-engineered, the synthetic gene clusters can be controlled by genetic circuits or other inducible regulatory systems, thereby controlling the products’ expression as desired. The expression cassettes can be designed to act as logic gates, pulse generators, oscillators, switches, or memory devices. The controlling expression cassette can be linked to a promoter such that the expression cassette functions as an environmental sensor, such as an oxygen sensor, temperature sensor, touch sensor, osmotic stress sensor, membrane stress sensor, or redox sensor.

[0115] As an example, the nifL, nifA, nifT, and nifX genes can be eliminated from the nif gene cluster Synthetic genes can be designed by codon randomizing the DNA encoding each amino acid sequence. Codon selection can be performed, specifying that codon usage be as divergent as possible from the codon usage in the native gene. Proposed sequences can be scanned for any undesired features, such as restriction enzyme recognition sites, transposonAttorney Docket No. PIV-00054 WOrecognition sites, repetitive sequences, sigma 54 and sigma 70 promoters, cry ptic ribosome binding sites, and rho independent terminators. Synthetic ribosome binding sites can be chosen to match the strength of each corresponding native ribosome binding site, such as by constructing a fluorescent reporter plasmid in which the 150 bp surrounding a gene's start codon (from -60 to +90) can be fused to a fluorescent gene. This chimera can be expressed under control of the Ptac promoter, and fluorescence measured via flow cytometry'. To generate synthetic ribosome binding sites, a library of reporter plasmids using 150 bp (-60 to +90) of a synthetic expression cassette can be generated. Briefly, a synthetic expression cassette can include a random DNA spacer, a degenerate sequence encoding an RBS library, and the coding sequence for each synthetic gene. Multiple clones can be screened to identify the synthetic ribosome binding site that best matches the native ribosome binding site. Synthetic operons that consist of the same genes as the native operons are thus constructed and tested for functional complementation. A further exemplary description of synthetic operons is provided in US 2014 / 0329326, the contents of which are herein incorporated by reference in their entirety.

[0116] In some embodiments, genetic alterations of a gram-positive bacteria include, e.g, deleting glnR to remove negative regulation of BNF in the presence of environmental nitrogen, inserting different promoters directly upstream of the nif cluster to eliminate regulation by GlnR in response to environmental nitrogen, mutating glnA to reduce the rate of ammonium assimilation by the GS-GOGAT pathway, deleting amtB to reduce uptake of ammonium from the media, mutating glnA so it is constitutively in the feedback-inhibited (FBI-GS) state, to reduce ammonium assimilation by the GS-GOGAT pathway.

[0117] In some embodiments, glnR is the main regulator of N metabolism and fixation in, e.g., Paenibacillus species. In some embodiments, the genome of a Paenibacillus species does not contain a gene to produce glnR. In some embodiments, the genome of a Paenibacillus species does not contain a gene to produce glnE or glnD. In some embodiments, the genome of a Paenibacillus species does contain a gene to produce glnB or glnK. For example, Paenibacillus sp. WLY78 does not contain a gene for glnB, or its homologs found in the archaeon Methanococcus maripaludis, nifll and nifI2. In some embodiments, the genomes of Paenibacillus species are variable. For example. Paenibacillus polymixa E681 lacks glnK and gdh, has several nitrogen compound transporters, but only amtB appears to be controlled by GlnR. In another example, Paenibacillus sp. JDR2 has glnK, gdh and most other central nitrogen metabolism genes, has many fewer nitrogen compound transporters, but does haveAttorney Docket No. PIV-00054 WOglnPHQ controlled by GlnR. Paenibacillus riograndensis SBR5 contains a standard glnRA operon. an fdx gene, a main nz / operon, a secondary nif operon, and an an operon (encoding iron-only nitrogenase). Putative glnR / tnrA sites were found upstream of each of these operons. GlnR can regulate all of the above operons. except the anf operon. GlnR can bind to each of these regulatory sequences as a dimer.

[0118] Paenibacillus N -fixing strains can fall into two subgroups: subgroup I, which contains only a minimal nif gene cluster and subgroup II, which contains a minimal cluster, plus an uncharacterized gene between nifX and hesA, and often other clusters duplicating some of the nif genes, such as nifH, nifHDK, nifBEN, or clusters encoding vanadium nitrogenase (vn / ) or iron-only nitrogenase (anf) genes.[001191 In some embodiments, the genome of Paenibacillus species does not contain a gene to produce glnB or glnK. In some embodiments, the genome of a Paenibacillus species can contain a minimal nif cluster with 9 genes transcribed from a sigma-70 promoter. In some embodiments, a Paenibacillus nif cluster is negatively regulated by nitrogen or oxygen. In some embodiments, the genome of a Paenibacillus species does not contain a gene to produce sigma-54. For example. Paenibacillus sp, WLY78 does not contain a gene for sigma-54. In some embodiments, a nif cluster is regulated by glnR, and / or TnrA. In some embodiments, activity of a nif cluster is altered by altering activity of glnR, and / or TnrA.

[0120] In Bacilli, glutamine synthetase (GS) is feedback-inhibited by high concentrations of intracellular glutamine, causing a shift in confirmation (referred to as FBI-GS). Nif clusters contain distinct binding sites for the regulators GlnR and TnrA in several Bacilli species. GlnR binds and represses gene expression in the presence of excess intracellular glutamine and AMP. A role of GlnR may be to prevent the influx and intracellular production of glutamine and ammonium under conditions of high nitrogen availability.. TnrA can bind and / or activate and / or repress gene expression in the presence of limiting intracellular glutamine, and / or in the presence of FBI-GS. In some embodiments, the activity of a Bacilli nif cluster is altered by altering the activity of GlnR.

[0121] Feedback-inhibited glutamine synthetase (FBI-GS) can bind GlnR and stabilize binding of GlnR to recognition sequences. Several bacterial species have a GlnR / TnrA binding site upstream of the nif cluster. Altering the binding of FBI-GS and GlnR can alter the activity of the nif pathway.Attorney Docket No. PIV-00054 WO

[0122] Additional genetic modifications suitable for the microbes of the present disclosure can be found in International Patent Application No. PCT / US2019 / 039528, the contents of which are herein incorporated by reference in their entirety.

[0123] In some embodiments, the nitrogen fixing bacteria are selected from bacteria deposited as ATCC PTA-126575, bacteria deposited as ATCC PTA-126576, bacteria deposited as ATCC PTA-126577. bacteria deposited as ATCC PTA-126578. bacteria deposited as ATCC PTA-126579, bacteria deposited as ATCC PTA-126580, bacteria deposited as ATCC PTA-126584, bacteria deposited as ATCC PTA-126586, bacteria deposited as ATCC PTA-126587, bacteria deposited as ATCC PTA-126588. bacteria deposited as PTA-126740, bacteria deposited as PTA-126743, bacteria deposited as NCMA 201701002, bacteria deposited as NCMA 201708004, bacteria deposited as NCMA 201708003, bacteria deposited as NCMA 201708002, bacteria deposited as NCMA 201712001, bacteria deposited as NCMA 201712002, and any combination thereof. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as ATCC PTA-126575. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as ATCC PTA-126576. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as ATCC PTA-126577. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as ATCC PTA-126578. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as ATCC PTA-126579. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as ATCC PTA-126580. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as ATCC PTA-126584. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as ATCC PTA-126586. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as ATCC PTA-126587. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as ATCC PTA-126588. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as PTA-126740. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as PTA-126743. In some embodiments, the nitrogen fixing bactena are bacteria deposited as NCMA 201701002. In some embodiments, the nitrogen fixing bacteria are bactena deposited as NCMA 201708004. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as NCMA 201708003. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as NCMA 201708002. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as NCMA 201712001. In some embodiments, the nitrogen fixing bacteria are bacteria deposited as NCMA 201712002, In some embodiments, the nitrogen fixing bacteria is comprised of one bacteria deposit. In some embodiments, the nitrogen fixingAttorney Docket No. PIV-00054 WObacteria is comprised of more than one (e.g., 2, 3, 4, 5, 6, 7, 8, 9, 10, etc.) bacteria deposit, including any combination of the foregoing deposits.

[0124] The microbial deposits of the present disci osure were made under the provisions of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purpose of Patent Procedure (Budapest Treaty ).

[0125] Applicants state that pursuant to 37 C. F. R. § 1.808(a)(2) “all restrictions imposed by the depositor on the availability to the public of the deposited material will be irrevocably removed upon the granting of the patent.” This statement is subject to paragraph (b) of this section (i.e., 37 C. F. R. § 1.808(b)).

[0126] The Enterobacler sacchari has now been reclassified as Kosakonia sacchari, the name for the organism can be used interchangeably throughout the present disclosure.

[0127] In some embodiments, microbes of the present disclosure can be derived from two wild-type strains. Strain CI006 is a bacterial species previously classified in the genus Enterobacler (see aforementioned reclassification as Kosakonia). Strain CI019 is a bacterial species classified in the genus Rahnella. The deposit information for the C1006 Kosakonia wild type (WT) and CI019 Rahnella WT is set forth in Table 1.

[0128] Some microorganisms described in this application were deposited on January 06, 2017 or August 11, 2017 with the Bigelow National Center for Manne Algae and Microbiota (NCMA), located at 60 Bigelow Drive, East Boothbay, Maine 04544, USA. All deposits were made under the terms of the Budapest Treaty on the International Recognition of the Deposit of Microorganisms for the Purposes of Patent Procedure. The Bigelow- National Center for Marine Algae and Microbiota accession numbers and dates of deposit for the Budapest Treaty¬ deposits are provided in Table I.

[0129] Biologically pure cultures of Kosakonia sacchari (WT), Rahnella aquatilis (WT), and a variant / remodeled Kosakonia sacchari strain were deposited on January- 06, 2017 with the Bigelow National Center for Marine Algae and Microbiota (NCMA), located at 60 Bigelow Drive, East Boothbay, Maine 04544, USA, and assigned NCMA Patent Deposit Designation numbers 201701001, 201701003, and 201701002, respectively. The applicable deposit information is set forth in Table 1.

[0130] Biologically- pure cultures of variant / remodeled Kosakonia sacchari strains were deposited on August 11, 2017 with the Bigelow- National Center for Marine Algae andAttorney Docket No. PIV-00054 WOMicrobiota (NCMA), located at 60 Bigelow Drive, East Boothbay, Maine 04544, USA, and assigned NCMA Patent Deposit Designation numbers 201708004, 201708003, and 201708002, respectively. The applicable deposit information is set forth in Table 1.[00131 A biologically pure culture of Klebsiella variicola (WT) was deposited on August 11, 2017 with the Bigelow National Center for Marine Algae and Microbiota (NCMA), located at 60 Bigelow Drive. East Boothbay, Maine 04544. USA, and assigned NCMA Patent Deposit Designation number 201708001. Biologically pure cultures of two Klebsiella variicola variants / remodeled strains were deposited on December 20, 2017 with the Bigelow National Center for Marine Algae and Microbiota (NCMA), located at 60 Bigelow Drive, East Boothbay, Maine 04544, USA. and assigned NCMA Patent Deposit Designation numbers 201712001 and 201712002, respectively. The applicable deposit information is set forth m Table 1.

[0132] Biologically pure cultures of two Kosakonia sacchari variants / remodeled strains were deposited on December 23, 2019 with the Amencan Type Culture Collection (ATCC), located al 10801 University Boulevard, Manassas, Virginia 20110-2209, USA and assigned ATCC Patent Deposit Numbers PTA- 126575 and PTA- 126576. Biologically pure cultures of four Klebsiella variicola variants / remodeled strains were deposited on December 23. 2019 with the American Type Culture Collection (ATCC), located at 10801 University Boulevard, Manassas, Virginia 20110-2209, USA and assigned ATCC Patent Deposit Numbers PTA-126.577, PTA- 126578. PTA-126579 and PTA-126580. A biologically pure culture of a Paenibacillus polymyxa (WT) strain was deposited on December 23, 2019 with the American Type Culture Collection (ATCC), located at 10801 University Boulevard, Manassas, Virginia 20110-2209, USA and assigned ATCC Patent Deposit Number PTA-126581. A biologically pure culture of a Paraburkholderia tropica (WT) strain was deposited on December 23, 2019 with the American Type Culture Collection (ATCC), located at 10801 University Boulevard, Manassas, Virginia 20110-2209, USA and assigned ATCC Patent Deposit Number PTA-126582. A biologically pure culture of a Herbaspirilhim aquaticum (WT) strain was deposited on December 23, 2019 with the American Type Culture Collection (ATCC), located at 10801 University Boulevard. Manassas. Virginia 20110-2209. USA and assigned ATCC Patent Deposit Number PTA-126583. Biologically pure cultures of four Metakosakonia intestini variants / remodeled strains were deposited on December 23, 2019 with the American Type Culture Collection (ATCC), located at 10801 University Boulevard, Manassas, Virginia 20110-2209, USA and assigned ATCC Patent Deposit Numbers PTA-126584, PTA-126586,Attorney Docket No. PIV-00054 WOPTA-126587 and PTA-126588. A biologically pure culture of a Metakosakonia miestim (WT) strain was deposited on December 23, 2019 with the American Type Culture Collection (ATCC), located at 10801 University Boulevard, Manassas, Virginia 20110-2209, USA and assigned ATCC Patent Deposit Number PTA-126585. A biologically pure culture of a Klebsiella variicola variant / remodeled strain was deposited on March 25, 2020 with the American Type Culture Collection (ATCC), located at 10801 University- Boulevard, Manassas, Virginia 20110-2209, USA and assigned ATCC Patent Deposit Number PTA-126740. A biologically pure culture of a Kosakonia sacchari variant / remodeled strain was deposited on March 25, 2020 with the American Type Culture Collection (ATCC), located at 10801 University' Boulevard, Manassas, Virginia 20110-2209, USA and assigned ATCC Patent Deposit Number PTA-126743. The applicable deposit information is set forth in Table 1.Table 1Pivot StrainDesignationAccession Date of Depository (some strains TaxonomyNumber Deposit have multipledesignations)C1006,NCMA Kosakonia sacchari (WT) 201701001 January 06. 2017PBC6.1,6NCMA CIO 19, 19 Rahnella aquatilis (WT) 201701003 January' 06, 2017 NCMA CM029, 6-412 Kosakonia sacchari 201701002 January 06, 20176-403NCMA Kosakonia sacchari 201708004 August 11, 2017CM0376-404,NCMA CM38, Kosakonia sacchari 201708003 August 11, 2017PBC6.38CM094,NCMA 6-881, Kosakonia sacchari 201708002 August 11, 2017PBC6.94CH 37. 137,NCMA Klebsiella variicola (WT) 201708001 August 11, 2017PB137NCMA 137-1034 Klebsiella variicola 201712001 December 20, 2017 NCMA 137-1036 Klebsiella variicola 201712002 December 20, 2017 ATCC 6-2425 Kosakonia sacchari PTA- 126575 December 23, 2019 ATCC 6-2634 Kosakonia sacchari PTA-126576 December 23, 2019 ATCC 137-1968 Klebsiella variicola PTA- 126577 December 23, 2019 ATCC 137-2219 Klebsiella variicola PTA- 126578 December 23. 2019 ATCC 137-2237 Klebsiella variicola PTA- 126579 December 23, 2019 ATCC 137-2285 Klebsiella variicola PTA- 126580 December 23, 2019 ATCC Paenibacillus polvmyxa PTA- 126581 December 23, 201941(WT)Attorney Docket No. PIV-00054 WOPivot StrainDesignationAccession Date of Depository (some strains TaxonomyNumber Deposit have multipledesignations)ATCC Paraburkholderia tropica PT A- 126582 December 23, 20198(WT)ATCC Herhaspirillum aquaticum PTA- 126583 December 23, 20193069(WT)ATCC 137-2253 Klebsiella variicola PTA- 126740 March 25, 2020 ATCC 137-3896 Klebsiella variicola PTA- 126741 March 25, 2020 ATCC 137-3890 Klebsiella variicola PTA-126749 March 25, 2020ATCC 6-5687 Kosokonia sacchari PTA- 126743 March 25, 2020

[0133] In some embodiments, the isolated and biologically pure microorganisms present in the spray dried composition and related agricultural compositions are those from Table 1. In other embodiments, the isolated and biologically pure microorganisms of the disclosure are derived from a microorganism of Table 1. For example, a strain, child, mutant, or derivative of a microorganism from Table 1 are provided herein. The disclosure contemplates all possible combinations of microbes listed in Table 1, said combinations sometimes forming a microbial consortia. The microbes from Table 1, either individually or in any combination, can be combined with any plant, active molecule (synthetic, organic, etc.), adjuvant, carrier, supplement, or biological described herein.

[0134] In some embodiments, the microbes are non-intergeneric remodeled microbes. The terra “non-intergenenc” indicates that the genetic variations introduced into the host do not contain nucleic acid sequences from outside the host genus (e.g., no transgenic DNA) Therefore, in some embodiments, the microbes are not transgenic. For example, for non-transgenic microbes with varied promoters, promoters for promoter swapping are selected from within the microbe's genome or genus.[00135| Exemplary’ non-intergeneric genetic variations include a mutation in the gene of interest that can improve the function of the protein encoded by the gene; a constitutionally active promoter that can replace the endogenous promoter of the gene of interest to increase the expression of the gene; a mutation that will inactivate the gene of interest; the insertion of a promoter from within the host’s genome into a heterologous location, e.g., insertion of the promoter into a gene that results in inactivation of said gene and upregulation of a downstream gene; and the like. The mutations can be point mutations, insertions, and / or deletions (full orAttorney Docket No. PIV-00054 WOpartial deletion of the gene). For example, in some embodiments, to improve the nitrogen fixation activity of the host microbe, a genetic variation can comprise an inactivating mutation of the nifL gene (negative regulator of nitrogen fixation pathway) and / or comprise replacing the endogenous promoter of the nifA and / or nifH gene (nitrogenase iron protein that catalyzes a key reaction to fix atmospheric nitrogen) with a constitutionally active promoter that will drive the expression of the nifA and / or nifH gene constitutively. Additional genetic variations of interest are described further in the foregoing “Genetic alterations” section.

