Method for producing l-valine
By genetically engineering Escherichia coli, mutating the transmembrane region of the alaE protein tail and optimizing the enzyme system, the problem of high production cost of L-valine was solved, achieving efficient increase in L-valine yield and reduction in cost.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- MEIHUA BIOTECH LANGFANG CO LTD
- Filing Date
- 2025-12-15
- Publication Date
- 2026-06-25
Smart Images

Figure PCTCN2025142664-FTAPPB-I100001 
Figure PCTCN2025142664-FTAPPB-I100002 
Figure PCTCN2025142664-FTAPPB-I100003
Abstract
Description
A method for producing L-valine
[0001] priority
[0002] This application claims the rights and priority of Chinese application No. 2024118552908, filed on December 16, 2024. The entire contents of Chinese application No. 2024118552908 are incorporated herein by reference for all purposes. Technical Field
[0003] This disclosure pertains to the field of bacterial fermentation, and particularly relates to a method for producing L-valine by using bacterial fermentation. Background Technology
[0004] L-valine is a natural essential amino acid widely used in animal feed. Therefore, there is an urgent need to improve L-valine production to reduce its production costs, ensure feed supply, and replace soybean meal, which is of great significance to national food security.
[0005] L-valine synthesis begins with pyruvate and involves four enzymes: acetohydroxy acid synthase (AHAS), acetohydroxy acid isomeroreductase (AHAIR), dihydroxy acid dehydratase (DHAD), and branched-chain amino acid transaminase (BCAATA). AHAS is the key enzyme, condensing two pyruvate molecules to form α-acetolactate. It is subject to feedback inhibition by the terminal product and can be induced to become an anti-feedback inhibition version, IlvN. G156E IlvN G20D,I21D,I21F and IlvH G41A,C50T AHAIR catalyzes the isomerization and reduction of α-acetolactate to α,β-dihydroxyisovalerate. Its cofactors favor NADPH, and protein engineering can be used to make it favor NADH, such as IlvC. S34G,L48E,R49F With IlvC L67E,R68F,K75E DHAD catalyzes the dehydration of dihydroxyisovalerate to α-ketoisovalerate. Finally, BCAATA or other non-specific transaminases convert α-ketoisovalerate to L-valine, requiring glutamate as an amino donor and consuming one molecule of NADPH; alternatively, leucine dehydrogenases, such as those derived from Bacillus lysine, can directly add ammonia, consuming one molecule of NADH.
[0006] The *E. coli* alaE gene encodes an L-alanine export protein. As a transport protein, AlaE catalyzes the active export of L-alanine using proton electrochemical potential, transporting intracellularly synthesized L-alanine to the extracellular space and preventing excessive accumulation of L-alanine within the cell. AlaE plays a crucial role in the fermentation production of L-alanine. Genetic engineering of *E. coli*, such as overexpressing the alaE gene or mutating it to enhance enzyme activity, can strengthen the cell's ability to export L-alanine. Summary of the Invention
[0007] This invention discovers that increasing alanine production in valine-producing bacteria can further increase valine production. This increase in alanine production is achieved through alaE mutations. The alaE mutants discovered in this invention are concentrated in the transmembrane region of the alaE tail. We found that mutations in the tail can enhance the function of alaE and further increase valine production.
[0008] On the one hand, this disclosure provides a modified bacterium that produces L-valine, wherein the genome contains modifications that increase the activity of the alanine efflux protein alaE.
[0009] In one specific implementation, the modification includes a mutation or deletion at any amino acid position from 141 to 149 of the alaE protein.
[0010] In one specific embodiment, the modification is selected from any substitution of a single amino acid at any amino acid position from 141 to 149, truncation starting at any amino acid position from 141 to 149, or truncation at amino acid positions from 141 to 149 and insertion of any amino acid.
[0011] In one specific embodiment, the truncation starting at any amino acid position from 141 to 149 includes a stop mutation at any amino acid position from 141 to 149 that becomes a stop codon or a stop mutation caused by a frameshift mutation. Preferably, the stop mutation is selected from the mutation of amino acid position 141, 142, or 143 into a stop codon, or the insertion of TTTA between nucleotides 418 and 419, resulting in the mutation of lysine at position 140 into isoleucine, with position 140 as the starting position 1 and the second amino acid mutating into a stop codon.
[0012] In one specific embodiment, the amino acids at positions 141 to 149 are truncated and any amino acid is inserted, including the deletion of bases at positions 425 to 433, resulting in the deletion of amino acids at positions 142 to 145 and the insertion of lysine.
[0013] In one specific embodiment, the substitution of a single amino acid at any amino acid position from position 141 to 149 is selected from alaE. A149D .
[0014] In one specific implementation, the bacteria further include alaE. A48S or alaE A48T Preferably, the bacteria include alaE A149D and alaE A48S More preferably, the bacteria include a deletion of bases 425 to 433 of alaE, resulting in a deletion of amino acids 142 to 145, and the insertion of lysine, and alaE A48S .
[0015] In one specific embodiment, the modified bacteria further includes a mutation in the leucine dehydrogenase LeuDH-encoded protein that increases L-valine production; preferably, the mutation is selected from LeuDH. V22I .
[0016] In one specific implementation, the modified bacteria, wherein the LeuDH is derived from lysine-containing Bacillus.
[0017] In one specific implementation, the modified bacteria comprises one or more LeuDH cells. V22I Gene copies are preferably two to eleven, such as two, three, four, five, six, seven, eight, nine, ten, or eleven copies, with eight copies being more preferred.
[0018] In one specific embodiment, the modified bacteria further includes an amino acid sequence mutation of the acetylhydroxy acid synthase IlvBN, preferably, the mutation being selected from IlvBN. G20D IlvBN V21D and IlvBN M22F .
[0019] In one specific implementation, the modified bacteria further includes modifications to reduce the production of byproducts.
[0020] In one specific embodiment, the modified bacteria, wherein the modification for reducing byproduct production is selected from all knockouts, truncations and simultaneous repair of frameshift mutations to wild type, or other truncations that reduce activity by more than 10%, of avtA, ldhA, mgsA, frd, pflB, adhE, ackA, alaA and / or alaC.
[0021] In one specific embodiment, the modified bacteria contain a modification that enhances the activity of the transhydrogenase pntAB. Preferably, the modification is selected from modifications that increase the pntAB gene copy number and promoter modifications. Preferably, the promoter modification is the insertion of a strong Ptac or PldhA promoter.
[0022] In one specific embodiment, the modified bacteria include a modification that enhances nadK activity. Preferably, the modification is selected from modifications that increase the copy number of the nadK gene and promoter modifications. Preferably, the promoter modification is the insertion of a strong Ptac or PldhA promoter.
[0023] In one specific embodiment, the modified bacteria further comprises one or more modifications that enhance the activity of ilvC, ilvD, and / or ilvE.
[0024] In one specific implementation, the modified bacteria contains one or more copies of the ilvC gene, preferably two to ten copies, such as two, three, four, five, six, seven, eight, nine, or ten copies, with five copies being more preferred.
[0025] In one specific implementation, the modified bacteria contains one or more copies of the ilvD gene, preferably two to ten copies, such as two, three, four, five, six, seven, eight, nine, or ten copies, with four copies being more preferred.
[0026] In one specific implementation, the modified bacteria contains one or more copies of the ilvE gene, preferably two to ten copies, such as two, three, four, five, six, seven, eight, nine, or ten copies, with three copies being more preferred.
[0027] In one specific implementation, the modified bacteria are grown under anaerobic or aerobic conditions.
[0028] In one specific implementation, the modified bacteria are bacteria that produce valine or alanine.
[0029] On the other hand, the use of the modified bacteria described in this disclosure in the production of L-valine is provided.
[0030] On the other hand, a method for increasing L-valine production is provided, the method comprising culturing bacteria containing modifications that increase alanine production in a culture medium.
[0031] In one specific implementation, the modified bacteria that increase alanine production are as described above as modified bacteria.
[0032] In one specific embodiment, the culture medium contains glucose.
[0033] In one specific embodiment, the method further includes separating L-valine. Beneficial effects
[0034] The genetically engineered bacteria disclosed herein have a high valine conversion rate. Detailed Implementation
[0035] The following description of this disclosure is merely intended to illustrate various embodiments of the disclosure. Therefore, the specific modifications discussed should not be construed as limiting the scope of this disclosure. It will be apparent to those skilled in the art that various equivalents, changes, and modifications can be made without departing from the scope of this disclosure, and it should be understood that these equivalent embodiments are included herein. All references cited herein, including publications, patents, and patent applications, are incorporated herein by reference in their entirety.
