Aptamer-based assay compositions and methods

WO2026143006A3PCT designated stage Publication Date: 2026-07-30ILLUMINA INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
ILLUMINA INC
Filing Date
2025-12-22
Publication Date
2026-07-30

AI Technical Summary

Technical Problem

Existing aptamer-based assays face challenges in accurately detecting and identifying analytes due to variations in protein concentrations within and between biological samples, making it difficult to establish a useful detection range for multiplexed assays.

Method used

The use of partially double-stranded aptamers immobilized on a surface, where binding to analytes disrupts double-stranded regions, enabling differentiation between bound and unbound aptamers through enzymatic cleavage or conformational changes, and employing sandwich complexes with detectable tags for fluorescence signaling.

Benefits of technology

This approach allows for precise detection and identification of analytes by distinguishing between bound and unbound aptamers, enhancing the accuracy and specificity of aptamer-based assays.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2025060909_30072026_PF_FP_ABST
    Figure US2025060909_30072026_PF_FP_ABST
Patent Text Reader

Abstract

Aptamer detection techniques are described in an aptamer-based assay. In an embodiment, structural or conformational differences between analyte-bound and unbound aptamers can be leveraged to detect the presence of analytes in a sample. For example, analyte binding to an aptamer may cause linearization of a hairpin loop or displacement of a reporter probe.
Need to check novelty before this filing date? Find Prior Art

Description

APTAMER-BASED ASSAY COMPOSITIONS AND METHODSCROSS-REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims priority to and the benefit of U.S. Provisional Application No. 63 / 738,185 filed December 23, 2024, the disclosure of which is hereby incorporated by reference in its entirety herein.REFERENCE TO ELECTRONIC SEQUENCE LISTING

[0002] The application contains a Sequence Listing which has been submitted electronically in .XML format and is hereby incorporated by reference in its entirety. Said .XML copy, created on December 18, 2025, is named “ILLrM0210PCT.xml” and is 19,950 bytes in size. The sequence listing contained in this .XML file is part of the specification and is hereby incorporated by reference herein in its entirety.BACKGROUND

[0003] The disclosed technology relates generally to analyte detection and / or identification techniques used in conjunction with an affinity-binder assay, such as an aptamer-based assay. In particular, the technology disclosed relates to analyte modification techniques that can be used in conjunction with aptamer capture to uniquely identify captured analytes.

[0004] The subject matter discussed in this section should not be assumed to be prior art merely as a result of its mention in this section. Similarly, a problem mentioned in this section or associated with the subject matter provided as background should not be assumed to have been previously recognized in the prior art. The subject matter in this section merely represents different approaches, which in and of themselves can also correspond to implementations of the claimed technology.

[0005] Protein expression patterns help define a cell’s identity and state. RNA transcripts are often used as a surrogate for protein expression, but the relationship between abundance ofproteins and mRNA is not one-to-one. There are differences caused by RNA regulation and / or protein regulation, such as posttranscriptional, translational, protein degradation and RNA regulation. Therefore, direct nucleic acid sequencing of RNA transcripts may not provide an accurate estimation of protein expression.

[0006] Aptamers are single stranded nucleic acid molecules that bind to molecular targets, such as proteins, with high affinity and specificity. Advancements in aptamer selection and design include Systematic Evolution of Ligands by Exponential enrichment (SELEX). In SELEX, high affinity aptamers for different analytes of interest can be isolated from a combinatorial library, permitting high throughput characterization of aptamer-target binding and multiplexed assays for analytes in a complex biological sample. Upon aptamer binding to an analyte target, the binding event can be detected to characterize the presence and concentration of various analytes in the biological sample. However, because protein or other analyte concentrations can vary to a high degree within and / or between different biological samples, identifying a useful detection range for a multiplexed aptamer-based assay is difficult.BRIEF DESCRIPTION

[0007] In one embodiment, the present disclosure provides a method of analyte detection. The method includes providing a plurality of aptamers immobilized on a surface, wherein different aptamers of the plurality of aptamers have binding specificity for respective different analytes and wherein each aptamer of the plurality is partially double-stranded. The method also includes contacting the plurality of aptamers with analytes of a sample to disrupt doublestranded regions in a first subset of the plurality of aptamers via formation of analyte-aptamer complexes, wherein a second subset of the plurality of aptamers does not form the analyteaptamer complexes based on a lack of corresponding analytes in the sample and retains the double-stranded regions. The method further includes detecting the analytes of the sample based on a detectable difference between the first subset and the second subset.

[0008] In one embodiment, the present disclosure provides a method of analyte detection. The method includes providing a plurality of aptamers immobilized on a surface wherein different aptamers of the plurality of aptamers have binding specificity for respective different analytes and such each aptamer of the plurality includes a first end coupled to the surface, a free second end, and a hairpin loop including a loop region and a double-stranded region. The method also includes contacting the surface with analytes of a sample such that an individual analyte binds to an individual aptamer of the plurality to disrupt the double-stranded region to cause linearization of the individual aptamer, and wherein a subset of the plurality of aptamers are not bound to any analytes after the contacting. The method includes contacting the surface with an enzyme that cleaves double-stranded regions, e.g., only cleaves double-stranded regions, in the subset of the plurality of aptamers that are not bound to any analytes. The method further includes detecting the analyte based on sequencing the linearized aptamer.

[0009] In one embodiment, the present disclosure provides a method of analyte detection. The method includes providing a plurality of aptamers immobilized on a surface wherein different aptamers of the plurality of aptamers have binding specificity for respective different analytes. The method also includes contacting analytes of a sample to the plurality of aptamers to form analyte-aptamer complexes. The method includes contacting the surface with an endonuclease, wherein the endonuclease cleaves a reporter sequence in an unbound subset of the plurality of aptamers. The method further includes detecting the analytes of the sample based on the sequences of retained reporter sequences of the analyte-aptamer complexes.

[0010] In one embodiment, the present disclosure provides a method of analyte detection. The method includes providing a plurality of aptamers immobilized on a surface wherein different aptamers of the plurality of aptamers have binding specificity for respective different analytes and wherein each aptamer of the plurality is partially double-stranded via hybridization to a primer strand. The method also includes contacting the plurality of aptamers with analytes of a sample to form analyte-aptamer complexes with a first subset of the plurality of aptamers, wherein a second subset of the plurality of aptamers does not form the analyte-aptamer complexes based on a lack of corresponding analytes in the sample. The method includesextending from the primer strand, wherein the first subset remains partially double-stranded after extension and wherein the second subset has a conserved restriction site double-stranded after extension. The method also includes contacting the surface with an enzyme that cleaves the conserved double-stranded restriction site in the second subset. The method further includes detecting the analytes of the sample based on a detectable difference between the first subset and the cleaved second subset.

[0011] In one embodiment, the present disclosure provides a method of analyte detection. The method includes contacting analytes of sample with a plurality of first aptamers and a plurality of second aptamers to form analyte-first aptamer-second aptamer complexes. The method also includes coupling an end of a first aptamer to an end of a second aptamer within an individual analyte-first aptamer-second aptamer complex to form an aptamer oligonucleotide. The method further includes detecting the analytes of the sample based on sequences of aptamer oligonucleotides of individual analyte-first aptamer-second aptamer complexes.

[0012] In one embodiment, the present disclosure provides a method of analyte detection. The method includes contacting analytes of sample with a plurality of first aptamers to form analyte-first aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes. The method also includes contacting the analyte-first aptamer complexes with a plurality of second aptamers to form analyte-aptamer sandwich complexes. The method further includes detecting the analytes of the sample based on detecting second aptamers of the analyte-aptamer sandwich complexes.

[0013] In one embodiment, the present disclosure provides a fluorescence assay array method. The method includes providing a solid surface including a plurality of wells and a plurality of beads disposed on the solid surface such that an individual well of the plurality of wells accommodates a single bead of the plurality of beads, wherein each bead of the plurality of beads includes at least one aptamer immobilized on a bead surface. The method also includes contacting analytes of a sample with the at least one aptamer immobilized on the beads surface, wherein the at least one aptamer binds to an individual analyte to form analyte-aptamer complexes. The method includes contacting the analyte-aptamer complexes with a plurality oftags to associate each individual analyte with one or more tags to form analyte-aptamer-tag complexes. The method also includes contacting the analyte-aptamer-tag complexes with a plurality of conjugated dyes to associate each individual tag with one or more conjugated dyes to generate a fluorescence signal. The method further includes detecting the analytes of the sample based on the fluorescence signal.BRIEF DESCRIPTION OF THE DRAWINGS

[0014] These and other features, aspects, and advantages of the disclosed embodiments will become better understood when the following detailed description is read with reference to the accompanying drawings in which like characters represent like parts throughout the drawings, wherein:

[0015] FIG. 1 is a flow diagram of a method for analyte detection using aptamers, in accordance with aspects of the present disclosure;

[0016] FIG. 2 is a method for analyte detection using aptamers including a hairpin loop, in accordance with aspects of the present disclosure;

[0017] FIG. 3 is an example analyte detection workflow using aptamers including a hairpin loop of FIG. 2, in accordance with aspects of the present disclosure;

[0018] FIG. 4 is a schematic illustration of example aptamer arrangements including identification sequences and primers of FIGS. 2 and 3, in accordance with aspects of the present disclosure;

[0019] FIG. 5 is a method for analyte detection using aptamers and a reporter probes, in accordance with aspects of the present disclosure;

[0020] FIG. 6 is an example analyte detection workflow using aptamers and the reporter probes of FIG. 5, in accordance with aspects of the present disclosure;

[0021] FIG. 7 is a schematic illustration of example aptamer arrangements and example reporter probe arrangements including identification sequences and primers of FIGS. 5 and 6, in accordance with aspects of the present disclosure;

[0022] FIG. 8 is an example analyte detection workflow using aptamers and the reporter probe of FIG. 5, in accordance with aspects of the present disclosure;

[0023] FIG. 9 is a schematic illustration of example aptamer arrangements including identification sequences and primers and example reporter probe arrangements of FIG. 8, in accordance with aspects of the present disclosure;

[0024] FIG. 10 an example analyte detection workflow using the aptamers and the reporter probes of FIG. 5, in accordance with aspects of the present disclosure;

[0025] FIG. 11 is a schematic illustration of example aptamer arrangements including identification sequences and primers and example reporter probe arrangements of FIG. 10, in accordance with aspects of the present disclosure;

[0026] FIG. 12 is a method for analyte detection using aptamers, in accordance with aspects of the present disclosure;

[0027] FIG. 13 is an example analyte detection workflow using the aptamers FIG. 12, in accordance with aspects of the present disclosure;

[0028] FIG. 14 is a schematic illustration of example aptamer arrangements including identification sequences, reporter sequences, and primers of FIGS. 12 and 13, in accordance with aspects of the present disclosure;

[0029] FIG. 15 is a method for analyte detection using aptamers and primer strands, in accordance with aspects of the present disclosure;

[0030] FIG. 16 is an example analyte detection workflow using the aptamers and the primers strands of FIG. 15, in accordance with aspects of the present disclosure;

[0031] FIG. 17 is a schematic illustration of example aptamer arrangements including identification sequences and primers and example primer strands of FIGS. 15 and 16, in accordance with aspects of the present disclosure;

[0032] FIG. 18 is a method for analyte detection using split aptamers, in accordance with aspects of the present disclosure;

[0033] FIG. 19 is an example analyte detection workflow using the split aptamers of FIG. 18, in accordance with aspects of the present disclosure;

[0034] FIG. 20 a schematic illustration of example split aptamer arrangements including identification sequences and primers of FIGS. 18 and 19, in accordance with aspects of the present disclosure;

[0035] FIG. 21 is an example analyte detection workflow via formation of analyte-aptamer sandwich complexes, in accordance with aspects of the present disclosure;

[0036] FIG. 22 is an example analyte detection workflow using a fluorescence assay array, in accordance with aspects of the present disclosure; and

[0037] FIG. 23 is a schematic diagram of a sequencing device for acquiring sequencing data for identification of sequences and / or index sequences, in accordance with aspects of the present disclosure.DETAILED DESCRIPTION

[0038] The following discussion is presented to enable any person skilled in the art to make and use the technology disclosed and is provided in the context of a particular application and its requirements. Various modifications to the disclosed implementations will be readily apparent to those skilled in the art, and the general principles defined herein may be applied to other implementations and applications without departing from the spirit and scope of the technology disclosed. Thus, the technology disclosed is not intended to be limited to theimplementations shown, but is to be accorded the widest scope consistent with the principles and features disclosed herein.

[0039] Aptamers are short single stranded nucleic acid molecules (ssDNA or ssRNA) that can bind to their specific target molecules with high affinity. Accordingly, aptamers can be used for multiomic applications, such as proteome characterization of a sample in a high-throughput manner. Disclosed herein are methods and compositions for protein sensing, protein protection, and / or flow cell quantification using affinity-based proteomics, e.g., in an aptamerbased assay. In general, aptamers or immobilized aptamers may be provided to capture cognate targets (e g., analytes, target proteins, sample proteins, sample) that are present in solution. Certain disclosed techniques present different embodiments for differentiating aptamers that are bound to proteins (i.e., form an analyte-aptamer complex) relative to unbound aptamers.

[0040] In certain embodiments, the disclosed techniques provide direct or indirect aptamer detection and differentiate between analyte-bound and unbound states based on an aptamer conformational change present in the bound state. In one example, the aptamer may include hairpin loop. When an analyte binds to the aptamer, the aptamer may undergo structural changes, such as disruption of the double-stranded region, resulting in the linearization of the aptamer. Accordingly, detection of the analytes may occur via fragmentation of unbound aptamers such that they are not available for downstream amplification / sequencing and, therefore, are not represented in next-generation sequencing (NGS).

