Antigen-deprived beta cells for type 1 diabetes treatment

Antigen-deprived beta cells derived from genetically modified stem cells address the autoimmune destruction of insulin-producing cells in T1D, offering a renewable source with reduced immunosuppression needs for effective T1D treatment.

WO2026128809A1PCT designated stage Publication Date: 2026-06-18THE REGENTS OF THE UNIVERSITY OF COLORADO

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
THE REGENTS OF THE UNIVERSITY OF COLORADO
Filing Date
2025-12-12
Publication Date
2026-06-18

AI Technical Summary

Technical Problem

Current treatments for Type 1 Diabetes (T1D) involve exogenous insulin substitution and immunosuppressive drugs to maintain beta cell grafts, which are burdensome and do not address the underlying autoimmune destruction of insulin-producing cells.

Method used

Development of antigen-deprived beta cells derived from induced pluripotent stem cells, genetically modified to be deficient in Hybrid Insulin Peptides (HIPs) or Cathepsin D, reducing the need for immunosuppression by eliminating autoantigens that trigger an autoimmune response.

🎯Benefits of technology

Provides a renewable source of insulin-producing cells with reduced immunosuppression needs, potentially improving long-term outcomes and quality of life for individuals with T1D by preventing autoimmune destruction.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025059395_18062026_PF_FP_ABST
    Figure US2025059395_18062026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are compositions including a cell or cells that reduce or attenuate hybrid insulin peptide (HIP) formation, for example, a cell or cells that include an insulin gene with a genetic modification in the C-peptide sequence of the insulin gene. Also provided are methods of using the cell or cell to treat autoimmune disorders, such as type 1 diabetes (T1D), and methods of treating autoimmune disorders, such as type 1 diabetes (T1D), including inhibiting or attenuating cathepsin D (CatD) activity, and identifying CatD inhibitors to treat autoimmune disorders, such as type 1 diabetes (T1D).
Need to check novelty before this filing date? Find Prior Art

Description

Attorney Docket No. 151077-00049PRANTIGEN-DEPRIVED BETA CELLS FOR TYPE 1 DIABETES TREATMENTSTATEMENT REGARDING FEDERAL SUPPORT

[0001] This invention was made with government support under grant number R21 Al 166247 awarded by the National Institutes of Health. The government has certain rights in the invention.FIELD

[0002] The present inventive concept relates to compositions including antigen-derived beta cells, methods for treatment, and methods for development of treatment for autoimmune disease, such as Type 1 Diabetes.BACKGROUND

[0003] Type 1 Diabetes (T1D) is an autoimmune disease in which the insulin-producing beta cells in the pancreas are destroyed, leading to permanent insulin deficiency. This condition requires lifelong management, significantly impacting the quality of life of patients. Current treatments for T1D involve exogenous insulin substitution combined with rigorous blood glucose monitoring. While these methods help manage the disease, they do not address the underlying cause and can be burdensome for patients. In previous years, researchers have explored transplantation approaches to restore insulin production. Transplantation of pancreatic islets obtained from organ donors has shown promise. However, the viability of these beta cell grafts must be maintained through treatments with immunosuppressive drugs, which can have significant side effects. Advancements in stem cell technology have led to the development of beta cells or islet like clusters derived from induced pluripotent stem cells. These cells offer a potentially renewable source of insulin-producing cells for transplantation. Despite this progress, even these transplants require the use of immunosuppressants to prevent the recurrence of autoimmunity targeting self-antigens on beta cells. The inventive concept introduces a novel approach: antigen-deprived beta cells derived from induced pluripotent stem cells for syngeneic transplantation. The key innovation lies in the removal of antigens from these beta cells. By eliminating the antigens that trigger an autoimmune response, these syngeneic grafts can potentially maintain beta cell viability without the need for immune suppression or with a significantly reduced need for such treatments. This technique addresses the major challengesAttorney Docket No. 151077-00049PR associated with current T1D treatments and transplantation methods. By reducing or eliminating the need for ongoing immunosuppression, it offers the potential for a more effective and less invasive solution for patients with T1D. This approach may significantly improve long-term outcomes and quality of life for individuals living with this chronic condition. Accordingly, there is a need for novel cell-based therapies for T1D, that address both the need for a renewable source of insulin-producing cells and the challenge of recurrent autoimmunity present in conventional treatments for T1D.SUMMARY

[0004] Aspects of the inventive concept include: Genetic modification of a cell or cells, e.g., human iPSCs to either: a) Introduce a specific mutation in the insulin gene(s), changing the amino acid sequence LAL, amino acids 24-26 in the C-peptide region of proinsulin, to LAI (or any other modification at the designated L-residue), that prevents CatD from processing the C- peptide at this site, thereby inhibiting the formation of disease-relevant HIPs; or b) Knock out or significantly reduce the expression of the Cathepsin D gene, preventing the formation of HIPs altogether, and a cell or cells including such genetic modifications.

[0005] In further aspects, genetically modified iPSCs can be differentiated into beta cells or islet-like clusters that are either: a) Deficient in specific HIPs critical in the development of autoimmune diabetes, or b) Deficient in CatD, thus unable to form HIPs.

[0006] Still further aspects of the inventive concept include methods of treating, methods for developing treatment for, and methods for preventing autoimmune disorders, e.g., T1D. In some aspects, methods of the inventive concept may include using genetically modified cells that are deficient in HIPs critical in the development of autoimmune diabetes / TID. In some aspects, methods of the inventive concept may include inhibiting / reducing CatD-mediated HIP formation for T1D treatment / prevention by, e.g., knocking out or significantly reducing CatD expression, or inhibiting / reducing CatD activity.BRIEF DESCRIPTION OF THE DRAWINGS

[0007] FIG. 1. Disease-relevant HIPs: HIPs that have been identified by LC-MS / MS in islets and for which disease-relevant T cell specificities were also identified in humans and NOD mice. These HIPs form at the same peptide bond (C-terminally adjacent to the LAL-sequence) withinAttorney Docket No. 151077-00049PR insulin C-peptide. HIP1 1, which forms through the ligation of two C-peptide fragments, is targeted by CD4 T cells in humans as well as diabetes-triggering CD4 T cells in NOD mice.

[0008] FIG. 2. HIP11-responders in T1D and non-diabetic controls: IFN-y ELISPOT analyses on freshly isolated PBMCs in presence and absence (no Ag) of HIP11, revealed significantly elevated responses to HIP11 in T1D subjects. An elevated level to HIP11 was detected in only one non-diabetic subject, who was a first degree relative (FDR) of a T1D patient. FDRs have an elevated risk of developing T1D.

[0009] FIG. 3. IL-10 induces the formation of a HIP in human islets: Human islets were cultured with or without the pro-inflammatory cytokines IL- 10, TNF-a, or IFN-y. Peptides from lysed islets were enriched and analyzed by LC-MSMS. The graph shows extracted ion chromatograms (EIC) for differently treated islet samples, revealing a unique ion signature (m / z = 545.2897) in IL- 10-treated islets that was absent in other samples. The fragmentation spectrum shown matched to a HIP in our database with high confidence (Spectrum Mill Score > 10.0; Scored Peak Intensity (SPI) > 70%), suggesting the formation of this HIP was induced by IL- 10 exposure. The HIPs sequence is shown in this figure and contains a C-peptide fragment (blue) linked to a fragment derived from islet amyloid polypeptide (red).

[0010] FIG. 4. CatD primarily targets C-peptide at the site of disease-relevant HIP formation: Human C-peptide was incubated in presence of various concentrations of human CatD. Mass spectral intensities of all peptides describing a specific cleavage site were summarized. Cleavage at the primary CatD cleavage site (Leucine a position 26) generates Des-(27-31) C-peptide. HIP 11 -formation mediated by CatD at this site was also observed by LC-MS / MS and through T cell assays using the human CD4 T cell clone E2 that we isolated from peripheral blood mononuclear cells (PMBCs) of a recent onset T1D patient.

[0011] FIG. 5. Cleavage site preferences for CatD: The MEROPS database reveals the preferred cleavage site preferences for CatD. The heat map illustrates the amino acid preferences at each position (P4-P4’) surrounding the cleavage site, with darker shades indicating higher preferences. CatD strongly prefers cleaving peptide bonds when a Leu (L) residue is present at the Pl position, directly upstream of the cleavage site. In contrast, an He (I) residue at Pl inhibits CatD cleavage. These insights provide a basis for designing targeted substrate mutations to block the formation of HIPs.Attorney Docket No. 151077-00049PR

[0012] FIG. 6. Substitution of Leucine with Tsoleucine in C-peptide prevents CatD-mediated HIP formation: (Panel A) Wild-type (LAL) and modified (LAI) C-peptide were incubated with and without CatD. The HIP 11 -reactive T cell clone E2 recognized CatD-treated wild-type C- peptide, confirming HIP11 formation, but not the modified C-peptide, indicating CatD cannot form HIP11 from the modified substrate. (Panel B) Synthetic wild-type and modified HIP11 were both recognized by E2, demonstrating that the lack of response to the modified C-peptide in (Panel A) was due to the absence of HIP formation.

[0013] FIG. 7. Absence of disease-relevant HIPs in InslI / IIns2I / Idouble homozygous NOD mice: (Panel A) Quantitative comparison of HIP content in islets from wild-type and Ins2 homozygous mice (n=3). Signal for 2.5HIP was outside linear range making comparison unfeasible. (Panel B) LC-MSMS analysis of islets from wild-type (125 Islet Equivalents IEQ), Ins2 homozygous (InslL / LIns2IZI, 111 IEQ), and double homozygous (InslI / IIns2I / I, 150 IEQ) mice. Extracted ion chromatograms for HIP11 demonstrate its absence in double homozygous mice. (L and I are isomers and have the same mass). Furthermore, 2.5HIP and 6.9HIP were also not detectable. (Panel C) Log-rank test reveal a significant delay (p = 0.018) in the onset of diabetes in Ins2 homozygous mice (n=19) compared to wild-type mice (n=20).

[0014] FIG. 8. Rapid infiltration of HIP -reactive T cells into grafted islets in diabetic NOD mouse recipients: A diabetic NOD mouse transplanted with NOD. cz<7 islets under the kidney capsule was sacrificed at disease recurrence (day 11 post-transplant). Flow cytometry analysis of single-cell suspensions from the spleen, pancreas, and islet graft using antibodies against CD45, CD4, lineage markers, and 2.5HIP-loaded MHC class II tetramers revealed a substantial accumulation of 2.5HIP-reactive T cells in the grafted islets (5.44%) compared to the spleen (0.26%) and pancreas (4.01%). The presence of a large number of HIP -reactive T cells in the graft at disease recurrence suggests their crucial role in mediating the destruction of transplanted islets.

[0015] FIG. 9. Ritonavir inhibits CatD effectively: Recombinant human CatD (7nM) was pretreated with various concentrations of aspartic protease inhibitors, then incubated with a fluorescently quenched peptide substrate (200 pM; Mca / Dnp-tagged) designed for preferential cleavage by CatD. After six hours, peptide cleavage was quantified by measuring fluorescence emission at 420nm (excitation at 320nm), revealing the extent of CatD inhibition by the tested inhibitors.Attorney Docket No. 151077-00049PR

[0016] FIG. 10. Human CatD does not form HIPs at pH 5.2, unlike murine CatD: Human C- peptide was incubated with a fixed concentration of CatD at various pH levels for 2 hours. Reactions were stopped by boiling and neutralization, and the formation of HIP 11 (a product of two linked C-peptide fragments) was monitored by mass spectrometry. HIP11 spectral intensities, indicative of its content, are plotted against the reaction pH. Murine CatD generates HIP11 at pH values below 6.0, while human CatD requires pH treatments below 5.2 for HIP formation, highlighting a key difference between the two species.

[0017] FIG. 11. CatD mediates formation of B-chain HIP in vitro. Insulin Humalog was incubated at pH 4.0 for 2h in the presence of murine C-peptide and various concentrations of CatD. Reactions were quenched by neutralization and addition of the CatD-specific protease inhibitor pepstatin. Samples were then reduced, alkylated, and digested with the protease AspN. Subsequent LC- MSMS analyses led to the identification of a novel HIP. The fragmentation spectrum shown matched to a HIP in our database with high confidence (Spectrum Mill Score > 10.0; Scored Peak Intensity (SPI) > 70%). The HIP sequence shown in this figure includes a B- chain fragment (blue) covalently linked to the N- terminus of C-peptide (red). Ongoing validation experiments confirm the identity of this HIP and characterize its biological relevance in the NOD mouse model of T1D.

[0018] FIG. 12 Mouse CatD exhibits broader pH activity range and greater C-peptide processing efficiency than human CatD. Recombinant human and mouse cathepsin D (CatD) were incubated with synthetic human C-peptide at pH values ranging from 5.0 to 6.0. Following the CatD reaction, samples were digested with AspN to remove N-terminal aspartic acid residues that suppress ionization during mass spectrometry analysis. The primary CatD C-peptide cleavage product (DLQVGQVELGGGPGAGSLQPLAL) was quantified by LC-MS / MS. Mouse CatD demonstrated activity across a broader pH range (up to pH 5.8) compared to human CatD (up to pH 5.2) and generated significantly greater abundance of the cleavage product at comparable pH values within the active range of both enzymes. Neither enzyme produced detectable cleavage product above pH 6.0. This cleavage occurs at the same leucine residue (Leu26) where hybrid insulin peptides are generated through transpeptidation. Data represent mean ± SEM (n=2 independent experiments).

[0019] FIG. 13. Validation of neoHIP spectrum in IL-ip stressed human islets. Human islets were cultured with lOng / mL of the cytokine IL-ip. NeoHIP formation was observed and theAttorney Docket No. 151077-00049PR presence of the HTP was validated using our rigorous validation software Peptide-Spectrum Match Validation with Internal Standards (P-VIS). Synthetic neoHIP and the biological samples were both treated with internal peptide standards and then analyzed by MS to compare spectra. (A) Resultant spectra were confirmed to match and determined to be within our confidence interval with the spectra sharing a (B) Pearson correlation coefficient (PCC) of 0.949. The symbols and “|” indicate the presence of b ions, y ions, or both ions, respectively, corresponding to fragmentation at the specified peptide bond within the biological sample. (C) The extracted ion chromatogram for the neoHIP was assessed and showed a high abundance of the HIP had formed in the IL-13 treated sample.

[0020] FIG. 14. Validation of neoHIP spectrum in human islets treated with 285mg / dL glucose. Human islets were cultured with a high glucose concentration (285mg / dL). NeoHIP formation was observed and the presence of the HIP was validated using our rigorous validation software Peptide-Spectrum Match Validation with Internal Standards (P-VIS). Synthetic neoHIP and the biological samples were both treated with internal peptide standards and then analyzed by MS to compare spectra. (A) Resultant spectra were confirmed to match and determined to be within our (B) confidence interval with the spectra sharing a Pearson correlation coefficient (PCC) of 0.987. The symbolsand “|” indicate the presence of b ions, y ions, or both ions, respectively, corresponding to fragmentation at the specified peptide bond within the biological sample. (C) The extracted ion chromatogram for the neoHIP was assessed and illustrated a high abundance of this HIP formed in the high glucose treated sample.

[0021] FIG. 15. Identification of the neoHIP spectrum in human islets treated with lOOpM C381. Human islets were cultured in the (A) absence and (B) presence of the v-ATPase activating small molecule, C381. Islet contents were analyzed by MS and the abundance of the triply charged fragment ion of the neoHIP (545.2919) was assessed. The resultant fragmentation spectra did not align with expected fragmentation spectra of the neoHIP in the OuM C381 treated sample, however the fragmentation spectra of the lOOuM C381 treated sample had high abundances of both the doubly charged (817.4343) and triply charged ion suggesting the neoHIP did form in this sample.

