Compositions and methods for improving tomato fruit quality
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- RAMOT AT TEL AVIV UNIVERSITY LTD
- Filing Date
- 2025-12-24
- Publication Date
- 2026-07-02
AI Technical Summary
Existing tomato breeding methods fail to effectively enhance multiple fruit quality traits such as soluble solids content, fruit size, and weight without introducing negative pleiotropic effects, necessitating the identification of novel genetic targets for bioengineering improvements.
The use of CRISPR-based screening to modify the expression of specific tomato genes, including Solyc01g106250 (B3-337), Solyc02g060560, Solyc02g062870, Solyc03g034130.2, Solyc03g034110.2, Solyc08g008190, and Solyc08g008200, either individually or in combinations, to improve fruit quality traits.
The modified expression of these genes results in higher soluble solids content, larger fruit size, and increased fruit weight, providing a genetic resource for developing high-quality tomato varieties.
Smart Images

Figure IMGF000030_0001_TABLE 
Figure IMGF000031_0001_TABLE 
Figure IMGF000033_0001_TABLE
Abstract
Description
COMPOSITIONS AND METHODS FOR IMPROVING TOMATO FRUIT QUALITY FIELD OF THE INVENTION
[0001] The present invention relates to compositions and methods for improving fruit quality traits in tomato (Solarium lycopersicum). In particular, the invention pertains to improving tomato fruit quality through modifications of tomato genes and combinations thereof, and to plants comprising the modifications.BACKGROUND OF THE INVENTION
[0002] Tomato is one of the most important vegetable crops worldwide and serves as a model system for research into fleshy fruit development and quality formation. While significant progress has been made in increasing tomato yield and disease resistance, less attention has been paid to intrinsic quality traits. In response to growing consumer preference for produce with superior flavor and size, a primary goal in modern plant breeding is the improvement of these quality characteristics.
[0003] It is well-established that the complex traits contributing to fruit quality are governed by intricate gene regulatory networks, wherein transcription factors play a central role. These proteins can modulate entire metabolic pathways responsible for the accumulation of sugars, acids, and other compounds that determine the final organoleptic properties of the fruit. Different studies have demonstrated the feasibility of using bioengineering to alter fruit quality by targeting specific transcription factors. For instance, the overexpression of certain known transcription factors has been shown to modulate individual parameters, such as soluble sugar content or fruit size.
[0004] While several transcription factors have been identified and shown to impact fruit quality, the discovery of novel regulators that can confer broad improvements across multiple desirable traits remains a significant challenge. There is a persistent need in the field to identify new genetic targets that can be utilized in bioengineering approaches to reliably enhance fruit quality. Specifically, there is a need for genes that can increase soluble solids content (a key indicator of flavor), fruit size, and fruit weight without introducing negative pleiotropic effects. The identification of such a regulator would provide a powerful tool for the development of new, high-value tomato varieties and could have applications also in other fruit-bearing crops.SUMMARY OF THE INVENTION
[0005] The present invention provides compositions and methods for improving tomato fruit quality through modification of tomato genes. According to certain aspects, the present invention provides a tomato plant having altered expression of one or more genes, including specific combinations of modified genes, wherein the plant exhibits improved fruit quality, including better, increased soluble solid content (Brix index), larger fruit size, and greater fruit weight.
[0006] Using a high-throughput CRISPR-based screening, the inventors identified genes associated with the tomato fruit quality. Modifying the expression of the identified genes, either individually or a of combinations thereof, leads to at least one improved fruit quality trait.
[0007] It is now disclosed that overexpression of transcription factor B3-337 (encoded by the Solyc01gl06250 gene) in tomato plants is capable of improving at least one tomato fruit quality trait. It is further disclosed that the knockout of Solyc02g060560 or Solyc02g062870 gene increases the size and sugar content of tomato fruits. Furthermore, it has been shown that the combined knockout of both Solyc03g034130.2 and Solyc03g034110.2 genes, both Solyc02g062860.2 and Solyc02g062870.2 genes, or both Solyc08g008190 and Solyc08g008200, increases the soluble solids content of tomato fruit, the fruit size, and / or the fruit yield.
[0008] The gene nomenclature used herein follows the standardized gene annotation system used for Solanum lycopersicum (tomato).
[0009] According to certain aspects, the present invention provides a genetically engineered tomato (Solanum lycopersicum) plant having at least one improved fruit quality trait compared to a corresponding non-engineered control plant, the genetically engineered plant comprises at least one cell having modified expression and / or activity of at least one protein comprising an amino acid sequence at least 85% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6 ,7 and 8, compared to the protein expression and / or activity in the non-engineered corresponding control plant. Each possibility represents a separate embodiment of the invention.
[0010] According to some embodiments, the at least one improved fruit quality trait is selected from the group consisting of higher soluble solid content, higher fruit size, higher fruit weight, higher sugar content, higher yield and any combination thereof compared with the corresponding control plant.[Oil] According to some embodiments, the plant is a transgenic plant. According to other embodiments, the plant is a non-transgenic plant. According to certain embodiments, the plant is genome edited.
[0012] According to some embodiments, said plant is not exclusively obtained by means of an essential biological process.
[0013] According to some embodiments, the genetically engineered plant comprises at least one cell having modified expression and / or activity of at least one protein comprising an amino acid sequence at least 90%, or at least 95%, or more identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6 ,7 and 8. Each possibility represents a separate embodiment of the invention.
[0014] According to some embodiments, the genetically engineered plant comprises at least one cell having modified expression and / or activity of at least one protein having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6 , 7 and 8. Each possibility represents a separate embodiment of the invention.
[0015] According to some embodiments, the genetically engineered plant comprises at least one cell having modified expression and / or activity of a combination of proteins having at least 85% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6 ,7 and 8. Each possibility represents a separate embodiment of the invention.
[0016] According to some embodiments, the genetically engineered plant comprises at least one cell having reduced expression and / or activity of at least one protein having at least 85% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-7. According to certain embodiments, the genetically engineered plant comprises at least one cell having reduced expression and / or activity of at least one protein having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-7
[0017] According to certain embodiments, the reduced expression and / or activity of the protein is achieved by downregulation of the endogenous gene encoding said protein within the at least one cell of the plant.
[0018] According to certain embodiments, the endogenous gene is downregulated by knockout or knockdown.
[0019] According to certain exemplary embodiments, the plant comprises at least one cell in which the encoding gene is knocked out or knocked down.
[0020] According to some embodiments, the plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 1. According to certain embodiments, the encoding gene is the tomato Solyc03g034130 gene. According to certain embodiments, the Solyc03g034130 gene comprises the coding sequence (CDS) set forth in SEQ ID NO: 9.
[0021] According to some embodiments, the plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 2. According to certain embodiments, the encoding gene is the tomato Solyc03g034110. The coding sequence of Solyc03g034110 set forth in SEQ ID NO: 10.
[0022] According to some embodiments, the plant comprises at least one cell in which the genes encoding SEQ ID NO: 1 and SEQ ID NO: 2 are downregulated.
[0023] According to some embodiments, the plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 3. According to certain embodiments, the encoding gene is the tomato Solyc02g062870. According to certain embodiments, the Solyc02g062870 gene comprises the coding sequence (CDS) set forth in SEQ ID NO: 11.
[0024] According to some embodiments, the plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 4. According to certain embodiments, the encoding gene is the tomato Solyc02g062860. According to certain embodiments, the Solyc02g062860 gene comprises the coding sequence (CDS) set forth in SEQ ID NO: 12.
[0025] According to some embodiments, the plant comprises at least one cell in which the genes encoding SEQ ID NO: 3 and SEQ ID NO: 4 are downregulated.
[0026] According to some embodiments, the plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 5. According to certain embodiments, the encoding gene is the tomato Solyc08g008190 gene. According to certain embodiments, the Solyc08g008190 gene comprises the coding sequence (CDS) set forth in SEQ ID NO: 13.
[0027] According to some embodiments, the plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 6. According to certain embodiments, the encodinggene is the tomato Solyc08g008200 gene. According to certain embodiments, the Solyc08g008200 gene comprises the coding sequence (CDS) set forth in SEQ ID NO: 14.
[0028] According to some embodiments, the plant comprises at least one cell in which the genes encoding SEQ ID NO: 5 and SEQ ID NO: 6 are downregulated.
[0029] According to some embodiments, the plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 7. According to certain embodiments, the encoding gene is the tomato Solyc02g060560 gene. According to certain embodiments, the Solyc02g060560 gene comprises the coding sequence (CDS) set forth in SEQ ID NO: 15.
[0030] According to some embodiments, the genetically engineered plant comprises at least one cell having enhanced expression and / or activity of a protein at least 85% identical to the amino acid sequence set forth is SEQ ID NO: 8, denoted herein B3-337.
[0031] According to some embodiments, the plant comprises at least one cell having overexpression of a gene encoding SEQ ID NO: 8 (denoted herein B3-337). The gene encoding SEQ ID NO: 8 is Solyc01gl06250. According to some embodiments, the plant is genetically engineered or genetically modified to have enhanced expression and / or activity of the transcription factor B3-337 (the protein product of Solyc01gl06250 gene).
[0032] According to some embodiments, the plant comprises an exogenous polynucleotide encoding B3-337. According to some embodiments, the polynucleotide encoding the B3-337 comprises a nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98%, or 100% identity to the nucleotide sequence of SEQ ID NO: 16.
[0033] According to some embodiments, the plant is a hybrid or grafted plant.
[0034] According to certain exemplary embodiments, the genetic background of said plant is of the cultivated tomato AC (Ailsa Craig).
[0035] According to some embodiments, the Brix index of the fruit of the plant is at least 4%, 4.5%, 5%, 5.5%, 6% or more. According to some embodiments, the Brix index of the fruit plant is at least 1%, 1.5%, 2%, 2.5% or higher compared to a fruit of the corresponding control plant.
[0036] According to some embodiments, the average soluble solid content of the fruit of the genetically engineered plant is at least 1%, 2%, 4%, 6%, 8%, 10%, 15%, 20% higher compared to the content in the fruits of the corresponding control plant.
[0037] According to some embodiments, the average fruit size of the genetically engineered plant is at least 2%, 4%, 6%, 8%, 10%, 15%, 20% higher compared to a fruit size of the corresponding control plant.
[0038] According to some embodiments, the average fruit weight of the genetically engineered plant is at least 2%, 4%, 6%, 8%, 10%, 15%, 20% higher compared to the average fruit weight of the corresponding control plant.