[0036] To enable those skilled in the art to better understand the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present disclosure, and not all embodiments.
[0037] Experimental Materials and Methods
[0038] (1) Strains and culture media
[0039] Plasmids were constructed using *Escherichia coli* DH5α as the cloning host, and *E. coli* Synthesized 1.0 was used as the starting strain for modification. The cultures were incubated at 37°C on LB broth (liquid or solid). The LB broth formulation consisted of 5 g / L yeast extract, 10 g / L peptone, and 10 g / L sodium chloride. 1.5-2% agar powder was added to the solid culture. The working concentrations of the antibiotics used were: kanamycin 50 μg / mL, spectinomycin 100 μg / mL, chloramphenicol 25 μg / mL, and bleomycin 50 μg / mL. L-rhamnose and L-arabinose were added at a concentration of 10 mM.
[0040] NBSA and AM1A media supplemented with 2-12% (w / v) glucose were used as acclimatization and fermentation media, respectively. The media formulations are shown in Table 1. Taking 2% glucose supplementation as an example, the medium is called NBSAG20 or AM1AG20, where G represents glucose and 20 represents the glucose concentration (g / L). In the initial acclimatization for valine production, the strain was grown in antibiotic-free NBSA inorganic salt medium at 37°C, with 100 mM ammonium sulfate, 1 mM betaine, and 2% (w / v) glucose added. The strains involved in this disclosure are shown in Table 3.
[0041] Table 1. NBSA and AM1A Culture Medium Formulations
[0042] Table 2. Micronutrient formulation
[0043] Table 3. Strains used
[0044] Table 4. Primer sequences used in this disclosure
[0045] (2) Plasmid construction methods
[0046] The pTargetF series plasmids were constructed by replacing the N20-1 sequence (catcgccgcagcggtttcag) on pTargetF (Addgene: 62226) using QuickChange. The pTargetF plasmid names and their corresponding N20 sequences used in strain construction are shown in Table 5.
[0047] Table 5. Plasmids used in this disclosure
[0048] Table 6. Primers used in this disclosure
[0049] (3) Anaerobic fermentation in acclimatization bottles
[0050] Single colonies of the acclimatized bacteria were streaked and inoculated into 4 mL LB broth, incubated at 37°C and 240 rpm for 24 h. 1% was then transferred to 250 mL sealed Erlenmeyer flasks and cultured on NBS AG50 medium, incubated at 37°C and 120 rpm for 18 h. Finally, 10% was inoculated into 500 mL sealed Erlenmeyer flasks on AMI AG100 medium, incubated at 37°C and 500 rpm, with the pH adjusted to 7.0 using 30-50% concentrated ammonia, and cultured for 24 h.
[0051] (4) Determination of valine yield by high performance liquid chromatography
[0052] Using a UV spectrophotometer at 600 nm (OD) 600E. coli biomass was determined by absorbance at a specific temperature. Glucose concentration was determined using an SBA-40C biosensor (Shandong Academy of Sciences, China) or high-performance liquid chromatography (HPLC). L-valine concentration was determined by HPLC after derivatization with phthalaldehyde. The mobile phase consisted of an acetonitrile / water (50:50, v / v) mixture and 50 mM sodium acetate at a flow rate of 1 mL / min, and the UV detection wavelength was 360 nm.
[0053] Example
[0054] To enable those skilled in the art to better understand the present disclosure, the technical solutions in the embodiments of the present disclosure will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present disclosure, and not all embodiments.
[0055] Example 1: Constructing Synthesized 1.0
[0056] Acetylhydroxy acid synthase catalyzes the first step of the synthesis of L-valine from pyruvate, and L-valine exerts feedback inhibition on this process. Acetylhydroxy acid synthase is a heterodimer encoded by IlvB and IlvN. Mutations in IlvN (G20D, V21D, M22F) can relieve the feedback inhibition of L-valine (JH Park2011, BB). The second-step enzyme, acetylhydroxy acid isomeroreductase, is encoded by ilvC, with a cofactor preference of NADPH. The third-step enzyme, dihydroxy acid dehydratase, is encoded by ilvD. The final-step enzyme is a branched-chain amino acid aminotransferase encoded by ilvE, with a NADPH preference for the synthesis of the amino donor L-glutamate. In addition to introducing feedback-resistant ilvBN from *E. coli* ATCC 8739, this disclosure also includes overexpression of one copy of ilvED and NADH-preferring *Corynebacterium glutamicum*-derived ilvC and *Bacillus lysinus*-derived leuDH via the tac promoter to utilize NADH generated from the upstream pathway. To ensure that the L-valine synthesis pathway is the sole pathway consuming pyruvate and NADH, the key enzyme genes adhE, ackA, ldhA, mgsA, frd, pflB, and avtA of the ethanol, acetic acid, lactate, succinic acid, and formic acid pathways were knocked out. Additionally, ygaZH, encoding a branched-chain amino acid efflux protein, and the global regulator lrp were also enhanced using the tac promoter. To address the generation of L-alanine byproducts, two additional alanine synthesis-related aminotransferases, alaA and alaC, were knocked out, and the terminal pathway was further enhanced by integrating five expression cassettes: PldhA-ilvCcg, PldhA-leuDH, PldhA-ilvBN (G20D, V21D, M22F), PldhA-ilvD, and Ptac-ilvC. For double protection, PldhA-nadK and Ptac-pntAB were also integrated to enhance NADPH supply, resulting in the Synthesized 1.0 strain (Figure 1). The specific construction structure of the Synthesized 1.0 strain is as follows:
[0057] 1.1. Insert Ptac-ilvBN at the adhE site mut
[0058] (1) Construction of pEcgRNA-adhE plasmid:
[0059] The synthesized oligosaccharide nucleic acids adhE-F / adhE-R were annealed and self-assembled to form a double-stranded sequence. The reaction system consisted of: 5 μl T4 ligase buffer, 5 μl primer adhE-F (20 μM), 5 μl primer adhE-R (20 μM), and 35 μl ddH2O. The reaction conditions were: incubation at 95℃ for 5 min, decreasing the temperature by 5–10℃ per minute, followed by incubation at 16℃ for 10 min. The self-assembled double-stranded sequence was diluted 200-fold, and 1 μl of the linearized fragment of pEcgRNA (Addgene: 166581) digested with BsaI was ligated using T4 ligase. The ligation product was transformed into DH5α chemocompetent cells, and the recovered bacterial culture was plated on LB agar plates containing spectinomycin (final concentration 50 μg / mL) to obtain transformants containing the pEcgRNA-adhE plasmid.
[0060] (2) Preparation of electroporation fragments:
[0061] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using primers adhE-F1(KO) / adhE-R1(KO), adhE-F2(KO) / adhE-R2(KO), ilvBNm-F1 / ilvBNm-R1, and ilvBNm-F2 / ilvBNm-R2 to obtain the adhE-UP, adhE-DN, ilvBNm-1, and ilvBNm-2 fragments, each approximately 530 bp in size. The fragments were 550bp, 1.8kb, and 400bp. Using p57-tac (synthesized by GenScript) plasmid as a template and Ptac-F(TY) / Ptac-R as primers, the Ptac fragment of approximately 200bp was amplified by PCR. Using adhE-UP, adhE-DN, ilvBNm-1, ilvBNm-2, and Ptac fragments as templates and adhE-F1(KO) / adhE-R2(KO) as primers, the Ptac-ilvBNm(adhE) fragment of approximately 3.4kb was amplified by overlap PCR.
[0062] (3) Preparation of competent cells:
[0063] The pEcCas(MC_0101208) plasmid was transformed into *E. coli* ATCC 8739 chemically competent cells. Transformants were obtained by screening on LB agar plates containing kanamycin (50 μg / mL) (the preparation method for chemically competent cells is described in *Molecular Cloning: A Laboratory Manual*, 3rd edition). Single colonies of ATCC8739 / pEcCas were picked and incubated in 4 mL LB tubes containing kanamycin (50 μg / mL) at 37°C and 220 rpm. 600When the concentration was 0.4, arabinose was added to a final concentration of 10 mM for induction, and the cells were cultured for another hour to prepare electrocompetent cells (for the preparation method of electrocompetent cells, refer to Li, 2021, Acta Biochim Biophys Sin.ibid.).
[0064] (4) Electrostatic transfer:
[0065] The Ptac-ilvBNm(adhE) fragment and pEcgRNA-adhE plasmid were electroporated into ATCC8739 / pEcCas competent cells (electroporation conditions: 2.5kV, 200Ω, 25μF). The cells were plated on LB plates containing spectinomycin (50μg / ml) and kanamycin (50μg / ml) and incubated overnight at 37°C. Single colonies were grown and colony PCR was performed using the adhE-VF / ilvBN-VR primers to verify the colony. The positive fragment was approximately 1kb.
