Advanced RNA targeting (arnatar) for cfb

Abstract

Disclosed herein are Advanced RNA Targeting (ARNATAR) dsRNA compounds targeting CFB. Such compounds are useful in methods for reducing expression of CFB and for therapeutically treating CFB associated diseases, disorders and / or conditions, or symptoms thereof in a subject.

Description

[0001]

[0002] ADVANCED RNA TARGETING (ARNATAR) FOR CEB

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] This application claims the benefit of U. S. Provisional Application Nos. 63 / 740,761, filed December 31, 2024, the entire content of which is incorporated herein in its entirety by this reference.

[0005] INCORPORATION BY REFERENCE OF MATERIAL SUBMITTED ELECTRONICALLY

[0006] Incorporated by reference in its entirety is a computer-readable nucleotide / amino acid sequence listing submitted concurrently herewith and identified as follows; the text file named ” 2025. _12_16_Seq_listing__CFB” (1,809 KB), which was created on December 16, 2025.

[0007] Throughout this application various publications are referenced. All publications, gene transcript identifiers, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, gene transcript identifiers, patent, or patent application was specifically and individually indicated to be incorporated by reference.

[0008] FIELD

[0009] Certain embodiments are directed to novel compounds and methods for modulating Complement Factor B (CFB) gene expression by Advanced RNA Targeting (ARNATAR). Such compounds and methods thereof are useful for reducing expression of CFB, thereby treating diseases, disorders and / or conditions related to CFB in a subject.

[0010] BACKGROUND

[0011] The use of therapeutic oligomeric compounds (e.g., compounds comprising oligonucleotides) was first proposed, over forty years ago by Stephenson and Zamecnik (Inhibition of Rous Sarcoma Viral RNA Translation by a Specific Oligodeoxyribonucleotide, PNAS, 1978, 75:285-288).75:285-288),

[0012] Sequence-specific silencing of gene expression. RNA interference (RNAi), was discovered in 1998 by Fire et al. (Potent and Specific Genetic interference by Double-Stranded RNA in Caenorhabditis elegans, Nature, 1998, 391:806-811). RNAi utilizes double-stranded RNA (dsRNA) to inhibit gene expression via the RNA-induced silencing complex (RISC).

[0013] RISC comprises a complex of multiple proteins interacting with an oligomeric compound to inhibit gene expression. The oligomeric compound acts as a template for RISC to recognize complementary messenger RNA (mRNA) transcripts to target a specific mRNA transcript for cleavage. Cleavage of the target mRNA blocks translation of the target mRNA and silences the target gene. Oligomeric compounds utilized by RISC include, but, are not limited to: single stranded oligomeric compounds such as microRNAs (miRNAs), certain oligonucleotides, and single strand siRNAs (Lima et aL, Single-stranded siRNAs activate RNAi in animals. Cell. 2012, 150(5):883-94), and double stranded RNA (dsRNA) compounds such as short hairpin RNAs (shRNAs) and small interfering RNAs (siRNAs).

[0014] Complement Factor B (CFB) is a critical protein in the alternative pathway of the complement system, a fundamental component of innate immunity. This pathway provides a rapid, antibody-independent response to pathogens. Tight regulation of complement factor B is critical to prevent host tissue damage. Research into CFB has revealed its dual role as a protector against infections and a contributor to autoimmune and inflammatory conditions (Thurman and Yapa, 2019, Front. Immunol, Volume W, https: / / doi.org / 10.3389 / fimmu.2019.00672; Ricklin et al., 2010, Nature Immunology 11 (9):785— 797). Dysregulation of CFB can contribute to excessive complement activation, leading to tissue damage and chronic inflammation. For instance, overexpression or hyperactivity of CFB has been implicated in conditions such as systemic lupus erythematosus (SLE), age-related macular degeneration (AMD), atypical hemolytic uremic syndrome (aHUS), Paroxysmal nocturnal hemoglobinuria (PNH), Primary immunoglobulin A nephropathy (IgAN), and rheumatoid arthritis (RA). These associations underscore CFB’s dual role in immune protection and potential pathogenicity when misregulated.

[0015] Disclosed herein are dsRNA compounds targeting CFB improved with Advanced RNA Targeting (ARNATAR) abilities that enhance their gene silencing activity for use in reducing CFB expression and treating CFB related metabolic diseases in a subject.SUMMARY OF THE INVENTION

[0016] Several embodiments provided herein relate to the discovery of certain ARNATAR design modified dsRNA compounds targeting CFB that can enhance their effectiveness in modulating CFB gene expression. In several aspects, the dsRNA compound is a modified shRNA or siRNA. The double-stranded RNA compound comprises a sense strand and an antisense strand. The antisense strands can be fully or partially complementary to a target nucleic acid.

[0017] In one embodiment, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of CFB in a cell comprises a sense strand and an antisense strand forming the dsRNA compound, wherein the antisense strand comprises or is any of the antisense strand sequences in any one of Tables 2, 6 or 10. In some embodiments, the antisense strand is in a salt form.

[0018] In one embodiment, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of CFB in a cell comprises a sense strand and an antisense strand forming the dsRNA compound, wherein the sense strand comprises or is any of the sense strand sequences in any one of Tables 2, 6 or 10. In some embodiments, the sense strand is in a salt form.

[0019] In one embodiment, a double-stranded ribonucleic acid (dsRNA) for inhibiting expression of CFB in a cell comprises a sense strand and an antisense strand forming the dsRNA compound, wherein the sense strand comprises or is any of the corresponding sense strand sequences in any one of Tables 2, 6 or 10, and wherein the antisense strand comprises or is any of the corresponding antisense strand sequences in any one of Tables 2, 6 or 10. In some embodiments, the sense strand and / or the antisense strand is in a salt form.

[0020] In certain embodiments, the dsRNA comprises a small interfering RNA (siRNA). In a further embodiment, the siRNA comprises or is any one of the siRNAs listed in any one of Tables 2, 6 or 10. In some embodiments, the siRNA is in a salt form.

[0021] In certain embodiments, the dsRNA comprises a conjugate. In certain embodiments, the conjugate is an N-Acetylgalactosamine-comprising moiety (GalNAc). In certain embodiments, the conjugate is attached to the 3’ end of the sense strand of a dsRNA targeting CFB, In certain embodiments, the conjugate is attached to the 3’ end of the sense strand of an siRNA targeting CFB.

[0022] In certain embodiments, a pharmaceutical composition for inhibiting expression of a gene encoding CFB comprises a dsRNA, alone or in combination with a pharmaceutically acceptable carrier or excipient.Certain embodiments provide a method for inhibiting the expression of CFB in a subject comprising the step of administering a dsRNA compound or a pharmaceutical composition described herein to the subject, in an amount sufficient to inhibit expression of CFB. In certain embodiments, the dsRNA inhibits expression of CFB by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%. In certain embodiments, the dsRNA comprises an siRNA.

[0023] Certain embodiments provide a method of inhibiting expression of CFB in a cell comprising contacting the cell with a dsRNA compound or a pharmaceutical composition described herein in an amount sufficient to inhibit expression of CFB, thereby inhibiting expression of CFB in the ceil.

[0024] Certain embodiments provide a method of treating and / or preventing a CFB associated disease, disorder and / or condition in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a dsRNA compound or a pharmaceutical composition described herein, thereby treating and / or preventing the CFB associated disease, disorder and / or condition in the subject.

[0025] Certain embodiments provide a method of treating a subject having a disease, disorder and / or condition that would benefit from reduction in CFB expression, comprising administering to the subject in need thereof a therapeutically effective amount of a dsRNA compound or a pharmaceutical composition described herein, thereby treating the subject having the disease, disorder and / or condition that would benefit from reduction in CFB expression.

[0026] Certain embodiments provide a method of preventing at least one symptom in a subject having a disease, disorder and / or condition that would benefit from reduction in CFB expression, comprising administering to the subject in need thereof a prophylactically effective amount of a dsRNA compound or a pharmaceutical composition described herein, thereby preventing at least one symptom in the subject having the disease, disorder and / or condition that would benefit from reduction in CFB expression.

[0027] In certain embodiments, a kit comprising a dsRNA compound or a pharmaceutical composition described herein, and optionally, a label, is provided.

[0028] In one embodiment, a process for preparing a sense and / or antisense strand of a double-stranded ribonucleic acid (dsRNA) compound described herein is provided, wherein the process comprises the steps of: a) preparing the sense and / or antisense strand by sequential coupling of modified and / or unmodified nucleotides via the phosphoramidite oligonucleotide synthesis on asolid support; b) optionally, coupling an N-Acetylgalactosamine-comprising moiety (GalNAc) to the sense and / or antisense strand on the solid support via the phosphoramidite oligonucleotide synthesis; c) detaching the sense and / or antisense strand from the solid support and removing the solid support; and d) optionally, further purifying the sense and / or antisense strand, optionally using chromatograph.

[0029] In one embodiment, a process for preparing a sense and / or antisense strand of a double-stranded ribonucleic acid (dsRNA) compound described herein is provided, wherein the process comprises the steps of; a) coupling an N-Acetylgalactosamine-comprising moiety (GalNAc) to a solid support via the phosphoramidite oligonucleotide synthesis, b) coupling a modified and / or unmodified nucleotide via the phosphoramidite oligonucleotide synthesis to the GalNAc on the solid support; c) sequentially coupling additional modified and / or unmodified nucleotides via the phosphoramidite oligonucleotide synthesis to prepare the sense and / or antisense strand; d) detaching the sense and / or antisense strand from the solid support and removing the solid support; and e) optionally, further purifying the sense and / or antisense strand, optionally using chromatography.

[0030] In one embodiment, a process of preparing a double-stranded ribonucleic acid (dsRNA) compound described herein is provided, comprising: a) contacting the sense strand prepared according to any one of the processes described herein with the antisense strand prepared according to any one of the processes described herein in equimolar concentrations in a solution; b) optionally heating the solution to a temperature of about 94°C; and c) optionally, reducing the temperature of the solution to about 25°C.

[0031] Certain embodiments provide a double-stranded ribonucleic acid (dsRNA) compound described herein for use in medicine.

[0032] Certain embodiments provide a double-stranded ribonucleic acid (dsRNA) compound described herein for use in treating or preventing a CFB-associated disease, disorder and / or condition in a subject.

[0033] BRIEF DESCRIPTION OF THE DRAWINGS FIGURE 1: Table listing Amatar designed siRNAs targeting CFB.

[0034] FIGURE 2: Charts showing CFB mRNA levels at 20 hrs after transfection of CRL5826TMcells with various siRNAs at various doses (0-10 nM).FIGURE 3; Charts showing CFB mRNA levels at 20 hrs after transfection of CRL5826TMcells with various siRNAs at various doses (0-10 nM).

[0035] FIGURE 4: Charts showing CFB mRNA levels at 24 or 48 hrs after transfection of CRL5826TMcells with various siRNAs at various doses (0-10 nM).

[0036] FIGURE 5: Charts showing CFB mRNA levels at 24 or 48 hrs after transfection of CRL5826TMcells with various siRNAs at various doses (0-10 nM).

[0037] FIGURE 6: Table listing Arnatar designed siRNAs with GalNAc conjugation targeting CFB. These Arnatar designed siRNAs are based on potent siRNAs disclosed in Figure 1 (designated parental siRNA),

[0038] FIGURE 7: Chart showing CFB mRNA levels at 26 hrs after transfection of CRL5826TMcells with various siRNAs at various doses (0-10 nM).

[0039] FIGURE 8: Chart showing CFB mRNA levels at 64 hrs after free uptake into human primary hepatocytes (HPH) with various siRNAs at various doses (0-10 M).

[0040] FIGURE 9A-B: Line graphs showing the percent CFB protein levels in transgenic mouse plasma over time after dosing 3 mg / kg of various siRNAs.

[0041] FIGURE 10; Graph showing CFB mRNA levels at 24 hrs after transfection of CRL5826TMcells with siRNAs at 1 nM.

[0042] FIGURE 11: Graph showing CFB mRNA levels at 48 hrs after transfection of CRL5826TMcells with siRNAs at 1 nM.

[0043] FIGURE 12: Chart showing dose response of CFB mRNA levels at 24 hrs after transfection of CRL5826TMcells with siRNAs at various doses (1-20 nM).

[0044] DETAILED DESCRIPTION OF THE INVENTION

[0045] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and / or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting. Also, terms such as “element” or “component” encompass both elements and components comprising one unit and elements and components that comprise more than one subunit, unless specifically statedotherwise.

[0046] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

[0047] Definitions

[0048] Unless specific definitions are provided, the nomenclature utilized in connection with, and the procedures and techniques of, analytical chemistry, synthetic organic chemistry, and medicinal and pharmaceutical chemistry described herein are those well-known and commonly used in the art. Standard techniques may be used for chemical synthesis, and chemical analysis. Where permitted, all patents, applications, published applications and other publications, GENBANK Accession Numbers and associated sequence information obtainable through databases such as National Center for Biotechnology Information (NCBI) and other data referred to throughout in the disclosure herein are incorporated-by-reference for the portions of the document discussed herein, as well as in their entirety.

[0049] Unless otherwise indicated, the following terms have the following meanings:

[0050] “2’-O-methoxyethyl” (also 2’-M0E and 2’-O(CH2)2-OCH3) refers to an O-methoxy-ethyl modification at the 2’ position of a furanose ring. A 2’-O-methoxyethyl modified sugar is a modified sugar.