[0136] Exemplary microbes for use in the spray dried composition and methods of the present disclosure are provided in Tables 2 and 3.Table 2Strain SEQ IDStrain ID NO Genotype DescriptionCI63; SEQ ID63 16S N / AC1063 NO 1Cl 63; SEQ I i )63 nifH N / ACI063 NO 2CI63; SEQ ID63 nifDl 1 of 2 unique genes annotated as nifD in 63 genome CI063 NO 3CI63; SEQ ID63 nifD2 2 of 2 unique genes annotated as nifD in 63 genome CI063 NO 4CI63; SEQ ID63 mfKl 1 of 2 unique genes annotated as uilK in 63 genome CI063 NO 5CI63; SEQ ID63 nifK2 2 of 2 unique genes annotated as nifK in 63 genome CI063 NO 6CI63; SEQ ID63 nifL N / ACI063 NO 7CI63; SEQ ID63 nifA N / ACI063 NO 8CI63; SEQ ID63 glnE N / ACI063 NO 9CI63; SEQ ID63 amtB N / ACI063 NO 10CT63; SEQ ID 500bp immediately upstream of tire ATG start codon 63 PinfCCI063 NO 11 of the infC geneSEQ ID CI137 137 16S N / ANO 12SEQ ID CI 137 137 nilHl 1 ol'2 unique genes annotated as mill in 137 genome NO 13SEQ ID CI137 137 nifH2 2 of 2 unique genes annotated as nifH in 137 genome NO 14SEQ ID CI 137 137 1 of 2 unique genes annotated as nifD in 137 genome NO 15 nifDlSEQ ID CI137 137 nifD2 2 of 2 unique genes annotated as nifD in 137 genome NO 16SEQ ID CI 137 137 nifKl 1 of 2 unique genes annotated as nifK in 137 genome NO 17SEQ I D CI137 137 nifK.2 2 of 2 unique genes annotated as nifK in 137 genomeNO 18Attorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype DescriptionCl 137 137 SEQ IDrtifL N / ANO 19SEQ ID CI137 137 nit'A N / ANO 20SEQ ID CI137 137 glnE N / ANO 21SEQ ID 500bp immediately' upstream of the TTG start codon of CI 137 137 PinfCNO 22 infCSEQ ID CI137 137 amtB N / ANO 23SEQ ID internal promoter located in nlpl gene, 299bp starting Cl 137 137 Prm8.2NO 24 at Slbp after the A of (he ATG of the nlpl gene SEQ ID 300bp upstream of the secE gene starting at 57bp CI137 137 Prm6.2NO 25 upstream of the A of the ATG of secESEQ ID CI 137 137 Prml.2 400bp immediately' upstream of the ATG of cspE gene NO 26SEQ IDnone 728 16S N / ANO 27SEQ IDnone 728 nifH N / ANO 28SEQ I Dnone 728 nifDl 1 of 2 unique genes annotated as nifD in 728 genome NO 29SEQ IDnone 728 nifD2 2 of 2 unique genes annotated as nifD in 728 genome NO 30SEQ IDnone 728 nifKl 1 of 2 unique genes annotated as nifK in 728 genome NO 31SEQ IDnone 728 nifK 2 2 of 2 unique genes annotated as nifK in 728 genome NO 32SEQ IDnone 728 nifL N / ANO 33SEQ IDnone 728 nifA N / ANO 34SEQ IDnone 728 glnE N / ANO 35SEQ IDnone 728 amtB N / ANO 36SEQ IDnone 850 16S N / ANO 37SEQ IDnone 852 16S N / ANO 38SEQ IDnone 853 16S N / ANO 39SEQ IDnone 910 16S N / ANO 40SEQ IDnone 910 mill N / ANO 41DinitrogenaseSEQ ID ironnone 910 N / ANO 42 molybdenumcofactor CDSSEQ IDnone 910 nifD 1 N / ANO 43SEQ IDnone 910 mfD2 N / ANO 44SEQ IDnone 910 riifK 1 N / ANO 45Attorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype DescriptionSEQ IDnone 910 riifK2 N / ANO 46SEQ IDnone 910 N / ANO 47 niiLSEQ IDnone 910 nifA N / ANO 48SEQ IDnone 910 glnE N / ANO 49SEQ IDnone 910 amtB N / ANO 50SEQ ID 498bp immediately upstream of die ATG of the infC none 910 Pinf'CNO 51 geneSEQ IDnone 1021 16S N / ANO 52SEQ IDnone 1021 mill N / ANO 53SEQ IDnone 1021 nifDl 1 of 2 unique genes annotated as nifD in 910 genome NO 54SEQ IDnone 1021 ni! D2 2 of 2 unique genes annotated as nifD in 910 genome NO 55SEQ I Dnone 1021 nifKl 1 of 2 unique genes annotated as nifK in 910 genome NO 56SEQ IDnone 1021 nifK2 2 of 2 unique genes annotated as nifK in 910 genome NO 57SEQ IDnone 1021 nifL N / ANO 58SEQ IDnone 1021 nifA N / ANO 59SEQ IDnone 1021 glnE N / ANO 60SEQ IDnone 1021 amtB N / ANO 61SEQ ID 500bp immediately upstream of the ATG start codon none 1021 PinfCNO 62 of the infC gene348bp includes the 319bp immediately upstream of the SEQ IDnone 1021 Prml ATG start codon of the Ipp gene and the first 29bp of NO 63the Ipp geneSEQ ID 339bp upstream of the sspA gene, ending at 46bp none 1021 Prm7NO 64 upstream of the ATG of the sspA geneSEQ IDnone 1113 16S N / ANO 65SEQ IDnone 1113 nifH N / ANO 66SEQ IDnone 1113 1 of 2 unique genes annotated as nifD in 1113 genome NO 67 nitDlSEQ IDnone 1113 2 of 2 unique genes annotated as nifD in 1113 genome NO 68 nifD2SEQ IDnone 1113NO 69 nifK N / ASEQ IDnone 1113 nifL N / ANO 70SEQ ID due to a gap m the sequence assembly, we can only none 1113 nifA partial geneNO 71 identify a partial gene from the 1113 genome SEQ IDnone 1113 glnE N / ANO 72Attorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype DescriptionSEQ IDnone 1116 16SNO 73SEQ IDnone 1116NO 74 nifHSEQ IDnone 1116 nifDl 1 of 2 unique genes annotated as nifD in 1116 genome NO 75SEQ IDnone 1116 mlD2 2 of 2 unique genes annotated as nifD in 1116 genome NO 76SEQ IDnone 1116 nifKl 1 of 2 unique genes annotated as nifK in 1116 genome NO 77SEQ IDnone 1116 niiK2 2 of2 unique genes annotated as nifK. in 1116 genome NO 78SEQ IDnone 1116 nifL N / ANO 79SEQ IDnone 1116 mf'A N / ANO 80SEQ IDnone 1116 glnE N / ANO 81SEQ IDnone 1116 amtB N / ANO 82SEQ I Dnone 1293 16S N / ANO 83SEQ II)none 1293 nifH N / ANO 84SEQ IDnone 1293 nifDl 1 of 2 unique genes annotated as nifD in 1293 genome NO 85SEQ II)none 1293 2 of 2 unique genes annotated as nifD in 1293 genome NO 86 nifD2SEQ IDnone 1293 nifK 1 of 2 unique genes annotated as nifK in 1293 genome NO 87SEQ IDnone 1293 nifK 1 2 of 2 unique genes annotated as nifK in 1293 genome NO 88SEQ IDnone 1293 nifA N / ANO 89SEQ IDnone 1293 glnE N / ANO 90SEQ IDnone 1293 1 of 2 unique genes annotated as amtB in 1293 genome NO 91 amtB 1SEQ IDnone 1293 amtB2 2 of 2 unique genes annotated as amtB in 1293 genome NO 92starting at 24bp after the A of the ATG start codon, 1021- SEQ I Dnone AnifL:: PinfC 1375bp of nifL have been deleted and replaced with 1612 NO 93the 1021 PinfC promoter sequencestarting at 24bp after the A of the ATG start codon, 102.1- SEQ I D AnifL:: PinfC 1375bp of nifL have been deleted and replaced with none1612 NO 94 with 500bp flank the 1021 PinfC promoter sequence; 500bp flanking the nifL gene upstream and downstream are included glnE gene with 1673bp immediately downstream of the 1021- SEQ IDnone glnE AAR- 2 ATG start codon deleted, resulting in a truncated glnE 1612 NO 95protein lacking the adcnyly l-removing ( AR) domain glnE gene with 1673bp immediately downstream of the ATG start codon deleted, resulting in a truncated glnE 1021- SEQ IDnone glnEAAR-2 with protein lacking the adenylyl-removing (AR) domain;1612 NO 96 500bp flank500bp flanking the glnE gene upstream anddownstream are includedAttorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype Descriptionstarting at 24bp after the A of the ATG start codon, 1021- SEQ IDnone AnifL:: Prml 1375bp of nifL have been deleted and replaced with 1615 NO 97the 1021 Prml promoter sequencestarting at 24bp after the A of the ATG start codon, 1021- Si Q ID AriifLcPrml 1375bp of niil. have been deleted and replaced with none1615 NO 98 with 500bp flank the 1021 rml promoter sequence: 500bp flanking the nifL gene upstream and downstream are included glnE gene with 1673bp immediately downstream of the 1021- SI Q IDnone ATG start codon deleted, resulting in a truncated glnE 1615 NO 99 glnE AAR-2protein lacking the adenylyl-removing (AR) domain glnE gene with 1673bp immediately downstream of the ATG start codon deleted, resulting in a truncated glnE 1021- SEQ ID glnEAAR-2 withnone protein lacking the adenylyl-removing (AR) domain;1615 NO 100 500bp flank500bp flanking the glnE gene upstream and downstream are includedstarting at 24bp after the A of the ATG start codon, 1021- SEQ IDnone AmfL:: Prml 1375bp oftiilL have been deleted and replaced with 1619 NO 101the 1021 Prml promoter sequencestarting at 24bp after the A of the ATG start codon, 1021- SEQ ID AnifL:: Prml 1375bp of nifL have been deleted and replaced with none1619 NO 102 with 500bp flank the 1021 mil promoter sequence; 500bp flanking the nifL gene upstream and downstream are included glnE gene with 1673bp immediately downstream of the SEQ IDnone 1021- glnEAAR-2 ATG start codon deleted, resulting in a truncated glnE 1623 NO 103protein lacking the adenvlvl-removing (AR) domain glnE gene with 1673bp immediately downstream of the ATG start codon deleted, resulting in a truncated glnE 1021- SEQ ID glnEAAR-2 withnone protein lacking the adenylyl-removing (AR) domain;1623 NO 104 500bp flank500bp flanking the glnE gene upstream and downstream are includedstarting at 24bp after the A of the ATG start codon, SEQ IDnone 1021- AriifL:: Prm7 1375bp of nifL. have been deleted and replaced with 1623 NO 105the 1021 Pmi7 promoter sequencesfttrting at 24bp after the A. of the ATG start codon, 1021 - SEQ ID AnifL:: Prm7 1375bp of nifl. have been deleted and replaced with none1623 NO 106 with 500bp flank the 1021 rm7 promoter sequence; 500bp flanking the nifl, gene upstream and downstream are included glnE gene with 1290bp immediately downstream of the 137- SEQ IDnone glnEAAR-2 ATG start codon deleted, resulting in a truncated glnE 1034 NO 107protein lacking the adenylyl-removing (. AR) domain glnE gene with 1290bp immediately downstream of the ATG start codon deleted, resulting in a truncated glnE 137- SEQ IDnone glnEAAR-2 with protein lacking the adenylyl-removing (AR) domain;1034 NO 108 500bp flankSOObp flanking tire glnE gene upstream and downstream are includedstarting at 24bp after the A of the ATG start codon, 137- SEQ IDnone AnifL:: PinfC 1372bp of mfL have been deleted and replaced with 1036 NO 109the 137 PinfC promoter sequencestarting at 24bp after the A. of the ATG start codon, SEQ ID AnifL:: PinfC 1372bp of nitL have been deleted and replaced with none 137- 1036 NO 110 with 500bp flank the 137 PinfC promoter sequence; 500bp flanking the nifL gene upstream and downstream are included glnE gene with 1290bp immediately downstream of the ATG start codon deleted AND 36bp deleted beginning 137- SEQ ID glnEAAR-2none at 1472bp downstream of tire start codon, resulting in a 1314 NO 111 36bp deletiontruncated glnE protein lacking tire adenylyl-removing( AR) domainAttorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype DescriptionglnE gene with 1290bp immediately downstream of the ATG start codon deleted AND 36bp deleted beginning 137- SEQ ID at 1472bp downstream of the start codon, resulting in a none glnEAAR-21314 NO 112 36bp deletion truncated glnE protein lacking the adenylyl-removing (AR) domain; 500bp flanking tire nifL gene upstream and downstream are includedstarting at 24bp after the A of the ATG start codon, 137- SEQ IDnone AnifL.:: Prm8.2 1372bp of nifL. have been deleted and replaced with 1314 NO 113the 137Pnn8.2 promoter sequencestarting at 24bp after the A of the A’l'G star t codon, 137- SEQ ID AnifL:: Prm8.2 1372bp of nifL have been deleted and replaced with none1314 NO 114 with 500bp flank the 137 Pnn8.2 promoter sequence; 500bp flanking the nifL gene upstream and downstream are included glnE gene with 1290bp immediately downstream of the ATG start codon deleted AND 36bp deleted beginning 137- SEQ ID glnEAAR-2none at 1472bp downstream of the start codon, resulting in a 1329 NO 115 36bp deletiontruncated glnE protein lacking the adenylyl-removing (AR) domainglnE gene with 1290bp immediately downstream of the ATG start codon deleted AND 36bp deleted beginning 137- SEQ ID glnEAAR-2 at 1472bp downstream of the start codon, resulting in a none1329 NO 116 36bp deletion truncated glnE protein lacking the adenylyl-removing (AR) domain; 500bp flanking the nifL gene upstream and downstream are includedstarting at 24bp after the A of the ATG start codon, 137- SEQ IDnone AnifL:: Pnn6.2 1372bp of nifL have been deleted and replaced with 1329 NO 117the 137 Prm6.2 promoter sequencestarting at 24bp after the A of the ATG start codon, 137- SEQ ID AnifL:: Prm6.2 1372bp of nifL have been deleted and replaced with none1329 NO 118 with 500bp Hank the 137 Prm6.2 promoter sequence; 500bp flanking the nifL gene upstream and downstream are included starting at 24bp after the A of the ATG start codon, 137- SEQ IDnone AnifL:: Pnnl.2 1372bp of nifY, have been deleted and replaced with 1382 NO 119the 137 Pnn 1.2 promoter sequencestarting at 24bp after the A of the ATG start codon, 137- SEQ ID AnilL:: Prml.2 1372bp of nifL have been deleted and replaced with none1382 NO 120 with 500bp flank the 137 Prml.2 promoter sequence; 500bp flanking the nifL gene upstream and downstream are included glnE gene with 1290bp immediately downstream of the 137- ATG start codon deleted AND 36bp deleted beginning SEQ ID glnEAAR-2none at 1472bp downstream of the start cotion, resulting in a 1382 NO 121 36bp deletiontruncated glnE protein lacking the adenylyl-removing (AR) domainglnE gene with 1290bp immediately downstream of the ATG start codon deleted AND 36bp deleted beginning 137- SEQ I D at 1472bp downstream of the start codon, resulting in a none glnEAAR-21382 NO 122 36bp deletion truncated glnE protein lacking the adenylyl-removing (AR) domain; 500bp flanking tire nifL gene upstream and downstream are includedstarting at 24bp after the A of the ATG start codon, 137- SEQ IDnone AnifL:: PinfC 1372bp of nifL, have been deleted and replaced with 1586 NO 123the 137 PinfC promoter sequencestarting at 24bp after the A of the ATG start codon, 137- SEQ ID AnifL:: PmfC 1372bp of nifL have been deleted and replaced with none1586 NO 124 with 500bp flank the 137 PinfC promoter sequence; 500bp flanking thenifL, gene upstream and downstream are includedAttorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype Description137- glnE gene with 1290bp immediately downstream of the SEQ IDnone ATG start codon deleted, resulting in a truncated glnE 1586 glnE AAR-2NO 125protein lacking the adenvlvl -removing (AR) domain glnE gene with 1290bp immediately downstream of the 137- ATG start codon deleted, resulting in a truncated glnE SEQ ID glnEAAR-2 withnone protein lacking the adenylyl-removing (AR) domain;1586 NO 126 50()bp flank500bp flanking the glnE gene upstream and downstream are includedglnE gene with 1650bp immediately downstream of the SEQ IDnone 19-594 ATG start codon deleted, resulting in a truncated glnE NO 127 glnEAAR-2protein lacking the adenvlyl-removing (AR) domain glnE gene with 1650bp immediately downstream of the ATG start codon deleted, resulting in a truncated glnE SEQ ID glnEAAR-2 withnone 19-594 protein lacking the adenylyl-removing (AR) domain;NO 128 500bp Hank500bp flanking the glnE gene upstream and downstream are includedstarting at 221bp after the A of the ATG start codon, SEQ IDnone 19-594 AnifL:: Pnn6.1 845bp of nilL have been deleted and replaced with the NO 129CTO 19 Prm6.1 promoter sequencestarting at 221bp after the A of the ATG start codon, SEQ ID 845bp of nilL have been deleted and replaced with tire none 19-594 AnifL:: Pmi6.1NO 130 with 500bp flank CIO 19 Prm6.1 promoter sequence: 50()bp flanking the nifL gene upstream and downstream are included starting at 22 Ibp after the A of the ATG start codon, SEQ IDnone 19-714 AnifL:: Prm6.1 845bp of nifL have been deleted and replaced with lire NO 131CTO 19 Prm6.1 promoter sequencestarting at 221bp after the A of the ATG start codon, SEQ ID AnifL:: Prm6.1 845bp of nifL have been deleted and replaced with the none 19-714NO 132 with 500bp flank CIO 19 Prm6.1 promoter sequence; 500bp flanking the nifY, gene upstream and downstream are included starting at 22 Ibp after the A of the ATG start codon, SEQ IDnone 19-715 AriifL:: Prm7.1 845bp of nifL have been deleted and replaced with the NO 133CIO 19 Prm7.1 promoter sequencestarting at 221bp after the A of the ATG start codon, SEQ ID AnifL:: Prm7 1 845bp of nifL have been deleted and replaced with the none 19-715NO 134 with 500bp flank CI019 Prm76.1promoter sequence; 500bp flanking the nifL gene upstream and downstream are included starting at 22 Ibp after the A of the ATG start codon, SEQ ID19-713 19-750 AnifL:: Prm 1.2 845bp of mfL have been deleted and replaced with the NO 135C1019 Prml.2 promoter sequencestarting at 22 I bp after the A of the ATG start codon, SEQ ID AnifL: Erm 1.2 845bp of nilL have been deleted and replaced with the 19-713 19-750NO 136 with 500bp flank CTO 19 Prml 2 promoter sequence; 500bp flanking the nifL gene upstream and downstream are included starting at 221bp after the A of the ATG start codon, SEQ ID17-724 19-804 AnifL:: Prml.2 845bp of mfL have been deleted and replaced with 1he NO 137C1019 Prml 2 promoter sequencestarting at 221 bp after the A of the ATG start codon, SEQ ID AnifL: Erm 1.2 845bp of nifL have been deleted and replaced with lire 17-724 19-804NO 138 with 500bp flank CTO 19 Prml.2 promoter sequence; 500bp flanking the nifL gene upstream and downstream are included glnE gene with 1650bp immediately downstream of the SEQ ID17-724 19-804 glnEAAR-2 ATG start codon deleted, resulting in a truncated glnE NO 139protein lacking the adenylyl-removing (AR) domainAttorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype DescriptionglnE gene with 1650bp immediately downstream of the ATG start codon deleted, resulting in a truncated glnE SEQ ID glnEAAR-2 with17-724 19-804 protein lacking the adenylyl-removing (AR) domain;NO 140 500bp flank500bp flanking the glnE gene upstream and downstream are includedstarting at 221bp after the A of the ATG start codon, SEQ ID19-590 19-806 AnifL:: Prm3.1 845bp of nifL have been deleted and replaced with the NO 141CIOl 9 Pnn3 1 promoter sequencestarting at 221bp after the A of tire ATG start codon, SEQ I D AntfL:: Prm3. 1 845bp of nifL have been deleted and replaced with the 19-590 19-806NO 142 with 500bp flank CI019 Prm3 1 promoter sequence; 500bp flanking the nifL gene upstream and downstream are included glnE gene with 1650bp immediately downstream of the SEQ I D19-590 19-806 glnEAAR-2 ATG start codon deleted, resulting in a truncated glnE NO 143protein lacking the adenylyl-removing (AR) domain glnE gene with 1650bp immediately downstream of the ATG start codon deleted, resulting in a truncated glnE SEQ ID glnEAAR-2 with19-590 19-806 protein lacking the adenyly l-removing (AR) domain;NO 144 500bp flank500bp flanking the glnE gene upstream and downstream are includedstarting at 24bp after the A of the ATG start codon, 63- SEQ IDnone AnifL:: PinfC 1375bp of rn i l have been deleted and replaced with 1146 NO 145the 63 PinfC promoter sequencestarting at 24bp after the A of the ATG start codon, SEQ ID AnifL:: PmfC 1375bp of nifL have been deleted and replaced with none 63- 1146 NO 146 with 500bp flank the 63 PinfC promoter sequence; 500bp flanking the nifL gene upstream and downstream are included starting at 31 bp after the A of the ATG start codon, CM015; SEQ ID6-397 AnifL:: Prm5 1375bp of nifL have been deleted and replaced with PBC6.15 NO 147the CK106 Pnn5 promoter sequencestarting at 3 Ibp after the A of the ATG start codon, CM015; SEQ ID Anifl.,:: Pnn5 1375bp of nifL. have been deleted and replaced with 6-397PBC6.15 NO 148 with 500bp flank the C1006 Prm5 promoter sequence; 500bp flanking the nifL gene upstream and downstream are included starting at 3 Ibp after the A of the ATG start codon, SEQ ID CM014 6-400 AnifL:: Prml 1375bp of nifL have been deleted and replaced with NO 149the C1006 Prml promoter sequencestarting at 3 Ibp after the A of the ATG start codon, SEQ ID AnifL:: Prml 1375bp of nifY. have been deleted and replaced with CM014 6-400NO 150 with 500bp flank the CI006 Prml promoter sequence; 500bp flanking the nifL gene upstream and downstream are included starting at 3 Ibp after the A of the ATG start codon, CM037; SEQ ID6-403 AnifL:: Prml 1375bp of nifL have been deleted and replaced with PBC6.37 NO 151the CI006Prml promoter sequencestarting at 3 Ibp after the A of the ATG start codon, CMO37; SEQ ID 1375bp of nifL have been deleted and replaced with 6-403 AnifL:: PrmlPBC6.38 NO 152 with 500bp flank the 0006 Prml promoter sequence; 500bp flanking the nifL gene upstream and downstream are included glnE gene with 1644bp immediately downstream of the CM037; SEQ ID6-403 glnEAAR-2 ATG start codon deleted, resulting in a truncated glnE PBC6.39 NO 153protein lacking the adenvlyl-removing (AR) domain glnE gene with 1644bp immediately downstream of the ATG start codon deleted, resulting in a truncated glnE CMOS 7; SEQ ID glnEAAR-2 with6-403 protein lacking the adenylyl-removing (AR) domain; PBC6.40 NO 154 500bp flank500bp flanking the glnE gene upstream anddownstream are includedAttorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype DescriptionglnE gene with 1287bp immediately downstream of the CM038; SEQ I i:•6-404 glnEAAR- 1 ATG start codon deleted, resulting in a truncated glnE PBC6.38 NO 155protein lacking the adenvlvl-removing (ARI domain starting at 3 Ibp after the A of the ATG start codon, CM038; SEQ ID6-404 AriifL:; Prml 1375bp of nifl_. have been deleted and replaced with PBC6.38 NO 156the C1006 Prml promoter sequencestarting at 3 Ibp after the A of the ATG start codon, CM038; SEQ ID AnifL:: Prml 1375bp of nifL have been deleted and replaced with 6-404PBC6.38 NO 157 with 500bp flank the CI006 Prml promoter sequence; 500bp flanking the nifL gene upstream and downstream are included glnE gene with 1287bp immediately downstream of the ATG start codon deleted, resulting in a truncated glnE CM038; SEQ ID glnEAAR- 1 with6-404 protein lacking the adenylyl-removing (AR) domain; PBC6.38 NO 158 500bp flank500bp flanking the glnE gene upstream and downstream are includedglnE gene with 1287bp immediately downstream of the CM029; SEQ ID6-412 ATG start codon deleted, resulting in a truncated glnE PBC629 NO 159 glnEAAR- 1protein lacking the adenvlvl-removing (AR) domain glnE gene with 1287bp immediately downstream of the ATG start codon deleted, resulting in a truncated glnE CM029; SEQ ID glnEAAR- 1 with6-412 protein lacking the adenylyl-removing (AR) domain; PBC629 NO 160 5()0bp flank500bp flanking the glnE gene upstream and downstream are includedstarting at 3 Ibp after the A of the ATG start codon, CM029; SEQ ID6-412 1375bp of nifL have been deleted and replaced with PBC6.29 NO 161 AnifL:: Pnn5the C1006 Prm5 promoter sequencestarting at 3 Ibp after the A of the ATG start codon, CM029; SEQ ID AnifL:: Prm5 1375bp of nifL have been deleted and replaced with 6-412PBC6.29 NO 162 with 500bp flank the CI006 Prm5 promoter sequence; 500bp flanking the nifL gene upstream and downstream are included starting at 3 Ibp after the A of the ATG start codon, CM093; SEQ ID6-848 AriifL:: Prml 1375bp of nifL. have been deleted and replaced with PBC6.93 NO 163the C1006 Prml promoter sequencestarting at 3 Ibp after the A. of the ATG start codon, CM093; SEQ ID Anifl.:: Prml 1375bp of nifl. have been deleted and replaced with 6-848PBC6.93 NO 164 with 500bp flank the CI006 Prml promoter sequence; 500bp flanking the nifl. gene upstream and downstream are included glnE gene with 1644bp immediately downstream of the CM093; SEQ ID6-848 glnE AAR-2. ATG start codon deleted, resulting in a truncated glnE PBC6.93 NO 165protein lacking the adenylyl-removing (. AR) domain glnE gene with 1644bp immediately downstream of the ATG start codon deleted, resulting in a truncated glnE CM093; SEQ ID6-848 glnEAAR- 2 with protein lacking the adenylyl-removing (. AR) domain; PBC6.93 NO 166 500bp flank SOObp flanking tire glnE gene upstream and downstream are includedFirst 1088bp of amtB gene and 4bp upstream of start CM093; SEQ ID6-848 AamlB codon deleted; 199bp of gene remaining lacks a start PBC6.93 NO 167codon; no amtB protein is translatedFirst 1088bp of amtB gene and 4bp upstream of start CM093; SEQ ID AamfB with6-848 codon deleted; 199bp of gene remaining lacks a start PBC6.93 NO 168 50()bp flankcodon; no amtB protein is translatedglnE gene with 1287bp immediately downstream of the CM094; SEQ ID6-881 glnEAAR- 1 ATG start codon deleted, resulting in a truncated glnE PBC6.94 NO 169protein lacking the adenylyl-removing (AR) domainAttorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype DescriptionglnE gene with 1287bp immediately downstream of the ATG start codon deleted, resulting in a truncated glnE CM094; SEQ ID glnEAAR-1 with6-881 protein lacking the adenylyl -removing (AR) domain; PBC6.94 NO 170 500bp flank500bp flanking the glnE gene upstream and downstream are includedstarting at 31 bp after the A of the ATG start codon, CM094; SEQ ID6-881 AnifL:: Prml 1375bp of nifL have been deleted and replaced with PBC6.94 NO 171the CI006 Prml promoter sequencestarting at 31 bp after the A of the ATG start codon, CM094; SEQ I D AntiL:: Pnnl 1375bp of mil, have been deleted and replaced with 6-881PBC6.94 NO 172 with 500bp flank the CI006 Prml promoter sequence; 500bp flanking the nifL gene upstream and downstream are included First 1088bp of amtB gene and 4bp upstream of start CM094; SEQ I D6-881 AamtB codon deleted; 199bp of gene remaining lacks a start PBC6.94 NO 173codon; no amtB protein is translatedFirst 1088bp of amtB gene and 4bp upstream of start CM094; SEQ ID AamtB with6-881 codon deleted; 199bp of gene remaining lacks a start PBC694 NO 174 500bp flankcodon; no amtB protein is translatedstarting at 20bp after the A of the ATG start codon, 910- SEQ IDnone AnilL:: PinfC 1379bp of nifL have been deleted and replaced with 1246 NO 175the 910 PinfC promoter sequencestarting at 20bp after the A of the ATG start codon, 910- SEQ ID Anifl,:: PinfC 1379bp of nifL have been deleted and replaced with none1246 NO 176 with 500bp flank the 910 PinfC promoter sequence; 500bp flanking the nifL gene upstream and downstream are included PBC6. J, SEQ IDCI006 16S-1 1 of 3 unique 16S rDNA genes in the CI006 genome 6, CI6 NO 177PBC6.1, SEQ IDCI006 16S-2 2 of 3 unique 16S rDNA genes in the CI 006 genome 6, C16 NO 178PBC6J, SI Q IDCI006 nitH N / A6, CI6 NO 179PBC6.1, SEQ ID 2 of 2 unique genes annotated as nifD in ('1006CT0066, C16 NO 180 nifD2 genomePBC6J, SI O ID 2 of 2 unique genes annotated as nifK in CI006CI0066, CI6 NO 181 nifK2 genomePBC6.1, SEQ IDCT006 nifL N / A6, C16 NO 182PBC6J, SEQ IDCI006 nifA N / A6, CI6 NO 183PBC6.1, SEQ IDCI006 glnE N / A6, CI6 NO 184PBC6 J, SEQ IDCI006 16S-3 3 of 3 unique 168 rDNA genes in the CI006 genome 6, CI6 NO 185PBC6.1, SEQ ID 1 of 2 unique genes annotated as niiD in CI006Cl 006 nifDl6, CI6 NO 186 genomePBC6.1, SEQ ID 1 of 2 unique genes annotated as nifK in CI006C1006 nifKl6, CI6 NO 187 genomePBC6.1, SEQ IDCl 006 amtB N / A6, CI6 NO 188348bp includes the 319bp immediately upstream of the PBC6. J, SEQ IDCI006 Prml ATG start codon of the Ipp gene and the first 29bp of 6, CI6 NO 189the ipp gene3 I3bp starting at 432bp upstream of the ATG start PBC6.1, SEQ IDCI006 PrtnS codon of the ompX gene and ending 119bp upstream 6, CI6 NO 190of the ATG start codon of the ompX geneSEQ ID19, CI19 CIO 19 nifL N / ANO 191Attorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype DescriptionSEQ ID19. CI19 CIO 19 nifA N / ANO 192SEQ ID19, Cl 19 CIO 19 16S-1 1 of 7 unique 16S rDNA genes in the C1019 genome NO 193SEQ ID19, CI19 CIO 19 16S-2 2 of 7 unique 16S rDNA genes in the CIO 19 genome NO 194SEQ ID19, Cl 19 CIO 19 16S-3 3 of 7 unique 16S rDNA genes in the C10I9 genome NO 195SEQ ID19, CI 19 CIO 19 16S-4 4 of 7 unique 16S rDNA genes in the CIO 19 genome NO 196SEQ ID19, Cl 19 CIO 19 16S-5 5 of 7 unique 16S rDNA genes in the C1019 genome NO 197SEQ ID19. CI19 CIO 19 16S-6 6 of 7 unique 16S rDNA genes in the CI019 genome NO 198SEQ ID19, Cl 19 CIO 19 16S-7 7 of 7 unique 16S rDNA genes in the C1019 genome NO 199SEQ ID 1 of 2 unique genes annotated as nifH in CI019 19, CI19 CIO 19 nifHlNO 200 genomeSEQ ID 2 of 2 unique genes annotated as nifH in CTO 19 19, CI19 CIO 19 nifH2NO 201 genomeSEQ I D ] of 2 unique genes annotated as irifD in CI019 19, CI19 CIO 19 nifDlNO 202 genomeSEQ ID 2 of 2 unique genes annotated as nifD in CIO 19 19, CH 9 CIO 19NO 203 nifD2 genomeSEQ I D 1 of 2 unique genes annotated as niflC in CI019 19, CI19 CIO 19 nifKlNO 204 genomeSEQ ID 2 of 2 unique genes annotated as nifK in CIO 19 19. CH 9 CIO 19NO 205 nifK2 genomeSEQ I D19, CI19 CIO 19 glnE N / ANO 206SEQ ID 449bp immediately upstream of the ATG of the dscC 2 19. CI 19 CIO 19 Prm4NO 207 geneSEQ ID 500bp immediately upstream of the TTG start codon of 19, Cl 19 CIO 19NO 208 Prml.2 the infC geneSEQ ID 170 bp immediately upstream of tire ATG start codon 19. CI19 CIO 19 Prm3.1NO 209 of the rplN gene142bp immediately upstream of the ATG of a highly- SEQ ID19, CI20 CI020 Prm6.1 expressed hypothetical protein (annotated as NO 210PROKKA 00662 in CIO 19 assembly 82)19, C121 SEQ IDCI021 Prm7.1 293bp immediately upstream of die ATG of the Ipp NO 211 gene19-375. glnE gene with 1650bp immediately downstream of the SEQ ID19-417, CM67 glnEzXAR-2 ATG start codon deleted, resulting in a truncated glnE NO 212CM067 protein lacking the adenylvl-removing (AR) domain glnE gene with 1650bp immediately downstream of the 19-375. ATG start codon deleted, resulting m a truncated glnE SEQ ID19-417, CM67 glnE AAR- 2 with protein lacking the adenylvl-removing (AR) domain;NO 213 500bp flankCM067 500bp flanking the glnE gene upstream and downstream are includedstarting at 221bp after the zX of the ATG start codon, 19-375,SEQ ID 845bp of nifL have been deleted and replaced w ith tire 19-417, CM67 AnifL::null-vlNO 214 31 bp sequenceCM067“GGAGTCTGAACTCATCCTGCGATGGGGGCTG”Attorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype Descriptionstarting at 221bp after the A of the ATG start codon, 845 bp of nifL have been deleted and replaced with the 19-375,SEQ ID AnifL::null-vl19-417, CM67 31 bp sequenceNO 215 with 500bp flank “GGAGTCTGAACTCATCCTGCGATGGGGGCTG'’ CM067; 500bp flanking the nifL gene upstream and downstream are includedstarting at 221bp after the A of the ATG start codon, 19-377, SEQ IDCM69 AnifL::null-v2 845bp of nifL have been deleted and replaced with the CM069 NO 2165bp sequence “TTAAA”starting at 22ibp after the A of the ATG start codon, 19-377, SEQ ID 845bp of nifL have been deleted and replaced with the CM69 AnifL::null-v2CM069 NO 217 with 500bp flank 5bp sequence “TTAAA”; 500bp flanking the nifL gene upstream and downstream are included19-389, starting at 22ibp after the A of the ATG start codon,SEQ ID19-418, CMS I AnifL:: Prm4 845bp of nifL have been deleted and replaced with the NO 218CM081 CH 9 Prm4 sequencestarting at 221bp after the A of the ATG start codon, 19-389,SEQ ID AnifL:: Pnn4 845bp of miL have been deleted and replaced with the 19-418, CMS INO 219 with 500bp flank CH 9 Prm4 sequence: 500bp flanking the nifL gene CMOS Iupstream and downstream are includedSEQ ID glnD with glnD gene with upstream and downstream flanking Cl 006 flankingNO 220 sequences includedsequencesRetaining the first 30 bp and the last 83 bp, the middle SEQ ID6-5687 AnifL:: Prm5 region of nifL. is deleted and replaced with the CI006 NO 221Prm5 promoter sequence.Deletion of the first 1287bp after the ATG start codon SEQ ID6-5687 glnE AAR of the glriE gene. Resulting GlnE protein lacks AR NO 222domain, but expresses ATase domainAglnD with Deletion of glnD gene by removing all 2676 SEQ ID6-5687 flanking nucleotides, including start and stop codons. Upstream NO 223sequences and downstream flanking sequences are included.Deletion of the nifL gene from 20bp after the ATG (start) to 87bp before the TGA (stop) of the gene. A 137- AnifL:: PmfC 500bp fragment of the region upstream of the infC 1036gene was inserted (PinfC) upstream of nifA replacing the deleted portion.137- Deletion of 1647bp after the start codon of the glnE AglnEAR-KO21034 geneDeletion of the nifL gene from 20bp after the ATG (start ) to 87bp before the TGA (stop ) of the gene A 137- AnifL:: PmfC 500bp fragment of the region upstream of the infC 2249gene was inserted (PinfC) upstream of nifA replacing the deleted portion.Attorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype Description137- Modification of the “GAT'’ found 513bp after the start glnEAR-DxD2249 codon of glnE to a “GCG” codon.Deletion of the nifL gene from 20bp after tire ATG (start) to 87bp before the TGA (stop) of the gene. A 137- AnifL:: Prm8.2 299bp fragment (Prm8.2), found 77bp after the start 1968codon of nipt to 376bp after the start codon of nlpl was inserted upstream of nifA replacing the deleted portion.137- Deletion of 1647bp after the start codon of the glnE Ag1nEAR-KO21968 gene.Deletion of the nifL gene from 20bp after the ATG ( start ) to 87bp before the TGA (stop) of she gene. A 137- AnifL: PrnfC 500bp fragment of the region upstream of the infC 1586gene was inserted (PinfC) upstream of nifA replacing the deleted portion.137- Deletion of 1647bp after the start codon of the glnE AglnEAR-KO21586 geneDeletion of the nifL gene from 20bp after the ATG (start) to 87bp before the TGA (stop) of the gene. A 137- AnifL:: Prml.2 400bp fragment from the region upstream of the cspE 2084gene was inserted (Prrnl.2) upstream of nifA replacing the deleted portion.137- Deletion of 1647bp after the start codon of the glnE AglnEAR-KO22084 geneDeletion of the nifL gene from 20bp after lire ATG (start) to 87bp before the TGA (stop) of the gene. A 137- AnifL:: Pnnl.2 400bp fragment from the region upstream of the cspE 2251gene was inserted (Pnnl.2) upstream of nifA replacing the deleted portion.Attorney Docket No. PIV-00054 WOStrain Strain SEQ IDID NO Genotype Description137- Deletion of 1647bp after the start codon of the glnE AglnE, AR-KO22251 gene.Deletion of the 47bp between ibtB2 and rpoN and 137- insertion of a fragment (Prm8.2), found 77bp after the rpoN-Pmi8.22251 start codon of nlpl to 376bp after the start codon of nlpl, directly upstream of rpoN.Deletion of the nifL gene from 20bp after the ATG (start) to 87bp before the TGA (stop) of the gene A 137- AnifL:: Prml,2 400bp fragment from the region upstream of the cspE 2219gene was inserted (Pmil.2) upstream of nil'A replacing the deleted portion.137- Deletion of 1647bp after tire start codon of the glnE 2219 AglnEAR“KO2 gene.137- Deletion of the 546bp before the stop codon of the 2219 AglnDACTi / 2 glnD geneTable 3Strain Lineage Mutagenic DNA Description Genotype Accession ID Number CI006 CI006 Wildtype parent Kosakonia sacchari WT 201701001 CI137 CI137 Wildtype parent Klebsiella variicola WT 201708001 Wildtype parent MetakosakoniaCI910 C1910 WT PT A- 126585 intestineWildtype parent ParaburkhoideriaCT8 CI 8 WT PT A- 126582 tropicaWildtype parent PaenibacillusCI41 CI41 WT PT A- 126581 polymyxaWildtype parent HerbaspirillumCI3069 CI3069 WT PT A- 12658.3 aquaticumMutant of AmlL:: Prm 1, AglnE- 6-403 Disruption of nifL gene with a 201708004 CI006 AR_KO2fragment of the region upstream of theAttorney Docket No. PIV-00054 WOStrain Lineage Mutagenic DNA Description Genotype Accession ID Number Ipp gene inserted (Prtn 1 ) upstream ofnifA. Deletion of the 1647bp after thestart codon of the glriE gene containingthe adenylyl-removing domain ofglutamate-ammonia-ligaseadenylyltransferase (AglnE-AR_KO2).Disruption of nifl_, gene with afragment of the region upstream of theIpp gene inserted (Prml ) upstream ofnifA. Deletion of the 987bp after theMutant of AnifL:: Pnnl,6-2425 start codon of the glnD gene containing PT A- 126575 CI006 AglnD_UT_truncationthe uridylyltransferase (U T) domain ofthe bifunctionaluridylyltransferase / uridylyl-removingenzyme (AglnD-UT_truncationlDisruption of nifl, gene with afragment of the region upstream of theIpp gene inserted (Prml) upstream ofnifA. Deactivation of theuridylyltransferase (UT ) domain of the6-2634 Mutant of AnifL,:: Prtnl, PTA- 126576 C1006 bifunctional AglnD__UT__deactivation uridylyltransferase / uridylyl-removingenzyme. glnD, by mutating ammo acidresidues 90 and 91 from GG to DV aswell as residue 104 from D to A.Deletion of the 1647bp after the startcodon of the glnE gene containing tire137- Mutant ofadenylyl-removing domain of AglnE-AR_KO2 201712001 1034 CI137glutamate-ammonia-ligaseadenylyltransferase (AglnE-AR KO2).Disruption of nifl, gene with afragment of the region upstream of thecspE gene inserted (Prml.2) upstream137- Mutant of of nifA. Deletion of the 1647bp after AnifL:: Prml.2 AglnE- 2084 CI 137 the start codon of the glnE gene AR KO2containing the adenylyl-removingdomain of glutamate-ammonia-ligaseadenylyltransferase (AglnE-AR_KO2).Deletion of the native dctAl promoterand insertion of a fragment (Prm8.2),found 77bp after the start codon of nlplto 376bp after the start codon of nlpl,137- directly upstream of dctAl. Deletion of AnifL:: P8.2, AglnE- PT A- 126577 1968 the 1647bp after the start codon of the AR KO2glnE gene containing the adenylyl- removing domain of glulamate- amm onia-liga sc adeny ly 1 transferase(AglnE-AR_KO2).Disruption of nifl gene with afragment of the region upstream of the AnifL:: Prml.2 AglnE- 137- Mutant of cspE gene inserted (Prml 2) upstream AR_KO2, PTA-126578 2219 CI137 of nifA. Deletion of the 1647bp after AglnD ACT 12 truncationthe start codon of the glnE genecontaining the adenylyl-removingAttorney Docket No. PIV-00054 WOStrain Lineage Mutagenic DNA Description Genotype Accession ID Number domain of glutamate-ammonia-ligaseadenylyltransferase (AglnE-AR KO2).Deletion of the 546bp before the stopcodon of tire glnD gene containing theACT 1 / 2 domain of the bifunctionaluridylyltransferase / uridylyl-removingenzyme (AglnD-ACT 12_tiuncation)Disruption of nifL gene with afragment of the region upstream of thecspE gene inserted (Prml.2) upstreamof mfA. Deletion of the 1647bp aftertire start codon of the glnE gene137- Mutant of AnifL:: Prm 1.2, AglnE- containing the adenylyl-removing PTA- 126579 2237 CI137 AR_KO2, glsA2:: Prml 2domain of glutamate-ammonia-ligaseadenylyltransferase (AglnE-AR KO2Deletion of the native glsA2 promoterand insertion of a fragment (Prml.2)directly upstream of the glsA2 CDSDisruption of nifL gene with afragment of the region upstream of thecspE gene inserted (Prml.2) upstreamof nifA. Deletion of the 1647bp afterthe start codon of the glnE gene137- Mutant of Ani£L:: Prml.2, AglnE- containing the adenylyl-removing PTA- 126580 2285 CI 137 domain of glutamate-ammonia-ligase AR_KO2, rpoN:: Prml.2adenylyltransferase (AglnE-AR_KO2).Deletion of the native rpoN promoterand insertion of a fragment (Prtn l.2 )directly upstream of the rpoN CDS.Disruption of nifL gene with afragment of the region upstream of thermF gene inserted (Prm2.1) upstreamof nifA. Deletion of the 1647bp afterthe start codon of the glnE gene910- Mutant of containing the adenylyl-removing AnifL:: Prm2.1, AglnE- PTA- 126588 3994 CI910 domain of glutamate-ammonia-ligase AR_KO2, glsA2:: Prml.1adenylyltransferase (AglnE-AR KO2).Deletion of the native glsA2 promoterand insertion of a fragment upstream ofthe csrA gene (Prm 1.1) directlyupstream of the glsA2 CDS.Disruption of nifL gene with afragment of the region upstream of thermF gene inserted (Prm2.1) upstreamof nifA. Deletion of the 1647bp afterthe start codon of the glnE gene AnifL:: Prm2.1, AglnE- 910- Mutant of containing the adenylyl-removing AR_KO2. PTA-126586 3963 CI910 domain of glutamate-ammonia-ligase AglnD__UT__truncation adenylyltransferase (AglnE-AR_KO2).Deletion of the 987bp after the startcodon of the glnD gene containing theuridylyltransferase (UT) domain of thebifunctionalAttorney Docket No. PIV-00054 WOStrain Lineage Mutagenic DNA Description Genotype Accession ID Number uridylyltransferase / uridylyl-removingenzyme (AglnD-UT_truncation)Disruption of nifL gene with afragment of the region upstream of thennF gene inserted (Prm2.]) upstream910- Mutant of of nifA. Deletion of the 1647bp after AmfL:: Prm2 1, AglnE- 3655 CI910 the start codon of the glnE gene AR_KO2 PT A-! 26584 containing the adenvlyl-reinovingdomain of glutamale-ammonia- ligaseadenylyltransferase (Ag1nE-AR_KO2).Disruption of nifL gene with afragment of the region upstream of thennF gene inserted (Pnn2.1) upstreamof nifA. Deletion of the 987bp after tire910- Mutant of AnifL:: Prm2.1,start codon of the glnD gene containing UFA-! 26587 3961 CI910 AglnD__UT__truncationthe uridylyltransferase (UT) domain ofthe bifunctionaluridylyltrausferase / uridylyl-removingenzyme (AglnD-UT_truncation).Disruption of nifL gene with apromoter that natively drives ompX(Prm5) inserted upstream of nifA.Deletion of the 1287bp after the startMutant of6-5687 AnifL:: Prm5, glnEAAR,codon of tiie glnE gene containing the PT A- 126743 CI006 AginDadenylyl-removing domain ofglutamate-ammonia- lig aseadenyiyltransferase Deletion of entil eglnD gene.