[0022] FIG. 16. Multi trigger model of type 1 diabetes. A model of type 1 diabetes progression to improve upon the linear model of disease (solid line). The multi-trigger model (dotted line) indicates genetic predisposition coupled with a triggering event such asAttorney Docket No. 151077-00049PR environmental stress leads to formation of HTPs within the beta cell insulin granules. This results in immune system targeting and destruction of HIP-containing beta cells. Variability in destruction of the beta cells can occur over an extended period of time until a critical beta cell mass is reached and disease symptoms appear.

[0023] FIG. 17. Protease-Mediated formation of HIPs and their recognition by T-Cell clone E2. Protease-mediated transpeptidation reaction: Following cleavage of C-peptide at L26, water can react with the reactive intermediate to yield the C-peptide cleavage product. Alternatively, a peptide can outcompete water to react with the intermediate to form a HIP.

[0024] FIG. 18. Comparison of the abundance of intact INS1 and INS2 C-peptide, HIP11, and 6.9HIP. Peptide abundances were analyzed by MS. The abundance of digested intact INS1 and INS2 C-peptide were quantified. (A) Intact INS1 C-peptide is approaching significance (p=0.0524) with greater abundance in the LI NOD islets than the NOD samples. (B) Intact INS2 (p=0.002) C-peptide was significantly elevated in the LI NOD samples suggesting less CatD- mediated processing of INS2 C-peptide. Both (C) HIP11 (0.0092) and (D) 6.9HIP (0.0366) were significantly reduced in the LI NOD islets with no detectable levels of either HIP observed. Peptide abundances were compared using a paired parametric t test with significance set at p<0.05. *p<0.05, **p<0.01

[0025] FIG. 19. Comparison of Islet Antigenicity and Disease Incidence Between wild-type NOD and LI NOD Mice. Antigen content in tryptically dispersed islets from wild-type NOD and LI NOD mice was assessed using diabetogenic T cell clones. Reactivity was quantified by measuring IFN-y secretion via ELISA. HIP-reactive T cell clone (A) BDC-10.1 exhibited stronger responses to wild-type NOD islets compared to LI NOD islets consistent with reduced HIP formation in the modified mice. Negligible differences were observed between PD 12-2.40 T cell clone response to islets from WT NOD mice and LI NOD mice, suggesting off-target peptide processing in the islets was not altered in the modified mice.

[0026] FIG. 20. Comparing the degree of insulitis in 10-week-old female NOD and LI NOD mice. A total of 289 pancreatic islets from 10 WT NOD mice and 244 pancreatic islets from 9 LI NOD mice were assessed for insulitis following H&E staining. LI NOD mice showed significant reduction in infiltrative insulitis (score 2 and 3) and overall, significantly less infiltrate than islets from WT NOD (Chi-square test, p<0.001).Attorney Docket No. 151077-00049PR

[0027] FIG. 21 . Absence of HIP-reactive CD4 T cells in the islets of LINOD mice: Single cell suspensions were prepared from islets of 14-week-old wild-type NOD or LI NOD mice and were analyzed by flow cytometry using I-Ag7 tetramers loaded with HIPs or insB9-23 peptides. Gates were set on live, linage negative, CD45+CD4+ events. Data are representative of two experiments.

[0028] FIG. 22. Comparison of disease incidence between WT NOD and LI NOD mice. Twenty female WT NOD and 20 female LI NOD mice were monitored for disease onset beginning at 11 -weeks old. Mice were monitored weekly by urine glucose tests until they were 30-weeks old. Mice that had blood glucose readings >250mg / dL for two consecutive days were determined to be diabetic. Survival between groups was compared by a Mantel-Cox Log-rank test and showed significant reduction in disease incidence for the LI NOD mice (p=0.0003).

[0029] FIG. 23. Blood glucose levels for spontaneously diabetic NOD mice receiving islet transplants from either LI NOD mice or NOD SCID mice monitored over time post-transplant.DETAILED DESCRIPTION

[0030] In the following detailed description, embodiments of the present invention are described in detail to enable practice of the invention. Although the invention is described with reference to these specific embodiments, it should be appreciated that the invention can be embodied in different forms and should not be construed as limited to the embodiments set forth herein. Rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the scope of the invention to those skilled in the art. All publications cited herein are incorporated by reference in their entireties for their teachings.

[0031] The invention includes numerous alternatives, modifications, and equivalents as will become apparent from consideration of the following detailed description.

[0032] The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used in the description of the invention and the appended claims, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. Additionally, as used herein, the term "and / or" includes any and all combinations of one or more of the associated listed items and may be abbreviated asAttorney Docket No. 151077-00049PR

[0033] Unless otherwise defined, all technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs.

[0034] As used herein, the term "comprise," in addition to its regular meaning, may also include, and, in some embodiments, may specifically refer to the expressions "consist essentially of' and / or "consist of." Thus, the expression "comprise" can also refer to embodiments, wherein that which is claimed "comprises" specifically listed elements does not include further elements, as well as embodiments wherein that which is claimed "comprises" specifically listed elements may and / or does encompass further elements or encompass further elements that do not materially affect the basic and novel character! stic(s) of that which is claimed. For example, that which is claimed, such as an amino acid sequence, nucleic acid, nucleic acid sequence, peptide, protein, composition, formulation, cell line, vector, etc. "comprising" specifically listed elements also encompasses, for example, an amino acid sequence, nucleic acid, nucleic acid sequence, peptide, protein, composition, formulation, cell line, vector, etc. "consisting of," i.e., wherein that which is claimed does not include further elements, and, for example, an amino acid sequence, nucleic acid, nucleic acid sequence, peptide, protein, composition, formulation, cell line, vector, etc. "consisting essentially of," i.e., wherein that which is claimed may include further elements that do not materially affect the basic and novel character! stic(s) of that which is claimed.

[0035] The term "about" generally refers to a range of numeric values that one of skill in the art would consider equivalent to the recited numeric value or having the same function or result. For example, "about" may refer to a range that is within ± 1%, ± 2%, ± 5%, ± 10%, ± 15%, or even ± 20% of the indicated value, depending upon the numeric values that one of skill in the art would consider equivalent to the recited numeric value or having the same function or result. Furthermore, in some embodiments, a numeric value modified by the term "about" may also include a numeric value that is "exactly" the recited numeric value. In addition, any numeric value presented without modification will be appreciated to include numeric values "about" the recited numeric value, as well as include "exactly" the recited numeric value. Similarly, the term "substantially" means largely, but not wholly, the same form, manner or degree and the particular element will have a range of configurations as a person of ordinary skill in the art would consider as having the same function or result. When a particular element is expressed as an approximation by use of the term "substantially," it will be understood that the particular element forms another embodiment.Attorney Docket No. 151077-00049PR

[0036] As used herein, the terms "treat," "treating" or "treatment" may refer to any type of action that imparts a modulating effect, which, for example, can be a beneficial and / or therapeutic effect, to a subject afflicted with a condition, disorder, disease or illness, including, for example, improvement in the condition of the subject (e.g., in one or more symptoms), delay in the progression of the disorder, disease or illness, delay of the onset of the disease, disorder, or illness, and / or change in clinical parameters of the condition, disorder, disease or illness, etc., as would be well known in the art.

[0037] As used herein, the terms "prevent," "preventing" or "prevention of (and grammatical variations thereof) may refer to prevention and / or delay of the onset and / or progression of a disease, disorder and / or a clinical symptom(s) in a subject and / or a reduction in the severity of the onset and / or progression of the disease, disorder and / or clinical symptom(s) relative to what would occur in the absence of the methods of the invention. In representative embodiments, the term "prevent," "preventing," or "prevention of (and grammatical variations thereof) refer to prevention and / or delay of the onset and / or progression of a metabolic disease in the subject, with or without other signs of clinical disease. The prevention can be complete, e.g., the total absence of the disease, disorder and / or clinical symptom(s). The prevention can also be partial, such that the occurrence of the disease, disorder and / or clinical symptom(s) in the subject and / or the severity of onset and / or the progression is less than what would occur in the absence of the present invention.

[0038] An "effective amount" or "therapeutically effective amount" may refer to an amount of a compound or composition of this invention that is sufficient to produce a desired effect, which can be a therapeutic and / or beneficial effect. The effective amount will vary with the age, general condition of the subject, the severity of the condition being treated, the particular agent administered, during the duration of the treatment, the nature of any concurrent treatment, the pharmaceutically acceptable carrier used, and like factors within the knowledge and expertise of those skilled in the art. As appropriate, an effective amount or therapeutically effective amount in any individual case can be determined by one of ordinary skill in the art by reference to the pertinent texts and literature and / or by using routine experimentation. (See, for example, REMINGTON, THE SCIENCE AND PRACTICE OF PHARMACY (latest edition)).

[0039] A "cell," "cells," and a "cell line" may be used interchangeably, and may refer to one or more cells and, in some embodiments, refer to mammalian cells, such as human cells. TheAttorney Docket No. 151077-00049PR term includes progeny of a cell or cell population. One of skill in the art will appreciate that "cells" include progeny of a single cell, and the progeny may not necessarily be completely identical (in morphology or of total DNA complement) to the original parent cell due to natural, accidental, or deliberate mutation and / or change. A "cell" may refer to isolated cells and / or cultivated cells which are not incorporated in a living human, non-human or animal body.

[0040] Embodiments of the inventive concept relate to a cell or cells including a genetic modification, and genetic modification of a cell or cells, e.g., induced pluripotent stem cells (iPSCs), to create, e.g., beta cells (P-cells) that are either Hybrid Insulin Peptide (HlP)-deficient or Cathepsin D (CatD)-deficient, for the treatment of autoimmune disorders, e.g., Type 1 Diabetes (T1D). Hybrid insulin peptides (HIPs) are a distinct class of autoantigens in T1D. HIPs are formed when fragments of proinsulin, e.g., the C-peptide, the connecting peptide of the insulin A-chain and insulin B-chain in proinsulin that is removed from mature insulin, become covalently linked to other beta-cell peptides through peptide bonds. These hybrid peptides contain non-genomic amino acid sequences that are not expressed in the thymus, potentially explaining how pathogenic T cells escape negative selection in T1D. HIPs have been identified as targets for autoreactive T cells in both human T1D patients and a mouse model of the disease. Cathepsin D (CatD) is a protease that has been identified as responsible for the formation of disease-relevant HIPs within beta cells.

[0041] Embodiments of the present inventive concept include and relate to, for example, any of the following:Genetically modified induced pluripotent stem cells (iPSCs):

[0042] In some embodiments, the inventive concept includes genetically modified iPSCs. These genetically modified iPSCs can be differentiated into beta cells or islet-like clusters and may be either: a) Deficient in specific HIPs critical in the development of autoimmune diabetes (T1D); or b) Deficient in Cathepsin D, thus unable to form HIPs that contribute to the development of autoimmune diabetes. In some embodiments, the iPSCs may include a modification / mutation at Leucine 26 (Leu26) in the human C-peptide, or its equivalent, e.g., at Leucine 24 (Leu24) in the mouse INS1 C-peptide, and / or at Leucine 26 (Leu26) in the mouse INS2 C-peptide. In some embodiments, the Leucine in the C-peptides according to embodiments of the inventive concept is substituted with Isoleucine (He).Attorney Docket No. 151077-00049PRTreatment of Type 1 Diabetes:

[0043] In some embodiments, application of the inventive concept is to provide a novel cellbased therapy for treating T1D. The HIP-deficient or CatD-deficient beta cells, or islet-like clusters derived from the genetically modified iPSCs, can be transplanted into T1D patients.Autoimmune Protection:

[0044] In some embodiments, these modified cells are more resistant to recurrent autoimmunity in T1D patients by either lacking specific HIPs or being unable to form HIPs due to Cathepsin D deficiency.Reduced Immunosuppression:

[0045] In some embodiments, the HIP-deficient or Cathepsin D-deficient nature of these cells reduce or eliminate the need for immunosuppression in transplant recipients, addressing a major challenge in current islet transplantation therapies.Scalable Source / Production of Beta Cells:

[0046] In some embodiments, this approach can provide a potentially unlimited source of functional, immunologically protected beta cells for transplantation.Personalized Medicine:

[0047] In some embodiments, this approach may be applied to generate patient-specific iPSCs, allowing for autologous transplantation and further reducing immunological complications related to treatment.Research Tools:

[0048] While not the primary focus, in some embodiments, genetically modified iPSCs of the inventive concept and resulting beta cell s / islet-like clusters may also serve as valuable research tools for further studying HIP formation, the role of CatD, and involvement of HIP formation and CatD in T1D pathogenesis.Attorney Docket No. 151077-00049PRPlatform Technology:

[0049] The genetic modification approach of the inventive concept may be extended to other autoimmune targets, creating a platform for developing protected cell therapies for various autoimmune diseases.

[0050] The inventive concept represents a novel approach to cell-based therapy for T1D, addressing both the need for a renewable source of insulin-producing cells and the challenge of recurrent autoimmunity. By genetically modifying iPSCs to produce either HIP-deficient or CatD-deficient beta cells, this technology can provide a more effective and durable treatment option for individuals with T1D.

[0051] Subjects suitable to be treated with the cell or cells, the composition, compositions and / or formulations of the present inventive concept include, but are not limited to, mammalian subjects. Mammals according to the present invention include, but are not limited to, canines, felines, bovines, caprines, equines, ovines, porcines, rodents (e.g., rats and mice), lagomorphs, primates, humans and the like, and mammals in utero. Any mammalian subject in need of being treated or desiring treatment according to the present invention is suitable. In some embodiments of the present inventive concept, the subject is a human subject. The human subject treated according to methods of the present inventive concept may be of any gender (for example, male, female or transgender) and at any stage of development (i.e., neonate, infant, juvenile, adolescent, adult, elderly). In some embodiments, the subject is afflicted with T1D or is at risk of developing T1D.