[0051] “2'-MOE nucleoside” (also 2’-O-methoxyethyl nucleoside) means a nucleoside comprising a 2’-M0E modified sugar moiety. “2 ’-MOE nucleotide” (also 2’-O-metboxyethyl nucleotide) means a nucleotide comprising a 2’-M0E modified sugar moiety.

[0052] “2’-O-methyl” (also 2’-OCH3 and 2’-0Me) refers to an O-methyl modification at the 2’ position of a furanose ring. A 2’-O-methyl modified sugar is a modified sugar,

[0053] “2’-0Me nucleoside” (also 2’-O-methyl nucleoside) means a nucleoside comprising a 2’- OMe modified sugar moiety. “2’-0Me nucleotide” (also 2’-O-methyl nucleotide) means a nucleotide comprising a 2’-0Me modified sugar moiety.

[0054] “2’ -substituted nucleoside” means a nucleoside comprising a substituent at the 2 ’-position of the furanosyl ring other than H or OH. In certain embodiments, 2’ -substituted nucleosidesinclude nucleosides with a fluoro (2’-F), O-methyl (2’-0Me), O-methoxyethyl (2 ’-MOE) or bicyclic sugar modifications.

[0055] “5-methylcytosine” means a cytosine modified with a methyl group attached to the 5 position, A 5-methylcytosine is a modified nucleobase and is part of a modified nucleoside. “5- methylcytidine” is the name of the nucleoside when the 5 methyl modified nucleobase is combined with a modified or unmodified sugar.

[0056] “About” means when used before a numerical designation (e.g., temperature, time, amount, concentration, and such other, including a range) indicates approximations which may vary by within ±10% of a value, e.g., ±9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, or 1%. For example, if it is stated, “the compounds affected at least about 70% inhibition of mRNA”, it is implied that the mRNA levels are inhibited within a range of 63% and 77%. Recitation of ranges of values herein is merely intended to serve as a method of referring individually to each separate value falling within the range and each endpoint, unless otherwise indicated herein, and each separate value and endpoint is incorporated into the specification as if it were individually recited herein, “Animal” refers to a human or non-human animal, including, but not limited to, any of mice, rats, rabbits, dogs, cats, pigs, and non-human primates, including, but not limited to, monkeys and chimpanzees..1

[0057] “Antisense oligonucleotide” or “ASO” means a single- stranded oligonucleotide having a nucleobase sequence that permits hybridization to a corresponding region or segment of a target nucleic acid. In certain embodiments, the antisense oligonucleotide comprises one or more ribonucleoside (RNA) residues and / or deoxyribonucleoside (DNA) residues.

[0058] “Base complementarity” refers to the capacity for the base pairing of nucleobases of an oligonucleotide with corresponding nucleobases in a target nucleic acid (i.e., hybridization), and is mediated by Watson-Crick, Hoogsteen, or reversed Hoogsteen hydrogen binding between corresponding nucleobases. Base complementarity also refers to canonical (e.g., A: U, A: T, C: G) or non-canonical base pairings (e.g., A: G, A: U, G: U, I: U, I: A, I: C).

[0059] “Bicyclic sugar” means a compound wherein two rings, e.g., two furanose rings, are modified by the bridging of two non-geminal carbon atoms. A bicyclic sugar is a modified sugar.

[0060] “Cap structure” or “terminal cap moiety” means chemical modifications, which have been incorporated at either terminus of an oligomeric compound.“Chemical modification” means modification of molecular structure or element from naturally occurring molecules. For example, siRNA compounds are composed of linked ribonucleosides (also sometimes referred to herein as RNA), therefore, substitution of a deoxyribonucleoside (also sometimes referred to herein as DNA) for a ribonucleoside is considered a chemical modification of the siRNA compound.

[0061] “Chemically distinct portion” refers to a portion of an oligomeric compound that is in some way chemically different than another portion of the same oligomeric compound. For example, a portion having 2'-OMe nucleotides is chemically distinct from a portion having nucleotides without 2’-()Me modifications,

[0062] “Chimeric oligomeric compounds” means oligomeric compounds that have at least 2 chemically distinct portions, each portion having a plurality of subunits, For example, as disclosed herein, siRNA can comprise a peripheral portion and a central portion. The peripheral portion comprises motifs with various modified or unmodified nucleobases so as to confer increased stability, specificity, safety, and potency, while the central portion comprises various modified or unmodified nucleobases to serve as substrate for RISC mediated degradation, “Complementarity” means the capacity for pairing between nucleobases of a first nucleic acid and a second nucleic acid.

[0063] “Comply” in the context of a therapy means the adherence to a recommended therapy by a subject.

[0064] “Comprise”, “comprises,” and “comprising” will be understood to imply the inclusion of a stated member without the exclusion of other (e.g., non-stated) members. For example, the inclusion of a stated step or element or group of steps or elements but not the exclusion of any other step or element or group of steps or elements, respectively. The terms “comprising,” “having,” “including,” and “containing” are to be construed as open-ended terms (i.e., meaning “including, but not limited to,”) unless otherwise noted.

[0065] “Contiguous nucleobases” means nucleobases immediately adjacent to each other.

[0066] “Deoxyribonucleotide” means a nucleotide having a hydrogen at the 2’ position of the sugar portion of the nucleotide, A sequence of deoxyribonucleotides is sometimes referred to as “DNA” herein, A deoxyribonucleotide is sometimes referred to as “DNA nucleotide” or “d nucleotide” or “D” herein. Deoxyribonucleotides may be modified with any of a variety of substituents.“Designing” or “designed” in the context of an oligomeric compound refers to the process of making / engineering an oligomeric compound that specifically hybridizes with a target nucleic acid molecule. Designing generally encompasses providing mutations and / or modifications to a e.g., natural sequence.

[0067] “Efficacy” means the ability to produce a desired effect.

[0068] “Expression” includes all the functions by which a gene’s coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and / or translation. Within the present disclosure, expression refers to protein as the product of expression.

[0069] “Fully complementary” or “100% complementary” means each nucleobase of a first nucleic acid sequence has a complementary nucleobase in a second nucleic acid sequence. In certain embodiments, a first nucleic acid sequence is an oligomeric compound and a target nucleic acid is a second nucleic acid sequence. Fully or 100% complementary can also refer to a portion of a first nucleic acid sequence being fully or 100% complementary to a nucleobase portion in a second nucleic acid sequence.

[0070] “Fully modified motif’ refers to an oligomeric compound comprising a contiguous sequence of nucleosides wherein each nucleoside has a chemical modification.

[0071] “GalNAc” refers to the compound N-Acetylgalactosamine or to a compound comprising one or more N-Acetylgalactosamine compounds or moieties. An N-Acetylgalactosamine- comprising moiety describes a compound comprising at least one N-Acetylgalactosamine compound or moiety, e.g., attached to one or more spacers and / or linkers for the attachment to an oligonucleotide compound.

[0072] “Hybridization” means the annealing of complementary nucleic acid molecules. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, a combination of an oligomeric compound and a nucleic acid molecule target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, a combination of a strand of an siRNA and a nucleic acid molecule target, particularly an mRNA target molecule.

[0073] “Immediately adjacent” means there are no intervening elements between the immediately adjacent elements.

[0074] “Induce”, “inhibit”, “potentiate”, “elevate”, “increase”, “decrease” or the like, generally denotes an action to obtain quantitative differences between two states,“Inhibiting the expression or activity” refers to a reduction or blockage of the expression or activity and does not necessarily indicate a total elimination of expression or activity.

[0075] “Internucleoside linkage” refers to the chemical bond between two adjacent nucleosides. The linkage may be a naturally occurring linkage, i.e., a phosphate linkage, or an artificial linkage, such as a phosphorothioate (also known as thiophosphate or PS) linkage.

[0076] “Linked nucleosides” means adjacent nucleosides (e.g., A, G, C, T, U, and I) linked together by an internucleoside linkage. Examples of linked nucleosides include a sequence of deoxyribonucleosides (sometimes referred to as DNA herein) or a sequence of ribonucleosides (sometimes referred to as RNA herein).

[0077] “Mismatch” or “non -complementary nucleobase” refers to the case when a nucleobase of a first nucleic acid is not capable of pairing with the corresponding nucleobase of a second or target nucleic acid through Watson-Crick base-pairing (e.g., A: T, A: U, C: G).

[0078] “Modified internucleoside linkage” refers to a substitution or any change from a naturally occurring internucleoside bond (i.e.. a phosphodiester intemucleoside bond).

[0079] “Modified nucleobase” means any nucleobase other than adenine, cytosine, guanine, thymidine, or uracil. An “unmodified nucleobase” means the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C), and uracil (U).

[0080] “Modified nucleoside” means a nucleoside having a modified sugar moiety and / or a modified nucleobase. As used herein, where the oligomeric compound is RNA based, a substitution of a deoxyribonucleoside (sometimes referred to as DNA nucleoside herein) for a ribonucleoside is considered a modification of the oligomeric compound.. Also, where the oligomeric compound is DNA based, a substitution of a ribonucleoside (sometimes referred to as RNA nucleoside herein) for a deoxyribonucleoside is considered a modification of the oligomeric compound,

[0081] “Modified nucleotide” means a nucleotide having at least one of a modified sugar moiety, a modified internucleoside linkage, a deoxyribonucleoside (sometimes referred to as DNA nucleotide herein) for a ribonucleoside (sometimes referred to as RNA nucleotide herein) substitution, a ribonucleoside (sometimes referred to as RNA nucleoside herein) for a deoxyribonucleoside (sometimes referred to as DNA nucleoside herein) substitution, and a modified nucleobase.?“Modified oligonucleotide” means an oligonucleotide comprising at least one of a modified internucleoside linkage, a modified sugar, a deoxyribonucleoside (sometimes referred to as DNA nucleoside herein) for a ribonucleoside (sometimes referred to as RNA nucleoside herein) substitution, a ribonucleoside (sometimes referred to as RNA nucleoside herein) for a deoxyribonucleoside (sometimes referred to as DNA nucleoside herein) substitution, and / or a modified nucleobase,

[0082] “Modified sugar” means substitution and / or any change from a natural sugar moiety of a nucleoside found in DNA or RNA,(

[0083] “Moiety” means one of the portions into which something is divided, i.e., a part or component of something. For example, a sugar moiety of a nucleotide is the sugar component of the nucleotide.

[0084] “Monomer” refers to a single unit of an oligomer or a single unit for forming an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides, whether naturally occurring or modified.

[0085] “Motif’ means a pattern of modification in an oligomeric compound. For example, as disclosed herein, ARNATAR designed oligomeric compounds comprising motifs with various modified nucleobases and internucleoside linkages in order to improve delivery, stability, specificity, safety, and potency of the compounds.

[0086] “Natural sugar (moiety)” or generally “sugar (moiety)” means a sugar (moiety) found in DNA (2’-H) or RNA (2’-OH). i.e,, 2-deoxy-beta-D-ribofuranose or beta-D-ribofuranose, respectively.

[0087] “Naturally occurring internucleoside linkage” means a 3’ to 5’ phosphodiester linkage. “N on-complementary nucleobase” refers to a pair of nucleobases that do not form hydrogen bonds with one another or otherwise support hybridization.

[0088] “Nucleic acid” or “nucleic acid molecule” refers to a sequence of monomeric nucleotides. A nucleic acid molecule includes, but is not limited to, ribonucleic acids (RNA), messenger RNA (mRNA), deoxyribonucleic acids (DNA), single-stranded nucleic acids, double-stranded nucleic acids, small interfering ribonucleic acids (siRNA), short hairpin ribonucleic acids (shRNA), and microRNAs (miRNA).“Nucleobase” means any unmodified nucleobase as defined above, any modified nucleobase and / or any artificial nucleobase that may generally be any heterocyclic moiety capable of pairing with a base of a nucleic acid molecule.

[0089] “Nucleobase complementarity” refers to a nucleobase that is capable of base pairing (also known as being complementary) with another nucleobase. If a nucleobase at a certain position of an oligomeric compound is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid molecule, then the position of hydrogen bonding between the oligomeric compound and the target nucleic acid molecule is considered to be complementary at that nucleobase pair. For example, in DNA, adenine (A) is complementary to thymine (T); in RNA, adenine (A) is complementary to uracil (U); and, guanine (G) is complementary to cytosine (C) in both DNA and RNA. Base pairs, or complementary nucleobases, are usually canonical Watson- Crick base pairs (C: G, A: U, A: T), but, non-canonical base pairs such as Hoogsteen base pairs (e.g., A: G, A: U), Wobble base pairs (e.g., G: U, I: U, I: A, I: C, wherein I is hypoxanthine) and the like are also included. Nucleobase complementarity facilitates hybridization of the oligomeric compounds described herein to their target nucleic acids.

[0090] “Nucleobase sequence” means the order of contiguous nucleobases independent of any sugar, linkage, and / or nucleobase modification.

[0091] “Nucleoside” means a nucleobase linked to the natural or modified sugar as defined above. Types of nucleosides include deoxyribonucleoside (sometimes referred to as DNA nucleoside herein) which contains deoxyribose as its sugar component and ribonucleoside (sometimes referred to as RNA nucleoside herein) which contains ribose as its sugar component.