[0137] In some embodiments, the amount of microbes (e.g., nitrogen fixing bacteria) present in the spray dried composition is in the range of about 104to about 1012CFU / g of the spray dried composition, for example, about 104CFU / g, about 105CFU / g, about 106CFU / g, about 107CFU / g, about 108CFU / g, about 109CFU / g, about IO10CFU / g, about 101' CFU / g, or about 1012CFU / g, including all values and subranges that lie therebetween. In some embodiments, the bacteria are present in the spray dried composition disclosed herein at a concentration in the range of about 106CFU / g to about 10” CFU / g or about 10sCFU / g to about 101!CFU / g or about 10yCFU / g to about 1011CFU / g. In some embodiments, the bacteria are present in the spray dried composition at a concentration of at least about 104CFU / g after at least 1 week (e.g., after at least 2 weeks, after at least 3 weeks, after at least 4 weeks, after at least 5 weeks, after at least 6 weeks, after at least 7 weeks, after at least 8 weeks, after at least 9 weeks, afterAttorney Docket No. PIV-00054 WOat least 10 weeks, after at least 11 weeks, or after at least 12 weeks) of formation at either 4 °C or room temperature (e.g., about 21 °C).

[0138] In some embodiments, fermentation of the microbes (e.g., nitrogen fixing bacteria) can be used to produce a high cell density culture liquid. In some embodiments, bioreactors, such as a continuous stirred tank reactor or a batch reactor can be used. In some embodiments, the culture liquid can be concentrated to further increase cell density. In some embodiments, a concentrating step comprises centrifugation, tangential flow filtration (TFF), or a combination thereof.

[0139] In some embodiments, the high cell density culture liquid can have a solids content of about 5 to about 20% (w / v). For example, the total solids content of the high cell density¬ culture can be about 5 to about 15%, about 5 to about 10%, about 5 to about 12%, about 8 to about 20%. about 8 to about 15%. about 8 to about 12%, about 8 to about 10%, about 10 to about 20%, about 10 to about 15%, about 10 to about 12%, about 12 to about 20%, about 12 to about 15%, about 15 to about 20%, each w / v, In some embodiments, the total solids content of the high cell density' culture can be about 5 to about 15% or about 5 to about 10% (w / v).

[0140] in some embodiments, cell density or cell concentration can be measured using ‘‘spread plating,” which refers to the plating of the culture liquid or the microbes contained therein on an agar plate and counting the number of colony forming units per volume of culture liquid. In some embodiments, the microbes (e.g., nitrogen fixing bacteria) are present in the spray dried composition disclosed herein at a concentration in the range of about 104to about 1012CFU / ml, for example, about 104CFU / ml. about IO5CFU / ml, about IO6CFU / ml, about ID7CFU / ml, about 108CFU / ml, about 109CFU / ml, about 10]° CFU / ml, about 1011CFU / ml, or about 1012CFU / mL, including all values and subranges that he therebetween. For instance, in some embodiments, the microbes (e.g., nitrogen fixing bacteria) can be present in the spray dried composition at a concentration in the range of about 107CFU / ml to about 1011CFU / ml. In some embodiments, the microbes (e g., nitrogen fixing bacteria) can be present in the spray dried composition at a concentration in the range of about 108CFU / mL to about 1010CFU / mL. Cell concentration can vary based on the microbes and concentration method employed.

[0141] In some embodiments, microbial viability- is measured in CFU / mL via a standard plating assay. In some embodiments, microbial viability is evaluated by measuring colonization potential. In some embodiments, the colonization potential is measured in loglO copies per gram of fresh weight via a root colonization assay. In some embodiments, theAttorney Docket No. PIV-00054 WOcontents of the spray dried composition or corresponding coating composition are screened for toxin accumulation. In some embodiments, the contents of the spray dried composition or corresponding coating composition are screened for toxin concentrations at a given time point, e.g., the target shelf life time point.

[0142] As used herein, the “shelf life" of a spray dried composition refers to the period of time over which the spray dried composition can be stored and still retain a desired level of efficacy for its intended purpose, e.g., retention of the viability of the microbes contained in the spray dried composition. In some embodiments, the shelf life is the period of time over which a spray dried composition can be stored at room temperature and experience less than log loss CFU / mL of 1. In some embodiments, the shelflife is the period of time over which a spray dried composition can be stored at room temperature and experience less than log loss CFU / mL of 0.5-2. In some embodiments, the shelflife is the period of time over which a spray- dried composition can be stored and experience less than about 50% loss of cell density in CFU / mL. In some embodiments, the shelf life is the period of time over which a spray dried composition can be stored and experience less than 90% loss of cell density in CFU / mL. In some embodiments, the shelflife is measured at room temperature. In some embodiments, the shelf life is measured at 4°C. In some embodiments, the temperature varies over the course of the period of storage over which shelflife is measured.Additives

[0143] Tn addition to comprising microbes, such as nitrogen fixing bacteria, the spray dried composition comprises at least a bulking agent, a desiccation protectant, an antioxidant, and a coating agent.

[0144] The bulking agent can be any suitable compound that acts as a matrix former and can prevent aggregation of the components of the composition. In some embodiments, the bulking agent can comprise a sugar, such as a low molecular weight mono- or disaccharide, a sugar alcohol, or a higher molecular weight polysaccharide. In some embodiments, the bulking agent comprises a monosaccharide, a disaccharide, an oligosaccharide, a polysaccharide, or any combination thereof. Examples of a suitable monosaccharide include, e.g., fructose, glucose (dextrose), galactose, and any combination thereof Examples of a suitable disaccharide include, e.g., trehalose, sucrose, lactose, maltose, isomaltose, and any combination thereof. Examples of a suitable oligosaccharide include, e.g., raffinose, a fructooligosaccharide, a galactooligosaccharide, a xylooligosaccharide, verbascose, and any combination thereof.Attorney Docket No. PIV-00054 WOExamples of a suitable polysaccharide include, e.g., a dextrin, a cellulose, a starch, a gum, and any combination thereof. Examples of a suitable dextrin include, e.g,, maltodextrin, a cyclodextrin (e.g., a, 0, and / or y), and any combination thereof. Examples of a suitable cellulose include, e.g., ethylcellulose, methylcellulose, hydroxypropyl cellulose, carboxymethyl cellulose, hydroxypropylmethylcellulose, and any combination thereof. Examples of a suitable starch include, e.g, cornstarch, sweet potato starch, potato starch, quinoa starch, crosslinked starch, cassava starch, debranched lentil starch, retrograded starch, tapioca starch, carboxymethyl starch, taro succiny lated starch, hi-maize resistant starch, inulin, and any combination thereof. Examples of a suitable gum include, e.g., gum acacia, agar, alginic acid, an alginate, carrageenan, gum ghatti, gum tragacanth, karaya gum, guar gum, locust bean bum, beta-glucan, dammar gum, glucomannan, tara gum, gellan gum, xanthangum, and any combination thereof.

[0145] In some embodiments, the bulking agent can be fructose, glucose, galactose, trehalose, sucrose, lactose, maltose, isomaltose. raffinose, a fructooligosaccharide, a galactooligosaccharide, a xylooligosaccharide, verbascose, maltodextrin, a cyclodextrin, ethylcellulose, methyl cellulose, hydroxypropyl cellulose, carboxymethyl cellulose, hydroxypropylmethylcellulose, inulin, gum acacia, agar, alginic acid, an alginate, carrageenan, gum ghatti, gum tragacanth, karaya gum. guar gum, locust bean bum, beta-glucan, dammar gum, glucomannan, tara gum, gellan gum. xanthan gum, or any combination thereof. In some embodiments, the bulking agent can be a polysaccharide. In some embodiments, the bulking agent can be a dextrin, such as maltodextrin.

[0146] In some embodiments, the concentration of the bulking agent in a liquid composition prior to spray dry ing is in the range from about 10 wt% to about 30 wt%. In some embodiments, the concentration of the bulking agent in a liquid composition prior to spray drying can be in the range from about 10 wt% to about 28 wt%, about 10 wt% to about 25 wt%, about 10 wt% to about 22 wt%, about 10 wt% to about 20 xvt%, about 10 wt% to about 18 wt%, about 10 wt% to about 15 wt%, about 10 wt% to about 12 wt%, about 12 wt% to about 30 wt%, about 12 wt% to about 28 wt%, about 12 wt% to about 25 wt%, about 12 wt% to about 22 wt%, about 12 wt% to about 20 wt%. about 12 wt% to about 18 wt%, about 12 w 1% to about 15 wl%, about 15 wt% to about 30 wt%, about 15 wt% to about 28 wt%, about 15 wt% to about 25 wt%, about 15 wt% to about 22 wt%, about 15 wt% to about 20 wt%, about 15 wt% to about 18 wt%, about 18 wt% to about 30 wt%, about 18 wt% to about 28 wt? >, about 18 wt% to about 25 wt%, about 18 wt% to about 22 wt%. about 18 wt% to about 20 wt%, about 20 wt% to about 30 wt%, aboutAttorney Docket No. PIV-00054 WO20 wt% to about 28 wt%, about 20 wt% to about 25 wt%, about 20 wt% to about 22 wt%, about 22 wt% to about 30 wt%, about 22 wt% to about 28 wt%, about 22 wt% to about 25 wt%, about 25 wt% to about 30 wt%, about 25 wt% to about 28 wt%, about 28 wt% to about 30 \u.. about 10 wt%, about 11 wt%, about 12 wt%, about 13 wt%, about 14 wt%, about 15 wt%. about 16 wt%. about 17 wt%, about 18 wi%, about 19 wt%, about 20 wt%, about 21 wt%, about 22 wt%, about 23 wt%, about 24 wt%, about 25 wt%, about 26 wt%, about 27 wt%, about 28 wt%, about 29 wt%, or about 30 wt%.

[0147] The desiccation protectant can be any suitable compound that protects the composition from water loss. In some embodiments, the desiccation protectant can comprise a saccharide, a sugar alcohol, a metal oxide, a clay, and any combination thereof. In some embodiments, the desiccation protectant can comprise a saccharide, a sugar alcohol, a metal oxide, and any combination thereof. Examples of a suitable saccharide as the desiccation protectant include, e.g., fructose, glucose, galactose, trehalose, sucrose, lactose, maltose, isomaltose, raffinose, or any combination thereof. Examples of a suitable sugar alcohol include, e.g.. sorbitol, mannitol, maltitol, erythritol, lactitol, isomalt, and any combination thereof. Examples of a suitable metal oxide include, e g., alumina, silica, aluminum silicate, zirconia, titania, and any combination thereof. Examples of a suitable clay include, e.g., bentonite, vermicullite, kaolinite, illite, and any combination thereof. In some embodiments, the desiccation protectant can comprise fructose, glucose, galactose, trehalose, sucrose, lactose, maltose, isomaltose, raffinose, xylitol, sorbitol, mannitol, maltitol, erythritol, lactitol, isomalt, bentonite, vermicullite, kaolinite, illite, or any combination thereof. In some embodiments, the desiccation protectant can comprise a saccharide. In some embodiments, the desiccation protectant can be trehalose. In some embodiments, the desiccation protectant is not a clay.[00148| in some embodiments, the concentration of the desiccation protectant in a liquid composition prior to spray drying is in the range from about 10 wt% to about 20 wt%. In some embodiments, the concentration of the desiccation protectant in a liquid composition prior to spray dry ing can be in the range from about 10 wt% to about 18 wt%, about 10 wt% to about 15 wt%, about 10 wt% to about 12 wt%, about 12 wt% to about 20 wt%, about 12 wt% to about 18 wt%, about 12 wt% to about 15 wt%, about 15 wt% to about 20 wt%. about 15 wt% to about 18 wt%, about 18 wt% to about 20 wt%, about 10 wt%, about 11 wt%, about 12 wt%, about 13 wt%, about 14 wt%, about 15 wt%, about 16 wt%, about 17 wt%, about 18 vvt%, about 19 wt%, or about 20 wt%.Attorney Docket No. PIV-00054 WO

[0149] In some embodiments, the bulking agent and desiccation protectant are different from each other. In some embodiments, the bulking agent and desiccation protectant are the same as each other.

[0150] The antioxidant can be any suitable compound that inhibits oxidation and / or improves the stability of the composition. In some embodiments, the antioxidant is a water soluble antioxidant. In some embodiments, the antioxidant comprises a vitamin, a carotenoid, tocofersolan, glutathione, an organic acid, an enzyme, a flavonoid, a phenol, a polyphenol, a phenolic acid, a stilbene, a tannin, a coumarin, lignan, or any combination thereof. Examples of a suitable vitamin include, e.g., ascorbic acid, a tocopherol, carotene, and any combination thereof. Examples of a suitable carotenoid include, e.g., lutein, zeaxanthin, canthaxanthin, astaxanthin, echinenone, fucoxanthin, p-cryptoxanthm. lycopene, and any combination thereof. Examples of a suitable organic acid include, e.g., citric acid, tartaric acid, uric acid, gallic acid, erythorbic acid, any salts thereof (e.g., a citrate, a gallate, a tartrate), and any combination thereof. Examples of a suitable enzyme include, e.g., superoxide dismutase, catalase, glutathione peroxidase, and any combination thereof. Examples of a suitable flavonoid include, e.g., a flavone (e.g., apigenin, luteolin, tangeretin, baicalein, rhoifolin), a flavonol (e.g., quercetin, kaempferol, myricetin, rutin, morin), a flavanone (e.g., hesperitin, naringin, naringenin. eriodictyol, hesperidin), a chalcone (e.g., phloretin, chalconaringenin. arbutin, phlioridzin), an anthocyanin (e.g., delphinidin, cyanidin. malvidin, peonidin), an isoflavone (e.g., genistein, genistin, daidzein, glycitein), and any combination thereof. Examples of a suitable phenol include, e.g., vanillin, salicylic acid, pyrocatechol, resorcinol, cresol, hydroquinone, eugenol, a capsaicinoid, and any combination thereof. Examples of a suitable polyphenol include, e.g., ellagic acid, catechin, epicatechin, gallocatechin. leukoanthocyanidin, curcumin. and any combination thereof. Examples of a suitable phenolic acid include, e.g., hydroxy benzoic acid, hydroxycinnamic acid, chlorogenic acid, ferulic acid, sinapic acid, protocatechuic acid, vanillic acid, syringic acid, gallic acid, caffeic acid, coumaric acid, and any combination thereof. Examples of a suitable stilbene include, e.g., resveratrol, piceatannol, and any combination thereof. Examples of a suitable tannin include, e.g., tannic acid, gallotannin, ellagitannin, and any combination thereof. Examples of a suitable lignan include, e.g., enterolactone, enterodiol, lariciresinol, matairesinol, sesamol, pinoresinol, secoisolariciresinol diglucoside, secoisolariciresinol, alpha conidendrin, nordihydroguaiaretic acid, and any combination thereof. Examples of a suitable coumarin include, e.g., coumarin.Attorney Docket No. PIV-00054 WOhydroxycoumarin, dihydroxycoumarin, hydroxy-methylcoumarin, phenylcoumarin, umbelliferone, and any combination thereof.

[0151] In some embodiments, the antioxidant comprises ascorbic acid, a tocopherol, carotene, lutein, zeaxanthin, canthaxanthin, astaxanthin, echinenone, fucoxanthin, -cryptoxanthin, lycopene, citric acid, tartaric acid, uric acid, a gallate, erythorbic acid, t-butylhydroquinone, butylated hydroxyanisole, butylated hydroxytoluene, a lecithin, superoxide dismutase. catalase, glutathione peroxidase, a flavone, a chalcone, a flavanone, a flavanol, an anthocyanin, an isoflavonoid, hydroxy benzoic acid, hydroxy cinnamic acid, chlorogenic acid, ferulic acid, sinapic acid, protocatechuic acid, vanillic acid, syringic acid, gallic acid, caffeic acid, coumaric acid, vanillin, salicylic acid, pyrocatechol, resorcinol, cresol, hydroquinone, eugenol, umbelliferone, a capsaicinoid, resveratrol, piceatannol, ellagic acid, tannic acid, gallotannin, ellagitannin, curcumin, catechin, epicatechin, gallocatechin, leukoanthocyanidin, enterolactone, enterodiol, lariciresinol, matairesinol, sesamol, pinoresinol, secoisolariciresinol diglucoside, secoisolariciresinol, alpha conidendrin, nordihydroguaiaretic acid, coumarin, hydroxy coumarin, dihydroxy coumarin, hydroxy-methylcoumarin, phenylcoumarin, any salt of the foregoing, or any combination thereof.

[0012] In some embodiments, the antioxidant can be a vitamin. In some embodiments, the antioxidant can comprise ascorbic acid or a salt thereof. In some embodiments, the antioxidant can be ascorbic acid.

[0153] Tn some embodiments, the concentration of the antioxidant in a liquid composition prior to spray drying is in the range from about 0.1 wt% to about 3 wt%. In some embodiments, the concentration of the antioxidant in a liquid composition prior to spray drying can be m the range from about 0 1 wt% to about 2.8 wt%. about 0.1 wt% to about 2.5 wt%, about 0.1 wt% to about 2.2 wt%, about 0.1 wt% to about 2 wt%, about 0.1 wt% to about 1.8 wt%, about 0.1 wt% to about 1.5 wt%, about 0.1 wt% to about 1.2 wt%, about 0.1 wt% to about 1 wt%, about 0.1 wt% to about 0.8 wt%. about 0.1 wt% to about 0.5 v. i%. about 0.1 wt% to about 0.2 wt%, about 0.2 to about 3 wt%, about 0.2 wt% to about 2.8 wt%, about 0.2 wt% to about 2.5 wt%, about 0.2 wt% to about 2.2 wt%. about 0.2 wt% to about 2 wt%, about 0.2 wt% to about 1.8 wt%, about 0.2 wt% to about 1.5 wt%, about 0.2 wt% to about 1.2 wt%, about 0.2 vvt% to about 1 wt%. about 0.2 w t% to about 0.8 wt%. about 0.2 wt% to about 0.5 wt%. about 0.5 t% to about 3 wt%, about 0.5 wt% to about 2.8 wt%, about 0.5 wt% to about 2.5 wt%, about 0.5 wt% to about 2.2 wt%, about 0.5 wt% to about 2 wt%, about 0.5 wt% to about 1.8 wt%, aboutAttorney Docket No. PIV-00054 WO0.5 wt% to about 1.5 wt%, about 0.5 wt% to about 1.2 wt%, about 0.5 wt% to about 1about 0.5 wt% to about 0.8 wt%, about 0.8 wt% to about 3 wt%, about 0,8to about 2.8 wt%, about 0.8 wt% to about 2.5 wt%, about 0.8 wt° / o to about 2.2 wt%, about 0.8 wt% to about 2 vvt%. about 0.8 wt% to about 1.8 wt%, about 0.8 wt% to about 1.5 wt%, about 0.8 wt% to about 1 2 about. 0.8 wt% to about 1 wt%, about 1 wt% to about 3 wt.%, about. I wt% to about 2.8 wt%, about 1 wt% to about 2.5 wt%, about 1 wt% to about 2.2 wt%, about 1 wt% to about 2 wt%, about 1 wt% to about 1.8 wt%, about 1 wt% to about 1.5 wt%, about 1 wt% to about 1.2 wt%, about 1.2 wt% to about 3 wt%. about 1.2 wt% to about 2.8 wt%. about 1.2 wt% to about 2.5 wt%, about 1.2 wt% to about 2.2 wt%, about 1.2 wt% to about 2 wt%, about 1.2 wt% to about 1.8 wt%, about 1.2 wt% to about 1.5 wt%. about 1.5 wt% to about 3 wt%, about 1.5 wt% to about 2.8 vvt%, about 1.5 wt% to about 2.5 wt%, about 1.5 wt% to about 2.2 wt%, about 1.5 wl% to about 2 wt%, about 1.5 wt% to about 1.8 wt%, about 2 wt% to about 3 wt%, about 2 wt% to about 2.8 wt%, about 2 wt% to about 2.5 wt%. about 2 wt% to about 2.2 wt%. about 2.2 wt% to about 3 wt%, about 22 wt% to about 2.8 wt%, about 2.2 wt% to about 25 wt%, about 2.5 wt% to about 3 wt%, about 2.5 wt% to about 2.8 wt%, about 2,8 wt% to about 3 wt%, about 0.1 wt%, about 0.2 wt%, about 0.3 wt%, about 0.4 wt%, about 0.5 wt%, about 0.6 vvt%. about 0.7 wt%, about 0.8 wt%, about 0.9 wt%, about i wt%, about l.l wt%, about 1.2 wt%, about 1.3 wt%, about 1.4 wt%, about 1.5 wt%, about 1.6 wt%, about 1.7 wt%, about 1.8 wt%, about 1.9 wt%, about 2 wt%, about 2.1 wt%, about 2.2 wt%, about 2.3 wt%, about 2.4 wt%, about 2.5 wt%, about 2.6 wt%, about 2.7 wt%, about 2.8 wt%, about 2.9 wt%, or about 3 wt%.

[0154] In some embodiments, the bulking agent comprises a dextrin, and the desiccation protectant comprises a saccharide. In some embodiments, the bulking agent comprises maltodextrin, and the desiccation protectant comprises trehalose.

[0155] In some embodiments, the bulking agent comprises a dextrin, and the antioxidant comprises a vitamin. In some embodiments, the bulking agent comprises maltodextrin, and the antioxidant comprises ascorbic acid.

[0156] In some embodiments, the desiccation protectant comprises a saccharide, and the antioxidant comprises a vitamin. In some embodiments, the desiccation protectant comprises trehalose, and the antioxidant comprises ascorbic acid.

[0157] In some embodiments, the bulking agent comprises a dextrin, the desiccation protectant comprises a saccharide, and the antioxidant comprises a vitamin. In someAttorney Docket No. PIV-00054 WOembodiments, the bulking agent comprises maltodextrin, the desiccation protectant comprises trehalose, and the antioxidant comprises ascorbic acid.

[0158] In some embodiments, the spray dried composition can further comprise a coating agent, which can act as a shell former. As such, in some embodiments, the spray dried composition comprises microbes (e.g., a nitrogen fixing bacteria), a bulking agent, a desiccation protectant, an antioxidant, and a coating agent. The coating agent can be any suitable compound that can coat particles or granules of tire spray dried composition to encapsulate the composition. In some embodiments, the spray dried composition is in the form of spray dried particles comprising a shell formed from the coating agent.

[0159] In some embodiments, the coating agent comprises a polymer, such as a biopolymer. Examples of a suitable biopolymer include, e.g., a protein, a gum, a starch, a pectin, a cellulose, a clay, glycine betaine, or any combination thereof. In some embodiments, the protein can comprise at least one animal source protein, at least one plant protein, or a combination thereof. In some embodiments, the protein can comprise at least one animal source protein. In some embodiments, the protein can comprise at least one plant protein. Examples of a suitable protein include, e.g,. whey protein, casein, a milk product, keratin, collagen, gelatin, surimi, albumin, mucoprotein, globulin, corn protein, soy protein, mung bean protein, chickpea protein, pea protein, grass pea protein, quinoa protein, bitter vetch, sunflower protein, hemp protein, pumpkin seed protein, nut protein, flaxseed protein, any salt of the foregoing, or any combination thereof.

[0160] In some embodiments, the protein comprises a milk protein. In some embodiments, the protein comprises whey protein, casein, a milk product, serum albumin, or any combination thereof. In some embodiments, the protein comprises whey protein.

[0161] Examples of a suitable cellulose for the coating agent include, e.g., ethylcellulose, methyl cellulose, hydroxypropyl cellulose, carboxymethyl cellulose, hydroxypropylmethylcellulose, and any combination thereof. Examples of a suitable starch for the coating agent include, e.g., cornstarch, sweet potato starch, potato starch, quinoa starch, crosslinked starch, cassava starch, debranched lentil starch, retrograded starch, tapioca starch, carboxymethyl starch, taro succinylated starch, hi-raaize resistant starch, inulin, and any combination thereof. Examples of a suitable gum for the coating agent include, e.g., gum acacia, agar, alginic acid, an alginate, carrageenan, gum ghatti, gum tragacanth, karaya gum,Attorney Docket No. PIV-00054 WOguar, high methoxyl pectin, low methoxyl pectin, bentonite, vermicullite, kaolinite, illite, glycine betaine, and any combination thereof.