[0039] A recombinant expression vector comprising a polynucleotide encoding for the transcription factor B3-337 having an amino acid sequence at least 85% identical to the amino acid sequence set forth in SEQ ID NO:8 is also provided in some embodiments. According to certain embodiments, the transcription factor B3-337 has an amino acid sequence at least 90%, 95% identical to the amino acid sequence set forth in SEQ ID NO: 8. According to certain embodiments, the transcription factor B3-337 has an amino acid sequence set forth in SEQ ID NO:8.
[0040] According to an additional aspect, the present invention provides a method of improving at least one fruit quality trait of a tomato plant, the method comprises a step of modifying, in the tomato plant, the expression and / or activity of at least one protein having an amino acid sequence at least 85% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-8.
[0041] According to some embodiments, the protein is at least 90%, or 95% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-8. According to certain exemplary embodiments, the protein comprises the amino acid sequence selected from the group consisting of SEQ ID NOs: 1-8.
[0042] According to some embodiments, the method comprises downregulating a gene encoding a protein having an amino acid sequence selected from the group consisting of SEQ ID NO: 1-7. Each possibility represents a separate embodiment of the invention
[0043] According to some embodiments, the method comprises downregulating genes encoding the proteins having the amino acid sequence set forth in SEQ ID NOs: 1 and 2.
[0044] According to some embodiments, the method comprises downregulating genes encoding the proteins having the amino acid sequence set forth in SEQ ID NOs: 3.
[0045]
[0046] According to some embodiments, the method comprises downregulating genes encoding the proteins having the amino acid sequence set forth in SEQ ID NOs: 3 and 4.
[0047] According to some embodiments, the method comprises downregulating genes encoding the proteins having the amino acid sequence set forth in SEQ ID NOs: 5 and 6.
[0048] According to some embodiments, the method comprises downregulating a gene encoding for the protein having the amino acid sequence set forth in SEQ ID NO: 7.
[0049] According to some embodiments, the method comprises knocking out or knocking down of the expression of at least one gene selected from the group consisting of Solyc03g034130, Solyc03g034110, Solyc02g062870, Solyc02g062860, Solyc08g008190, Solyc08g008200, and Solyc02g060560.
[0050] According to some embodiments, the genes are downregulated using the CRISPR system. In certain embodiments, the genes Solyc03g034130 and Solyc03g034110, Solyc02g062870 and Solyc02g062860, or Solyc08g008190 and Solyc08g008200, are knockout or knockdown using common single guide RNA (sgRNA).
[0051] According to some embodiments, the method comprises overexpressing a gene encoding for the protein having the amino acid sequence set forth in SEQ ID NO: 8.
[0052] According to some embodiments, the method comprises a step of cultivating the plant under a defined condition.
[0053] The fruit quality is defined as described above. In some embodiments, the improved fruit quality trait is selected from the group consisting of higher soluble solid content, higher fruit size, higher fruit weight, higher sugar content, higher yield and any combination thereof compared with the corresponding control plant.
[0054] According to an additional aspect, the present invention provides a method of improving the fruit quality of a tomato plant, the method comprises a step of enhancing the expression and / or activity of a transcription factor B3-337 having an amino acid sequence at least 85% identical to the amino acid sequence set forth in SEQ ID NO: 8 in the plant relative to a corresponding control plant.
[0055] According to some embodiments, the method comprises a step of growing the plant under conditions whereby enhancing the expression and / or activity increases the fruit quality.
[0056] According to an additional aspect, the present invention provides a method of improving a fruit quality of a plant, the method comprising:(i) transforming the plant with at least one exogenous polynucleotide encoding for transcription factor B3-337 having an amino acid sequence at least 85% identical to the amino acid sequence set forth in SEQ ID NO: 8; and(ii) growing the plant.
[0057] According to some embodiments, the method comprises the step of (iii) transforming the plant with an exogenous polynucleotide encoding for B3-337.
[0058] According to an additional aspect, the present invention provides a polynucleotide encoding for B3-337, said polynucleotide comprises a promoter other than the natural promoter of the B3-337 gene.
[0059] According to some embodiments, a DNA construct comprising said polynucleotide is provided. According to certain embodiments, the DNA construct is a plant expression vector.
[0060] A host cell comprising said DNA construct or plant expression vector is provided according to certain aspects of the invention.
[0061] Further embodiments and the full scope of applicability of the present invention will become apparent from the detailed description and drawings given hereinafter. However, it should be understood that the detailed description and specific examples, while indicating preferred embodiments of the invention, are given by way of illustration only, since various changes and modifications within the spirit and scope of the invention will become apparent to those skilled in the art from this detailed description.DRAWINGS FIGs. 1A-1J. CRISPR-generated tomato lines with increased fruit sweetness.Representative ripe fruit from wild-type Ailsa Craig (AC) and independent CRISPR sgRNA lines targeting the indicated genes, and quantification of soluble solids content (Brix). (1A-1B) HD-ZIP: TOM6-155 (Solyc03g034130, Solyc03g034110). (1C-1D) MFS: TOMI-99 (Solyc02g062870). (1E-1F) NHE: 0990-32 (Solyc08g008190, Solyc08g008200). (1G-1H) C2H2: TOM6-126 (Solyc02g060560). (11-1 J) B3-337 / BAS: TOM6-165 (Solyc01gl06250). The 165 and cb3-337 lines are loss-of-function mutants generated by CRISPR and BAS-1 and BAS-8 are gain-of-function lines that increase the expression of the Solyc01gl06250 gene.1A, 1C, IE, 1G, 1H: fruit images illustrating size and shape differences vs. AC; scale bars, 1 cm. IB, ID, IF, 1H, 1J: boxplots showing the distribution of Brix values for AC and each corresponding CRISPR line. Asterisks indicate statistically significant differences compared with AC. Significance was determined using Student’s t-test. ** = p value < 0.01.FIGs. 2A-2D. Tomato lines with increased fruit sizeGraphs illustrating width and length of mutant lines vs. AC. FIGs. 2A-2B: C2H2: T0M6-126 (Solyc02g060560) - Graphs illustrating width and length of TOM6-126 mutant fruits vs. AC. FIGs. 2C-2D: B3-337 / BAS: TOM6-165 (Solyc01gl06250). Graphs illustrating width and length of 165 and cb3-337 (loss-of-function mutant) and BAS lines (gain-of-function lines) vs. AC.DETAILED DESCRIPTION OF THE INVENTION
[0062] The present invention relates to a genetic manipulation of tomato genes, aiming at improving fruit quality. In particular, the present invention relates to modifying the expression of any of the proteins having amino acid sequence set forth in SEQ ID NO: 1-8, alone or in certain combinations, to enhance fruit quality in tomatoes.
[0063] The inventors of the present invention employed high-throughput genomic screening methods to identify tomato genes that affect fruit quality. In particular, a sgRNA CRISPR library was utilized to identify genes, as well as gene combinations, associated with improved fruit quality
[0064] It is now disclosed that downregulation of a gene encoding a protein selected from the group consisting of SEQ ID NO: 1-7 and / or certain combinations thereof improves the quality of tomato fruits.
[0065] The present invention in some embodiments uses molecular biology methods to innovatively screen a mutant, Tom6-155, in tomato. Its target genes, Solyc03g034130.2 and Solyc03g034110.2, belong to the HD-ZIP family of transcription factors. Through phenotypic identification, the inventors preliminarily determined that Solyc03g034130.2 and Solyc03g034110.2 are involved in regulating plant fruit quality. Further testing found that compared with the wild type, the mutant strains of Solyc03g034130.2 and Solyc03g034110.2 had higher soluble solids content.
[0066] According to some embodiments, the tomato plant comprises at least one cell in which the HD-ZIP transcription factor is downregulated.
[0067] The gene sequence ID (Sequence ID) of the Solyc03g034130.2 gene in NCBI is LOC101251158 (homeobox-leucine zipper protein ATHB-40-like). The encoded protein set forth in SEQ ID NO: 1, and the CDS sequences set forth in SEQ ID NO: 9.
[0068] The gene sequence ID (Sequence ID) of the Solyc03g034110.2 gene in NCBI is LOC101254766. The encoded protein set forth in SEQ ID NO: 2, and the CDS sequences set forth in SEQ ID NO: 10.
[0069] Through preliminary research on the tomato genes Solyc03g034130.2 and Solyc03g034110.2, it is now disclosed that Solyc03g034130.2 and Solyc03g034110.2 have a certain impact on tomato fruit quality. These genes are negatively correlated with tomato fruit quality; that is, knocking out or knocking down these genes increases the soluble solids content in tomato fruit, improving fruit quality. This provides a genetic resource foundation for the cultivation of high-quality new tomato varieties. The tomato quality regulation is manifested as follows: when the Solyc03g034130.2 gene and the Solyc03g034110.2 gene are simultaneously knocked out or knocked down, the soluble solid content in the tomato of the knocked out or knocked down strain is significantly higher than that of the wild type. Regulating gene expression levels includes utilizing DNA homologous recombination technology, CRISP-mediated gene editing technology, and Agrobacterium-mediated transformation system to regulate the expression of Solyc03g034130.2 and Solyc03g034110.2, thereby obtaining transgenic plant lines, and obtaining homozygous Solyc03g034130.2 and Solyc03g034110.2 gene mutant plants from the offspring of Solyc03g034130.2 and Solyc03g034110.2 gene knockout or knockdown plants; homozygous Solyc03g034130.2 and Solyc03g034110.2 gene mutant plants are plants with higher fruit quality.
[0070] The present invention in some embodiments, employs molecular biology methods to innovatively screen a mutant, Tom 1-99, in tomato, whose target transporter protein family is the MFS family. Through phenotypic identification, the inventors preliminarily determined that Solyc02g062860.2 and Solyc02g062870.2 are involved in the regulation of sugar content in plant fruits. Compared with the wild type, the soluble solids content of the Solyc02g062860.2 and Solyc02g062870.2 gene mutant lines is higher.
[0071] The gene sequence ID of Solyc02g062870.2 in NCBI is LOC101247786, The protein sequence set forth in SEQ ID NO: 3, and the CDS set forth in SEQ ID NO: 11.
[0072] The gene Solyc02g062860.2 has an NCBI sequence ID LOC101264697. The protein sequence set forth in SEQ ID NO: 4, and its CDS sequence is shown in SEQ ID NO: 12.