[0052] The present inventive concept is more particularly described in the following, which is intended to be illustrative only, since numerous modifications and variations therein will be apparent to those skilled in the art.EXAMPLE 1

[0053] Data has been generated for the inventive concept through both in vitro and in vivo testing. In vitro experiments demonstrated that modifying the C-peptide sequence from LAL to LAI prevents Cathepsin D (CatD) from cleaving at this site and forming Hybrid Insulin Peptides (HIPs). In vivo testing involved the generation of NOD mice carrying the LAI mutation in both insulin genes (Insl1 1Ins2IZI). These mice showed significantly reduced HIP content in islets compared to wild-type islets, with double homozygous (Insl1 / 1Ins2LI) NOD mice demonstratingAttorney Docket No. 151077-00049PR a complete absence of disease-relevant HIPs. Importantly, we observed a significant delay in disease onset in Ins2 homozygous (Ins l, ,Ins2n) mice compared to wild-type NOD mice. T-cell assays further supported these findings, showing that T cell clones reactive to HIPs do not respond to the modified LAI form of C-peptide treated with CatD, indicating the absence of HIP formation. While these data strongly support the inventive concept, validation is performed for its application to human iPSCs and differentiation of human iPSCs into beta cells or islet-like clusters.EXPERIMENTAL

[0054] Transplantation experiments advancing the inventive concept towards commercial application may include the following. Beta cells deficient in hybrid insulin peptides (HIPs) avoid rejection or face slower rejection when transplanted into diabetic recipients is demonstrated. Islets are isolated from HIP-deficient NOD mice (Insl1 1Ins2VI) and transplanted into diabetic NOD mice recipients, with wild-type NOD mouse islets serving as controls. Blood glucose levels are monitored in recipients to assess graft function and survival, with graft rejection indicated by a return to hyperglycemia. The studies include detailed immunological analysis, examining the immune response in recipient mice at various post-transplantation time points. This involves flow cytometric analysis of graft-infiltrating immune cells, focusing on HIP-reactive T cells, and examining their activation status and proliferation. Histological examinations are also conducted, retrieving grafts at different time points to assess immune cell infiltration and beta cell preservation in the transplanted islets. To evaluate long-term outcomes, a subset of recipient mice is monitored for extended periods, up to 100 days. Additionally, the molecular mechanisms underlying any observed protection from autoimmune rejection in HIP- deficient islets are investigated, potentially including gene expression analysis of transplanted islets and infiltrating immune cells. These experiments are important for validating that HIP- deficient beta cells are protected from autoimmune attack, which forms the basis of the cell therapy approach of the inventive concept using genetically modified iPSCs.Attorney Docket No. 151077-00049PREXAMPLE 2AIMS

[0055] Hybrid insulin peptides (HIPs) are targeted by highly pathogenic CD4 T cells in non- obese diabetic (NOD) mice, the primary animal model for studying Type 1 Diabetes (T1D). The following addresses a critical gap in understanding the role of HIPs in the pathogenesis of T1D and offers innovative approaches to investigate the mechanisms of HIP formation and beta-cell destruction. These peptides form in pancreatic beta-cells through the covalent ligation of proinsulin fragments to various beta-cell peptides. HIPs contain non-genomic amino acid sequences not expressed in the thymus, making them plausible autoantigens for pathogenic T cells in T1D and potential triggers for the disease. It has been established that the protease Cathepsin D (CatD) catalyzes the formation of HIPs identified as the ligands for the most diabetogenic T cell clones to have been identified in NOD mice. It has been shown that CatD forms a new peptide bond at a specific Leucine of proinsulin (position 26 of the C-peptide) with various beta-cell peptides. One notable example is the 2.5HIP, containing a peptide of the protein Chromogranin A (ChgA), and forming the antigen for the well-known T cell clone BDC-2.5. ChgA-deficient NOD mice are protected from diabetes onset, supporting the critical role of this epitope in the disease. In human T1D, significantly elevated numbers of HIP-reactive T cells have been identified in peripheral blood mononuclear cells (PBMCs) of recent-onset patients, distinguishing them from non-diabetic controls. At least one human HIP has been identified that is CatD-generated, forming at the designated Leucine residue, and its presence in human islets has been validated through analysis by mass spectrometry. Based on the high specificity of CatD for Leucine residues, we hypothesized that exchanging the Leucine residue of C-peptide with an Isoleucine residue could block CatD-mediated HIP formation. To test this, a NOD mouse model has been generated with both insulin genes modified to contain the isoleucine modification. Mass spectrometric analyses of the islets from these mice confirmed the absence of the three HIPs recognized by the most pathogenic T cell clones currently known in NOD mice. Furthermore, disease incidence was reduced in mice carrying a modified insulin gene profile: Insulin 2 contained an isoleucine substitution that prevented HIP formation, while Insulin 1 retained its native leucine residue and maintained HIP-forming capability. This selective inhibition of HIP formation with Insulin 2 resulted in lower overall HIP levels and decreased disease development. Accordingly, there is support for CatD-generated HIPs playing a pivotal role in the initiation andAttorney Docket No. 151077-00049PR progression of T1D. The new NOD mouse model is used to determine the role of HIPs in disease initiation and to investigate the mechanism by which HIPs are formed by Cathepsin D. These aims are for more specifically:1. Determining whether CatD-generated HIPs initiate or accelerate disease in NOD mice.

[0056] A novel HIP-deficient NOD mouse model provides a unique opportunity to directly test whether HIPs formed by CatD are critical autoantigens in the pathogenesis of T1D. By studying the impact of HIP deficiency on immune cell infiltration, diabetes incidence, and islet transplantation outcomes, the role of HIPs in initiating and sustaining autoimmune beta-cell destruction is validated. The insights gained from these studies guide the development of therapeutic interventions for T1D prevention and reversal.

[0057] The goals of this aim are to: first, quantify HIP content in islets of wild-type and HIP- deficient mice using mass spectrometry; second, analyze immune cell infiltration in islets of wild-type and HIP-deficient mice using flow cytometry and histology; third, monitor diabetes incidence in HIP-deficient mice; fourth, evaluate the survival and function of HIP-deficient islets in a syngeneic transplantation setting; and fifth, assess the ability of diabetogenic T cell clones to induce diabetes in HIP-deficient mice.2. Investigating the mechanism of HIP-formation mediated by Cathepsin D.

[0058] It has been established that cathepsin D (CatD) plays a central role in the formation of disease-relevant hybrid insulin peptides (HIPs) within beta-cells. By studying the mechanism of CatD-mediated HIP formation and identifying potential inhibitors, it is the aim to develop novel strategies for preventing HIP formation and attenuate the autoimmune response in Type 1 diabetes (T1D). Furthermore, identifying new HIPs through in vitro reactions can provide critical reagents for studying their role in T ID. To address mechanism of HIP formation mediated by CatD we will first, identify CatD inhibitors among FDA approved drugs using mass spectrometry and a FRET assay; and secondly, evaluate HIP formation through in vitro reactions with CatD using mass spectrometry.

[0059] Given the compelling evidence from NOD mice and human studies that HIPs could be a key trigger for T1D onset, understanding their role in disease may lead to innovative strategies for prevention, early diagnosis, and treatment. Exploring FDA-approved inhibitors ofAttorney Docket No. 151077-00049PRCatD activity can identify novel avenues for preventing HIP formation and T1D development. The outcomes can be transformative, substantiating HIPs as critical autoantigens in T1D and paving the way for antigen-specific immunotherapies aimed at inducing tolerance. Moreover, identifying HIP-deficient islets as candidates for transplantation may significantly improve T1D treatment, eliminating the need for long-term immunosuppression and providing a more durable and safer alternative to current therapies.SIGNIFICANCE

[0060] Type 1 Diabetes (T1D) is an autoimmune disease characterized by the destruction of insulin-producing beta cells mediated by autoreactive T cells. The precise triggers for this autoimmune attack remain elusive. Our group discovered Hybrid Insulin Peptides (HIPs) as a distinct class of autoantigens that are targets for CD4 T cells in T1D. In these peptides, proinsulin fragments are covalently linked to other beta-cell peptides through peptide bonds.HIPs contain non-genomic amino acid sequences that are not expressed in the thymus, providing a plausible explanation of how pathogenic T cells can escape the negative selection process in T1D. Previous work has already established several key findings:1. Multiple diabetes-triggering CD4 T cell clones in non-obese diabetic (NOD) mice, the major animal model used for the study of T1D, have been shown to target HIPs;2. A Chromogranin A (ChgA) peptide forms part of a HIP that is targeted by diabetes triggering T cells in NOD mice. ChgA-deficient NOD mice are protected from diabetes, indicating that this HIP may be critical to development of disease;3. In NOD mice, the frequency and activation of HIP-reactive T cells in the bloodstream increase with age, serving as indicators of disease activity;4. HIPs have been reliably detected using mass spectrometry (LC-MS / MS) in murine and human islets;5. HIP-reactive T cells have been identified in the residual pancreatic islets of T1D organ donors; and6. Significantly elevated levels of pro-inflammatory T cells targeting HIPs have been detected in the peripheral blood of recent-onset T1D patients, distinguishing them from non-diabetic control subjects.Attorney Docket No. 151077-00049PR

[0061] NOD mice spontaneously develop autoimmune diabetes through mechanisms that closely resemble human T1D, including the involvement of autoreactive CD4+ and CD8+ T cells targeting pancreatic beta-cells. Although the highly inbred nature and controlled environment of NOD mice may not fully capture the heterogeneity of human T1D, this model still offers invaluable insights into the intricate interplay between genetic and environmental factors that trigger the disease. NOD mice have been extensively used for preclinical testing of numerous candidate therapeutics for T1D, including teplizumab, which, in 2022, was approved by the FDA to delay the onset or progression of clinical T1D. Prior to the identification of HIPs and HIP-reactive T cells in human disease, HIPs were discovered in NOD mice, further emphasizing the value of this murine model for studying the role of these neoepitopes in T1D. Various diabetes-triggering CD4 T cell clones isolated from NOD mice, including BDC-2.5, NY4.1, and BDC-6.9, are known to target HIPs that form through covalent crosslinking between a distinct insulin C-peptide fragment (ending with the amino acid sequence LAL) and naturally occurring peptides of chromogranin A (yielding 2.5HIP), proinsulin (yielding HIP11), or islet amyloid polypeptide (yielding 6.9HIP) (FIG. 1). Experiments conducted with immunodeficient NOD scid mice possessing only a monoclonal population of T cells (retrogenic mice), each expressing one of 17 specific T-cell receptors (TCRs) targeted against various autoantigens, revealed that only a small subset of autoantigen-specific TCRs could initiate islet infiltration and beta-cell destruction independently. Notably, the most pathogenic TCRs included those originating from HIP-reactive T cells BDC-2.5, BDC-10.1, NY-4.1, and BDC-6.9 with incidence of 100% for both BDC-2.5 and BDC-10.1, 71% for NY4.1 and 56% for BDC-6.9. Two additional TCRs responsive to the insulin B:9-23 epitope mediated islet infiltration, but only one of them was identified as pathogenic, albeit with lower potency, resulting in diabetes in only 33% of the mice. The remaining TCRs, specific for other epitopes associated with T1D, such as glutamic acid decarboxylase isoform 65 (GAD65), insulinoma-associated protein 2 (IA2), and phogrin (IA2-beta), did not induce disease onset in these retrogenic mice, highlighting the fact that autoreactivity does not inherently equate to pathogenicity. In summary, these findings establish that a group of HIPs (2.5HIP, 6.9HIP, and HIP11) is targeted by the most pathogenic CD4 TCRs that are currently known in NOD mice. These HIPs share a common proinsulin fragment (blue peptide sequence in FIG. 1), linked to various beta-cell peptides (red peptideAttorney Docket No. 151077-00049PR sequences in FIG. 1). HTPs provide plausible targets that could explain the loss of self-tolerance leading to the autoimmune destruction of beta-cells in T1D.

[0062] In human disease, HIP-reactive T cell specificities have been identified in the residual pancreatic islets of organ donors with T1D. Furthermore, significantly elevated levels of several HIP-reactive T cell specificities have been detected in the peripheral blood of recent onset T1D patients, distinguishing them from non-diabetic control subjects. For example, ELISPOT analyses on peripheral blood mononuclear cells (PBMCs) from recent-onset T1D patients demonstrated that the frequency of proinflammatory CD4 T cells targeting the human form of HIP11 is significantly elevated in T1D patients but not in non-diabetic control subjects (FIG. 2). Furthermore, a CD4 T cell receptor (TCR) targeting HIP11 was isolated from the residual pancreatic islets of a T ID organ donor, suggesting its contribution to the pathogenic process. HIP11 is currently the only HIP for which T cells have been discovered in human disease and the presence of which has been validated through mass spectrometric analyses using islets from non- diabetic organ donors. The inventors are presently investigating the role of various stress factors in triggering the formation of HIPs in human islets that can initiate the generation of HIPs and lead to the development of T cells that break the self-tolerance threshold, ultimately initiating beta-cell destruction. FIG. 3 demonstrates that treatment of human islets with the cytokine IL-10 leads to the formation of a HIP that was otherwise not detected in untreated samples. This indicates that HIPs can form in response to environmental stress factors, delivering a highly relevant mechanism explaining the progression of disease in response to environmental stressors in TID.

[0063] To confirm that HIPs forming at the LAL-junction of C-peptide (FIG. 1) are authentic epitopes, mass spectrometry (LC-MS / MS) was employed on human and murine islet lysates. Using our stringent P-VIS validation protocol, we verified the presence of these HIPs in the islets of mice and non-diabetic human organ donors. Notably, these HIPs could be reliably detected in islets of NOD and BALB / c mice. BALB / c mice do not develop spontaneous diabetes, indicating that the mere presence of HIPs does not automatically lead to the development of a pathogenic T cell population. In T1D, genetic risk factors such as HLA-predisposition may provide scenarios in which non-genomic peptide sequences (occurring at HIP junctions) get preferentially presented in high-risk HLA haplotypes, while low risk HLA haplotypes may not effectively present the non-genomic peptide junctions. HIPs sharing the described C-peptide sequence are soAttorney Docket No. 151077-00049PR far the only ones for which we have pinpointed both (1 ) LC-MS / MS evidence for their presence in islets and (2) disease-relevant T cells targeting these HIPs. The data suggest that at least one of these HIPs (the 2.5HIP, containing a ChgA peptide) is critical for beta-cell destruction in NOD mice. For this, it was shown that ChgA-deficient NOD mice are shielded from onset of disease, supporting a disease-critical role for 2.5HIP. Furthermore, memory CD4 T cells recognizing the human equivalent of the 2.5HIP are significantly elevated in T1D patients compared to controls, highlighting the role of this HIP in human disease.

[0064] The common feature among these disease-relevant HIPs is the crosslinking fragment of C-peptide, which ends in the amino acid sequence LAL. The non-ligated form of the crosslinking fragment of C-peptide fragment is called Des-(27-3 l)C-peptide, as it lacks the five C-terminal residues (27-31) of intact C-peptide. Des-(27-31)C-peptide was shown to be cosecreted with insulin from beta-cells accounting for up to 37% of the total C-peptide released upon glucose stimulation. This suggests that processing of C-peptide occurs within insulin secretory granules at this specific peptide bond. The presence of 6.9HIP in the secretory granules of beta-cells obtained from NOD mice has since been validated. Furthermore, we identified Cathepsin D (CatD) as the distinct protease responsible for the formation of Des-(27-3 Repeptide and the disease-relevant HIPs in beta-cells. As shown in FIG. 4, CatD-mediated cleavage of C-peptide occurs primarily on the C-terminal side of the LAL sequence. This leads to the dominant formation of Des-(27-3 l)C-peptide, emphasizing the highly selective nature of CatD in targeting the LAL sequence of C-peptide. Notably, we also validated the formation of HIP 11 in these reactions, which occurs in a side-reaction during CatD-mediated processing of C-peptide (HIP11 forms through the ligation of two C-peptide fragments).