[0041] In certain embodiments, differential affinity effects associated with binding of an analyte to an aptamer may be leveraged to distinguish analyte-aptamer complexes from unbound aptamers. For example, a region of the aptamer may be partially double-stranded due to hybridization with a probe (e.g., a reporter probe). However, the binding affinity of an analyte, if present, is greater than the probe hybridization strength such that the doublestranded region is disrupted, thereby causing displacement of the probe. Detection modalities may leverage this differential disruption. For example, the analyte, if present, may sterically hinder the action of DNA cleavage enzymes that would cleave the aptamer in the absence ofthe analyte. In this way, analyte-aptamer complexes and unbound aptamers that are partially double stranded may be distinguished to facilitate analyte detection. In certain embodiments, analyte binding to an aptamer may inhibit (e.g., physically block) cleavage or other enzymes to differentiate analyte-aptamer complexes and unbound aptamers. For example, an aptamer may include reporter sequences that act as cleavage sites and are susceptible to cleavage via enzymes within the analyte-binding region of the aptamer. Binding of an analyte to the analyte-binding region may sterically hinder an enzyme’s ability to access the cleavage site and, therefore, inhibit the enzyme cleavage. This allows the analyte-aptamer complexes to remain intact and associated with a surface while unbound aptamers are cleaved by the enzymes. Accordingly, the analyte-aptamer complexes may block enzymes from cleaving aptamers associated with an analyte.

[0042] In certain embodiments, aptamer binding detection may employ blocking primer extension of a primer strand hybridized to the aptamer. For example, aptamers may be provided that are immobilized to a surface and partially double-stranded due to hybridization to the primer strand. Analytes may be provided to form analyte-aptamer complexes. A primer strand hybridized to the aptamer of the analyte-aptamer complex will not undergo primer extension due to steric hindrance associated with the binding of an analyte to an individual aptamer. Only the unbound aptamers that include the primer strand will be extended. Accordingly, the fully extended, double-stranded unbound aptamers may be vulnerable to targeted double-stranded DNA enzyme fragmentation (e.g., double stranded DNase (dsDNase)) to facilitate differentiation between bound and unbound aptamers and detection of analytes.

[0043] In certain embodiments, aptamer binding detection can rely on a split aptamer that is detectable when both portions of the aptamer are bound to the analyte. For example, each split aptamer (e.g., a first split aptamer, a first aptamer, a second split aptamer, a second aptamer) may include half of the analyte-binding region associated for a respective analyte. Each split aptamer may also include a non-binding region. When an individual analyte is complexed with a first split aptamer, the analyte-binding region of the first split aptamer is positioned insufficient proximity to an analyte-binding region of the second split aptamer to permit ligation. Ligation may be performed using enzymatic ligation or chemical ligation (e.g., cross-linking, click chemistry (e.g., (e.g., strained ring opening molecules)). After ligation, a ligated aptamer is formed in which the ligated aptamer is bound to the analyte. The ligated aptamer may be amplified and / or sequenced to identify analytes present in the sample. A split aptamer half with no corresponding analytes present in the sample will not be brought into close proximity to its respective aptamer half. In some embodiments, enzymes (e.g., exonuclease) may be provided to digest remaining split aptamers that are unbound. Accordingly, any aptamer identification sequence associated with unbound aptamers will not be amplified and will not be present in any sequencing results from downstream detection steps.

[0044] In certain embodiments, the disclosed techniques include using aptamers in a sandwich-type binding arrangement for capture and optical detection / quantification of proteins. In one example, an individual aptamer may be immobilized to a surface via a binding group , wherein an individual analyte may bind to the individual aptamer to form immobilized analyte-aptamer complexes. A second quantification aptamer may be provided to the individual analyte-aptamer complex that carries a detectable tag (e.g., fluorescence tag) such that the second quantification aptamer may bind to the analyte to form an analyte-aptamer sandwich complex. Binding of the second aptamer to the analyte-aptamer complexes will output a fluorescent signal that can be tracked on a flow cell to facilitate quantification and identification of analyte-aptamer sandwich complexes. The use of two aptamers improves specificity for analyte detection.

[0045] In certain embodiments, aptamer detection may be based on a mapped array with a relatively simple intensity readout. For example, aptamers may be provided immobilized to a solid support. Individual analytes may bind to the immobilized aptamers to form immobilized analyte-aptamer complexes. Subsequently, captured analytes may be biotinylated such that streptavidin conjugated dyes may nonspecifically associate and bind to the biotin molecules on the analytes. Because the pool of analytes can be a complex mixture of different proteins (including some that are covered by the assay and, in certain cases, some proteins that are notassayed), the particular amino acid locations that the biotin binds (and streptavidin conjugated dye via association) to the analytes may be uncharacterized, e.g., non-specific or stochastic. Nonetheless, with sufficient coverage of the analytes with attached biotin, a fluorescent signal may be detected upon association of the streptavidin conjugated dyes to the biotin for most or all of the analytes of interest. Accordingly, intensity of the fluorescent signal of the conjugated dyes bound to a specific analyte-aptamer complex may be utilized to determine analyte concentration within a sample.

[0046] With the foregoing in mind, FIG. 1 is a flow diagram of a method 10 for analyte detection using aptamers as disclosed herein. The method 10 may be performed in the order disclosed herein, in any suitable order, or may include additional steps. For example, certain blocks of the method 10 may be performed concurrently or consecutively. In addition, in certain embodiments, at least one of the blocks of the method 10 may be omitted. It should be noted that affinity-binder and aptamers may be used interchangeably.

[0047] At block 12 of the method 10, a sample with analytes is provided to be detected. For example, the sample may include analytes such as biological fluid, cell, tissue, organ, or organism, comprising analytes or molecules if interest, such as proteins. It should be noted that the types of samples described herein are exemplary and may include additional types of samples, which is further described below.

[0048] At block 14 of the method 10, the sample is contacted with aptamers to allow binding of analytes in sample to aptamers. For example, a respective analyte may bind to a respective analyte-binding region of the aptamer. In certain embodiments, the aptamers may be immobilized onto a surface and / or substrate via a binding group, wherein the binding group may be biotin. Accordingly, an individual analyte within the sample may bind to a respective analyte-binding region of an individual aptamer to form an analyte-aptamer complex (e.g., an immobilized analyte-aptamer complex). In some embodiments, the binding of an analyte to an aptamer may cause a structural change to the aptamer to facilitate formation of the analyteaptamer complexes. In certain embodiments, a respective analyte may not be present in sample which may cause unbound aptamers to remain.

[0049] At block 16 of the method 10, the presence of one or more analytes is detected based on detection signal associated with binding. The disclosed aptamers may include a nonbinding region that may include conserved sequences such as a first primer region and / or a second primer region that is amplifiable. Accordingly, the analyte-aptamer complexes may be amplified and / or sequenced to identify analytes present in the sample. In certain embodiments, unbound aptamers (or unbound aptamers) may be fragmented (e.g., cleaved) via enzymes (e.g., dsDNase, endonuclease) to isolate unbound aptamers (or unbound aptamers) from the immobilized analyte-aptamer complexes. In this way, the fragmented unbound aptamers may be washed such that the remaining analyte-aptamer complexes may be amplified and sequenced. In other embodiments, the fragmented unbound aptamers may be amplified and sequenced to differentiate from the analyte-aptamer complexes. Additionally and / or alternatively, cleavage may cause an aptamer-specific identification sequence to be separated from a strand or end coupled to a surface. In this way, the aptamer-specific identification sequence will not be present in sequencing data generated from oligonucleotides that remain on the surface.

[0050] In certain embodiments, analytes may be detected via a fluorescent signal. A second quantification aptamer including a detectable tag (e.g., fluorescence tag) may be provided to analyte-aptamer complexes such that binding of the second aptamer to the analyte-aptamer complexes will output a fluorescent signal that can be tracked on a flow cell. For example, the second quantification aptamer may bind to the analyte of the immobilized analyte-aptamer complexes to generate an analyte-aptamer sandwich complex. In this way, analytes that are sandwiched between two aptamers will fluoresce. Aptamers with no corresponding analytes in the sample will not be detected via fluorescence. In other embodiments, analytes may be detected using the Illumina bead array for fast TAT quantification aptamers. For example, analytes of analyte-aptamer complexes may be biotinylated such that streptavidin conjugated dyes may nonspecifically associate and bind to the biotin. A fluorescent signal may be detected upon binding of the streptavidin conjugated dyes to the biotin. For example, intensity and concentration of the analyte-aptamer complexes may be determined via the intensity andconcentration of the conjugated dyes bound to a specific analyte-aptamer complex. Unbound aptamers and / or analytes that are not biotinylated will not output a detectable signal.

[0051] FIG. 2 is a method 20 for analyte detection using aptamers including a hairpin loop, as disclosed herein. The method 20 may be performed in the order disclosed herein, in any suitable order, or may include additional steps. For example, certain blocks of the method 20 may be performed concurrently or consecutively. In addition, in certain embodiments, at least one of the blocks of the method 20 may be omitted. It should be noted that affinity -binder and aptamers may be used interchangeably.

[0052] At block 22 of the method 20, aptamers are provided immobilized to a surface, wherein the aptamers include a hairpin loop including a loop region and a double-stranded region. At block 24 of the method 20, the aptamers are contacted with analytes such that an individual analyte binds to an individual aptamer and disrupts the double-stranded region to cause linearization of the individual aptamer. For example, the analyte-binding region may be part of the loop region and / or the double-stranded region. Accordingly, binding of the individual analyte to the analyte-binding region may destabilize the double-stranded region as the binding strength of the analyte to the aptamer may be stronger than the hybridization strength of the double-stranded region. This causes linearization of the aptamer and generates an analyteaptamer complex.

[0053] At block 26 of the method 20, the surface is contacted with an enzyme to cleave doublestranded regions in the remaining aptamers that are not bound to analytes (e.g., unbound aptamers). Put differently, unbound aptamers will retain their respective double-stranded regions as a respective analyte was not present within a sample to disrupt the double-stranded region. The double-stranded regions of the unbound aptamers may be cleaved via targeted double-stranded fragmentation using enzymes such as dsDNase and generate fragmented unbound aptamers. The fragmented unbound aptamers may be washed and removed such that only the analyte-aptamer complexes remain. In other embodiments, the fragmented unbound aptamers may be collected via supernatant, amplified, and sequenced to distinguish thefragmented unbound aptamers from the aptamer sequences associated with the analyteaptamer complexes.

[0054] At block 28 of the method 20, the analyte is detected based on the presence of the linearized aptamer. After cleavage and removal of the fragmented unbound aptamers, the analyte-aptamer complexes may be treated and processed for downstream sequencing. Analytes may be removed prior to subsequent detection steps. For example, addition of enzymes (e.g., protease, proteinase K) may be used to facilitate degradation of the analytes such as proteins. In other embodiments, heat, chemical degradation, or may be used for the degradation of the analytes. In some embodiments, the aptamer may be cleaved from the analyte via chemical or enzymatic means. However, in certain embodiments, no protein treatment or removal is performed, and downstream detection steps may occur with the analyte complexed with its respective aptamer. The aptamer may be amplified and / or sequenced to identify analytes present in the sample.

[0055] The detection may be direct detection via direct sequencing of the linearized aptamer to identify the aptamer sequence or an aptamer barcode or indirect sequencing via a subsequent hybridization to a reporter probe that includes an aptamer identification sequence. The indirect detection may be as generally discussed in US 11965880B2, which is incorporated by reference in its entirety herein. For example, the linearized aptamer may undergo hybridization with first and second reporter probes to form a trimolecular complex, whereby the tri-molecular complex includes an aptamer barcode that can undergo subsequent sequencing steps for detection.

[0056] With the foregoing in mind, FIG. 3 is an example analyte detection workflow 50 using aptamers including a hairpin loop of FIG. 2, as disclosed herein. At step 52, aptamers 54 may be provided immobilized a surface 51 (e.g., solid surface, support, capture bead, well, flow cell, flow cell), wherein one end of the aptamers 54 may be modified with a binding group 56 such that the aptamers 54 may bind to the surface 51 via the binding group 56 and be immobilized. In certain embodiments, one end (e.g., a first end) of the aptamer may be functionalized with a binding group (e.g., biotin tag) such that the aptamer is immobilized tothe surface. For example, the surface may include biotin binding proteins such that the binding group may bind to the biotin binding proteins to immobilized the aptamer. It should be noted that the biotin binding protein may include avidin, streptavidin, neutravidin, an anti-biotin antibody, a biotin receptor, and / or a biotin-binding enzyme. In some embodiments, the biotinbinding enzyme comprises biotinidase or biotin holocarboxylase synthetase. For example, the binding group 56 may include a biotin tag such that the biotin can bind to the surface 51, which may be functionalized with biotin binding proteins.

[0057] As discussed herein, the aptamer 54 may refer to an oligonucleotide that includes an analyte-binding region 60 and other region or regions that do not bind to analytes, e.g., at least one non-binding region 53, and that may participate in secondary structure formation. In the illustrated embodiment, the aptamers 54 may include a loop region 58 and a double-stranded region 62. A second free end 64 may be part of the double-stranded region 62. At step 70, a sample may be provided wherein the sample may include analytes 72. The analyte 72 may bind to an analyte-binding region 60 of the aptamer 54 and disrupt the double-stranded region 62 based on the greater aptamer-analyte affinity relative to the strength of hybridization of the complementary regions to cause linearization of the aptamer 54 and generate an analyteaptamer complex 74. In certain embodiments, a portion of the aptamers 54 may retain their double-stranded regions 62 and will remain as unbound aptamers 76.

[0058] It should be noted that each individual aptamer 54 is specific for an individual analyte 72 and has a unique analyte-binding region 60 relative to other aptamers 54. As further described herein, the non-binding region 53 of the aptamers 54 may include identification sequences (e.g., aptamer identification sequences) that do not directly interact with the analyte 72 but that are uniquely identifying for the aptamer 54 identity. The non-binding region 53 may additionally include one or more conserved regions, such as a primer binding region or an adapter (e g., sequencing adapter), that are conserved between different aptamers 54.

[0059] At step 80, an enzyme 81 may be provided to permit targeted fragmentation of the double-stranded regions 62 of the unbound aptamers 76. For example, enzymes 81 such as dsDNase selectively cleave double-stranded regions of oligomers. In the illustrated example,dsDNase is utilized as the enzyme 81 to cleave the double-stranded region 62 of the unbound aptamer 76, thereby generating a fragmented unbound aptamer 84. In certain embodiments, the double-stranded region 62 may include a conserved sequence. Accordingly, cleavage of the double-stranded region 62 may permit downstream sequencing to facilitate differentiation between the aptamers 54 that formed the analyte-aptamer complex 74 and the unbound aptamers 76 (e.g., fragmented unbound aptamer 84).