[0073] Preliminary studies on the tomato genes Solyc02g062860.2 and Solyc02g062870.2 have revealed that these genes have a certain impact on the sugar content of tomato fruits. Specifically, the Solyc02g062860.2 and Solyc02g062870.2 genes are negatively correlated with the sugar content of tomato fruits; that is, gene knockout increases the soluble solids content of tomato fruits, thereby improving fruit sugar content and quality. This lays a certain genetic resource foundation for the breeding of high-quality new tomato varieties. Those skilled in the art can readily mutate the Solyc02g062860.2 and Solyc02g062870.2 genesdescribed in this invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides possessing 75% or higher nucleotide sequence identity with the Solyc02g062860.2 and Solyc02g062870.2 genes, as long as they encode the same protein and have the same function, are derived from and are equivalent to the sequences of this invention. Primer pairs used to amplify the full-length coding sequences or fragments of the transport proteins encoded by the Solyc02g062860.2 and Solyc02g062870.2 genes are also within the scope of protection of this invention. The improvement in tomato fruit sugar content is specifically manifested in the following way: after simultaneously knocking out or knocking down the Solyc02g062860.2 and Solyc02g062870.2 genes in tomatoes, the soluble solids (brix) content of the knockout or knockdown lines is significantly higher than that of the wild type.
[0074] It is further disclosed that downregulation of Solyc02g062860.2 leads to improved fruit quality as described herein.
[0075] The present application in some embodiments uses molecular biology methods to innovatively screen a mutant 0990-32 in tomatoes, and the target transport protein is NHE family. Through phenotype identification, the inventors preliminarily determine that Solyc08g008190 and Solyc08g008200 are involved in the regulation of fruit quality and fruit development of plants. Compared with the wild type, the soluble solid content of the Solyc08g008190 and Solyc08g008200 gene mutant strain is higher, and the volume is larger.
[0076] The NCBI sequence ID of Solyc08g008190 is LOC101262233, The protein Sequence set forth in SEQ ID NO: 5, and the CDS set forth in SEQ ID NO: 13.
[0077] The NCBI sequence ID of Solyc08g008200 is LOC101262542, The protein Sequence set forth in SEQ ID NO: 6, and the CDS set forth in SEQ ID NO: 14.
[0078] It is now disclosed that Solyc08g008190 and Solyc08g008200 have influence on fruit quality and fruit enlargement of tomato, and the Solyc08g008190 and Solyc08g008200 genes of tomato are negatively correlated with fruit enlargement and quality of tomato; that is, after gene knockout, the tomato fruit is larger, the soluble solid content is increased, and the fruit quality is improved. The way to reduce the expression of Solyc08g008190 and Solyc08g008200 genes in the target plant is to knock out or knock down Solyc08g008190 and Solyc08g008200 genes. After the Solyc08g008190 and Solyc08g008200 genes in the tomato are mutated, the mutant strain has higher soluble solids (brix) content and larger fruits compared with the wild type.
[0079] The present invention in some embodiment uses molecular biology methods to innovatively screen a mutant TOM6-126 in tomato. Its target transcription factor is the C2H2 family, whose function is currently unknown. Through phenotypic identification, the inventors preliminarily determined that Solyc02g060560 is involved in the regulation of plant fruit sugar content and fruit enlargement. Compared with the wild type, the Solyc02g060560 gene mutant strain has a higher soluble solids content.
[0080] The gene sequence number (Sequence ID) of the Solyc02g060560 gene in Phytozomel3 (https: / / phytozome-nextjgi.doe.gov / ) is Solyc02g060560.1, The amino acid sequence set forth in SEQ ID NO: 7, and the CDS sequence is shown in SEQ ID NO: 15.
[0081] Through preliminary research on the tomato gene Solyc02g060560, the inventors discovered that the gene has a certain impact on tomato fruit sugar content and fruit size. The gene is negatively correlated with sugar content and fruit size. Specifically, knocking out the gene resulted in larger tomato fruits and increased soluble solids content, which in turn improved fruit sugar content and quality. This provides a genetic resource foundation for the development of new, high-sugar, high-quality tomato varieties. The improvement of the sugar content of tomato fruit is specifically manifested as follows: after the Solyc02g060560 gene in the tomato is mutated, the mutant strain has a higher soluble solid (brix) content and larger fruits than the wild type.
[0082] It is now further disclosed that the overexpression of transcription factor B3-337 improves the fruit quality in tomatoes. Through cloning and preliminary characterization of the tomato B3-337 gene, the inventors have shown that B3-337 plays a significant role in determining tomato fruit quality. Expression analysis demonstrated a positive correlation between B3-337 expression and fruit quality traits. Specifically, overexpression of B3-337 resulted in measurable improvements in tomato fruit quality. The improvement of tomato fruit quality is specifically manifested in that, compared with the wild type, the B3-337 gene overexpression strain has a higher soluble solid content, larger fruits, and heavier weight. These findings provide a valuable genetic resource and a foundation for the development of new high-quality tomato varieties.
[0083] As used herein, “tomato” or “Tomato (Solarium ly coper sicuni)” refers to plants, plant parts, and plant materials of the species Solanum lycopersicum, inclusive of the full taxonomic scope recognized for cultivated and wild tomatoes. The term encompasses a wide range of tomato varieties and forms, including but not limited to processing tomatoes, fresh-market and specialty commercial cultivars, heirloom lines, landraces, and wild or feral populations, as well as research, breeding, and experimental lines. The term further includes all geneticbackgrounds and improvements thereof, such as hybrids, grafted plants (including scions and rootstocks), selections, introgressed materials, and plants derived from interspecific crosses with compatible Solanum species where the resulting plants are classified within Solanum lycopersicum or are materially used as tomato in cultivation or processing. Unless expressly excluded, “tomato” also covers tissues, organs, seeds, pollen, embryos, callus, cell cultures, explants, and harvested products from such plants. The plant includes hybrids, Fl plants, and subsequent filial generations (F2, F3, and later), backcross lines, doubled haploids, and synthetic populations derived from the genetically engineered tomato plant described herein.
[0084] The term “Brix” or “Brix index” is used herein as known in the art and refers to a standardized measurement used to quantify the soluble solids content in a liquid solution, primarily sugars such as sucrose, fructose, and glucose. It is expressed as a percentage, where one degree Brix corresponds to 1 gram of sucrose in 100 grams of solution.
[0085] CRISPR / Cas9 gene editing technology can be used to obtain tomato plants with high fruit sugar content and increased fruit size. Specifically, the Solyc03g034130, Solyc03g034110, Solyc02g062870, Solyc02g062860, Solyc08g008190, Solyc08g008200, and / or Solyc02g060560 gene can be knocked out or knocked down to obtain a mutant strain. This strain has a higher soluble solids content than the target plant, providing important materials for breeding new high-yield and high-quality tomato varieties, and has important guiding significance for the genetic improvement of crops.
[0086] The gene nomenclature used herein follows the standardized gene annotation system used for Solanum lycopersicum (tomato). For example, in Solyc01gl06250, “Solyc” designates the species, “01” indicates the chromosome number, “g” denotes a gene, and “106250” is a unique identifier assigned during genome annotation.
[0087] Unless otherwise indicated, the practice of the present application will employ, conventional techniques of plant biology, microbiology, tissue culture, molecular biology, chemistry, biochemistry, DNA recombination and bioinformatics, which are within the skill of the art. Such techniques are explained fully in the literature. In addition, the methods of DNA extraction, construction of phylogenetic trees, methods of gene editing, construction of gene editing vectors, obtaining of gene edited plants, etc. employed by the present application can be achieved using methods disclosed in the prior art, except for the methods employed in the following examples.
[0088] As used herein, the term ‘downregulation’ of a gene refers to any reduction, partial or complete, in the expression and / or functional activity of the gene or its encoded product. Downregulation includes, without limitation, gene knockdown (e.g., by RNA interference orantisense molecules) and gene knockout (e.g., by targeted mutagenesis or deletion resulting in loss of gene function). In some embodiments, the plant described herein comprises at least one cell in which the encoding gene is knocked out or knocked down. In some embodiments, downregulation, when referring to a knockdown, denotes a reduction of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, or more in the expression level of the gene, relative to an appropriate control.
[0089] The plant can be mutated by any suitable method, including without limitation recombination; physical mutagenesis (e.g., irradiation with gamma rays, X-rays, UV, ion beams); chemical mutagenesis (e.g., EMS, ENU, sodium azide, nitrosoureas); transposon or T-DNA insertional mutagenesis; targeted genome engineering using RNA-guided nucleases (e.g., Cas9, Casl2, Casl3 and variants), meganucleases, TALENs, or zinc finger nucleases; base editing, prime editing, or epigenome editing; RNA editing; and any combination thereof, provided that the resulting plant retains the desired phenotype or genotype.
[0090] According to some embodiments, the endogenous genes of the plant is knocked out or knocked out using the CRISPR system.
[0001] Clustered regularly interspaced short palindromic repeats (CRISPR) / Cas systems are known in the art and can be engineered for directed genome editing. Cas genes encode RNA-guided DNA endonuclease enzymes capable of introducing a double strand break in a double helical nucleic acid sequence. The Cas enzyme can be directed to make the double stranded break at a target site within a gene using the single guide RNA (sgRNA) and tracer cellular machinery.
[0092] The terms "single guide RNA", "sgRNA" and "gRNA" are used herein interchangeably and refer to a piece of RNA that function as guides for RNA- or DNA-targeting enzymes, which they form complexes with. The targeting specificity of the CRISPR / Cas system is determined by a short sequence (e.g., 20-nt) at the 5' end of the gRNA. The desired target sequence must precede the protospacer adjacent motif (PAM). After base pairing of the gRNA to the target, Cas mediates a double strand break about 3 -nucleotides (nt) upstream of PAM.