[0092] “Nucleoside mimetic” includes those structures used to replace the sugar or the sugar and the base and not necessarily the linkage at one or more positions of an oligomeric compound, such as, for example, nucleoside mimetics having morpholino, cyclohexenyl, cyclohexyl, tetrahydropyranyl, bicyclo, or tricyclo sugar mimetics, e.g,, non furanose sugar units. Nucleotide mimetic includes those structures used to replace the nucleoside and the linkage at one or more positions of an oligomeric compound such as for example peptide nucleic acids or morpholines (morpholines linked by -N(H)-C(~O)-O- or other non-phosphodiester linkage). Sugar surrogate overlaps with the slightly broader term nucleoside mimetic, but is intended to indicate replacement of the sugar unit (furanose ring) only. The tetrahydropyranyl rings provided herein are illustrative of an example of a sugar surrogate wherein the furanose sugar group has been replaced with atetrahydropyranyl ring system, " Mimetic” refers to groups that are substituted for a sugar, a nucleobase, and / ' or intemucleoside linkage. Merely as an example, a mimetic is used in place of the sugar or sugar-internucleoside linkage combination, and the nucleobase is maintained for hybridization to a selected target.

[0093] “Nucleotide” means a nucleoside having a linkage group (e.g., a phosphate (p) or phosphorothioate (PS) group) covalently linked to the sugar portion of the nucleoside. Nucleotides include ribonucleotides and deoxyribonucleotides with phosphate and / or phosphorothioate linkages. Ribonucleotides are the linked nucleotide units forming RNA. Deoxyribonucleotides are the linked nucleotide units forming DNA. A sequence of linked nucleotides, e.g., ribonucleotides, deoxyribonucleotides, and / or a mixture thereof, form an oligonucleotide.

[0094] “Off-target effect” refers to an unwanted or deleterious biological effect associated with modulation of RNA or protein expression of a gene other than the intended target nucleic acid.

[0095] “Oligomeric activity” means any detectable or measurable activity attributable to the hybridization of an oligomeric compound to its target nucleic acid. In certain embodiments, oligomeric activity is measured as a decrease in the amount or expression of a target nucleic acid. Oligomeric activity can be modulated by an oligomeric compound, such as a dsRNA compound. Oligomeric activity can be modulated by an oligomeric compound such as an siRNA compound.

[0096] “Oligomeric compound” means a compound of linked monomeric subunits (also known as “subunits” herein) that is capable of undergoing hybridization to at least a region of a target nucleic acid through hydrogen bonding. The oligomeric compound acts as a template for RISC to recognize complementary messenger RNA (mRNA) transcripts to target a specific mRNA transcript for cleavage. The oligomeric compound acts as a template for RISC to recognize complementary messenger RNA (mRNA) transcripts to target a specific mRNA transcript for cleavage. Cleavage of the target mRNA blocks translation of the target mRNA and silences the target gene. Examples of oligomeric compounds include single-stranded and double-stranded compounds, such as, antisense oligonucleotides, ssRNAs, siRNAs, shRNAs, and miRNAs. Generally, oligomeric compounds are distinguished from polymeric compounds based on their number of monomers, wherein an oligomer often has about 5 to about 100 monomeric units.

[0097] “Oligomeric inhibition” means reduction of target nucleic acid (e.g., mRN A) levels in the presence of an oligomeric compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the oligomeric compound.“Oligomeric mechanisms” include RISC or RNase H-related mechanisms involving hybridization of an oligomeric compound with target nucleic acid (e.g., inRNA), wherein the outcome or effect of the hybridization is target degradation and inhibition of gene expression.

[0098] “Oligonucleotide” as used herein means a sequence of linked nucleosides and / or nucleotides, each of which can be modified or unmodified, independently from each other. Oligonucleotides can have a linking group other than a phosphate group (e.g., a phosphorothioate group) used as a linking moiety between nucleosides. In certain embodiments, an oligonucleotide comprises one or more ribonucleosides (RNA) and / or deoxyribonucleosides (DNA) residues.

[0099] “Phosphorothioate linkage” or “PS” means a linkage between nucleosides where the phosphodiester bond is modified by replacing one of the non-bridging oxygen atoms with a sulfur atom, A phosphorothioate linkage is a modified internucleoside linkage.

[0100] “Portion” means a defined number of contiguous (he., linked) nucleosides of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleosides of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleosides of an oli omeric compound.

[0101] “Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.

[0102] “RNA” or “ribonucleic acid” consists of ribose nucleotides or ribonucleotides (nitrogenous bases attached to a ribose sugar) linked by phosphodiester bonds, forming strands of varying lengths, The nitrogenous bases in natural RNA are adenine, guanine, cytosine, and uracil. In the dsRNA described herein, they may also comprise thymine and / or other bases.

[0103] “Ribonucleotide” means a nucleotide having a hydroxy at the 2’ position of the sugar portion of the nucleotide. Ribonucleotides can be modified with any of a variety of substituents and may be connected by covalent linkages other than naturally occurring phosphodiester, such as phosphorothioate. A ribonucleotide is sometimes referred to as RNA, “R” or “r” herein.

[0104] “Segments” are defined as smaller or sub-portions of regions within a nucleic acid molecule, e.g., a target nucleic acid.

[0105] “Sites,” as used herein, are defined as unique nucleoside positions within a nucleic acid, e.g., a target nucleic acid.

[0106] “Specifically hybridizable” refers to an oligomeric compound having a sufficient degree of complementarity between an oligomeric compound (e.g., siRNA) and a target nucleic acid (e.g.,mRNA) to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in viva assays and therapeutic treatments.

[0107] “Stringent hybridization conditions” or “stringent conditions” refer to conditions under which an oligomeric compound will hybridize to its target sequence, with minimal hybridization to other nucleic acid molecules.

[0108] “Subject” means a human or non-human animal, in particular, a human or non-human animal selected for treatment or therapy.

[0109] “Target” generally refers to a protein or nucleic acid molecule, the modulation of which is desired. As used herein, “target” particularly refers to a nucleic acid molecule (e.g., mRNA), the modulation of which is desired.

[0110] “Target gene” refers to a gene encoding a target.

[0111] “Targeting” means the process of design and selection of an oligomeric compound that will specifically hybridize to a target nucleic acid and induce a desired effect.

[0112] “Target nucleic acid,” “target RNA,” “target RNA transcript,” and “nucleic acid target” all mean a nucleic acid capable of being targeted by oligomeric compounds.

[0113] “Target region” means a portion of a target nucleic acid to which one or more oligomeric compounds are targeted.

[0114] “Target, segment” means the sequence of nucleotides of a target nucleic acid to which an oligomeric compound is targeted. “5’ target site” refers to the 5 ’-most nucleotide of a target segment. “3’ target site” refers to the 3 ’-most nucleotide of a target segment. In an embodiment, a target segment is at least a 12-nucleobase portion (i.e, at least 12 consecutive nucleobases) of a target region to which an oligomeric compound is targeted or anneals, binds, or targets.

[0115] “Therapeutic efficacy” or “therapeutically effective” refers to the effectiveness of a compound or composition, such as an oligomeric compound described herein, in a therapeutic application. Therapeutic efficacy can be increased by improvements in delivery, stability, specificity, safety, and / or potency of the therapeutic compound.

[0116] “Unmodified” RNA nucleobases mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases cytosine (C) and uracil (U). “Unmodified” DNA nucleobases mean the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T) and cytosine (C). In certain embodiments, an unmodified RNA nucleobase is considered modified when a DNAnucleobase is substituted for the RNA nucleobase in an oligomeric compound such as an siRNA compound. In certain embodiments, an unmodified DNA nucleobase is considered modified when an RNA nucleobase is substituted for the DNA nucleobase in a DNA sequence.

[0117] “Unmodified nucleoside” means herein a nucleoside composed of a naturally occurring nucleobase and a naturally occurring sugar moiety. In certain embodiments, an unmodified nucleoside is an RNA nucleoside in an oligomeric compound such as an siRNA compound.

[0118] “Unmodified nucleotide” means herein a nucleotide composed of a naturally occurring nucleobase, a naturally occurring sugar moiety, and an internucleoside linkage, wherein the internucleotide linkage may be a naturally occurring linkage (i.e., a phosphate linkage) or an artificial linkage (e.g.. a phosphorothioate linkage). In certain embodiments, an unmodified nucleotide is an RNA nucleotide in an oligomeric compound such as an siRNA compound.

[0119] Disclosed herein are improved compounds targeting Complement Factor B (CFB) with Advanced RNA Targeting (ARNATAR) designs that enhance their gene silencing activity. In certain embodiments, the compound is a double-stranded ribonucleic acid (dsRNA) compound. In an embodiment, the dsRNA is an shRNA or an siRNA compound.

[0120] In one embodiment, a double-stranded ribonucleic acid (dsRNA) compound for inhibiting expression of CFB in a cell comprises a sense strand and an antisense strand forming the dsRNA, wherein the antisense strand comprises or is any of the antisense nucleotide sequences in any one of Tables 2, 6 or 10. In certain embodiments, the dsRNA is an siRNA compound, wherein the antisense strand comprises or is any of the antisense nucleotide sequences in any one of Tables 2, 6 or 10. In certain embodiments, the antisense nucleotide sequence comprises a 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleoside long portion of any sequence shown in Tables 2. 6 or 10. In certain embodiments, the antisense nucleotide sequences comprises or is the antisense nucleotide sequence of ATsilO16 (SEQ ID NO: 2), ATsi1017 (SEQ ID NO: 4), ATsi1018 (SEQ ID NO: 8), ATsi 1019 (SEQ IDNOs: 10), ATsi 1020 (SEQ ID NO: 16), ATsi 1021 (SEQ ID NO: 26), ATsi 1022 (SEQ ID NO: 28), ATsi1318 (SEQ ID NO: 34), ATsi 1321 (SEQ ID NO: 40), ATsi 1323 (SEQ ID NO: 44), ATsi 1325 (SEQ ID NO: 48), ATsi 1327 (SEQ ID NO: 52), ATsi 1339 / ATsi 1394 (SEQ ID NO: 76), ATsil348 (SEQ ID NO: 94), ATsiI349 (SEQ ID NO: 96), ATsil351 (SEQ ID NO: 100), ATsi 1354 (SEQ ID NO: 106), ATsi 1356 (SEQ ID NO: 110), ATsi 1357 / ATsil 395 (SEQ ID NO: 112), ATsi1363 (SEQ ID NO: 124), or ATsi1374 (SEQ ID NO: 126), or a 13, 14, 15, 16, 17,18, 19 or 20 nucleoside long portion thereof. In a preferred embodiment, the siRNA compound comprises oris the antisense sequence of ATsilOl 8 (SEQ) ID NO: 8), ATsi 1318 (SEQ ID NO: 34), ATsil 321 (SEQ ID NO: 40), ATsil 325 (SEQ ID NO: 48), ATsi 1327 (SEQ ID NO: 52), ATsil 339 / ATsil394 (SEQ ID NO: 76), ATsi1357 / ATsi1395 (SEQ ID NO: 112), ATsi1363 (SEQ ID NO: 124), or ATsi1374 (SEQ ID NO: 126), or a 13, 14, 15, 16, 17, 18, 19 or 20 nucleoside long portion thereof. In certain embodiments, the antisense nucleotide sequences shown in Tables 2, 6 or 10, or portions thereof, can be chemically modified with Advanced RNA Targeting (ARNATAR) motifs (reference is made to WO2024137543, which is incorporated-by-reference herein) in order to improve speed, stability, durability, specificity, safety, and potency of siRNA compounds. In some embodiments, the antisense strand is in a salt form.

[0121] In one embodiment, a double-stranded ribonucleic acid (dsRNA) compound for inhibiting expression of CFB in a cell comprises a sense strand and an antisense strand forming the dsRNA, wherein the sense strand comprises or is any of the sense nucleotide sequences in any one of Tables 2, 6 or 10. In certain embodiments, the dsRNA is an siRNA compound, wherein the sense strand comprises or is any of the sense nucleotide sequences in any one of Tables 2, 6 or 10. In certain embodiments, the sense nucleotide sequence comprises a 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleoside long portion of any sequence shown in Tables 2, 6 or 10. In certain embodiments, the sense nucleotide sequences comprises or is the sense nucleotide sequence of ATsi 1016 (SEQ ID NO: 3), ATsi1017 (SEQ ID NO: 5), ATsilOl 8 / ATsi1374 (SEQ ID NO: 9), ATsilO19 (SEQ ID NO: 11), ATsi 1020 (SEQ ID NO: 17), ATsi 1021 (SEQ ID NO: 27), ATsi 1022 (SEQ ID NO: 29), ATsil 318 (SEQ ID NO: 35), ATsi 1321 (SEQ ID NO: 41), ATsil 323 (SEQ ID NO: 45), ATsi 1325 (SEQ ID NO: 49), ATsi 1327 (SEQ ID NO: 53), ATsil 339 / ATsi 1394 (SEQ ID NO: 77), ATsi 1348 (SEQ ID NO: 95), ATsi 1349 (SEQ ID NO: 97), ATsi1351 (SEQ ID NO: 101), ATsi 1354 (SEQ ID NO: 107), ATsi 1356 (SEQ ID NO: 111), ATsil 357 / ATsil 395 (SEQ ID NO: 113), or ATsil 363 (SEQ ID NO: 12.5), or a 13, 14, 15, 16, 17, 18, 19 or 20 nucleoside long portion thereof. In a preferred embodiment, the siRNA compound comprises or is the sense sequence of ATsi 1018 / ATsi1374 (SEQ ID NO: 9), ATsi1318 (SEQ ID NO: 35), ATsi 1321 (SEQ ID NO: 41), ATsi 1325 (SEQ ID NO: 49), ATsi 1327 (SEQ ID NO: 53), ATsi 1339 / ATsi 1394 (SEQ ID NO: 77), ATsil 357 / ATsil 395 (SEQ ID NO: E13), or ATsi1363 (SEQ ID NO: 125), or a 13, 14, 15, 16, 17, 18, 19 or 20 nucleoside long portion thereof. In certain embodiments, the sense nucleotide sequences shown in Tables 2, 6 or 10, or portions thereof, can be chemically modified withAdvanced RNA Targeting (ARNATAR) motifs (reference is made to WO2024137543 which is incorporated-by-reference herein) in order to improve speed, stability, durability, specificity, safety and potency of siRNA compounds. In some embodiments, the sense strand is in a salt form.