[0162] In some embodiments, the coating agent comprises ethyl cellulose, methylcellulose, hydroxypropyl cellulose, carboxymethyl cellulose, hydroxypropylmethylcellulose, cornstarch, sweet potato starch, potato starch, quinoa starch, crosslinked starch, cassava starch, debranched lentil starch, retrograded starch, tapioca starch, carboxymethyl starch, taro succinylated starch, hi-maize resistant starch, inulin, gum acacia, agar, alginic acid, an alginate, carrageenan, gum ghatti, gum tragacanth, kara a gum, guar, high methoxyl pectin, low methoxyl pectin, bentonite, vermicullite, kaolinite, illite, glycine betaine, or any combination thereof.

[0163] In some embodiments, the concentration of the coating agent in a liquid composition prior to spray drying is in the range from about 2 wt% to about 10 wt%. In some embodiments, the concentration of the coating agent in a liquid composition prior to spray drying can be in the range from about 2 wt% to about 9 wt%, about 2 wt% to about 8 wt%, about 2 wt% to about 7 wt%, about 2 v % to about 6 wt%, about 2 wt% to about 5 wt%, about 2 wt% to about 4 wl%, about 2 wt% to about 3 wt%, about 3 wt% to about 10 wt%, about 3 wt% to about 9 wt%, about 3 w t% to about 8 wt%, about 3 wt% to about 7 wt%, about 3 wt% to about 6 wt%, about 3 wt% to about 5 wt%. about 3 wt% to about 4 wt%, about 4 wt% to about 10 wt%, about 4 wt% to about 9 wt%, about 4 wt% to about 8 wt%, about 4 wt% to about 7 wt%, about 4 wt% to about 6 wt%, about 4 wt% to about 5 wt%. about 5 wt% to about 10 wt%, about 5 wt% to about 9 wt%. about 5 wt% to about 8 wt%, about 5 wt% to about 7 wt%, about 5 wt% to about 6 wt%, about 6 wt% to about 10 wt%, about 6 wt% to about 9 wt%, about 6 v % to about 8 wt%, about 6 wt% to about 7 wt%, about 7 wt% to about 10 wt%, about 7 wt% to about 9about 7 wt% to about 8 vvt%, about 8 wt% to about 10 wt%, about 8 wt% to about 9 wt%, about 9 wt% to about 10 wt%, about 2 wt%, about 3 wt%, about 4 wt%, about 5 wt%, about 6 wt%, about 7 w t%. about 8 wt%, about 9 wl%, or about 10 wt%.

[0164] In some embodiments, the bulking agent and coating agent are different from each other. In some embodiments, the bulking agent and coating agent are the same as each other.

[0165] In some embodiments, the spray dried composition does not comprise an alginate. In some embodiments, the spray dried composition is not a cross-linked alginate microcapsule (CLAM) composition.

[0166] In some embodiments, the spray dried composition does not comprise a protein hydrolysate.Attorney Docket No. PIV-00054 WO

[0167] In some embodiments, a liquid composition is formed prior to spray drying, which contains a liquid solvent, typically water, microbes (e.g., nitrogen fixing bacteria), a bulking agent, a desiccation protectant, an antioxidant, and a coating agent. The liquid composition prior to spray drying can have any suitable total solids content but, in general, can have a total solids content of about 10 to about 60%. For example, the total solids content of the liquid composition can be about 10 to about 55%, about 10 to about 50%, about 10 to about 45%, about 10 to about 40%, about 10 to about 35%, about 10 to about 35%, about 10 to about 30%, about 10 to about 25%, about 10 to about 20%, about 10 to about 15%, about 15 to about 60%, about 15 to about 55%, about 15 to about 50%, about 15 to about 45%, about 15 to about 40%, about 15 to about 35%, about 15 to about 30%, about 15 to about 25%, about 15 to about 20%, about 20 to about 60%, about 20 to about 55%, about 20 to about 50%, about 20 to about 45%, about 20 to about 40%. about 20 to about 35%, about 20 to about 30%, about 20 to about 25%, about 25 to about 60%. about 25 to about 55%, about 25 to about 50%, about 25 to about 45%. about 25 to about 40%, about 25 to about 35%, about 25 to about 30%, about 30 to about 60%, about 30 to about 55%, about 30 to about 50%, about 30 to about 45%, about 30 to about 40%, about 30 to about 35%. about 35 to about 60%, about 35 to about 55%, about 35 to about 50%, about 35 to about 45%, about 35 to about 40%, about 40 to about 60%, about 40 to about 55%, about 40 to about 50%, about 40 to about 45%, about 45 to about 60%, about 45 to about 55%, about 45 to about 50%, about 50 to about 60%, about 50 to about 55%, or about 55 to about 60%. In some embodiments, the total solids content of the liquid composition can be about 25 to about 55 wt%. about 30 to about 50%, or about 35 to about 45%.

[0168] Once formed into particles or granules, the spray dried composition typically has a low water content, as measured by the water activity (aw). In some embodiments, the spray dried composition has a water activity (aw) of about 0.1 to about 0.4. For example, the water activity (aw) can be about 0.1 to 0.38, about 0.1 to about 0.35, about 0,1 to about 0.32, about 0.1 to about 0.3, about 0.1 to about 0.28, about 0.1 to about 0.25, about 0.1 to about 0.22, about 0.1 to about 0.2, about 0.1 to 0.18, about 0.1 to about 0.15, about 0.1 to about 0.12, about 0.15 to about 0.4, about 0.15 to 0.38, about 0.15 to about 0.35, about 0.15 to about 0.32, about 0.15 to about 0.3, about 0.15 to about 0.28, about 0.15 to about 0.25, about 0.15 to about 0.22, about 0.15 to about 0.2, about 0.15 to 0.18, about 0.18 to about 0.4, about 0.18 to 0.38, about 0.18 to about 0.35. about 0.18 to about 0.32, about 0.18 to about 0.3, about 0.18 to about 0.28, about 0.18 to about 0.25, about 0.18 to about 0.22, about 0.18 to about 0.2, about 0.2 to about 0.4, about 0.2 to 0.38, about 0.2 to about 0.35, about 0.2 to about 0.32, about 0.2 to about 0.3, aboutAttorney Docket No. PIV-00054 WO0.2 to about 0.28, about 0.2 to about 0.25, about 02 to about 0.22, about 0.25 to about 0.4, about 0.25 to 0.38, about 0.25 to about 0,35, about 0.25 to about 0.32, about 0.25 to about 0.3, about 0.25 to about 0.28, about 0.3 to about 0.4, about 0.3 to 0.38, about 0.3 to about 0.35, about 0.3 to about 0.32, 0.35 to about 0.4, about 0.35 to 0.38, about 0.1, about 0.11, about 0.12, about 0.13, about 0.14, about 0.15, about 0.16, about 0.17, about 0.18, about 0.19, about 0.2, about 0.21, about 0.22, about 0.23, about 0.24, about 0.25, about 0.26, about 0.27, about 0.28, about 0.29, about 0.3, about 0.31, about 0.32, about 0.33, about 0.34, about 0.35, about 0.36, about 0.37, about 0.38, about 0.39, or about 0.4. In some embodiments, the spray dried composition has a water activity (aw) of about 0.1 to about 0.35, about 0.1 to about 0.3, or about 0.15 to about 0.3. In some embodiments, the spray dried composition has a water activity (aw) of about 0.4 or less or about 0.3 or less. In some embodiments, the water activity (aw) is at least 0.05 (e.g., about 0.05 to about 0.4, about 0.05 to about 0.3, or about 0.05 to about 0.2).

[0169] In some embodiments, the spray dried composition has a low water content, as measured by the moisture content. In some embodiments, the spray dried composition has a moisture content of about 1 wt% to about 6.5 wt%. For example, the spray dried composition can have a moisture content of about 1-6 wt%, about 1-5.5 wt%, about 1-5 wt%, about 1 -4.5 wt%, about 1-4 wt%, about 1-3.5 wt%, about 1-3 wt%, about 1-2.5 wt%, about 1-2 wt%, about 1-1.5 wt%, about 1.5-6.5 wt%, about 1.5-6 wt%, about 1.5-5.5 wt%, about 1.5-5 wt%, about 1.5-4.5 wt%. about 1.5-4 wt%, about 1.5-3.5 wt%, about 1.5-3 wt%, about 1.5-2.5 wt%, about 1.5-2 wt%, about 2-6.5 wt%, about 2-6 wt%, about 2-5.5 wt%, about 2-5 wt%, about 2-4.5 wt%, about 2-4 wt%, about 2-3.5 wt%, about 2-3 wt%, about 2-2.5 wt%, about 2.5-6.5 wt%, about 2.5-6 wt%, about 2.5-5.5 wt%, about 2.5-5 wt%, about 2.5-4, 5 wt%, about 2.5-4 wt%, about 2.5-3.5 wt%, about 2.5-3 wt%, about 3-6.5 wt%, about 3-6 wt%, about 3-5.5 wt%, about 3-5 wt%, about 3-4.5 wt%. about 3-4 wt%, about 3-3.5 wt%, about 3.5-6.5 wt%, about 3.5-6 wt%, about 3.5-5.5 wt%, about 3.5-5 wt%, about 3.5-4.5 wt%, about 3.5-4 wt%, about 4-6.5 wt%, about 4-6 wt%, about 4-5.5 wt%, about 4-5 wt%, about 4-4.5 wt%, about 4.5-6 wt%, about 4.5-5.5 wt%, about 4.5-5 wt%, about 4.5-4.5 wt%, about 5-6.5 wt%, about 5-6 wt%, about 5-5.5 wt%, about 5.5-6.5 wt%, about 5.5-6 wt%, or about 6-6.5 wt%. In some embodiments, the spray dried composition has a moisture content of about 6.5 wt% or less, about 6 wt% or less, about 5.5 wt% or less, about 5 wt% or less, about 4.5 wt% or less, about 4 wt% or less, about 3.5 wt%, about 3 wt% or less, about 2.5 wt% or less, about 2 wt% or less, about 1,5 wt% or less, or about 1 wt% or less. In some embodiments, the spray dried composition has a moisture content of about 2 wt% to about 6 wt%.Attorney Docket No. PIV-00054 WO

[0170] In some embodiments, the spray dried composition has a water activity (aw) of about 0.1 to about 0.4 and a moisture content of about 1 wt% io about 6.5 wt%. In some embodiments, the spray dried composition has a water activity (aw) of about 0.15 to about 0.3 and a moisture content of about 2 wt% to about 6 wt%.

[0171] In some embodiments, one or more of the additives (e.g., bulking agent, desiccation protectant, antioxidant, and / or coating agent) in the spray dried composition act to stabilize the microorganism population within the composition In some embodiments, one or more of the additives decreases or slows the decay rate of the microbial population. In some embodiments, the spray dried composition accomplishes this change in the decay rate by maintaining the microorganisms in a semi-dormant state. In a semi-dormant state, microorganisms do not respond to environmental conditions as rapidly as they would in an active state.

[0172] In some embodiments, the one or more additives (e.g., bulking agent, desiccation protectant, antioxidant, and / or coating agent) improves the microbial survival rate, decreases microbial decay, improves microbial metabolic activity, improves microbial catabolic gene expression, improves the microbial colonization rate, and / or decreases toxin accumulation within the spray dried composition after storage (e.g., after 1 week storage, after 2 weeks storage, after 3 weeks storage, after 4 weeks storage, after 5 weeks storage, after 6 weeks storage, after 7 weeks storage, after 8 weeks storage, after 9 weeks storage, after 10 weeks storage, after 11 weeks storage, or after 12 weeks storage) compared to a composition without the combination of bulking agent, desiccation protectant, antioxidant, and a coating agent. In some embodiments, the improved stability of the spray dried composition is relative to a comparable freeze dried composition.

[0173] In some embodiments, the spray dried composition increases the survival rate of microbial cells after storage of the composition, e g., after 1, 2, 3, 4, 5, or 6 weeks or after 1, 2, 3, 4, 5, or 6 months of storage. In some embodiments, the log reduction (e.g., log loss) of CFU / mL of microbes (e.g., bacteria) after the storage period is less than 1 relative to the initial concentration of microbes (e.g., nitrogen fixing bacteria). In some embodiments, the log loss is less than about 1 (e.g., about 0.9 or less, about 0.8 or less, about 0.7 or less, about 0.6 or less, about 0.5 or less, about 0.4 or less, about 0.3 or less, or about 0.2 or less) after the storage period relative to the initial concentration of microbes (e.g., nitrogen fixing bacteria)

[0174] In some embodiments, the spray dried composition has an in-package stability of at least 5 weeks (e.g.. at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at leastAttorney Docket No. PIV-00054 WO10 weeks, at least 11 weeks, or at least 12 weeks) at about room temperature (e.g., about 21 °C) as determined by a log reduction of about 0.5 or less (e.g., about 0.4 or less, about 0.3 or less, or about 0.2 or less) in the concentration of the microbes (e.g., nitrogen fixing bacteria) relative to the initial concentration.

[0175] In some embodiments, the spray dried composition has an in-package stability of at least about 2 months (e.g., about 3 months or more, about 4 months or more, about 5 months or more, about 6 months or more, about 7 months or more, about 8 months or more, about 9 months or more, about 10 months or more, about 11 months or more, or about 12 months or more) at about 4 °C as determined by a log reduction of about 0.5 or less in the concentration of the microbes (e.g., nitrogen fixing bacteria). In some embodiments, the composition has an in-package stability of at least 10 months at about 4 °C as determined by a log reduction of about 0.5 or less (e.g., about 0.4 or less, about 0.3 or less, or about 0.2 or less) in the concentration of the microbes (e.g., nitrogen fixing bacteria) relative to the initial concentration.

[0176] In some embodiments, a concentration of the microbes (e.g., nitrogen fixing bacteria) has a log reduction of 2 or less (e.g., about 1.9 or less, about 1.8 or less, about 1.7 or less, about 1.6 or less, about 1.5 or less, about 1.4 or less, about 1.3 or less, about 1.2 or less, about 1.1 or less, about 1 or less, about 0.9 or less, about 0.8 or less, about 0.7 or less, about 0,6 or less, about 0.5 or less, about 0.4 or less, about 0.3 or less, or about 0.2 or less) in the spray dried composition relative to the initial concentration of the microbes (e.g.. nitrogen fixing bacteria).

[0177] To provide anon-limiting illustrative example of a calculation to identify an acceptable rate of decay, suppose the initial cell density is 1 E10 CFU / mL: the acceptable threshold for cell density for the purposes of application to agricultural plant tissues or the environs thereof is 1E9 CFU / mL; and the target shelflife is at least three months. Then an acceptable rate of decay would be one that resulted in a composition having the cell density of 1E9 CFU / mL at the three month time point. Assuming that decay is approximately linear for the log of the cell density', this would be a decay rate that was less than or equal to the decay rate r that satisfied the equation log10Tf= log10Ti− r × t, where Tfis the final cell density threshold in CFU / mL at the target shelf-life time point. Tiis the initial cell density in CFU / mL, r is the decay rate in log10loss of CFU / mL per day. and t is the number of days at the target shelf-life time point. For this example, that would translate to: log101E9 = log101E10 − r × 90, which is satisfied when r is 1 / 90 ≈ 0.011 log10loss of CFU / mL per day.Attorney Docket No. PIV-00054 WO

[0178] The present disclosure further provides a method of forming a spray dried composition comprising: contacting a liquid composition with a heated gas, wherein the liquid composition comprises water, microbes (e.g., nitrogen fixing bacteria), a bulking agent, a desiccation protectant, an antioxidant, and a coating agent; introducing the liquid composition into a chamber through a nozzle; and drying the liquid composition in the chamber to provide a spray dried composition. In some embodiments, the method further comprises collecting the spray dried composition. For example, the spray dried powder can be separated from the extracted water, carried to a separator (e.g., a cyclone separator) and collected in a container (e.g., a collection container).

[0179] It was discovered that such method can provide a spray dried composition comprising microbes (e.g., nitrogen fixing bacteria) with improved cell viability and / or shelflife. In some embodiments, such improvement is relative to a comparable freeze dried composition or a spray dried composition that does not include one or more of the bulking agent, desiccation protectant, antioxidant, and coating agent. In some embodiments, the improvement in cell viability and / or shelf life is relative to a spray dried composition that does not include the bulking agent, desiccation protectant, and antioxidant. In some embodiments, the improvement in cell viability and / or shelflife is relative to a spray dried composition that does not include the bulking agent, desiccation protectant, antioxidant, and coating agent. Moreover, it was discovered that spray drying a microbial composition offers at least one benefit over a freeze drying process, such as a high throughput production, a more economical process, particle size control, and / or improved solubility.

[0180] In some embodiments, the liquid composition is a slurry. In some embodiments, the liquid composition is an emulsion or dispersion.

[0181] The liquid composition can have any suitable density, such as about 1 to about 1.5 g / mL.

[0182] In general, the liquid composition will have a suitable viscosity to pass through the nozzle (e.g., atomizer). For example, the liquid composition can have a viscosity' of about 500 to about 16,000 cP (e.g.. about 500 to about 10.000 cP, about 1000 to about 10,000 cP, about 1000 to about 4000 cP) In some embodiments, the liquid composition is atomized when passing through the nozzle. In some embodiments, the nozzle is a single fluid nozzle (e.g., a pressure swirl single fluid nozzle, a single cone single fluid, a compound nozzle), a two fluid nozzle (e.g., external mix two fluid nozzle, internal mix two fluid nozzle), a rotary atomizer,Attorney Docket No. PIV-00054 WOor an ultrasonic atomizer. In some embodiments, the nozzle is a rotary atomizer. In some embodiments, the droplet size of the atomized liquid composition can range from about 10 pm to about 500 pm (e.g., about 50 urn to about 200 pm) in diameter.

[0183] The nozzle can be set to provide any suitable pressure (Q flow) for the atomization spray gas flow. For example, the nozzle pressure can be 25 mm to about 45 mm (e g., 25 mm, 30 mm. 35 mm. 40 mm. 45 mm. etc,). In some embodiments, the nozzle pressure can be 45 mm In addition, the aspirator rate can range from 70% to 100% (28 m’ / hr to 38 m’ / hr). in some embodiments, the aspirator is 100%.

[0184] In some embodiments, an inlet temperature of the heated gas can be about 130 to about 170 °C. For example, the inlet temperature can be about 130 to about 165 °C, about 130 to about 160 °C, about 130 to about 155 °C, about 130 to about 150 °C, about 130 to about 145 °C, about 130 to about 140 °C, about 130 to about 135 °C, about 135 to about 170 °C, about 135 to about 165 °C, about 135 to about 160 °C, about 135 to about 155 °C. about 135 to about 150 °C, about 135 to about 145 °C, about 135 to about 140 °C, about 140 to about 170 °C, about 140 to about 165 °C, about 140 to about 160 °C, about 140 to about 155 °C, about 140 to about 150 °C, about 140 to about 145 °C, about 145 to about 170 °C, about 145 to about 165 °C, about 145 to about 160 °C, about 145 to about 155 °C, about 145 to about 150 °C, about 150 to about 170 °C, about 150 to about 165 °C, about 150 to about 160 °C, about 150 to about 155 °C, about 155 to about 170 °C, about 155 to about 165 °C, about 155 to about 160 °C, about 160 to about 170 °C, about 160 to about 165 °C, or about 165 to about 170 °C. In some embodiments, an inlet temperature of the heated gas is about 130 °C. In some embodiments, the inlet temperature is about 140 to about 160 °C, about 145 to about 155 °C, or about 150 °C. In some embodiments, the outlet temperature of the chamber is about 45 to about 85 °C. For example, the outlet temperature can be about 45 to about 80 °C, about 45 to about 75 °C, about 45 to about 70 °C, about 45 to about 65 °C, about 45 to about 60 °C, about 45 to about 55 °C, about 45 to about 50 °C. about 50 to about 80 °C. about 50 to about 75 °C, about 50 to about 70 °C, about 50 to about 65 °C, about 50 to about 60 °C, about 50 to about 55 °C, about 55 to about 85 °C, 55 to about 80 °C, about 55 to about 75 °C, about 55 to about 70 °C, about 55 to about 65 °C, about 55 to about 60 °C, about 60 to about 85 °C, 60 to about 80 °C, about 60 to about 75 °C, about 60 to about 70 °C, about 60 to about 65 °C, about 65 to about 85 °C, 65 to about 80 °C, about 65 to about 75 °C, about 65 to about 70 °C, about 70 to about 85 °C, 70 toAttorney Docket No. PIV-00054 WOabout 80 °C, about 70 to about 75 °C, about 75 to about 85 °C, or 75 to about 80 °C. In some embodiments, the outlet temperature of the chamber is about 45 to about 55 °C or about 50 °C.

[0185] Once the liquid composition has been introduced into the chamber, the residence time can be any time period suitable to sufficiently dry the composition. For example, the residence time of the liquid composition in the chamber can be about 30 min or less, about 15 min or less, about 10 min or less, about 5 mm or less, about 4 min or less, about 3 min or less, about 2 min or less, or about 1 min or less. In some embodiments, the residence time of the liquid composition in the chamber can be about 5 min or less.

[0186] The spray dried composition is formed as particles. The average particle size typically can be adjusted by adjusting one or more parameters of the spray drying system. In some embodiments, the spray dried composition comprises particles with an average particle size (D v(50) or D50) of about 5 to about 100 pm. For example, the average particle size (Dv(50) or D50) can be about 5 to about 90 pm, about 5 to about 80 pm, about 5 to about 70 pm, about 5 to about 60 pm, about 5 to about 50 pm, about 5 to about 40 pm, about 5 to about 30 pm, about 5 to about 20 pm, about 5 to about 10 pm, about 10 to about 100 pm, about 10 to about 90 pm, about 10 to about 80 pm. about 10 to about 70 pm, about 10 to about 60 pm, about 10 to about 50 pm, about 10 to about 40 pm, about 10 to about 30 pm, about 10 to about 20 pm, about 20 to about 100 pm, about 20 to about 90 pm, about 20 to about 80 pm, about 20 to about 70 pm, about 20 to about 60 pm, about 20 to about 50 pm, about 20 to about 40 pm. about 20 to about 30 pm. about 30 to about 100 pm, about 30 to about 90 pm, about 30 to about 80 pm, about 30 to about 70 pm, about 30 to about 60 pm, about 30 to about 50 pm, about 30 to about 40 pm, about 40 to about 100 pm, about 40 to about 90 pm, about 40 to about 80 pm, about 40 to about 70 pm, about 40 to about 60 pm, about 40 to about 50 pm. about 50 to about 100 pm, about 50 to about 90 pm, about 50 to about 80 pm, about 50 to about 70 pm, about 50 to about 60 pm, about 60 to about 100 pm, about 60 to about 90 pm, about 60 to about 80 pm, about 60 to about 70 pm, about 70 to about 100 pm, about 70 to about 90 pm, about 70 to about 80 pm, about 80 to about 100 pm, about 80 to about 90 pm. or about 90 to about 100 pm. In some embodiments, the spray dried composition comprises particles with an average particle size (Dv(50) or D50) of about 10 to about 50 pm or about 10 to about 30 pm.

[0187] In a generalized example of preparing a spray dried composition, the process begins with making a slurry of ingredients. The ingredients comprise a liquid solvent, such as water, a bulking agent, a desiccation protectant, an antioxidant, and a composition comprising microbes (e g., nitrogen fixing bacteria), such as a high cell density culture liquid comprisingAttorney Docket No. PIV-00054 WOmicrobes (e.g., nitrogen fixing bacteria). The ingredients are either first combined to form a slurry (e.g., emulsion or dispersion) or are added separately to a solution tank, optionally with stirring. For conventional spray drying processes to be commercially viable, typical slurry viscosities should be in the range of about 10 to about 300 cP.

[0188] The slurry' formed in the solution tank is next delivered to an atomizer using a feed pump. The slurry enters the atomizer and leaves the atomizer as a spray of liquid droplets, and the droplets are introduced into a chamber (e.g., drying chamber). Concurrently, a feed of air (e.g., air or an inert gas, such as nitrogen or argon) is heated by a process heater and supplied mto the chamber by a blower. The water evaporated from the droplets enters the heated air as the atomized liquid droplets dry' to form solid particles after exposure to the incoming heated air. The dried powder leaves the chamber along with the water vapor laden air, and is carried to a particle separator (e.g., cyclone separator), which removes the dried particles from the circulating air stream and deposits the particles into a collection container. The water vapor laden air exits the collection container and enters a baghouse, where very fine particles are removed before the water vapor laden air is sent into a condenser, typically via a blower. The condenser removes the water vapor from the process air, and the collected w ater can be re-used or discarded.

[0189] The liquid composition can be fed to the chamber (e.g, drying chamber) using a pump at any suitable feed rate. For example, the feed rate can be about 0.5 to about 2 L / hr (e.g., about 0.5 to about 1.5 L / hr, about 0.5 to about 1 L / hr, about 0.75 to about 2 L / hr, about 0.75 to about 1.5 L / hr, about 0.75 to about 1 L / hr, about 1 to about 2 L / hr, about 1 to about 1.5 L / hr, about 1.25 to about 2 L / hr, about 1.25 to about 1,5 L / hr. about 1.5 to about 2 L / hr. about 1.75 to about 2 L / hr, about 0.5 L / hr, about 0.6 L / hr, about 0.7 L / hr, about 0.8 L / hr, about 0.9 L / hr, about 1 L / hr, about 1.1 L / hr, about 1.2 L / hr, about 1.3 L / hr, about 1.4 L / hr, about 1.5 L / hr, about 1.6 L / hr, about 1.7 L / hr, about 1.8 L / hr, about 1.9 L / hr. or about 2 L / hr). In some embodiments, the feed rate can be about 0.75 to about 1.25 L / hr or about 1 L / hr.

[0190] The pump can operate at any suitable speed, including about 20 to about 100 rpm (e.g., about 20 to about 80 rpm, about 20 to about 50 rpm, about 30 to about 100 rpm, about 30 to about 80 rpm, about 30 to about 50 rpm, about 20 rpm, about 25 rpm, about 30 rpm, about 35 rpm, about 40 rpm, about 45 rpm, about 50 rpm, about 55 rpm, about 60 rpm, about 65 rpm, about 70 rpm, about 75 rpm, about 80 rpm. about 85 rpm, about 90 rpm, about 95 rpm, or about 100 rpm.Attorney Docket No. PIV-00054 WO[00191 J The present disclosure provides a coating composition comprising water and the spray dried composition. In some embodiments, the coating composition can be applied to agricultural plant tissues, any plant part, or the environs thereof. In some embodiments, the coating composition can be applied in-furrow. In some embodiments, the coating composition further comprises a seed. In other words, the coating composition can be applied as a seed coat on a seed. In some embodiments, the coating composition can be applied to the roots of a plant. In some embodiments, the coating composition can be applied to the surface of a seedling, plant, plant part, or the environs thereof. In some embodiments, the coating composition can be applied as a layer above a surface of a seed, seedling, plant, plant part, or the environs thereof. In some embodiments, the coating composition can be applied to a seed, seedling, plant, plant part, or the environs thereof using any suitable method, such as spraying, immersing, dipping, rolling, shaking, immersing, flowing, misting, painting, brushing, washing, coating, sprinkling, and / or encapsulating the seed, seedling, plant, plant part, or the environs thereof with the coating composition (e.g., dispersion of live microbes). Non-limiting examples of plant tissues include a seed, seedling, leaf, cutting, plant, bulb, tuber, root, and rhizomes.

[0192] The coating composition can comprise any components discussed herein. For example, the coating composition can comprise water, a bacteria selected from Kosakonia, Klebsiella, and a combination of both Kosakonia and Klebsiella, maltodextrin, trehalose, ascorbic acid, and whey protein. In some embodiments, the coating composition can comprise water, Kosakonia or Klebsiella, maltodextrin, trehalose, ascorbic acid, and whey protein. In some embodiments, the coating composition can comprise water, a combination of both Kosakonia and Klebsiella, maltodextrin, trehalose, ascorbic acid, and whey protein.

[0193] In some embodiments, the coating composition can further comprise at least one (e.g., 1. 2. 3. 4. 5. etc.) additive. Suitable additives include, e.g.. polyol, a buffer, a prebiotic, and a polymer that is exogenous to the nitrogen fixing bacteria.

[0194] A polyol is any suitable compound comprising three or more hydroxy groups and typically is derived from a saccharide. Examples of a suitable polyol for the coating composition include, e.g., glycerol, triethylene glycol, sorbitol, mannitol, maltitol, galactitol, eiythritol, lactitol, isomalt, ribitol., arabitol, inositol, ononitol, pinitol. polyglycitol. and any combination thereof.Attorney Docket No. PIV-00054 WO

[0195] In some embodiments, the coating composition comprises a buffer Tn some embodiments, the buffer maintains the pH of the coating composition in a pH range of about 5 to about 9 (e.g., about 5 to about 8, about 5 to about 7, about 5 to about 6, about 6 to about 9, about 6 to about 8, about 6 to about 7, about 7 to about 9, or about 7 to about 8). In some embodiments, the buffer maintains the pH of the coating composition in a pH range of about 6 to about 8.