[0093] According to some embodiments, the plant further comprises polynucleotide encoding a Cas enzyme. A Cas enzyme can be from any appropriate species (e.g., an archaea or bacterial species). For example, a Cas enzyme can be from Streptococcus pyogenes, Pseudomonas aeruginosa, or Escherichia coli. In some cases, a Cas enzyme can be a type I (e.g., type IA, IB, IC, ID, IE, or IF), type II (e g., IIA, IIB, or IIC), or type III (e g., IIIA or IIIB), type IV, type V (e.g., Casl2a / Cpfl, Casl2b, Casl2f), and type VI (e.g., Casl3a, Casl3b,Casl3d) Cas enzyme. The encoded Cas enzyme can be any appropriate homolog or Cas fragment in which the enzymatic function (i.e., the ability to introduce a sequence-specific double strand break in a double helical nucleic acid sequence) is retained. In certain embodiments, the Cas protein is Cas9 (e.g., SpCas9, SaCas9, NmCas9, StlCas9), Casl2 (e.g., Casl2a / Cpfl from Acidaminococcus or I.achnospiraceae: Casl2b; Casl2f), or Casl3 (e.g., LwaCasl3a, PspCasl3b, RfxCasl3d), including any homolog, ortholog, or engineered variant retaining the enzymatic function for sequence-specific nucleic acid cleavage or editing. In some embodiments, a Cas enzyme is a Streptococcus pyogenes Cas9 enzyme. In some cases, a Cas enzyme can be codon optimized for expression in particular cells, such as dicot or monocot plant cells. The Cas enzyme can further be a protospacer-adjacent motif (PAM) edited variant, including, for example, the Cas9 enzyme variants SpG and SpRY.
[0094] According to some embodiments, the endogenous genes, encoding to the proteins having at least 85% identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 1-7, are knocked out using the CRISPR system.
[0095] In some embodiments, the genes are knocked out using sgRNAs that are common to a combination of the genes encoding to the proteins having at least 85% identity to an amino acid sequence selected from the group consisting of SEQ ID NO: 1-7.
[0096] According to certain exemplary embodiments, the Solyc03g034130 and Solyc03g034110 genes are knocked out using the CRISPR system with a sgRNA encoded by a nucleotide sequence ACCCACATCAAGTCGCGGTG (SEQ ID NO: 31).
[0097] According to certain exemplary embodiments, the Solyc02g062870 gene is knocked out using the CRISPR system with a sgRNA encoded by a nucleotide sequence ATGAAAGGTCGTCTAAGACA (SEQ ID NO: 32). According to certain exemplary embodiments, the Solyc02g062870 and Solyc02g062860 genes are knocked out using the CRISPR system with a sgRNA encoded by a nucleotide sequence ATGAAAGGTCGTCTAAGACA (SEQ ID NO: 32).
[0098] According to certain exemplary embodiments, the Solyc08g008190 and Solyc08g008200 genes are knocked out using the CRISPR system with a sgRNA encoded by a nucleotide sequence ATGCACGAGGACATCATCGC (SEQ ID NO: 33)
[0099] According to certain exemplary embodiments, the Solyc02g060560 gene is knocked out using the CRISPR system with a sgRNA encoded by a nucleotide sequence CTATGTACCTGACTTGAACC (SEQ ID NO: 34).
[0100] The term "plant" as used herein includes the whole plant, its parent and progeny plants and different parts of the plant, including seeds, fruits, stems, buds, leaves, roots, flowers, tissues and organs, and these different parts all have our target gene or nucleic acid. The "plant" mentioned here also includes plant cells, suspension cultures, callus, embryos, meristem areas and pollen, and similarly, each of the aforementioned objects contains the target gene / nucleic acid.
[0101] The present invention includes any plant cell, or any plant obtained or obtainable by the method therein, and all plant parts and propagules thereof. This patent also includes transfected cells, tissues, organs or whole plants obtained by any of the aforementioned methods. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics, and the progeny obtained using the method of this patent have the same characteristics.
[0102] The present invention also extends to the harvestable parts of the plants as described above, but not limited to seeds, fruits, peels. It also further relates to other derivatives of the plants after harvest, such as organic acids, sugars, lycopene, tomatine, volatile substances, vitamins, minerals and proteins. The present invention also relates to foods or food additives obtained from the relevant plants.
[0103] The term “expression” as used herein refers to the production of a protein product encoded by a gene.
[0104] As used herein, the terms "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" are intended to refer to isolated DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., messenger RNA), naturally occurring types, mutated types, synthetic DNA or RNA molecules, DNA or RNA molecules composed of nucleotide analogs, single-stranded or double-stranded structures. These nucleic acids or polynucleotides include, but are not limited to, gene coding sequences, antisense sequences, and regulatory sequences of non-coding regions. These terms include a gene. "Gene" or "gene sequence" is used broadly to refer to a functional DNA nucleic acid sequence. Thus, a gene can include introns and exons in genomic sequences, and / or coding sequences in cDNA, and / or cDNA and its regulatory sequences. In particular embodiments, such as with respect to isolated nucleic acid sequences, it is preferred to assume that they are cDNA.
[0105] Unless otherwise indicated, the first position of each nucleotide sequence in the sequence listing is the 5' terminal nucleotide of the corresponding DNA / RNA, and the last position is the 3' terminal nucleotide of the corresponding DNA / RNA.
[0106] The present invention in some embodiments discovered a new transcription factor B3-337 that regulates plant fruit quality from tomatoes during the research process, and proved through experiments that, compared with the wild type, the B3-337 gene overexpression strain has a higher soluble solid content, larger fruits, and heavier weight, that is, the fruit quality of the B3-337 gene overexpression strain is significantly better than that of the wild type material, indicating that the B3-337 gene plays an important regulatory function in the formation of tomato fruit quality, which has important guiding significance for the genetic improvement of tomatoes.
[0107] According to certain aspects, the present invention provides a transgenic tomato plant having an improved fruit quality compared to a corresponding control plant, the plant comprising at least one cell having an enhanced expression and / or activity of B3-337.
[0108] According to some embodiments, the transcription factor B3-337 sequence ID number in NCBI is XP_019067400.1, the gene ID is LOC101244128 and the mRNA transcript number is XM 004230585.5. The gene CDS is set forth in SEQ ID NO: 16.
[0109] According to some embodiments, the endogenous B3-337 gene is overexpressed. According to certain embodiments, the promotor or UTR of the endogenous B3-337 is genetically modified to overexpress the B3-337 gene. According to some embodiments, a repressor is genetically removed from the promotor to allow activation. According to some embodiments, epigenetic regulation is genetically modified at the promoter to allow activation. According to some embodiments, the promotor of the endogenous B3-337 is replaced by a promoter that enhances the expression of B3-337. According to some embodiments, the promoter or enhancer of the endogenous B3-337 is replaced or modulated, such that the plant overexpresses said endogenous B3-337.
[0110] According to some embodiments, the expression and / or activity of B3-337 is enhanced by at least 5%, 10%, 20%, 30%, 40%, 50% or more, compared with the expression and / or activity in the corresponding control plant grown under the same conditions. Each possibility represents a separate embodiment of the invention. According to certain exemplary embodiments, the number of B3-337 mRNA molecules or proteins is increased by at least 5%, 10%, 20%, 30%, 40%, 50% or more, compared with the number in a corresponding control plant grown under the same conditions. Each possibility represents a separate embodiment of the invention.
[0111] According to some embodiments, the plant comprises two or more copies of the exogenous polynucleotide encoding for B3-337.
[0112] According to some embodiments, the polynucleotide encoding for B3-337 is operatively linked to a constitutive promoter. According to certain embodiments, the plant comprises a polynucleotide encoding for B3-337, said polynucleotide is operably linked to Cauliflower mosaic virus 35S promoter.
[0113] According to some embodiments, the activity of B3-337 is increased.
[0114] According to some embodiments, the plant overexpressing or have a stronger activity of B3-337 exhibits a better tomato fruit quality in terms of high soluble solid content, large fruits, and / or weight compared with a corresponding control plant.
[0115] In addition, those skilled in the art can easily mutate the B3-337 gene of the present invention by using known methods, such as directed evolution and point mutation. Those artificially modified nucleotides with 75% or higher identity to the nucleotide sequence encoding the transcription factor protein B3-337 are derived from the nucleotide sequence of the present invention and are equivalent to the sequence of the present invention as long as they encode the same protein and / or have the same function. Primer pairs for amplifying the full length or fragments of the coding sequence encoding the protein B3-337 also fall within the scope of protection of the present invention.
[0116] In the above method for improving the quality of tomato fruit, the B3-337 gene in the plant genome is overexpressed to obtain a B3-337 gene overexpressing plant, and a homozygous B3-337 gene overexpressing plant is obtained from the offspring of the B3-337 gene overexpressing plant; the homozygous B3-337 gene overexpressing plant is a plant with higher fruit quality. The self-pollinated offspring can be the offspring of the first generation of self-pollination, the offspring of the second generation of self-pollination, the offspring of the third generation of self-pollination, etc., until a homozygous B3-337 gene overexpressing plant is obtained. The fruit of the self-pollinated offspring of the homozygous B3-337 gene overexpressing plant is a high-quality tomato fruit.
[0117] The above method for improving the quality of tomato fruit is also applicable to other recipient plants with homologous genes to tomatoes. There is no particular limitation on the recipient plants applicable to the present invention, including not only tomatoes but also other plants with high homology, as long as they are suitable for gene transformation operations, such as various crops, flower plants or forestry plants. The plants may be, for example (but not limited to): dicots, monocots, woody plants, Rosales, Rosaceae, Prunus, peach, Cruciferae, Arabidopsis, etc.
[0118] As used herein, the term “transcription factor” refers to a protein that carries out a biological function involving the regulation of gene transcription. In particular, a transcription factor is a protein that contains a DNA-binding domain (DBD), which enables it to recognize and bind specific DNA sequences, such as enhancer elements or promoter regions. Upon binding these regulatory elements, the transcription factor can facilitate the initiation of transcription, for example by stabilizing the formation and / or activity of the transcription initiation complex. Transcription factors also interact with regulatory DNA sequences, including enhancer sequences that may be located hundreds of base pairs upstream or downstream of the gene being transcribed. Transcription factors are sometimes referred to as sequence-specific DNA-binding factors. They may exert their transcription-regulating function independently or in combination with other proteins, e.g., by forming an activation complex, and can assist in recruiting RNA polymerase and associated factors to the transcription start site.
[0119] It is to be understood that the invention also includes functional fragments of B3-337. A person skilled in the art would appreciate that it is possible to design a protein lacking one or several amino acids without deteriorating the function of the protein.
[0120] The term “overexpression” as used herein refers to the production of a gene product in a transgenic plant that exceeds level of production in a non-modified or non-transgenic plant. The term “overexpressing” as used herein explicitly includes overexpression in part of the plant growth cycle or when the plant is grown under specific conditions. For example, if the polynucleotide encoding for B3-337 is under an inducible promoter, the plant is expected to overexpress the proteins when it has the right conditions or appropriate inducing factors.