[0060] FIG. 4 is a schematic illustration of example aptamer 54 arrangements that may be used in conjunction with FIGS. 2 and 3, as disclosed herein. The illustrated example shows different arrangements of conserved and / or variable regions that may be present within the aptamer 54 sequence. The structure of the aptamer 54 may include the binding group 56, the double-stranded region 62 (e.g., first complementary region 100, second complementary region 102), and the loop region 58. Certain illustrated sequence regions such as the nonbinding region 53 and the analyte-binding region 60 may be present in one or both of the double-stranded region 62 and the loop region 58. That is, while the analyte-binding region 60 is illustrated as being within the loop region 58, in certain embodiments, the analyte-binding region 60 may be partially within the double-stranded region 62. The loop region 58 may include certain conserved primer or adapter sequences. In one embodiment, the loop region includes an aptamer identification sequence 108 that is distinct from but uniquely identifying for the aptamer sequence.

[0061] In general, an individual aptamer 54 is specific to an individual analyte 72 (as illustrated in FIG. 3) via the analyte-binding region 60. Put differently, the analyte-binding region 60 exhibits high affinity for a specific analyte 72 in a sample. An individual aptamer 54 may associate (e.g., bind) to a respective different analyte 72 via the analyte-binding region 60 to form the analyte-aptamer complex 74. Thus, an analyte-binding region 60 of one aptamer 54 may have different nucleotide sequences relative to another analyte-binding region 60 of another aptamer 54. It should be understood that an aptamer-based assay may include one or more different aptamers (e.g., with respective different analyte-binding regions 60), and the illustrated two aptamers of FIG. 2 are by way of example. An aptamer-based assay mayinclude at least 10 different aptamers, at least 50 different aptamers, at least 100 different aptamers, at least 1000 different aptamers, at least 5000 different aptamers, at least 100,000 different aptamers, or at least 1,000,000 different aptamers, in embodiments.

[0062] In the illustrated example, the loop region 58 may include the analyte-binding region 60, universal primer 1 region 104, aptamer identification (ID) 108, and the universal primer 2 region 106. In certain embodiments, the number of bases within the loop region 58 may be adjusted for structural considerations of formation of a hairpin loop. For example, the formation of the hairpin loop of FIGS. 2 and 3 may be facilitated via formation of the doublestranded region 62 due to hybridization between first complementary region 100 and second complementary region 102. In other embodiments, the sequences of the first complementary region 100 and the second complementary region 102 may be conserved throughout the aptamers 54 of an aptamer-based assay. In this way, the formation of the double- stranded region 62 may be facilitated using a single first complementary region 100 that hybridizes to a single second complementary region 102 to form the double-stranded region 62. Accordingly, the double-stranded region 62 may include one or more conserved sequences (eg., primer sequences) and / or sequencing adaptors. In certain embodiments, the first complementary region 100 may be part of the analyte-binding region 60 sequence, which may be unique to an individual aptamer 54. In a generally similar regard, the second complementary region 102 may be complementary to the first complementary region 100 that may be part of the analyte-binding region 60 and as such, the second complementary region 102 may be unique to an individual aptamer 54.

[0063] The aptamer 54 may range in length from about 10 bases to about 120 bases, such as about 75 bases, such as about 50 bases, or such as about 25 bases. In general, the length of the hairpin loop may be selected to permit formation of the double-stranded region and subsequent analyte binding / linearization. In certain embodiments, the double-stranded region is designed to have a target melting temperature that is compatible with steps of the workflow. Furthermore, it should be noted that the hairpin loop may retain its double- stranded region (i.e., be stable) at low temperatures. For example, the double-stranded region may be stable attemperatures less than 45°C. The double-stranded region may exhibit a melting temperature (Tm) ranging from about 45°C to about 60°C. The melting temperature may be related to the nucleotide composition and a length of the double-stranded region 62. Thus, the nucleotide composition and length may be tuned to achieve a desired melting temperature that is disrupted by analyte binding and that is consistent with the workflow conditions, e.g., stable prior to analyte contact.

[0064] The non-binding region 53 of the aptamers 54 does not bind to the analytes 72 and / or does not significantly impact binding affinity of the analyte-binding region 60, and as such, the sequence of the non-binding region 53 may be selected to avoid interaction with the analytes 72. In certain embodiments, the non-binding region 53 may include sequences used as a proxy for detection of the aptamers 54 binding to a respective analyte 72. Accordingly, the non-binding region 63 may include a bar code or identification sequence (e g., aptamer ID 108) to detect an analyte-aptamer interaction. However, it should be understood that the identification sequence 108 may be omitted and / or the primer or adapter sequences may be omitted in certain embodiments. Each aptamer ID 108 is selected to be uniquely associated with an individual aptamer 54. Thus, different aptamers 54 are associated with respective different aptamer ID 108 sequences that are all different from one another and are uniquely identifying. In an embodiment, uniquely identifying sequences are uniquely identifying while accounting for barcode errors (e.g., a 1-2 nucleotide sequence error) during sequencing. Further, the aptamer ID 108 sequence may be designed such that the identification sequence is different from the aptamer 54 sequence. In an embodiment, the identification sequence may be 10-50 bases in length.

[0065] To facilitate detection, the non-binding region 53 may also include the universal primer 1 104 and universal primer 2 106. Universal primer 1 region 104 and universal primer 2 region 106 region, where present, may be conserved throughout the aptamers 54. In this way, the amplification may be used as preparation of a sequencing library for sequencing using a single universal primer that binds to the universal primer 1 region 104 and a single universal primer than binds to the universal primer 2 region 106, respectively.

[0066] It should be noted that the relative arrangement of the binding group 56 and second complementary region 102 can be exchanged, such that the binding group 56 may be 5’ or 3’ relative to the second complementary region 102. Furthermore, it should be noted that while the surface 51 of FIG. 3 is not illustrated, formation of the analyte-aptamer complex 74 and unbound aptamer 76 may occur such that one end (e.g., a portion of the aptamer 54 is immobilized to the surface 51, thereby rendering the aptamer 54 immobilized. Accordingly, detection of the analyte-aptamer complex 74 and / or fragmented unbound aptamer 84 may begin with the addition of primers that are complementary to the universal primer 1 region 104 and universal primer 2 region 106 to generate an amplification product.

[0067] In the illustrated example, the aptamer 54 includes the universal primer 1 region 104 and universal primer 2 region 106 that flank the aptamer ID 108 such that amplification of the universal primer 1 region 104 and universal primer 2 region 106 regions using primers 110 generates an amplification product 112. In certain embodiments, the first complementary region 100 may be part of the analyte-binding region 60 and / or adjacent to the analyte-binding regions 60, while second complementary region 102 may be part of the universal primer 2 region 106 and / or adjacent to the universal primer 2 region 106. Accordingly, in certain embodiments, the primers 110 may be complementary to portions of the double-stranded region 62 that include a conserved sequence. It should be noted that the depicted arrangement permits analyte detection without sequencing of the analyte-binding region 60 if desired.

[0068] FIG. 5 is a method 150 for analyte detection using aptamers 54 and reporter probes, as disclosed herein. The method 150 may be performed in the order disclosed herein, in any suitable order, or may include additional steps. For example, certain blocks of the method 150 may be performed concurrently or consecutively. In addition, in certain embodiments, at least one of the blocks of the method 150 may be omitted. It should be noted that affinity -binder and aptamers may be used interchangeably.

[0069] At block 152 of the method 150, aptamers are provided immobilized to a surface and partially double-stranded via hybridization to a reporter probe (aptamer-probe complex), wherein a portion of the reporter probe is complementary to a portion of the aptamer to formthe double-stranded region. It should be noted that one end (e.g., a first end) of the aptamers may be functionalized with a binding group (e.g., biotin tag) such that the aptamer is immobilized to the surface.

[0070] In one example, a portion of the reporter probe may be complementary to a portion of the analyte-binding region of the aptamer. In another example, a reporter probe may be complementary to the non-binding region of the aptamer to form the double-stranded region. In some embodiments, the reporter probe may include contiguous sequences that are complementary to a portion of the analyte-binding region of the aptamer. Accordingly, the reporter probe may be modified to include regions complementary to the analyte-binding regions and / or non-binding regions of aptamers. Additionally and / or alternatively, the reporter probes may include non-binding regions, such as conserved sequences that may include a primer region, a sequencing adapter, and / or identification sequences to facilitate downstream sequencing for analyte detection.

[0071] At block 154 of the method 150, the aptamers are contacted with analytes to disrupt the double-stranded regions in a first portion of the aptamers by formation of analyte-aptamer complexes and retain double-stranded regionin a second portion of the aptamers. In general, binding of an individual analyte may destabilize the double-stranded region of the aptamerprobe complex (or aptamer) as the binding strength of the analyte to the aptamer may be stronger than the hybridization strength of the double-stranded region. Additionally and / or alternatively, protective effects such as steric hindrance associated with binding of an analyte to an aptamer may be leveraged to distinguish analyte-aptamer complexes from unbound aptamers. For example, binding of the analyte to the aptamer may sterically hinder enzyme cleave when the analyte is present.

[0072] At block 156 of the method 150, the analytes are detected based on the sequence of the analyte-aptamer complexes. After cleavage and removal of the fragmented unbound aptamers, the analyte-aptamer complexes may be treated and processed for downstream sequencing. For example, analytes may be removed prior to subsequent detection steps. For example, addition of enzymes (e.g., protease, proteinase K) may be used to facilitate degradation of the analytessuch as proteins. In other embodiments, heat, chemical degradation, or may be used for the degradation of the analytes. In some embodiments, the aptamer may be cleaved from the analyte via chemical or enzymatic means. However, in certain embodiments, no protein treatment or removal is performed, and downstream detection steps may occur with the analyte complexed with its respective aptamer. The aptamer may be amplified and / or sequenced to identify analytes present in the sample.

[0073] In certain embodiments, analytes are detected based on a readout associated with the displaced reporter probes and / or remaining unbound aptamers (aptamer-probe complexes) that include the partially double-stranded regions. For example, the displaced reporter probes (after analyte binding) of the aptamer-probe complex may be collected, amplified, and sequenced to identify the respective aptamer that bound to a respective analyte. That is, the detection may be based on probes displaced into solution that can be collected / sequenced. Additionally and / or alternatively, unbound aptamers will retain their respective double-stranded regions as a respective analyte was not present within a sample to disrupt the double-stranded region. The double-stranded regions of the unbound aptamers may be cleaved via targeted doublestranded fragmentation using enzymes (e g., dsDNase) and generate fragmented unbound aptamers. The fragmented unbound aptamers may be washed and removed such that only the analyte-aptamer complexes remain. In other embodiments, the fragmented unbound aptamers may be collected via supernatant, amplified, and sequenced to distinguish the fragmented unbound aptamers from the sequences associated with the analyte-aptamer complexes.

[0074] In certain cases, the use of dummy or nondetectable reporter probes mixed in with detectable reporters may be used to achieve dynamic range compression between highly abundant analytes and less abundant analytes. For example, the dummy reporter probes may be capable of binding the aptamer but may lack one or more universal sequences that permit amplification. Thus, the presence of these dummy reporters can act to dilute the detectable signal from certain analytes. Dynamic range compression may be as generally discussed in US Patent Application No. 20240287583, which is incorporated by reference herein in its entirety.

[0075] By way of example, FIG. 6 is an example analyte detection workflow 200 using aptamers 54 and the reporter probes of FIG. 5, as disclosed herein.

[0076] At step 202, aptamers 54 may be provided immobilized to a surface 51 (e.g., solid surface, support, capture bead, well, flow cell) as discussed herein. The aptamers 54 form partially double-stranded complexes with reporter probes 204. In certain embodiments, an exemplary reporter probe 204 may include a non-binding region 206 and a complementary region 208. The non-binding region 206 may include conserved sequences such as priming regions and / or sequencing adapters that are conserved between different reporter probes 204. The complementary region 208 may include sequences that are complementary to a portion of the aptamer 54, such as a portion of the analyte-binding 60, to facilitate formation of the double-stranded region 62. Accordingly, in certain embodiments, an individual reporter probe 204 for an individual aptamer 54 has a unique complementary region 208 relative to other reporter probe 204. Accordingly, the binding of the reporter probe 204 to the aptamer 54 generates an aptamer-probe complex 210.

[0077] At step 212, a sample may be provided wherein the sample may include analytes 72. The analyte 72 may bind to analyte-binding region 60 of the aptamer 54 and disrupt the doublestranded region 62, which displaces the reporter probe 204 (e.g., displaced reporter probe 214) to generate an analyte-aptamer complex 74. In certain embodiments, aptamer-probe complexes 210 (e.g., unbound aptamers 76) may remain complexed (i.e., retain the doublestranded region 62). Accordingly, in some embodiments, the displaced reporter probe 214 may be sequenced to identify the respective analytes 72. In other embodiments, the remaining aptamer-probe complexes 210 may be amplified and sequenced and / or the double-stranded region of the aptamer-probe complexes may be cleaved for downstream sequencing.

[0078] With the preceding in mind, FIG. 7 is a schematic illustration of example aptamer 54 arrangements and example reporter probe 204 arrangements including identification sequences and primers of FIGS. 5 and 6, as disclosed herein. In the illustrated diagram, the aptamer-probe complex 210 is prepared for amplification and sequencing. However, it should be noted that in some embodiments the displaced reporter probe 214 and / or cleaved aptamer-probe complex may be amplified and sequenced to facilitate analyte detection. The illustrated example shows different arrangements of conserved and / or variable regions that may be present within the aptamer 54 and / or reporter probe 204 to facilitate formation of a contiguous amplification template (amplification product 112).