[0066] (5) Loss of pEcgRNA-adhE plasmid:
[0067] Single colonies that were positive for PCR were picked and inoculated into LB tubes containing kanamycin (final concentration 50 μg / ml), along with 10 mM rhamnose, and incubated overnight at 37°C. The next day, the bacterial culture was streaked directly onto LB agar plates containing kanamycin (final concentration 50 μg / ml) and incubated overnight at 37°C. The following day, single colonies were picked and transferred to LB agar plates containing spectinomycin (final concentration 50 μg / ml). If no growth was observed, it indicated that the pEcgRNA-adhE plasmid had been lost, yielding ATCC8739 (ΔadhE::Ptac-ilvBN). mut ) / pEcCas strain.
[0068] (6) pEcCas plasmid loss:
[0069] Pick ATCC 8739 (ΔadhE::Ptac-ilvBN mut Positive clones of pEcCas were directly cultured overnight at 37°C on an antibiotic-free LB medium using a shaker. A small amount of bacterial culture was then streaked onto 10 g / L sucrose LB agar plates for single colony agarization. Single colonies were identified on LB agar plates containing kanamycin (50 μg / mL) to verify pEcCas plasmid elimination. ATCC8739 (ΔadhE::Ptac-ilvBN) was obtained. mut ).
[0070] 1.2. Insertion of Ptac-leuDH at the avtA site
[0071] (1) Construction of pEcgRNA-avtA plasmid:
[0072] The synthesized two oligosaccharide nucleic acids, avtA-F / avtA-R, were annealed to form a double-stranded sequence. The method was the same as in Example 1, section 1.1.
[0073] (1) Transformers containing pEcgRNA-avtA plasmid were obtained.
[0074] (2) Preparation of electroporation fragments:
[0075] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers avtA-F1(KO) / avtA-R1(KO) and avtA-F2(KO) / avtA-R2(KO) to obtain avtA-UP and avtA-DN fragments, each approximately 500 bp. Using the Ptac fragment as a template, PCR amplification was performed using primers Ptac-F(avtA) / Ptac-R to obtain the Ptac(avtA) fragment, approximately 200 bp. Using the pUC-leuDH plasmid (synthesized by GenScript) as a template, PCR amplification was performed using primers leuDH-F / leuDH-R to obtain the leuDH gene sequence, approximately 1.1 kb (see Table 7). Using avtA-UP, avtA-DN, Ptac(avtA), and leuDH fragments as templates, and primers avtA-F1(KO) / avtA-R2(KO), overlap... PCR amplification yielded a Ptac-leuDH(avtA) fragment of approximately 2.3 kb.
[0076] (3) Preparation of competent cells:
[0077] The pEcCas plasmid was transformed into E. coli ATCC 8739(ΔadhE::Ptac-ilvBN). mut In competent cells, the method is the same as in Example 1, 1.1(3).
[0078] (4) Electrostatic transfer:
[0079] The Ptac-leuDH(avtA) fragment and pEcgRNA-avtA plasmid were electroporated into ATCC 8739 (ΔadhE::Ptac-ilvBN). mut Single colonies were grown in leuDH-VF / avtA-VR primers and verified by colony PCR. The positive fragment was about 1.3kb.
[0080] (5) Loss of pEcgRNA-avtA plasmid:
[0081] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN). mut,ΔavtA::Ptac-leuDH) / pEcCas strain.
[0082] 1.3. Insertion of Ptac-ilvC at the ldhA site cg
[0083] (1) Construction of pEcgRNA-ldhA plasmid:
[0084] The synthesized two oligosaccharide nucleic acids, ldhA-F / ldhA-R, were annealed to form a double-stranded sequence. The method was the same as in Example 1, 1.1(1), to obtain the pEcgRNA-ldhA plasmid.
[0085] (2) Preparation of electroporation fragments:
[0086] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers ldhA-F1(KO) / ldhA-R1(KO) and ldhA-F2(KO) / ldhA-R2(KO) to obtain ldhA-UP and ldhA-DN fragments, each approximately 500 bp. Using the Ptac fragment as a template, PCR amplification was performed using primers Ptac-F(ldhA) / Ptac-R to obtain the Ptac(ldhA) fragment, approximately 200 bp. Using the pUC-ilvCcg plasmid (synthesized by GenScript) as a template, PCR amplification was performed using primers ilvCcg-F / ilvCcg-R to obtain the ilvCcg fragment, with the gene sequence shown in Table 7, approximately 1 kb. Using ldhA-UP, ldhA-DN, Ptac(ldhA), and ilvCcg fragments as templates, and primers ldhA-F1(KO) / ldhA-R2(KO), overlap... PCR amplification yielded a Ptac-ilvCcg(ldhA) fragment, approximately 2.3 kb.
[0087] (3) Electrostatic transfer:
[0088] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-ilvCcg(ldhA) fragment and pEcgRNA-ldhA plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mut In competent cells, single colonies were verified by colony PCR using primers ldhA-VF / ilvCcg-VR, and the positive fragment was approximately 1.2 kb.
[0089] (4) Loss of pEcgRNA-ldhA plasmid:
[0090] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN).mut ,ΔavtA::Ptac-leuDH,ΔldhA::Ptac-ilvCcg) / pEcCas strain.
[0091] Table 7. Gene Sequences
[0092] 1.4. mgsA site insertion into Ptac-lrp
[0093] (1) Construction of pEcgRNA-mgsA plasmid:
[0094] The synthesized two oligosaccharide nucleic acids mgsA-F / mgsA-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as in Example 1, 1.1(1), to obtain the pEcgRNA-mgsA plasmid.
[0095] (2) Preparation of electroporation fragments:
[0096] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers mgsA-F1(KO) / mgsA-R1(KO), mgsA-F2(KO) / mgsA-R2(KO), and lrp-F / lrp-R to obtain mgsA-UP, mgsA-DN, and lrp fragments, approximately 450bp, 400bp, and 600bp, respectively. Using mgsA-UP, mgsA-DN, lrp, and Ptac fragments as templates, and mgsA-F1(KO) / mgsA-R2(KO) as primers, overlap PCR amplification was performed to obtain the Ptac-lrp(mgsA) fragment, approximately 1.7kb.
[0097] (3) Electrostatic transfer:
[0098] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-lrp(mgsA) fragment and pEcgRNA-mgsA plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mut In competent cells, single colonies were verified by colony PCR using the mgsA-VF / lrp-VR primers. The positive fragment was approximately 1 kb.
[0099] (4) Loss of pEcgRNA-mgsA plasmid:
[0100] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN). mut,ΔavtA::Ptac-leuDH,ΔldhA::Ptac-ilvCcg,ΔmgsA::Ptac-lrp) / pEcCas strain.
[0101] 1.5. FRD site insertion of Ptac-ygaZH
[0102] (1) Construction of pEcgRNA-frd plasmid:
[0103] The synthesized two oligosaccharide nucleic acids, frd-F and frd-R, were annealed to form a double-stranded sequence. The method was the same as in Example 1, 1.1(1), to obtain the pEcgRNA-frd plasmid.
[0104] (2) Preparation of electroporation fragments:
[0105] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers frd-F1(KO) / frd-R1(KO), frd-F2(KO) / frd-R2(KO), and ygaZH-F / ygaZH-R to obtain frd-UP, frd-DN, and ygaZH fragments, approximately 500bp, 450bp, and 1.1kb, respectively. Using frd-UP, frd-DN, ygaZH, and Ptac fragments as templates, and frd-F1(KO) / frd-R2(KO) as primers, overlap PCR amplification was performed to obtain the Ptac-ygaZH(frd) fragment, approximately 2.3kb.
[0106] (3) Electrostatic transfer:
[0107] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-ygaZH(frd) fragment and pEcgRNA-frd plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mut In competent cells, single colonies were verified by colony PCR using the primers frd-VF / ygaZH-VR. The positive fragment was approximately 1.2 kb.
[0108] (4) Loss of pEcgRNA-frd plasmid:
[0109] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN). mut, ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp, Δfrd::Ptac-ygaZH) / pEcCas strain.
[0110] 1.6. pflB gene knockout
[0111] (1) Construction of pEcgRNA-pflB plasmid:
[0112] The synthesized two oligosaccharide nucleic acids, pflB-F / pflB-R, were annealed to form a double-stranded sequence. The method was the same as in Example 1, section 1.1.