[0196] In some embodiments, the coating composition is buffered to the desired pH using a conventional buffer. Non-limiting examples of buffers include, e.g., sodium citrate, ascorbate, succinate, lactate, citric acid, boric acid, borax, hydrochloric acid, disodium hydrogen phosphate, acetic acid, formic acid, glycine, bicarbonate, phosphate, tartaric acid. Tns-glycine, Tris-NaCl, Tris-ethylenediamine tetraacetic acid (“EDTA”), Tris-borate, Tns-borate-EDTA, Tns-acteate-EDTA (‘" TAB’’), Tris-buffered saline, 4-(2 -hydroxyethyl)-] - piperazineethanesulfonic acid (“HEPES"’), 3-(N-morpholino) propanesulfonic acid (“MOPS”), piperazine- 1.4-bis(2-ethanesulfonic acid) (“PIPES”), 2-(N-morpholino)ethanesulfonic acid (“MES”), and phosphate buffered saline (“PBS”). Table 4 provides exemplary buffers as well as their pKa values and useful pH ranges.Table 4Common name and / or chemical name pKa at 25°C Useful pH range ACES (2-[(2-amino-2-oxoethyl)amino]ethane-l- 6.78 6.1-7.5sulfonic acid)Acetic acid (Ethanoic acid) 4.8 3.8-5.8ADA (2,2'-[(2-amino-2- 6.59 6.0-7.2oxoethy Dazanediy 1] di acetic aci d)AMP (2-methyl-2-amino- 1 -propanol) 9.7 9.0-10.5AMPD (2-amino-2-methyl-1,3-propanediol) 8.8 7.8-9.7AMPSO (N-(l,l-dimethyl-2-hydroxyethyl)-3- 9 8.3-9.7amino-2-hydroxypropanesulfonic acid)BES (2-(bis(2-hydroxyethyl)amino)ethane 7.09 6.4-7.8sulfonic acid)Bicine (2-(bis(2-hydroxyethyl)amino)acetic acid) 8.35 7.6-9.0Bis-Tris (p-nitrophenyl phosphate bis(tris) salt) 6.5 5.8-7.2Attorney Docket No. PIV-00054 WOBis-Tris Propane (2,2'-[propane-l,3- 6.8, 9.0 6.3-9.5 diylbis(azanediyl)]bis[2-(hydroxymethyl)propane- 1,3 -diol])Boric acid 9.24 8.25-10.25 CABS (4-(cyclohexylamino)- 1 -butanesulfonic 10.7 10.0-11.4acid)Cacodylate (dimethylarsenic acid) 6.27 5.0-7.4CAPS (3 -(cyclohexylamino)- 1 -propanesulfonic 10.4 9.7-11.1acid)CAP S 0 (3 -(cyclohexyl ammo)-2-hy droxy- 1 - 9.6 8.9-10.3 propanesulfonic acid)CHES (N-Cyclohexyl-2-aminoethanesulfonic 9.3 8.3-10.3acid)Citric acid (2-hydroxypropane-l,2,3-tricarboxylic 3.13, 4.76, 2.1-7.4acid) 6.40DIPSO (3-|N. N-bis(2-hy droxy ethylamino)-2- 7.6 7.0-8.2hydroxy-1 -propanesulfonic acid)EPPS (4-(2-hy droxy ethyl)- 1 - 8 7.3-8.7 piperazinepropanesulfonic acid)Gly-Gly (diglycine) 8.2 7.5-8.9HEPBS (N-(2-hydroxyethyl)piperazine-N'-(4- 8.3 7.6-9.0 butanesulfonic acid))HEPES (4-(2-hy droxy ethyl)-l - 7.48 2.5-3.5 or 6.8-S.2 piperazineethanesulfonic acid)HEPPSO (N-(hy droxy ethyl)piperazine-N'-2- 7.8 7.1-8.5 hydroxypropanesulfonic acid)KH2PO4 (monopotassium phosphate) 7.2 6.2-8.2MES (2-(N-niorpholino)ethanesulfonic acid) 6.15 5.5-6 7MOBS (4-(3-sulfonatopropyl)morpholin-4-ium) 7.6 6.9-8.3MOPS (3-(N-morpholino)propanesulfonic acid) 7.2 6.5-7.9MOPSO (2-hydroxy-3-(morpholin-4-yl)propane- 6.9 6.2-7.61 -sulfonic acid)Attorney Docket No. PIV-00054 WOPBS or high buffering capacity PBS (phosphate- 5.8-8 0buffered saline)PIPES (piperazme-N, N'-bis(2-ethanesulfonic 6.76 6.1-7.5acid))POPSO (piperazine-N, N'-bis(2- 7.8 7.2-8.5hy droxy propanes ulfoni c acid))TABS ( N -tii si In droxymethy l)methy 1-4- 8.9 8.2-9.6 aminobutanesulfonic acid)TAPS ( [ tris(hy droxymethyl)methylanuno] 8.43 7.7-9.1 propanesulfonic acid)TAPSO (3 - [N -tris(hy droxy methyl)metliy lamino ] - 7.635 7.0-8.22-hy droxy propanesulfonic acid)TEA (triethanolamine) 7.8 7.3-8.3TES (2-[[l,3-dihy droxy -2- 7.4 6.8-8.2(hy droxymethy l)propan-2- y 1 ] amino] eth anesulfonic acid)Tricine (N-[tris(hy droxy methyl )methyl]gly cine) 8.05 7.4-8.8Tris (tris(hydroxymethyl)aminomethane) or (2- 8.07 7.1-9.1amino-2-(hydroxymethyl)propane-l,3-diol)

[0197] Additional buffers and instructions on how to prepare them can be found in, e.g., “Common Buffers and Stock Solutions,” Current Protocols in Nucleic Acid Chemistry, (2011) A.2A.1-A.2.14, the contents of which are incorporated herein in their entirety.

[0198] In some embodiments, the buffer has a high buffering capacity. In some embodiments, the buffer is a modified, high buffering capacity version of any one of the buffers disclosed herein. In some embodiments, the buffer comprises phosphate buffered saline (PBS).

[0199] Examples of a suitable prebiotic include, e.g., inulin (e.g.. chicory inulin, high molecular weight inulin), fructo oligosaccharide, oligofructose, a galacto-oligosaccharide, and any combination thereof.

[0200] The polymer for the coating composition can be any suitable polymer that is exogenous to the microbes (e.g., nitrogen fixing bacteria) present in the coating composition. In some embodiments, the polymer provides adhesiveness. For example, the polymer can beAttomey Docket No. PIV-00054 WOpolyvinylpyrrolidone (PVP), polyvinyl acetate, a cellulose (e.g., ethylcellulose, methyl cellulose, carboxymethyl cellulose, hydroxypropylcellulose), an alginate, carrageenan, gum arabic, xanthan gum, starch, a starch derivative, pullulan, chitosan, a glycosaminoglycan (GAG), polymerized fibrin, arabino-galactan, a lecithin, formononetin, alkali formononetinate, hesperetin, a cephalin, mineral oil. polyaciylate, polymethyacrylate, polyethylene glycol, polyacrylic acid, polymethacrylic acid, polystyrene- butadiene, polystyrene-acrylic, poly(lactic-co-glycolic acid) (PLGA), polyvinyl alcohol, polyvinyl chloride, polyvinylacrylate, polyhydroxyethyl acrylate, polychloroprene, polyethylene oxide, polyamide, polyethylene glycol (PEG), polyacrylamide, polyacrylonitrile, polystyrene, polyoxyethylene-poly oxybutylene block copolymers any copolymer of the foregoing, and any combination thereof In some embodiments, the polymer in the coating composition can comprise polyvinylpyrrolidone-vinyl acetate (PVP-VA).

[0201] In some embodiments, the coating composition can comprise one or more (e.g.. 1, 2, 3, 4, 5, etc.) additional components. These additional components can include protectants and beneficial ingredients including but not limited to animal and bird repellants, attractants, baits, herbicides, herbicide safeners, antidessicants, antitranspirants, frost prevention aids, inoculants, dyes, brighteners, markers, synergists, pigments, UV protectants, antioxidants, leaf polish, pigmentation stimulants and inhibitors, surfactants, moisture retention aids, humic acids and humates, lignins and lignates, bitter flavors, irritants, malodorous ingredients, molluscicides (e g.. slugs and snails), nematicides, rodenticides, defoliants, desiccants, sticky traps, IPM (integrated pest management) lures, chemosterilants, plant defense boosters (harpin protein and chitosan), and other beneficial or detrimental agents applied to the surface of the plant tissue or the environs thereof. In some embodiments, multiple active agents are readily formulated within a given spray dried composition, for example, multiple active agents can include two or more of any of the following fungicides, fertilizers, pesticides, herbicides, and any type of active ingredient or class of active ingredient.

[0202] Suitable additional ingredients for the coating composition include, but are not limited to, the following:

[0203] Insecticides: Al) the class of carbamates consisting of aldicarb, alanycarb, benfuracarb, carbaryl, carbofuran, carbosulfan, methiocarb, methomyl, oxamyl, pirimicarb, propoxur and thiodicarb: A2.) the class of organophosphates consisting of acephate, azmphos-ethyl, azinphos-methyl, chlorfenvinphos, chlorpyrifos, chlorpyrifos-methyl, demeton-S-Attorney Docket No. PIV-00054 WOmethyl, diazmon, dichlorvos / DDVP, dicrotophos, dimethoate, disulfoton, ethion, fenitrothion, fenthion, isoxathion, malathion, methamidaphos, methidathion, mevinphos, monocrotophos, oxymethoate, oxydemeton-methyl, parathion, parathion-methyl, phenthoate, phorate, phosalone, phosmet, phosphamidon, pirimiphos-methyl, quinalphos, terbufos, tetrachlorvinphos, triazophos and trichlorfon; A3) the class of cyclodiene organochlorine compounds such as endosulfan; A4) the class of fiproles consisting of ethiprole, fipronil, pyrafluprole and py riprole; A5) the class of neonicotinoids consisting of acetamiprid, chlothianidin, dinotefuran. imidacloprid, nitenpyram, thiacloprid and thiamethoxam; A6) the class of spinosyns such as spinosad and spinetoram; A7) chloride channel activators from the class of mectins consisting of abamectin, emamectin benzoate, ivermectin, lepimectin and milbemectin; A8) juvenile hormone mimics such as hydroprene, kinoprene, methoprene, fenoxycarb and pyriproxyfen; A9) selecti e homopteran feeding blockers such as pymetrozme, flonicamid and pyrifluquinazon; A 10) mite growth inhibitors such as clofentezine, hexythiazox and etoxazole; Al l) inhibitors of mitochondrial ATP synthase such as diafenthiuron, fenbutatin oxide and propargite; uncouplers of oxidative phosphorylation such as chlorfenapyr; A12) nicotinic acetylcholine receptor channel blockers such as bensultap, cartap hydrochloride, thiocyclam and thiosultap sodium; Al 3) inhibitors of the chitin biosynthesis type 0 from the benzoylurea class consisting of bistrifluron, diflubenzuron, flufenoxuron, hexaflumuron, lufenuron, novaluron and teflubenzuron; A14) inhibitors of the chitin biosynthesis type 1 such as buprofezin; Al 5) moulting disruptors such as cyromazine; Al 6) ecdyson receptor agonists such as methoxyfenozide, tebufenozide, halofenozide and chromafenozide, Al 7) octopamin receptor agonists such as amitraz; Al 8) mitochondrial complex electron transport inhibitors pyridaben, tebufenpyrad, tolfenpyrad, flufenerim, cyenopyrafen, cyflumetofen, hydramethylnon, acequinocyl or fluacrypyrim; A19) voltage-dependent sodium channel blockers such as indoxacarb and metafl umi zone; A20) inhibitors of the lipid synthesis such as spirodi clofen, spiromesifen and spirotetramat; A21) ry anodine receptor-modulators from the class of diamides consisting of flubendiamide, the phthalamide compounds (R)-3-Chlor-Nl-{2-methyl-4-[l,2,2,2-tetrafluor-l -(trifluormethy l)ethyl]phenyl } -N2-(l-methyl-2-methyl sulfonylethyl)phthalamid and (S)-3-Chlor-N 1- {2-methyl-441,2,2,2-tetrafluor- 1 - (trifluormethyl)ethy 11 phenyl } -N 2-( 1 -methyl-2-methy Isulfony letliy Dphthalamid, chloranthraniliprole and cyantraniliprole; A22) compounds of unknown or uncertain mode of action such as azadirachtin, amidoflumet, bifen azate, fluensulfone, piperonyl butoxide, pyridalyl, sulfoxaflor; or A23) sodium channel modulators from the class of pyrethroidsAttomey Docket No. PIV-00054 WOconsisting of acrinathrin, allethrin, bifenthrin, cyfluthrin, gamma-cyhalothrin, lambda- cyhalothrin, cypermethrin, alpha-cypermethrin, beta-cypermethrin, zeta-cypermethrin, deltamethrin, esfenvalerate, etofenprox, fenpropathnn, fenvalerate, flucythnnate, tau-fluvalinate. permethrin, silafluofen, tefluthrin. tralomethrin. and any combination thereof.

[0204] Fungicides: Bl) azoles selected from the group consisting of bitertanol, bromuconazole, cyproconazole. difenoconazole, diniconazole, enilconazole, epoxi conazole, fluquinconazole, fenbuconazole, flusilazole, flutriafol, hexaconazole, inubenconazole, ipconazole, metconazole, myclobutanil, penconazole, propi conazole, prothioconazole, simeconazole, triadimefon, triadimenol, tebuconazole, tetraconazole, triti conazole, prochloraz, pefurazoate, imazalil, triflumizole. cyazofamid, benomyl. carbendazim, thia¬ bendazole, fubendazole, ethaboxam, etndiazole and hymexazole, azaconazole, diniconazole-M, oxpoconazol, paclobutrazol, uniconazol, l-(4-chloro-phenyl)-2-([l,2,4]triazol-l-yl)-cycloheptanol and imazalilsulfphate; B2) strobilunns selected from the group consisting of azoxystrobin. dimoxystrobin, enestroburin, fluoxastrobin. kresoxim-methyl, methominostrobin, orysastrobin, picoxystrobin, pyraclostrobin, tnfloxystrobin, methyl (2-chloro-541 -(3-methylbenzyloxyimino)ethyl]benzyI)carbamate, methyl (2-chloro-5-[ 1 -(6- methylpyridin-2-ylmethoxyimino)ethyl]benzyl)carbamate and methyl 2-(ortho-(2,5-dimethylphenyloxymethylene)-phenyl)-3-rnethoxyacrylate, 2-(2-(6-(3-chloro-2-methyl-phenoxy)-5-fluoro-pyrimidin-4-yIoxy)-phenyl)-2-methoxyimino-N-methyl-acetamide and 3-methoxy-2-(2-(N-(4-methoxy-phenyl)-cyclopropanecarboximidoylsulfanylmethyl)-phenyl)-acrylic acid methyl ester; B3) carboxamides selected from the group consisting of carboxin, benalaxyl, benalaxyl-M, fenhexamid, flutolanil, furametpyr. mepronil, metalaxyl. mefenoxam, ofurace, oxadixyl, oxy carboxin, penthiopyrad. isopyrazam, thifluzamide, tiadiml, 3.4-dichloro-N-(2-cyanophenyl)isothiazole-5-carboxamide, dimethomorph, flumorph, flumetover, fluopicolide (picobenzamid), zoxaraide, carpropamid, diclocymet, mandipropamid, N-(2-(443-(4-chlorophenyl)prop-2-ynyloxy]-3-methoxyphenyl)ethyl)-2-methanesulfonyl-amino-3-methyl buty rami de. N-(2-(4- 3-(4-chloro-phenyl)prop-2-ynyloxy]-3-methoxy-phenyl)ethyl)-2-ethanesulfony 1 amino-3-methy Ibuty ramide, methyl 3 -(4-chloropheny l)-3 -(2- isopropoxycarbonyl-amino-3-methyl-butyrylamino)propionate, N-(4'-bromobiphenyl-2-yl)-4-difluoromethylA-methylthiazole-6-carboxamide, N-(4'-trifluoroniethyl-biphenyl-2-yl)-4- dilluoromethyl-2-methyIthiaz.ole-5-carboxamide, N-(4'-chloro-3'-fluorobiphenyl-2-yl)-4-difluoromethyl-2-methyl-thiaz.ole-5-carboxamide. N-(3',4'-dichloro-4-fluorobiphenyl-2-yl)-3-difluoro-methyl-l-methyl-pyrazole-4-carboxamide, N-(3',4'-dichloro-5-fluorobiphenyl-2-yl)-Attomey Docket No. PIV-00054 WO3-difluoromethyl-l-methylpyrazole-4-carboxamide, N-(2-cyano-phenyl)-3,4- dichloroisothiazole-5 -carboxamide, 2-amino-4-methyl-thiazo1e-5-carboxanilide, 2-chloro-N-(l,l,3-trimethyl-indan-4-yl)-nicotinamide. N-(2-(l,3-dimetliylbutyl)-phenyl)~l,3-dimethyl-5- fluoro-lH-pyrazole-4-carboxamide, N-(4'-chloro-3',5-difluoro-biphenyl-2-yl)-3-difluorometbyl-1 -methyl-] H-pyrazole-4-carboxamide, N-(4'-chIoro-,3', 5-difluoro-biphenyl-2-yl)-3-tnfluoromethyl-l-methyl-lH-pyrazole-4-carboxamide, N-(3'_ 4'-dichloro-5-fluoro-biphenyl-2-yl)-3-trifluoromethyl-l-methyl-lH-pyrazole-4-carboxamide, N-(3', 5-difluoro-4'-methyl-biphenyl-2-yl)-3-difluoromethyl-l-methyl-lIl-pyrazole-4-carboxamide, N-(3', 5-difluoro-4'-methyl-biphenyl-2-y])-3-trifluoromethyl-l -methyl- lH-pyrazole-4-carboxamide, N-(cis-2-bicyclopropyl-2-yl-phenyl)-3-difluoromethyl-l-methyl-lH-pyrazole-4-carboxamide, N-(trans-2-bicyc1opropyl-2-yl-phenyl)-3-difluoro-methyl-l-methyl-lH-pyrazole-4-carboxamide, fluopyram, N-(3-ethyl-3,5-5-trimethyl-cyclohexyl)-3-formylamino-2-hydroxy-benzamide. oxytetracyclin, silthiofam, N-(6-methoxy-pyridin-3-yl) cyclopropanecarboxamide, 2-iodo-N-phenyl-benzamide, N-(2-bicyclo-propyl-2-yl-phenyl)-3-drfluormethyl-l-methyIpyrazol-4-yIcarboxamide, N-(3',4',5'-trifluorobiphenyl-2-yl)-l,3-dimethylpyrazol-4-ylcarboxamide, N-(3',4'.5'-trifluorobiphenyl-2-yl)-l,3-dimethyl-5-fluoropyrazol-4-yl-carboxamide, N-(3'.4',5'-trifluorobiphenyl-2-yl)-5-chloro-l,3-dimethyl-pyrazol-4- lcarboxamide, N-(3',4',5'-trifluorobiphenyl-2-yl)-3-fluoromethyl-l-methylpyrazol-4-ylcarboxamide, N-(3',4',5'-trifluorobiphenyl-2-yl)-3-(chlorofluoromethyl)-l- methylpyrazol-4-ylcarboxamide, N-(3',4',5'-trifluorobiphenyl-2-yl)-3-difluoromethyl-l-methylpyrazol-4-ylcarboxamide, N-(3',4',5'-trifluorobiphenyl-2-yl)-3-difluoromethyl-5-fluoro-l-methylpyrazol-4-ylcarboxamide. N-(3'.4',5'-trifluorobiphenyl-2-yI)-5-chloro-3-difluoromethyl-l-methylpyrazol-4-ylcarboxamide, N-(3',4',5'-trifluorobiphenyl-2-yl)-3-(chlorodifluoromethyl)-l-methylpyrazo]-4-ylcaiboxamide, N-(3',4',5'-trifluorobiphenyl-2-yl)-l-methyl-3-trifluoromethylpyrazo1-4-ylcarboxamide, N-(3',4',5'-lrifluorobiphenyl-2-yl)-5-fluoro-l-metliyl-3-trifluoromethylpyrazol-4-ylcarboxamide, N-(3\4'.5'-trifluorobiphenyl-2-yl)-5-chloro-l-methyl-3-trifluoromethylpyrazol-4-yl carboxamide, N-(2'.4'.5'-trifluorobiphenyl-2-yl)-l,3-dimethylpyrazol-4-ylcarboxamide, N-(2',4',5'-trifluorobiphenyl-2-yl)-l,3-dimethyl-5-fluoropyrazol-4-ylcarboxamide, N-(2',4',5'-trifluorobiphenyl-2-yl)-5-chloro-l,3-dimethylpyrazol-4-ylcarboxamide. N -(2 '.4', 5 '-trifluorobiphenyl -2-yl)-3 -fluoromethyl - 1 -methy Ipyrazol -4-y 1 carboxami de. N-(2',4',5'-trifluorobiphenyl-2-yl)-3- (cblorofluoromethyl)-I-methylpyrazol-4-ylcarboxamide, N-(2',4',5'-trifluorobiphenyl-2-yl)-3-difluoromethyl-l-methyIpyrazol-4-ylcarboxamide, N-(2',4',5'-trifluorobiphenyl-2-yl)-3-Attomey Docket No. PIV-00054 WOdif]uoromethyl-5-fluoro-l-methylpyrazol-4-y]carboxamide, N-(2',4',5'-trifluorobiphenyl-2-yl)-5-chloro-3-difluoromethyl- 1 -methylpyrazol -4-ylcarboxamide, N-(2',4',5'-trifluorobiphenyl-2-yl)-3-(chlorodifluoromethyl)-l-methylpyrazol-4-ylcarboxamide, N-(2'.4',5'-trifluorobiphenyl-2-yl)-l-methyl-3-trifluoromethylpyrazol-4-ylcarboxamide. N-(2', 4',5'-trifluorobiphenyl-2-yl)-5-fluoro-l-methyl-3-trifluorometihylpyrazol -4-ylcarboxamide, N-(2'.4',5'-trifluorobiphenyl-2-yl)-5-chloro-l-methyl-3-trifluoromethylpyrazol-4- ylcarboxamide, N-(3',4'-dichloro-3-fluorobiphenyl-2-yl)-l-methyl-3-trifluoromethyl-lH-pyrazole-4-carboxamide, N-(3',4'-dichloro-3-fluorobiphenyl-2-yl)- 1 -methyl-3-di fl uoromethyl - 1 H-pyrazol e-4-carboxami de, N-(3',4'-difl uoro-3 -fluorobi pheny l-2-y 3 )- 1 -methyl-3-trifluoromethyl-lH-pyrazole-4-carboxamide, N-(3',4'-difluoro-3-fluorobiphenyl-2-yl)-l-methyl-S-difluoromethyl-lH-pyrazole-4-carboxamide, N-(3'-chloro-4'-fluoro-3-fluorobiphenyl-2-yl)-l -methyl-3-difluoromethyl-lH-pyrazole-4-carboxamide, N-(3’,4'-dichloro-4-fluorobiphenyl-2-yl)- 1 -methyl-3-trifl uoromethyl- 1 H-pyrazol e-4-carboxamide, N - (3',4'-difluoro-4-fluorobiphenyl-2-yl)-l-methyl-S-trifluoromethyl-lH-pyrazole-4-carboxamide. N-(3',4'-dichloro-4-fluorobiphenyl-2-yl)-l-methyl-3-difluoromethyl-lH-pyrazole-4-carboxamide, N-(3',4'-difluoro-4-fluorobiphenyl-2-yl)-l-metlryl-3-difluoromethyl-lH-pyrazole-4-carboxamide, N-(3'-chloro-4'-fluoro-4-fluorobiphenyl-2-yl)-l-methyl-S-difluoromethyl-lH-pyraz.ole-4-carboxamide, N-(3',4'-dichloro-5-fluorobiphenyl-2- yl)-l-methyl-3-trifluoromethyl-lH-pyrazole-4-carboxamide, N-(3',4'-difluoro-5- fluorobiphenyl-2-yl)-l-methyl-3-trifluoromethyl-lH-pyrazole-4-carboxamide, N-(3',4'-dichloro-5-fluorobipheriyl-2-yl)-l-methyl-S-difluoromethyl-lH-pyrazole-carboxamide, N- (3'.4'-difluoro-5-fluorobiphenyl-2-yl)- l-methyl-3-difluoromethyl-lH-pyraz.ole-4-carboxamide, N-(3',4'-dichloro-5-fluorobiphenyl-2-yl)-l,3-dimetliyl-lH-pyrazole-4-carboxamide, N-(3'-chloro-4'-fluoro-5-fluorobiphenyl-2-yl)-l-methyl-3-difluorornethyl-lH-pyrazole-4-carboxamide, N-(4'-fluoro-4-fluorobiphenyl-2-yl)-l-methyl-3-trifluoromethyl-lH-pyrazole-4-carboxarmde, N-(4'-fluoro-5-fluorobiphenyl-2-yl)-l-methyl-3-trifluoromethyl-lH-pyrazole-4-carboxamide, N-(4'-chloro-5-fluorobiphenyl-2-yl)-l -methyl-3-trifluoromethyl-lH-pyrazole-4-carboxamide, N-(4'-methyl-5-fluorobiphenyl-2-yl)-l-methyl-3-trifluoromethyl-lH-pyrazole-4-carboxamide, N-(4'-fluoro-5-fluorobiphenyl-2-yl)-l,3-dimethyl-lH-pyrazole-4-carboxamide, N-(4'-chloro-5-fluorobiphenyl-2-yl)-l,3-dimethyl-lH-pyrazol e-4-carboxami de, N-(4'-methyl-5 -fluorobi pheny 1-2-yl )- 1,3 -dimethy 1- 1 H-pyr zol e-4- carboxamide, N-(4'-fluoro-6-fluorobiphenyl-2-yl)-l-methyl-3-trifluoromethyl-lH-pyrazole-4-carboxamide, N-(4'-chIoro-6-fluorobiphenyl-2-yl)- 1 -methyl-3 -trifluoromethyl- IH-pyrazole-Attorney Docket No. PIV-00054 WO4-carboxamide, N-[2-( 1,1,2,3, 3, 3-hexafluoropropoxy)-phenyl]-3-ditluoromethyl-l -methyl-lH-pyrazole-4-carboxamide, N-[4'-(trifluoromethy1thio)-biphenyl-2-y1]-3-difluoromethyl-l-metliyl-lH-pyrazole-4-carboxamide and N44'-(trifhioromethy lthio)-bipheny 1-2-yl] -1-methyl- 3 -trifluoromethyl- 1 -methyl- lH-pyrazole-4-carboxaniide; B4) heterocyclic compounds selected from the group consisting of fluazinam, pyrifenox, bupirimate, cyprodinil, fenarimol, ferimzone, mepampyrim, nuanmol, pynmethanil, trifonne, fenpiclonil, fludioxonil, al dimorph, dodemorph, fenpropimorph, tridemorph, fenpropidin, iprodione, procymidone, vinclozolin, famoxadone, fenamidone, octhilinone, proben-azole, 5-chloro-7-(4-methyl-piperidin-l-yl)-6- (2,4,6-trifluorophenyl)41,2,4jtriazolol 1,5-aJpyrimidine, anilazine, diclomezine, pyroquilon, proquinazid, tricyclazole, 2-butoxy-6-iodo-3-propylchromen-4-one, acibenzolar-S-methyl, captafol, captan, dazomet, folpet, fenoxanil, quinoxyfen, N, N-dimethyl-3-(3-bromo-6-fluoro- 2-methylindole-l -sulfonyl)-[ 1.2.4] triazol e-1 -sulfonamide, 5-ethyl-6-octyl41,2,4] tri azolo[l 2,3,5.6-tetrachloro-4-methanesulfonyl-pyridine. 3,4,5-trichloro-pyridine-2.6-di-carbonitrile, N-(l-(5-bromo-3-chloro-pyridin-2-yl)-ethyl)-2,4-dichloro-ni cotinamide, N-((5-bromo-3-chloro pyridin-2-yl)-metbyl)-2,4-dichloro-ni cotinamide, diflumetorim, nitrapyrin, dodemorphacetate, fluoroimid. blasticidm-S, chinomethionat, debacarb. difenzoquat, difenzoquat-methylsulphat, oxolinic acid and piperalin; B5) carbamates selected from the group consisting of mancoz. eb, maneb, metam, methasulphocarb. metiram, ferbam, propmeb, thiram, zineb, ziram, diethofencarb, iprovalicarb, benthiavalicarb, propamocarb, propamocarb hydrochlond, 4-fluorophenyl N-(l-(l-(4-cyanophenyl)-ethanesulfonyl)but-2-yl)carbamate, methyl 3-(4-chloro-phenyl)-3-(2-isopropoxycarbonylamino-3-methyl- butyrylamino)propanoate; or B6) other fungicides selected from the group consisting of guanidine, dodine. dodine free base, immoctadine, guazatine, antibiotics: kasugamycin, streptomycin, polyoxin, validamycin A, nitrophenyl derivatives: binapacryl, dinocap, dinobuton, sulfur-containing heterocyclyl compounds: dilhianon, isoprothiolane, organometallic compounds: fentin salts, organophosphorus compounds: edifenphos. iprobenfos, fosetyl. fosetyl-aluminum. phosphorous acid and its salts, pyrazophos, tolclofos- methyi, organochlorine compounds: dichlofluanid, flusulfamide, hexachloro-benzene, phthalide, pencycuron, quintozene, thiophanate-methyl, tolylfluanid, others: cyflufenamid, cymoxanil. dimethirimol, ethirimol, furalaxyl, metrafenone and spiroxamine, guazatine-acetate, iminoc-tadine-triacetate, iminoctadine-tris(albesilate), kasugamycin hydrochloride hydraTe, dichlorophen, pentachlorophenol and its salts, N-(4-chloro-2-nitro-phenyl)-N-ethyl- 4-methyl-benzenesulfonamide, did nitrothal-isopropyl, tecnazen, biphenyl, bronopol,Attorney Docket No. PIV-00054 WOdiphenylamine, mildiomycin, oxincopper, prohexadione calcium, N- (cy'clopropylmethoxyimino-(6-difluoromethoxy-2,3-difluoro-phenyl)-methyl)-2-phenyl acetamide, N'-(4-(4-chloro-3-trifluoromethyl-phenoxy)-2,5-dimetliyl-phenyl)-N-ethyl-N-methyl formamidine. N'-(4-(4-fluoro-3-trifluoromethyl-phenoxy)-2.5-dimethyl-phenyl)-N-ethyl-N-methyl formamidine, N'-(2-methy]-5-trifluormethyl-4-(3-irimethylsilanyl-propoxy)-phenyl)-N-ethyl-N-methylformamidine and N'-(5-difluormethyl-2-methyl-4-(3-trimetiiylsilanyl-propoxy)-phenyl)-N-etliyl-N-methyl formamidine, and any combination thereof