[0079] In general, the aptamer 54 may include the binding group 56 and the analyte-binding region 60. The reporter probe 204 includes complementary region 240 and a non-binding region 206 (e.g., universal primer 1 region 104, aptamer ID 108, and universal primer 2 region 106). The complementary region 240 hybridizes to a portion of the analyte-binding region 60 to generate the aptamer-probe complex 210. In the illustrated example, the complementary region 240 is unique to each individual aptamer 54. It should be understood that the relative arrangement of the aptamer 54 and the reporter probe 204 can be exchanged, such that the aptamer 54 may be 5’ or 3’ of the reporter probe 204. In certain embodiments, dummy reporter probes 204 may be provided for high abundance analytes that share the complementary region 240 but that are not detectable, e.g., lack the universal primer region 1 104 and universal primer region 2106. In the illustrated example, the reporter probe includes the universal primer 1 region 104 and universal primer 2 region 106 that flank the aptamer ID 108 such that amplification of the universal primer 1 region 104 and universal primer 2 region 106 regions using primers 110 generates an amplification product 112. Universal primer 1 region 104 and universal primer 2 region 106 region are conserved throughout the reporter probes 204. In this way, the amplification may be used as preparation of a sequencing library for sequencing using a single universal primer that binds to the universal primer 1 region 104 and a single universal primer than binds to the universal primer 2 region 106, respectively. It should be noted that this technique does not sequence the analyte-binding region 60.

[0080] FIG. 8 is an example analyte detection workflow 250 using aptamers 54 and reporter probe 204, as disclosed herein. At step 252, aptamers 54 may be provided immobilized to a surface 51. In the illustrated diagram, the aptamers 54 may include an analyte-binding region 60, non-binding region 53, double-stranded region 62, a second free end 64, and a complementary region 256 that may be part of the double-stranded region 62. In certainembodiments, the double-stranded region 62 may include one or more conserved sequences (e.g., primer sequences) and / or sequencing adaptors. In other embodiments, the sequences of the complementary region 256 may be conserved throughout the aptamers 54.

[0081] In the illustrated diagram, a reporter probe 204 is bound to the complementary region 256 to generate an aptamer-probe complex 210. The reporter probe 204 may include a nonbinding region 206 and a complementary region 258. The complementary region 258 may include sequences that are complementary to portions of the aptamer 54, such as the complementary region 256 of the aptamer 54, to permit the formation of the double-stranded region 62. In the illustrated diagram, the reporter probe 204 binds to the complementary region 256, which is adjacent to the analyte-binding region 60. Accordingly, in certain embodiments, the sequences of the complementary region 258 may be conserved throughout the reporter probes 204. In certain embodiments, it should be noted that the reporter probe 204 may prehybridized to the aptamers 54 prior to contacting the surface.

[0082] At step 254, a sample may be provided wherein the sample may include analytes 72. The analyte 72 may bind to analyte-binding region 60 of the aptamer 54 and disrupt the doublestranded region 62, which displaces the reporter probe 204 (e.g., displaced reporter probe 214) to generate an analyte-aptamer complex 74. In certain embodiments, a portion of aptamerprobe complexes 210 (e.g., unbound aptamers 76) may remain complexed (i.e., retain the double-stranded region 62). Identification of the analytes 72 may occur via one or more ways. For example, the displaced reporter probe 214 may be sequenced to identify the respective aptamers 54 that bound to respective analytes 72. In other embodiments, the double-stranded region of the aptamer-probe complexes 210 may be cleaved via enzyme 81 for downstream sequencing. For example, the enzyme 81 (e.g., dsDNase) cleaves the double-stranded region 62 of the aptamer-probe complex 210, thereby generating a fragmented unbound aptamer. In certain embodiments, the cleaved double-stranded region 62 may include a conserved sequence. Accordingly, cleavage of the double-stranded region 62 may permit downstream sequencing to facilitate differentiation between the aptamers 54 that formed the analyteaptamer complex 74 and the aptamer-probe complex 210 (e.g., unbound aptamer 76).

[0083] FIG. 9 is a schematic illustration of example aptamer 54 arrangements including identification sequences and primers and example reporter probe 204 arrangements of FIG. 8, as disclosed herein. In general, the aptamer 54 may include the binding group 56, the complementary region 256, the non-binding region 53 (e.g., universal primer 1 region 104, aptamer ID 108, universal primer 2 region 106), and the analyte-binding region 60. The complementary region 256 may sequences complementary to the complementary region 258 of the reporter probe. In some embodiments, the complementary region 257 may include universal sequences (e.g., primer sequences) and / or sequencing adapters that may be conserved throughout the aptamers 54. Additionally and / or alternatively, the complementary region 256 may be adjacent to the non-binding region 53 and / or be part of the sequence associated with the non-binding region 53.

[0084] The reporter probe 204 may include the complementary region 258 and the nonbinding region 206. The complementary region 258 may include sequences that are complementary to the complementary region 256 to facilitate the formation of a doublestranded region 62. In certain embodiments, the complementary region 258 may include conserved sequences and / or sequencing adapters. Additionally and / or alternatively, the complementary region 258 may be part of the non-binding region 206. The non-binding region 206 of the reporter probe 204 does not bind to the analytes 72 and / or does not significantly impact binding affinity of the analyte-binding region 60, and as such, the sequence of the nonbinding region 206 may be selected to avoid interaction with the analytes 72. It should be understood that the relative arrangement of the aptamer 54 and the reporter probe 204 can be exchanged, such that the aptamer 54 may be 5’ or 3’ of the reporter probe 204.

[0085] FIG. 10 an example analyte detection workflow 300 using the aptamers 54 and the reporter probes 204 of FIG. 5, as disclosed herein. At step 302, aptamers 54 may be provided immobilized to a surface 51. In certain embodiments, a reporter probe 204 may include a complementary region 208 that includes sequences that are complementary to a portion of the analyte-binding region 60 of the aptamer 54. Accordingly, the reporter probe 204 may bind to the analyte-binding region 60 of the aptamer to form the double-stranded region 62 (analyte-probe complex 210). In particular, the reporter probe 204 may bind to sequences of the analytebinding region 60 such that the double-stranded region 62 is centrally located in the aptamer 54.

[0086] At step 304, a sample may be provided wherein the sample may include analytes 72. The analyte 72 may bind to analyte-binding region 60 of the aptamer 54 and disrupt the doublestranded region 62, which displaces the reporter probe 204 (e.g., displaced reporter probe 214) to generate an analyte-aptamer complex 74. In certain embodiments, a portion of the aptamerprobe complexes 210 (e.g., unbound aptamers 76) may remain complexed (i.e., retain the double-stranded region 62). The remaining unbound complexes may be removed via cleavage of the double-stranded region 62 using enzyme 81 (e.g., dsDNase). In certain embodiments, the cleaved unbound complex may be collected via supernatant and sequenced to differentiate aptamers 54 associated with the aptamer-probe complexes 210 and the fragmented unbound complexes.

[0087] By way of example, FIG. 11 is a schematic illustration of example aptamer 54 arrangements including identification sequences and primers and example reporter probe 204 arrangements of FIG. 10. In the illustrated diagram, the aptamer 54 includes the binding group 56, analyte-binding regions 60, and a non-binding region 53 (e.g, universal primer 1 region 104, aptamer ID 108, universal primer 2 region 106). The reporter probe 204 includes a complementary region 208 that is complementary to a portion of the analyte-binding region 60, which permits the formation of a double-stranded region 62 as demonstrated in FIG. 10. Accordingly, each individual reporter probe 204 is specific for an individual aptamer 54 that has a unique sequence relative to other reporter probes 204.

[0088] FIG. 12 is a method for analyte detection using aptamers, as disclosed herein. The method 350 may be performed in the order disclosed herein, in any suitable order, or may include additional steps. For example, certain blocks of the method 350 may be performed concurrently or consecutively. In addition, in certain embodiments, at least one of the blocks of the method 350 may be omitted. It should be noted that affinity-binder and aptamers may be used interchangeably.

[0089] At block 352 of the method 350, aptamers are provided immobilized to a surface. One end of the aptamer (e.g., a first end) may be functionalized with a binding group (e.g., biotin tag) such that the aptamer is immobilized to the surface with biotin. For example, the surface may include biotin binding proteins to facilitate immobilization of the aptamer. The aptamers may include an analyte-binding region, a non-binding region, and reporter sequences. One or more reporter sequences may be flanked with sequences associated with the analyte-binding region. Put differently, the reporter sequences may generally reside within the analyte-binding region of the aptamer. In particular, the reporter sequences may reside within specific sites / regions of the analyte-binding region of the aptamer to direct cleavage via an enzyme. Accordingly, the reporter sequences may include sequences that are specific to a type of enzyme associated with cleavage. Exemplary enzymes include, but are not limited to, endonucleases, uracil-N-glycosylase (UNG), 8-oxoguanine DNA glycosylase (8-oxo-G), and the like.

[0090] At block 354, the aptamers are contacted with analytes to form analyte-aptamer complexes. When an individual analyte binds to the analyte-binding region of the aptamer, the analyte may obstruct and / or block the regions in which the reporter sequences reside. A portion of the aptamers may remain as unbound aptamers, wherein the reporter sequences of the unbound aptamers are not obstructed.

[0091] At block 356, the surface is contacted with enzymes, wherein the enzymes cleave the one or more reporter sequence of the unbound aptamers. That is, the reporter sequences of the unbound aptamers are accessible to the enzymes to permit cleavage. In contrast, the reporter sequences of the analyte-aptamer complexes are obstructed due to the presence of the analyte, which inhibits cleavage at the reporter sequence sites.

[0092] At block 358, the analytes are detected based on the sequences of the retained reporter sequences of the analyte-aptamer complexes. After cleavage and removal of the fragmented unbound aptamers, the analyte-aptamer complexes may be treated and processed for downstream sequencing. For example, analytes may be removed prior to subsequent detection steps. For example, addition of enzymes (e.g., protease, proteinase K) may be used to facilitatedegradation of the analytes such as proteins. In other embodiments, heat, chemical degradation, or may be used for the degradation of the analytes. In some embodiments, the aptamer may be cleaved from the analyte via chemical or enzymatic means. However, in certain embodiments, no protein treatment or removal is performed, and downstream detection steps may occur with the analyte complexed with its respective aptamer. The aptamer may be amplified and / or sequenced to identify analytes present in the sample. In other embodiments, the unbound aptamers may be cleaved such that the fragmented unbound aptamers retain the non-binding region. The unbound aptamers may be collected via supernatant, amplified, and sequenced to differentiate the bound aptamers and the unbound aptamers.

[0093] With the preceding in mind, FIG. 13 is an example analyte detection workflow using the aptamers FIG. 12, as disclosed herein. At step 402, aptamers 54 may be provided immobilized to a surface 51. The aptamers 54 may include an analyte-binding region 60, double-stranded region 62, non-binding region 53, a second free end 64, and reporter sequences 406. The non-binding region 53 may reside at the second free end 64 of the aptamer 54. In the illustrated example, the sites associated with the reporter sequences 406 reside within the analyte-binding region 60.

[0094] At step 404, a sample may be provided wherein the sample may include analytes 72. A respective analyte 72 may bind to a respective analyte-binding region 60 of an individual aptamer 54 to form analyte-aptamer complex 74. In certain embodiments, a portion of the aptamers 54 may not bind to an analyte 72 and thus will remain as unbound aptamers 76. The unbound aptamers 76 may be cleaved via enzymes 81 associated with their respective reporter sequences 406 while analyte-aptamer complexes 74 will not be cleaved as the presence of the analyte 72 imparts steric hindrance and inhibits cleavage. Accordingly, the fragmented unbound aptamers may be washed away such that the analyte-aptamer complexes 74 may be processed for sequencing. In other embodiments, the fragmented unbound aptamers may be amplified and sequenced via the non-binding region 53 to differentiate the unbound aptamers 76 from the immobilized analyte-aptamer complexes 74.

[0095] By way of example, FIG. 14 is a schematic illustration of example aptamer 54 arrangements including identification sequences, reporter sequences, and primers of FIGS. 12 and 13, as disclosed herein. The aptamer 54 includes the binding group 56, analyte-binding regions 60, and a non-binding region 53 (e.g., universal primer 1 region 104, aptamer ID 108, universal primer 2 region 106), and reporter sequences 406. In the illustrated diagram, the reporter sequences 406 are flanked by sequences associated with analyte-binding region 60. It should be noted that the aptamer 54 may include one or more, two or more, or three or more regions associated with the reporter sequence 406. Furthermore, it should be understood that the relative arrangement of the aptamer 54 can be exchanged, such that the non-binding region 53 may be 5’ or 3’ of the binding group 56.

[0096] FIG. 15 is a method 450 for analyte detection using aptamers 54 and reporter probes, as disclosed herein. The method 450 may be performed in the order disclosed herein, in any suitable order, or may include additional steps. For example, certain blocks of the method 450 may be performed concurrently or consecutively. In addition, in certain embodiments, at least one of the blocks of the method 450 may be omitted. It should be noted that affinity-binder and aptamers may be used interchangeably.

[0097] At block 452 of the method 450, aptamers are provided immobilized to a surface wherein an individual aptamer is partially double-stranded via hybridization to a primer strand. It should be noted that one end (e.g., a first end) of the aptamers may be functionalized with a binding group (e.g., biotin tag) such that the aptamer is immobilized to the surface. The primer strand may be complementary to a portion of the aptamer, such as the non-binding region of the aptamer and may be positioned near the free end of the aptamer. In certain embodiments, the primer strand may be pre-hybridized to the aptamers prior to contacting the surface.

[0098] At block 454 of the method 450, the aptamers are contacted with analyte-aptamer complexes, wherein a first portion of the aptamers bind to the analytes to form the analyteaptamer complexes, and a second portion of the aptamers remain unbound as unbound aptamers.

[0099] At block 456 of the method 450, the primer strand is extended, wherein the first portion of the aptamers remains partially double-stranded and the second portion of the aptamers are fully double stranded. For example, binding of an individual analyte to an individual aptamer may physically block primer extension due to steric hindrance. In this way, only unbound aptamers will be extended from the primer strand to form double-stranded unbound complexes. It should be noted that the double-stranded unbound complexes may include a conserved restriction site that is susceptible to cleavage.