[0113] (1) Obtain pEcgRNA-pflB plasmid.
[0114] (2) Preparation of electroporation fragments:
[0115] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using pflB-F1(KO) / pflB-R1(KO) and pflB-F2(KO) / pflB-R2(KO) as primers to obtain pflB-UP and pflB-DN fragments, each approximately 400 bp. Using pflB-UP and pflB-DN fragments as templates, and pflB-F1(KO) / pflB-R2(KO) as primers, overlap PCR amplification was performed to obtain the pflB(KO) fragment, approximately 800 bp.
[0116] (3) Electrostatic transfer:
[0117] The method is the same as in 1.1(3) and (4) of Example 1. The pflB(KO) fragment and pEcgRNA-pflB plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mut In competent cells, single colonies were verified by colony PCR using primers pflB-VF / pflB-R2(KO), and the positive fragment was approximately 1 kb.
[0118] (4) Loss of pEcgRNA-pflB plasmid:
[0119] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN). mut, ΔavtA:: Ptac-leuDH, ΔldhA:: Ptac-ilvCcg, ΔmgsA:: Ptac-lrp, Δfrd:: Ptac-ygaZH, ΔpflB) / pEcCas strain.
[0120] 1.7. ackA site insertion Ptac-ilvED
[0121] (1) Construction of pEcgRNA-ackA plasmid:
[0122] The synthesized two oligosaccharide nucleic acids, ackA-F / ackA-R, were annealed to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-ackA plasmid.
[0123] (2) Preparation of electroporation fragments:
[0124] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers ackA-F1(KO) / ackA-R1(KO), ackA-F2(KO) / ackA-R2(KO), and ilvED-F / ilvED-R to obtain ackA-UP, ackA-DN, and ilvED fragments, approximately 550bp, 500bp, and 2.8kb, respectively. Using ackA-UP, ackA-DN, ilvED, and Ptac fragments as templates, and primers ackA-F1(KO) / ackA-R2(KO), overlap PCR amplification was performed to obtain the Ptac-ilvED(ackA) fragment, approximately 4.2kb.
[0125] (3) Electrostatic transfer:
[0126] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-ilvED(ackA) fragment and pEcgRNA-ackA plasmid were electroporated into ATCC8739(ΔadhE::Ptac-ilvBN) mut In competent cells, single colonies were verified by colony PCR using primers ackA-VF / ilvED-VR. The positive fragment was approximately 1.6 kb.
[0127] (4) Loss of pEcgRNA-ackA plasmid:
[0128] The method is the same as 1.1(5) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN). mut, ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp, Δfrd::Ptac-ygaZH, ΔpflB, ΔackA::Ptac-ilvED) / pEcCas strain.
[0129] (5) pEcCas plasmid loss:
[0130] The method is the same as 1.1(6) in Example 1, to obtain ATCC8739(ΔadhE::Ptac-ilvBN). mut , ΔavtA::Ptac-leuDH, ΔldhA::Ptac-ilvCcg, ΔmgsA::Ptac-lrp, Δfrd::Ptac-ygaZH, ΔpflB, ΔackA::Ptac-ilvED), named TYS8975.
[0131] 1.8. alaA gene knockout
[0132] (1) Construction of pEcgRNA-alaA plasmid:
[0133] The two synthesized oligosaccharide nucleic acids alaA-F / alaA-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-alaA plasmid.
[0134] (2) Preparation of electroporation fragments:
[0135] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using alaA-F1(KO) / alaA-R1(KO) and alaA-F2(KO) / alaA-R2(KO) as primers to obtain alaA-UP and alaA-DN fragments of approximately 500bp and 400bp, respectively. Using alaA-UP and alaA-DN fragments as templates, and alaA-F1(KO) / alaA-R2(KO) as primers, overlap PCR amplification was performed to obtain the alaA(KO) fragment of approximately 900bp.
[0136] (3) Electrostatic transfer:
[0137] The method is the same as in Example 1, 1.1(3)(4). The alaA(KO) fragment and pEcgRNA-alaA plasmid were electroporated into TYS8975 / pEcCas competent cells. Single colonies were verified by colony PCR using alaA-VF / alaA-R2(KO) primers. The positive fragment was approximately 1.1 kb.
[0138] (4) Loss of pEcgRNA-alaA plasmid
[0139] The method was the same as in Example 1, 1.1(5), to obtain the TYS8975(ΔalaA) / pEcCas strain.
[0140] (5) pEcCas plasmid loss:
[0141] The method was the same as in Example 1, 1.1(6), to obtain the TYS8975(ΔalaA) strain.
[0142] 1.9.alaC gene knockout
[0143] (1) Construction of pISFba1reRNA-alaC plasmid:
[0144] The two synthesized oligosaccharide nucleic acids alaC-F / alaC-R were used to replace the spacer sequence (CTGATGGTCCATGTCTGTTA) on pISFba1reRNA (Addgene: 226822) using QuickChange to obtain the pISFba1reRNA-alaC plasmid.
[0145] (2) Preparation of electroporation fragments:
[0146] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using alaC-F1(KO) / alaC-R1(KO) and alaC-F2(KO) / alaC-R2(KO) as primers to obtain alaC-UP and alaC-DN fragments, approximately 600bp and 500bp, respectively. Using alaC-UP and alaC-DN fragments as templates, and alaC-F1(KO) / alaC-R2(KO) as primers, overlap PCR amplification was performed to obtain the alaC(KO) fragment, approximately 1.1kb.
[0147] (3) Electrostatic transfer:
[0148] 300 ng of pISFba1 (Addgene: 226820) plasmid was transformed into E. coli TYS8975(ΔalaA) electroporated competent cells. Transformants were obtained by screening on LB agar plates containing kanamycin (50 μg / mL). TYS8975(ΔalaA) / pISFba1 transformants were inoculated into LB tubes containing 5 mL of kanamycin and cultured overnight at 37°C and 220 rpm. The overnight culture was then transferred at a 1% inoculum to fresh LB tubes containing kanamycin and a final concentration of 10 mM L-arabinose, and cultured at 37°C and 220 rpm until OD500 was reached. 600The concentration was 0.6-0.8. Electroporation competent cells were prepared. The alaC(KO) fragment and pISFba1reRNA-alaC plasmid were electroporated into TYS8975(ΔalaA) / pISFba1 competent cells. Single colonies were verified by colony PCR using alaC-VF / alaA-R2(KO) primers. The positive fragment was approximately 1.3kb.
[0149] (4) Loss of pISFba1reRNA-alaC and pISFba1 plasmid:
[0150] Positive clones were inoculated into LB medium containing rhamnose (10 mM) and kanamycin and incubated overnight at 37°C. They were then diluted and plated or streaked onto solid LB agar plates containing kanamycin and incubated overnight at 37°C. Clones were randomly selected and spotted onto LB agar plates containing kanamycin and spectinomycin, respectively, for selection. Clones sensitive to spectinomycin successfully eliminated the plasmid. Next, to eliminate the pISFba1 plasmid, spectinomycin-sensitive strains were inoculated into liquid LB medium and incubated overnight at 37°C. The bacterial culture was streaked onto LB agar plates containing 10 g / L sucrose and incubated overnight at 37°C. Single colonies were then randomly selected and selected on LB agar plates containing and without kanamycin. Colonies sensitive to kanamycin successfully eliminated the plasmid. After complete plasmid elimination, strain TYS8975 (ΔalaA, ΔalaC) was obtained and named strain TYS8976.
[0151] 1.10. Insert PldhA-ilvC at the lacZ site. cg
[0152] (1) Construction of pEcgRNA-ilvCcg(lacZ) plasmid:
[0153] The two synthesized oligosaccharide nucleic acids lacZ-F / lacZ-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-lacZ plasmid.
[0154] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers lacZ-F1(ld) / lacZ-R1(ld), lacZ-F2(ld) / lacZ-R2(ld), lacZ-F3(ld) / lacZ-R3(ld), Pldh-F / Pldh-R, and ilvCcg-F(ld) / ilvCcg-R(ld) to obtain lacZ1(ld), lacZ2(ld), lacZ3(ld), PldhA, and ilvCcg(ld) fragments, approximately 730bp, 500bp, 470bp, 830bp, and 1kb, respectively. The lacZ1(ld), lacZ2(ld), lacZ3(ld), PldhA, and ilvCcg(ld) fragments were then cloned into the EcoRI / Hind array of pEcgRNA-lacZ using a DNA assembly method (DNA assembly kit purchased from TransGen). At site III, the pEcgRNA-ilvCcg(lacZ) plasmid was obtained.