[0121] The term “enhanced activity” as used herein refers to an elevated activity of the transcription factor compared with the natural, endogenous transcription factor. This enhanced activity may be achieved by overexpressing the endogenous protein, adding an additional, exogenous copy of the protein, or providing suitable conditions that increase its activity. The enhanced activity may be also achieved by incorporating a functional, active fragment of the protein.
[0122] The phrase “corresponding control plant” is as known in the art. For example, if the plant comprises enhanced expression and / or activity of B3-337, the corresponding plant will have the same background without said enhanced expression and / or activity of B3-337.
[0123] According to some embodiments, the plant comprises an exogenous nucleotide sequence encoding for B3-337 or a functional fragment thereof. The term “functional fragment thereof as used herein refers to an amino acid sequence that is shorter in length thanthe full length of the protein sequence yet retains the activity of said protein. For example, in some embodiments, the functional fragment of the protein sequence comprises an amino acid sequence at least 100, at least 150, at least 200, at least 250, at least 300 or more amino acids in length and retains the activity of the protein.
[0124] The term “promoter” is used herein as known in the art. Promoter is a nucleic acid sequence located upstream or 5' to a translational start codon of an open reading frame (ORF) of a gene and is involved in recognition and binding of RNA polymerase II and other proteins to initiate transcription. “Constitutive promoters” are functional in most or all tissues of a plant throughout plant development. Tissue-, organ- or cell-specific promoters are expressed only or predominantly in a particular tissue, organ, or cell type, respectively.
[0015] As used herein, the terms “transgenic” and “transformed” are used interchangeably and refer to a plant, plant tissue or cell into which a foreign or recombinant DNA has been introduced. The term "foreign gene" or recombinant gene refers to any nucleic acid (e.g., gene sequence) that is introduced into the genome of an organism or tissue of an organism or a host cell by experimental manipulations, such as those described herein, and may include gene sequences found in that organism so long as the introduced gene does not reside in the same location, as does the naturally occurring gene.
[0126] As used herein, the term "coding" or "encoding" refers to the process by which a gene, through the mechanisms of transcription and translation, provides information to a cell from which a series of amino acids can be assembled into a specific amino acid sequence to produce an active enzyme. Because of the degeneracy of the genetic code, certain base changes in DNA sequence do not change the amino acid sequence of a protein.
[0127] Many organisms display differences in codon usage, also known as “codon bias” (i.e., bias for use of a particular codon(s) for a given amino acid). Codon bias often correlates with the presence of a predominant species of tRNA for a particular codon, which in turn increases efficiency of mRNA translation. Accordingly, a coding sequence derived from a particular organism may be tailored for improved expression in a different organism through codon optimization. According to some embodiments, B3-337 sequence is codon-optimized for expression in the transgenic plant as described herein.
[0128] The terms "protein" and "polypeptide" are used interchangeably herein, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds, or by means other than peptide bonds. A protein or polypeptide must contain at least 20 amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein's or polypeptide's sequence. In one embodiment, a protein may comprise of more thanone, e.g., two, three, four, five, or more, polypeptides, in which each polypeptide is associated to another by either covalent or non-covalent bonds / interactions. Polypeptides include any peptide comprising two or more amino acids joined to each other by peptide bonds or by means other than peptide bonds. "Polypeptides" and “proteins” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others.
[0129] The term "Endogenous", as used herein, refers to any material from or naturally produced inside an organism, cell, tissue or system.
[0130] The term "Exogenous", as used herein, refers to any material introduced to or produced outside of an organism, cell, tissue or system. Accordingly, "exogenous nucleic acid" refers to a nucleic acid that is introduced to or produced outside of an organism, cell, tissue or system. According to some embodiments, sequences of the exogenous nucleic acid are not naturally produced, or cannot be naturally found, inside the organism, cell, tissue, or system that the exogenous nucleic acid is introduced into.
[0131] As used herein, plant includes the entire plant, its parent and progeny plants, and various parts of the plant, including seeds, fruits, stems, buds, leaves, roots, flowers, tissues, and organs, all of which contain the gene or nucleic acid of interest, plant as used herein also includes plant cells, suspension cultures, callus tissue, embryos, meristematic regions, and pollen, each of which may contain the gene / nucleic acid of interest.
[0132] The present invention encompasses any plant cell, or any plant obtained or obtainable by any of the methods herein, as well as all plant parts and propagules thereof. Transfected cells, tissues, organs, or whole plants obtained by any of the aforementioned methods are also encompassed by this patent. The only requirement is that the progeny exhibit the same genotypic or phenotypic characteristics, and that the progeny obtained using the methods described herein have the same characteristics.
[0133] The present invention also extends to harvestable parts of the plants described above, including, but not limited to, seeds, fruit, and pericarp. It further relates to other post -harvest derivatives of the plants, such as organic acids, sugars, lycopene, tomatine, volatile substances, vitamins, minerals, and proteins. The present invention also relates to foods or food additives obtained from the plants.
[0134] The terms “elevated”, “increased”, or “enhanced” are used herein interchangeably and refer to an increased, for example, by at least 1%, 2%, 3%, 4%, 5%, 10% or more, forexample at least 15%, 20%, 25%, 30%, 35%, 40% or 50%, 60%, 70%, 80%, 90% or more in comparison to a control or wild-type plant.
[0135] The terms “reduced”, “decreased”, or “diminished” are used herein interchangeably and refer to a reduction, for example, by at least 1%, 2%, 3%, 4%, 5%, 10% or more, for example at least 15%, 20%, 25%, 30%, 35%, 40% or 50% 60%, 70%, 80%, 90% or more in comparison to a control or wild-type plant.
[0136] The overexpression of B3-337 may be carried out by transforming the plant with an exogenous nucleic acid construct encoding to the protein. According to other embodiments, the endogenous B3-337 is overexpressed. According to some embodiments, the promoter or enhancer of the endogenous B3-337 is replaced or modulated, such that the plant overexpresses said endogenous B3-337.
[0137] All technical terms used herein are terms commonly used in biochemistry, molecular biology and agriculture, and can be understood by one of ordinary skill in the art to which this invention belongs.
[0138] In order to overexpress B3-337, and the expression of a heterologous protein in the plant, a nucleic acid sequence (a polynucleotide) encoding said proteins may be transformed to the plant by any method known in the art.
[0019] A nucleic acid construct can be introduced into any plant cell using a suitable genetic engineering technique. Both monocotyledonous and dicotyledonous angiosperm or gymnosperm plant cells may be genetically engineered in various ways known to the art. Exemplary methodology includes but is not limited to transformation, electroporation, particle gun bombardment, calcium phosphate precipitation, and polyethylene glycol fusion, transfer into germinating pollen grains, direct transformation, and other methods known to the art.
[0140] Agrobacterium-mediated Transformation - One method for introducing an expression vector into plants is based on the natural transformation system of Agrobacterium. Descriptions of Agrobacterium vector systems and methods for Agrobacterium-mediated gene transfer are well known in the art.[014.1] According to some embodiments, an Agrobacterium species such as A. tumefaciens and A. rhizogenes are used. Briefly, Agrobacterium may be transformed with a plant expression vector via, e.g., electroporation, after which the Agrobacterium is introduced to plant cells via, e.g., the leaf-disk method.
[0142] The Agrobacterium transformation methods discussed above are known to be useful for transforming dicots. Several studies have shown the use of vacuum infiltration for Agr ob acterium -m edi ated tr an sf orm ati on .
[0143] Numerous processes are available to introduce DNA into a plant host cell. In many processes it is necessary that the nucleotide sequences to be introduced occur in cloning and / or expression vectors. Vectors are essentially plasmids, cosmids, viruses, bacteriophages, shuttle vectors, and other vectors commonly used in genetic engineering. Vectors can have other functional units which stabilize the vector in a host organism and / or make its replication possible. Vectors can also contain regulatory elements functionally linked to the nucleotide sequence obtained and which allow expression of the nucleotide sequence in a host organism. Such regulatory units can be promoters, enhancers, operators and / or transcription termination signals. Vectors also frequently contain marker genes which allow selection of the host organisms containing them, such as antibiotic resistance genes.
[0014] Processes for introducing DNA into plant cells include transformation of plant cells with Agrobacterium as transforming agents, protoplast fusion, microinjection, electroporation of DNA, introduction of DNA by means of biolistic methods and other possibilities. The processes of microinjection and electroporation of DNA into plant cells do not themselves place any special requirements on the plasmids to be used. Simple plasmids can be used, such as pUC derivatives. However, if whole plants are to be regenerated from cells transformed in that manner, a selectable marker should be present.
[0145] Depending on the process used to introduce coding nucleotide sequences into the plant cells, it may be necessary for the vector to contain other DNA sequences. For example, if the Ti or R1 plasmid is used to transform plant cells, it is necessary for at least the right border sequence, and often both the right and left border sequences of the Ti and R1 plasmid cells to be linked as flank regions with the genes being introduced. When Agrobacterium is used for transformation, the DNA being introduced must be cloned in special plasmids, in either an intermediary vector or a binary vector. Because of sequences homologous with sequences in the T-DNA, intermediary vectors can be integrated into the Ti or R1 plasmid of Agrobacterium through homologous recombination. Those also contain the vir region required for transfer of the T-DNA. Intermediary vectors cannot replicate in agrobacteria. The intermediary vector can be transferred to Agrobacterium tumefaciens by means of a helper plasmid. In contrast, binary vectors can replicate both in agrobacteria and in E. coli. They contain a gene for a selection marker and a linker or polylinker framed by the right and left T-DNA border regions. Binary vectors can be transformed directly into agrobacteria. TheAgrobacterium which serves as the host cell should contain a plasmid carrying a vir region. This vir region is necessary for the transfer of the T-DNA into the plant cell. The Agrobacterium transformed in that way is used to transform plant cells. Plant explants can be co-cultivated with the agrobacterium to transfer the DNA into the plant cells. The whole plants can be regenerated from the infected plant material, such as leaf fragments, stem segments, roots, protoplasts, or plant cells cultivated in suspension, in a suitable medium which contains antibiotics or biocides to select transformed cells.
[0146] Microprojectile Bombardment - An additional method for transforming DNA segments to plant cells is microprojectile bombardment. In this method, microparticles may be coated with DNA and delivered into cells by a propelling force. Exemplary particles include those comprised of tungsten, gold, platinum, and the like.