[0122] In one embodiment, a double- stranded ribonucleic acid (dsRNA) compound for inhibiting expression of CFB in a cell comprises a sense strand and an antisense strand forming the dsRNA, wherein the sense strand comprises or is any of the sense nucleotide sequences in any one of Tables 2, 6 or 10, and wherein the antisense strand comprises or is any of the antisense nucleotide sequences in any one of Tables 2, 6 or 10. In certain embodiments, the dsRNA is an siRNA compound, wherein the sense strand comprises or is any of the sense nucleotide sequences in any one of Tables 2, 6 or 10, and wherein the antisense strand comprises or is any of the antisense nucleotide sequences in any one of Tables 2, 6 or 10. In certain embodiments, the sense strand or antisense strand nucleotide sequence comprises a 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleoside long portion of any sequence shown in Tables 2, 6 or 10. In certain embodiments, the sense and or antisense nucleotide sequences comprises of is the nucleotide sequences of ATsi 1016 (SEQ ID NOs: 3 and 2), ATsi1017 (SEQ ID NOs: 5 and 4), ATsilO18 (SEQ ID NOs; 9 and 8), ATsilO19 (SEQ ID NOs: 11 and 10), ATsi 1020 (SEQ ID NOs: 17 and 16), ATsi 1021 (SEQ ID NOs; 27 and 26), ATsi 1022 (SEQ ID NOs: 29 and 28), ATsi1318 (SEQ ID NOs: 35 and 34), ATsi1321 (SEQ ID NOs: 41 and 40), ATsi 1323 (SEQ ID NOs: 45 and 44), ATsi 1325 (SEQ ID NOs: 49 and 48), ATsi 1327 (SEQ ID NOs: 53 and 52), ATsi1339 / ATsi1394 (SEQ ID NOs: 77 and 76), ATsil348 (SEQ ID NOs: 95 and 94), ATsi 1349 (SEQ ID NOs: 97 and 96), ATsi 1351 (SEQ ID NOs: 101 and 100), ATsil354 (SEQ ID NOs: 107 and 106), ATsil356 (SEQ ID NOs: 111 and 110), ATsi 1357 / ATsi 1395 (SEQ ID NOs: 113 and 112), ATsi1363 (SEQ ID NOs: 125 and 124), or ATsi1374 (SEQ ID NOs: 9 and 126), or a 13, 14, 15, 16, 17, 18, 19 or 20 nucleoside long portion thereof. In a preferred embodiment, the siRNA compound comprises or is the sense strand and antisense strand nucleotide sequences of ATsil018 (SEQ ID NOs: 9 and 8), ATsi1318 (SEQ ID NOs: 35 and 34), ATsi 1321 (SEQ ID NOs: 41 and 40), ATsi 1325 (SEQ ID NOs: 49 and 48), ATsiI327 (SEQ ID NOs: 53 and 52), ATsi1339 / ATsi1394 (SEQ ID NOs: 77 and 76), ATsi 1357 / ATsi 1395 (SEQ ID NOs: 113 and 112), ATsi1363 (SEQ ID NOs: 125 and 124), or ATsi1374 (SEQ ID NOs: 9 and 126), or a 13, 14, 15, 16, 17, 18, 19 or 20 nucleoside long portion thereof. In certain embodiments, the sense and / or antisense nucleotide sequences shown in Tables 2. 6 or 10 can be chemically modified with Advanced RNA Targeting (ARNATAR) motifs(reference is made to WO2024137543 which is incorporated-by-reference herein) in order to improve speed, stability, durability, specificity, safety and potency of siRNA compounds. In some embodiments, the sense and / or antisense strand is in a salt form.

[0123] In certain embodiments, the dsRNA compound comprises at least one modified nucleotide. In another embodiment, substantially all of the nucleotides of the sense strand are modified nucleotides; substantially ail of the nucleotides of the antisense strand are modified nucleotides; or substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides. Substantially all refers to at least about 70%, 75%, 80%, 85%, 90% or 95% of the nucleosides are modified. In a further embodiment, all of the nucleotides of the sense strand are modified nucleotides; all of the nucleotides of the antisense strand are modified nucleotides; or all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides,

[0124] In certain embodiments, the dsRNA compound comprises a strand comprising at least one phosphorothioate internucleotide (PS) linkage. In certain embodiments, the dsRNA compound comprises a strand comprising a phosphorothioate internucleotide (PS) linkage adjacent to a deoxyribonucleoside (D) or ribonucleoside (R). In certain embodiments, the dsRNA compound comprises a phosphorothioate internucleotide (PS) linkage adjacent to the deoxyribonucleoside (D) or ribonucleoside (R) on the 5’ side, the 3’ side or both sides. In certain embodiments, the dsRNA compound comprises a strand comprising a phosphorothioate internucleotide (PS) linkage adjacent to 2 nucleosides at the 5’ end of the strand and / or 2 nucleosides at the 3’ end of the strand.

[0125] In certain embodiments, the dsRNA compounds or compositions comprise an siRNA. In a preferred embodiment, the siRNA comprises any one of the siRNAs listed in any one of Tables 2, 6 or 10. In a preferred embodiment, the dsRNA comprises or is any of the nucleotides with chemical modifications of ATsil016'(SEQ ID NOs: 3 and 2), ATsi1017 (SEQ ID NOs: 5 and 4), ATsi1018 (SEQ ID NOs: 9 and 8), ATsilO19 (SEQ ID NOs: 11 and 10), ATsil020 (SEQ ID NOs: 17 and 16), ATsilO21 (SEQ ID NOs: 27 and 26), or ATsilO22 (SEQ ID NOs: 29 and 28), ATsi1318 (SEQ ID NOs: 35 and 34), ATsi1321 (SEQ ID NOs: 41 and 40), ATsil323 (SEQ ID NOs: 45 and 44), ATsi1325 (SEQ ID NOs: 49 and 48), ATsi1327 (SEQ ID NOs: 53 and 52), ATsi1339 / ATsi1394 (SEQ ID NOs: 77 and 76), ATsil348 (SEQ ID NOs: 95 and 94), ATsil349 (SEQ ID NOs: 97 and 96), ATsil351 (SEQ ID NOs: 101 and 100), ATsi 1354 (SEQ ID NOs: 107 and 106), ATsil356 (SEQ ID NOs: 111 and 110), ATsi1357 / ATsi1395 (SEQ ID NOs: 113 and11.2), ATsi1363 (SEQ ID NOs: 125 and 124), or ATsi1374 (SEQ ID NOs: 9 and 126). In a more preferred embodiment, the siRNA comprises the nucleotides with chemical modifications of ATsi1018 (SEQ ID NOs: 9 and 8), ATsi1318 (SEQ ID NOs: 35 and 34), ATsi1321 (SEQ ID NOs: 41 and 40), ATsi1325 (SEQ ID NOs: 49 and 48), ATsi 1327 (SEQ ID NOs: 53 and 52), ATsi1339 / ATsi1394 (SEQ ID NOs: 77 and 76), ATsi1357 / ATsi1395 (SEQ ID NOs: 113 and 112), ATsi1363 (SEQ ID NOs: 125 and 124), or ATsi1374 (SEQ ID NOs: 9 and 126).

[0126] Certain embodiments disclosed herein provide a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (ATsi1018 as shown in Table 6, SEQ ID NO: 9) comprises the formula: (mC)*(fA)*(mA)(mG)(fA)(mG)(fA)(mA)(fG)(fU)(mC)(mG)(fU)(mU)(fU)(mC)(mA)(fU)(mU)*‘ (T)*(T)[AN-GalNAc];HG Ni-iAc

[0127]

[0128] Certain embodiments disclosed herein provide a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the antisense strand (ATa994 as shown in Table 6, SEQ ID NO: 8) comprises the formula: (5p)(mA)*(A)*(mU)(fG)(mA)(fA)(mA)*(mC)(fG)(mA)(mC)(fU)(mU)(fC)(mU)(fC)(mU)(mU)(G)*(mU)*(mG);

[0129]

[0130] Certain ' embodiments disclosed herein provide a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the antisense strand (ATal374 as shown in Table 10, SEQ ID NO; 126) comprises the formula; (5p)(mA)*(A)*(mU)(fG)(mA)(fA)(mA)(mC)(fG)(mA)(mC)(fU)(mU)(fC)(mU)(fC)(mU)(mU)(f G

[0131]

[0132] )*(mU)*(mG);

[0133]

[0134] Certain embodiments disclosed herein provide a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (ATsi1394 as shown in Table 10, SEQ ID NO: 77) comprises the formula: (mA)*(fU)*(mA)(mU)(fG)(mU)(fU)(mU)(fU)(fC)(mU)(rnA)(fC)(mC)(fA)(mA)(mA)(fU)(mU)* (T)*(T)[AN-GalNAcJ;

[0135]

[0136] Certain embodiments disclosed herein provide a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the antisense strand (ATal339 as shown in Table 10, SEQ ID NO: 76) comprises the formula: (5p)(mA)*(A)*(mU)(fU)(mU)(fG)(G)*(mU)(fA)(mG)(mA)(fA)(mA)(fA)(mC)(fA)(mU)(mC)(T )*(mU)*(mC);0

[0137] II

[0138]

[0139] Certain embodiments disclosed herein provide a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (Al’s 1395 as shown in Table 10, SEQ ID NO: 113) comprises the formula: (mU)*(fD')*(mC)(mA)(fC)(mA)(fA)(mG)(fA)(fG)(mA)(mA)(fG)(mU)(fC)(mG)(mU)(fU)(mU)* (T)*(T)[AN-GalNAc];

[0140]

[0141] Certain embodiments disclosed herein provide a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the antisense strand (ATa1357 as shown in Table 10, SEQ ID NO: 112) comprises the formula: (5p)(mA)*(A)*(mA)(fC)(mG)(fA)(C)*(mU)(fU)(mC)(mU)(fC)(mU)(fU)(mG)(fU)(G)(mA)(A)*(mC)*(mU);0 HO-P-0 0‘

[0142]

[0143] Certain preferred embodiments disclosed herein provide a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (ATs1018 as shown in Table 6, SEQ ID NO: 9) comprises the formula: (mC)*(fA)*(mA)(mG)(fA)(mG)(fA)(mA)(fG)(fU)(mC)(mG)(fU)(mU)(fU)(mC)(mA)(fU)(mU)* (T)*(T)[AN-GalNAc] (structure shown above), and the antisense strand (ATa994 as shown in Table 6, SEQ ID NO: 8) comprises the formula: (5p)(mA)*(A)*(mU)(fG)(mA)(fA)(A)*(mC)(fG)(mA)(mC)(fU)(mU)(fC)(mU)(fC)(mU)(mU)(G)*(mU)*(mG) (structure shown above), or the antisense strand (ATa1374 as shown in Table 10, SEQ ID NO: 126) comprises the formula: (5p)(mA)*(A)*(mU)(fG)(mA)(fA)(mA)(mC)(fG)(mA)(mC)(fU)(mU)(fC)(mU)(fC)(mU)(mU)(fG)*(mU)*(mG) (structure shown above).

[0144] Certain preferred embodiments disclosed herein provide a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (ATs1394 as shown in Table 10, SEQ ID NO: 77) comprises the formula:

[0145]

[0146] (mA)*(fG)*(mA)(mU)(fG)(mU)(fU) (T)*(T)[AN-GalNAc] (structure shown above), the antisense strand (ATal339 as shown in Table 10, SEQ ID NO: 76) comprises the formula: (5p)(mA)*(A)*(mU)(fU)(mU)(fG)(G)*(mU)(fA)(mG)(mA)(fA)(mA)(fA)(mC)(fA)(mU)(mC)(T )*(mU)*(mC) (structure shown above).

[0147] Certain preferred embodiments disclosed herein provide a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (ATs1395 as shown in Table 10, SEQ ID NO: 113) comprises the formula: (mU)*(fU)*(mC)(mA)(fC)(mA)(fA)(mG)(fA)(fG)(mA)(mA)(fG)(mU)(fC)(mG)(mU)(fU)(mU)* (T)*(T)[AN-GalNAc] (structure shown above), and the antisense strand (ATal357 as shown in Table 10, SEQ ID NO: 112) comprises the formula: (5p)(mA)’*(A)*(mA)(fC)(mG)(fA)C*(mU)(fU)(mC)(mU)(fC)(mU)(fU)(mG)(fU)(mG)(mA)A*( mC)*(mU) (structure shown above).In certain embodiments, the sense and / or antisense strand of ATsilO16, ATsilO17, ATsilO18, ATsilO19, ATsil020;ATsilO21, or ATsilO22, ATsi1318, ATsi1321, ATsil323, ATsi1325, ATsi1327, ATsil339, ATsil348, ATsil349, ATsil351, ATsil354, ATsil356, ATsil357, ATsi1363, ATsi1374, ATsil394, or ATsil395 is a salt.