[0100] At block 458 of the method 450, the analytes are detected based on the sequences of the cleaved first portion and the cleaved second portion. In certain embodiments, the conserved restriction site of the double-stranded unbound complexes may be targeted for double-stranded fragmentation via enzymes such as dsDNase. After cleavage and removal of the fragmented unbound aptamers, the analyte-aptamer complexes may be treated and processed for downstream sequencing. For example, analytes may be removed prior to subsequent detection steps. For example, addition of enzymes (e.g., protease, proteinase K) may be used to facilitate degradation of the analytes such as proteins. In other embodiments, heat, chemical degradation, or may be used for the degradation of the analytes. In some embodiments, the aptamer may be cleaved from the analyte via chemical or enzymatic means. However, in certain embodiments, no protein treatment or removal is performed, and downstream detection steps may occur with the analyte complexed with its respective aptamer. The aptamer may be amplified and / or sequenced to identify analytes present in the sample. In other embodiments, the fragmented double-stranded aptamers may be collected via supernatant, amplified, and sequenced to distinguish between the unbound aptamers and the aptamers that bound to a respective analyte.

[0101] By way of example, FIG. 16 is an example analyte detection workflow 500 using the aptamers and the primers strands of FIG. 15. It should be noted the workflow 500 may be performed in the order disclosed herein, in any suitable order, or may include additional steps. For example, certain blocks of the workflow 500 may be performed concurrently orconsecutively. In addition, in certain embodiments, at least one of the steps of the workflow 500 may be omitted.

[0102] At step 502, aptamers 54 may be provided immobilized to a surface 51 (e.g., solid surface, support, capture bead, well, flow cell), wherein one end of the aptamers 54 may be modified with a binding group 56 such that the aptamers 54 may be immobilized to the surface 51 via the binding group 56. The aptamers 54 may include an analyte-binding region 60, double-stranded region 62, non-binding region 53, and a second free end 64. The non-binding region 53 may reside at the second free end 64 of the aptamer 54. In the illustrated example, the aptamer 54 is partially double-stranded due to hybridization of a primer strand 506 to the aptamer 54 at the non-binding region 53 of the aptamer. Accordingly, the primer strand 506 may include conserved sequences that are complementary to the non-binding region 53 to permit formation of the double-stranded region 62.

[0103] At step 504, a sample may be provided wherein the sample may include analytes 72. A respective analyte 72 may bind to a respective analyte-binding region 60 of an individual aptamer 54 to form analyte-aptamer complex 74. In certain embodiments, a portion of the aptamers 54 may not bind to an analyte 72 and thus will remain as unbound aptamers 76. Subsequently, enzymes may be provided to the analyte-aptamer complexes 74 and unbound aptamers 76 to permit extension of the primer strand 506. In the illustrated diagram, binding of an individual analyte 72 to an individual aptamer 54 blocks primer extension due to steric hindrance associated with the analyte 72. Thus, only unbound aptamers 76 will be extended from the primer strand 506 to form double-stranded unbound complexes. The double-stranded unbound complexes may be targeted for double-stranded fragmentation using enzymes such as dsDNase. After cleavage and removal of the fragmented unbound aptamers, the analyteaptamer complexes may be treated and processed for downstream sequencing.

[0104] With the foregoing in mind, FIG. 17 is a schematic illustration of example aptamer arrangements including identification sequences and primers and example primer strands of FIGS. 15 and 16. The aptamer 54 includes the binding group 56, analyte-binding regions 60, and a non-binding region 53 (e.g., universal primer 1 region 104, aptamer ID 108, universalprimer 2 region 106). In the illustrated diagram, the primer strand 506 may bind to the nonbinding region 53 to create the double-stranded region 62 as demonstrated in FIG. 16. It should be understood that the relative arrangement of the aptamer 54 can be exchanged, such that the non-binding region 53 may be 5’ or 3’ of the binding group 56.

[0105] FIG. 18 is a method for analyte detection using split aptamers, as disclosed herein. The method 550 may be performed in the order disclosed herein, in any suitable order, or may include additional steps. For example, certain blocks of the method 550 may be performed concurrently or consecutively. In addition, in certain embodiments, at least one of the blocks of the method 550 may be omitted. It should be noted that affinity-binder and aptamers may be used interchangeably.

[0106] At block 552 of the method 550, analytes are contacted with first aptamers and second aptamers to form analyte-first aptamer-second aptamer complexes. For example, each aptamer (e.g., first aptamer, second aptamer) may include a portion of the analyte-binding region such that both aptamers may bind to the same individual analyte. Put differently, an aptamer sequence may be split (e.g., split aptamer) to create the two aptamers (e.g., first aptamer and the second aptamer) such that each split aptamer include a portion of the analytebinding region and a non-binding region. In this way, an individual first aptamer and an individual second aptamer may include sequences (e.g., analyte-binding region) that are specific to an individual analyte to permit binding of both aptamers to an individual analyte.

[0107] At block 554, an end of the first aptamer is coupled to an end of the second aptamer to form an aptamer oligonucleotide. For example, when an individual analyte is complexed with a first aptamer, the analyte-binding region of the first aptamer may be positioned in sufficient proximity to the analyte-binding regions of the second aptamer to permit ligation to generate a ligated aptamer oligonucleotide (e g., ligated aptamer, aptamer). Ligation may be performed using enzymatic ligation or chemical ligation (e.g., cross-linking, click chemistry (e.g., (e.g., strained ring opening molecules)). Techniques for click chemistry as disclosed in US20210381040A1, hereby incorporated by reference in its entirety, may be used as ligation techniques (e.g., chemical ligation) to ligate the first aptamer and the second aptamer herein.

[0108] At block 556, the analytes are detected based on the sequences of the ligated aptamer oligonucleotide. After ligation, the ligated aptamer oligonucleotide is formed in which the ligated aptamer oligonucleotide is bound to the analyte. The ligated aptamer oligonucleotide may be amplified and / or sequenced to identify analytes present in the sample. For example, analytes may be removed prior to subsequent detection steps. For example, addition of enzymes (e.g., protease, proteinase K) may be used to facilitate degradation of the analytes such as proteins. In other embodiments, heat, chemical degradation, or may be used for the degradation of the analytes. In some embodiments, the aptamer may be cleaved from the analyte via chemical or enzymatic means. However, in certain embodiments, no protein treatment or removal is performed, and downstream detection steps may occur with the analyte complexed with its respective aptamer. It should be noted that a split aptamer half with no corresponding analytes present in the sample will not be brought into close proximity for ligation to its respective aptamer half. In some embodiments, enzymes (e.g., exonuclease) may be provided to digest remaining split aptamers that are unbound. Accordingly, any aptamer identification sequence associated with unbound aptamers will not be amplified and will not be present in any sequencing results from downstream detection steps.

[0109] With the preceding in mind, FIG. 19 is an example analyte detection workflow using the split aptamers of FIG. 18, as disclosed herein. At step 602, an aptamer 54 is split into two aptamers 54 (e g., split aptamers), a first aptamer 608 and a second aptamer 610. In the illustrated diagram, each split aptamer includes an analyte-binding region 60 and a nonbinding region 53. At step 604, a sample may be provided wherein the sample may include analytes 72. A respective analyte 72 may bind to a respective analyte-binding region 60 of the first aptamer 608 and a respective analyte-binding region 60 of the second aptamer 610 to form an analyte-first aptamer-second aptamer complex 74. While both first aptamer 608 and second aptamer 610 are bound to the analyte 72, the aptamers are discretized. In certain embodiments, a portion of the split aptamers may not have a respective analyte to bind to and may remain as unbound aptamers 76.

[0110] At step 606, when the individual analyte-binding regions 60 of the first aptamer 608 may be positioned in sufficient proximity to the analyte-binding regions 60 of the second aptamer 610 to facilitate ligation of the two aptamers to generate a ligated aptamer 54. Ligation may be performed using enzymatic ligation or chemical ligation (e.g., cross-linking, click chemistry (e.g., (e.g., strained ring opening molecules)). The aptamer 54 may remain bound to the analyte 72. Accordingly, the ligated aptamers 54 may be amplified and / or sequenced to identify analytes present in the sample. For example, PCR may be performed using primers that are specific to the non-binding region 53 of the split aptamers 54 (e g., ligated aptamers 54). Additionally, unbound aptamers 76 with no corresponding analytes will not be brought into proximity for ligation to its respective aptamer. As such, enzymes 81 (e.g., exonucleases) may be provided to digest remaining split aptamers that are unbound such that unbound aptamers will not be amplified and sequenced in downstream detection steps.

[0111] By way of example, FIG. 20 is a schematic illustration of example split aptamer 54 arrangements including identification sequences and primers of FIGS. 18 and 19. The illustrated example shows different arrangements of conserved and / or variable regions that may be present within the first aptamer 608 and the second aptamer 610 to generate the aptamer 54 sequence that forms a contiguous amplification template. In the illustrated diagram, first aptamer 608 includes a non-binding region 53 (e.g., universal primer 1 region 104, aptamer ID 108) and analyte-binding region 60 (e.g., analyte-binding region 1 60a). The second aptamer 610 includes a non-binding region 53 (e.g., universal primer 2 region 106, aptamer ID 108) and analyte-binding region 60 (e.g., analyte-binding region 260b). It should be noted that the sequences of each of the analyte-binding regions 60 (e.g., analyte-binding region 1 60a, analyte-binding region 2 60b) in each respective aptamer (e.g., aptamer 608, aptamer 610) are different relative to each other. Furthermore, it should be noted that the analyte-binding region 60 in each of the aptamer (e.g., first aptamer 608, second aptamer 610) correspond to a unique individual analyte 72. Accordingly, a pair of split aptamers may exhibit a binding affinity for an individual analyte 72.

[0112] The non-binding region 53 of the first aptamer 608 and second aptamer 610 does not bind to the analytes 72 and / or does not significantly impact binding affinity of the analytebinding region 60, and as such, the sequence of the non-binding region 53 may be selected to avoid interaction with the analytes 72. The non-binding region 53 may be used as a proxy for detection of the aptamers 54 binding to a respective analyte 72. Accordingly, the non-binding region 63 may include a bar code or identification sequence (e.g., aptamer ID 108) to detect an analyte-aptamer interaction. Each aptamer ID 108 is selected to be uniquely associated with an individual aptamer 54. Thus, different aptamers 54 are associated with respective different aptamer ID 108 sequences that are all different from one another and are uniquely identifying. In an embodiment, uniquely identifying sequences are uniquely identifying while accounting for barcode errors (e.g., a 1-2 nucleotide sequence error) during sequencing. Further, the aptamer ID 108 sequence may be designed such that the identification sequence is different from the aptamer 54 sequence. In an embodiment, the identification sequence may be 10-50 bases in length. In the illustrated example, the aptamer ID 108 in the first aptamer 608 and the second aptamer 610 may be identical to facilitate detection of both aptamers binding to an individual analyte.

[0113] Furthermore, the universal primer region 1 104 and universal primer 2 region 106 may be part of the non-binding region 53 of both the first aptamer 608 and second aptamer 610 for detection. For example, universal primer 1 region 104 and universal primer 2 region 106 region may be conserved throughout a pair of split aptamers 54. In this way, the amplification may be used as preparation of a sequencing library for sequencing using a single universal primer that binds to the universal primer 1 region 104 and a single universal primer than binds to the universal primer 2 region 106, respectively.

[0114] The first aptamer 608 and the second aptamer 610 may be ligated to generate the ligated aptamer 54. In particular, the aptamer 54 is forms a contiguous sequence for amplification and / or sequencing. It should be noted that the relative arrangement of the universal primer 1 region 104 and universal primer 2 region 106 can be exchanged, such that the universal primer 1 region 104 may be 5’ or 3’ relative to the universal primer 2 region 106.

[0115] FIG. 21 is an example analyte detection workflow 650 via formation of analyteaptamer sandwich complexes, as disclosed herein. It should be noted the workflow 650 may be performed in the order disclosed herein, in any suitable order, or may include additional steps. For example, certain blocks of the workflow 650 may be performed concurrently or consecutively. In addition, in certain embodiments, at least one of the steps of the workflow 650 may be omitted.

[0116] At step 652, a sample 660 including analytes 72 may be obtained. At step 654, aptamers 54 may be provided to the analytes 72 to form analyte-aptamer complex 74. The aptamers 54 may include a non-binding region 53, an analyte-binding region 60, and a binding group 56. In the illustrated diagram, analytes 72 may form the analyte-aptamer complexes 74 in solution (e.g., solution-phase). In certain embodiments, analyte-aptamer complex 74 may form upon a surface. For example, aptamers 54 may bind to a surface via the binding group 56 and remain immobilized. Subsequently, analytes 72 may be provided to the immobilized aptamers 54 to form immobilized analyte-aptamer complexes 74. It should be noted that the aptamer 54 may include sequences that are specific for an individual analyte 72 (e.g., analytebinding region 60), and thus, each aptamer 54 may include partially variable and conserved sequences (e.g., non-binding region 53).

[0117] At step 656, solution-phase analyte-aptamer complexes 74 may contact a surface 51 (e g., solid surface, support, capture bead, well, flow cell), wherein the analyte-aptamer complexes 74 may bind (e.g., linked) via the binding group 56 and remain immobilized. At step 658, second aptamers 662 may be provided to the immobilized analyte-aptamer complexes 74. The second aptamers 662 may include an analyte-binding regions 60 and detectable tags 665 (e.g., fluorescent tags or primers that can be used to amplify and sequence the solution phase aptamers for quantification). In certain embodiments, the analyte-binding regions 60 of an individual second aptamer 662 that is specific for an individual analyte 72 may include sequences that differ from the individual aptamer 54 that is specific towards the same individual analyte 72. That is, the second aptamer 662 may have binding affinity to a different region (e.g., epitope) of an individual analyte 72 and therefore, two different aptamersthat bind to a same analyte have different nucleotide sequences. In this way, the individual second aptamer 662 may bind to a different region (e.g., epitope) of the individual analyte 72 relative to the individual aptamer 54 already bound to the individual analyte 72. Accordingly, binding of the second aptamers 662 to the analyte-aptamer complexes 74 generates analyteaptamer sandwich complexes 664.