[0065] In summary, these findings indicate HIPs are critical epitopes in the pathogenesis of T1D. CatD was identified as the protease responsible for the selective formation of various disease-relevant and potentially disease-critical HIPs within pancreatic beta-cells. These HIPs are targeted by autoreactive T cells in both humans and NOD mice, indicating their importance in the development of autoimmunity in T1D. Based on these observations, we hypothesize that CatD-generated HIPs play a critical role in the initiation and progression of T1D. Further investigation into the mechanisms of HIP formation, the factors influencing their generation, and strategies to modulate their levels in beta cells may provide novel insights into the pathogenesis of T1D and open new avenues for the development of targeted therapeutic interventions.Attorney Docket No. 151077-00049PRINNOVATION

[0066] Experiments described in this Example employ cutting-edge proteomic methods to establish the selective role of the protease CatD in driving the formation of disease-relevant and potentially disease-critical HIPs within beta-cells. This work is position at the forefront of groundbreaking research, integrating the fields of immunology and proteomics, and utilizing state-of-the-art technologies to investigate the role of HIPs in T1D. For our LC-MS / MS studies, an Agilent 6550 QTOF LC-MS / MS and a highly advanced Thermo Fusion Lumos Orbitrap mass spectrometer are used. Another innovative aspect is a novel mouse model on the NOD background that is incapable of forming disease-relevant HIPs shown in FIG. 1. This HIP- deficient NOD mouse model was recently developed. Investigating this model enables testing whether the presence of these HIPs is necessary to initiate and / or sustain the destruction of betacells in NOD mice. Moreover, islets from these mice may prove valuable in transplantation experiments, potentially requiring reduced levels of immunosuppression or even no immunosuppression to prevent beta-cell rejection in transplant recipients due to the absence of HIPs. These findings can be translated to human applications through the generation of HIP - deficient beta-cells derived from induced pluripotent stem cells (iPSCs). This approach can significantly improve the treatment of T1D by providing a durable and safer alternative to current transplantation strategies, which rely on long-term immunosuppression to prevent graft rejection and recurrent autoimmunity. Furthermore, identifying novel HIPs that can form through the reversed proteolytic action of CatD can pave the way for new diagnostic markers and personalized treatments, including strategies for inducing antigen-specific tolerance to halt betacell destruction. By establishing a critical role for HIPs formed by CatD in the pathogenesis of T1D, CatD may be elevated as a therapeutic target in T1D, aligning with ongoing research in cancer, where CatD is being explored as a target. In summary, these studies may have the potential to yield several groundbreaking discoveries and advancements in T1D research. These include (1) identifying a new therapeutic target in the form of CatD, (2) developing immune- shielded beta-cells resistant to HIP formation and autoimmune attack, (3) validating disease- critical autoantigens in T1D, (4) identifying key reagents required for antigen-specific tolerance induction, and (5) discovering novel biomarkers for T cell phenotyping in human disease. These data would provide a highly plausible and comprehensive explanation for the breakdown ofAttorney Docket No. 151077-00049PR immunological self-tolerance that leads to the destruction of beta-cells in the pathogenesis of T1D. These findings not only offer new insights into the underlying mechanisms of the disease but also lead to innovative strategies aimed at prevention, early intervention, and targeted treatment of T1D.The aims described in this example are more particularly described as follows:1. DETERMINING WHETHER CATHEPSIN D-GENERATED HIPS INITIATE DISEASE IN NOD MICE.Introduction:

[0067] Previous work has established that CatD mediates the formation of disease-relevant HIPs within beta-cells. As illustrated in FIG. 4, CatD primarily targets the LAL sequence of C- peptide, which is the site at which disease-relevant HIPs form (see FIG. 1). Since CatD-deficient mice die around three weeks of age, we employed an innovative approach to prevent CatD cleavage at the LAL locus. To accomplish this this the MEROPS database was referred to, a dedicated resource for studying proteases and their substrate specificity. MEROPS data (FIG. 5) revealed that CatD primarily cleaves peptide bonds at the amino acid residue that is C-terminally adjacent to a Leucine (L) residue (referred to as the Pl position). Conversely, the presence of and Isoleucine (I) residue at the Pl position blocks CatD-mediated cleavage. We therefore hypothesized that modifying the C-peptide’s LAL sequence to LAI would prevent CatD from cleaving and forming disease-relevant HIPs at this site, thereby blocking the formation of 2.5HIP, HIP11, and 6.9HIP. To test this hypothesis, we incubated both wild-type and mutated human C-peptide with recombinant human CatD and assessed the samples for the presence of HIPs using the HIP 11 -reactive T cell clone E2, isolated by Dr. Baker from the peripheral blood of a recent-onset T1D patient. The T cell clone exhibited a strong response to wild-type C- peptide treated with CatD (FIG. 6, Panel A), confirming the presence of HIP11, which forms through the crosslinking between two C-peptide fragments (see FIG. 1). The presence of HIP 11 in these samples was further validated by LC-MS / MS. Conversely, no response was observed when the T cell clone was exposed to the LAI form of C-peptide treated with CatD, indicating that CatD cannot render this peptide antigenic. LC-MS / MS analysis further confirmed the absence of the modified HIP11 in the LAI samples. Control experiments (FIG. 6, Panel B)Attorney Docket No. 151077-00049PR validated that the T cell clone E2 responded positively to synthetic forms of both wild-type HIP11 and HIP11 containing the LAI mutation, confirming that the lack of response to the modified C-peptide was due to the absence of HIP formation and not an inability of the T cell clone to recognize the modified HIP sequence. Through an R21 grant, we generated NOD mice carrying the LAI mutation in both insulin genes. Preliminary experiments on islets from Insll llns2I 1mice (Ins2 homozygous; refer to Table 1 for mouse nomenclature) revealed significantly reduced HIP content compared to wild-type islets (FIG. 7, Panel A). We predict that the remaining HIP content in these mice originated from Insl, which is still expressed in its native LAL-form, allowing CatD-mediated HIP formation to occur. We next generated double homozygous (InslI / IIns2I / I) NOD mice and confirmed the absence of disease-relevant HIPs in their islets (FIG. 7, Panel B). We are monitoring disease incidence in Ins2 homozygous (InslL / LIns2M) mice. Data from this study reveals that there is a significant delay in disease onset when comparing Ins2 homozygous to wild-type NOD mice (p = 0.018, FIG. 7, Panel C).1.1. QUANTIFYING HIP CONTENT IN ISLETS OF WILD-TYPE AND GENETICALLY MODIFIED MICEIntroduction:

[0068] The mice described provide a unique opportunity allowing the generation of mice with variable HIP content. As shown in FIG. 7, Ins2 homozygous mice contain about 20% of HIP11, if compared to wild-type mice. Here we will quantify HIP content in islets of various mouse genotypes (see Table 1). We expect HIP11 content in InslL / IIns2IZImice, will be approximately 10% if compared to wild-type mice. These mice will be under further investigation in aim 1.3, where we will investigate disease incidence.Table 1: Mouse NomenclatureAttorney Docket No. 151077-00049PRExperimental Design:

[0069] To prepare samples for LCMSMS analysis, up to 200 islet equivalents (IEQ) are suspended per experiment in 50% trifluoroethanol (TFE) and subjected to heat and sonication to lyse cells and release proteins. Cellular debris is removed by centrifugation, and proteins are fractionated by size exclusion chromatography (SEC). The resulting chromatographic fractions are digested with the protease AspN, and the resulting peptides are analyzed using an Agilent 6550 mass spectrometer. To validate peptide identity, synthetic peptides and a rigorous P-VIS validation protocol are employed. Quantitative comparisons of HIP content across the different genotypes are performed using label-free quantification methods, such as peak area integration of extracted ion chromatograms (EICs) for each HIP (see FIG.7). To account for variations in sample preparation and instrument performance, HIP signal intensities are normalized to the total ion chromatograms (TICs). Furthermore, using established protocols, HIP content is monitored in the islets of these mice through T cell assays using the HIP-reactive T cell clones BDC-2.5 and BDC-6.9. The reproducibility of the measurements is assessed by analyzing multiple biological replicates for each genotype, analyzing both males and females separately.

[0070] It is expected that HIP11 content in islets of double homozygous (InslI IIns2I') and Insl Het Ins2 Hom (InslL IIns2I / I) mice is 0% and 10%, respectively, if compared to HIP content in wild-type (InslL / LIns2L L) islets. If, upon using 200 lEQs from double homozygous (InslLIIns2I / I) mice, HIP11 cannot be detected, the total number of lEQs used in these experiments is increased to obtain additional material for deep profiling analyses on an Orbitrap mass spectrometer. This enhances the sensitivity of measurements and allows for detecting low- abundance HIPs that may be present in these islets. If additional HIP content in the islets is observed of the mice, potential mechanisms that could contribute to the formation of these HIPs are investigated, such as alternative cleavage sites for CatD or the involvement of other proteases. The genotypes of the mice are also verified using PCR-based methods to ensure that the observed results are not due to errors in animal breeding or genotyping. By quantifying HIP content in islets of these mice, valuable insights is gained into the efficacy of the LAI mutation in preventing CatD-mediated HIP formation and establish a foundation for investigating the role of these HIPs in the pathogenesis of autoimmune diabetes.Attorney Docket No. 151077-00049PR1 2. STUDYING IMMUNE CELLS IN ISLETS OF WILD-TYPE AND DOUBLEHOMZYGOUS MICEIntroduction:

[0071] Previously, it has been established that there is significant infiltration of HIP-reactive CD4 T cells into the islets of NOD mice. Utilizing a 2D assay designed to probe the antigen specificity of these islet-infiltrating T cells, it was indicated that the percentage of HIP-reactive cells may, in fact, be underestimated. Given the potent diabetogenic nature of HIP-reactive T cells, as evidenced in transfer models and retrogenic systems, we hypothesize that islets devoid of HIPs will experience a diminished influx of HIP-reactive T cells. Since CD4 T helper cells play a central role in orchestrating the immune response, we anticipate that the presence and function of other cell types, particularly cytotoxic CD8 T cells and B cells, will be influenced. A reduced HIP content in islets of InslL / LIns21'1mice and absence of HIPs in islets of InslI IIns2I / Imice (see FIG. 7) has been demonstrated, indicating that decreased HIP presentation in these islets result in impaired activation of HIP-reactive T cells.Experimental Design:

[0072] To further delineate the immunophenotype of cells within the islets of HIP-deficient InslI / IIns2I / INOD mice, Ins I1 IIns2I / INOD mice and prediabetic NOD mice are analyzed at 8 and 12 weeks of age, a time when NOD mice typically begin to manifest islet infiltration, (a) Flow cytometric analysis of islet infiltrate: Single-cell suspensions from the islets are stained with anti- CD4, anti-CD8, anti-CD19, anti-CDl lb, and anti-CDl lc antibodies to investigate major leukocyte populations in the islets, following established protocols. The percentage and absolute number of T cells (CD4+or CD8+), B cells (CD19+), and antigen-presenting cells (CD1 lb+and / or CD1 lc+) are determined. MHC class II tetramers loaded with HIPs (2.5HIP, 6.9HIP) or conventional epitopes from insulin B:9-23 (insp8G and insp8E) will be used to ascertain CD4 T cell antigen specificity. The islets of InslI / IIns21'1NOD mice lack HIP-reactive T cells but not insulin-reactive T cells. Early T cell activation markers (CD69+, CD154+), antigen encounter (CD44hlCD62L10), proliferation (Ki-67+), and regulatory T cells (CD25+Foxp3+) are investigated using tetramer analysis. Intracellular staining for pro-inflammatory cytokines (TNF- a, or IFN-y) is performed on stimulated cells using established protocols. For these measurements the Fortessa X-20 is used, a 5-laser flow cytometer. Both male and female NODAttorney Docket No. 151077-00049PR mice are analyzed separately since disease incidence is lower in NOD males, (b) Histological analysis of pancreatic infiltration in wild-type and genetically modified mice: Histological sections of the pancreas from wild-type (InslL / LIns2L / L), Insl Het Ins2 Hom (InslL / IIns2I / I), and double homozygous (InslI / IIns2I / I) mice are analyzed to determine location, quality (e.g., peri- insulitis), and percentage of infiltrated islets. Mice from each group are euthanized at 8 and 12 weeks of age, and their pancreatic tissues are harvested and embedded in paraffin for histological examination. H&E staining are conducted to assess leukocyte infiltration within the islets, as previously described. A minimum of 100 islets from each group will be systematically scored based on the degree of infiltration (Score 0: No infiltration, Score 1 : Peri-infiltrate, Score 2: Heavy infiltration, Score 3: Complete destruction). The histological analysis encompasses a total of 10 mice per group.

[0073] A comprehensive understanding of the immune cell populations involved in the observed infiltrations is ensured by these experiments. The islets in InslI / IIns21 1mice demonstrate significantly lower infiltration scores compared to those in wild-type (InslL LIns2L L) mice is expected, aligning with our hypothesis of reduced diabetes incidence in modified mice. Furthermore, upon MHC class II tetramer analysis, we anticipate that islets will be lacking 2.5HIP tet+and 6.9HIP tet+cells as we did not detect these HIPs in InslI / IIns2I / Imice. It was postulated that insulin B: 9-23 -reactive T cells also contribute to disease initiation, and the experiments proposed under this aim should help decipher the relative contribution of these different populations of islet-reactive T cells to the disease process. By comparing the phenotype and function of HIP -reactive T cells with those of insulin B: 9-23 -reactive T cells in the islets, valuable insights are gained into the role of each specificity in driving the autoimmune response. If low cell numbers are encountered that limit the ability to perform comprehensive phenotypic analyses (as low infiltration in InslI / IIns2I / Imice is predicted), samples from multiple mice are pooled to increase the yield of islet-infiltrating cells. Additionally, if the flow cytometric panel is challenging to optimize, the most informative markers are prioritized, and smaller panels are developed. These experiments provide a detailed characterization of the immune cell populations infiltrating the islets of wild-type and HIP-deficient mice, with a focus on HIP-reactive and insulin B: 9-23 -reactive T cells. These studies shed light on the impact of HIP deficiency on the autoimmune response and help elucidate the contribution of CatD in providing T cell ligands forAttorney Docket No. 151077-00049PR different islet-infiltrating T cell specificities involved in the pathogenesis of autoimmune diabetes.1.3. INVESTIGATING DISEASE INCIDENCE IN DOUBLE HOMOZYGOUS MICE Experimental Design:

[0074] Lines of wild-type and InslI / IIns2I / I(double homozygous) NOD mice are established. Monitoring the incidence of diabetes within a cohort of 20 female double homozygous (Insl^Ins171), and 20 female wild-type (InslL LIns2L / L) mice is the primary focus. It is well established that compared to NOD males, diabetes incidence is accelerated in female NOD mice; therefore, the kinetics of disease in female mice is investigated first. However, male mice are also be monitored as an even more dramatic effect on disease incidence is predicted. The genotypes of the offspring are verified through PCR analysis using tissue samples collected from ear clips. Starting at 10 weeks of age, weekly screening for elevated glucose levels using urine glucose monitoring strips is performed. If a positive urine glucose reading is obtained, blood glucose levels are measured. Diabetes is diagnosed based on the presence of two consecutive blood glucose readings equal to, or exceeding 250 mg / dL. Statistical analysis is performed using appropriate methods to compare diabetes incidence and onset between the different genotypes. Kaplan-Meier survival curves are generated to visualize the differences in diabetes incidence over time, and log-rank tests are used to determine the statistical significance of these differences.

[0075] Double homozygous (InslI / IIns2I / I) mice are protected from the onset of diabetes, like the outcomes observed in ChgA-deficient mice, which are protected from disease and are unable to form the 2.5HIP antigen recognized by diabetes-triggering CD4 T cell clones shown in FIG. 1. Although additional genotypes (e.g., InslL / IIns2L / Ior InslIZIIns2L / I) can be studied that are expected to contain variable amounts of HIPs, it is expected that focusing on double homozygous (InslI / IIns2I / I) and Insl Het Ins2 Hom (InslL / IIns2I / I) mice are sufficient to assess the impact of HIP content on disease pathogenesis. If InslI IIns2I / INOD mice develop diabetes, the detailed analysis under aim 1.2 reveals the extent and nature of infiltrating lymphocytes, providing insights into the potential involvement of other autoantigens or alternative pathways in the disease process. If the disease incidence in the InslI / IIns2I / Imice is not significantly different from that of the wild-type mice, the possibility of compensatory mechanisms or alternativeAttorney Docket No. 151077-00049PR autoantigens driving the disease process is investigated. This may involve the T cell assays on fractionated islet lysates of these mice and the identification of novel autoantigens using mass spectrometry and the characterization of T cell responses against these antigens. Overall, these experiments provide critical insights into the role of HIPs in the development of autoimmune diabetes.1.4. EVALUATING ISLETS FROM INS1I / IINS2I / IMICE IN A TRANSPLANTATIONSETTINGIntroduction:

[0076] The role of HIPs in beta-cell destruction in T1D is currently of interest. However, the innovative mouse model offers a unique opportunity to directly test if HIPs are critical autoantigens in NOD mice. Validating this hypothesis can have significant implications for studying and treating human T1D. Dealing with new-onset diabetes in NOD mice is challenging due to the varying extent of beta-cell destruction. Reversal attempts may fail when there are insufficient remaining beta-cells. To address this issue, an islet transplantation model is utilized. Islet transplantation may reverse T1D, as patients who receive islet allografts often achieve insulin independence. However, islet-specific memory T cells can reactivate and ultimately lead to graft destruction, even in the presence of immunosuppression. In the NOD mouse model, it is well-established that islet isografts in diabetic NOD mice are rapidly destroyed, usually within 10-15 days, accompanied by a massive infiltration of leukocytes within the islet graft. As shown in FIG. 8, it has demonstrated that HIP-reactive T cells constitute one of the predominant populations in the islet graft. Specifically, 2.5HIP-reactive T cells account for 5-10% of the total CD4 infiltrate. 6.9HIP-reactive T cells have also been detected in the islet graft and were present at higher proportions (2-4%; data not shown) compared to insulin B: 9-23 -reactive T cells, which remain below 1%. Through antigen-specific immunotherapy, we discovered that attenuating the immune response to 2.5HIP significantly delays graft rejection. Building on this insight, it is proposed that islets devoid of multiple HIPs are protected from autoimmune destruction. This approach can be translated into human disease by using iPSCs that are genetically modified to carry the desired modifications. These genetically modified iPSCs can be differentiated into insulin-producing beta-cells, which lack the expression of HIPs.Attorney Docket No. 151077-00049PRExperimental Design:

[0077] Spontaneously diabetic NOD mice undergo transplantation with either syngeneic wild-type NOD.scid (Ins ll ,lns21 1) or double homozygous NOD (InslI / IIns2I / I) islets (500 IEQS will be placed under the kidney capsule), with continuous monitoring of recipient blood glucose levels, as previously described. Diabetic NOD islet recipients typically attain normoglycemia within 24-48 hours post-transplant but subsequently face aggressive disease recurrence within 1-4 weeks post-transplant, primarily due to autoimmune destruction. In these experiments, recipients from both groups will be closely observed for diabetes recurrence. Diabetic mice receiving InslI IIns21 1islets are protected from this rapid recurrence. To confirm that the reversal of diabetes is due to the grafting of InslI / IIns2I / Iislets, the transplanted kidney will be surgically removed at the study’s end (at the 100-day mark), leading to a rapid return to hyperglycemia. To assess whether the response to HIPs is blunted in the transplant setting, we will conduct another series of experiments in which the graft infiltrate will be analyzed via flow cytometry. This analysis will evaluate the percentage and phenotype of HIP-reactive T cells using our HIP- as well as B:9-23 loaded MHC II tetramers. A significant reduction in the percentage of HIP-reactive T cells is observed in mice transplanted with InslT / IIns2T / Iislets when compared to those transplanted with NOD. scid islets, resulting in lower numbers of other cell types, particularly CD8 T cells. Previous data have indicated the importance of 2.5HIP-reactive T cells in recruiting IGRP-reactive CD8 T cells, a pivotal population implicated in the destruction of 0-cells. Therefore, the presence and phenotype of IGRP tetramer-positive cells is explored to determine whether the absence of HIPs can influence the presence and function of other effector populations.