[0148] In particular embodiments, the sense and / or antisense strand consists of the nucleotide sequences as described above.

[0149] dsRNA can be trafficked into target cells by a variety of modalities. In certain embodiments, dsRNA compounds enter cells via viral delivery vectors, lipid-based delivery, polymer-based delivery, and / or conjugate-based delivery.

[0150] In certain embodiments, the dsRNA compound described herein further comprises a conjugate. In certain embodiments, the siRNA compound listed in any one of Tables 2, 6, or 10 comprises a conjugate. The conjugate can be selected from cholesterols, lipids, carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes. In a preferred embodiment, the conjugate is an N~ Acetylgalactosamine-comprising moiety (GalNAc). In an embodiment, the conjugate can be attached to the 3’ end of a sense strand. In a preferred embodiment, the conjugated dsRNA compound is an siRNA compound further conjugated to a GalNAc.

[0151] In certain embodiments, the dsRNA compounds or compositions disclosed herein comprise a salt of the dsRNA compound. In certain embodiments, the siRNA compounds or compositions disclosed herein comprise a salt of the siRNA compounds disclosed in the tables herein below. In certain embodiments, the compounds or compositions disclosed herein comprise a salt of the oligonucleotide strands disclosed in the tables hereinbelow.

[0152] In certain embodiments, the dsRNA compounds or compositions comprise a dsRNA compound that inhibits expression of a CFB target nucleic acid by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%. In certain embodiments, the dsRNA compound is an siRNA compound that inhibits expression of a CFB target nucleic acid by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98’% or 99%. In certain embodiments, the compound or composition that inhibits expression of a CFB is as provided in Tables 2, 6 or 10. In a preferred embodiment, the siRNA compound comprises or is any one of the nucleotide sequences with chemical modifications of ATsilO16 (SEQ ID NOs: 3 and 2), ATsil017 (SEQ ID NOs: 5 and 4), ATsil018 (SEQ ID NOs: 9 and 8), ATsi 1019 (SEQ ID NOs: 11 and 10), ATsi 1020 (SEQ ID NOs: 17 and 16), ATsi 1021 (SEQID NOs: 27 and 26), or ATsi 1022 (SEQ ID NOs: 29 and 28), ATsi 1318 (SEQ ID NOs: 35 and 34), ATsi 1321 (SEQ ID NOs: 41 and 40), ATsi1323 (SEQ ID NOs: 45 and 44), ATsil 325 (SEQ ID NOs; 49 and 48), ATsi 1327 (SEQ ID NOs: 53 and 52), ATsi 1339 / ATsi 1394 (SEQ ID NOs: 77 and 76), ATsi 1348 (SEQ ID NOs 95 and 94), ATsi 1349 (SEQ ID NOs: 97 and 96), ATsi 1351 (SEQ ID NOs: 101 and 100), ATsi 1.354 (SEQ ID NOs: 107 and 106), ATsi1356 (SEQ ID NOs: 111 and 110), ATsi1357 / ATsi1395 (SEQ ID NOs: 113 and 112), ATsi1363 (SEQ ID NOs: 125 and 124), or ATsi1374 (SEQ ID NOs: 9 and 126),

[0153] In certain embodiments, a pharmaceutical composition is provided. The composition which is for inhibiting expression of a gene encoding CFB comprises a dsRNA compound, or salt thereof, alone or in combination with a pharmaceutically acceptable carrier, diluent and / or excipient. In certain embodiments, the dsRNA compound is in a buffer solution. The buffer solution can comprise acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof, In one embodiment, the buffer solution is phosphate buffered saline (PBS). In certain embodiments, the dsRNA compound in the pharmaceutical composition is an siRNA compound. In certain embodiments, the siRNA compound is as provided in Tables 2, 6 or 10. In a preferred embodiment, the siRNA compound comprises or is any one of the nucleotide sequences with chemical modifications of ATsi 1016 (SEQ ID NOs: 3 and 2), ATsi 1017 (SEQ ID NOs: 5 and 4), ATsi 1018 (SEQ ID NOs: 9 and 8), ATsi 1019 (SEQ ID NOs: 11 and 10), ATsi 1020 (SEQ ID NOs: 17 and 16), ATsi 1021 (SEQ ID NOs: 27 and 26), or ATsi 1022 (SEQ ID NOs: 29 and 28), ATsi1318 (SEQ ID NOs: 35 and 34), ATsil 321 (SEQ ID NOs: 41 and 40), ATsi 1323 (SEQ ID NOs: 45 and 44), ATsi 1325 (SEQ ID NOs: 49 and 48), ATsi 1327 (SEQ ID NOs: 53 and 52), ATsi 1339 / ATsi 1394 (SEQ ID NOs: 77 and 76), ATsil 348 (SEQ ID NOs: 95 and 94), ATsi 1349 (SEQ ID NOs: 97 and 96), ATsil351 (SEQ ID NOs: 101 and 100), ATsil354 (SEQ ID NOs: 107 and 106), ATsil356 (SEQ ID NOs: 111 and 110), ATsil 357 / ATsi 1395 (SEQ ID NOs: 113 and 112), ATsi1363 (SEQ ID NOs: 125 and 124), or ATsi1374 (SEQ ID NOs: 9 and 126).

[0154] Certain embodiments disclosed herein provide a method of inhibiting CFB expression in a cell, the method comprising contacting the cell with a dsRNA compound, or salt thereof, or composition disclosed herein in an amount sufficient to inhibit expression of CFB, thereby inhibiting expression of CFB in the cell. In certain embodiments, the method further comprises assessing the expression level of CFB protein and / or mRNA in the cell. In certain embodiments, the dsRNA compound is an siRNA compound. In certain embodiments, the siRNA compound orcomposition that inhibits expression of a CFB is as provided in Tables 2, 6 or 10. In a preferred embodiment, the siRNA comprises or is any one of the nucleotide sequences with chemical modifications of ATsilOl 6 (SEQ ID NOs: 3 and 2), ATsilO17 (SEQ ID NOs: 5 and 4), ATsilOl 8 (SEQ ID NOs: 9 and 8), ATsilOl 9 (SEQ ID NOs: 11 and 10), ATsil020 (SEQ ID NOs: 17 and 16), ATsilO21 (SEQ ID NOs: 27 and 26), or ATsilO22 (SEQ ID NOs: 29 and 28), ATsi1318 (SEQ ID NOs: 35 and 34), ATsi1321 (SEQ ID NOs: 41 and 40), ATsil323 (SEQ ID NOs: 45 and 44), ATsi1325 (SEQ ID NOs: 49 and 48), ATsi1327 (SEQ ID NOs: 53 and 52), ATsi1339 / ATsi1394 (SEQ ID NOs: 77 and 76), ATsil348 (SEQ ID NOs: 95 and 94), ATsil349 (SEQ ID NOs: 97 and 96), ATsil351 (SEQ ID NOs: 101 and 100), ATsil354 (SEQ ID NOs: 107 and 106), ATsil356 (SEQ ID NOs: 111 and 110), ATsi1357 / ATsi1395 (SEQ ID NOs: 113 and 112), ATsi1363 (SEQ ID NOs: 125 and 124), or ATsi1374 (SEQ ID NOs; 9 and 126)., In certain embodiments, the cell is a mammalian cell. In a preferred embodiment, the cell is a human cell,

[0155] Certain embodiments of the invention provide a method for treating and / or preventing a CFB associated disease, disorder and / or condition in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a dsRNA compound or composition disclosed herein in an amount sufficient to inhibit expression of CFB, whereby inhibiting expression of CFB in the subject treats and / or prevents the CFB associated disease, disorder and / or condition in the subject, In certain embodiments, the dsRNA compound is an siRNA compound. In certain embodiments, the compound or composition that inhibits expression of a CFB is as provided in Tables 2, 6 or 10. In a preferred embodiment, the siRNA comprises or is any one of the nucleotide sequences with chemical modifications of In certain embodiments, the dsRNA compound is an siRNA compound. In a preferred embodiment, the siRNA comprises or is any one of the nucleotide sequences with chemical modifications of ATsilO16 (SEQ ID NOs: 3 and 2), ATsi1017 (SEQ ID NOs: 5 and 4), ATsil018 (SEQ ID NOs: 9 and 8), ATsilO19 (SEQ ID NOs: 11 and 10), ATsil020 (SEQ ID NOs: 17 and 16), ATsil021 (SEQ ID NOs: 27 and 26), or ATsilO22 (SEQ ID NOs: 29 and 28), ATsi1318 (SEQ ID NOs: 35 and 34), ATsi1321 (SEQ ID NOs: 41 and 40), ATsil323 (SEQ ID NOs: 45 and 44), ATsi1325 (SEQ ID NOs: 49 and 48), ATsi1327 (SEQ ID NOs: 53 and 52), ATsi1339 / ATsi1394 (SEQ ID NOs: 77 and 76), ATsil348 (SEQ ID NOs: 95 and 94), ATsil349 (SEQ ID NOs: 97 and 96), ATsil351 (SEQ ID NOs: 101 and 100), ATsil354 (SEQ ID NOs: 107 and 106), ATsil356 (SEQ ID NOs: 111 and 110), ATsil357 / ATsil395 (SEQ ID NOs: 113 and 112), ATsi1363 (SEQ ID NOs: 125 and 124), orATsi1374 (SEQ ID NOs: 9 and 126). Also contemplated are salt forms of the strands comprising the siRNA compound. In a preferred embodiment, the CFB associated disease, disorder and / or condition is an inflammatory disease, disorder and / or condition. In a preferred embodiment, the CFB associated inflammatory disease, disorder and / or condition is an autoimmune disease, disorder and / or condition. In a preferred embodiment, the CFB associated inflammatory disease, disorder and / or condition includes, but, is not limited to: age-related macular degeneration (AMD), atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), diabetes (Type 2), metabolic syndrome, insulin resistance, cardiovascular disease, and dyslipidemia. In a preferred embodiment, the CFB associated autoimmune disease, disorder and / or condition includes, but, is not limited to: systemic lupus erythematosus (SLE), psoriasis, dermatomyositis, eczema, vitiligo, psoriasis, primary immunoglobulin A nephropathy (IgAN), arthritis (e.g., reactive arthritis, rheumatoid arthritis (RA)), diabetes (Type 1), Addison's disease, Graves’ disease, Hashimoto's thyroiditis, myasthenia gravis, scleroderma, multiple sclerosis (MS), Guillain-Barre syndrome, Crohn’s disease, ulcerative colitis (UC), vasculitis, Kawasaki disease, Celiac disease, inflammatory bowel disease (IBD), pernicious anemia, Raynaud's phenomenon, and Sjogren's syndrome. In certain embodiments, the subject is a mammal. In a preferred embodiment, the mammal is a human,

[0156] Certain embodiments of the invention provide an assay to determine the level of CFB inhibition in a sample from a subject. In certain embodiments, the CFB assay comprises: a) administering a compound or composition disclosed herein to a subject in an amount sufficient to inhibit expression of CFB; b) removing a sample from a subject; c) determining the amount of CFB protein present in the sample; Thereby determining the amount of CFB inhibition by the compound or composition. In certain embodiments, the sample is from blood, serum, urine and / or liver. In certain embodiments, the amount of CFB protein present in the sample is determined by isolating the CFB protein from the sample, Western Blotting the protein and probing with a CFB specific monoclonal antibody to assess the amount of CFB protein present. In certain embodiments, the amount of CFB protein present in the sample is determined using ELISA.

[0157] Certain embodiments of the invention provide a method for treating and / or preventing a CFB associated disease, disorder and / or condition in a subject, comprising administering to the subject in need thereof a therapeutically effective amount of a dsRNA compound listed in Tables 2, 6 or 10, or a pharmaceutical composition comprising any of the dsRNA compounds listed inTables 2, 6 or 10, thereby treating and / or preventing the CFB associated disease, disorder and / or condition in the subject, In certain embodiments, the dsRNA for treating a CFB associated disease, disorder and / or condition in the subject is an siRNA listed in Tables 2, 6 or 10. In a preferred embodiment, the siRNA comprises or is any one of the nucleotide sequences with chemical modifications of ATsilO16 (SEQ ID NOs: 3 and 2), ATsil017 (SEQ ID NOs: 5 and 4), ATsil018 (SEQ ID NOs: 9 and 8), ATsilO19 (SEQ ID NOs: 11 and 10), ATsil020 (SEQ ID NOs: 17 and 16), ATsi 1021 (SEQ ID NOs: 27 and 26), or ATsi 1022 (SEQ ID NOs: 29 and 28), ATsi 1318 (SEQ ID NOs: 35 and 34), ATsi 1321 (SEQ ID NOs: 41 and 40), ATsi 1323 (SEQ ID NOs: 45 and 44), ATsi 1325 (SEQ ID NOs: 49 and 48), ATsi 1327 (SEQ ID NOs: 53 and 52), ATsi 1339 / ATsi 1394 (SEQ ID NOs: 77 and 76), ATsi 1348 (SEQ ID NOs: 95 and 94), ATsil349 (SEQ ID NOs: 97 and 96), ATsil351 (SEQ ID NOs: 101 and 100), ATsi 1354 (SEQ ID NOs: 107 and 106), ATsi 1356 (SEQ ID NOs: 111 and 110), ATsi1357 / ATsi1395 (SEQ ID NOs: 113 and 112), ATsi1363 (SEQ ID NOs: 125 and 124), or ATsi1374 (SEQ ID NOs: 9 and 126). Also contemplated are salt forms of the strands comprising the siRNA compound. In a preferred embodiment, the CFB associated disease, disorder and / or condition is an inflammatory disease, disorder and / or condition. In a preferred embodiment, the CFB associated inflammatory disease, disorder and / or condition is an autoimmune disease, disorder and / or condition. In a preferred embodiment, the CFB associated inflammatory disease, disorder and / or condition includes, but, is not limited to: age-related macular degeneration (AMD), atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), diabetes (Type 2), metabolic syndrome, insulin resistance, cardiovascular disease, and dyslipidemia. In a preferred embodiment, the CFB associated autoimmune disease, disorder and / or condition includes, but is not limited to: systemic lupus erythematosus (SLE), psoriasis, dermatomyositis, eczema, vitiligo, psoriasis, primary immunoglobulin A nephropathy (IgAN), arthritis (e.g., reactive arthritis, rheumatoid arthritis (RA)), diabetes (Type 1), Addison’s disease, Graves' disease, Hashimoto's thyroiditis, myasthenia gravis, scleroderma, multiple sclerosis (MS), Guillain-Barre syndrome, Crohn's disease, ulcerative colitis (UC), vasculitis, Kawasaki disease, Celiac disease, inflammatory bowel disease (IBD), pernicious anemia, Raynaud's phenomenon, and Sjogren's syndrome. In certain embodiments, the subject is a mammal. In a preferred embodiment, the mammal is a human.