[0147] Electroporation - where one wishes to introduce DNA by means of electroporation, it is contemplated that the method of Krzyzek et al. (U.S. Pat. No. 5,384,253) may be advantageous. In this method, certain cell wall -degrading enzymes, such as pectin-degrading enzymes, are employed to render the target recipient cells more susceptible to transformation by electroporation than untreated cells. Alternatively, recipient cells can be made more susceptible to transformation, by mechanical wounding.
[0148] Suitable methods for transformation of host plant cells for use with the current invention include virtually any method by which DNA can be introduced into a cell (for example, where a recombinant DNA construct is stably integrated into a plant chromosome) as described hereinabove and are well known in the art. Another exemplary method for introducing a recombinant DNA construct into plants is insertion of a recombinant DNA construct into a plant genome at a pre-determined site by methods of site-directed integration. Site-directed integration may be accomplished by any method known in the art, for example, by use of zinc-finger nucleases, engineered or native meganucleases, TALE-endonucleases, or an RNA-guided endonuclease (for example a CRISPR / Cas9 system). Transgenic plants can be regenerated from a transformed plant cell by the methods of plant cell culture or by taking a cutting from a transgenic plant and rooting the cutting to establish a vegetative clone of the transgenic plant. A transgenic plant homozygous with respect to a transgene (that is, two allelic copies of the transgene) can be obtained by self-pollinating (selfing) a transgenic plant that contains a single transgene allele with itself, for example an R0 plant, to produce R1 seed. One fourth of the R1 seed produced will be homozygous with respect to the transgene. Plants grown from germinating R1 seed can be tested for zygosity, typically using a SNP assay, DNAsequencing, or a thermal amplification assay that allows for the distinction between heterozygotes and homozygotes, referred to as a zygosity assay.
[0149] The genetic constructs used in the present invention may generally contain a suitable promoter which functions in plant cells, a suitable terminator such as nopaline synthetic enzyme gene terminator, other elements useful for regulating the expression and marker genes suitable for selecting the transformant such as drug-resistant genes, e.g. genes resistant to kanamycin, G418 or hygromycin in addition to the intended gene. The promoter contained in the genetic construct may be a constitutive promoter, an organ-specific promoter or a developmental stage-specific promoter and can be suitably selected depending on the host, gene, desired expression level, organ for the expression, developmental stage, etc.
[0150] Most endogenous genes have regions of DNA that are known as promoters, which regulate gene expression. Promoter regions are typically found in the flanking DNA upstream from the coding sequence in both prokaryotic and eukaryotic cells. A promoter sequence provides for regulation of transcription of the downstream gene sequence and typically includes from about 50 to about 2,000 nucleotide base pairs. Promoter sequences also contain regulatory sequences such as enhancer sequences that can influence the level of gene expression. Some isolated promoter sequences can provide for gene expression of the B3-337 as described herein, that is a DNA encoding to a protein different from the native or homologous DNA.
[0151] Promoter sequences are also known to be strong or weak, or inducible. A strong promoter provides for a high level of gene expression, whereas a weak promoter provides for a very low level of gene expression. An inducible promoter is a promoter that allows gene expression to be turned on and off in response to an exogenously added agent, or to an environmental or developmental stimulus. Promoters can also provide for tissue specific or developmental regulation. An isolated promoter sequence that is a strong promoter for heterologous DNAs is advantageous because it provides for a sufficient level of gene expression for easy detection and selection of transformed cells and provides for a high level of gene expression when desired.
[0152] Expression cassettes generally include, but are not limited to, a plant promoter such as the CaMV 35S promoter, or others such as CaMV 19S, nos, Adhl, sucrose synthase, a-tubulin, ubiquitin, actin, cab, PEPCase or those associated with the R gene complex. Further suitable promoters include the poplar xylem-specific secondary cell wall specific cellulose synthase 8 promoter, cauliflower mosaic virus promoter, the Z10 promoter from a gene encoding a 10 kDa zein protein, a Z27 promoter from a gene encoding a 27 kDa zein protein,inducible promoters, such as the light inducible promoter derived from the pea rbcS gene and the actin promoter from rice. Seed specific promoters, such as the phaseolin promoter from beans, may also be used.
[0153] Alternatively, novel tissue specific promoter sequences may be employed in the practice of the present invention. cDNA clones from a particular tissue can be isolated and those clones which are expressed specifically in that tissue are identified, for example, using Northern blotting. The promoter and control elements of corresponding genomic clones can then be localized using techniques well known to those of skill in the art.
[0154] The choice of plant tissue source for transformation will depend on the nature of the host plant and the transformation protocol. Useful tissue sources include callus, suspension culture cells, protoplasts, leaf segments, stem segments, tassels, pollen, embryos, hypocotyls, tuber segments, meristematic regions, and the like. The tissue source is selected and transformed so that it retains the ability to regenerate whole, fertile plants following transformation, i.e., contains totipotent cells. The transformation is carried out under conditions directed to the plant tissue of choice.
[0155] According to the present invention, an intended plant can be obtained by introducing and manipulating a genetic construct as disclosed herein into various plant cells including, but are not limited to, protoplasts, tissue-cultured cells, tissues and organ explants, pollens, embryos and whole plant bodies. From the plants manipulated according to the embodiment of the present invention, the intended transgenic plant is selected or screened by an approach and method as known in the art. An individual plant body may be regenerated from the isolated transformant. Methods of regenerating individual plant bodies from plant cells, tissues or organs for various species are well known by those skilled in the art.
[0156] The transformed plant cells, calli, tissues or plants may be identified and isolated by selecting or screening the characters encoded by marker genes contained in the genetic construct used for the transformation. For example, the selection may be conducted by growing a manipulated plant in a medium containing a repressive amount of antibiotic or herbicide, to which the introduced genetic construct can impart the resistance. Further, the transformed plant cells and plants may be identified by the screening with reference to the activity of visible marker genes (such as P -glucuronidase genes, luciferase genes, B genes or Cl genes) which may be present in the transgenic nucleic acid construct of the present invention. The methods of the selection and screening are well known by those skilled in the art.
[0157] It is further contemplated that combinations of screenable and selectable markers may be useful for identification of transformed cells. For example, selection with a growth inhibiting compound, such as bialaphos or glyphosate at concentrations below those providing 100% inhibition followed by screening of growing tissue for expression of a screenable marker gene such as luciferase would allow one to recover transformants from cell or tissue types that are not amenable to selection alone. Selectable marker genes include, but are not limited to, Kan, GFP, EGFP, GUS, LUX, CAH, SPT, NPTII, HPT, APHIV, BAR, PAT, CHS, AHAS and flavonoid synthesis genes.
[0158] An exemplary embodiment of methods for identifying transformed cells involves exposing the cultures to a selective agent, such as a metabolic inhibitor, an antibiotic, herbicide or the like. Cells which have been transformed and have stably integrated a marker gene conferring resistance to the selective agent used, will grow and divide in culture. Sensitive cells will not be amenable to further culturing.
[0159] The transgenic plants, progeny, seeds, plant cells, and plant parts of the invention may also contain one or more additional traits. Additional traits may be introduced by crossing a plant containing a transgene comprising the recombinant DNA molecules provided by the invention with another plant containing one or more additional trait(s). As used herein, "crossing" means breeding two individual plants to produce a progeny plant. Two plants may thus be crossed to produce progeny that contain the desirable traits from each parent. As used herein "progeny" means the offspring of any generation of a parent plant, and transgenic progeny comprise a DNA construct provided by the invention and inherited from at least one parent plant. Additional trait(s) also may be introduced by co-transforming a DNA construct for that additional transgenic trait(s) with a DNA construct comprising the recombinant DNA molecules provided by the invention (for example, with all the DNA constructs present as part of the same vector used for plant transformation) or by inserting the additional trait(s) into a transgenic plant comprising a DNA construct provided by the invention or vice versa (for example, by using any of the methods of plant transformation or genome editing on a transgenic plant or plant cell). Such additional traits include, but are not limited to, increased insect resistance, increased water use efficiency, increased yield performance, increased drought resistance, increased seed quality, improved nutritional quality, hybrid seed production, and herbicide-tolerance, in which the trait is measured with respect to a wild-type plant.
[0160] Physical methods and biochemical methods can be employed for identifying plants containing the genetic construct of the present invention or plant cells transformed with theconstruct. Examples of the methods include: (1) Southern analysis or PCR amplification for detecting and determining the structure of recombinant DNA insert; (2) Northern blotting, SI RNase protection, primer elongation PCR amplification or reverse transcriptase PCR (RT-PCR) amplification for detecting and determining the RNA transcription product of genetic construct; and (3) when the genetic construct is a protein, protein gel electrophoresis, western blotting, immune precipitation, enzyme immunoassay, etc. but the methods are not limited to them. These assay methods are well known by those skilled in the art.
[0161] The above-mentioned methods for increasing the sugar content and size of tomato fruits are also applicable to other recipient plants that share homologous genes with tomatoes. There are no particular limitations on the recipient plants suitable for this invention, including not only tomatoes but also other plants with high homology, as long as they are suitable for gene transformation, such as various crops, flowers, or forestry plants. Examples of such plants include (but are not limited to): dicots, monocots, woody plants, plants of the Rosales order, plants of the Rosaceae family, Prunus, peaches, and cruciferous plants.
[0162] As used herein, the term “about” when combined with a value refers to ± 10% of the reference value.
[0163] As used herein the singular forms “a”, “an”, and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, reference to “a compound” includes a plurality of such compounds. It should be noted that the term “and” or the term “or” are generally employed in their sense including “and / or” unless the context clearly dictates otherwise.
[0164] As used herein, the term "comprising" means "including but not limited to".
[0165] As used herein, the term "and / or" refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative ("or").