[0078] These experiments are for determining whether HIP-deficient islets possess reduced immunogenicity, making them suitable candidates for islet transplantation. Although it is thought that islets from Insl1 IIns21 1mice are devoid of infiltrating HIP-reactive T cells, it is possible that T cells of other specificities might be present, such as insulin B: 9-23 -reactive T cells. It has been found that a sizable portion of insulin-reactive T cells present in the islets express FoxP3, whereas HIP-reactive T cells harbor a strong inflammatory phenotype. Experiments under aim 1.2, where the islet infiltrate is analyzed with MHC class II tetramers and histology, provide answers to these questions. If it is found that there is a significant infiltrate in the transplanted InslI / IIns2I / Iislets, InslI / IIns21 1NOD mice are generated on a NOD. scid background, where isletsAttorney Docket No. 151077-00049PR would be completely devoid of T and B cells. This approach allows for the investigation of the role of non-HIP autoantigens in graft rejection and to determine whether the absence of HIPs alone is sufficient to confer protection against autoimmune destruction. Additionally, if the transplanted Ins l[ IIns2nislets are not completely protected from recurrent autoimmunity, the use of low-dose immunosuppression and / or antigen-specific immunotherapy is explored to enhance graft survival. This approach can help to uncover the relative contributions of HIP - reactive T cells and other autoreactive T cell populations to graft destruction and provide insights into the development of targeted immunotherapies for T1D. These findings can have important clinical implications for the development of novel cell-based therapies for T1D. By using gene editing techniques such as CRISPR-Cas9, it can be possible to introduce the LAI mutation into the insulin gene of human induced pluripotent stem cells (iPSCs), which can be transdifferentiated into beta-cells. Such beta-cells can be infused into the portal vein of the liver of T1D patients, providing a renewable source of insulin-producing cells that are protected from autoimmune destruction. This approach offers several advantages, including the elimination of the need for immunosuppression, protection against autoimmune destruction, and an unlimited supply of beta-cells. To translate these findings into clinical application, the differentiation of HIP-deficient iPSCs into functional beta-cells is optimized and their safety and efficacy is evaluated in preclinical animal models. Nonetheless, these findings provide a strong rationale for the therapeutic potential of HIP-deficient iPSC-derived beta-cells as a novel cell-based therapy for T1D.1.5. T CELL MEDIATED DIABETES INDUCTION IN INS1I / IINS2I / IMICE Experimental Design:

[0079] The BDC-2.5 T cell clone is a well-characterized diabetogenic CD4+ T cell clone that recognizes the 2.5HIP antigen. Injection of BDC-2.5 cells into NOD pups results in the rapid onset of diabetes, providing a robust model to study the pathogenicity of HIP-reactive T cells. In this aim, we will investigate whether the BDC-2.5 clone can initiate diabetes in the InslEIIns2I / I NOD mouse, which does not contain the 2.5HIP antigen due to the LAI mutation that prevents CatD-mediated processing of C-peptide (see FIG. 7). We will inject 10 * 106BDC-2.5 T cells intraperitoneally (i.p.) into double homozygous (InslI / IIns2I / I) or wild-type pups at 5-12 days of age in a volume of 50 microliters of sterile PBS. The wild-type NOD group will serve as aAttorney Docket No. 151077-00049PR positive control for the pathogenicity of the BDC-2.5 clone. The experiment will be performed with a group of three pups per genotype (InslL IIns21'1and wild-type) and will be repeated at least three times to confirm the results and to assess the reproducibility of the BDC-2.5 T cell clone’s activity. The pups will be monitored for diabetes beginning three days after the injection by checking urine glucose levels daily using urine glucose test strips. If a positive result is obtained, a blood glucose reading will be taken using a glucometer. A blood glucose level of 250 mg / dL (13.9 mmol / L) or greater on two consecutive days will be considered indicative of diabetes onset. The mice will be followed for up to 4 weeks after the injection. If a mouse has not become diabetic within 4 weeks, it will be considered protected from diabetes induced by BDC-2.5. To confirm the presence of the transferred BDC-2.5 cells in the recipients, we will analyze the spleen, pancreatic lymph nodes, and islet infiltrates of a subset of mice from each group by flow cytometry one week post-transfer. The BDC-2.5 T cell clone expresses a distinct TCR that can be detected using an anti-Vb4+ monoclonal antibody. This analysis will allow us to track the survival and homing of the transferred cells to the target tissue.

[0080] InslI / IIns2I / INOD mice do not develop diabetes following the transfer of the BDC-2.5 T cell clone, as these mice should not express the 2.5HIP antigen required for the activation of the BDC-2.5 clone. In contrast, wild-type NOD mice develop diabetes rapidly after BDC-2.5 cell transfer, serving as a positive control for the pathogenicity of the clone. Transfer of diabetogenic T cell clones is a well-established technique. However, if a lower-than-expected incidence of diabetes in the wild-type NOD recipients is observed, islets from NOD mice are isolated and InslI / IIns2I / INOD mice and in vitro assays are performed to determine their antigenicity using the BDC-2.5 T cell clone. Titration curves are established by comparing in vitro stimulation with the 2.5HIP antigen and increasing numbers of islets cells where IFN-y production are measured by ELISA as a readout for T cell activation. If necessary, the cell transfer protocol (e.g., cell number, route of administration, or recipient age) is optimized to ensure consistent diabetes induction in the wild-type NOD mice. As a possible alternative source of T cells, CD4 T cells isolated from 2.5 TCR-Transgenic mice can be used as these cells also rapidly transfer diabetes in young NOD mice. If the InslI / IIns2I / INOD mice develop diabetes following BDC-2.5 cell transfer, the possibility that the transferred cells may recognize alternative antigens in the absence of 2.5HIP is investigated, and experiments described under Aim 1.1 should provide some insight. If these experiments are successful, these experiments are repeated with the BDC-Attorney Docket No. 151077-00049PR6.9 T cell clone which recognizes a different HIP formed at the LAL-locus of C-peptide (see FIG. 1). These experiments should shed light on the importance of HIPs in the initiation of autoimmune diabetes in the NOD mouse model. If the Ins I1’Ins1 1mice remain diabetes-free following the transfer of BDC-2.5 or BDC-6.9 T cells, strong evidence is provided for the hypothesis that InslI / IIns2I / Imice cannot produce the 2.5HIP and 6.9HIP.2. INVESTIGATING THE MECHANISM OF HIP-FORMATION MEDIATED BY CATHEPSIN D Introduction:

[0081] CatD was identified as the protease responsible for the formation of various HIPs (FIG. 1) that are targeted by the most pathogenic T cells currently known in NOD mice. While the new animal model (aim 1) does not form these specific HIPs, which all form at the same site within C-peptide, the role of CatD is not limited to HIP formation at these sites. Unlike murine islets, which contain stable levels of HIPs, detecting HIPs in human islets has been challenging and highly variable. In most cases, the human islets we investigated did not contain detectable levels of HIPs. The presence of HIPs in human islets depends on specific environmental factors, such as exposure to distinct cytokines (FIG. 3). Currently, the Delong group is investigating the role of stress on human islets is being investigated. Here, CatD-mediated HIP-formation is focused on through in vitro reactions. This approach gives precise control over experimental conditions, such as pH, substrate concentration, and reaction time. This level of control may not be achievable when working with human islets, which are subject to inherent variability due to factors such as donor genetics, age, and environmental influences. Additionally, CatD-mediated HIP formation may provide a therapeutic target. Blocking the activity of CatD may allow the reduction of HIP content in beta cells. This aligns with cancer research, where CatD is also under investigation as a therapeutic target where studies have shown that inhibiting CatD activity can enhance the efficacy of various chemotherapeutic agents. By targeting CatD, the aim is to improve the effectiveness of cancer treatments and overcome drug resistance. Similarly, in the context of T1D, inhibiting CatD-mediated HIP formation can offer a novel approach to prevent or delay the onset of the disease by reducing the generation of key autoantigens. Furthermore, the insights gained from this study can contribute to the identification of new HIPs, which can be used to develop novel diagnostic and therapeutic strategies for T1D prevention and intervention.Attorney Docket No. 151077-00049PRIdentification of these epitopes will be critical for the development of antigen-specific tolerance induction strategies, as well as the detection of HIP-reactive T cells, which may serve as biomarkers for T1D. By better understanding the mechanisms of HIP formation and the role of CatD in this process, the aim is to identify potential targets for preventing or reducing the formation of these autoantigens.2.1. IDENTIFYING CATHEPSIN D INHIBITORS AMONG FDA-APPROVED DRUGS Introduction:

[0082] CatD, an aspartic protease, shares structural similarities with HIV-1 protease, a major therapeutic target for HIV treatment. Given the success of ten distinct FDA-approved HIV-1 protease inhibitors in hindering viral proliferation, we hypothesize that these inhibitors may also effectively inhibit CatD activity, potentially preventing the formation of HIPs involved in the pathogenesis of T1D. To test this hypothesis, we will optimize a Forster Resonance Energy Transfer (FRET) assay to screen HIV-1 protease inhibitors for their ability to inhibit CatD activity. Our in house developed FRET assay employs an optimized peptide substrate for CatD that is labeled with a fluorophore and quencher in close proximity, resulting in low fluorescence. Upon CatD-mediated cleavage, the fluorophore and quencher separate, leading to increased fluorescence. Effective inhibitors will prevent substrate cleavage, maintaining a low FRET signal. Our preliminary trials demonstrated that Ritonavir, an FDA-approved HIV-1 protease inhibitor, blocked CatD activity with an IC50 of 72 nM (FIG. 9), supporting the potential repurposing of HIV-1 protease inhibitors for T1D prevention by targeting CatD-mediated HIP formation.Experimental Design:

[0083] To optimize the FRET assay for screening HIV-1 protease inhibitors, the following key parameters are focused upon: (1) Buffer composition: Evaluate different buffer systems (e g., sodium acetate, citrate, and MES) and pH ranges (3.5-5.5) to identify optimal conditions for CatD activity and inhibitor screening. (2) Reaction conditions: Optimize substrate and enzyme concentrations, incubation time, and temperature to ensure robust and reproducible FRET signals. (3) Inhibitor screening: Validate the optimized FRET assay using known CatD inhibitors (e g., Pepstatin A) and a panel of 10 FDA-approved HIV-1 protease inhibitors atAttorney Docket No. 151077-00049PR concentrations ranging from 0 nM to 100 pM. (4) Data analysis: Develop a standardized data analysis pipeline to calculate IC50 values for each inhibitor based on the FRET assay results, using non-linear regression analysis. Furthermore, to validate the efficacy of identified inhibitors in blocking HIP formation, we will employ LC-MS / MS to quantify the relative abundance of newly formed HIPs (e g., HIP11) in the presence and absence of inhibitors. Reactions will be conducted using human C-peptide as substrate, and samples will be prepared for LC-MS / MS analysis following our established protocols.

[0084] The optimized FRET assay enables the identification of potent HIV-1 protease inhibitors that effectively block CatD activity. The successful development of this assay will provide a valuable tool for future high-throughput screening of novel CatD inhibitors. Collaborations with drug discovery experts at our School of Pharmacy can facilitate the adaptation of this assay for large-scale inhibitor screening. Optimizing a FRET assay to screen FDA-approved HIV-1 protease inhibitors for their ability to inhibit CatD activity represents a promising approach to identify potential therapeutic agents for preventing HIP formation and T1D development. For this we foresee studies on NOD mice to monitor disease prevention in presence of CatD inhibitors. The insights gained from this study will inform future efforts to develop targeted interventions for T1D prevention and management.2.2. EVALUATING HIP-FORMATION THROUGH IN VITRO REACTIONS WITH CATHEPSIN D Introduction:

[0085] HIPs have been detected in the islets of both NOD mice and non-diabetes-prone BALB / c mice, suggesting that HIP formation is a regular cellular process. However, human islets rarely contain detectable levels of HIPs, even when analyzing large quantities of islets. We hypothesize that this discrepancy may be explained by the difference in pH optima for HIP formation between human and murine CatD. Our preliminary data (FIG. 10) shows that human CatD does not form HIP11 above pH 5.0, while murine CatD forms HIP11 up to pH 5.8. This difference could have critical implications for the mechanism of disease progression in humans compared to NOD mice. By focusing on HIP formation mediated directly by human CatD through in vitro reactions, we can gain greater control over reaction conditions and identify new HIPs that may not be readily detectable in human islets. Such HIPs could provide valuableAttorney Docket No. 151077-00049PR reagents for the identification of new T1D biomarkers, such as autoreactive T cells in PBMCs of at-risk individuals (see FIG. 2). In addition to C-peptide, the insulin molecule provides a major substrate in beta cells for HIP formation. The insulin B-chain as autoantigen has long been a major focus of T1D research and numerous T cells targeting its B:9-23 region have been identified. Numerous B-chain reactive T cells show significantly elevated responses to a modified form of the B:9-23 epitope where it was shown that altering an arginine residue (R) to a glutamic acid residue (E) within the B:9-23 sequence (SHLVEALYLVCGERG —> SHLVEALYLVCGEEG) leads to significantly improved responses by autoreactive T cells. As a consequence of this observation, T-cell tetramer reagents used for detecting T cells in biological samples contain this modification to enhance their binding affinity and specificity. A plausible mechanism on how such a modification can occur in beta-cells is through transpeptidation reactions. Here, we will optimize the transpeptidation reactions mediated by CatD using insulin, C-peptide and natural beta cell peptides (identified in human islets) as substrates. In preliminary experiments, we incubated insulin in the presence of CatD and C-peptide. Here we identified a new HIP that formed between a fragment of the insulin B-chain and the N-terminus of C-peptide (FIG. 11). By expanding on this experiment and using different peptide substrates (including peptides isolated by chromatography from human islets) we aim to detect new HIPs that may form in human islets and develop an improved understanding of the factors governing HIP formation.Experimental Design:

[0086] HIP formation through in vitro reactions with CatD are evaluated by (1) Optimize conditions for CatD-mediated formation ofHIPl l : (a) pH optimization: Incubate C-peptide (human) with human CatD at various pH conditions (pH 3.0, 3.5, 4.0, 4.5, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 6.0) for 2h at 37°C. Quench the reactions through neutralization and addition of the CatD inhibitor pepstatin A. Analyze the reaction products by LC-MS / MS to verify the formation of HIP11 and determine the optimal pH for HIP11 formation based on its relative abundance, (b) Time course: Using the optimal pH determined in (a), incubate human C-peptide with human CatD for various time points (0.5, 1, 2, 4, 8, 12, and 24h) at 37°C. Quench the reactions and analyze the reaction products by LC-MS / MS to verify the formation of HIP11. Determine the optimal incubation time for HIP11 formation based on its relative abundance and the formationAttorney Docket No. 151077-00049PR of other HIPs or degradation products, (c) CatD concentration: Using the optimal pH and incubation time determined in (a) and (b), incubate human C-peptide with varying concentrations of human CatD (0.1, 0.5, 1, 2, 5, and 10 nM) at 37°C. Quench the reactions and analyze the reaction products by LC-MS / MS to verify the formation of HIP11. Determine the optimal CatD concentration for HIP11 formation based on its relative abundance and the formation of other HIPs or degradation products. (2) Repeat experiments using human insulin, instead of C-peptide. Due to poor solubility of insulin at pH levels above 5.0, remove undissolved insulin through centrifugation (lOmin at 10,000g) following peptide incubation. Quench the reactions with pepstatin A and analyze the reaction products by LC-MS / MS to identify cleaved peptides and determine dominant cleavage sites within insulin based on their relative abundance (see FIG. 4). (3) Co-incubate insulin, insulin A- or B-chain, or C-peptide with CatD in the presence of peptides isolated from human islet lysates. Synthetic peptides will be N-terminally acetylated to block them from competing with islet peptides as substrates for HIP -formation. Fractionate human islets by size exclusion chromatography using our established protocols. Incubate insulin and other peptides with CatD in the presence of various beta cell peptide concentrations (0-10 mg / mL). Use the optimal pH, time, and concentration determined under (1) and (2) at 37°C. Quench the reactions through neutralization and addition of pepstatin A. Identify HIPs using LC- MS / MS using our published protocols and HIP databases. Validate HIP identities using synthetic peptides and the p-VIS validation protocol.