[0158] In certain embodiments, a symptom of a CFB associated disease, disorder and / or condition is treated, ameliorated and / or prevented in a subject comprising administering to the subject inneed thereof a therapeutically effective amount of a compound comprising or being any of the dsRNA listed in Tables 2, 6 or 10, or a pharmaceutical composition comprising or being any of the dsRNA compounds listed in Tables 2. 6 or 10. In certain embodiments, the dsRNA for treating the symptom in the subject is an siRNA listed in Tables 2, 6 or 10. In a preferred embodiment, the siRNA comprises or is any one of the nucleotide sequences with chemical modifications of ATsilO16 (SEQ ID NOs: 3 and 2), ATsilOU (SEQ ID NOs: 5 and 4), ATsil018 (SEQ ID NOs: 9 and 8), ATsi 1019 (SEQ ID NOs: 11 and 10), ATsi 1020 (SEQ ID NOs: 17 and 16), ATsi 1021 (SEQ ID NOs: 27 and 26), or ATsi 1022 (SEQ ID NOs: 29 and 28), ATsi1318 (SEQ ID NOs; 35 and 34), ATsi 1321 (SEQ ID NOs: 41 and 40), ATsil323 (SEQ ID NOs: 45 and 44), ATsi 1325 (SEQ ID NOs: 49 and 48), ATsi 1327 (SEQ ID NOs: 53 and 52), ATsi 1339 / ATsi 1394 (SEQ ID NOs: 77 and 76), ATsi 1348 (SEQ ID NOs: 95 and 94), ATsi 1349 (SEQ ID NOs: 97 and 96), ATsil351 (SEQ ID NOs: 101 and 100), ATsiI354 (SEQ ID NOs: 107 and 106), ATsil356 (SEQ ID NOs: 111 and 110), ATsi1357 / ATsi1395 (SEQ ID NOs: 113 and 112), ATsi1363 (SEQ ID NOs: 125 and 124), or ATsil 374 (SEQ ID NOs: 9 and 126). Also contemplated are salt forms of the strands comprising the ’siRNA compound. In certain embodiments, the CFB associated disease, disorder and / or condition is an inflammatory disease, disorder and / or condition. In certain embodiments, the inflammatory disease, disorder and / or condition is selected from one or more of the group consisting of inflammation, age-related macular degeneration (AMD), atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), diabetes (Type 2), metabolic syndrome, insulin resistance, cardiovascular disease, dyslipidemia, systemic lupus erythematosus (SEE), psoriasis, dermatomyositis, eczema, vitiligo, primary immunoglobulin A nephropathy (IgAN), arthritis (e.g., reactive arthritis, rheumatoid arthritis (RA)), diabetes (Type 1), Addison's disease, Graves’ disease, Hashimoto's thyroiditis, myasthenia gravis, scleroderma, multiple sclerosis (MS), Guillain-Barre syndrome, Crohn's disease, ulcerative colitis (UC), vasculitis, Kawasaki disease, Celiac disease, inflammatory bowel disease (IBD), pernicious anemia, Raynaud's phenomenon, and Sjogren's syndrome. In a preferred embodiment, the CFB associated disease, disorder and / or condition is systemic lupus erythematosus (SLE). In a preferred embodiment, the CFB associated disease, disorder and / or condition is primary immunoglobulin A nephropathy (IgAN). In a preferred embodiment, the CFB associated disease, disorder and / or condition is rheumatoid arthritis (RA). In certain embodiments, the subject is a mammal. In a preferred embodiment, the mammal is a human.Certain embodiments of the invention provide a method for treating, ameliorating and / or preventing a subject having a disease, disorder and / or condition that would benefit from reduction in CFB expression, comprising administering to the subject in need thereof a therapeutically effective amount of a compound comprising or being any of the dsRNA compound fisted in Tables 2, 6 or 10, or a pharmaceutical composition comprising or being any of the dsRNA listed in Tables 2, 6 or 10, thereby treating, ameliorating and / or preventing the subject having the disorder that would benefit from reduction in CFB expression. In certain embodiments, the dsRNA compound is an siRNA listed in Tables 2, 6 or 10. In a preferred embodiment, the siRNA comprises or is any¬ one of the nucleotide sequences with chemical modifications of ATsi 1016 (SEQ ID NOs: 3 and 2), ATsilO17 (SEQ ID NOs: 5 and 4), ATsil018 (SEQ ID NOs: 9 and 8), ATsilO19 (SEQ ID NOs:

[0159]

[0160] 11 and 10), ATsi 1020 (SEQ ID NOs: 17 and 16), ATsil021 (SEQ ID NOs: 27 and 26), or ATsi 1022 (SEQ ID NOs: 29 and 28), ATsi13l8 (SEQ ID NOs: 35 and 34), ATsi 1321 (SEQ ID NOs: 41 and 40), ATsi 1323 (SEQ ID NOs: 45 and 44), ATsi1325 (SEQ ID NOs: 49 and 48), ATsi 1327 (SEQ ID NOs: 53 and 52), ATsi1339 / ATsi1394 (SEQ ID NOs: 77 and 76), ATsi 1348 (SEQ ID NOs: 95 and 94), ATsi 1349 (SEQ ID NOs: 97 and 96), ATsi 1351 (SEQ ID NOs: 101 and 100), ATsil354 (SEQ ID NOs: 107 and 106), ATsil356 (SEQ ID NOs: 111 and 110), ATsi 1357 / ATsil 395 (SEQ ID NOs: 113 and 112), ATsi1363 (SEQ ID NOs: 125 and 124), or ATsi1374 (SEQ ID NOs: 9 and 126). Also contemplated are salt forms of the strands comprising the siRNA compound. In certain embodiments, the disease, disorder and / or condition is a CFB associated disease, disorder and / or condition. In a preferred embodiment, the disease, disorder and / or condition that would benefit from reduction in CFB expression is an inflammatory disease, disorder and / or condition. In a preferred embodiment, the inflammatory disease, disorder and / or condition that would benefit from reduction in CFB expression is an autoimmune disease, disorder and / or condition. In a preferred embodiment, the disease, disorder and / or condition that would benefit from reduction in CFB expression is selected from the group of inflammation, age-related macular degeneration (AMD), atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), diabetes (Type 2), metabolic syndrome, insulin resistance, cardiovascular disease, dyslipidemia, systemic lupus erythematosus (SLE), psoriasis, dermatomyositis, eczema, vitiligo, psoriasis, primary immunoglobulin A nephropathy (IgAN), arthritis (e.g., reactive arthritis, rheumatoid arthritis (RA)), diabetes (Type 1), Addison's disease. Graves' disease, Hashimoto's thyroiditis, myasthenia gravis, scleroderma, multiple sclerosis (MS),Guillain-Barre syndrome, Crohn's disease, ulcerative colitis (UC), vasculitis, Kawasaki disease, Celiac disease, inflammatory bowel disease (IBD). pernicious anemia. Raynaud's phenomenon, and Sjogren's syndrome. In a preferred embodiment, the disease, disorder and / or condition that would benefit from reduction in CFB expression is systemic lupus erythematosus (SLE). In a preferred embodiment, the disease, disorder and / or condition that would benefit from reduction in CFB expression is primary immunoglobulin A nephropathy (IgAN). In a preferred embodiment, the disease, disorder and / or condition that would benefit from reduction in CFB expression is rheumatoid arthritis (RA). In certain embodiments, the subject is a mammal. In a preferred embodiment, the mammal is a human.

[0161] Certain embodiments provide a method for inhibiting the expression of CFB in a subject comprising the step of administering the dsRNA compound or composition comprising any of the dsRNA compounds described herein to the subject, in an amount sufficient to inhibit CFB expression. The dsRNA compound is administered subcutaneously or intravenously to the subject. In certain embodiments, the dsRNA compound inhibits expression of a CFB target nucleic acid by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%. In certain embodiments, the dsRNA compound is administered to the subject at a dose of about 0.01 mg / kg to about 50 mg / kg. In certain embodiments, the dsRNA compound is an siRNA compound that inhibits expression of a CFB target nucleic acid by at least about 70%, 75%, 80?%, 85%, 90%, 95%, 98% or 99%, In certain embodiments, the dsRNA compound is an siRNA compound that is administered to the subject at a dose of about 0,01 mg / kg to about 50 mg / kg. In certain embodiments, a preferred dose is selected from 700mg, 800mg and 900mg. In certain embodiments, a therapeutically effective amount of the compound or composition comprising the dsRNA compound described herein is dosed at about 150mg, 300mg or 600mg once every 3 months. In certain embodiments, a therapeutically effective amount of the compound or composition comprising the dsRNA compound described herein is dosed at about 150mg, 300mg or 600mg once every 6 months. Also contemplated are salt forms of the strands comprising the dsRNA compound. In certain embodiments, the subject is a mammal. In a preferred embodiment, the mammal is a human.

[0162] In certain embodiments, after administration of the dsRNA compound or composition comprising the dsRNA compound to a subject, the level of CFB in a sample(s) from the subject is determined. In certain embodiments, the level of CFB in the subject sample(s) is a CFB nucleic acid level or protein level in a blood, plasma, urine or liver tissue sample(s). In certainembodiments, the dsRNA compound is an siRNA compound.

[0163] In certain embodiments, the dsRNA compound or composition comprising dsRNA compound is administered alone or in combination with additional therapeutic agent(s) to a subject for treatment of a CFB associated disease, disorder and / or condition, or symptom thereof. In certain embodiments, the dsRNA compound is an siRNA compound listed in Tables 2, 6 or 10, In certain embodiments, the additional therapeutic agent is selected from the group consisting of immunosuppressants, non-steroidal anti-inflammatory drugs (NSAIDs), disease modifying anti¬ rheumatic drugs (DMARDs), intravenous immunoglobulins (IVIG), and insulin. In certain embodiments, the immunosuppressant is a steroid (e.g., prednisone, methylprednisolone, or dexamethasone), colchicine, hydroxychloroquine, sulfasalazine, dapsone, methotrexate, mycophenolate mofetil, azathioprine, anti-IL-1 biologic (e.g., anakinra, canakinumab, or rilonacept), anti-TNF biologic (e.g., infliximab, adalimumab, golimumab, etanercept, or certolizumab), anti-IL-6 biologic (e.g.. tocilizumab, or sarilumab), anti-complement biologic (e.g., eculizumab), anti-CD20 biologic (e.g., rituximab), anti-B cell growth factor biologic (e.g., belimumab), cyclosporine, anti~CTLA4 biologic (e.g., abatacept), anti-IL-17 biologic (e.g,, secukinumab, ixekizumab, or brodalumab), anti-IL-23 biologic (e.g., guselkumab or ustekinumab), anti-IL-5 biologic (e.g., mepolizumab, reslizumab, or benralizumab), anti-IL- 4 / anti-IL-13 biologic (e.g., dupilumab), anti-IgE biologic (e.g., omalizumab), anti-a4|37 integrin biologic (e.g., vedolizumab), or JAK inhibitor (e.g., tofacitinib, upadacitinib, or baricitinib). In certain embodiments, the NSAID is diclofenac, diflunisal, etodolac, fenoprofen, flurbiprofen, ibuprofen, indomethacin, ketoprofen, ketorolac, mefenamic acid, meloxicam, nabumetone, naproxen, oxaprozin, piroxicam, sulindac, tolxnetin, celecoxib, rofecoxib, or valdecoxib. In certain embodiments, the DMARD is methotrexate, leflunomide, hydroxychloroquine, sulfasalazine, infliximab, adalimumab, etanercept, rituximab, abatacept, tocilizumab, tofacitinib, and JAK inhibitors. In certain embodiments, the additional therapeutic agent(s), when used in combination with the compounds or compositions comprising dsRNA described herein, may provide a synergistic or additive effect in treating a CFB associated disease, disorder and / or condition.