[0155] (2) Electrostatic transfer:
[0156] The method is the same as 1.1(3) and (4) in Example 1. pEcCas was electroporated into TYS8976 to obtain TYS8976 / pEcCas / . The pEcgRNA-ilvCcg(lacZ) plasmid was electroporated into TYS8976 / pEcCas competent cells. Single colonies were verified by colony PCR using lacZ-VF / ilvCcg-V-R2 primers. The positive fragment was about 2.1kb.
[0157] (3) Loss of pEcgRNA-ilvCcg(lacZ) plasmid:
[0158] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg ) / pEcCas strain.
[0159] 1.11. Insert PldhA-leuDH at the lacI site
[0160] (1) Construction of pEcgRNA-leuDH(lacI) plasmid:
[0161] The two synthesized oligosaccharide nucleic acids lacI-F / lacI-R were annealed to form a double-stranded sequence. The method was the same as in Example 1, 1.1(1), to obtain the pEcgRNA-lacI plasmid.
[0162] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers lacI-F1(ld) / lacI-R1(ld), lacI-F2(ld) / lacI-R2(ld), lacI-F3(ld) / lacI-R3(ld), and leuDH-F(ld) / leuDH-R(ld) to obtain lacI1(ld), lacI2(ld), lacI3(ld), and leuDH(ld) fragments, approximately 670 bp, 500 bp, 400 bp, and 1.1 kb, respectively. The lacI1(ld), lacI2(ld), lacI3(ld), PldhA, and leuDH(ld) fragments were cloned into the EcoR I / Hind III site of pEcgRNA-lacI using DNA assembly (DNA assembly kit purchased from TransGen), to obtain the pEcgRNA-leuDH(lacI) plasmid.
[0163] (2) Electrostatic transfer:
[0164] The method is the same as 1.1(3) and (4) in Example 1. The pEcgRNA-leuDH(lacI) plasmid was electroporated into TYS8976(ΔlaacZ::PldhA-ilvC) cg In ) / pEcCas competent cells, single colonies were verified by colony PCR using leuDH-VF / lacI-VR primers, and the positive fragment was approximately 2.2kb.
[0165] (3) Loss of pEcgRNA-leuDH(lacI) plasmid:
[0166] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg ,Δlad::PldhA-leuDH) / pEcCas strain.
[0167] 1.12. Insert PldhA-ilvD at the ydjK site
[0168] (1) Construction of pEcgRNA-ilvD(ydjK) plasmid:
[0169] The synthesized two oligosaccharide nucleic acids, ydjK-F / ydjK-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-ydjK plasmid.
[0170] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers ydjK-F1(ld) / ydjK-R1(ld), ydjK-F2(ld) / ydjK-R2(ld), ydjK-F3(ld) / ydjK-R3(ld), and ilvD-F(ld) / ilvD-R(ld) to obtain fragments ydjK1(ld), ydjK2(ld), ydjK3(ld), and ilvD(ld), approximately 650 bp, 460 bp, 350 bp, and 1.9 kb, respectively. The ydjK1(ld), ydjK2(ld), ydjK3(ld), PldhA, and ilvD(ld) fragments were then cloned into the EcoRI / Hind array of pEcgRNA-ydjK using a DNA assembly method (DNA assembly kit purchased from TransGen). At site III, the pEcgRNA-ilvD(ydjK) plasmid was obtained.
[0171] (2) Electrostatic transfer:
[0172] The method is the same as in 1.1(3) and (4) of Example 1. The pEcgRNA-ilvD(ydjK) plasmid was electroporated into TYS8976(ΔlacZ::PldhA-ilvC) cg In competent cells, single colonies were verified by colony PCR using primers ydjK-VF / ilvD-VR, and the positive fragment was approximately 1.8 kb.
[0173] (3) Loss of pEcgRNA-ilvD(ydjK) plasmid:
[0174] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg ,ΔlacI::PldhA-leuDH,ΔydjK::PldhA-ilvD) / pEcCas strain.
[0175] 1.13. Insert PldhA-nadK at the yaiT site
[0176] (l) Construction of pEcgRNA-nadK(yaiT) plasmid:
[0177] The synthesized two oligosaccharide nucleic acids, yaiT-F / yaiT-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-yaiT plasmid.
[0178] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers yaiT-F1(ld) / yaiT-R1(ld), yaiT-F2(ld) / yaiT-R2(ld), yaiT-F3(ld) / yaiT-R3(ld), and nadK-F(ld) / nadK-R(ld) to obtain yaiTl(ld), yaiT2(ld), yaiT3(ld), and nadK(ld) fragments, approximately 650 bp, 460 bp, 350 bp, and 1.9 kb, respectively. The yaiTl(ld), yaiT2(ld), yaiT3(ld), PldhA, and nadK(ld) fragments were cloned into the EcoR I / Hind III site of pEcgRNA-yaiT using DNA assembly (DNA assembly kit purchased from TransGen), to obtain the pEcgRNA-nadK(yaiT) plasmid.
[0179] (2) Electrostatic transfer:
[0180] The method is the same as 1.1(3) and (4) in Example 1. The pEcgRNA-nadK(yaiT) plasmid was electroporated into TYS8976(ΔlacZ::PldhA-ilvC) cg In competent cells, single colonies were verified by colony PCR using primers yaiT-VF / nadK-VR. The positive fragment was approximately 2.1 kb.
[0181] (3) Loss of pEcgRNA-nadK(yaiT) plasmid:
[0182] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg , ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD, ΔyaiT::PldhA-nadK) / pEcCas strain.
[0183] 1.14. Insert PldhA-ilvBN at the yihF site. mut
[0184] (1) pEcgRNA-ilvBN mut (yihF) plasmid construction:
[0185] The synthesized two oligosaccharide nucleic acids, yihF-F / yihF-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-yihF plasmid.
[0186] Using the *E. coli* ATCC8739 genome as a template, PCR amplification was performed using primers yihF-F1(ld) / yihF-R1(ld), yihF-F2(ld) / yihF-R2(ld), and yihF-F3(ld) / yihF-R3(ld) to obtain yihF1(ld), yihF2(ld), and yihF3(ld) fragments, approximately 730 bp, 510 bp, and 490 bp, respectively. Using the *Ptac-ilvBNm(adhE)* fragment as a template, PCR amplification was performed using primers ilvBN-F(ld) / ilvBN-R(ld) to obtain the ilvBNmut(ld) fragment, approximately 2.1 kb. The yihF1(ld), yihF2(ld), yihF3(ld), *PldhA*, and ilvBNmut(ld) fragments were then processed using DNA assembly methods. The kit was purchased from TransGen (Taiwan). The pEcgRNA-yihF site was cloned into the EcoR I / Hind III site to obtain pEcgRNA-ilvBN. mut (yihF) plasmid.
[0187] (2) Electrostatic transfer:
[0188] The method is the same as 1.1(3) and (4) in Example 1. pEcgRNA-ilvBN mut (yihF) plasmid was electrotransferred into TYS8976(ΔlacZ::PldhA-ilvC) cg In competent cells, single colonies were verified by colony PCR using primers yihF-VF / ilvBN-VR. The positive fragment was approximately 1.9 kb.
[0189] (3) pEcgRNA-ilvBN mut (yihF) plasmid loss:
[0190] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg , ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD, ΔyaiT::PldhA-nadK, ΔyihF::PldhA-ilvBN mut ) / pEcCas strain.
[0191] 1.15. Insert Ptac-ilvC at the yjcS site
[0192] (1) Construction of pEcgRNA-yjcS plasmid:
[0193] The synthesized two oligosaccharide nucleic acids, yjcS-F / yjcS-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-yjcS plasmid.
[0194] (2) Preparation of electroporation fragments:
[0195] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using primers yjcS-F1 / yjcS-R1, yjcS-F2 / yjcS-R2, yjcS-F3 / yjcS-R3, and ilvC-F(yjcS) / ilvC-R(yjcS) to obtain fragments yjcS-1, yjcS-2, yjcS-3, and ilvC(yjcS), with values of approximately 650 bp, 450 bp, 530 bp, and 1.6 kb, respectively. Using fragments yjcS-1, yjcS-2, yjcS-3, Ptac, and ilvC(yjcS) as templates, and primers yjcS-F1 / yjcS-R3, overlap PCR amplification was performed to obtain the Ptac-ilvC(yjcS) fragment, with a value of approximately 3.5 kb.