[0118] In certain embodiments, analytes 72 of the analyte-aptamer sandwich complexes 664 may be determined based on a readout of the aptamers (e.g., aptamers 54, second aptamer 662). For example, immobilized aptamers may be eluted from the surface 51 and amplified (e.g., PCR). The amplification may be part of a sequencing library preparation workflow that provides adapter ends for a suitable sequencing platform. In this way, the eluted aptamers 54 can be subsequently sequenced to generate sequencing data used to identify the analytes 72 present in the sample 660.

[0119] In certain embodiments, analytes 72 of the analyte-aptamer sandwich complexes 664 may be determined via a fluorescence readout. For example, the formation of the analyteaptamer sandwich complexes 664 may be quantified. Binding of the second aptamer 662 to an analyte-aptamer complex 74 enables identification and / or quantification of analytes via the detectable tags 665. For example, the detectable tags 665 of the second aptamers 662 may include fluorescent tags. When an individual second aptamer 662 binds to an individual analyte-aptamer complex 74 that is immobilized at a particular location on a flow cell, the particular location emits a fluorescent signal that is indicative of the second aptamer 662 binding to the individual analyte-aptamer complex 74. It should be noted that unbound second aptamers 662 may be washed away such that the output of fluorescent signal is indicative of the analyte-aptamer sandwich complexes 664 and not the unbound second aptamers 662. Accordingly, the fluorescent signal may be tracked on a flow cell to facilitate quantification and identification of analyte-aptamer sandwich complexes 664 via downstream steps (e.g., amplification, sequencing) to identify the analytes 72 present in the sample 660.

[0120] FIG. 22 is an example analyte detection workflow 700 using a fluorescence assay array, as disclosed herein. It should be noted that the workflow 700 may be performed usingdifferent types of surfaces 51. In the illustrated example, a solid support 714 (e.g., flow cell) may be utilized for an aptamer 54 assay, wherein the aptamer 54 may bind to the solid support 714 via a binding group 56. In another example, a capture-bead / well support 716 may be used, wherein a surface 51 may include wells 718 that contain a bead 720. In a generally similar regard, the aptamer 54 may bind to the bead 720 via the binding group 56. Accordingly, one or more of aptamer 54 may be bound to a bead 720.

[0121] In certain embodiments, a bead 720 or other each surface 51 (e.g., solid support 714) may be provided that is bound to a set or lawn of aptamers 54 that are identical to one another such that all aptamers 54 on an individual bead 720 have affinity for the same analyte 72. In this way, the identical aptamers 54 on one bead 720 can target the same analyte 72 within a sample. An aptamer-based assay with analyte quantification may provide at least one bead 720 / analyte 72, whereby each bead 720 has a sufficient aptamer density to bind multiple copies of the analyte 72. Binding-associated fluorescence intensity per bead 720 can be used to estimate analyte concentration, whereby more fluorescence signal at a particular bead 720 is indicative of higher analyte concentration relative to beads with lower or no fluorescence intensity. The illustrated embodiment provides a relatively fast and simple analyte quantification that can be combined with a flow-cell based sequencing workflow to achieve concentration and characterization information.

[0122] At step 702, aptamers 54 are provided and immobilized to a surface 51, wherein one end of the aptamers 54 may be functionalized with a binding group 56 (e.g., biotin tag) such that the aptamers 54 are immobilized onto the surface 51. The surface 51 may be functionalized with molecules such that the binding group 56 may bind to the surface. For example, the surface 51 may include biotin binding proteins such that the binding group 56 may bind to the biotin binding proteins to immobilize the aptamer 54. The location of the immobilized aptamers 54 may be spatially decoded to facilitate quantification of analyte abundance in downstream steps.

[0123] It should be noted that the aptamers 54 may include an analyte-binding region that exhibits a specificity for an individual analyte 72 and a non-binding region that may includepartially variable and conserved sequences (e.g., primer sequences, sequencing adapters, identification sequences).

[0124] At step 704, analytes 72 may contact the aptamers 54 to form immobilized analyteaptamer complex 74. The aptamers 54 bind to analytes 72 via the analyte-binding region of the aptamer. The surface 51 may be washed to remove unbound analytes 72. At step 706, the analytes 72 may be labeled by the addition of detectable tags 701. For example, the detectable tags 701 may include biotin groups. Biotinylation of the analytes 72 may occur by functionalizing one or more amino acid residues of an analyte 72 with detectable tags 701. The surface 51 may be washed to remove unbound detectable tags 701 (e.g., biotin tag 701).

[0125] At step 708, a streptavidin conjugated dye 703 is provided, wherein the streptavidin conjugated dye 703 may bind to the biotin groups. Because a pool of analytes 72 may include a complex mixture of different proteins (including some that are covered by the assay and, in certain cases, some proteins that are not assayed), the particular amino acid locations that the detectable tags 701 binds (and streptavidin conjugated dye via association to the biotin) to the analytes may be uncharacterized, e.g., non-specific or stochastic. Put differently, the streptavidin conjugate dye 703 is not specific to a particular analyte 72 and thus may be utilized for a complex mixture of analytes 72. Accordingly, sufficient coverage of the analytes 72 with attached biotin groups 701 will output a fluorescent signal that may be detected upon binding of the streptavidin conjugated dyes 703 to the detectable tag 701 for most or all of the analytes of interest.

[0126] At step 710, the fluorescent intensity of the streptavidin conjugated dyes 703 bound to a specific analyte-aptamer complex 74 may be utilized to quantify a concentration of an analyte 72 within a sample. In the illustrated diagram, a capture-bead / well support 716 may include various locations 724, wherein each location is representative of a single bead 720 within a well 718 that is associated with a location of an individual aptamer 54 (e.g., analyteaptamer complex 74), which has already been spatially decoded at step 702. A fluorescent signal will be detected at a particular location 724, wherein the intensity of the fluorescent signal is proportional to a concentration of analytes 72. Accordingly, absolute quantificationmay be performed by building a standard curve using the fluorescent intensities to determine concentration of an analyte 72 present within a sample.

[0127] In other embodiments, sequencers may be used for an array readout using a support e.g., flow cell 726). In the illustrated example, the flow cell 726 may include lanes 728, wherein an individual lane 728 may be representative for an amount or concentration of analyte 72.

[0128] The term “analyte-binding region” refers to an oligonucleotides (ssDNA or ssRNA) that will form a cognate target by binding to an analyte of interest. The “analyte-binding region” may include one or more portions that permit binding of the analyte-binding region to the analyte. For example, the one or more portions may include an aptamer region that will bind to the analyte of interest with high affinity. It should be noted that the analyte-binding region may include other sequences (e.g., identification sequences) to enable downstream sequencing and analysis.

[0129] As used herein, an aptamer may refer to a non-naturally occurring nucleic acid that has specific binding affinity for a target molecule. The binding of the aptamer to the target molecule can result in catalytically changing the target molecule, reacting with the target molecule in a way that modifies or alters the target molecule or the functional activity of the target molecule, covalently attaching to the target molecule (as in a suicide inhibitor), and facilitating the reaction between the target molecule and another molecule. In one embodiment, the target molecule is a three-dimensional chemical structure, other than a polynucleotide, that binds to the aptamer through a mechanism which is predominantly independent of Watson / Crick base pairing or triple helix binding. In an embodiment, the aptamer is not a nucleic acid having the known physiological function of being bound by the target molecule. The term “affinity binder” may refer to a molecule that may associate (e.g., bind) to a sample analyte. Exemplary analytes include proteins (e g., antibodies) or oligonucleotides (e.g., aptamers).

[0130] Aptamers include nucleic acids that are identified from a candidate mixture of nucleic acids. A specific binding affinity of an aptamer for its target may refer to aptamer binding to its target generally with a much higher degree of affinity than it binds to other, non-target, components in a mixture or sample. Different aptamers may have either the same number or a different number of nucleotides. Aptamers may be DNA, RNA, or modified aptamers and may be single stranded, double stranded, or contain double stranded regions. The aptamers discussed herein can be used in any diagnostic, imaging, high throughput screening or target validation techniques or procedures or assays for which aptamers, oligonucleotides, antibodies and ligands, without limitation can be used. Aptamers may be synthesized using DNA synthesis techniques and may include one or more modified bases.

[0131] As discussed herein, an aptamer may include certain regions that do not participate in analyte binding. For aptamers that may be relatively long, aptamer synthesis may include click chemistry steps as discussed herein.

[0132] In certain embodiments of the disclosure, the disclosed aptamers 54 and / or reporter probes 204 can include one or more conserved regions, such as a conserved primer region, e.g., a first conserved primer region and a second conserved primer region. A conserved region is conserved between at least some other aptamer of a set of aptamers 54 (or reporter probe of a set of reporter probes 204) such that the conserved region has an identical or similar nucleotide sequence as compared between the probes. For example, for a given reporter probe, all reporter probes 204 can have a same first conserved primer region. Furthermore, for a given aptamer, all aptamers 54 can have a same second conserved primer region. In this manner, primers based on the first conserved primer region and the second conserved primer region can be used to amplify any aptamer 54 and / or ligated aptamer 54.

[0133] One or more probes as discussed herein may include an identification sequence that can include one or more nucleotide sequences that can be used to identify one or more specific aptamers. The identification sequence can be an artificial sequence. The identification sequence can comprise at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more consecutive nucleotides. In some embodiments, the identification sequencecomprises at least about 10, 20, 30, 40, 50, 60, 7080, 90, 100 or more consecutive nucleotides. In some embodiments, at least a portion of the identification sequence in a probe is different.

[0134] One or more probes as discussed herein may include an affinity tag. Affinity tags can be useful for a variety of applications, for example the bulk separation of target nucleic acids hybridized to hybridization tags. As used herein, the term “affinity tag” or “tag sequence” and grammatical equivalents can refer to a component of a multi-component complex, wherein the components of the multi-component complex specifically interact with or bind to each other. For example an affinity tag can include biotin or poly-His that can bind streptavidin or nickel, respectively. Other examples of multiple-component affinity tag complexes are listed, for example, U.S. Patent Application Pub. No. 2012 / 0208705, U.S. Patent Application Pub. No.2012 / 0208724 and Int. Patent Application Pub. No. WO 2012 / 061832, each of which is incorporated by reference in its entirety.

[0135] The disclosed embodiments provide different primers and probes. Probes and / or primers of the disclosed embodiments are designed to be complementary to a target sequence (either the target sequence of the sample or to other probe sequences), such that hybridization of the target sequence and the probes of the present invention occurs. As outlined below, this complementarity need not be perfect; there may be any number of base pair mismatches which will interfere with hybridization between the target sequence and the single stranded nucleic acids of the present invention. However, if the number of mutations is so great that no hybridization can occur under even the least stringent of hybridization conditions, the sequence is not a complementary target sequence. Thus, by “substantially complementary” herein is meant that the probes are sufficiently complementary to the target sequences to hybridize under normal reaction conditions.

[0136] A variety of hybridization conditions may be used in the present invention, including high, moderate and low stringency conditions. Longer sequences hybridize specifically at higher temperatures. Generally, stringent conditions are selected to be about 5-10° C. lower than the thermal melting point (Tm) for the specific sequence at a defined ionic strength and pH. The Tm is the temperature (under defined ionic strength, pH and nucleic acidconcentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at Tm, 50% of the probes are occupied at equilibrium). Stringent conditions will be those in which the salt concentration is less than about 1.0 M sodium ion, typically about 0.01 to 1.0 M sodium ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least about 30° C. for short probes (e.g. 10 to 50 nucleotides) and at least about 60° C. for long probes (e.g. greater than 50 nucleotides).

[0137] In certain embodiments, probe contacting steps may be run under stringency conditions which allows formation of the hybridization complex only in the presence of target. Stringency can be controlled by altering a step parameter that is a thermodynamic variable, including, but not limited to, temperature, formamide concentration, salt concentration, chaotropic salt concentration, pH, organic solvent concentration, etc. The size of the primer nucleic acid may vary, as will be appreciated by those in the art, in general varying from 5 to 500 nucleotides in length. Primers may be between 10 and 100, between 15 and 50, and from 10 to 35 depending on the use and amplification technique.

[0138] In some embodiments, the adapter may be ligated to reporter probes (e.g., affinity binders, aptamers, reporter probes). Any suitable adapter may be attached to a target polynucleotide, such as a reporter probe, via any suitable process, such as those discussed herein. The adapter can include a library-specific index tag sequence (e.g., i5, i7). The index tag sequence may be attached to the target polynucleotides from each library before the sample is immobilized for sequencing. The index tag is not itself formed by part of the target polynucleotide, but becomes part of the template for amplification. The index tag may be a synthetic sequence of nucleotides which is added to the target as part of the template preparation step. Accordingly, a library-specific index tag is a nucleic acid sequence tag which is attached to each of the target molecules of a particular library, the presence of which is indicative of or is used to identify the library from which the target molecules were isolated. Preferably, the index tag sequence is 20 nucleotides or less in length. For example, the index tag sequence may be 1-10 nucleotides or 4-6 nucleotides in length. A four nucleotide indextag gives a possibility of multiplexing 256 samples on the same array, a six base index tag enables 4,096 samples to be processed on the same array. The adapters may contain more than one index tag so that the multiplexing possibilities may be increased.

[0139] The adapters may include any other suitable sequence in addition to the index tag sequence. For example, the adapters may include universal extension primer sequences, which are typically located at the 5' or 3' end of the adapter and the resulting polynucleotide for sequencing. The universal extension primer sequences may hybridize to complementary primers bound to a surface of a solid substrate. The complementary primers include a free 3' end from which a polymerase or other suitable enzyme may add nucleotides to extend the sequence using the hybridized library polynucleotide as a template, resulting in a reverse strand of the library polynucleotide being coupled to the solid surface. Such extension may be part of a sequencing run or cluster amplification.