[0087] A standardized protocol for efficient HIP formation by optimizing pH, incubation time, and CatD concentration is established. This optimization process leads to the identification of new HIPs that may form in human islets. It may be necessary to adjust incubation times to optimize HIP formation when using peptides derived from human beta cells. Throughout the experiments, the reaction conditions are modulated as needed to ensure optimal HIP formation and identification. By carefully controlling the experimental parameters and adapting the protocol to accommodate the unique properties of human beta cell peptides, a robust and reproducible method for generating HIPs is created. If HIP 11 cannot be detected by mass spectrometry, an alternative is to use the T cell assays and the E2 T cell clone as it has been a very sensitive method to detect low abundant peptides. Experiments described not only advance the understanding of the role of HIPs in T1D pathogenesis but also provide a foundation for the development of innovative diagnostic and therapeutic approaches targeting these autoantigens.Attorney Docket No. 151077-00049PRRIGOR AND REPRODUCIBILITY

[0088] To ensure scientific rigor and reproducibility, transparency is maintained by sharing methodological details, results, and necessary reagents. Statistical analyses will be conducted using appropriate tests (e.g., t-test, ANOVA) with Prism (version 9) software. Experiments are sufficiently powered, repeated at least 3 times, and results with p < 0.05 are considered significant. Advanced mass spectrometry techniques (Agilent 6550 QTOF, Thermo Lumos Fusion Orbitrap) are employed to enhance accuracy and sensitivity. Blinding, randomization, and proper controls are implemented to minimize bias and validate results. Experimental data are securely stored, and detailed protocols and analysis scripts are documented. By adhering to these principles, robust and reproducible findings are generated that contribute to the development of clinical applications for T1D prevention and management.EXAMPLE 3Beta Cell Stress Triggers Formation of Hybrid Insulin Peptides Through Granular pH Modulation

[0089] In type 1 diabetes (T1D), hybrid insulin peptides (HIPs) have been identified as targets of autoreactive CD4 T cells in both humans and experimental mouse models. These unique neoepitopes are generated through a transpeptidation process whereby an insulin peptide fragment becomes covalently linked to a peptide fragment derived from the same or a different beta cell granular protein. Recent investigations have established that cathepsin D (CatD), an aspartic protease, mediates the transpeptidation reaction leading to formation of several diseaserelevant HIPs, providing crucial mechanistic insight into HIP biogenesis. The pathogenic significance of HIPs in T1D has been demonstrated through multiple lines of evidence in nonobese diabetic (NOD) mice, where autoreactive CD4 T cells recognizing HIPs exhibit potent diabetogenic activity. Complementary studies in humans have confirmed the clinical relevance of these findings. HIP-reactive T cells have been detected at significantly elevated frequencies in the peripheral blood of recent-onset T1D patients compared to non-diabetic controls and identified within residual pancreatic islets from T1D organ donors, providing direct evidence of HIP-reactive T cells in the target tissue. Our recent work further validated the importance of HIPs by demonstrating delayed disease onset in NOD mice when HIP abundance wasAttorney Docket No. 151077-00049PR significantly reduced through modification of a single amino acid residue in the insulin C- peptide region targeted by cathepsin D.

[0090] A key observation motivating this study is that HIPs are consistently detectable in mouse islets, including islets from non-diabetes-prone strains such as BALB / c mice, whereas HIP detection in human islets has been sporadic under standard isolation conditions. This discrepancy suggests fundamental differences in HIP formation mechanisms between species. Importantly, the mere presence of HIPs does not automatically lead to diabetes development, as evidenced by their detection in non-autoimmune mouse strains. This supports that additional factors, particularly HLA presentation, play a key role in determining whether HIPs drive autoimmunity. HLA molecules, which constitute the primary genetic risk factor for T1D, may contribute to disease susceptibility by presenting the junction sequences of HIPs, the foreign peptide bonds where two distinct peptides are covalently linked, to autoreactive T cells. In contrast, non-diabetes-associated HLA molecules may preferentially present the native (nonjunction) sequences within HIPs, which would not be recognized as foreign by the immune system.

[0091] Despite these advances in understanding HIP formation and pathogenicity, the cellular and biochemical factors that regulate CatD activity within beta cells to control HIP production remain poorly defined. The insulin granule maintains an acidic microenvironment with pH values typically ranging between 5.0 and 6.0, conditions that may be suboptimal for cathepsin D activity. Recent subcellular localization studies indicate that HIPs form within beta cell insulin granules but are also detected in crinophagic bodies, which arise from fusion of insulin granules with lysosomes. Both insulin granules and lysosomes contain vacuolar-type H+- ATPase (V-ATPase) proton pumps embedded within their membranes that drive luminal acidification. In lysosomes, activation of these proton pumps is essential for optimal lysosomal enzyme function.

[0092] We hypothesize that species-specific differences in CatD pH optima may explain the differential HIP detection between mouse and human islets. Specifically, human CatD may require a lower pH than mouse CatD to efficiently catalyze HIP formation, explaining why HIPs are readily detectable in mouse islets under standard conditions but sporadic in human islets. We further propose that environmental stressors, such as proinflammatory cytokines known to lower lysosomal pH, may induce further acidification of insulin granules and / or crinophagic bodies inAttorney Docket No. 151077-00049PR human beta cells. This stress-induced acidification could enhance CatD activity and increase HIP formation by CatD as well as other proteases, thereby upregulating production of these neoepitopes and making beta cells more visible to autoreactive CD4 T cells. Such a mechanism would provide a critical link between environmental triggers and the onset of autoimmune beta cell destruction in genetically susceptible individuals.

[0093] In the present study, we investigated whether environmental stress conditions that may acidify cellular compartments can enhance CatD-mediated HIP formation in human islets. We exposed human islets to a proinflammatory cytokine as well as a modulator of the vATPase proton pump and assessed HIP abundance by mass spectrometry to test our hypothesis that stress-induced acidification upregulates HIP production. Our findings provide insight into environmental triggers that may promote neoepitope formation and initiate or accelerate autoimmune beta cell destruction in T1D pathogenesis.Material and MethodsRecombinant mouse versus recombinant human Cathepsin D (CatD) activity

[0094] Human C-peptide (0.3775pg / uL) was incubated with either recombinant mouse or recombinant human CatD (112.5nM; 0.005pg / uL). Reactions occurred in Mcllvaine buffer at varying pH between pH5 and pH6. The mixture was incubated for two hours at 37°C and the reactions were halted by neutralization of the solution with ammonium hydroxide and addition of pepstatin (final concentration in solution: O.lOOpM). Volume containing 5ug of intact C-peptide were collected from each reaction mixture and lyophilized at 55°C under vacuum. Samples were then resuspended in AspN digestion buffer (25mM ammonium bicarbonate with 500pM ZnSO4) and digested overnight following addition of O.lug AspN. The digested samples were lyophilized at 55 °C under vacuum then resuspended in MS buffer composed of 3% acetonitrile, 0.1% formic acid, and MS-grade water. Samples were analyzed using LC-MS / MS by injecting 0.05pg / sample into the system. The relative abundance of the CatD-mediated cleavage product of C-peptide (DLQVGQVELGGGPGAGSLQPLAL) was measured and compared at the various pH levels between groups.Attorney Docket No. 151077-00049PRHuman Islet Culture and Treatment

[0095] Human islets were obtained from a single donor per condition tested from the integrated islet distribution program and washed in 1 x PBS. After washing the islets, they were resuspended in CMRL-1066 culture media containing 1% Glutamine, 1% pen / strep, and 10% human serum. Islets were then plated in 12-well untreated culture plates with 1000 islet equivalents (ieqs) per well in ImL of media. The islets were treated with various insults such as 0-10ng / mL of IL-1B, 95mg / dl or 285mg / dL glucose, or 0-100pM C381 and incubated for 24hrs at 37°C and 5% CO2.Human Islet Assessment by Mass Spectrometry

[0096] Islets were prepared for analysis using our previously published approach. The samples were lysed by heating at 95C. The supernatant was then fractionated by size exclusion chromatography and then the fractions were lyophilized under vacuum. The fractions were resuspended in ammonium bicarbonate buffer containing 500pM zinc and then digested with AspN. The fractions were lyophilized under vacuum and then resuspended in buffer containing 3% acetonitrile and 0.1% formic acid, and then analyzed by MS.ResultsSpecies-specific differences in Cathepsin D (CatD) pH dependence

[0097] To investigate whether species-specific differences in CatD pH dependence could explain the differential HIP detection between mouse and human islets, we compared the ability of recombinant mouse and human CatD to cleave human C-peptide across a range of pH conditions (FIG. 12). Rather than directly measuring CatD-mediated HIP formation, which we previously established to occur, we monitored the C-peptide cleavage product that forms at the same leucine residue (Leu26) of C-peptide at which HIPs are generated. This approach provides a more sensitive readout of CatD activity because the primary function of proteases is peptide bond hydrolysis rather than transpeptidation, resulting in significantly higher yields of the cleavage product compared to HIPs and thereby increasing our analytical sensitivity.Recombinant mouse CatD exhibited a broader pH range of proteolytic activity, generating the C- peptide cleavage product at pH values up to 5.8. In contrast, human CatD showed a more restricted pH range, producing detectable C-peptide cleavage product only up to pH 5.2. AtAttorney Docket No. 151077-00049PR comparable pH values within the active range of both enzymes, mouse CatD generated significantly greater amounts of the C-peptide cleavage product than human CatD. Neither mouse nor human CatD produced detectable levels of C-peptide cleavage product above pH 6.0. These findings demonstrate that human CatD requires a more acidic environment than mouse CatD for C-peptide processing, supporting our hypothesis that normal granular pH conditions may be insufficient for robust HIP formation in human islets under stress-free conditions.Identification of a novel cytokine-induced HIP in human islets

[0098] To assess whether cytokine stress enhances HIP formation in human islets, we exposed isolated human islets to the proinflammatory cytokine IL-ip and analyzed the samples by mass spectrometry. MS spectra were searched for potential HIPs using an in-house algorithm currently under development. This search identified a previously uncharacterized HIP composed of an insulin C-peptide fragment (GAGSLQPL) on the N-terminal side of the junction and an islet amyloid polypeptide (IAPP) fragment (TPIESHQV) on the C-terminal side, yielding the neoepitope GAGSLQPLTPIESHQV. Importantly, this novel HIP (neoHIP) was detected exclusively in cytokine-stressed samples and was absent from control islet samples.Validation of the neoHIPIL-ip induces neoHIP formation in human islets

[0099] To confirm the identity of the novel C-peptide-IAPP HIP, we obtained the predicted neoepitope sequence (GAGSLQPLTPIESHQV) commercially and performed side-by-side MS analysis with cytokine-stressed human islet samples. Comparison of the fragmentation spectra between the synthetic standard and the biological sample yielded a Pearson correlation coefficient (PCC) of 0.949, which fell within the statistical confidence interval calculated from internal peptide standards added to the samples, confirming that the peptide detected in IL-ip- stressed islets matched the structure of the synthetic neoHIP (FIG. 13). This high correlation validates the presence of this novel C-peptide-IAPP hybrid peptide in human islets exposed to proinflammatory IL-1 (3 stress.Attorney Docket No. 151077-00049PRHyperglycemia enhances neoHIP formation

[0100] We also assessed the effect of glucose on HIP formation in human islets by culturing human islets under normoglycemic or hyperglycemic conditions. In the presence of elevated glucose levels (285mg / dL), the neoHIP formation was observed whereas this HIP was not detected under normal glucose conditions. This finding suggests the glucose treatment was capable of upregulating HIP-forming activity within the human islets. The neoHIP spectrum from the islet sample was compared to that of the synthetic neoHIP by MS (FIG. 14). Using our rigorous validation approach, we confirmed the presence of the HIP within the high glucose- treated sample. This further illustrates an additional route through which environmental stress on human islets can influence HIP formation in human islets.Evidence for v-ATPase modulation by C381

[0101] The small molecule C381was previously indicated to lower lysosomal pH through activation of the v-ATPase proton pump, that controls the pH of insulin granules, lysosomes and crinophagic bodies. We aimed to test the effect of this molecule on human islets due to the expression of this proton pump on the beta cell insulin granules. Following treatment of human islets in the absence and presence of lOOpM C381, the sample contents were assessed by MS. Sample datafiles were searched through our in-house database and indicated the presence of the neoHIP in human islets treated with l OO M C381. Spectral analysis following extraction of the ion chromatogram indicated the neoHIP formed (FIG. E). This serves as a result that supports future aims that include validating the presence the HIPs using the P-VIS approach.Discussion

[0102] HIPs are an intriguing autoantigen in T1D. Our work here illustrates how environmental mediators may influence HIP formation. Additionally, this work introduces an approach for successfully identifying a previously unidentified HIP present in human islets. Improving the frequency through which HIPs can be identified has been an obstacle limiting the research of HIPs in T1D. Although HIPs are consistently detected in islets from mice, their detection in human islets is less frequent.

[0103] The sporadic detection of HIPs in human islets compared to mouse islets can be attributed to several interrelated factors. First, species-specific differences in cathepsin D pH-Attorney Docket No. 151077-00049PR dependence provide a fundamental biochemical explanation for differential HTP formation. As illustrated in Figure 17, recombinant mouse CatD exhibited proteolytic activity across a broader pH range (up to pH 5.8) compared to human CatD (up to pH 5.2). Given that insulin granule pH typically ranges between 5.0 and 6.0, this narrower activity window for human CatD suggests that basal granular pH conditions may be suboptimal for robust HIP formation in human beta cells under non-stressed conditions. This extended range of activity for mouse CatD not only favors more efficient C-peptide processing but also provides a mechanistic explanation for why HIPs are consistently detected in mouse islets while remaining sporadic in human islets. Supporting this species difference, previous studies observed glucose-stimulated secretion of the CatD-mediated C-peptide cleavage product in rats but failed to detect equivalent secretion from radioactively pulsed human islets, suggesting fundamental differences in CatD-mediated processing between rodents and humans.