[0166] Additional objects, advantages, and novel features of the present invention will become apparent to one ordinarily skilled in the art upon examination of the following examples, which are not intended to be limiting. Additionally, each of the various embodiments and aspects of the present invention as delineated hereinabove and as claimed in the claims section below finds experimental support in the following examples.EXAMPLESMethodsForming the Tomato Libraries
[0167] sgRNA oligonucleotides were designed and synthesized against tomato gene panels as described in Examples 1-4 hereinbelow. Each sgRNA targets at least two genes of homologous function to achieve simultaneous knockout of multiple redundant genes. The synthesized sgRNA oligonucleotides were used as templates, and DNA fragments containing sgRNA of the targeted genes were obtained through Polymerase Chain Reaction (PCR) amplification, followed by purification treatment on the amplified product to remove impurities. The purified DNA products were cloned into the appropriate vector (see Examples 1-4 hereinbelow|), using Golden -gate cloning. Finally, a group-scale CRISPR library of tomato gene-panel was successfully constructed. The constructed CRISPR library comprising the gene panel was introduced into AC wild-type tomatoes using tissue culture techniques. Positive seedlings were identified by kanamycin resistance selection and PCR identification. Positive seedlings were planted in a greenhouse under common agricultural growth conditions of the tomato variety used. At the fruit ripening stage, all transgenic plants were subjected to comprehensive and systematic phenotypic identification, including key quality indicators such as fruit size, color, shape and soluble solids content (brix).Screening the Tomato Libraries
[0168] To efficiently identify sgRNA and target genes thereof in the mutant plants showing the desired phenotype, leaves of the mutant plants were sampled, genomic DNA was extracted by using a CT AB method, and Barcoding analysis was performed by taking the sample as a template. The sgRNA and the target gene were rapidly identified through sequence alignment.Example 1: Identifying tomato transcription factors associated with fruit quality
[0169] sgRNA oligonucleotides were designed for the tomato transcription factor panel and amplified DNA fragments containing the sgRNA were obtained and purified as described hereinabove. The purified DNA products were cloned into the pMR284-Crimera vector, and a CRISPR library of tomato transcription factors was successfully constructed. Transgenic plants containing the library were obtained as described hereinabove. Among the numerous mutants with significant phenotypes, the mutant designated Tom6-155 was selected for further research. Compared to the AC control, Tom6-155 fruit brix content was significantly increased, suggesting that the Tom6-155 mutant may play an important role in regulating tomato fruit quality. The sgRNAs and their target genes in the Tom6-155 plant were identified as described hereinabove, revealing the coding sequence (CDS) and amino acid sequences of Solyc03g034130.2 and Solyc03g034110.2 in phytozome 13 (phytozome-next.jgi.doe.gov / info / Slycopersicum_ITAG2_4). Sequence alignment using DNAMANsoftware revealed a CDS sequence similarity of 91.26% and an amino acid sequence similarity of 87.5% (data not shown)). This demonstrates that there may be functional redundancy between these two genes and knocking out both genes simultaneously resulted in a phenotype with fruit quality superior to that of the wild type.
[0170] To confirm the presence of Solyc03g034130.2 and Solyc03g034110.2 in the positive-phenotype plants, genomic DNA was extracted and PCR amplification was performed using primers 4130-F, 4130-R and 4110-F, 4110-R described in Table 1 hereinbelow. The PCR amplification products were then recovered and sequenced. Mutant plants with edited Solyc03g034130.2 and Solyc03g034110.2 genes were screened based on the sequencing results.Table 1: Primers used to detect Solyc03g034130.2 and Solyc03g034110.2
[0171] Phenotypes of the Solyc03g034130.2 / Solyc03g034110.2 mutant strain and wildtype plants were photographed and identified (Figure 1A). The present invention primarily reflects tomato quality through the soluble solids Brix content of tomato fruit (Figure IB). A higher soluble solids Brix content indicates better quality. As shown in Figure IB, after the same number of days of cultivation under suitable conditions, the soluble solids Brix content of the Solyc03g034130.2 / Solyc03g034110.2 mutant strain was significantly higher compared to that of the wild-type fruit.
[0172] These results indicate that under suitable conditions, the fruits of the Solyc03g034130.2 / Solyc03g034110.2 mutant line had a higher soluble solids (Brix) content than the wild-type fruit within the same timeframe, suggesting that the Solyc03g034130.2 / Solyc03g034110.2 gene, encoding the transcription factors having the amino acid sequence set forth in SEQ ID NO: 1 and SEQ IID NO:2, respectively, can regulate tomato fruit quality.Example 2: Identifying tomato membrane transport protein associated with fruit quality
[0173] sgRNA oligonucleotides were designed for the tomato membrane transport protein panel and amplified DNA fragments containing the sgRNA were obtained and purified as described hereinabove. The purified DNA products were cloned into the pMR284-Crimera vector, and a CRISPR library of tomato transcription factors was successfully constructed. Transgenic plants containing the library were obtained as described hereinabove. Among the many mutants with significant phenotypes, the mutant numbered Tom 1-99 was selected as a further research object. Compared to the AC control, its fruit brix content was significantly increased, indicating that the Tom 1-99 mutant may play an important role in the regulation of tomato fruit quality.
[0174] To efficiently identify the sgRNA and its target genes in the Toml-99 mutant plant, samples were taken from the Toml-99 mutant plant, genomic DNA was extracted and the sgRNA and target genes were identified as described hereinabove. The results showed that the sgRNA target genes were Solyc02g062860.2 and Solyc02g062870.2, membrane transport proteins belonging to the Major Facilitator Superfamily (MFS). The amino acid sequences of the two genes Solyc02g062860.2 and Solyc02g062870.2 were obtained from Phytozome 13 (phytozome-next.jgi.doe.gov / info / Slycopersicum_ITAG2_4). Further sequence alignment using DNAMAN software showed that the amino acid sequence similarity was 99.8% (data not shown). This proves that there may be functional redundancy when these two genes perform their functions, and simultaneous knockout results in a phenotype with better fruit quality than the wild type.
[0175] To confirm the presence of Solyc02g062860.2 and Solyc02g062870.2 genes in the positive-phenotype plants, genomic DNA was extracted and PCR amplification was performed using primers 2860-F, 2860-R and primers 2870-F, 2870-R described in Table 2 hereinbelow. The PCR amplification products were then recovered and sequenced.Table 2: Primer used to detect Solyc02g062860.2 and Solyc02g062870.2
[0176] Solyc02g062870.2 gene mutant lines were further examined. Phenotypic photographs (Figure 1C) and identification were performed on the fruits of theSolyc02g062870.2 gene mutant lines (i.e., knockout lines) and the wild-type (AC) plants. The present invention mainly reflects the high or low sugar content of tomatoes through the brix content of soluble solids in the tomato fruit. The higher the brix content of soluble solids, the higher the sugar content and the better the quality. As shown in Figure ID, after being cultured for the same number of days under suitable conditions, the brix content of the Solyc02g062870.2 gene mutant lines was significantly higher compared to that of the wildtype fruit.
[0177] These results indicate that under suitable conditions and within the same time frame, the fruit of the Solyc02g062870.2 gene mutant lines has a higher sugar content than the fruit of the wild-type plant. This shows that the Solyc02g062870.2 gene, encoding the MFS proteins having SEQ ID NO:3, can regulate the sugar content and quality of tomato fruit. Example 3: Identifying tomato transporter proteins associated with fruit quality
[0178] sgRNA oligonucleotides were designed for the tomato transporter protein panel and amplified DNA fragments containing the sgRNA were obtained and purified as described hereinabove. The purified DNA products were cloned into the pMR284-Crimera vector, and a CRISPR library of tomato transcription factors was successfully constructed. Transgenic plants containing the library were obtained as described hereinabove. Among the many mutants with significant phenotypes, the mutant numbered 0990-32 was selected as a further research object. Compared to the AC control, its fruit brix content was significantly increased, indicating that the 0990-32 mutant may play an important role in the regulation of tomato fruit quality.
[0179] To efficiently identify the sgRNA and its target genes in the 0990-32 mutant plant, samples were taken from the 0990-32 mutant plant, genomic DNA was extracted and the sgRNA and target genes were identified as described hereinabove. The results showed that the sgRNA target genes were Solyc08g008190 and Solyc08g008200. The CDS and amino acid sequences of the two genes Solyc08g008190 and Solyc08g008200.2 were obtained from Phytozome 13 (phytozome-next.jgi.doe.gov / info / Slycopersicum_ITAG2_4). Further sequence alignment using DNAMAN software showed that the amino acid sequence similarity was 80.9% (data not shown). This proved that these two genes may have functional redundancy when performing their functions, and their simultaneous knockout results in a phenotype with larger fruit volume and better quality compared to the fruit phenotype of the wild type.
[0180] To confirm the presence of Solyc08g008190 and Solyc08g008200 genes in the positive-phenotype plants, genomic DNA was extracted and PCR amplification wasperformed using primers 8190-F; 8190-R; 8200-F; and 8200-R described in Table 3 hereinbelow.Table 3: Primer used to detect Solyc08g008190 and Solyc08g008200
[0181] Phenotypic photographs (Figure IE) and identification were performed on the Solyc08g008190 / Solyc08g008200 gene mutant line and the wild-type plant. By comparing their fruit length and width, it is shown that fruit length and width are increased compared to the wild type, and the fruit volume is larger.
[0182] The present invention mainly uses the soluble solids Brix content of tomato fruit to reflect the quality of the tomato. The higher the soluble solids Brix content, the better its quality. As shown in Figure IF, after being cultured under suitable conditions for the same number of days, the Brix content of the Solyc08g008190 / Solyc08g008200 gene mutant line was significantly higher than that of the wild-type fruit.
[0183] These results indicate that under suitable conditions and within the same time frame, the fruit of the Solyc08g008190 / Solyc08g008200 gene mutant line has a higher soluble solids content and is larger than the fruit of the wild-type plant. This shows that the Solyc08g008190 / Solyc08g008200 genes, encoding the transported proteins having the amino acid sequence set forth in SEQ ID NO: 5 and SEQ ID NO: 6, respectively, can regulate the quality and size of tomato fruit.Example 4: Identifying additional tomato transcription factor associated with fruit quality
[0184] sgRNA oligonucleotides were designed for the tomato transcription factor panel and amplified DNA fragments containing the sgRNA were obtained and purified as described hereinabove. The purified DNA products were cloned into the pMR284-Crimera vector, and a CRISPR library of tomato transcription factors was successfully constructed. Transgenic plants containing the library were obtained as described hereinabove. Among the numerous mutants with significant phenotypes, the mutant designated TOM6-126 was selected for further research. Compared to the AC control, TOM6-126 fruit volume was larger, and theBrix content was significantly higher, indicating that the mutation in TOM6-126 may play an important role in regulating tomato fruit shape and sugar content. The sgRNAs and their target genes in the TOM6-126 plant were identified as described hereinabove, revealing that the target sequence is Solyc02g060560.