[0164] In certain embodiments, the additional therapeutic agent(s), when used in combination with the dsRNA compounds or compositions comprising the dsRNA compound described herein, may provide a synergistic or additive effect in treating an CFB associated disease, disorder and / or condition.

[0165]

[0166] In certain embodiments, the subject in need of therapeutic treatment with a compound or composition disclosed herein is a mammal. In a preferred embodiment, the subject is a human.

[0167] Certain embodiments provide a process for making a dsRNA described herein comprising synthesizing an oligonucleotide on a solid support using phosphoramidite chemistry, thereby making the double-stranded (sense and antisense strand) ribonucleic acid (dsRNA) compound.

[0168] In one embodiment, a process for preparing a sense and / or antisense strand of a double¬ stranded ribonucleic acid (dsRNA) compound is provided, wherein the process comprises the steps of a) preparing the sense and / or antisense strand by sequential coupling of modified and / or unmodified nucleotides via the phosphoramidite oligonucleotide synthesis on a solid support; b) optionally, coupling an N-Acetylgalactosamine-comprising moiety (GalNAc) to the sense and / or antisense strand on the solid support via the phosphoramidite oligonucleotide synthesis; c) detaching the sense and / or antisense strand from the solid support and removing the solid support; and d) optionally, further purifying the sense and / or antisense strand, optionally using chromatography.

[0169] In one embodiment, a process for preparing a sense and / or antisense strand of a double¬ stranded ribonucleic acid (dsRNA) compound is provided, wherein the process comprises the steps of: a) coupling a moiety to a solid support via the phosphoramidite oligonucleotide synthesis, b) coupling a modified and / or unmodified nucleotide via the phosphoramidite oligonucleotide synthesis to the moiety on the solid support; c) sequentially coupling additional modified and / or unmodified nucleotides via the phosphoramidite oligonucleotide synthesis to prepare the sense and / or antisense strand; d) detaching the sense and / or antisense strand from the solid support and removing the solid support; and e) optionally, further purifying the sense and / or antisense strand, optionally using chromatography. In certain embodiments, the moiety coupled to the solid support is selected from GalNAc, cholesterol, lipid, carbohydrate, phospholipid, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluorescein, rhodamine, coumarin, dye, and the like. In a preferred embodiment, the moiety coupled to the solid support is an N-Acetylgalactosamine- comprising moiety (GalN Ac).

[0170] In one embodiment, a process for preparing a sense and / or antisense strand of a double¬ stranded ribonucleic acid (dsRNA) compound is provided, wherein the process comprises the steps of: a) coupling an N-Acetylgalactosamine-comprising moiety (GalNAc) to a solid support via the phosphoramidite oligonucleotide synthesis, b) coupling a modified and / or unmodified nucleotidevia the phosphoramidite oligonucleotide synthesis to the GalNAc on the solid support; c) sequentially coupling additional modified and / or unmodified nucleotides via the phosphoramidite oligonucleotide synthesis to prepare the sense and / or antisense strand; d) detaching the sense and / or antisense strand from the solid support and removing the solid support; and e) optionally, further purifying the sense and / or antisense strand, optionally using chromatography.

[0171] In one embodiment, a process of preparing a double-stranded ribonucleic acid (dsRNA) compound is provided, comprising: a) contacting the sense strand prepared according any one of the processes described herein with the antisense strand prepared according any one of the processes described herein in equimolar concentrations in a solution; b) optionally heating the solution to a temperature of about 94°C; and c) optionally reducing the temperature of the solution to about 25 °C.

[0172] The present invention also provides kits comprising any of the dsRNA compounds or any of the pharmaceutical compositions disclosed herein, and optionally, instructions for use. The present invention provides a vial comprising any of the compounds or any of the pharmaceutical compositions disclosed herein. The present invention provides a syringe comprising any of the compounds or any of the pharmaceutical compositions disclosed herein, In one embodiment, the invention provides a kit for performing a method of inhibiting expression of a CFB gene in a subject by administering to the subject in need thereof an amount effective to inhibit expression of the CFB in the subject. The kit comprises a dsRNA compound and instructions for use and, optionally, means for administering the dsRNA compound to a subject. In certain embodiments, the compound or pharmaceutical composition is a dsRNA compound listed in Tables 2, 6 or 10. In certain embodiments, the dsRNA compound is an siRNA compound listed in Tables 2, 6 or 10. In a preferred embodiment, the siRNA comprises or is any one of the nucleotide sequences with chemical modifications of ATsi 1016 (SEQ ID NOs: 3 and 2), ATsilO17 (SEQ ID NOs: 5 and 4), ATsilOl 8 (SEQ ID NOs: 9 and 8), ATsilO19 (SEQ ID NOs: 11 and 10), ATsil 020 (SEQ ID NOs: 17 and 16), ATsi 1021 (SEQ ID NOs: 27 and 26), or ATsi 1022 (SEQ ID NOs: 29 and 28), ATsi1318 (SEQ ID NOs: 35 and 34), ATsi 1321 (SEQ ID NOs: 41 and 40), ATsi 1323 (SEQ ID NOs: 45 and 44), ATsi 1325 (SEQ ID NOs: 49 and 48), ATsil 327 (SEQ ID NOs: 53 and 52), ATsil 339 / ATsil 394 (SEQ ID NOs: 77 and 76), ATsi 1348 (SEQ ID NOs: 95 and 94), ATsi 1349 (SEQ ID NOs: 97 and 96), ATsi 1351 (SEQ ID NOs: 101 and 100), ATsi 1354 (SEQ ID NOs: 107 and 106), ATsi 1356 (SEQ ID NOs: 111 and 110), ATsi1357 / ATsi1395 (SEQ ID NOs: 113 and112), ATsi1363 (SEQ ID NOs: 125 and 124), or ATsi1374 (SEQ ID NOs: 9 and 126). Also contemplated are salt forms of the strands comprising the siRNA compound,

[0173] Certain embodiments provide a double-stranded ribonucleic acid (dsRNA) compound as described herein for use in medicine.

[0174] Certain embodiments provide a double-stranded ribonucleic acid (dsRNA) compound described herein for use in treating, ameliorating, and / or preventing a CFB associated disease, disorder and / or condition in a subject.

[0175] Certain Embodiments of the Invention

[0176] Embodiment 1 provides a double-stranded ribonucleic acid (dsRNA) compound for inhibiting expression of CFB in a cell, wherein the dsRNA compound comprises a sense strand and an antisense strand forming the dsRNA compound, wherein the antisense strand comprises or is any of the antisense sequences in any one of Tables 2, 6 or 10,

[0177] Embodiment 2 provides a double-stranded ribonucleic acid (dsRNA) compound for inhibiting expression of CFB in a cell, wherein the dsRNA compound comprises a sense strand and an antisense strand forming the dsRNA compound, wherein the sense strand comprises any of the sense sequences in any one of Tables 2, 6 or 10,

[0178] Embodiment 3 provides the double-stranded ribonucleic acid (dsRNA) compound of embodiment I or 2, wherein the dsRNA compound comprises the sense strand of embodiment 2 and the antisense strand of embodiment 1.

[0179] Embodiment 4 provides the double-stranded ribonucleic acid (dsRNA) compound of any preceding embodiments 1-3, wherein the dsRNA compound is an shRNA compound or an siRNA compound.

[0180] Embodiment 5 provides the double-stranded ribonucleic acid (dsRNA) compound of any preceding embodiments 1-4, wherein the dsRNA comprises at least one modified nucleotide.

[0181] Embodiment 6 provides the double-stranded ribonucleic acid (dsRNA) compound of any preceding embodiments 1-5, wherein substantially all of the nucleotides of the sense strand are modified nucleotides; substantially all of the nucleotides of the antisense strand are modified nucleotides; or substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides.Embodiment 7 provides the double-stranded ribonucleic acid (dsRNA) compound of any preceding embodiments 1-6, wherein all of the nucleotides of the sense strand are modified nucleotides; all of the nucleotides of the antisense strand are modified nucleotides; or all of the nucleotides of the sense strand and all of the nucleotides of the antisense strand are modified nucleotides.

[0182] Embodiment 8 provides the double-stranded ribonucleic acid (dsRNA) compound of any preceding embodiments 1-7, wherein the strand comprises at least one phosphorothioate intemucleotide (PS) linkage.

[0183] Embodiment 9 provides the double-stranded ribonucleic acid (dsRNA) compound of any preceding embodiments 1 -8, wherein the strand comprises a phosphorothioate internucleotide (PS) linkage adjacent to a deoxyribonucleoside (D) or ribonucleoside (R),

[0184] Embodiment 10 provides the double-stranded ribonucleic acid (dsRNA) compound of embodiment 9, wherein the phosphorothioate internucleotide (PS) linkage is adjacent to the deoxyribonucleoside (D) or ribonucleoside (R) on the 5’ side, the 3’ side or both sides.

[0185] Embodiment 11 provides the double-stranded ribonucleic acid (dsRNA) compound of embodiment 8, wherein the strand comprises a phosphorothioate internucleotide (PS) linkage adjacent to 2 nucleosides at the 5’ end of the strand and / or 2 nucleosides at the 3’ end of the strand.

[0186] Embodiment 12 provides the double-stranded ribonucleic acid (dsRNA) compound of any of the preceding embodiments 1-11 which is an siRNA comprising any one of siRNAs in any one of Tables 2, 6 or 10.

[0187] Embodiment 13 provides the double-stranded ribonucleic acid (dsRNA) compound of any preceding embodiments 1-12, further comprising a conjugate.

[0188] Embodiment 14 provides the double-stranded ribonucleic acid (dsRNA) compound of embodiment 13, wherein the conjugate is selected from cholesterols, lipids, carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, peptides, dyes.

[0189] Embodiment 15 provides the double-stranded ribonucleic acid (dsRNA) compound of embodiment 13, wherein the conjugate is an N-Acetylgalactosamine-comprising moiety (GalNAc),

[0190] Embodiment 16 provides the double-stranded ribonucleic acid (dsRNA) compound of any preceding embodiments 13-15, wherein the conjugate is attached to the 3’ end of the sense strand.Embodiment 17 provides the double-stranded ribonucleic acid (dsRNA) compound of any preceding embodiments 1-16, wherein the dsRNA compound inhibits expression of an CFB target nucleic acid by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98 % or 99%.

[0191] Embodiment 18 provides a pharmaceutical composition for inhibiting expression of CFB comprising the double-stranded ribonucleic acid (dsRNA) compound of any preceding embodiments 1-17, alone or in combination with a pharmaceutically acceptable carrier or excipient.

[0192] Embodiment 19 provides the pharmaceutical composition of embodiment 18, wherein the dsRNA compound is in a buffer solution.

[0193] Embodiment 20 provides the pharmaceutical composition of embodiment 19, wherein the buffer solution comprises acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof.

[0194] Embodiment 21 provides the pharmaceutical composition of embodiment 20, wherein the buffer solution is phosphatc-buffcrcd saline (PBS).

[0195] Embodiment 22 provides a method of treating and / or preventing an CFB associated disease, disorder and / or condition in a subject, comprising administering to the subject a therapeutically effective amount of the dsRNA compound or pharmaceutical composition comprising the dsRNA compound of any preceding embodiments 1-21, thereby treating and / or preventing the CFB associated disease, disorder and / or condition in the subject.

[0196] Embodiment 23 provides the method of embodiment 22 wherein the CFB associated disease, disorder and / or condition is an inflammatory disease, disorder and / or condition.

[0197] Embodiment 24 provides the method of embodiment 22, wherein the inflammatory disease, disorder and / or condition is an autoimmune disease, disorder and / or condition.

[0198] Embodiment 25 provides the method of embodiment 23, wherein the inflammatory disease, disorder and / or condition is any of age-related macular degeneration (AMD), atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), diabetes (Type 2), metabolic syndrome, insulin resistance, cardiovascular disease, dyslipidemia, systemic lupus erythematosus (SLE), psoriasis, dermatomyositis, eczema, vitiligo, psoriasis, primary immunoglobulin A nephropathy (IgAN), arthritis (e.g., reactive arthritis, rheumatoid arthritis (RA)), diabetes (Type 1), Addison's disease, Graves' disease, Hashimoto's thyroiditis, myasthenia gravis, scleroderma, multiple sclerosis (MS), Guillain-Barre syndrome, Crohn's disease, ulcerativecolitis (UC), vasculitis, Kawasaki disease, Celiac disease, inflammatory bowel disease (TBD), pernicious anemia, Raynaud's phenomenon, and Sjogren’s syndrome,

[0199] Embodiment 26 provides the method of any one of embodiments 22-25, wherein the dsRNA compound inhibits the expression of CFB RNA by at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%.

[0200] Embodiment 27 provides a method of treating a subject having a disease, disorder and / or condition that would benefit from reduction in CFB expression, comprising administering to the subject a therapeutically effective amount of the dsRNA compound of any one of embodiments 1- 17, or the pharmaceutical composition of any one of embodiments 18-21, thereby treating the subject having the disease, disorder and / or condition that would benefit from reduction in CFB expression.

[0201] Embodiment 28 provides a method of preventing at least one symptom in a subject having a disease, disorder and / or condition that would benefit from reduction in CFB expression, comprising administering to the subject a prophylactically effective amount of the dsRNA compound of any one of embodiments 1-17, or the pharmaceutical composition of any one of embodiments 18-21, thereby preventing at least one symptom in the subject having the disease, disorder and / or condition that would benefit from reduction in CFB expression, Embodiment 29 provides the method of embodiment 27 or 28, wherein the disease, disorder and / or condition is a CFB associated disease, disorder and / or condition.