[0205] Herbicides: Cl) acetyl-CoA carboxylase inhibitors (ACC), for example, cyclohexenone oxime ethers, such as alloxydim, cletliodim, cloproxydim, cycloxydim, sethoxydim, tralkoxydim, butroxydim, clefoxydim or tepraloxydim; phenoxyphenoxypropionic esters, such as clodinafop-propargyl, cyhalofop-butyl, diclofop- methyl, fenoxaprop-ethyl, fenoxaprop-P-ethyl, fenthiapropethyl, fluazifop- butyl. fluazifop-P-butyl, haloxyfop-ethoxyethyl, haloxyfop-methyl. haloxyfop-P-methyl, isoxapyrifop, propaquizafop, quizalofop-ethyl, quizalofop-P-ethyl or quizalofop-tefuryl; or arylaminopropionic acids, such as flamprop-methyl or flamprop-isopropyl; C2 acetolactate synthase inhibitors (ALS), for example, imidazolinones, such as imazapyr, imazaquin, imazamethabenz-methyl (imazarne), imazamox, imazapic or irnazethapyr; pyrimidyl ethers, such as pyrithiobac-acid. pyrithiobac-sodium, bispyribac-sodium. KIH-6127 or pyribenzoxym; sulfonamides, such as florasulam, flumetsulam or metosulam: or sulfonylureas, such as amidosulfuron, azimsulfuron, bens ulfuron -methyl, chlorimuron-ethyl, chlorsulfuron, cinosulfuron, cyclosulfamuron, ethametsulfuron-methyl, ethoxysulfuron, flazasulfuron, halosulfuron-methyl. imazosulfuron. metsulfuron-methyl. nicosulfuron. primisulfuron-methyl, prosulfuron, pyrazosulfuron-ethyl, nmsulfuron, sulfometuion-methyl, thifensulfuron-methyl, triasulfuron, tribenuron-methyl, triflusulfuron-methyl, tritosulfuron, sulfosulfuron, foramsulfuron or iodosulfuron; C3) amides, for example, allidochlor (CDAA), benzoylprop-ethyl. broinobutide. chlorthiamid, diphenamid, etobenzanidibenzchlomet), fluthiamide, fosamin or monalide; C4) auxin herbicides, for example, pyridinecarboxylic acids, such as clopyralid or picloram; or 2,4-D or benazolin; C5) auxin transport inhibitors, for example, naptalame or diflufenzopyr; C6) carotenoid biosynthesis inhibitors, for example, benzofenap, clomazone (dirnethazone). diflufenican, lluorochloridone, fluridone, pyrazolynate, pyrazoxyfen, isoxaflutole. isoxachl oriole, mesotrione, sulcotnone (chlormesulone). ketospiradox. flurtamone, norflurazon or amitrol; C7) enolpyruvylshikimate-3-phosphateAttorney Docket No. PIV-00054 WOsynthase inhibitors (EPSPS), for example, glyphosate or sulfosate; C8) glutamine synthetase inhibitors, for example, bilanafos (bialaphos) or glufosinate-ammonium; C9) lipid biosynthesis inhibitors, for example, anilides, such as anilofos or mefenacet; chloroacetanilides, such as dimethenamid, S-dimethenamid, acetochlor, alachlor, butachlor, butenachlor, diethatyl-ethyl, dimethachlon metazachlor, metolachlor, S-metolachlor, pretilachlor, propachfor, prynachlor, terbuchlor, thenylchlor or xylachlor; thioureas, such as butylate, cycloate, di-allate, dimepiperate, S-ethyl dipropylthiocarbamate (EPTC), esprocarb, molinate, pebulate, prosulfocarb, thiobencarb (benthiocarb), tri-allate or vernolate; or benfuresate or perfluidone; CIO) mitosis inhibitors, for example, carbamates, such as asulam, carbetamid, chlorpropham, orbencarb, pronamid (propyzamid), propham or tiocarbazil; dinitroanilines, such as benefin, butralin, dinitramin, ethalfluralin, fluchloralin, oryzalin, pendimethalin, prodiamine or trifluralin; pyridines, such as dithiopyr or thiazopyr; or butamifos, dimethyl tetrachloroterephthalate (DC A) or maleic hydrazide; CH) protoporphyrinogen IX oxidase inhibitors, for example, diphenyl ethers, such as acifluorfen. acifluorfen-sodium, aclonifen, bifenox, chlomitrofen (CNP), ethoxyfen, fluorodifen, fluoroglycofen-ethyl, fomesafen, furyloxyfen, lactofen, nitrofen, nitrofluorfen or oxyfluorfen; oxadiazoles, such as oxadiargyl or oxadiazon; cyclic imides, such as azafenidin, butafenacil, carfentrazone-ethyl, cinidon-ethyl, flumiclorac-pentyl, flumioxazin, flumipropyn, tlupropacil, fluthiacet-methyl, sulfentrazone or thidiazimin; or pyrazoles, such as ET-751. JV 485 or nipyraclofen; C12) photosynthesis inhibitors, for example, propanil, pyridate or pyridafol; benzothiadiazinones, such as bentazone; dinitrophenols, for example, bromofenoxim, dinoseb, dinoseb-acetate, dinoterb or DNOC; dipyridylenes, such as cyperquat-chloride, difen zoquat-methyl sulfate, diquat or paraquat-dichloride; ureas, such as chlorbromuron, chlorotoluron, difenoxuron, dimefuron, diuron, ethidimuron, fenuron, fluometuron, isoproturonisouron, linuron, methabenzthiazuron, methazole, metobenzuron, meioxuron, monolinuron, neburon. siduron or tebuthiuron; phenols, such as bromoxynil or ioxynil; chloridazon; triazines, such as ametryn. atrazine, cyanazine, desmein, dimethamethryn, hexazinone, prometon, prometryn, propazine, simazine, simetryn, terbumeton, terbutryn, terbuthylazme or trietazine; triazinones, such as metamitron or metribuzin; uracils, such as bromacil, lenacil or terbacil; or biscarbamates, such as desmedipham or phenmedipham; Cl 3) synergists, for example, oxiranes, such as tridiphane; C14) CIS cell wall synthesis inhibitors, for example, isoxaben or dichlobenil; CI 6) various other herbicides, for example, dichloropropionic acids, such as dalapon; dihydrobenzofurans, such as ethofumesate; phenylacetic acids, such as chlorfenac (fenac); or aziprotryn, barban,Attorney Docket No. PIV-00054 WObensulide, benzthiazuron, benzofluor, buminafos, buthidazole, buturon, cafenstrole, chlorbufam, chlorfenprop-methyl, chloroxuron, cinmethylin, cumyluron, cycluron, cyprazine, cyprazole, dibenzyluron, dipropetryn, dymron, eglinazin-ethyl, endothall, ethiozin, flucabazone, fluorbentranil. flupoxam. isocarbamid, isopropalin, karbutilate, mefluidide, monuron, napropamide, napropanilide, nitralin, oxacid omefone, phenisopham, piperophos, procyazine. profluralin, pyributicarb, secbumeton, sulfallate (CDEC), terbucarb, triaziflam, triazofenamid, trimeturon, environmentally compatible salts of any of the foregoing, or any combination thereof.

[0206] Nematicides: Benomyl. cloethocarb. aldoxycarb, tirpate. diamidafos, fenamiphos, cadusafos, dichlofenthion, ethoprophos, fensulfothion, fosthiazate, heterophos. isamidofof, isazofos, phosphocarb, thionazin, imicyafos, mecarphon, acetoprole, benclothiaz, chloropicrin, dazomet, fluensulfone, oxamyl, terbufos, and any combination thereof.

[0207] Plant Growth Regulators or Hormones: DI) Antiauxins, such as clofibric acid, 2,3,5-triiodobenzoic acid; D2) Auxins such as 4-CPA, 2,4-D, 2,4-DB, 2,4-DEP, dichlorprop, fenoprop, IAA, IBA, naphthaleneacetamide, a-naphthaleneacetic acids, 1 -naphthol, naphthoxyacetic acids, potassium naphthenate, sodium naphthenate, 2.4.5-T; D3) cytokinins, such as 2 IP, benzyl adenine, 4-hydroxyphenethyl alcohol, kinetin, zeatin; D4) defoliants, such as calcium cyanamide, dimethipin, endothal, ethephon, merphos, metoxuron, pentachlorophenol, thidiazuron, tribufos; D5) ethylene inhibitors, such as aviglycine, 1-methylcyclopropene; D6) ethylene releasers, such as ACC, etacelasil, ethephon, glyoxime; D7) gametocides, such as fenridazon, maleic hydrazide; D8) gibberellins, such as gibberellins, gibberellic acid; D9) growth inhibitors, such as abscisic acid, ancymidol, butralin, carbaryl, chlorphonium, chlorpropham, dikegulac, flumetralin, fluoridamid, fosamine, glyphosine, isopyrimol, jasmonic acid, maleic hydrazide, mepiquat, piproctanyl. prohydrojasmon, propham, tiaojiean, 2,3,5-tn-iodobenzoic acid; D10) morphactins, such as chlorfluren. chlorflurenol, di chlorflurenol, flurenol; DI 1 ) growth retardants, such as chlormequat, daminozide, flurprimidol, mefluidide, paclobutrazol, tetcyclacis, uniconazole; D12) growth stimulators, such as brassinolide, brassinolide-ethyl, 2-(3,4-dichlorophenoxy)-N,N-diethylethan-1-amine (DCPTA), forchlorfenuron, hymexazol, prosuler, triacontanol; D13) unclassified plant growth regulators, such as bachmedesh, benzofluor, buminafos, carvone, choline chloride, ciobutide, clofencet, cyanamide, cyclanilide, cycloheximide, cyprosulfamide, epocholeone, ethychlozate, ethylene, fuphenthiourea, furalane, heptopargil, holosulf.Attorney Docket No. PIV-00054 WOinabenfide, karetazan, lead arsenate, methasulfocarb, prohexadione, pydanon, sintofen, triapenthenol, trinexapac, and any combination thereof.

[0208] In some embodiments, the coating composition can comprise one or more of a fertilizer, nitrogen stabilizer, or urease inhibitor, Fertilizers include anhydrous ammonia, urea, ammonium nitrate, and urea-ammonium nitrate (UAN) compositions, among many others. In some embodiments, pop-up fertilization and / or starter fertilization is used in combination with the methods and microbes of the present disclosure.

[0209] In some embodiments, nitrogen stabilizers can be used in combination with the methods and microbes of the present disclosure. Nitrogen stabilizers include nitrapyrin, 2-chloro-6-(trichloromethyl) pyridine, N-SERVE 24, INSTINCT, dicyandiamide (DCD) Urease inhibitors include N-(n-butyl)-thiophosphoric triamide (NBPT), AGROTAIN, AGROTAIN PLUS, and AGROTAIN PLUS SC. Further, the disclosure contemplates utilization of AGROTAIN ADVANCED 1.0, AGROTAIN DRI-MAXX, and AGROTAIN ULTRA

[0210] In some embodiments, stabilized forms of fertilizer can be used. For example, a stabilized form of fertilizer is SUPER U, containing 46% nitrogen in a stabilized, urea-based granule, SUPERU contains urease and nitrification inhibitors to guard from denitrification, leaching, and volatilization. Stabilized and targeted foliar fertilizer such as N1TAMIN can also be used herein.

[0211] Slow- or controlled-release fertilizer that can be used herein entails: A fertilizer containing a plant nutrient in a form which delays its availability' for plant uptake and use after application, or which extends its availability' to the plant significantly’ longer than a reference ‘rapidly available nutrient fertilizer’ such as ammonium nitrate or urea, ammonium phosphate or potassium chloride. Such delay of initial availability' or extended time of continued availability' can occur by' a variety' of mechanisms. These include controlled water solubility of the material by semi-permeable coatings, occlusion, protein materials, or other chemical forms, by slow hy drolysis of water soluble low molecular weight compounds, or by other unknown means.

[0212] Stabilized nitrogen fertilizer that can be used herein entails: A fertilizer to which a nitrogen stabilizer has been added. A nitrogen stabilizer is a substance added to a fertilizer which extends the time the nitrogen component of the fertilizer remains in the soil in the urea-N or ammoniacal-N form.Attorney Docket No. PIV-00054 WO

[0213] Nitrification inhibitor that can be used herein entails: A substance that inhibits the biological oxidation of ammoniacal-N to nitrate-N. Some examples include: (1) 2-chloro-6-(trichloromethyl-pyridine), common name Nitrapyrin, manufactured by Dow Chemical; (2) 4-amino-l,2,4-6-triazole-HCl, common name ATC, manufactured by Ishihada Industries; (3) 2,4-diamino-6-trichloro-methyltriazine, common name CI- 1580, manufactured by American Cyanamid; (4) Dicyandiamide, common name DCD, manufactured by Showa Denko; (5) Thiourea, common name TU, manufactured by Nitto Ryuso; (6) 1 -mercapto- 1,2, 4-triazole, common name MT, manufactured by Nippon; (7) 2-amino-4-chloro-6-methyl-pyramidine, common name AM. manufactured by Mitsui Toatsu; (8) 3,4-dimethylpyrazole phosphate (DMPP), from BASF; (9) l-amide-2-thiourea (ASU), from Nitto Chemical Ind.; (10) Ammonium thiosulphate (ATS); (11) 1H-1,2,4-triazole (HPLC); (12) 5-ethylene oxide-3- trichloro-methyl-1,2,4-thiodiazole (Terrazole), from Olin Mathieson; (13) 3-methylpyrazole (3-MP); (14) l-carbamoyle-3-methyl-pyrazole (CMP); (15) Neem; and (16) DMPP.

[0214] Urease inhibitor that can be used herein entails: A substance that inhibits hydrolytic action on urea by the enzyme urease. Thousands of chemicals have been evaluated as soil urease inhibitors (Kiss and Simihaian, 2002). However, only a few' of the many compounds tested meet the necessary requirements of being nontoxic, effective at low concentration, stable, and compatible with urea (solid and solutions), degradable in the soil and inexpensive. They can be classified according to their structures and their assumed interaction with the enzyme urease (Watson. 2000, 2005). Four main classes of urease inhibitors have been proposed: (a) reagents which interact with the sulphydryl groups (sulphydryl reagents), (b) hydroxamates, (c) agricultural crop protection chemicals, and (d) structural analogues of urea and related compounds. N-(n-butyl) thiophosphoric triamide (NBPT), phenylphosphorodiamidate (PPD / PPDA), and hydroquinone are probably the most thoroughly studied urease inhibitors (Kiss and Simihaian, 2002). Research and practical testing have also been carried out with N-(2 -nitrophenyl) phosphoric acid triamide (2-NPT) and ammonium thiosulphate (ATS). The organo-phosphorus compounds are structural analogues of urea and are some of the most effective inhibitors of urease activity, blocking the active site of the enzyme (Watson, 2005).

[0215] In some embodiments, the coating composition can comprise trace metal ions, such as molybdenum ions, iron ions, manganese ions, or combinations of these ions. The concentration of ions in examples of compositions as described herein can be about 0.1 mM to about 50 mM. In some embodiments, tire coating composition can comprise additional carriers, besides thoseAttorney Docket No. PIV-00054 WOinvolved in the formulation process. Additional carriers include, e.g., beta-glucan, carboxymethyl cellulose (CMC), bacterial extracellular polymeric substance (EPS), sugar, trehalose, maltose, animal milk, milk powder, or other suitable carriers. In some embodiments, peat or planting materials can be used as a carrier, or biopolymers in which a composition is entrapped in the biopolymer can be used as a carrier.

[0216] The coating composition can include food sources for the plant, such as barley, rice, or other biological materials such as seed, plant parts, sugar cane bagasse, hulls or stalks from grain processing, ground plant material or wood from building site refuse, sawdust or small fibers from recycling of paper, fabric, or wood. For example, a fertilizer can be used to help promote the growth or provide nutrients to a plant tissue, e.g.. a seed, seedling, or plant. Non¬ limiting examples of fertilizers include nitrogen, phosphorous, potassium, calcium, sulfur, magnesium, boron, chloride, manganese, iron, zinc, copper, molybdenum, and selenium (or any salts thereof). Additional examples of fertilizers include one or more amino acids, salts, carbohydraTes, vitamins, glucose, NaCl, yeast extract, NH₄H₂PO₄, (NH₄)₂SO₄, glycerol, valine, L-leucine, lactic acid, propionic acid, succinic acid, malic acid, citric acid, KH tartrate, xylose, lyxose, and lecithin.

[0217] Some examples of plant nutrients can be selected from the group consisting of a nitrogen fertilizer including, but not limited to urea, ammonium nitrate, ammonium sulfate, non-pressure nitrogen solutions, aqua ammonia, anhydrous ammonia, ammonium thiosulfate, sulfur-coated urea, urea-formaldehyde (ureaform), isobutylidene diurea (IBDU), polymer- coated urea, calcium nitrate, and methylene urea, phosphorous fertilizers such as diammonium phosphate, monoammonium phosphate, ammonium polyphosphate, concentrated superphosphate and triple superphosphate, and potassium fertilizers such as potassium chloride, potassium sulfate, potassium-magnesium sulfate, and potassium nitrate. Such compositions can exist as free salts or 10ns within the coating composition. Alternatively, nutrients / fertilizers can be complexed or chelated to provide sustained release over time.

[0218] In some embodiments, the coating composition can comprise a control agent with antibacterial properties. In some embodiments, the control agent can be streptomycin, oxytetracycline, oxolinic acid, or gentamicin. Other examples of antibacterial compounds include those based on dichlorophene and benzyl alcohol hemi formal (Proxel® from ICI (England) or Acticide® RS from Thor Chemie (England) and Kathon® MK 25 from Rohm &Attorney Docket No. PIV-00054 WOHaas (Philadelphia, PA) and isothiazolinone derivatives such as alkylisothiazolinones and benzisothiazolinones (Acticide® MBS from Thor Chemie (England)).

[0219] In some embodiments, the plant growth regulator can be selected from the group consisting of: abscisic acid, amidochlor, ancymidol, 6- benzy l aminopurine, brassinolide, butralin, chlormequat (e.g., chlormequat chloride), choline chloride, cyclanilide. daminozide, dikegulac, dimelhipin, 2,6-dimethylpuridine. ethephon, flumetralin. flurprimidol. fluthiacet. forchlorfenuron, gibberellic acid, inabenfide, indole-3-acetic acid, maleic hydrazide, mefluidide, mepiquat (e.g., mepiquat chloride), naphthaleneacetic acid, N-6-benz ladenine, paclobutrazol, prohexadione phosphorotrithioate, 2,3,5-tri-iodobenzoic acid, trinexapac-ethyl and uniconazole. Additional non-limiting examples of growth regulators include a brassinosteroid, a cytokmine (e.g., kinetin and zeatin), an auxin (e.g., indolylacetic acid and indolylacetyl aspartate), a flavonoid or isoflavanoids (e.g., formononetin and diosmetin), a phytoalexin (e.g., glyceolline), a phytoalexin-inducing oligosaccharide (e.g., pectin, chitin, chitosan, polygalacturonic acid, and oligogalacturonic acid), and a gibberellin. In some embodiments, such agents are compatible with the agricultural plant tissues or the environs thereof onto which the coating composition is applied (e.g., it should not be deleterious to the growth or health of the plant). In some embodiments, the agent does not cause safety concerns for human, animal, or industrial use (e.g., no safety issues, or the compound is sufficiently labile that the commodity plant product derived from the plant contains negligible amounts of the compound).

[0220] Examples of rodenticides include, e.g., 2-isovalerylindan- 1,3 - dione, 4-(qumoxalin-2-yIamino) benzenesulfonamide, alpha-chlorohydrin, aluminum phosphide, antu, arsenous oxide, barium carbonate, bisthiosemi, brodifacoum, bromadiolone, bromethalin, calcium cyanide, chloralose, chlorophacinone, cholecalciferol, coumachlor, coumafuryl. coumatetralyl, cnmidine, difenacoum, difethialone, diphacinone. ergocalciferol. flocoumafen. fluoroacetamide, flupropadine. flupropadine hydrochloride, hydrogen cyanide, iodomethane, lindane, magnesium phosphide, methyl bromide, norbormide, phosacetim, phosphine, phosphorus, pindone, potassium arsenite, pyrinuron, scilliroside, sodium arsenite, sodium cyanide, sodium fluoroacetate, strychnine, thallium sulfate, warfarin, and zinc phosphide.

[0221] The present disclosure further provides a method of coating a plant portion with microbes (e.g.. nitrogen fixing bacteria). In particular, the method comprises: combining a spray dried composition disclosed herein with a liquid to produce a dispersion of live microbes;Attorney Docket No. PIV-00054 WOand coating a plant portion (e.g., seed, plant tissue, or the environs thereof) with the dispersion of live microbes. As a result, the disclosure provides a coated plant comprising a plant portion coated with a spray dried composition or a corresponding coating composition as described herein. In some embodiments, the plant portion comprises a seed, a leaf, a stem, or any combination thereof. In some embodiments, the plant portion comprises a seed, such that a coated seed is provided. In some embodiments, the seed is from com, wheat, barley, rice, sorghum, millet, oats, rye, triticale, buckwheat, sugar cane, canola, soybean, potato, onion, tomato, strawberry, or asparagus. In some embodiments, the seed is a corn seed. In some embodiments, the com can be, e g., sweet com, flint com, popcorn, dent com, pod com, flour com, or any combination thereof In some embodiments, the corn is organic.

[0222] In some embodiments, the plant is a monocot. In some embodiments, the plant is a di cot. In some embodiments, the plant portion is from a genetically modified organism (GMO), non-GMO, organic, or conventional plant. In some embodiments, the methods described herein are suitable for plant tissues from any of a variety of transgenic plants, non-transgenic plants, and hybrid plants thereof.

[0223] In some embodiments, the application methods provide an effective amount of the microbes (e.g., nitrogen fixing bacteria) to a plant portion (e.g, seed, plant tissue, or the environs thereof). In general, an effective amount is an amount sufficient to result in plants with one or more improved traits (e.g., a desired level of nitrogen fixation). An effective amount of the microbes (e.g., nitrogen fixing bacteria) can be used to populate the sub-soil region around seeds, seedlings, plants, or plant parts with viable bacterial growth, or populate the seeds, seedlings, plants, or plant parts with viable bacterial growth. In some embodiments, the present methods result in a higher concentration of microbes (e.g., nitrogen fixing bacteria) surviving through storage, delivery, and / or transport until planting.

[0224] In some embodiments, the dispersion of live microbes can be applied as a treatment to a seed, seedling, plant, plant part, or environs thereof in a variety of concentrations. For example, the microbes can be at a CFU concentration per seed of: 1 * IO1, 1 × 102, 1 × 103, 1 × 104, 1 × 105, 1 x 106, 1 x 107, 1 × 108, 1 × 109, 1 × 1010, 1 × 1011, or more. In some embodiments, the dispersion of live microbes comprises microbes at a concentration of about 1 × 104to about 1 × 108CFU per seed. In some embodiments, the dispersion of live microbes comprises about 1 × 105to about 1 × 107CFU per seed. In some embodiments, the dispersion of live microbes comprises about 1 × 106CFU per seed.Attorney Docket No. PIV-00054 WO

[0225] In the United States, about 10% of corn acreage is planted at a seed density of above about 36,000 seeds per acre; 1 / 3 of the com acreage is planted at a seed density of between about 33,000 to 36,000 seeds per acre; 1 / 3 of the com acreage is planted at a seed density of between about 30,000 to 33.000 seeds per acre, and the remainder of the acreage is variable. See, “Com Seeding Rate Considerations,” written by Steve Butzen, available at: www.pioneer.com / home / site / us / agronomy / library / corn-seeding-rate-considerations / .

[0226] Table 5 below utilizes various CFU concentrations per seed m a contemplated seed treatment embodiment (rows across) and various seed acreage planting densities (1stcolumn: 15K-45K) to calculate the total amount of CFU per acre, which would be utilized in various agricultural scenarios (i.e., seed treatment concentration per seed seed density planted per acre). Thus, if one were to utilize a seed treatment with 1 x 106CFU per seed and plant 30,000 seeds per acre, then the total CFU content per acre would be 3 x 1010(i.e., 30K × 1 × 106). Table 5Corn Population1.00E+02 1.00E+03 1.00E+04 1.00E1-05 1.00E+06 1.00E+07 1.00E+08 1.00E+09 (seeds per acre)15,000 1 50E+06 1 50E+07 1.50E+08 1 50E+09 1 50E+10 1 50E+11 1 50EH2 1 50E+13 16.000 1.60E+06 1 60E+07 1.60E-08 1.60E+09 1 60E+10 1.60E+11 1.60E+12 1.60E+13 17,000 1 70E+06 1 70E+07 1 70E+08 1 70E+09 1 70E- 10 1 70E+11 1 70E+12 1 70E 13 18,000 1.80E+06 1.80E+07 1.80E+08 1.80E+09 1.80E-10 1.80E+11 1 80E+12 1.80E-13 19,000 1.90E+06 1 90E+07 1.90E ■> 08 1.90E+09 1 90E+10 1.90E+11 1.90EH2 1.90E+13 20,000 2.00E+06 200E+07 2.00E-08 2.00E+09 200E+10 2.00E+11 2.00E+12 2.00E+13 21,000 2.10E406 2.10E+07 2.10E+08 2.10E+09 2.10E f 10 2.10E H1 2.10E+12 2.10E- 13 22,000 2.20E+06 2.20E+07 2.20E+08 2.20E+09 2.20E+10 2.20E+11 220E+12 2.20E-13 23,000 2.30E+06 230E+07 2.30E-08 2.30E+09 2.30E+10 2.30E+11 2.30E+12 2.30E+13 24,000 2.40E+06 240E+07 2.40E-08 2.40E+09 2.40E+10 2.40E+11 2.40E+12 2.40E+13 25,000 2.50E i06 2.50E+07 2.50E+08 2.50E+09 2.50E+10 2.50E H1 2.50E+12 2.50E- 13 26,000 2.60E+06 2.60E+07 2.60E+08 2.60E+09 2.60E-10 2.60E+11 260E+12 2.60E-13Attorney Docket No. PIV-00054 WOCorn Population1.00E+02 1.00E+03 1.00E+04 1.00E+05 1.00E+06 1.00E+07 1.00E+08 1.00E+09 (seeds per acre)27,000 2.70E+06 2.70E+07 2.70F.+08 2.70E+09 2.70E+10 2.70E+11 270E+12 2.70EX13 28,000 2.80E+06 2 80E+07 2.80E-08 2.80E+09 280E+10 2.80E+11 2.80E+12 2.80E+13 29,000 2.90E+06 290E+07 2.90EX08 2.90E+09 290F+10 2.90E+11 2.90E+12 2.90F.+13 30,000 3.00E+06 3.00E+07 3.00E+08 3.00E+09 3.00EH0 3.00E+11 300E+12 3.00E- 13 31,000 3.10E+06 3.10E+07 3.10F.m8 3.10E+09 3.10E+10 3.10E+11 3 10F+ 12 3.10EX13 32,000 3.20E+06 3.20E+07 3.20E-08 3.20E+09 3.20E+10 3.20E+11 3.20E+12 3.20E+13 33,000 3.30E+06 3 30E+07 3.30EX08 3.30E+09 3.30E+10 3.30E+11 3.30E+12 3.30F.+13 34,000 3.40E I06 3.40E+07 3.40E+08 3.40E+09 3.40EH0 3.40E+ 11 3.40E+12 3.40E- 13 35,000 3.50E+06 3.50E+07 3.50E+08 3.50E+09 3.50EX10 3.50E+11 3.50E+12 3.50E-13 36,000 3.60E i 06 3.60E I 07 3.60E 08 3.60E 109 3.60E 10 3.60E I 11 3.60EI 12 3.60E 13 37,000 3.70E i 06 3.70E 107 3.70E!08 3.70E 109 3.70F f 10 3.70E I 11 3.70EI 12 3.70F. ) 13 38,000 3.80E +06 3.80E+07 3.80E+08 3.80E+09 3.80E+10 3.80EH1 3.80E+12 3.80E- 13 39,000 3.90E+06 3.90E+07 3.90Ef08 3.90E+09 3.90E+10 3.90E+11 3.90E+12 3.90E+13 40,000 4.00E+06 4.00E+07 4.00E-08 4.00E+09 4.00E+10 4.00E+11 4.00EH2 4.00E+13 41,000 4.10E+06 4.10E+07 4.10E+08 4.10E+09 4.10E H0 4.10E H1 4.10E+12 4.10E- 13

[0227] For in-furrow and seed treatment embodiments, in some embodiments, the dispersion of live microbes microbes can be applied to provide microbes at a CFU concentration per acre of about 1E9-1E13 CFU / acre. In some embodiments, the dispersion of live microbes microbes can be applied to provide microbes at a CFU concentration per acre of about: 3E9, 1.5E10, 3E10, 1.5E11, 3E11, 8E11, 1.5E12, 3E12, or more.