[0104] Second, technical limitations in mass spectrometric detection may contribute to the apparent scarcity of HIPs in human samples. The amino acid composition of C-peptide fragments incorporated into HIPs differs significantly between mice and humans, potentially affecting ionization efficiency during electrospray mass spectrometry. Human C-peptide and its proteolytic fragments exhibit greater hydrophobicity compared to their mouse counterparts which can negatively impact ionization through reduced solubility in the aqueous mobile phase and altered chromatographic behavior. Peptides with excessive hydrophobicity often show diminished signal intensity compared to peptides with more balanced hydrophilic and hydrophobic properties. These structural differences indicate that human HIPs may be present at levels comparable to mouse HIPs but fall below the detection threshold due to inferior ionization properties. This technical limitation underscores the importance of our stress-induction experiments, where enhanced HIP formation under inflammatory conditions may elevate HIP abundance sufficiently to overcome ionization barriers and enable reliable detection.

[0105] Third, biological differences in cellular degradation pathways may influence HIP accumulation in human beta cells. Impaired crinophagic and autophagic activity has been linked to T1D pathogenesis, and such defects could lead to abnormal accumulation of HIPs in affected individuals. This possibility suggests that HIP abundance may vary substantially between healthy individuals and those developing T1D, with cellular stress and impaired clearance mechanisms contributing to elevated neoantigen levels in at-risk populations. Critically, the presence of HIPsAttorney Docket No. 151077-00049PR alone does not automatically trigger autoimmunity but also the HL A context can determine immunological outcome. High-risk HLA molecules may efficiently present HIP junction sequences, where the foreign transpeptide bond creates a neoepitope recognizable by autoreactive T cells. In contrast, low-risk HLA molecules may preferentially present native (nonjunction) sequences within HIPs, which would not elicit immune recognition as foreign antigens. Lhis HLA-dependent presentation pattern could explain why genetically susceptible individuals progress to clinical T1D while others with comparable HIP levels do not. Together, these factors of reduced CatD activity at physiological pH, impaired autophagy leading to HIP accumulation, and high-risk HLA presentation of junction epitopes provide a comprehensive framework for understanding the variable detection and pathogenic role of HIPs in human T1D.

[0106] The uncovering of a mechanism that influences HIP formation is a significant finding to improve the understanding of the role of HIPs in T1D pathogenesis. Here we showed that treating human islets with IL-ip, elevated glucose, and C381 resulted in the formation of a previously unidentified HIP. Although this may be influenced by acidification of environmental pH, this hypothesis requires further investigation. Additionally, this neoHIP appears to have a specifically tailored mechanism through which it forms. Dissimilar to previously identified HIPs, the neoHIP contains an insulin C-peptide fragment that is naturally cleaved at the C- and N- terminal segments (GAGSLQPL). This portion of C-peptide is two-residues N-terminal of the preferred CatD cleavage site of human C-peptide. However, more work is required to investigate the potential role of this HIP in immune cell targeting of beta cells in human islets, the environmental stressor does seem to upregulate the HIP’s formation. Limitations due exist in the current work though due to donor-to-donor biological variability as well as donor islet isolation occurring at different institutions which introduces a confounding variable into our sample treatment and analysis. These limitations could provide explanation as to why neoHIP detection remains sporadic. The future aims of this work will be to identify an optimal timeframe following human islet stress during which neoHIP abundance is most detectable.

[0107] The Eisenbarth model of type 1 diabetes (T1D) describes a linear decline in pancreatic beta cells following a precipitating event. Since its inception, modifications to the model have been introduced. This includes alterations to the linearity of beta cell mass loss, and instead, it was proposed that loss of beta cell mass can take on a relapsing or remitting pattern. Although this model has guided T1D research for nearly four decades, the driving targets ofAttorney Docket No. 151077-00049PR autoimmunity in the beta cell have yet to be established. With the discovery of a HIP that is generated following cytokine stress of human islets in vitro, we propose an additional modification to the Eisenbarth model. Instead of a gradual linear loss of beta cell mass over time, we propose a more stepwise decrease in beta cell mass as a result of beta cell stress leading to changes, such as HIP-formation, within the beta cell that leads to their increased immunogenicity and subsequent targeting by autoreactive T cells. Given that individuals are exposed to diverse environmental stressors throughout life, this model may explain the high patient-to-patient variability in disease progression observed among autoantibody-positive individuals at high genetic risk for T1D. Environmental triggers such as viral infections, metabolic stress, or inflammatory insults could episodically enhance HIP formation, creating variable windows of heightened beta cell immunogenicity that accelerate autoimmune destruction in a non-linear fashion. This framework also accounts for the characteristically rapid onset of clinical symptoms once beta cell mass falls below the functional threshold required for glucose homeostasis (FIG. 16).

[0108] These findings represent an important advancement in HIP research by demonstrating that proinflammatory cytokines can induce formation of novel HIPs in human islets. This establishes a mechanistic link between environmental stress and neoantigen generation, providing experimental support for the concept that beta cell stress drives episodic increases in immunogenicity. Elucidation of the precise molecular mechanisms governing stress-induced HIP formation, including the roles of granular acidification, cathepsin D activation, and autophagy in regulating neoepitope abundance is performed. Additionally, comprehensive identification and immunological characterization of the complete HIP repertoire in human islets under both stress- free and stressed conditions is essential for determining whether HIPs represent bona fide disease drivers or epiphenomena in T1D pathogenesis. Understanding how environmental factors modulate HIP formation can reveal critical intervention points for preventing or delaying autoimmune beta cell destruction in at-risk individuals.EXAMPLE 4Strategic Elimination of Disease Relevant Hybrid Insulin peptide (HIP) Formation in NOD Mice

[0109] Type 1 diabetes (T1D) is an autoimmune disease characterized by the destruction of insulin-producing beta cells, resulting in insulin deficiency and hyperglycemia. The non-obeseAttorney Docket No. 151077-00049PR diabetic (NOD) mouse serves as a well-established animal model for studying T1D, as it spontaneously develops autoimmune diabetes with numerous similarities to human disease. Recent investigations into both mouse and human islets by mass spectrometry (MS) have revealed the presence of neoepitopes called hybrid insulin peptides (HIPs). These HIPs form through the covalent cross-linking of proinsulin peptides with various beta cell peptides, producing amino acid sequences that are not genetically encoded. This unique formation mechanism may allow HIP-reactive T cells to escape thymic tolerization or negative selection, enabling them to circulate in the periphery where they selectively target beta cells for destruction.

[0110] HIPs have been detected and validated in both human and mouse islets by MS and specific HIPs are recognized by autoreactive T cells in NOD mice and T1D patients. In NOD mice, several HIP-reactive CD4 T cells have been shown to trigger diabetes development. In human disease, HIP-reactive T cells and T cell receptors (TCRs) have been detected within residual islets of T1D organ donors. Furthermore, HIP-reactive T cells were shown to circulate at significantly elevated levels in the peripheral blood of recent-onset T1D patients, distinguishing them from non-diabetic control subjects. We consider HIPs to be disease-relevant when they are fully validated by MS and are targeted by an established CD4 T cell that contributes to disease. The clinical relevance of HIPs is further supported by observations that a high percentage (73%) of islet autoantibody-positive subjects who progress to stage 2 or 3 T1D show HIP reactivity, indicating that disease activity correlates with an increase in proinfl ammatory T cells targeting HIPs. Our group’s work has uncovered the role of the aspartic protease cathepsin D (CatD) as an enzyme involved in the formation of several disease-relevant HIPs through transpeptidation reactions (FIG. 17). We discovered that CatD specifically targets proinsulin at a conserved leucine residue within the C-peptide region, corresponding to Leu82 in human proinsulin and Leu80 in mouse INS1 proinsulin and Leu82 in mouse INS2 proinsulin (Leu26 in the human C- peptide, Leu24 in the mouse INS1 C-peptide, and Leu26 in the mouse INS2 C-peptide). Through analyses of human and mouse islets, we have validated the presence of disease-relevant HIPs forming at this specific leucine residue. Notably, in NOD mice, three of these HIPs serve as targets for the most pathogenic T cell clones currently known. Among these, the 2.5HIP, which incorporates a natural cleavage product of Chromogranin A (ChgA) from beta cell secretory granules, functions as the cognate epitope for the diabetogenic CD4 T cell clone BDC-2.5. TheAttorney Docket No. 151077-00049PR critical role of this HIP in NOD mice is underscored by the observation that ChgA-defi cient NOD mice, which cannot form this HIP, are protected from disease development.Comprehensive analysis of CatD cleavage patterns reveals a strong preference for peptide bonds on the C-terminal side of leucine residues, while peptide bonds adjacent to other amino acids are largely unaffected by this protease. This inspired our recent work where we showed that NOD mice expressing the INS21 1modification, which prevents cathepsin D from cleaving insulin C- peptide at a critical site, had reduced abundance of hybrid insulin peptides (HIPs) in their islets and a decrease in disease incidence. However, beta cells from these mice retained the capacity to generate HIPs due to continued expression of wild-type INS1 C-peptide, which contains the cathepsin D (CatD) processing site essential for HIP formation. This residual HIP production may explain the incomplete protection observed in the INS21 1model, as autoreactive T cells could still be activated by HIPs derived from the unmodified INS1 transcript.

[0111] Given the critical role of the conserved leucine residue in CatD-mediated HIP formation and the pathogenic importance of these neoepitopes in T1D development, we hypothesized that genetic modification of this site would prevent HIP formation and subsequent autoimmune targeting of beta cells. In the present study, we generated NOD mice carrying double leucine-to-isoleucine knock-in mutations at position 24 in INS1 C-peptide and position 26 in INS2 C-peptide (LI NOD mice). This conservative amino acid substitution was designed to preserve insulin function while disrupting the specific CatD recognition and cleavage site required for pathogenic HIP generation. Here, we characterize the phenotypic and immunological consequences of these targeted modifications on T1D susceptibility in the NOD mouse model. We hypothesized that simultaneous disruption of both cathepsin D cleavage sites would completely prevent the formation of HIPs generated through this proteolytic pathway, thereby providing greater protection from autoimmune diabetes compared to wild-type (WT) NOD mice thereby surpassing the partial protection observed in INS2I / Imice.Materials and MethodsGeneration of NOD mice with a point mutation in both insulin 1 and insulin 2 C-peptide

[0112] Generation of NOD mice with a point mutation in INS1 Guide RNA (#102for target sequence: CCTTCAGACCTTGGCGTTGGAGG) was designed to direct a dsDNA break near the leucine 81 codon in the insulin 1 coding sequence of NOD mice. A single- stranded DNAAttorney Docket No. 151077-00049PR repair template was synthesized at IDT to include a codon change from TTG (Leu) to ATC (He) and to introduce a novel Pvul restriction site by silent mutations. The synthetic guide RNA (5 ng / pL, Synthego), Cas9 protein (IDT Alt-R® S.p. HiFi Cas9 Nuclease V3, 20 ng / pL), and repair template (25 ng / pL) were cytoplasmically microinjected into NOD mouse zygotes, which were then transferred into pseudopregnant ICR recipients. Resulting pups were genotyped by PCR using primers INS1 90-102 5’ (CAAACCCACCCAGGCTTTTG) and INS1 90-102 3’ (ACATGACAATAAATGCCAGAGAAA), followed by Pvul restriction digest to identify putative mutation founders (wild-type: 404 bp; mutant: 221 bp + 183 bp). Three founder lines (5, 6, and 20) were bred to wild-type NOD mice to establish the INS11 1lines. The INS1 coding region was sequenced by Sanger sequencing to confirm the mutation and rule out undesired mutations. All lines were maintained and phenotyped independently to ensure consistency in phenotype, and sperm was cryopreserved for long-term storage. All mouse experiments described below were conducted using female NOD mice, as they develop diabetes more rapidly and predictably than males of the same strain.

[0113] INS2IZINOD mice were established as previously described. Generation of the full LI NOD was completed by cross-breeding the two mouse strains (INS1T / Ix INS2T / I). Ear clips were collected from mice pups, and INS1 and INS2 gene expression was assessed following PCR to identify mice expressing both the INSlI Iand INS2LIgene modification All mouse experiments described below were conducted using female NOD mice, as they develop diabetes more rapidly and predictably than males of the same strain.Mass spectrometry analysis of C-peptide cleavage and HIP formation

[0114] Female mouse islets were isolated at the Barbara Davis Center for Childhood Diabetes Islet Core Facility following established protocols and subsequently prepared for mass spectrometric analysis. Isolated islets were resuspended in phosphate-buffered saline (PBS) and combined 1 :1 (v / v) with trifluoroethanol (TFE), followed by heating at 95°C for 10 minutes to achieve complete lysis of cells and disruption of insulin secretory granules. The resulting lysates underwent fractionation and peptide enrichment by size exclusion chromatography as previously described.

[0115] Enriched fractions were subjected to proteolytic digestion using the endoprotease AspN, which exhibits specificity for peptide bond cleavage at the amino-terminal side of asparticAttorney Docket No. 151077-00049PR acid residues. This digestion strategy generates peptide products that retain the core HIP sequences formed at the cathepsin D-targeted leucine residue, facilitating their detection and quantification by liquid chromatography-tandem mass spectrometry (LC-MS / MS) using an Agilent 6550 quadrupole time-of-flight (Q-TOF) mass spectrometer. Importantly, AspN digestion of full-length INS1 and INS2 C-peptide yields products that encompass the cathepsin D cleavage site, enabling direct comparison between C-peptide fragments that underwent CatD- mediated processing and those that remained intact.Survival curve analysis

[0116] Twenty female mice of each NOD and LI NOD were monitored for disease onset up to 30 weeks beginning at 11 weeks old. These mice underwent weekly urine glucose checks and a positive urine glucose test was followed by a blood glucose check using a OneTouch Ultra glucometer (LifeScan). Two consecutive days of glucose levels >250mg / dL confirmed a mouse as diabetic. The survival curve was plotted, and statistical analysis was completed by performing a Mantel-Cox log-rank test. No significant phenotypic differences were observed between mouse colonies.Antigen Assay

[0117] T-cell reactivity was assessed using a murine clone assay system. Responder T cells were titrated and combined with 25,000 NOD peritoneal exudate cells serving as antigen- presenting cells (APCs). The assay tested various islet cells from female WT NOD and female LI NOD mice. The samples were prepared in culture medium and added to U-bottom 96-well tissue culture plates (Falcon #35-3077) containing the T-cell / APC mixture. After 48 hours of incubation, supernatants were collected and analyzed for interferon-y (IFN-y) levels via ELISA. The control T-cell used recognizes the well-characterized B9-23 insulin B-chain epitope (PD12- 2.40). The presence of 2.5HIP was detected using the HIP reactive T cell clone BDC-10.1. Two trials were completed to compare the response to islet cells from both mouse groups. Statistical analysis to compare response was completed by performing a two-way ANOVA and pointwise comparisons completed by paired t test.Attorney Docket No. 151077-00049PRHistology

[0118] Pancreatic infiltrate of both the WT and LI NOD mice was completed through histological analysis. The pancreas from 10 WT NOD mice and nine LI NOD mice were harvested and embedded in parafilm. The degree of leukocyte islet infiltration was assessed following staining of the tissue with H&E, as previously described. Islets were scored based on whether they were not infiltrated (score = 0), had a peri-infiltrate (score = 1 ), were heavily infiltrated (score = 2) or were fully infiltrated (score = 3).Autoreactive T cell islet infiltration