[0196] (3) Electrostatic transfer:
[0197] The method is the same as in 1.1(3) and (4) of Example 1. The Ptac-ilvC(yjcS) fragment and pEcgRNA-yjcS plasmid were electroporated into TYS8976(ΔlacZ::PldhA-ilvC) cg ,ΔlacI::PldhA-leuDH,ΔydjK::PldhA-ilvD,ΔyaiT::PldhA-nadK,ΔyihF::PldhA-ilvBN mut In ) / pEcCas competent cells, single colonies were verified by colony PCR using yjcS-VF / ilvC-VR primers, and the positive fragment was approximately 1.4kb.
[0198] (4) Loss of pEcgRNA-yjcS plasmid:
[0199] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg ,ΔlacI::PldhA-leuDH,ΔydjK::PldhA-ilvD,ΔyaiT::PldhA-nadK,ΔyihF::PldhA-ilvBN mut,ΔyjcS::Ptac-ilvC) / pEcCas strain.
[0200] 1.16. Insert Ptac-pntAB at the ybaP site
[0201] (1) Construction of pEcgRNA-ybaP plasmid:
[0202] The synthesized two oligosaccharide nucleic acids, ybaP-F / ybaP-R, were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-ybaP plasmid.
[0203] (2) Preparation of electroporation fragments:
[0204] Using the Escherichia coli ATCC8739 genome as a template, PCR amplification was performed using primers ybaP-F1 / ybaP-R1, ybaP-F2 / ybaP-R2, ybaP-F3 / ybaP-R3, and pntAB-F(ybaP) / pntAB-R(ybaP) to obtain ybaP-1, ybaP-2, ybaP-3, and pntAB(ybaP) fragments, approximately 670 bp, 520 bp, 560 bp, and 3.0 kb, respectively. Using ybaP-1, ybaP-2, ybaP-3, Ptac, and pntAB(ybaP) fragments as templates, and primers ybaP-F1 / ybaP-R3, overlap PCR amplification was performed to obtain the Ptac-pntAB(ybaP) fragment, approximately 5.0 kb.
[0205] (3) Electrostatic transfer:
[0206] The method is the same as 1.1(3) and (4) in Example 1. The Ptac-pntAB(ybaP) fragment and pEcgRNA-ybaP plasmid were electroporated into TYS8976(ΔlacZ::PldhA-ilvC) cg ,ΔlacI::PldhA-leuDH,ΔydjK::PldhA-ilvD,ΔyaiT::PldhA-nadK,ΔyihF::PldhA-ilvBN mut In competent cells, single colonies were verified by colony PCR using primers ybaP-VF / pntAB-VR. The positive fragment was approximately 1.5 kb.
[0207] (4) Loss of pEcgRNA-ybaP plasmid:
[0208] The method is the same as 1.1(5) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg, ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD, ΔyaiT::PldhA-nadK, ΔyihF::PldhA-ilvBN mut ,ΔyjcS::Ptac-ilvC,ΔybaP::Ptac-pntAB) / pEcCas strain.
[0209] (5) pEcCas plasmid loss:
[0210] The method is the same as 1.1(6) in Example 1, to obtain TYS8976(ΔlacZ::PldhA-ilvC) cg , ΔlacI::PldhA-leuDH, ΔydjK::PldhA-ilvD, ΔyaiT::PldhA-nadK, ΔyihF::PldhA-ilvBN mut ,ΔyjcS::Ptac-ilvC,ΔybaP::Ptac-pntAB), named Synthesized 1.0.
[0211] The Synthesized 1.0 strain exhibited the following fermentation performance under anaerobic conditions: 5.48 g / L valine production after 48 hours; OD... 600 Approximately 0.73, with a production intensity of 0.11 g / L / h.
[0212] Example 2: Synthesized 2.0 was obtained by superimposing key genes of the main pathway and their mutants onto Synthesized 1.0.
[0213] This disclosure integrates the ilvXGMED expression cassette between CJZ69_19855 and 19860, and integrates ilvC and leuDH in two rounds using CRISPR-related transposases in Synthesized 1.0. V22I First, the interrupted frd, adhE, mgsA, and ackA sites were targeted for ilvC integration, and strains that integrated 3 copies of ilvC at frd, adhE, and mgsA were screened. Based on this, pflB and Pldh were targeted for leuDH integration. V22I Filtered and integrated 8 copies of LeuDH V22I Synthesized 2.0. The specific construction method is as follows:
[0214] pEcCas was transferred into Synthesized 1.0 medium and screened on LB agar plates containing kanamycin to obtain Synthesized 1.0 / pEcCas transformants. Transformants were picked and inoculated into 5 mL LB tubes containing kanamycin and incubated overnight at 37°C and 220 rpm. The overnight culture was then transferred at a 1% inoculum to fresh LB liquid medium containing kanamycin (and a final concentration of 10 mM L-arabinose) and incubated at 37°C and 220 rpm until OD500. 600 Electrocompetent cells were prepared with a pH of 0.6-0.8. Using the *E. coli* Synthesized 1.0 genome as a template, and with primers sitelLHR-F / sitelLHR-R, sitelRHR-F / sitelRHR-R, and ilvXGMEDOvLHR-F / ilvXGMEDOvRHR-R, the sitelLHR, sitelRHR, and ilvXGMED fragments were amplified. Using sitelLHR-F / sitelRHR-F as primers and the sitelLHR, sitelRHR, and ilvXGMED fragments as templates, the ilvXGMED(KI) fragment was obtained via Overlap Extension PCR. 300 ng of pTargetF-arrayl and 600 ng of the ilvXGMED(KI) fragment were transfected into the above electrocompetent cells. The recovery solution was plated on LB agar plates containing chloramphenicol and kanamycin and incubated overnight at 37°C. The successful integration of ilvXGMED into the genome was verified using sitelLHR-F / sitelRHR-F, and the successfully integrated strain was named Synthesized 1.0::ilvXGMED.
[0215] Nanjing GenScript replaced the N15 sequence gagacctctggtctc of pQCasTns(Ptr)-entry(BsaI) (Addgene: 190274) with tgcaacaggtgaacgagtcctttggctttgaggtgaactgccgagtaggcagctgaagttgtgacttcattcagaaaaactacactccgtac to synthesize pQCasTns(Ptr)-ldhA-pflB. The two 32bp uppercase letter sequences represent the N32 sequences targeting ldhA and pflB, respectively; the replacement sequence is gcaacggtaaatgcgttgacacctctatgg. gcgtgaactgccgagtaggcagctggaaatgttgccgaatccggcatgggtatcgtcgaagagtgaactgccgagtaggcagctggaaatatggagccgtcgcccggatggtagcgtcaacggtgaactgccgagtaggcagctggaaattgtgcgcaggctttttcggtctttatcttgca, synthesizing pQCasTns(Ptr)-frd-adhE-mgsA-ackA, where four 32bp uppercase letter sequences represent the N32 sequences targeting ackA, adhE, frd, and mgsA, respectively. Transform pQCasTns(Ptr)-frd-adhE-mgsA-ackA and pPtrDonor-ilvC into Synthesized 1.0::ilvXGMED strain, and after resuscitating the cells in fresh LB medium at 37°C for 1 h, plate the cells onto LB agar plates containing 100 μg / mL kanamycin and 25 μg / mL chloramphenicol. After overnight growth at 37°C for 16 h, scrape several hundred colonies from the plates, resuspend a portion in fresh LB medium, and then replate them onto double-antibiotic LB agar plates supplemented with 100 μg / mL anhydrotetracycline (aTC) to induce protein expression. Culture the cells again at 37°C for 16 h, which usually results in biofilm formation, then scrape them off and resuspend them in LB medium. Re-dilute the cells appropriately, plate them onto double-antibiotic LB agar plates containing 1000 μg / mL aTC, and grow overnight at 37°C. Colony PCR analysis was then performed, and the primers used are shown in Table 6, “Verification of ilvC insertion”.
[0216] The obtained strain was deplasmidized using pFree_Zeo(Addgene: 92053) (refer to Lauritsen, Ida, et al. "A versatile one-step CRISPR-Cas9 based approach to plasmid-curing." Microbial Cell Factories 16.1 (2017): 135.) and then transformed into pQCasTns(Ptr)-ldhA-pflB and pPtrDonor-leuDH. V22I Cells were revived in fresh LB medium at 37°C for 1 hour, then plated onto LB agar plates containing kanamycin and chloramphenicol. After overnight growth at 37°C for 16 hours, several hundred colonies were scraped from the plates, a portion of which was resuspended in fresh LB medium and then re-coated onto LB agar plates containing 100 μg / mL anhydrotetracycline (aTC) to induce protein expression. Cells were cultured at 37°C for another 16 hours, typically forming a biofilm, which was then scraped off and resuspended in LB medium. The cells were then appropriately diluted and plated onto LB agar plates containing 1000 μg / mL aTC, and grown overnight at 37°C. Colony PCR identification analysis was then performed; the primers used are shown in Table 6, “Verification of leuDH”. v22I The inserted strain was then processed using pFree_Zeo to remove all plasmids, resulting in Synthesized 2.0.