[0228] In some embodiments, an aqueous dispersion of live microbes (e.g, live nitrogen fixing bacteria) is applied in-furrow or as a seed treatment to provide microbes at a concentration of between about 3E9 to about 3E12 CFU per acre. In the aqueous dispersion of live microbes that is to be applied in furrow or as a seed treatment, the microbes can be present at a CFU concentration per milliliter of: 1 × 101, 1 x 102, 1 * 103, 1 x 104, I x IO5, 1 x 106, I xAttorney Docket No. PIV-00054 WOIO7, 1 * 10*, 1 x io9, 1 × 1010, 1 x 1O1!, I x so12, 1 x io13, ormore. In some embodiments, the aqueous dispersion of live microbes that is to be applied in furrow or as a seed treatment comprise microbes at a concentration of about 1 × 106to about 1 × 109CFU / mL. In some embodiments, the dispersion of live microbes that is to be applied in furrow or as a seed treatment comprise microbes at a concentration of about 1 × 107to about 1 × 1010CFU per milliliter In some embodiments, the dispersion of live microbes that is to be applied in furrow or as a seed treatment comprise microbes at a concentration of about 1 × 108to about 1 × 109CFU per milliliter. In some embodiments, the liquid dispersion of live microbes that is to be applied in furrow or as a seed treatment comprise microbes at a concentration of up to about 1 × 1013CFU per milliliter.

[0229] In some embodiments, the composition comprising the microbes (e.g., nitrogen fixing bacteria), such as the spray dried composition or a corresponding coating composition, has an on plant stability of at least 4 weeks (e.g., at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 8 weeks, at least 9 weeks, at least 10 weeks, at least 11 weeks, or at least 12 weeks) at about room temperature (e.g., about 21 °C). On plant stability can be determined by a log reduction of about 0.8 or less (e.g.. about 0.7 or less, about 0.6 or less, about 0.5 or less, about 0.4 or less, about 0.3 or less, or about 0.2 or less) in the concentration of the microbes (e.g., nitrogen fixing bacteria) of the composition comprising the microbes (e.g., nitrogen fixing bacteria) prior to coating a plant portion (e.g., in furrow or on seed).

[0230] The present disclosure provides methods for improving one or more aspects of agricultural plant characteristics with the spray dried composition or corresponding coating composition, comprising a) contacting a spray dried composition disclosed herein with a liquid to produce a dispersion of live microbes; and b) applying the dispersion of live microbes to a locus comprising the plant, thereby colonizing the locus with the microbes. In some embodiments, the one or more aspects of the agricultural plant characteristics comprises health, yield, yield variance, stress resistance, growth, or agronomic characteristics of the plant. In some embodiments, the present methods are used to increase agricultural plant crop yield and / or decrease agricultural plant crop yield variance.

[0231] In some embodiments, the methods are used to supply nitrogen to the plant. That is, the disclosure provides method for supplying nitrogen to a plant, the method comprising: contacting as spray dried composition disclosed herein with a liquid to produce a dispersion of live nitrogen fixing bacteria; and applying the dispersion of live nitrogen fixing bacteria to aAttorney Docket No. PIV-00054 WOlocus comprising the plant, thereby colonizing the locus with the nitrogen fixing bacteria, thereby supplying nitrogen to the plant,

[0232] The present disclosure is characterized by the following embodiments.

[0233] Embodiment 1. A spray dried composition comprising a nitrogen fixing bacteria, a bulking agent, a desiccation protectant, an antioxidant, and a coating agent.

[0234] Embodiment 2. The spray dried composition of Embodiment 1, wherein the nitrogen fixing bacteria is gram-negative.

[0235] Embodiment 3. The spray dried composition of Embodiment 1 or 2, wherein the nitrogen fixing bacteria comprise at least one bacterium from the group consisting of Kosakonia. Klebsiella, Citrobacter, Flavobacterium, Achromobacter, Arthrobacter, Azospirillum. Azotobacter, Paraburkholderia, Herbaspirillum. Phytobacter, Pseudomonas, Rahnella, Gluconacetobacter, Azoarcus. Trinickia, Rhizobium, Rhodobacter, Rubrivivax, Paenibacillus, Pseudacidovorax, Ensifer, Burkholderia, Sphingomonas, and Hydrogenophag.

[0236] Embodiment 4. The spray dried composition of any one of Embodiments 1-3, wherein the nitrogen fixing bacteria comprise Kosakonia. Klebsiella, or both Kosakonia and Klebsiella.

[0237] Embodiment 5. The spray dried composition of any one of Embodiments 1-4, wherein the nitrogen fixing bacteria comprise at least one genetic variation introduced into a member selected from the group consisting of: nifA, nifL, ntrB, ntrC. polynucleotide encoding glutamine synthetase, glnA, glnB, glnK, draT, amtB, polynucleotide encoding glutaminase, glnD, glnE, nifJ, nifH, nifD, nifK, nifY, nifE, nifN, nifU, nifS, nifV, nifW, nifZ, nifM, nifF, nifB, nifQ, a gene associated with biosynthesis of a nitrogenase enzyme, and combinations thereof

[0238] Embodiment 6. The spray dried composition of any one of Embodiments 1-5, wherein the nitrogen fixing bacteria comprise at least one genetic variation introduced into at least one gene, or non-coding polynucleotide, of the nitrogen fixation or assimilation genetic regulatory network that results in one or more of: increased expression or activity of NifA or glutaminase; decreased expression or activity of NifL, NtrB, glutamine synthetase, GlnB, GlnK, DraT, AmtB; decreased adenylyl-removing activity of GlnE; and decreased uridylyl -removing activity of GlnD.

[0239] Embodiment 7. The spray dried composition of any one of Embodiments 1-6, wherein the nitrogen fixing bacteria are selected from bacteria deposited as ATCC PTA-126575,Attorney Docket No. PIV-00054 WObacteria deposited as ATCC PT A- 126576, bacteria deposited as ATCC PTA-126577, bacteria deposited as ATCC PTA-126578, bacteria deposited as ATCC PTA-126579, bacteria deposited as ATCC PTA-126580, bacteria deposited as ATCC PTA-126584, bacteria deposited as ATCC PTA-126586, bacteria deposited as ATCC PTA-126587, bacteria deposited as ATCC PTA-126588, bacteria deposited as PTA-126740, bacteria deposited as PTA-126743, bacteria deposited as NCMA 201701002, bacteria deposited as NCMA 201708004, bacteria deposited as NCMA 201708003, bacteria deposited as NCMA 201708002, bacteria deposited as NCMA 201712001. bacteria deposited as NCMA 201712002, and any combination thereof.

[0240] Embodiment 8. The spray dried composition of Embodiment 1, wherein the nitrogen fixing bacteria is a probiotic.

[0241] Embodiment 9. The spray dried composition of Embodiment 8, wherein the probiotic is at least one selected from Lactobacillus, Bifidobacterium, Saccharomyces, Streptococcus, Enterococcus, Escherichia, and Bacillus.

[0242] Embodiment 10. The spray dried composition of any one of Embodiments 1-9, wherein the bulking agent comprises a monosaccharide, a disaccharide, an oligosaccharide, a polysaccharide, or any combination thereof, wherein the polysaccharide is a dextrin, a cellulose, a starch, a gum, or any combination thereof.

[0243] Embodiment 11. The spray dried composition of Embodiment 10, wherein the bulking agent is fructose, glucose, galactose, trehalose, sucrose, lactose, maltose, isomaltose, raffinose, a fructooligosaccharide, a galactooligosaccharide, a xylooligosaccharide, verbascose, maltodextrin, a cyclodextrin, ethylcellulose, methylcellulose, hydroxypropyl cellulose, carboxymethyl cellulose, hydroxypropylmethylcellulose, cornstarch, sweet potato starch, potato starch, quinoa starch, crosslinked starch, cassava starch, debranched lentil starch, retrograded starch, tapioca starch, carboxymethyl starch, taro succinylated starch, hi-maize resistant starch, inulin, gum acacia, agar, alginic acid, an alginate, carrageenan, gum ghatti, gum tragacanth, karaya gum, guar gum, locust bean bum, beta-glucan, dammar gum, glucomannan, tara gum, gellan gum. xanthan gum, or any combination thereof.

[0244] Embodiment 12. The spray dried composition of Embodiment 10 or 11, wherein the polysaccharide comprises maltodextrin.Attorney Docket No. PIV-00054 WO

[0245] Embodiment 13. The spray dried composition of any one of Embodiments 1-12, wherein the desiccation protectant comprises a saccharide, a sugar alcohol, a metal oxide, a clay, or any combination thereof.

[0246] Embodiment 14. The spray dried composition of Embodiment 13, wherein tire desiccation protectant comprises fructose, glucose, galactose, trehalose, sucrose, lactose, maltose, isomaltose, raffinose, xylitol, sorbitol, mannitol, maltitol, erythritol. lactitol, isomalt, alumina, silica, aluminum silicate, zirconia, titania, bentonite, vermicullite, kaolinite, illite, or any combination thereof.

[0247] Embodiment 15. The spray dried composition of Embodiment 14, wherein the desiccation protectant is trehalose.

[0248] Embodiment 16. Tire spray dried composition of any one of Embodiments 1-15, wherein the antioxidant comprises a vitamin, a carotenoid, tocofersolan, glutathione, an organic acid, an enzyme, a flavonoid, a phenol, a polyphenol, a phenolic acid, a stilbene, a tannin, a coumarin, a lignan, or any combination thereof.

[0249] Embodiment 17. The spray dried composition of any one of Embodiments 1-16, wherein the antioxidant comprises ascorbic acid, a tocopherol, carotene, lutein, zeaxanthin, canthaxanthin, astaxanthin, echinenone, fucoxanthin, p-cryptoxanthin, lycopene, citric acid, tartaric acid, uric acid, a gallate, erythorbic acid, t-butylhydroquinone, butylated hydroxyanisole, butylated hydroxytoluene, a lecithin, superoxide dismutase, catalase, glutathione peroxidase, a flavone, a chalcone, a flavanone, a flavanol, an anthocyanin, an isoflavonoid, hydroxybenzoic acid, hydroxycinnamic acid, chlorogenic acid, ferulic acid, sinapic acid, protocatechuic acid, vanillic acid, syringic acid, gallic acid, caffeic acid, coumaric acid, vanillin, salicylic acid, pyrocatechol, resorcinol, cresol, hydroquinone, eugenol, umbelliferone, a capsaicinoid, resveratrol, piceatannol, ellagic acid, tannic acid, gallotannin, ellagitannin, curcumin, catechin, epicatechin, gallocatechin, leukoanthocyanidin, enterolactone, enterodiol, lariciresinol, matairesinol, sesamol, pinoresinol, secoisolariciresinol diglucoside, secoisolariciresinol, alpha conidendrin, nordihydroguaiaretic acid, coumarin, hydroxy coumarin, dihydroxy coumarin, hydroxy-methylcoumarin, phenylcoumarin, any salt of the foregoing, or any combination thereof.

[0250] Embodiment 18. The spray dried composition of any one of Embodiments 1-17, wherein the antioxidant comprises ascorbic acid or a salt thereof.Attorney Docket No. PIV-00054 WO

[0251] Embodiment 19. The spray dried composition of any one of Embodiments 1-18, wherein the coating agent comprises a biopolymer.

[0252] Embodiment 20. The spray dried composition of Embodiment 19, wherein the coating agent comprises a protein, a gum, a starch, a pectin, a cellulose, a clay, glycine betaine, or any combination thereof.

[0253] Embodiment 21. The spray dried composition of Embodiment 20, wherein the protein comprises at least one animal source protein, at least one plant protein, or a combination thereof.

[0254] Embodiment 22. The spray dried composition of Embodiment 21, wherein the protein comprises whey protein, casein, a milk product, keratin, collagen, gelatin, surimi, albumin, mucoprotein, globulin, com protein, soy protein, mung bean protein, chickpea protein, pea protein, grass pea protein, quinoa protein, bitter vetch, sunflower protein, hemp protein, pumpkin seed protein, nut protein, flaxseed protein, any salt of the foregoing, or any combination thereof.

[0255] Embodiment 23. The spray dried composition of Embodiment 22, wherein the protein comprises whey protein

[0256] Embodiment 24. The spray dried composition of Embodiment 20, wherein the coating agent comprises ethylcellulose, methylcellulose, hydroxypropyl cellulose, carboxymethyl cellulose, hydroxypropylmethylcellulose, cornstarch, sweet potato starch, potato starch, quinoa starch, crosslinked starch, cassava starch, debranched lentil starch, retrograded starch, tapioca starch, carboxymethyl starch, taro succinylated starch, hi-maize resistant starch, inulin, gum acacia, agar, alginic acid, an alginate, carrageenan, gum ghatti. gum tragacanth, karaya gum, guar, high methoxyl pectin, low methoxyl pectin, bentonite, vermicullite, kaolinite, illite, glycine betaine, or any combination thereof.

[0257] Embodiment 25. The spray dried composition of any one of Embodiments 1-24, wherein the composition has a water activity of about 0.1 to about 0.4.

[0258] Embodiment 26. The spray dried composition of any one of Embodiments 1-25, wherein the composition has a moisture content of about 1 wl% to about 6.5 wt%.

[0259] Embodiment 27. The spray dried composition of any one of Embodiments 1-26, wherein the composition has an in-package stability of at least 5 weeks at about roomAttorney Docket No. PIV-00054 WOtemperature as determined by a log reduction of about 0.5 or less in the concentration of the nitrogen fixing bacteria.

[0260] Embodiment 28. The spray dried composition of any one of Embodiments 1-27, wherein the composition has an in-package stability of at least 10 months at about 4 °C as determined by a log reduction of about 0.5 or less in the concentration of the nitrogen fixing bacteria.

[0261] Embodiment 29. The spray dried composition of any one of Embodiments 1-28, wherein a concentration of the nitrogen fixing bacteria has a log reduction of 2 or less in the spray dried composition relati ve to an initial concentration of the nitrogen fixing-bacteria.

[0262] Embodiment 30. The spray dried composition of any one of Embodiments 1-29 further comprising a seed.

[0263] Embodiment 31. The spray dried composition of Embodiment 30, wherein the seed is from com, wheat, barley, rice, sorghum, millet, oats, rye, triticale, buckwheat, sugar cane, canola, soybean, potato, onion, tomato, strawberry, or asparagus

[0264] Embodiment 32. A coating composition comprising water and the spray dried composition of any one of Embodiments 1-29.

[0265] Embodiment 33. The coating composition of Embodiment 32, wherein the spray dried composition comprises Kosakonia, Klebsiella, or both Kosakonia and Klebsiella, maltodextrin, trehalose, ascorbic acid, and whey protein.

[0266] Embodiment 34. The coating composition of Embodiment 32 or 33 further comprising at least one additive selected from polyol, a buffer, a prebiotic, and a polymer that is exogenous to the nitrogen fixing bacteria.

[0267] Embodiment 35. Hie coating composition of Embodiment 34, wherein the polymer is selected from polyvinylpyrrolidone (PVP), polyvinyl acetate, a cellulose (e.g., ethylcellulose, methyl cellulose, carboxymethyl cellulose, hydroxypropylcellulose), an alginate, carrageenan, gum arabic, xanthan gum, starch, a starch derivative, pullulan, chitosan, a glycosaminoglycan (GAG), polymerized fibrin, arabino-galactan, a lecithin, formononetin, alkali formononetinate, hesperetin, a cephalin, mineral oil, polyacrylate, polymethyacrylate, polyethylene glycol, polyacrylic acid, polymethacrylic acid, polystyrene-butadiene. polystyrene-acrylic, poly(lactic-co-glycolic acid) (PLGA), polyvinyl alcohol, polyvinyl chloride, polyvinylacrylate, polyhydroxy ethyl acrylate, poly chloroprene, polyethylene oxide,Attorney Docket No. PIV-00054 WOpolyamide, polyethylene glycol (PEG), polyacrylamide, polyacrylonitrile, polystyrene, polyoxyethylene-polyoxybutylene block copolymers any copolymer of the foregoing, and any combination thereof.

[0268] Embodiment 36. A coated plant comprising a plant portion coated with the spray dried composition of any one of Embodiments 1-31 or the coating composition of any one of Embodiments 32-35.

[0269] Embodiment 37. The coated plant of Embodiment 36, wherein the plant portion comprises a seed, a leaf, a stem, or any combination thereof.

[0270] Embodiment 38. The coated plant of Embodiment 37, wherein, the seed is from corn, wheat, barley, rice, sorghum, millet, oats, rye, triticale, buckwheat, sugar cane, canola, soybean, potato, onion, tomato, strawberry, or asparagus.[002711 Embodiment 39. The coated plant of Embodiment 38, wherein the seed is a com seed.

[0272] Embodiment 40. The coated plant of any one of Embodiments 36-39, wherein the coating composition has an on plant stability of at least 4 weeks at about room temperature as determined by a log reduction of about 0.8 or less m the concentration of the nitrogen fixing bacteria of the coating composition prior to coating the seed.

[0273] Embodiment 41. A method of forming a spray dried composition comprising contacting a liquid composition with a heated gas, wherein the liquid composition comprises water. a nitrogen fixing bacteria, a bulking agent, a desiccation protectant, an antioxidant, and a coating agent;introducing the liquid composition into a chamber through a nozzle; anddrying the liquid composition in the chamber to provide a spray dried composition.

[0274] Embodiment 42. The method of Embodiment 41, w herein the liquid composition is an emulsion or dispersion.

[0275] Embodiment 43. The method of Embodiment 41 or 42, wherein the liquid composition is atomized when passing through the nozzle.[00276| Embodiment 44. The method of any one of Embodiments 41-43, wherein the nozzle is a rotary atomizer.

[0277] Embodiment 45. The method of any one of Embodiments 41-44, wherein an inlet temperature of the heated gas is about 130 to about 170 °C.Attorney Docket No. PIV-00054 WO

[0278] Embodiment 46. The method of any one of Embodiments 41-45, wherein the outlet temperature of the chamber is about 50 to about 85 °C.

[0279] Embodiment 47. The method of any one of Embodiments 41-46, wherein the residence time of the liquid composition in the chamber is less than about 5 min.

[0280] Embodiment 48. The method of any one of Embodiments 41-47, wherein the spray dried composition comprises particles with an average particle size (D50) of about 10 to about 50 pm.

[0281] Embodiment 49. The method of any one of Embodiments 41-48, wherein the nitrogen fixing bacteria is gram-negative.

[0282] Embodiment 50. The method of any one of Embodiments 41-49. wherein the nitrogen fixing bacteria comprise at least one bacterium from the group consisting of Kosakonia, Klebsiella, Citrobacter. Flavobacterium, Achromobacter, Arthrobacter, Azospirillum, Azotobacter, Paraburkholderia, Herbaspir ilium, Phytobacter, Pseudomonas, Rahnella, Gluconacetobacter, Azoarcus. Trinickia, Rhizobium, Rhodobacter, Rubrivivax, Paenibacillus, Pseudacidovorax, Ensifer, Burkholderia, Sphingomonas, and Hydrogenophaga.

[0283] Embodiment 51. The method of any one of Embodiments 41-50, wherein the nitrogen fixing bacteria comprise Kosakonia, Klebsiella, or both Kosakonia and Klebsiella.

[0284] Embodiment 52. The method of any one of Embodiments 41-51. wherein the nitrogen fixing bacteria comprise at least one genetic variation introduced into a member selected from the group consisting of: nifA, niJL, ntrB, ntrC, polynucleotide encoding glutamine synthetase, glnA, glnB, glnK, draT, amtB, polynucleotide encoding glutaminase, glnD, glnE, nifJ, nifH, nifD, nifK, nifl’, nifE. niJN, nifU, nifS, nifV, nifW, nifZ. nifM, nifY, nifB, nifO, a gene associated with biosynthesis of a nitrogenase enzyme, and combinations thereof.

[0285] Embodiment 53. The method of any one of Embodiments 41-52, wherein the nitrogen fixing bacteria comprise at least one genetic variation introduced into at least one gene, or non¬ coding polynucleotide, of the nitrogen fixation or assimilation genetic regulatory network that results in one or more of: increased expression or activity of NifA or glutaminase; decreased expression or activity of NifL, NtrB. glutamine synthetase, GlnB. GlnK. DraT, AmtB; decreased adenylyl-removing activity of GlnE; and decreased uridylyl-removing activity of GlnD.Attorney Docket No. PIV-00054 WO

[0286] Embodiment 54. The method of any one of Embodiments 41-53, wherein the nitrogen fixing bacteria are selected from bacteria deposited as ATCC PTA-126575, bacteria deposited as ATCC PTA-126576, bacteria deposited as ATCC PTA-126577, bacteria deposited as ATCC PTA-126578, bacteria deposited as ATCC PTA-126579, bacteria deposited as ATCC PTA-126580. bacteria deposited as ATCC PTA-126584, bacteria deposited as ATCC PTA-126586, bacteria deposited as ATCC PTA-126587, bacteria deposited as ATCC PTA-126588, bacteria deposited as PTA-126740, bacteria deposited as PTA- 126743, bacteria deposited as NCMA 201701002, bacteria deposited as NCMA 201708004. bacteria deposited as NCMA 201708003, bacteria deposited as NCMA 201708002. bacteria deposited as NCMA 201712001, bacteria deposited as NCMA 201712002, and any combination thereof.[00287| Embodiment 55. The method of Embodiment 41, wherein the nitrogen fixing bacteria is a probiotic.

[0288] Embodiment 56. The method of Embodiment.55, wherein the probiotic is at least one selected from Lactobacillus, Bifidobacterium, Saccharomyces, Streptococcus. Enterococcus, Escherichia, and Bacillus.

[0289] Embodiment 57. The method of any one of Embodiments 41-56, wherein the bulking agent comprises a monosaccharide, a disaccharide, an oligosaccharide, a polysaccharide, or any combination thereof, wherein the polysaccharide is a dextrin, a cellulose, a starch, a gum, or any combination thereof.

[0290] Embodiment 58. The method of Embodiment 57, wherein the bulking agent is fructose, glucose, galactose, trehalose, sucrose, lactose, maltose, isomaltose, raffinose, a fructooligosaccharide, a galactooligosaccharide, a xyiooligosaccharide, verbascose, maltodextrin, a cyclodextrin, ethylcellulose, methylcellulose, hydroxypropyl cellulose, carboxymethyl cellulose, hydroxypropylmethylcellulose, cornstarch, sweet potato starch, potato starch, quinoa starch, crosslinked starch, cassava starch, debranched lentil starch, retrograded starch, tapioca starch, carboxymethyl starch, taro succinyl ated starch, hi-maize resistant starch, inulin, gum acacia, agar, alginic acid, an alginate, carrageenan, gum ghatti, gum tragacanth, karaya gum, guar gum, locust bean bum, beta-glucan, dammar gum, glucomannan, tara gum, gellan gum, xanthan gum, or any combination thereof.

[0291] Embodiment 59. The method of Embodiment 58, wherein the polysaccharide comprises maltodextrin.Attorney Docket No. PIV-00054 WO

[0292] Embodiment 60. The method of any one of Embodiments 41-59, wherein the desiccation protectant comprises a saccharide, a sugar alcohol, a metal oxide, a clay, or any combination thereof.

[0293] Embodiment 61. The method of Embodiment 60, wherein the desiccation protectant comprises fructose, glucose, galactose, trehalose, sucrose, lactose, maltose, isomaltose, raffinose, xylitol, sorbitol, mannitol, maltitol. erythritol, lactitol, isomalt, alumina, silica, aluminum silicate, zirconia, titania, bentonite, vermicullite, kaolinite, illite, or any combination thereof.

[0294] Embodiment 62. The method of Embodiment 61, wherein the desiccation protectant is trehalose.

[0295] Embodiment 63. The method of any one of Embodiments 41-62, wherein the antioxidant comprises a vitamin, a carotenoid, tocofersolan, glutathione, an organic acid, an enzyme, a flavonoid, a phenol, a polyphenol, a phenolic acid, a stilbene, a tannin, a coumarin, a lignan, or any combination thereof.

[0296] Embodiment 64. The method of any one of Embodiments 41-63, wherein the antioxidant comprises ascorbic acid or a salt thereof, a tocopherol, carotene, lutein, zeaxanthin, canthaxanthin, astaxanthin, echinenone, fucoxanthin, p-cryptoxanthin, lycopene, citric acid, tartaric acid, uric acid, a gallate, erythorbic acid, t-butylhydroquinone, butylated hydroxyanisole, butylated hydroxytoluene, a lecithin, superoxide dismutase, catalase, glutathione peroxidase, a flavone, a flavonol, a flavanone, a chalcone, an anthocyanin, an isoflavonoid, hydroxybenzoic acid, hydroxycinnamic acid, chlorogenic acid, ferulic acid, sinapic acid, protocatechuic acid, vanillic acid, syringic acid, gallic acid, caffeic acid, coumaric acid, vanillin, salicylic acid, pyrocatechol, resorcinol, cresol, hydroquinone, eugenol, umbelliferone, a capsaicinoid, resveratrol, piceatannol, ellagic acid, tannic acid, gallotannin, ellagitannin, curcumin, catechin, epicatechin, gallocatechin, leukoanthocyanidin, enterolactone, enterodiol, lariciresinol, matairesinol, sesamol, pinoresinol, secoisolariciresinol diglucoside, secoisolariciresinol, alpha conidendrin, nordihydroguaiaretic acid, coumarin, hydroxy coumarin, dihydroxy coumarin, hydroxy-methylcoumarin, phenylcoumarin, any salt of the foregoing, or any combination thereof.

[0297] Embodiment 65. The method of any one of Embodiments 41-64, wherein the antioxidant comprises ascorbic acid or a salt thereof.Attorney Docket No. PIV-00054 WO

[0298] Embodiment 66. The method of any one of Embodiments 41-65, wherein the coating agent comprises a biopolymer.

[0299] Embodiment 67. The method of Embodiment 66, wherein the coating agent comprises a protein, a gum, a starch, a pectin, a cellulose, a clay, glycine betaine, or any combination thereof

[0300] Embodiment 68. The method of Embodiment 67, wherein the protein comprises at least one animal source protein, at least one plant protein, or a combination thereof.

[0301] Embodiment 69. Hie method of Embodiment 67 or 68, wherein the protein comprises whey protein, casein, a milk product, keratin, collagen, gelatin, surimi, albumin, mucoprotein, globulin, com protein, soy protein, mung bean protein, chickpea protein, pea protein, grass pea. protein, quinoa protein, bitter vetch, sunflower protein, hemp protein, pumpkin seed protein, nut protein, flaxseed protein, any salt of the foregoing, or any combination thereof.

[0302] Embodiment 70 The method of Embodiment 69, wherein the protein comprises whey protein.

[0303] Embodiment 71. The method of Embodiment 67, wherein the coating agent comprises ethylcellulose, methylcellulose, hydroxypropyl cellulose, carboxymethyl cellulose, hydroxypropylmethylcellulose, cornstarch, sweet potato starch, potato starch, quinoa starch, crosslinked starch, cassava starch, debranched lentil starch, retrograded starch, tapioca starch, carboxymethyl starch, taro succinylated starch, hi-maize resistant starch, inulin, gum acacia, agar, alginic acid, an alginate, carrageenan, gum ghatti, gum tragacanth, karaya gum, guar, high methoxyl pectin, low- methoxyl pectin, bentonite, vermicullite, kaolinite, illite, glycine betaine, or any combination thereof.

[0304] Embodiment 72. The method of any one of Embodiments 41-71, wherein the composition has a water activity of about 0.1 to about 0.4

[0305] Embodiment 73. The method of any one of Embodiments 41-72, wherein the composition has a moisture content of about 1 wt% to about 6.5 wt%.

[0306] Embodiment 74. The method of any one of Embodiments 41-73, wherein the composition has an in-package stability of at least 5 weeks at about room temperature as determined by a log reduction of about 0.5 or less in the concentration of the nitrogen fixing bacteria.Attorney Docket No. PIV-00054 WO

[0307] Embodiment 75. The method of any one of Embodiments 41-74, wherein the composition has an in-package stability of at least 10 months at about 4 °C as determined by a log reduction of about 0.5 or less in the concentration of the nitrogen fixing bacteria.

[0308] Embodiment 76. Hie method of any one of Embodiments 41-75, wherein a concentration of the nitrogen fixing bacteria has a log reduction of 2 or less in the spray dried composition relative to an initial concentration of the nitrogen fixing-bacteria.

[0309] Embodiment 77. The method of any one of Embodiments 41-76, wherein the liquid composition comprises Kosakonia. Klebsiella, or both Kosakonia and Klebsiella, maltodextrin, trehalose, ascorbic acid, and whey proteinEXAMPLESExample 1

[0310] This example compared the effects of different carriers on the functional, structural, and storage stability properties of spray-dried powders containing a gram negative bacteria m an embodiment of the invention.