[0140] In some embodiments, the adapters include one or more universal sequencing primer sequences. The universal sequencing primer sequences may bind to sequencing primers to allow sequencing of an index tag sequence, a target sequence, or an index tag sequence and a target sequence. In some embodiments, the disclosed reporter probes, e.g., reporter probes 204, may include a “sequencing adapter” or “sequencing adapter site”, that is to say a region that comprises one or more sites that can hybridize to a primer. In some embodiments, a sequence can include at least a first primer site useful for amplification, sequencing, and the like.

[0141] After adapter incorporation, the disclosed reporter probes may be sequenced. In one example, the sequencing may be via Illumina’s sequencing-by-synthesis and reversible terminator-based sequencing chemistry. Illumina's sequencing technology relies on the attachment of fragmented genomic DNA to a planar, optically transparent surface on which oligonucleotide anchors are bound. Template DNA is end-repaired to generate 5'-phosphorylated blunt ends, and the polymerase activity of Klenow fragment is used to add a single A base to the 3' end of the blunt phosphorylated DNA fragments. This addition prepares the DNA fragments for ligation to oligonucleotide adapters, which have an overhang of a single T base at their 3' end to increase ligation efficiency. The adapter oligonucleotides arecomplementary to the flow-cell anchors. Under limiting-dilution conditions, adapter-modified, single-stranded template DNA is added to the flow cell and immobilized by hybridization to the anchors. Attached DNA fragments are extended and bridge amplified to create an ultra-high density sequencing flow cell with hundreds of millions of clusters, each containing ~l,000 copies of the same template. In one embodiment, the randomly fragmented genomic DNA is amplified using PCR before it is subjected to cluster amplification. Alternatively, an amplification-free genomic library preparation is used, and the randomly fragmented genomic DNA is enriched using the cluster amplification alone. The templates are sequenced using a robust four-color DNA sequencing-by-synthesis technology that employs reversible terminators with removable fluorescent dyes. High-sensitivity fluorescence detection is achieved using laser excitation and total internal reflection optics. Sequence are aligned against a truth table or stored correlations between aptamer identity and identification sequences using specially developed data analysis pipeline software.

[0142] A non-binding region can include a minimum sequence of just the primer regions flanking the identification sequence to introduce an adapter sequence, such as examples of sequences, or their complements, for primer 1 and primer 2 used in Illumina® sequencing preparations, A14, Bl 5, during amplification. In other embodiments, universal capture primer sequences and / or sample index sequences can be incorporated into oligonucleotides generated from the reporter probes, such as via amplification and / or ligation and extension. Certain arrangements that include indexes may incorporate a custom or bridged primer during sequencing to accommodate the different indexes. Other embodiments may include custom options for sequencing libraries using single reads from surface P5 for example, or for adding dark sequencing by synthesis cycles where common sequences exist in adapter regions.

[0143] The adapter sequences A14-ME, ME, B15-ME, ME', A14, B15, and ME are provided below:

[0144] A14-ME: 5'-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 1)

[0145] B15-ME: 5'-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG-3' (SEQ ID NO: 2)

[0146] ME': 5'-phos-CTGTCTCTTATACACATCT-3' (SEQ ID NO: 3)

[0147] A14: 5'-TCGTCGGCAGCGTC-3' (SEQ ID NO: 4)

[0148] B15: 5'-GTCTCGTGGGCTCGG-3' (SEQ ID NO: 5)

[0149] ME: AGATGTGTATAAGAGACAG (SEQ ID NO.: 6)

[0150] The primer region or primer binding region can include a region having the sequence of a universal Illumina® capture primer or a region specifically hybridizing with a universal Illumina® capture primer. Universal Illumina® capture primers include, e.g., P5 5’-AATGATACGGCGACCACCGA-3’ ((SEQ ID NO: 7)) or P7 (5’-CAAGCAGAAGACGGCATACGA-3’ (SEQ ID NO: 8)), or fragments thereof. A region specifically hybridizing with a universal Illumina® capture primer can include, e.g., the reverse complement sequence of the Illumina® capture primer P5 ("anti-P5": 5’-TCGGTGGTCGCCGTATCATT-3’ (SEQ ID NO: 9) or P7 ("anti-P7": 5’-TCGTATGCCGTCTTCTGCTTG-3’ (SEQ ID NO: 10)), or fragments thereof.

[0151] A conserved primer region can additionally or alternatively include a region having the sequence of an Illumina® sequencing primer, or fragment thereof, or a region specifically hybridizing with an Illumina® sequencing primer, or fragment thereof. Illumina® sequencing primers include, e g., SB S3 (5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’ (SEQ ID NO: 11)) or SBS8 (5’- CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT-3’ (SEQ ID NO: 12)). A region specifically hybridizing with an Illumina® sequencing primer, or fragment thereof, can include, e.g., the reverse complement sequence of the Illumina® sequencing primer SBS3 ("anti-SBS3": 5’-AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT-3’ (SEQ ID NO: 13)) or SBS8("anti-SBS8":5’-AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAGACCG-3’ (SEQ ID NO: 14)), or fragments thereof. The incorporation of sequencing primer sequences in the reporter probes may be either directly or via subsequent amplification, ligation, or other sequencing library preparation steps.

[0152] In an embodiment, the sequencing may use Illumina® NGS primers. The following primers are shown by way of example.Read 1 5’ TCGTCGGC AGCGTC AGATGTGTATA AGAGAC AG 3 ’ (SEQ ID NO: 15)Read 25’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG (SEQ ID NO: 16)Paired End Read 1 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT(SEQIDNO: 17)Paired End Read 2 5' CGGTCTCGGCATTCCTGCTGAACCGCTCTTCCGATCT (SEQ ID NO: 18)Index 1 Read 5’ CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG(SEQ ID NO: 19)Index 2 Read 5’ AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC (SEQ ID NO: 20)

[0153] It should be understood that the index read primers may be designed to include the particular index sequence associated with a particular sample in an aptamer-based assay. Thus, the index primers may have a nucleotide region, shown as i5 or i7, that varies in sequence between different samples of a multiplexed sample. Other samples in the run can be prepared with primers that include their respective indexes. Accordingly, certain sequence reads may be obtained with universal primers while other sequence reads are obtained with primers or a mix of primers that are specific to indexes of one or more samples in a multiplexed reaction.

[0154] In an embodiment, unique molecular identifiers (UMIs) may be incorporated onto the aptamers 54 and / or reporter probes 204. UMIs are short sequences used to uniquely tag each molecule in a sample library to provide error correction and reduce sequencing bias.

[0155] FIG. 23 is a block diagram of an exemplary server device 1002 that may be used in connection with the disclosed techniques to generate and / or analyze sequencing data. The server device 1002 may be configured to determine a copy number variant genotype in a nucleic acid sample. The general architecture of the server device 1002 depicted in FIG. 23 includes an arrangement of computer hardware and software components. The server device 1002 may include many more (or fewer) elements than those shown in FIG. 23. It is not necessary, however, that all of these generally conventional elements be shown in order to provide an enabling disclosure. As illustrated, the server device 1002 includes a processing unit 1019, a network interface 1020, a computer readable medium drive 1030, an input / output device interface 1040, a display 1050, and an input device 1060, ah of which may communicate with one another by way of a communication bus. The network interface 1020 may provide connectivity to one or more networks or computing systems. The processing unit 1019 may thus receive information and instructions from other computing systems or services via a network. The processing unit 1019 may also communicate to and from memory 1070 and further provide output information for an optional display 1050 via the input, / output device interface 1040. The input / output device interface 1040 may also accept input from the optional input device 1060, such as a keyboard, mouse, digital pen, microphone, touch screen, gesture recognition system, voice recognition system, gamepad, accelerometer, gyroscope, or other input device.

[0156] The memory 1070 may contain computer program instructions (grouped as modules or components in some embodiments) that the processing unit 1019 executes in order to implement one or more embodiments. The memory 1070 generally includes RAM, ROM and / or other persistent, auxiliary or non-transitory computer readable media. The memory 1070 may store an operating system 1072 that provides computer program instructions for use by the processing unit 1019 in the general administration and operation of the server device1002. The memory 1070 may store a reference genome 10710, such as for use by the sequencing application 1010. In certain embodiments, the memory 1070 may store aptamer IDs or aptamer sequences for aptamer characterization. The memory 1070 may further include computer program instructions and other information for implementing aspects of the present disclosure.

[0157] For example, in one embodiment, the memory 1070 includes a sequencing application 1010. The system 1016 can perform the methods disclosed herein. In addition, memory 1070 may include or communicate with the data store 1090 and / or one or more other data stores that store one or more inputs, one or more outputs, and / or one or more results (including intermediate results) of characterizing aptamers as disclosed herein.

[0158] In some embodiments, the disclosed systems and methods may involve approaches for shifting or distributing certain sequence data analysis features and sequence data storage to a cloud computing environment or cloud-based network. User interaction with sequencing data, genome data, or other types of biological data may be mediated via a central hub that stores and controls access to various interactions with the data. In some embodiments, the cloud computing environment may also provide sharing of protocols, analysis methods, libraries, sequence data as well as distributed processing for sequencing, analysis, and reporting. In some embodiments, the cloud computing environment facilitates modification or annotation of sequence data by users. In some embodiments, the systems and methods may be implemented in a computer browser, on-demand or on-line.

[0159] In some embodiments, software written to perform the methods as described herein is stored in some form of computer readable medium, such as memory, CD- ROM, DVD-ROM, memory stick, flash drive, hard drive, SSD hard drive, server, mainframe storage system and the like.

[0160] In some embodiments, the methods may be written in any of various suitable programming languages, for example compiled languages such as C, C#, C++, Fortran, and lava. Other programming languages could be script languages, such as Perl, MatLab, SAS,SPSS, Python, Ruby, Pascal, Delphi, R and PHP. In some embodiments, the methods are written in C, C#, C++, Fortran, Java, Perl, R, Java or Python. In some embodiments, the method may be an independent application with data input and data display modules. Alternatively, the method may be a computer software product and may include classes wherein distributed objects comprise applications including computational methods as described herein.

[0161] The term “sample” herein may refer to a sample that includes analytes, typically derived from a biological fluid, cell, tissue, organ, or organism, comprising analytes or molecules if interest, such as proteins. Exemplary analytes include proteins, polypeptides, nucleic acids, carbohydrates, lipids, polysaccharides, glycoproteins, hormones, receptors, antigens, antibodies, affibodies, antibody mimics, viruses, pathogens, toxic substances, substrates, metabolites, transition state analogs, cofactors, inhibitors, drugs, dyes, nutrients, growth factors, cells, tissues, and any fragment or portion of any of the foregoing. In some embodiments, a target molecule is a protein.

[0162] A sample may include, but is not limited to, sputum / oral fluid, amniotic fluid, blood, biological fluids, a blood fraction, or fine needle biopsy samples (e.g., surgical biopsy, fine needle biopsy, etc.), urine, peritoneal fluid, pleural fluid, and the like. Although the sample is often taken from a human subject (e g., patient), the sample may be from any organism. The sample may be used directly as obtained from the biological source or following a pretreatment to modify the character of the sample. For example, such pretreatment may include preparing plasma from blood, diluting viscous fluids and so forth. Methods of pretreatment may also involve, but are not limited to, filtration, precipitation, dilution, distillation, mixing, centrifugation, freezing, lyophilization, concentration, amplification, nucleic acid fragmentation, inactivation of interfering components, the addition of reagents, lysing, etc. If such methods of pretreatment are employed with respect to the sample, such pretreatment methods are typically such that the nucleic acid(s) of interest remain in the test sample, sometimes at a concentration proportional to that in an untreated test sample (e.g., namely, a sample that is not subjected to any such pretreatment method(s)). Such “treated” or“processed” samples are still considered to be biological “test” samples with respect to the methods described herein.

[0163] In an embodiment, “dummy” aptamers may be used in any of the embodiments described here (e.g., the one-bead capture step) to selectively deplete high-abundance analytes. As referred to herein, the “dummy” aptamers refer to aptamers 54 without the affinity tag, e.g., binding group 56 such as a biotin tag, as in FIGS. 3, 4, 6-11, 13, 14, 16, 17, and 19-22. Accordingly, a mixture of aptamers 54 may be produced, wherein the mixture of aptamers 54 may include aptamers with the binding group 56 (e.g., standard aptamers) and aptamers 54 lacking the biotin tag (e.g., dummy aptamers). The mixture of aptamers may contact various analytes 72 and form complexes (e.g. analyte-aptamer complexes 74) via the analyte-binding region 60 to a respective analyte 72 in solution. Subsequently, the surface 51 of FIGS. 3, 4, 6-11, 13, 14, 16, 17, and 19-22 may be provided. In this way, only the standard aptamers (e.g., aptamers with binding group 56) bind to the surface 51, after which they are captured and subsequently sequenced. In this way, the addition of dummy aptamers advantageously reduces the overall bead requirement and enables a lower-cost assay. Techniques for dynamic range compression as disclosed in WO2023196528A1, hereby incorporated by reference in its entirety herein, may be used in conjunction with the aptamer-based assays herein. The ratio of the dummy aptamers to the tagged or standard aptamers may be adjusted based on the abundance of a particular analyte. Low abundance analytes may not have any dummy aptamers, while high abundance analytes may have ratios of dummy standard aptamers of 1:1 or 2: 1 or more.

[0164] The term “about” or “approximately” may refer to ±0.1%, ±0.25%, ±0.5%, ±1%, ±2, ±5%, ±10%, or ±15%.

[0165] It is to be understood that the subject matter described herein is not limited in its application to the details of construction and the arrangement of components set forth in the description herein or illustrated in the drawings hereof. The subject matter described herein is capable of other implementations and of being practiced or of being carried out in various ways. Also, it is to be understood that the phraseology and terminology used herein is for thepurpose of description and should not be regarded as limiting. As used herein, an element or step recited in the singular and proceeded with the word “a” or “an” should be understood as not excluding plural of said elements or steps, unless such exclusion is explicitly stated. Furthermore, references to “one example” are not intended to be interpreted as excluding the existence of additional examples that also incorporate the recited features. The use of “including,” “comprising,” or “having” and variations thereof herein is meant to encompass the items listed thereafter and equivalents thereof as well as additional items.