[0217] Anaerobic fermentation of three monoclonal strains of Synthesized 2.0 yielded production intensities of 0.24, 0.35, and 0.27 g / L / h, respectively, which were more than double those of Synthesized 1.0, demonstrating the effectiveness of these targets.
[0218] Example 3: Synthesized 2.0 in situ mutation of alaE to alaE Val141* (*This is the stop codon, the same applies below)
[0219] (1) Construction of pEcgRNA-alaE2 plasmid:
[0220] The two synthesized oligosaccharide nucleic acids alaE2-F / alaE2-R were annealed to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-alaE2 plasmid.
[0221] (2) Preparation of electroporation fragments:
[0222] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using alaEup-F / alaE141-R and alaE141-F / alaEdn-R primers to obtain the alaE141-UP and alaE141-DN fragments, respectively. Using the alaE141-UP and alaE141-DN fragments as templates, and alaEup-F / alaEdn-R primers as primers, overlap PCR amplification was performed to obtain the alaE141 fragment, approximately 800 bp.
[0223] (3) Electrostatic transfer:
[0224] The method is the same as in Example 1, 1.1(3)(4). The alaE141 fragment and pEcgRNA-alaE2 plasmid were electroporated into Synthesized 2.0 / pEcCas competent cells. Single colonies were subjected to colony PCR using alaEup-F / alaEdn-R primers, and the PCR fragments were sent for sequencing identification.
[0225] (4) Loss of pEcgRNA-alaE2 plasmid:
[0226] The method is the same as 1.1(5) in Example 1, to obtain Synthesized 2.0 (alaE) Val141* ) / pEcCas strain.
[0227] (5) pEcCas plasmid loss:
[0228] The method is the same as 1.1(6) in Example 1, to obtain Synthesized 2.0 (alaE) Val141* ).
[0229] Example 4: Synthesized 2.0 in situ mutation of alaE to alaE Ser142*
[0230] (1) Preparation of electroporation fragments:
[0231] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using alaEup-F / alaE142-R and alaE142-F / alaEdn-R primers to obtain the alaE142-UP and alaE142-DN fragments, respectively. Using the alaE142-UP and alaE142-DN fragments as templates, and alaEup-F1 / alaEdn-R primers as primers, overlap PCR amplification was performed to obtain the alaE142 fragment, approximately 800 bp.
[0232] (2) Electrostatic transfer:
[0233] The method is the same as in Example 1, 1.1(3)(4). The alaE142 fragment and pEcgRNA-alaE2 plasmid were electroporated into Synthesized 2.0 / pEcCas competent cells. Single colonies were subjected to colony PCR using alaEup-F / alaEdn-R primers, and the PCR fragments were sent for sequencing identification.
[0234] (3) Loss of pEcgRNA-alaE2 plasmid:
[0235] The method is the same as 1.1(5) in Example 1, to obtain Synthesized 2.0 (alaE) Ser142* ) / pEcCas strain.
[0236] (4) pEcCas plasmid loss:
[0237] The method is the same as 1.1(6) in Example 1, to obtain Synthesized 2.0 (alaE) Ser142* ).
[0238] Example 5: Synthesized 2.0 in situ mutation of alaE to alaE Arg143*
[0239] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using alaEup-F / alaE143-R and alaE143-F / alaEdn-R primers to obtain the alaE143-UP and alaE143-DN fragments, respectively. Using the alaE143-UP and alaE143-DN fragments as templates, and alaEup-F / alaEdn-R primers as primers, overlap PCR amplification was performed to obtain the alaE143 fragment, approximately 800 bp.
[0240] (2) Electrostatic transfer:
[0241] The method is the same as in Example 1, 1.1(3)(4). The alaE143 fragment and pEcgRNA-alaE2 plasmid were electroporated into Synthesized 2.0 / pEcCas competent cells. Single colonies were subjected to colony PCR using alaEup-F / alaEdn-R primers, and the PCR fragments were sent for sequencing identification.
[0242] (3) Loss of pEcgRNA-alaE2 plasmid:
[0243] The method is the same as 1.1(5) in Example 1, to obtain Synthesized 2.0 (alaE) Arg143* ) / pEcCas strain.
[0244] (4) pEcCas plasmid loss:
[0245] The method is the same as 1.1(6) in Example 1, to obtain Synthesized 2.0 (alaE) Arg143* ).
[0246] Example 6: Synthesized 2.0 in situ mutation of alaE to alaE Lys140IlefsTer2 (the lysine at position 140 is mutated to isoleucine, with position 140 as the starting 1 and the second amino acid as the termination mutation)
[0247] (1) Preparation of electroporation fragments:
[0248] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using alaEup-F / alaE 140-R and alaE 140-F / alaEdn-R as primers to obtain the alaE140-UP and alaE140-DN fragments, respectively. Using the alaE140-UP and alaE140-DN fragments as templates, and alaEup-F / alaEdn-R as primers, overlap PCR amplification was performed to obtain the alaE140 fragment, approximately 800 bp.
[0249] (2) Electrostatic transfer:
[0250] The method is the same as in Example 1, 1.1(3)(4). The alaE140 fragment and pEcgRNA-alaE2 plasmid were electroporated into Synthesized 2.0 / pEcCas competent cells. Single colonies were subjected to colony PCR using alaEup-F / alaEdn-R primers, and the PCR fragments were sent for sequencing identification.
[0251] (3) Loss of pEcgRNA-alaE2 plasmid:
[0252] The method is the same as 1.1(5) in Example 1, to obtain Synthesized 2.0 (alaE) Lys140IlefsTer2 ) / pEcCas strain.
[0253] (4) pEcCas plasmid loss:
[0254] The method is the same as 1.1(6) in Example 1, to obtain Synthesized 2.0 (alaE) Lys140IlefsTer2 ).
[0255] Example 7: Synthesized 2.0 in situ mutation alaEp.Ser142_Gln145delinsLys(c.425_433del) (indicating the deletion of bases from position 425 to 433, resulting in the deletion of amino acids from position 142 to 145 and the insertion of lysine)
[0256] (1) Construction of pEcgRNA-alaE plasmid:
[0257] The two synthesized oligosaccharide nucleic acids alaE-F / alaE-R were annealed and self-assembled to form a double-stranded sequence. The method was the same as 1.1(1) in Example 1 to obtain the pEcgRNA-alaE plasmid.
[0258] (2) Preparation of electroporation fragments:
[0259] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using alaEup-F / alaE(del)-R and alaE(del)-F / alaEdn-R as primers to obtain the alaEdel-UP and alaEdel-DN fragments, respectively. Using the alaEdel-UP and alaEdel-DN fragments as templates, and alaEup-F / alaEdn-R as primers, overlap PCR amplification was performed to obtain the alaEdel fragment, approximately 800 bp.
[0260] (3) Electrostatic transfer:
[0261] The method is the same as in Example 1, 1.1(3)(4). The alaEdel fragment and pEcgRNA-alaE plasmid were electroporated into Synthesized 2.0 / pEcCas competent cells. Single colonies were subjected to colony PCR using alaEup-F / alaEdn-R primers, and the PCR fragments were sent for sequencing identification.
[0262] (3) Loss of pEcgRNA-alaE plasmid:
[0263] The method was the same as in Example 1, 1.1(5), to obtain the Synthesized 2.0(alaESer142_Gln145delinsLys) / pEcCas strain.
[0264] (4) pEcCas plasmid loss:
[0265] The method is the same as 1.1(6) in Example 1, to obtain Synthesized 2.0(alaESer142_Gln145delinsLys).
[0266] Example 8: Synthesized 2.0 in situ mutant alaE Ala149Asp
[0267] (1) Preparation of electroporation fragments:
[0268] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using alaEup-F / alaE149-R and alaE149-F / alaEdn-R primers to obtain the alaE149-UP and alaE149-DN fragments, respectively. Using the alaE149-UP and alaE149-DN fragments as templates, and alaEup-F / alaEdn-R primers as primers, overlap PCR amplification was performed to obtain the alaE149 fragment, approximately 800 bp.
[0269] (2) Electrostatic transfer:
[0270] The method is the same as in Example 1, 1.1(3)(4). The alaE149 fragment and pEcgRNA-alaE plasmid were electroporated into Synthesized 2.0 / pEcCas competent cells. Single colonies were subjected to colony PCR using alaEup-F1 / alaEdn-R primers, and the PCR fragments were sent for sequencing identification.