[0311] Liquid compositions were prepared with a 26.66% excipient content. Formulation 1 was modified to form Formulations 2, 3, and 6, in which 5% of the maltodextrin content -was substituted with the respective excipient: whey protein, casein, or bentonite. Maltodextrin, whey protein, casein, modified starch, gum Arabic, bentonite, and talc were evaluated in a basal formulation that further included 13.33% trehalose as a desiccation protectant and the remainder water. A Klebsiella variicola 137-2253 strain, which is a gram negative bacteria, was used as the microbe sample at a broth concentration of about 1E10 CFU / mL. The microbial broth was combined -with each formulation in a 1: 1 (volume to volume) ratio.

[0312] The formulated cultures were fed to the spray dryer through the nozzle and spray dried under the conditions set forth in Table 6. Physical properties of the resulting powders were measured, as set forth in Table 7.Table 6Form Culture Outlet Temperature Feed Rate Formulation ExcipientDensity (g / mL) (°C) (L / hr) 1 maltodextrin 1.08 53 0.97Attorney Docket No. PIV-00054 WO2 whey protein 1.08 54 0.94 3 casein 1.07 52 1.01 4 modified starch 1.07 47 0.98 5 gum Arabic 1.06 52 0.96 6 bentonite 1.08 50 1.00 rehydraTed gum7 1.07 55 0.95arabicTable 7Powder Water Powder Moisture Form Log FormulationYield (%) Activity Content (%) Loss1 82 0.28 4.9 1.62 97 0.25 3.3 1.43 91 0.22 6.3 2.44 52 0.49 8.1 1.555 86 0.23 4 9 1.66 86 0.28 4.4 1.47 87 0.2363 4.69 1.63

[0313] Using the maltodextrin and trehalose composition as a control (Formulation 1), ascorbic acid was added in an amount of either 10 mg / mL or 20 mg / mL. In some compositions, L-ascorbic acid-phosphate (‘" AA-2-phosphate”), which is an ascorbic acid source, was added in amounts to provide 10 mg / mL or 20 mg / mL ascorbic acid. The vanous liquid compositions were spray dried under the conditions set forth in Table 8. The physical properties of the resulting particles were measured, as set forth in Table 9.Attorney Docket No. PIV-00054 WOTable 8Additive Form Culture Outlet Feed Rate Formulation(amount) Density (g / mL) Temperature (°C) (L / hr) 1 — 1.08 52.5 0.99L-ascorbic acid8 1.08 51 0.99(10 mg / mL)L-ascorbic acid9 1.09 48.5 0.98(20 mg / mL)AA-2- 10 phosphate (5 1.09 49.5 0.94mg / mL)AA-2- 11 phosphate (10 1.09 54.6 1.01mg / mL)Table 9Powder Yield Water Powder Moisture Form Formulation(%) Activity Content (%) Log Loss1 93.2 0.17 3.8 0.998 91.6 0.21 3.7 0.999 58.2 0.35 4.6 0.9810 92.8 0.24 4 0.9411 92.2 0.16 3.7 1.01[00314 Cell viability values of the liquid formulations as spray dried powders were measured (FIG. 1). The addition of ascorbic acid reduced cell viability loss during spray drying, which is caused primarily by dehydraTion, as well as heat and oxidative stresses. The higher dosage of ascorbic acid (20 mg / mL) resulted in a decreased yield due to powder stickiness observed on the wall of the drying chamber.Example 2

[0315] This example demonstrates the effect of a coating agent in an embodiment of the in ention

[0316] Whey protein was added to the liquid composition of Formulation 8 in accordance with Table 10. Both formulations were spray dried using the following conditions. The inlet temperature was 130 °C, and the outlet temperature was 50 ± 2 °C. The nozzle pressure was 45 mm, and the aspirator was set to 100%. The pump rate was 40% (approximately 1 L / hr)Attorney Docket No. PIV-00054 WOwith a batch time of 15 minutes, and the dehumidifier turned on. The average water activity 0.2, and the average percent moisture content (MC%) was 4%.Table 10Per 1000 g mediaAdditiveFormulation 12 (g) Formulation 8 (g) deionized water 600 600maltodextrin DE- 10 206.7 256.7trehalose 13.3.3 133.3ascorbic acid 10 10whey protein 50 0

[0317] In-package stability of some of the spray dried powders are shown in FIG. 2. These data show similar decay rate trends for Formulation 12 (maltodextrin, trehalose, ascorbic acid, and whey protein) and Formulation 8 (maltodextrin, trehalose, and ascorbic acid).

[0318] Adding whey protein to spray dried formulations enhanced the 137-2253 cell viability and stability during storage. It is believed that whey protein formed a protective layer around the cells during spray drying, reducing heat and dehydraTion stress, while also contributing to a glassy matrix that stabilizes cellular structures. Whey protein’s antioxidant properties helped mitigate oxidative stress and improved powder quality by reducing stickiness and enhancing flowability. Additionally, whey protein controlled the moisture content, lowered water activity, and extended the shelflife of the bacteria.

[0319] The spray dried particles made from Formulation 12 had a viable titer over 1E9 CFU / mL after 7 weeks of storage at 4 °C (FIG. 3). As shown in FIG. 3, all the aliquots of the spray dried powders were stored at 4 °C for 49 days and then increased to 21 °C and 30 °C to study the decay rate at higher temps After being increased to 21 °C, the powder decay rate remained very similar to 4 °C. However, storage at 30 °C increased the decay rate of the spray dried powder.Example 3

[0320] This example demonstrates the effect of the concentration of total solids in the liquid composition in an embodiment of the invention.

[0321] Liquid compositions comprising different total solid percentages (13%, 21%, 26%) and excipients were spray dried in accordance with Table 11. Formulations 13 and 14Attorney Docket No. PIV-00054 WOcontained 21.66% maltodextrin DE-10 (DE: dextrose equivalent), 5% whey protein, and 13.33% trehalose. Formulations 15 and 16 contained 26.66% maltodextrin DE-10 and 13.33% trehalose. Formulation 17 contained 16% maltodextrin DE-10 and 8% trehalose. Formulation 18 contained 33.33% maltodextrin DE-10 and 16.66% trehalose. Formulation 19 contained 27.07% maltodextrin DE-10. 16.66% trehalose, and 6.25% whey protein. Table 1 ] shows the total solid contents of each formulated culture. Formulations were mixed 1: 1 (v / v) with whole broth, which had a low solid content. As a result, the final formulated cultures had measured total solid contents of 21%, 13%, and 26%, respectively.

[0322] The physical properties of the resulting particles were measured, as set forth in Table 12.Table 11Total Solids Outlet Temperature Feed Rate Formulation ExcipientContent (%) (°C) (L / hr) 13 whey protein 21 54 0.94 14 whev protein 21 51 1 15 maltodextrin 21 46 0.98 16 maltodextrin 21 52.5 0.99 17 maltodextrin 13 45.5 0.98 18 maltodextrin 26 50.5 119 whey protein 26 54.8 1Table 12Powder Powder Excipient (Total Water Form Formulation Yield MoistureSolids %) Activity Log Loss (%) Content (%)13 whey protein (21) 96.8 0.25 3.37 1.42 14 whey protein (21) 82.7 0.35 4.97 1.09 15 maltodextrin (21) 0.32 5.53 1.1 16 maltodextrin (21) 93.2 0.17 3.8 1.52 17 maltodextrin (13) 87.6 0.18 4.6 1.61 18 maltodextrin (26) 80.8 0.21 4.38 0.9619 whey protein (26) 73.6 0.27 5.4 0.75[00323 The results showed that increasing the total solids content led to a lower log loss in both the maltodextrin and whey protein formulations (FIG. 4). However, an excessively high total solids can cause the droplet surface to dry too quickly, preventing water from evaporating effectively from the center of the dry ing particle. Despite these differences in total solids, theAttorney Docket No. PIV-00054 WOmoisture content (FIG. 5) and water activity (FIG. 6) did not vary significantly across the formulationsExample 4

[0324] This example demonstrates the effect of the inlet and outlet temperatures when spray drying liquid compositions in an embodiment of the invention.

[0325] Spray drying was performed using a B-290 benchtop spray dryer (BLICHI, Switzerland). The inlet and outlet temperatures and other spray diyer conditions were chosen based on previous experiments, Tire inlet and outlet temperatures were as set forth in Table 13. After each batch of spray drying, all the spray diyer components, including the drying chamber, atomizing nozzles, cyclone, pipes, and exhaustion duct were washed, sanitized, and sterili zed. The calculation of log loss (y) was used to determine the concentration of Klebsiella variicola 137-2253 strain as CFU per gram of dry weight, before and after the spray drying process of Formulation 12.Table 13Inlet Temperature Outlet Temperature(°C) (°C)130 50150 67.5170 85

[0326] FIG. 7 shows the log loss at different inlet and outlet temperatures. FIG. 8 shows the viability of Kv cells of the spray dried powders at the various outlet temperatures.

[0327] FIGs. 9 and 10 show the moisture content (%) and water activity, respectively, of the spray dried powder made at different inlet and outlet temperatures. Although lowering the moisture content and water activity help maintain storage stability and prolong the shelf life of probiotics, it negatively impacts the physiological functions of bacteria, eventually causing physical damage to various cellular components.

[0328] As shown in FIG. 11. the spray dried powders produced at 150 °C and 170 °C were more stable when stored at higher temperatures (21 °C and 30 °C). The spray dried powderAttorney Docket No. PIV-00054 WOmade at 130 °C had a higher titer at the beginning but had a faster decay rate at 30 °C. which might be due to the higher moisture content of this powder.Example 5

[0329] This example compares the effects of spray drying a formulation prepared from whole broth versus a cell concentrate in an embodiment of the invention.

[0330] Formulation 12 was combined with either whole broth comprising Klebsiella variicola 137-2253 strain or a TFF cell concentrate thereof, each made by a pilot-scale fermenter. The combined liquid compositions were subsequently spray dried at an inlet temperature of 130 °C. FIGs. 12A and 12B show the in-package stabilities of the resulting spray dried powders prepared from the cell concentrate (FIG. 12A) and whole broth (FIG. 12B) at 4 °C, 21 °C, and 30 °C. The spray dried powder made from the cell concentrate had a high titer (over 1E11 CFU / mL) compared to the whole broth but had reduced in-package stability at room temperature.

[0331] FIG. 13 shows the on-seed stability of the spray dried pow'ders. The results demonstrate that the spray dried powder prepared from the cell concentrate was stable more than 60 day s on-seed.Example 6

[0332] This example is directed to scaling up the spray drying process in an embodiment of the invention.

[0333] An objective of this experiment was to scale the process from a bench scale to a pilotscale spray dry er by transferring Formulation 12 comprising the Klebsiella variicola 137-2253 strain to a MOBILE MINOR™ spray dryer (GEA, Germany). Spray dried pow'ders were produced using either an atomizer nozzle or a rotary atomizer using the following parameters. Both the atomizer and rotary nozzles operated at 150 °C inlet temperature, w'ith outlet temperatures of 53 °C and 57 °C, respectively. The nozzle flow rates ere 55% for the atomizer and 65% for the rotary atomizer. Both nozzles had a pump rate of 30 rpm, with nozzle pressures of 25 psi for the atomizer and 78 psi for the rotary atomizer. The viable cell counts were measured, as set forth in Table 14.Attorney Docket No. PIV-00054 WOTable 14Viable Cell Count (VCC)SampleAtomizer Nozzle Rotaiy Atomizerconcentrated cell 2.39E11 CFU / mL 2.19E11 CFU / mLformulated culture 1.02E11 CFU / mL 1.26E11 CFU / mLspray dried powder 2E11 CFU / g 2.66E11 CFU / g

[0334] The spray dried powder produced using a rotaiy atomizer had lower moisture content and water activity compared to the same spray dried powder produced using an atomizer nozzle. In addition, the spray dried powder produced using a rotaiy' atomizer had reduced log loss. Despite these improvements, the moisture content of the spray dried powders remained relatively high, which necessitated an increase in the outlet temperature.

[0335] The effect of the amount of antioxidant present m the liquid formulation was studied for both a lab scale and pilot scale.Table 15Production Ascorbic AcidFormulation Nozzle TypeScale Concentration12 lab atomizer nozzle 2.3%11 lab atomi zer nozzle 87 mg / 100 g12 pilot rotaiy- atomizer 2.3%12 pilot atomi zer nozzle 2.2%Table 16Ascorbic Acid Formulation Drying Method Sample TypeConcentration (%)12 none frozen liquid 1.4212 spray dried powder 2.78

[0336] Table 16 shows the ascorbic acid content in the formulation prior to spray drying and post spray drying. The concentration of ascorbic acid was measured in the liquid formulation before spray drying. The sample w as sent to an external lab in a frozen state.[003371 Ascorbic acid is less stable at high temperatures, so the remaining amount of ascorbic acid in the spray dried powder was tested. The measurements in Table 16 indicate that the liquid formulation contained 1.42% ascorbic acid. When mixed 1:1 with culture, the resulting formulated culture will theoretically contain 0.7% ascorbic acid. Given that the total solids content of the formulated culture is 21%, after spray diving, the dry powder, which has 4%Attorney Docket No. PIV-00054 WOtotal solids, should theoretically contain 3.2% ascorbic acid. Therefore, a result of 2.78% ascorbic acid in the dry powder indicates an 85% recovery' of ascorbi c acid. Without wishing to be bound by theory, it is believed that a low outlet temperature (e.g., about 45 to about 55 °C) and a rapid drying time resulted in keeping the ascorbic acid stable throughout the spray dry ing process.Example 7

[0338] This example is directed to scaling up the spray drying process in an embodiment of the invention.

[0339] Liquid compositions were prepared comprising Formulation 12 and the Klebsiella variicola 137-1036 strain produced at a pilot scale. The liquid compositions were either freeze dried or spray dried FIG. 14 shows the in-package decay rate at -20 °C for the resulting materials over 180 days. FIG 15 shows the in-package decay rate at -4 °C for the resulting materials over 180 days. FIG 16 shows the in-package decay rate at 21 °C for the resulting materials over 126 days.Example 8

[0340] This example compares freeze dried powders to spray dried powders in an embodiment of the invention.

[0341] Liquid compositions were prepared comprising Formulation 12 and the Klebsiella variicola 137-1036 strain. The liquid compositions were either freeze dried or spray dried. The in-package accelerated decay rate was studied at 30 °C for the resulting materials (FIG.17).

[0342] The spray dried powders and freeze dried material were each combined with an extender composition and applied to wheat and coni seeds. The spray dried microbial powder was resuspended using extender formulations (these included, but were not limited to, polysaccharides, buffers, and salts) to achieve a target titer on-seed. The concentration of powder in microbial resuspension was 2-10% powder by weight and these inoculants were applied on-seed at an application rate of 5-10 fl oz / CWT, crop dependent. The application log losses and on-seed stabilities (CFU / g) were measured over days (FIG. 18). The higher application log loss and lower initial on-seed titer observed with wheat compared to com couldAttorney Docket No. PIV-00054 WObe related to using the pesticide-containing CruiserMaxx Vibrance Cereals Seed treatment (CMVC) (Syngenta, Greensboro, NC).

[0343] The on-seed stability of Return OS, a freeze dried product for on-seed (OS) application for wheat, was compared to a spray dried product prepared from Formulation 12 and the 137- 1036 strain (FIG. 19).

[0344] A three week on-seed stability study at 4 °C and 21 °C was conducted for freeze dried and spray dried powders, each containing the 137-1036 strain. Treated seeds were prepared with either 5 fl oz / cwt or 7.5 fl oz / CWT of the corresponding freeze dried or spray dried powder either with or without CruiserMaxx Vibrance Cereals Seed treatment (CMVC) (Syngenta, Greensboro, NC), as follows. Freeze dried 137-1036 at 5 fl oz / CWT with co-application CMVC; Freeze dried 137-1036 at 7.5 fl oz / CWT with co-application CMVC: Spray dried 137- 1036 at 7.5 fl oz / CWT with co-application CMVC; and Spray dried 1 7-1036 at 5 fl oz / CWT without co-application of CMVC.

[0345] The results are set forth in FIG. 20 (one month on-seed). One month decay rate estimates of these materials were evaluated with a line of fit (linear regression line) using JMP software (JMP Statistical Discovery LLC, Cary, NC) (FIG. 21).Example 9

[0346] This example compares comparable liquid, freeze dried, and spray dried samples in an embodiment of the invention.

[0347] A liquid sample comprising water and the 137-1036 strain was mixed with an extender composition in a 3:1 ratio (microbe:extender). The liquid sample was applied to wheat seeds at a concentration of 7.5 fl oz / cwt.

[0348] A comparable liquid formulation was prepared, combined with a cryoprotectant, and freeze dried. The freeze dried cake was milled and combined with an anti-caking agent. Next, 2 wt% of the freeze dried pow der w as mixed with an extender composition and applied to wheat seeds at a concentration of 5 fl oz'cwt.

[0349] A comparable liquid formulation was prepared, combined with Formulation 12, and spray dried. Next. 2 wt% of the spray dried powder was mixed with an extender composition and applied to wheat seeds at a concentration of 5 fl oz'cwri The mixing ratio ofAttorney Docket No. PIV-00054 WOmicrobe:extender and / or the cell concentration can be adjusted to increase the CFU on-seed viability for the spray dried formulation.

[0350] The on-seed stability at 21 °C of the liquid, freeze dried, and spray dried applications are set forth in FIG. 22.

[0351] Scanning electron microscope (SEM) images were taken of the freeze dried and spray dried formulations. The spray dried powder prepared from Formulation 12 comprised spherical agglomerates that were amorphous with a smooth and intact surface without any apparent cracks or fissures. The freeze dried powder looked like random shards or platelets. FIGs. 23 A and 23B show the particle size distributions, as measured by the volume mean diameter (Dv), of the freeze dried and spray dried particles. For the freeze dried particles, the Dv(10) was 34 pm, the Dv(50) was 183 pm, and the Dv(90) was 451 pm (FIG. 23 A). The D[4.3] was 218 pm, and the span was 2.29 (span = [Dv(90) - Dv( l0)] / Dv(50)). For the spray dried particles, the Dv(10) was 12.1 pm, the Dv(50) was 24.4 pm, and the Dv(90) was 56.9 pm (FIG. 23B). The D[4,3] was 34.2 pm, and the span was 1.83.INCORPORATION BY REFERENCE

[0352] All references, articles, publications, patents, patent publications, and patent applications cited herein are incorporated by reference in their entireties for all purposes. However, mention of any reference, article, publication, patent, patent publication, and patent application cited herein is not, and should not be taken as an acknowledgment or any form of suggestion that they constitute valid prior art or form part of the common general knowledge in any country in the world.

Claims

Attorney Docket No. PIV-00054 WOCLAIMSWhat is claimed is:

1. A spray dried composition comprising a nitrogen fixing bacteria, a bulking agent, a desiccation protectant, an antioxidant, and a coating agent.

2. The spray dried composition of claim 1, wherein the nitrogen fixing bacteria is gram¬ negative.

3. The spray dried composition of claim 1 or 2, wherein the nitrogen fixing bacteria comprise at least one bacterium from the group consisting of Kosakonia, Klebsiella, Citrobacter, Flavobacterium, Achromobacter, Arthrobacter, Azospirillum, Azotobacter, Parciburkholderia, Herbaspirillum, Phytobacter, Pseudomonas. Rahnella, Gluconacetobacter, Azoarcus, Trinickia, Rhizobium, Rhodobacter, Rubrivtvax, Paenibacillus, Pseudacidovorax, Ensifer. Burkholderia, Sphingomona, and Hydrogenophaga.

4. The spray dried composition of any one of claims 1-3, wherein the nitrogen fixing bacteria comprise Kosakonia, Klebsiella, or both Kosakonia and Klebsiella.

5. The spray dried composition of any one of claims 1-4, wherein the nitrogen fixing bacteria comprise at least one genetic variation introduced into a member selected from the group consisting of: nifA. nifL, ntrB, ntrC, polynucleotide encoding glutamine synthetase, glnA, glnB, glnK. draT, amtB, polynucleotide encoding glutaminase, glnD, glnE, nifJ. nifH, nifD, nifK, nifY, nifE, nifN, nifU, nifS, nlfV, niJW, nifZ. nlfM. nifF, nifB, nifQ, a gene associated with biosynthesis of a nitrogenase enzy me, and combinations thereof.

6. The spray dried composition of any one of claims 1-5, wherein the nitrogen fixing bacteria compnse at least one genetic variation introduced into at least one gene, or non-coding polynucleotide, of the nitrogen fixation or assimilation genetic regulator,- network that results in one or more of: increased expression or activity of NifA or glutaminase: decreased expression or activity of NifL. NtrB, glutamine synthetase. GlnB, GlnK, DraT, AmtB: decreased adenylyl-removing activity of GlnE; and decreased uridylyl-removing activity of GlnD,7. The spray dried composition of any one of claims 1-6, wherein the nitrogen fixing bacteria are selected from bacteria deposited as ATCC PTA-126575, bacteria deposited asAttorney Docket No. PIV-00054 WOATCC PTA-126576, bacteria deposited as ATCC PTA-126577, bacteria deposited as ATCC PTA-126578, bacteria deposited as ATCC PTA-126579, bacteria deposited as ATCC PTA-126580, bacteria deposited as ATCC PTA-126584, bacteria deposited as ATCC PTA-126586, bacteria deposited as ATCC PTA-126587, bacteria deposited as ATCC PTA-126588, bacteria deposited as PTA- 126740, bacteria deposited as PTA- 126743, bacteria deposited as NCMA 201701002, bacteria deposited as NCMA 201708004, bacteria deposited as NCMA 201708003, bacteria deposited as NCMA 201708002, bacteria deposited as NCMA 201712001, bacteria deposited as NCMA 201712002. and any combination thereof.8 The spray dried composition of any one of claims 1-7, wherein the bulking agent comprises a monosaccharide, a disaccharide, an oligosaccharide, a polysaccharide, or any combination thereof, wherein the polysaccharide is a dextrin, a cellulose, a starch, or any combination thereof.

9. The spray dried composition of claim 8, wherein the polysaccharide comprises maltodextrin.

10. The spray dried composition of any one of claims 1-9, wherein the desiccation protectant comprises a saccharide, a sugar alcohol, a metal oxide, or any combination thereof.

11. The spray dried composition of claim 10, wherein the desiccation protectant is trehalose12. The spray dried composition of any one of claims 1-11, wherein the antioxidant comprises a vitamin, a carotenoid, tocofersolan. glutathione, an organic acid, an enzyme, a lipid, a flavonoid, a phenol, a polyphenol, a phenolic acid, a stilbene, a tannin, a coumarin, a lignan, or any combination thereof,13. The spray dried composition of any one of claims 1-12, wherein the antioxidant comprises ascorbic acid, a tocopherol, carotene, lutein, zeaxanthm, canthaxanthin, astaxanthin, echinenone, fucoxanthin, p-cryptoxanthin, lycopene, citric acid, tartaric acid, uric acid, a gallate, erythorbic acid, t-butylhydroquinone, butylated hydroxyanisole, butylated hydroxy toluene, a lecithin, superoxide dismutase, catalase, glutathione peroxidase, a flavone, a flavonol, a flavanone, a chalcone, an anthocyanin, an isoflavonoid, hydroxybenzoic acid, hydroxycinnamic acid, chlorogenic acid, ferulic acid, sinapic acid, protocatechuic acid, vanillic acid, syringic acid, gallic acid, caffeic acid, coumaric acid, vanillin, salicylic acid.Attorney Docket No. PIV-00054 WOpyrocatechol, resorcinol, cresol, hydroquinone, eugenol, umbelliferone, a capsaicinoid, resveratrol, piceatannol, ellagic acid, tannic acid, gallotannin, ellagitannin, curcumin, catechin, epicatechin, gallocatechin, leukoanthocyanidin, enterolactone, enterodiol, lariciresinol, matairesinol. sesamol, pinoresinol, secoisolariciresinol diglucoside, secoisolariciresinol, alpha conidendrin, nordihydroguaiaretic acid, coumarin, hydroxycoumarin, dihydroxycoumarin, hydroxy-methylcoumarin, phenylcoumarin, any salt of the foregoing, or any combination thereof.

14. The spray dried composition of any one of claims 1-13, wherein the antioxidant comprises ascorbic acid or a salt thereof15. The spray dried composition of any one of clams 1-14, wherein the coating agent comprises a biopolymer.

16. The spray dried composition of claim 15, wherein the coating agent comprises a protein, a gum, a starch, a pectin, a cellulose, a clay, glycine betaine, or any combination thereof.

17. The spray dried composition of claim 16, wherein the protein comprises at least one animal source protein, at least one plant protein, or a combination thereof.

18. The spray dried composition of claim 17. wherein the protein comprises whey protein.

19. The spray dried composition of any one of claims 1-18, wherein the composition has a water activity of about 0.1 to about 0.4.

20. The spray dried composition of any one of claims 1-19, wherein the composition has a moisture content of about 1 wt% to about 6.5 wt%.

21. The spray dried composition of any one of claims 1-20, wherein the composition has an in-package stability of at least 5 weeks at about room temperature as determined by a log reduction of about 0.5 or less in the concentration of the nitrogen fixing bacteria.

22. The spray dried composition of any one of claims 1-21, wherein the composition has an in-package stability of at least 10 months at about 4 °C as determined by a log reduction of about 0.5 or less in the concentration of the nitrogen fixing bacteria.Attorney Docket No. PIV-00054 WO23. The spray dried composition of any one of claims 1-22. wherein a concentration of the nitrogen fixing bacteria has a log reduction of 2 or less in the spray dried composition relative to an initial concentration of the nitrogen fixing bacteria.

24. A coating composition comprising water and the spray dried composition of any one of claims 1-23.

25. The coating composition of claim 24, wherein the spray dried composition comprises Kosakonia, Klebsiella, or both Kosakonia and Klebsiella, maltodextrin, trehalose, ascorbic acid, and whey protein.

26. The coating composition of claim 25 further comprising at least one additive selected from polyol, a buffer, a prebiotic, and a polymer that is exogenous to the nitrogen fixing bacteria.

27. The coating composition of claim 26. wherein the polymer is selected from polyvinylpyrrolidone (PVP), polyvinyl acetate, a cellulose (e.g.„ ethylcellulose, methylcellulose, carboxymethyl cellulose, hydroxypropylcellulose), an alginate, carrageenan, gum arabic, xanthan gum, starch, a starch derivative, pullulan, chitosan, a glycosaminoglycan (GAG), polymerized fibrin, arabino-galactan, a lecithin, formononetin, alkali formononetinate, hesperetm. a cephalin, mineral oil, polyacrylate, polymethyacrylate, polyethylene glycol, polyacrylic acid, polymethacrylic acid, polystyrene-butadiene. polystyrene-acrylic, poly(lactic-co-glycolic acid) (PLGA), polyvinyl alcohol, polyvinyl chloride, polyvinylacrylate, polyh droxy ethyl acrylate, polychloroprene, polyethylene oxide, polyamide, polyethylene glycol (PEG), polyacrylamide, polyacrylonitrile, polystyrene, polyoxyethylene-poly oxybutylene block copolymers any copolymer of the foregoing, and any combination thereof.

28. A method of forming a spray dried composition comprisingcontacting a liquid composition with a heated gas, wherein the liquid composition comprises water, a nitrogen fixing bacteria, a bulking agent, a desiccation protectant, an antioxidant, and a coating agent:introducing the liquid composition into a chamber through a nozzle; anddrying the liquid composition in the chamber to provide a spray dried composition.Attorney Docket No. PIV-00054 WO29. The method of claim 28, wherein the liquid composition is an emulsion or dispersion.

30. The method of claim 28 or 29, wherein the liquid composition is atomized when passing through the nozzle.

31. The method of any one of claims 28-30, wherein an inlet temperature of the heated gas is about 130 to about 170 °C.

32. The method of any one of claims 28-31, wherein the outlet temperature of the chamber is about 50 to about 85 °C.

33. The method of any one of claims 28-32, wherein the residence time of the liquid composition in the chamber is less than about 5 min.

34. The method of any one of claims 28-33, wherein a concentration of the nitrogen fixing bacteria has a log reduction of 2 or less in the spray dried composition relative to an initial concentration of the nitrogen fixing bacteria in the liquid composition35. The method of any one of claims 28-34, wherein the nitrogen fixing bacteria comprise at least one genetic variation introduced into a member selected from the group consisting of: nifA, nifY ntrB. ntrC. polynucleotide encoding glutamine synthetase. glnA. glnB, glnK, draT. amtB, polynucleotide encoding glutaminase, glnD, glnE. nifY. nifH, nifY), nifK, nifY, nifY, nifY, nifY, nifY. nifY, nifY’, nifY, nift, nifY,' nifY, nifQ, a gene associated with biosynthesis of a nitrogenase enzyme, and combinations thereof.

36. The method of any one of claims 28-35, wherein the bulking agent comprises a polysaccharide selected from a dextrin, a cellulose, a starch, and any combination thereof 37. The method of any one of claims 28-36, wherein the antioxidant comprises ascorbic acid or a salt thereof, a tocopherol, citric acid, tartaric acid, a gallate, erythorbic acid, t- butylhydroquinone, butylated hydroxyanisole, butylated hydroxytoluene, a lecithin, or any combination thereof.

38. The method of any one of claims 28-37, wherein the coating agent comprises whey protein, casein, a milk product, keratin, collagen, gelatin, surimi, albumin, mucoprotein, globulin, com protein, soy protein, mung bean protein, chickpea protein, pea protein, grass peaAttorney Docket No. PIV-00054 WOprotein, quinoa protein, bitter vetch, sunflower protein, hemp protein, pumpkin seed protein, nut protein, flaxseed protein, any salt of the foregoing, or any combinati on thereof.

39. The method of any one of claims 28-38. wherein the liquid composition comprises Kosakonia, Klebsiella, or both Kosakonia and Klebsiella, maltodextrin, trehalose, ascorbic acid, and whey protein.