[0166] This written description uses examples to enable any person skilled in the art to practice the disclosed embodiments, including making and using any devices or systems and performing any incorporated methods. The patentable scope is defined by the claims, and may include other examples that occur to those skilled in the art. Such other examples are intended to be within the scope of the claims if they have structural elements that do not differ from the literal language of the claims, or if they include equivalent structural elements with insubstantial differences from the literal languages of the claims.CLAUSES

[0167] The technology disclosed can be practiced as a composition, kit, system, method, or article of manufacture. One or more features of an implementation can be combined with the base implementation. Implementations that are not mutually exclusive are taught to be combinable. One or more features of an implementation can be combined with other implementations. This disclosure periodically reminds the user of these options. Omission from some implementations of recitations that repeat these options should not be taken as limiting the combinations taught in the preceding sections — these recitations are hereby incorporated forward by reference into each of the following implementations.

[0168] The following clauses may be combined or exchanged with one another.

[0169] Clause 1 is a method of analyte detection, comprising providing a plurality of aptamers immobilized on a surface, wherein different aptamers of the plurality of aptamers have binding specificity for respective different analytes and wherein each aptamer of theplurality is partially double-stranded; contacting the plurality of aptamers with analytes of a sample to disrupt double-stranded regions in a first subset of the plurality of aptamers via formation of analyte-aptamer complexes, wherein a second subset of the plurality of aptamers does not form the analyte-aptamer complexes based on a lack of corresponding analytes in the sample and retains the double-stranded regions; and detecting the analytes of the sample based on a detectable difference between the first subset and the second subset.

[0170] Clause 2 is a method of analyte detection of clause 1, wherein the second subset is subject to cleavage from a double-stranded cleavage enzyme.

[0171] Clause 3 is a method of analyte detection of clause 2, wherein the cleavage causes one or more conserved primer sites to be separated from a strand or end coupled to the surface such that aptamers of the second subset cannot be sequenced.

[0172] Clause 4 is a method of analyte detection of clause 2, wherein the cleavage causes an aptamer-specific identification sequence to be separated from a strand or end coupled to the surface such that the aptamer-specific identification sequence is not present in sequencing data generated from oligonucleotides retained on the surface.

[0173] Clause 5 is a method of analyte detection of clause 1, wherein the double-stranded portion of each aptamer comprises a conserved sequence.

[0174] Clause 6 is a method of analyte detection of clause 1, wherein the double-stranded region is part of a hairpin loop.

[0175] Clause 7 is a method of analyte detection of clause 1, wherein the aptamer is hybridized to a reporter probe to form the double-stranded region.

[0176] Clause 8 is a method of analyte detection of clause 1, wherein the aptamer comprises a reporter region comprising an aptamer identification sequence.

[0177] Clause 9 is a method of analyte detection of clause 1, wherein the double- stranded cleavage enzyme comprises a double-stranded DNase.

[0178] Clause 10 is a method of analyte detection, comprising providing a plurality of aptamers immobilized on a surface wherein different aptamers of the plurality of aptamers have binding specificity for respective different analytes and such each aptamer of the plurality comprises a first end coupled to the surface; a free second end; and a hairpin loop comprising a loop region and a double-stranded region; contacting the surface with analytes of a sample such that an individual analyte binds to an individual aptamer of the plurality to disrupt the double-stranded region to cause linearization of the individual aptamer, and wherein a subset of the plurality of aptamers are not bound to any analytes after the contacting; contacting the surface with an enzyme that cleaves double-stranded regions in the subset of the plurality of aptamers that are not bound to any analytes; and detecting the analyte based on sequencing the linearized aptamer.

[0179] Clause 11 is a method of analyte detection of clause 10, wherein the individual aptamer comprises a first primer site and a second primer site, and wherein sequencing the linearized aptamer comprises using the first primer site and / or the second primer site.

[0180] Clause 12 is a method of analyte detection of clause 10, wherein enzyme cleaves the subset to separate one or both of the first primer site or the second primer site from the first end.

[0181] Clause 13 is a method of analyte detection of clause 10, wherein each aptamer of the plurality comprises an analyte-binding region disposed in the hairpin loop.

[0182] Clause 14 is a method of analyte detection of clause 10, claim 10, wherein the double-stranded region of each aptamer comprises a conserved sequence.

[0183] Clause 15 is a method of analyte detection of clause 10, wherein the double-stranded region of each aptamer has melting point between 45°C-60°C.

[0184] Clause 16 is a method of analyte detection of clause 10, wherein the double-stranded region comprises a first region adjacent to or comprising the first end and a second region adjacent to or comprising the free second end.

[0185] Clause 17 is a method of analyte detection of clause 10, wherein the first end is coupled to the surface via biotin.

[0186] Clause 18 is a method of analyte detection of clause 10, wherein the enzyme comprises a double-stranded DNase.

[0187] Clause 19 is a method of analyte detection comprising providing a plurality of aptamers immobilized on a surface wherein different aptamers of the plurality of aptamers have binding specificity for respective different analytes; contacting analytes of a sample to the plurality of aptamers to form analyte-aptamer complexes; contacting the surface with an endonuclease, wherein the endonuclease cleaves a reporter sequence in an unbound subset of the plurality of aptamers; and detecting the analytes of the sample based on the sequences of retained reporter sequences of the analyte-aptamer complexes.

[0188] Clause 20 is a method of analyte detection comprising providing a plurality of aptamers immobilized on a surface wherein different aptamers of the plurality of aptamers have binding specificity for respective different analytes and wherein each aptamer of the plurality is partially double-stranded via hybridization to a primer strand; contacting the plurality of aptamers with analytes of a sample to form analyte-aptamer complexes with a first subset of the plurality of aptamers, wherein a second subset of the plurality of aptamers does not form the analyte-aptamer complexes based on a lack of corresponding analytes in the sample; extending from the primer strand, wherein the first subset remains partially doublestranded after extension and wherein the second subset has a conserved restriction site after extension; contacting the surface with an enzyme that cleaves the conserved double-stranded restriction site; and detecting the analytes of the sample based on a detectable difference between the cleaved first subset and the cleaved second subset.

[0189] Clause 21 is a method of analyte detection comprising contacting analytes of sample with a plurality of first aptamers and a plurality of second aptamers to form analyte-first aptamer-second aptamer complexes; coupling an end of a first aptamer to an end of a second aptamer within an individual analyte-first aptamer-second aptamer complex to form anaptamer oligonucleotide; and detecting the analytes of the sample based on sequences of aptamer oligonucleotides of individual analyte-first aptamer-second aptamer complexes.

[0190] Clause 22 is a method of analyte detection comprising contacting analytes of sample with a plurality of first aptamers to form analyte-first aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes; contacting the analyte-first aptamer complexes with a plurality of second aptamers to form analyte-aptamer sandwich complexes; and detecting the analytes of the sample based on detecting second aptamers of the analyte-aptamer sandwich complexes.

[0191] Clause 23 is a method of analyte detection comprising a fluorescence assay array method, comprising providing a solid surface comprising: a plurality of wells; and a plurality of beads disposed on the solid surface such that an individual well of the plurality of wells accommodates a single bead of the plurality of beads, wherein each bead of the plurality of beads comprises at least one aptamer immobilized on a bead surface; contacting analytes of a sample with the at least one aptamer immobilized on the beads surface, wherein the at least one aptamer binds to an individual analyte to form analyte-aptamer complexes; contacting the analyte-aptamer complexes with a plurality of tags to associate each individual analyte with one or more tags to form analyte-aptamer-tag complexes; contacting the analyte-aptamer-tag complexes with a plurality of conjugated dyes to associate each individual tag with one or more conjugated dyes to generate a fluorescence signal; and detecting the analytes of the sample based on the fluorescence signal.

Claims

1. CLAIMSWhat is claimed is:

1. A method of analyte detection, comprising:providing a plurality of aptamers immobilized on a surface, wherein different aptamers of the plurality of aptamers have binding specificity for respective different analytes and wherein each aptamer of the plurality is partially double-stranded;contacting the plurality of aptamers with analytes of a sample to disrupt doublestranded regions in a first subset of the plurality of aptamers via formation of analyteaptamer complexes, wherein a second subset of the plurality of aptamers does not form the analyte-aptamer complexes based on a lack of corresponding analytes in the sample and retains the double-stranded regions; anddetecting the analytes of the sample based on a detectable difference between the first subset and the second subset.

2. The method of analyte detection of claim 1, wherein the second subset is subject to cleavage from a double-stranded cleavage enzyme.

3. The method of analyte detection of claim 2, wherein the cleavage causes one or more conserved primer sites to be separated from a strand or end coupled to the surface such that aptamers of the second subset cannot be sequenced.

4. The method of analyte detection of claim 2, wherein the cleavage causes an aptamer-specific identification sequence to be separated from a strand or end coupled to the surface such that the aptamer-specific identification sequence is not present in sequencing data generated from oligonucleotides retained on the surface.

5. The method of analyte detection of claim 1, wherein the double-stranded portion of each aptamer comprises a conserved sequence.

6. The method of analyte detection of claim 1, wherein the double-stranded region is part of a hairpin loop.

7. The method of analyte detection of claim 1, wherein the aptamer is hybridized to a reporter probe to form the double-stranded region.

8. The method of analyte detection of claim 1, wherein the aptamer comprises a reporter region comprising an aptamer identification sequence.

9. The method of analyte detection of claim 1, wherein the double-stranded cleavage enzyme comprises a double-stranded DNase.

10. A method of analyte detection, comprising:providing a plurality of aptamers immobilized on a surface wherein different aptamers of the plurality of aptamers have binding specificity for respective different analytes and such each aptamer of the plurality comprises:a first end coupled to the surface;a free second end; anda hairpin loop comprising a loop region and a double-stranded region; contacting the surface with analytes of a sample such that an individual analyte binds to an individual aptamer of the plurality to disrupt the double-stranded region to cause linearization of the individual aptamer, and wherein a subset of the plurality of aptamers are not bound to any analytes after the contacting;contacting the surface with an enzyme that cleaves double-stranded regions in the subset of the plurality of aptamers that are not bound to any analytes; anddetecting the analyte based on sequencing the linearized aptamer.

11. The method of analyte detection of claim 10, wherein the individual aptamer comprises a first primer site and a second primer site, and wherein sequencing the linearized aptamer comprises using the first primer site and / or the second primer site.

12. The method of analyte detection of claim 10, wherein enzyme cleaves the subset to separate one or both of the first primer site or the second primer site from the first end.

13. The method of analyte detection of claim 10, wherein each aptamer of the plurality comprises an analyte-binding region disposed in the hairpin loop.

14. The method of analyte detection of claim 10, wherein the double- stranded region of each aptamer comprises a conserved sequence.

15. The method of analyte detection of claim 10, wherein the double-stranded region of each aptamer has melting point between 45°C-60°C.

16. The method of analyte detection of claim 10, wherein the double-stranded region comprises a first region adjacent to or comprising the first end and a second region adjacent to or comprising the free second end.

17. The method of analyte detection of claim 10, wherein the first end is coupled to the surface via biotin.

18. The method of analyte detection of claim 10, wherein the enzyme comprises a doublestranded DNase.

19. A method of analyte detection, comprising:providing a plurality of aptamers immobilized on a surface wherein different aptamers of the plurality of aptamers have binding specificity for respective different analytes;contacting analytes of a sample to the plurality of aptamers to form analyte-aptamer complexes;contacting the surface with an endonuclease, wherein the endonuclease cleaves a reporter sequence in an unbound subset of the plurality of aptamers; anddetecting the analytes of the sample based on the sequences of retained reporter sequences of the analyte-aptamer complexes.

20. A method of analyte detection, comprising:providing a plurality of aptamers immobilized on a surface wherein different aptamers of the plurality of aptamers have binding specificity for respective different analytes and wherein each aptamer of the plurality is partially double-stranded via hybridization to a primer strand;contacting the plurality of aptamers with analytes of a sample to form analyteaptamer complexes with a first subset of the plurality of aptamers, wherein a second subset of the plurality of aptamers does not form the analyte-aptamer complexes based on a lack of corresponding analytes in the sample;extending from the primer strand, wherein the first subset remains partially doublestranded after extension and wherein the second subset has a conserved restriction site after extension;contacting the surface with an enzyme that cleaves the conserved double-stranded restriction site; anddetecting the analytes of the sample based on a detectable difference between the cleaved first subset and the cleaved second subset.

21. A method of analyte detection, comprising:contacting analytes of sample with a plurality of first aptamers and a plurality of second aptamers to form analyte-first aptamer-second aptamer complexes;coupling an end of a first aptamer to an end of a second aptamer within an individual analyte-first aptamer-second aptamer complex to form an aptamer oligonucleotide; and detecting the analytes of the sample based on sequences of aptamer oligonucleotides of individual analyte-first aptamer-second aptamer complexes.

22. A method of analyte detection, comprising:contacting analytes of sample with a plurality of first aptamers to form analyte-first aptamer complexes, wherein individual aptamers of the plurality of the aptamers have a specific affinity for respective different analytes of the analytes;contacting the analyte-first aptamer complexes with a plurality of second aptamers to form analyte-aptamer sandwich complexes; anddetecting the analytes of the sample based on detecting second aptamers of the analyteaptamer sandwich complexes.

23. A fluorescence assay array method, comprising:providing a solid surface comprising:a plurality of wells; anda plurality of beads disposed on the solid surface such that an individual well of the plurality of wells accommodates a single bead of the plurality of beads, wherein each bead of the plurality of beads comprises at least one aptamer immobilized on a bead surface;contacting analytes of a sample with the at least one aptamer immobilized on the beads surface, wherein the at least one aptamer binds to an individual analyte to form analyte-aptamer complexes;contacting the analyte-aptamer complexes with a plurality of tags to associate each individual analyte with one or more tags to form analyte-aptamer-tag complexes;contacting the analyte-aptamer-tag complexes with a plurality of conjugated dyes to associate each individual tag with one or more conjugated dyes to generate a fluorescence signal; anddetecting the analytes of the sample based on the fluorescence signal.