[0271] (3) Loss of pEcgRNA-alaE plasmid:
[0272] The method was the same as in Example 1, 1.1(5), to obtain the Synthesized 2.0(alaEAla149Asp) / pEcCas strain.
[0273] (4) pEcCas plasmid loss:
[0274] The method is the same as 1.1(6) in Example 1, to obtain Synthesized 2.0 (alaE) Ala149Asp ).
[0275] Example 9: In Synthesized 2.0 (alaE) Ala149Asp In situ superposition mutation of strain alaE Ala48Ser
[0276] (1) Construction of pEcgRNA-alaE3 plasmid:
[0277] The two synthesized oligosaccharide nucleic acids alaE3-F / alaE3-R were annealed to form a double-stranded sequence. The method was the same as in Example 1, 1.1.1(1), to obtain the pEcgRNA-alaE3 plasmid.
[0278] (2) Preparation of electroporation fragments:
[0279] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using alaEup-F / alaE48S-R and alaE48S-F / alaEdn-R primers to obtain the alaE48S-UP and alaE48S-DN fragments, respectively. Using the alaE48S-UP and alaE48S-DN fragments as templates, and alaEup-F / alaEdn-R primers as primers, overlap PCR amplification was performed to obtain the alaE48S fragment, approximately 800 bp.
[0280] (3) Electrostatic transfer:
[0281] The method is the same as in Example 1, 1.1(3)(4). The alaE48S fragment and pEcgRNA-alaE3 plasmid were electroporated into Synthesized 2.0 (alaEAla149Asp) / pEcCas competent cells. Single colonies were subjected to colony PCR using alaEup-F / alaEdn-R primers, and the PCR fragments were sent for sequencing identification.
[0282] (4) Loss of pEcgRNA-alaE plasmid:
[0283] The method is the same as 1.1(5) in Example 1, to obtain Synthesized 2.0 (alaE) Ala149Asp,Ala48Ser ) / pEcCas strain.
[0284] (5) pEcCas plasmid loss:
[0285] The method is the same as 1.1(6) in Example 1, to obtain Synthesized 2.0 (alaE) Ala149Asp,Ala48Ser ).
[0286] Example 10: In situ superposition of alaE mutants in Synthesized 2.0 (alaESer142_Gln145delinsLys) strain Ala48Thr
[0287] (1) Preparation of electroporation fragments:
[0288] Using the E. coli ATCC8739 genome as a template, PCR amplification was performed using alaEup-F / alaE48T-R and alaE48T-F / alaEdn-R primers to obtain the alaE48T-UP and alaE48T-DN fragments, respectively. Using the alaE48T-UP and alaE48T-DN fragments as templates, and alaEup-F / alaEdn-R primers as primers, overlap PCR amplification was performed to obtain the alaE48T fragment, approximately 800 bp.
[0289] (2) Electrostatic transfer:
[0290] The method is the same as in Example 1, 1.1(3)(4). The alaE48T fragment and pEcgRNA-alaE3 plasmid were electroporated into Synthesized 2.0 (alaESer142_Gln145delinsLys) / pEcCas competent cells. Single colonies were subjected to colony PCR using alaEup-F / alaEdn-R primers, and the PCR fragments were sent for sequencing identification.
[0291] (4) Loss of pEcgRNA-alaE plasmid:
[0292] The method was the same as in Example 1, 1.1(5), to obtain the Synthesized 2.0(alaESer142_Gln145delinsLys,Ala48Thr) / pEcCas strain.
[0293] (5) pEcCas plasmid loss:
[0294] The method is the same as 1.1(6) in Example 1, to obtain Synthesized 2.0(alaESer142_Gln145delinsLys,Ala48Thr).
[0295] Example 11: Fermentation test of different valine strains
[0296] As shown in Table 8, these mutants significantly increased alanine production compared to the control strain Synthesized 2.0, indicating that the alaE mutation enhanced the alanine efflux function. In addition, we observed that these mutants also increased valine production.
[0297] Table 8. Fermentation yield of different valine strains
[0298] By incorporating via reference
[0299] The full contents of each patent and scientific document mentioned in this article are incorporated herein by reference for all purposes. Equivalence
[0300] This disclosure may be embodied in other specific ways without departing from its spirit or essential characteristics. Therefore, the above embodiments should be considered illustrative in all cases and not as limiting of the invention described herein. Consequently, the scope of this disclosure is defined by the appended claims rather than by the foregoing description and is intended to be encompassed therein by all variations within the equivalent meaning and scope of the claims.
Claims
1. Modified bacteria that produce L-valine, whose genome contains modifications that increase the activity of the alanine efflux protein alaE.
2. The modified bacteria of claim 1, wherein the modification that increases the activity of the alanine efflux protein alaE comprises a mutation or deletion at any amino acid position from 141 to 149.
3. The modified bacteria as described in claim 1 or 2, wherein the modification is selected from the substitution of a single amino acid at any amino acid position from 141 to 149, truncation starting at any amino acid position from 141 to 149, or truncation at amino acid positions from 141 to 149 and insertion of any amino acid.
4. The modified bacteria of claim 3, comprising a stop mutation at any amino acid position from 141 to 149 that results in a stop codon or a stop mutation caused by a frameshift mutation, preferably, the stop mutation being selected from a stop codon at amino acid position 141, 142 or 143, or from the insertion of TTTA between nucleotides 418 and 419 resulting in a lysine at position 140 being mutated to isoleucine, with position 140 as the starting position 1 and the second amino acid mutated to a stop codon.
5. The modified bacteria of claim 3, wherein the amino acid positions 141 to 149 are truncated and any amino acid is inserted, including the deletion of the bases at positions 425 to 433, resulting in the deletion of the amino acids at positions 142 to 145, and the insertion of lysine.
6. The modified bacteria of claim 3, wherein the single amino acid at any amino acid position from position 141 to 149 is replaced by alaE. A149D .
7. The modified bacteria according to any one of claims 1 to 6, wherein the bacteria further comprises alaE. A48S or alaE A48T Preferably, the bacteria include alaE A149D and alaE A48S More preferably, the bacteria include a deletion of bases 425 to 433 of alaE, resulting in a deletion of amino acids 142 to 145, and the insertion of lysine, and alaE A48S .
8. The modified bacteria according to any one of claims 1 to 7, further comprising a leucine dehydrogenase LeuDH mutation, preferably, said mutation being LeuDH. V22I .
9. The modified bacteria according to any one of claims 1 to 8, further comprising an amino acid sequence mutation of acetylhydroxy acid synthase IlvBN, preferably, said mutation being selected from IlvBN. G20D IlvBN V21D and IlvBN M22F .
10. The modified bacteria according to any one of claims 1 to 9, wherein the bacteria further comprises a modification to reduce the production of byproducts, preferably the modification to reduce the production of byproducts is selected from all knockouts, truncations and simultaneous repair of frameshift mutations to wild type, or other truncations with a reduction in activity of more than 10% of avtA, ldhA, mgsA, frd, pflB, adhE, ackA, alaA and / or alaC.
11. The modified bacteria according to any one of claims 1 to 10, wherein the bacteria comprises a modification that enhances the activity of the transhydrogenase pntAB, preferably, the modification is selected from modifications that increase the copy number of the pntAB gene and promoter modifications, preferably, the promoter modification is the insertion of a strong Ptac or PldhA promoter.
12. The modified bacteria according to any one of claims 1 to 11, wherein the bacteria comprises a modification that enhances nadK activity, preferably, the modification is selected from modifications that increase the copy number of the nadK gene and promoter modifications, preferably, the promoter modification is the insertion of a strong Ptac or PldhA promoter.
13. The modified bacteria according to any one of claims 1 to 12, wherein the bacteria further comprises one or more modifications that enhance the activity of ilvC, ilvD, and / or ilvE.
14. The modified bacteria as described in any one of claims 1 to 13, comprising one or more copies of the ilvC gene, preferably two to ten copies, more preferably five copies; comprising one or more copies of the ilvD gene, preferably two to ten copies, more preferably four copies; and / or comprising one or more copies of the ilvE gene, preferably two to ten copies, more preferably three copies.
15. The use of the modified bacteria as described in any one of claims 1 to 14 in the production of L-valine.
16. A method for producing L-valine, the method comprising culturing bacteria containing modifications that increase alanine production in a culture medium.
17. The method of claim 16, wherein the modified bacteria that increase alanine production are the modified bacteria of any one of claims 1-14.