[0185] To confirm the presence of Solyc02g060560 in the positive-phenotype plants, genomic DNA was extracted and PCR amplification was performed using primers 0560-F and 0560-R described in Table 4 hereinbelow. The PCR amplification products were then recovered and sequenced. Mutant plants with edited Solyc02g060560.2 gene were screened based on the sequencing results.Table 4: Primers used to detect Solyc02g060560
[0186] The Solyc02g060560 gene mutant strain and wild-type plants were phenotypically photographed (Figure 1G) and identified. After being cultured for the same number of days under suitable conditions, the Brix content of the Solyc02g060560 gene mutant strain was significantly higher than that of the wild-type fruit (Figure 1H), and both the fruit length and width increased (Figures 2A-2B), showing an increase in volume.
[0187] These results indicate that, under suitable conditions and within the same time frame, the fruit of the Solyc02g060560 gene mutant strain has a higher sugar content and is larger than the fruit of the wild-type plant. This shows that the Solyc02g060560 gene can regulate the sugar content and size of tomato fruit.
[0018] Example 5: Functional Identification of Gene B3-337
[0189] The B3-337 (Solyc01gl06250) gene was amplified using PCR, and the amplified gene was inserted into a pK2-35S-B3-337 overexpression vector using the Gateway method, followed by sequencing confirmation. The recombinant vector was introduced into Agrobacterium GV3101, which was then used to infect tomato cotyledons prepared from sterilized seeds germinated on ’A MS medium. After pre-culture, cotyledons were immersed in Agrobacterium suspension and co-cultured, then transferred to selective media for callus induction, shoot regeneration, and rooting. Regenerated plants were screened for successful transformation by PCR using specific primers, and positive T1 plants were self-pollinated to obtain T2 and T3 generations. Homozygous T3 plants were confirmed by RNA quantificationusing RT-PCR, which demonstrated significantly elevated expression levels in selected overexpression lines OE1, OE4, and OE8. Phenotypic evaluation of these lines revealed that, under identical cultivation conditions, fruits from B3-337 overexpression plants exhibited markedly higher soluble solids (brix content, Figure 1J), as well as increased fruit size and weight compared to wild-type controls (Figures 2C-2D). These results indicate that overexpression of the B3-337 transcription factor positively regulates tomato fruit quality by enhancing sugar content and promoting larger fruit development.SequencesSEQ ID NO 1 - Solyc03g034130 Protein sequence - Amino acidsSEQ ID NO: 2 - Solyc03g034110 Protein sequence - Amino acidsSEQ ID NO: 3 - Solyc02g062870 Protein sequence - Amino acidsSEQ ID NO: 4 - Solyc02g062860 Protein sequence - Amino acidsSEQ ID NO: 5 - Solyc08g008190 Protein sequence - Amino acidsSEQ ID NO: 6 - Solyc08g008200 Protein sequence - Amino acidsSEQ ID NO: 7 - Solyc02g060560 Protein sequence - Amino acidsSEQ ID NO: 8 - Solyc01gl06250 Protein sequence - Amino acidsSEQ ID NO: 9 - Solyc03g034130 CDS sequence - Nucleic acidsSEQ ID NO: 10 - Solyc03g034110 CDS sequence - Nucleic acidsSEQ ID NO: 11 - Solyc02g062870 CDS sequence - Nucleic acidsSEQ ID NO: 12 - Solyc02g062860 CDS sequence - Nucleic acidsSEQ ID NO: 13 - Solyc08g008190 CDS sequence - Nucleic acidsSEQ ID NO: 14 - Solyc08g008200 CDS sequence - Nucleic acidsSEQ ID NO: 15 - Solyc02g060560 CDS sequence - Nucleic acidsSEQ ID NO: 16 - Solyc01gl06250 CDS sequence - Nucleic acidsSEQ ID Nos: 17-30 - Primers - Nucleic acidsSEQ ID Nos: 31-34 - sgRNA encoded DNA- Nucleic acid
[0190] Although the invention has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications, and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.
Claims
CLAIMS1. A genetically engineered tomato (Solanum lycopersicum) plant having at least one improved fruit quality trait compared to a corresponding non-engineered control plant, the genetically engineered plant comprises at least one cell having modified expression and / or activity of at least one protein comprising an amino acid sequence at least 85% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6 ,7 and 8, compared to the protein expression and / or activity in the nonengineered corresponding control plant.
2. The plant of claim 1, wherein the at least one improved fruit quality trait is selected from the group consisting of higher soluble solid content, higher fruit size, higher fruit weight, higher sugar content, higher yield and any combination thereof compared with the corresponding control plant.
3. The plant of any one of claims 1 or 2, wherein the genetically engineered plant comprises at least one cell having modified expression and / or activity of at least one protein having an amino acid sequence selected from the group consisting of SEQ ID NOs: 1, 2, 3, 4, 5, 6 , 7 and 8.
4. The plant of any one of claims 1 to 3, wherein the genetically engineered plant comprises at least one cell having reduced expression and / or activity of at least one protein having at least 85% identity to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-7.
5. The plant of claim 4, wherein the reduced expression and / or activity of the protein is achieved by downregulation of the endogenous gene encoding said protein within the at least one cell of the plant.
6. The plant of any one of claims 4-5, wherein the genetically engineered plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 1.
7. The plant of claim 6, wherein the gene is the tomato Solyc03g034130 gene.
8. The plant of any one of claims 4-5, wherein the genetically engineered plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 2.
9. The plant of claim 8, wherein the gene is the tomato Solyc03g034110 gene.
10. The plant of any one of claims 6-9, wherein the plant comprises at least one cell in which the genes encoding SEQ ID NO: 1 and SEQ ID NO: 2 are downregulated.
11. The plant of any one of claims 4-5, wherein the genetically engineered plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 3.
12. The plant of claim 11, wherein the gene is the tomato Solyc02g062870 gene.
13. The plant of any one of claims 4-5, wherein the genetically engineered plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 4.
14. The plant of claim 13, wherein the gene is the tomato Solyc02g062860 gene.
15. The plant of any one of claims 11-14, wherein the plant comprises at least one cell in which the genes encoding SEQ ID NO: 3 and SEQ ID NO: 4 are downregulated.
16. The plant of any one of claims 4-5, wherein the genetically engineered plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 5.
17. The plant of claim 16, wherein the gene is the tomato Solyc08g008190 gene.
18. The plant of any one of claims 4-5, wherein the genetically engineered plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 6.
19. The plant of claim 18, wherein the gene is the tomato Solyc08g008200 gene.
20. The plant of any one of claims 16-19, wherein the plant comprises at least one cell in which the genes encoding SEQ ID NO: 5 and SEQ ID NO: 6 are downregulated.
21. The plant of any one of claims 4-5, wherein the genetically engineered plant comprises at least one cell having reduced expression of a gene encoding a protein having at least 85% identity to the amino acid sequence set forth in SEQ ID NO: 7.
22. The plant of claim 21, wherein the gene is the tomato Solyc02g060560 gene.
23. The plant of any one of claims 5-22, wherein the endogenous gene is downregulated by knockout or knockdown.
24. The plant of any one of claims 1-2, wherein the genetically engineered plant comprises at least one cell having enhanced expression and / or activity of a protein at least 85% identical to the amino acid sequence set forth is SEQ ID NO: 8.
25. The plant of claim 24, comprising at least one cell having overexpression of a gene encoding transcription factor B3-337 having the amino acid sequence set forth in SEQ ID NO:8.
26. The plant of any one of claims 24-25, wherein the gene encoding SEQ ID NO: 8 is Solyc01gl06250.
27. The plant of any one of claims 24-26, wherein the plant comprises an exogenous polynucleotide encoding a protein having an amino acid sequence at least 85% identical to the amino acid sequence set forth is SEQ ID NO: 8.
28. The plant according to any one of the preceding claims, wherein the genetic background of said plant is of the cultivated tomato AC (Ailsa Craig).
29. The plant according to any one of the preceding claims, wherein Brix index of the fruit of the genetically engineered plant is at least 0.5% higher compared to the Brix index of a fruit of the corresponding control plant.
30. The plant according to any one of the preceding claims, wherein the average soluble solid content of the fruit of the genetically engineered plant is at least 1% higher compared to the content in the fruits of the corresponding control plant.
31. The plant according to any one of the preceding claims, wherein the average fruit size of the genetically engineered plant is at least 2% higher compared to the average fruit size of the corresponding control plant.
32. A recombinant expression vector comprising a polynucleotide encoding for the transcription factor B3-337 having an amino acid sequence at least 85% identical to the amino acid sequence set forth in SEQ ID NO: 8.
33. A method of improving at least one fruit quality trait of a tomato plant, the method comprises a step of modifying, in the tomato plant, the expression and / or activity of at least one protein having an amino acid sequence at least 85% identical to an amino acid sequence selected from the group consisting of SEQ ID NOs: 1-8.
34. The method of claim 33, wherein the method comprises downregulating a gene encoding a protein having an amino acid sequence selected from the group consisting of SEQ ID NO: 1-7.
35. The method of claim 33, comprising downregulating genes encoding the proteins having the amino acid sequence set forth in SEQ ID NOs: 1 and 2.
36. The method of claim 33, comprising downregulating the gene encoding the protein having the amino acid sequence set forth in SEQ ID NO: 3.
37. The method of claim 33, comprising downregulating genes encoding the proteins having the amino acid sequence set forth in SEQ ID NO: 3 and 4.
38. The method of claim 33, comprising downregulating genes encoding the proteins having the amino acid sequence set forth in SEQ ID NO: 5 and 6.
39. The method of claim 33, comprising downregulating the gene encoding the protein set having the amino acid sequence forth in SEQ ID NO: 7.
40. The method of claim 33, wherein said method comprises knocking out or knocking down of the expression of at least one gene selected from the group consisting of Solyc03g034130, Solyc03g034110, Solyc02g062870, Solyc02g062860, Solyc08g008190, Solyc08g008200, and Solyc02g060560.
41. The method of claim 33, wherein the method comprises overexpressing a gene encoding for the protein having the amino acid sequence set forth in SEQ ID NO: 8.
42. A method of improving the fruit quality of a tomato plant, the method comprises a step of enhancing the expression and / or activity of a transcription factor B3-337 having an amino acid sequence at least 85% identical to the amino acid sequence set forth in SEQ ID NO: 8 in the plant relative to a corresponding control plant.
43. A method of improving a fruit quality of a plant, the method comprising:(i) transforming the plant with at least one exogenous polynucleotide encoding for transcription factor B3-337 having an amino acid sequence at least 85% identical to the amino acid sequence set forth in SEQ ID NO: 8; and(ii) growing the plant.