[0119] To isolate pancreatic islets, mice were anesthetized with Ketamine / Xylazine prior to cervical dislocation. The pancreas was inflated via the common bile duct by adding ~3 ml of 0.8mg / ml Collagenase P (Roche) and lOpg / ml Dnase I (Roche) in HBSS (Cellgro). Following inflation the pancreas was removed and incubated at 37°C for 10-11 min and the islets isolated by density centrifugation. To confirm that the islets were intact they were handpicked under a dissecting microscope. Following digestion, islets were incubated with cell dissociation buffer (Sigma) and pipetted vigorously every 5 minutes until complete dissociation. Islet samples were stained with fluorescent antibodies and analyzed by flow cytometry.Statistical analysis

[0120] Statistical analyses and figures were performed and generated using Prism 10.1.0 (GraphPad Software). The comparison of peptide abundances determined by MS and comparison of the outcomes from the IFN-y ELISA were completed using either one-tailed or two-tailed paired t-tests. Islet antigen assay results were analyzed using two-way ANOVA to compare T cell responses to islets isolated from WT and INS2riNOD mice across multiple experimental trials. Post-hoc pairwise comparisons were performed using Tukey’s multiple comparison test. Results are shown as mean+SD. Survival analysis was performed using the Mantel-Cox log-rank test. Mouse sex was not a factor in the statistical analysis of the data.Attorney Docket No. 151077-00049PRResultsMass spectrometry analysis of C-peptide cleavage and HIP formation

[0121] To determine whether the leucine-to-isoleucine substitutions disrupted cathepsin D- mediated processing, we performed mass spectrometry analysis on islets isolated from WT NOD and LI NOD mice. MS analysis revealed an increase in intact INS1 C-peptide abundance approaching significance (FIG. 18, Panel A, p=0.0524) and a significant increase in the abundance of intact INS2 C-peptide (FIG. 18, Panel B, p=0.002) in LI NOD islets compared to WT NOD islets, indicating that the L-to-I mutations effectively prevent CatD-mediated cleavage at these sites. Correspondingly, HIPs known to form through CatD-mediated transpeptidation at the designated C-peptide leucine residues were absent in LI NOD islets, while these HIPs were readily detectable in WT NOD islets. Specifically, neither HIP11 (FIG. 18, Panel C, p=0.0092) nor 6.9HIP (FIG. 18, Panel D, p=0.0366) were present at detectable levels in LI NOD islets, demonstrating complete elimination of these disease-relevant neoepitopes. No signal was detected for the 2.5HIP in the islets from LI NOD mice. Mass spectrometric detection of 2.5HIP in NOD samples however yielded signal intensities below the linear range of quantification and therefore, this HIP’s abundance was not compared following MS analysis of the islets.Murine HIP-reactive T cell assay by ELISA

[0122] To assess the functional impact of HIP elimination on T cell recognition, we measured IFN-y production by established HIP-reactive T cell clones in response to islet cells from WT NOD and LI NOD mice. Autoreactive T cell clone, BDC-10.1 (FIG. 19, Panel A), which recognize the 2.5HIP respectively, showed significantly reduced responses to LI NOD islets compared to WT NOD islets. For BDC-10.1, the difference in T cell response was statistically significant at higher islet cell concentrations (3,750 islet cells, p=0.011; 7,500 islet cells, p=0.031; 15,000 islet cells, p<0.001). In contrast, the insulin B-chain reactive T cell clone PD12-2.40, which recognizes the genetically encoded B:9-23 epitope that is native to the beta cell proteome and independent of CatD processing, showed no significant difference in response between WT NOD and LI NOD islet cells (FIG. 19, Panel B). This demonstrates that the L-to-I modification specifically eliminates HIP-mediated T cell recognition while preserving presentation of conventional autoantigens. This also supports the fact that insulin B-chain levels are not significantly altered by the L-to-I modification of C-peptide.Attorney Docket No. 151077-00049PRHistology

[0123] To evaluate whether elimination of HIP formation affects the degree of pancreatic immune infiltration, we performed histological analysis of H&E-stained pancreas sections from 10-week-old female mice. Analysis of 289 islets from WT NOD mice and 244 islets from LI NOD mice revealed a significant reduction in severe insulitis in LI NOD mice compared to WT NOD mice (FIG. 20). Chi-squared analysis demonstrated a significant difference in the distribution of insulitis scores between groups (p<0.001), with LI NOD islets experiencing markedly reduced infiltration. Nearly half (48.4%) of LI NOD islets remained completely uninfiltrated (score 0), compared to less than one quarter (23.9%) of WT NOD islets. The frequency of peri-insulitis (score 1) was similar between groups, observed in 33.6% of WT NOD islets and 39.7% of LI NOD islets. Notably, severe infiltrative insulitis was significantly reduced in LI NOD mice, with only 7.4% showing <50% infiltration (score 2) and 4.5% showing >50% infiltration (score 3), compared to 24.9% and 17.6%, respectively, in WT NOD islets. These findings indicate that elimination of HIP formation substantially reduces pancreatic immune infiltration and attenuates disease progression in NOD mice. The specific reduction in severe insulitis (scores 2-3), while peri-insulitis rates remain comparable, suggests that CatD-dependent HIPs are particularly important for the transition from benign peri-islet inflammation to destructive intra-islet infiltration.Autoreactive T cell islet infiltration

[0124] To directly assess whether HIP elimination affects the accumulation of HIP-reactive T cells within pancreatic islets, we performed flow cytometry analysis on single-cell suspensions from islets of 14-week-old WT NOD and LI NOD mice. Using peptide-MHC tetramer staining, we quantified the frequency of HIP-reactive CD4 T cells infiltrating the islets. Both 2.5HIP- reactive and 6.9HIP -reactive CD4 T cells appeared reduced in LI NOD islets compared to WT NOD islets (FIG. 21). In contrast, T cells recognizing the conventional insulin B:9-23 epitope (detected using InsB9-23 p8G or p8E tetramer variants) showed similar frequencies between WT NOD and LI NOD islets. While these initial observations suggest that HIP-reactive T cells may be specifically reduced in LI NOD islets while non-HIP insulin-reactive T cells are maintained, statistical significance has not yet been established and additional replicates are ongoing.Attorney Docket No. 151077-00049PRSurvival curve analysis

[0125] To determine whether elimination of CatD-mediated HIP formation impacts disease progression, we monitored spontaneous diabetes development in female WT NOD and LI NOD mice up to 30 weeks of age. By the end of the monitoring period, 70% (14 / 20) of WT NOD mice had developed diabetes, whereas LI NOD mice showed a significant reduction in disease incidence, with 80% (16 / 20) remaining diabetes-free (p=0.0003; FIG. 22). Furthermore, the four LI NOD mice that did develop diabetes exhibited a marked delay in disease onset compared to WT NOD mice. Initial diabetes incidence occurred at 24 weeks of age in LI NOD mice versus 13 weeks of age in WT NOD mice, representing an 11 -week delay. These results demonstrate that genetic disruption of both CatD cleavage sites in the INS1 and INS2 C-peptides provides substantial protection from autoimmune diabetes in the NOD mouse model.Discussion

[0126] Various HIP-reactive CD4 T cells were shown to be highly diabetogenic in NOD mice. Based on this established pathogenic role, we hypothesized that eliminating the epitopes recognized by these autoreactive T cells would significantly reduce disease incidence. Our investigation demonstrated that LI NOD mice, which cannot generate HIPs formed through cathepsin D-mediated cleavage at the conserved leucine residues in INS 1 and INS2 C-peptides, exhibited a substantial reduction in diabetes incidence compared to WT NOD controls. This protective effect was even more pronounced than the reduction previously observed in INS21 1NOD mice, which retained the capacity to form HIPs from the unmodified INS1 transcript. The enhanced protection in LI NOD mice strongly supports a critical role for CatD-generated HIPs in driving disease progression.

[0127] Histological analysis revealed that immune cell infiltration of LI NOD islets still occurred, as evidenced by the presence of insulitis in these mice. However, the severity of insulitis was significantly reduced compared to WT NOD mice. This reduction in immune cell infiltration is consistent with the absence of primary CatD-generated HIP epitopes that would normally attract and activate autoreactive T cells which specifically target HIPs. Mass spectrometry analysis confirmed the absence of disease-critical HIPs, 6.9HIP, and HIP11, in LIAttorney Docket No. 151077-00049PRNOD islet samples, supporting our hypothesis that modification of the CatD cleavage sites effectively prevents formation of these specific neoepitopes.

[0128] The apparent absence of 2.5HIP in LI NOD islets illustrated by significantly reduced LI NOD islet antigenicity, presents an intriguing paradox when considered alongside previous studies demonstrating the potency of this epitope. The T cell receptors (TCR) of BDC-2.5 and BDC-10.1, which both recognize the chromogranin A containing 2.5HIP, cause 100% diabetes incidence when transferred into retrogenic NOD SCID, making them the most pathogenic TCRs currently known in NOD mice. Additionally, chromogranin A (ChgA) knockout mice on the NOD background are fully protected from diabetes, indicating a critical role for ChgA-derived peptides in disease pathogenesis.

[0129] Despite the protection conferred by ChgA from NOD, 20% (4 / 20) of LI NOD mice still developed diabetes by 30 weeks of age, a finding that warrants further investigation. Several potential explanations exist for this residual disease incidence. First, other HIPs containing ChgA peptides may form at alternative sites within C-peptide or through proteolytic pathways independent of the leucine-specific CatD cleavage mechanism targeted by our L-to-I modifications. Notably, our group has recently identified a class of HIPs, termed iso-HIPs, that form spontaneously through a protease-independent mechanism involving an anhydride intermediate at aspartic acid residues. These iso-HIPs would be unaffected by the leucine-to- isoleucine substitutions and could potentially serve as pathogenic targets for autoreactive T cells in LI NOD mice that progress to diabetes. Second, mice that progress to diabetes may exhibit elevated reactivity against conventional autoantigens, such as the insulin B chain epitope, sufficient to drive disease in the absence of HIP-mediated responses. This explanation coincides with prior work by Vignali in which retrogenic NOD.scid mice expressing a single autoreactive TCR were monitored. In that study, 33% of the mice expressing the B-chain reactive TCR, 12- 4.1 which targets the B-chain epitope, B9-23, developed diabetes. Since disease-relevant HIPs were not observed in the LI NOD model and the insulin B-chain was not modified, autoreactivity to the B9-23 epitope could provide a plausible explanation for the onset of disease in our LI NOD mice. Importantly, the LI NOD mice that developed diabetes presented with disease symptoms significantly later than WT NOD controls (24 weeks versus 13 weeks for initial onset), suggesting that HIP presence may accelerate disease progression. However, future longitudinal studies with larger cohorts will be required to establish this temporal relationshipAttorney Docket No. 151077-00049PR and investigate the underlying mechanisms. These studies may also include tolerization of the LI NOD mice to the B-chain epitope to investigate the possible role of this epitope being targeted for degradation in our LI NOD model. The redundancy in autoreactive T cell responses may be greater than previously appreciated, allowing disease progression through non-HIP pathways when primary HIP epitopes are eliminated, particularly given sufficient time. The delayed disease onset in LI NOD mice that did progress to diabetes supports this interpretation, suggesting that HIP presence accelerates disease but is not absolutely required for eventual P-cell destruction in all animals.

[0130] Importantly, the current study in LI NOD mice indicates that CatD with its exclusive preference of targeting leucine vs, isoleucine residues is the sole protease driving formation of the most pathogenic HIPs characterized to date. The highly significant protection observed when both INS1 and INS2 CatD cleavage sites are disrupted, combined with the absence of multiple disease-relevant HIPs by mass spectrometry, strongly implicates CatD-mediated transpeptidation as the dominant mechanism for generating disease-driving neoepitopes in the NOD mouse model. Understanding the mechanisms underlying residual disease in the small percentage of LI NOD mice that progress to diabetes will be crucial for developing more comprehensive therapeutic interventions targeting HIP-mediated autoimmunity in T1D.EXAMPLE 5Monitoring of Blood Glucose Levels for Diabetic NOD Mice After Receiving Transplanted Islets From LI NOD and NOD SCID Mice

[0131] FIG. 23 shows blood glucose levels of spontaneously diabetic NOD mice after receiving islet transplants from either LI NOD (solid line) mice or NOD SCID (dotted line) mice monitored over time post-transplant (55 days). A glucose level of -250 mg / dL represents the diabetes threshold.

[0132] It was observed that both recipient groups were hyperglycemic (>250 mg / dL) pretransplant. The NOD SCID islet recipients initially exhibited normalized glucose levels, these mice returned to a state of hyperglycemia by day 5. However, LI NOD islet recipients maintained normal glucose levels (<150 mg / dL) for 50 days before eventual rise in glucose. These results demonstrate that LI NOD islets survived for approximately 55 days post-transplant without rejection, in contrast to control (NOD SCID) islets, which were rejected within 8 days.Attorney Docket No. 151077-00049PR

[0133] The foregoing is intended to be illustrative of the present inventive concept and is not to be construed as limiting thereof. The invention is defined by the following claims, with equivalents of the claims to be included therein.

Claims

Attorney Docket No. 151077-00049PRTHAT WHICH IS CLAIMED:

1. A cell or cells comprising an insulin gene with a genetic modification in the C- peptide sequence of the insulin gene.

2. The cell or cells of claim 1, wherein the cell is a pluripotent stem cell (PSC).

3. The cell or cells of claim 2, wherein the pluripotent stem cell is an induced pluripotent stem cell (iPSC).

4. The cell or cells of claim 1, wherein the cell or cells comprise beta cells, or isletlike clusters.

5. The cell or cells of claim 4, wherein the beta cells, or islet clusters are derived from the genetically modified iPSCs.

6. The cell or cells of any one of claims 1-5, wherein the genetic modification in the C-peptide sequence comprises a modification of leucine residue 26 in the sequence of human C- peptide, or its equivalent.

7. The cell or cells of claim 6, wherein the genetic modification in the C-peptide sequence comprises substituting leucine residue 26 of human C-peptide, or its equivalent, with isoleucine.

8. The cell or cells of any one of claims 1-7, wherein the genetic modification in the C-peptide sequence reduces and / or attenuates hybrid insulin peptide (HIP) formation.

9. A cell or cells comprising a genetic modification that knocks out or significantly reduces expression and / or activity of cathepsin D (CatD) in the cell.

10. The cell or cells of claim 9, wherein the cell is a pluripotent stem cell (PSC).Attorney Docket No. 151077-00049PR11 . The cell or cells of claim 11, wherein the pluripotent stem cell is an induced pluripotent stem cell (iPSC).

12. The cell or cells of any one of claims 9-11, wherein the genetic modification reduces and / or attenuates hybrid insulin peptide (HIP) formation.

13. The cell or cells of claim 9, wherein the cell or cells comprise beta cells, or isletlike clusters.

14. The cell or cells of claim 13, wherein the beta cells, or islet clusters are derived from the genetically modified iPSCs.

15. The cell or cells of any one of claims 1-14, wherein the cell is a human cell.

16. A method of treating an autoimmune disorder comprising administering the cell or cells of any one of claims 1-15 to a subject in need thereof.

17. The method of claim 16, wherein administering the cell comprises transplanting the cell or cells into the subject.

18. The method of claim 16 or 17, wherein the subject is a human subject.

19. The method of any one of claims 16-18, wherein the autoimmune disorder is type 1 diabetes (T1D).

20. A method of reducing or attenuating hybrid insulin peptide (HIP) formation comprising administering the cell or cells of any one of claims 1-15 to a subject in need thereof.

21. The method of claim 20, wherein administering the cell comprises transplanting the cell or cells into the subject.Attorney Docket No. 151077-00049PR22. The method of claim 20 or 21, wherein the subject is a human subject.

23. The method of any one of claims 20-22, wherein the subject is afflicted with type 1 diabetes (T1D).

24. A method of reducing blood glucose levels in a subject in need thereof comprising administering the cell or cells of any one of claims 1-15 to the subject.

25. The method of claim 24, wherein administering the cell comprises transplanting the cell or cells into the subject.

26. The method of claim 24 or 25, wherein the subject is a human subject.

27. The method of any one of claims 24-26, wherein the subject is afflicted with type 1 diabetes (T1D).