[0202] Embodiment 30 provides the method of embodiment 29, wherein the CFB associated disease, disorder and / or condition is an inflammatory disease, disorder and / or condition.

[0203] Embodiment 31 provides the method of embodiment 30, wherein the inflammatory disease, disorder and / or condition is an autoimmune disease, disorder and / or condition.

[0204] Embodiment 32 provides the method of embodiment 31, wherein the inflammatory disease, disorder and / or condition is any of age-related macular degeneration (AMD), atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), diabetes (Type 2), metabolic syndrome, insulin resistance, cardiovascular disease, dyslipidemia, systemic lupus erythematosus (SLE), psoriasis, dermatomyositis, eczema, vitiligo, primary immunoglobulin A nephropathy (IgAN), arthritis (e.g., reactive arthritis, rheumatoid arthritis (FLA)), diabetes (Type 1), Addison's disease, Graves' disease, Hashimoto's thyroiditis, myasthenia gravis, scleroderma, multiple sclerosis (MS), Guillain-Barre syndrome, Crohn's disease, ulcerative colitis (UC),vasculitis, Kawasaki disease, Celiac disease, inflammatory bowel disease (IBD), pernicious anemia, Raynaud's phenomenon, and Sjogren's syndrome.

[0205] Embodiment 33 provides the method of any one of embodiments 22-32, wherein the subject is an animal, preferably a human.

[0206] Embodiment 34 provides the method of any one of embodiments 22-33, wherein the dsRNA compound is administered to the subject at a dose of about 0,01 mg / kg to about 50 mg / 'kg.

[0207] Embodiment 35 provides the method of any one of embodiments 22-34, wherein the dsRNA compound is administered to the subject subcutaneously.

[0208] Embodiment 36 provides the method of any one of embodiments 22-35, further comprising determining the level of CFB in a sample(s) from the subject,

[0209] Embodiment 37 provides the method of embodiment 36, wherein the level of CFB in the subject sample(s) is a CFB nucleic acid level or protein level in a blood, plasma, urine or liver tissue sample(s).

[0210] Embodiment 38 provides the method of any one of embodiments 22-37, further comprising administering to the subject an additional therapeutic agent for treatment of a CFB associated disease, disorder and / or condition.

[0211] Embodiment 39 provides the method of embodiment 38, wherein the additional therapeutic agent is selected from the group consisting of immunosuppressants, non-steroidal anti¬ inflammatory drugs (NSAIDs), disease modifying anti-rheumatic drugs (DMARDs), intravenous immunoglobulins (IVIG). and insulin.

[0212] Embodiment 40 provides a kit comprising the dsRNA compound of any one of embodiments 1-17, or the pharmaceutical composition of any one of embodiments 18-21, and optionally, a label.

[0213] Embodiment 41 provides a process for making the double-stranded ribonucleic acid (dsRNA) of any of claims 1-17, comprising synthesizing an oligonucleotide on a solid support using phosphoramidite chemistry, thereby making the double stranded ribonucleic acid or siRNA compound.

[0214] Embodiment 42 provides a process for preparing the sense and / or antisense strand of the double-stranded ribonucleic acid (dsRNA) compound of any one of embodiments 1-17, wherein the process comprises the steps of: a) preparing the sense and / or antisense strand by sequential coupling of modified and / or unmodified nucleotides via the phosphoramidite oligonucleotidesynthesis on a solid support; b) optionally, coupling an N -Acetylgalactosamine-comprising moiety (GalNAc) to the sense and / or antisense strand on the solid support via the phosphoramidite oligonucleotide synthesis; c) detaching the sense and / or antisense strand from the solid support and removing the solid support; and, d) optionally, further purifying the sense and / or antisense strand, optionally using chromatography.

[0215] Embodiment 43 provides a process for preparing the sense and / or antisense strand of the double-stranded ribonucleic acid (dsRNA) compound of any one of embodiments 1-17, wherein the process comprises the steps of: a) coupling an N-Acetylgalactosamine-comprising moiety (GalNAc) to a solid support via the phosphoramidite oligonucleotide synthesis; b) coupling a modified and / or unmodified nucleotide via the phosphoramidite oligonucleotide synthesis to the GalNAc on the solid support; c) sequentially coupling additional modified and / or unmodified nucleotides via the phosphoramidite oligonucleotide synthesis to prepare the sense and / or antisense strand; d) detaching the sense and / or antisense strand from the solid support and removing the solid support; and, e) optionally, further purifying the sense and / or antisense strand, optionally using chromatography.

[0216] Embodiment 44 provides a process of preparing the double-stranded ribonucleic acid (dsRNA) compound of any one of embodiments 1-17, comprising: a) contacting the sense strand prepared according to claim 42 or 43 with the antisense strand prepared according to embodiments 42 or 43 in equimolar concentrations in a solution; b) optionally heating the solution to a temperature of about 94°C; and, c) optionally reducing the temperature of the solution to about 25°C.

[0217] Embodiment 45 provides a double-stranded ribonucleic acid (dsRNA) compound as defined in any of Embodiments 1-17 for use in medicine.

[0218] Embodiment 46 provides a double-stranded ribonucleic acid (dsRNA) compound as defined in any of embodiments 1 - 17<for use in treating and / or preventing a CFB associated disease, disorder and / or condition in a subject.

[0219] Embodiment 47 provides a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (ATs1018 as shown in Table 6, SEQ ID NO: 9) comprises the formula: (mC)*(fA)*(mA)(mG)(fA)(mG)(fA)(mA)(fG)(fU)(mC)(mG)(fU)(mU)(fU)(mC)(mA)(fU)(mU)*(T)*(T)[AN-GalNAc] (structure shown above).

[0220] Embodiment 48 provides a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the antisense strand (ATa994 as shown in Table 6. SEQ ID NO: 8) comprises the formula: (5p)(mA)*(A)*(mU)(fG)(mA)(fA)(mA)*(mC)(fG)(mA)(mC)(fU)(mU)(fC)(mU)(fC)(mU)(mU)(G)*(mU)*(mG) (structure shown above).

[0221] Embodiment 49 provides a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the antisense strand (ATal374 as shown in Table 10, SEQ ID NO: 126) comprises the formula: (5p)(mA)*(A)*(mU)(fG)(mA)(fA)(mA)(mC)(fG)(mA)(mC)(fU)(mU)(fC)(mU)(fC)(mU)(mU)(fG)*(mU)*(mG) (structure shown above),

[0222] Embodiment 50 provides a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (ATs1394 as shown in Table 10, SEQ ID NO: 77) comprises the formula: (mA)*(fG)*(mA)(mU)(fG)(mU)(fU)(mU)(fU)(fC)(mU)(mA)(fC)(mC)(fA)(mA)(mA)(fU)(mU)*(T)*(T)[AN-GalNAc] (structure shown above).

[0223] Embodiment 51 provides a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the antisense strand (ATal339 as shown in Table 10, SEQ ID NO: 76) comprises the formula: (5p)(mA)*(A)*(mU)(fU)(mU)(fG)(G)*(mU)(fA)(mG)(mA)(fA)(mA)(fA)(mC)(fA)(mU)(mC)(T)*(mU)*(mC) (structure shown above).

[0224] Embodiment 52 provides a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (ATsl395 as shown in Table 10, SEQ ID NO: 113) comprises the formula: (mU)*(fU)*(mC)(mA)(fC)(mA)(fA)(mG)(fA)(fG)(mA)(mA)(fG)(mU)(fC)(mG)(mU)(fU)(mU)*(T)*(T)[AN-GalNAc] (structure shown above).Embodiment 53 provides a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the antisense strand (ATal357 as shown in Table 10, SEQ ID NO: 112) comprises the formula: (5p)(mA)*(A)*(mA)(fC)(mG)(fA)(C)*(mU)(fU)(mC)(mU)(fC)(mU)(fU)(mG)(fU)(mG)(mA)(A )*(mC)*(mU) (structure shown above).

[0225] Embodiment 54 provides a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (ATslOlS as shown in Table 6, SEQ ID NO: 9) comprises the formula: (mC)*(fA)*(mA)(mG)(fA)(mG)(fA)(mA)(fG)(fU)(mC)(mG)(fU)(mU)(fU)(mC)(mA)(fU)(mU)*(T)*(T)[AN-GalNAc] (structure shown above), and the antisense strand (ATa994 as shown in Table 6, SEQ ID NO; 8) comprises the formula: (5p)(mA)*(A)*(mU)(fG)(mA)(fA)(mA)*(mC)(fG)(mA)(mC)(fU)(mU)(fC)(mU)(fC)(mU)(mU)(G)*(mU)*(mG) (structure shown above), or the antisense strand (ATa1374 as shown in Table 10, SEQ ID NO: 126) comprises the formula: (5p)(mA)*(A)*(mU)(fG)(mA)(fA)(mA)(mC)(fG)(mA)(mC)(fU)(mU)(fC)(mU)(fC)(mU)(mU)(f G)*(mU)*(mG) (structure shown above).

[0226] Embodiment 55 provides a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (ATs1394 as shown in Table 10, SEQ ID NO: 77) comprises the formula: (mA)*(fG)*(mA)(mU)(fG)(mU)(fU)(mU)(fU)(fC)(mU)(mA)(fC)(mC)(fA)(mA)(mA)(fU)(mU)*(T)*(T)[AN-GalNAc] (structure shown above), the antisense strand (ATal339 as shown in Table 10, SEQ ID NO: 76) comprises the formula: (5p)(mA)*(A)*(mU)(fU)(mU)(fG)(G)’>:(mU)(fA)(mG)(mA)(fA)(mA)(fA)(mC)(fA)(mU)(mC)(T ) (mU)*(mC) (structure shown above).

[0227] Embodiment 56 provides a compound comprising an siRNA compound for inhibiting expression of CFB in a cell, wherein the siRNA compound comprises a sense strand and an antisense strand forming a duplex, wherein the sense strand (ATsl395 as shown in Table 10, SEQ ID NO: 113) comprises the formula:

[0228]

[0229] (mU)*(fU)*(mC)(mA)(fC)(mA)(fA)(mG)(fA)(fG)(mA)(mA)(fG)(mU)(fC)(mG)(mU)(fU)(mU)*(T)*(T)[AN-GalNAc] (structure shown above), and the antisense strand (ATal357 as shown in Table 10, SEQ ID NO: 112) comprises the formula: (5p)(mA)*(A)*(mA)(fC)(mG)(fA)(C)*(mU)(fU)(mC)(mU)(fC)(mU)(fU)(mG)(fU)(mG)(mA)(A

[0230]

[0231] (structure shown above).

[0232] The following description applies to any of the above embodiments.

[0233] 01 igomeric Compounds

[0234] The double-stranded RNA (dsRNA) compounds comprise or are oligomeric compounds such as short hairpin RNAs (shRNAs) and small interfering RNAs (siRNAs). Presently, they target the CFB gene by targeting the CFB mRNA. Oligomeric compounds may be single- or double¬ stranded. A dsRNA oligomeric compound of the invention comprises an “antisense strand” to a target nucleic acid, meaning that it is capable of undergoing hybridization to a target nucleic acid through hydrogen bonding,

[0235] In certain embodiments, an oligomeric compound has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted. For example, in certain such embodiments, an siRNA compound comprises an antisense strand which has a nucleobase sequence that, when written in the 5’ to 3’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted,

[0236] In certain embodiments, a dsRNA oligomeric compound is 12-30 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 18 to 30 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 12 to 22 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 14 to 30 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 14 to 21 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 15 to 30 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 15 to 21 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 16 to 30 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 16 to 21 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 17 to 30 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 17 to 21 subunits in length. In certainembodiments, a dsRNA oligomeric compound is 18 to 30 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 18 to 21 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 20 to 30 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 15 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 16 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 17 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 18 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 20 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 21 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 22 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 23 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 25 subunits in length. In certain embodiments, a dsRNA oligomeric compound is 25 subunits in length. In other embodiments, a dsRNA oligomeric compound is 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked subunits. In certain such embodiments, the dsRNA oligomeric compounds are 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked subunits in length, or a range defined by any two of the above values. In some embodiments, the dsRNA oligomeric compound is an siRNA compound. The above description applies to one strand of the dsRNA oligomeric compound.

[0237] It is possible to increase or decrease the length of a dsRNA oligomeric compound, such as an siRNA compound, and / or introduce base mismatch(s) without eliminating activity (US Patent 7,772,203, incorporated-by-reference herein). For example, it is possible to introduce non- canonical base pairings (e.g., A: G, A: C, G: U, I: U, I: A, I: C) into an oligomeric compound without eliminating activity. In certain embodiments, designing oligomeric compounds with one or more non-canonical base pairings, i.e., mismatch(s), enhances the activity of the oligomeric compound.

[0238] The dsRNA oligomeric compound can comprise a mismatch(es) with the target, between the oligomeric strands within the duplex, or combinations thereof. The mismatch may occur throughout the siRNA compound such as in the overhang (a portion of the sense or antisense strandat the 5’ and / or 3’ end of a duplexed si NA that has no complementary strand) or the duplex portion.

[0239] Oligomeric Compound Motifs

[0240] A motif refers to a pattern of modification of a dsRNA oligomeric compound. Various motifs have been described in the art and are incorporated-by-reference herein (e.g., US Patent 11,203,755; US Patent 10,870,849; EP Patent 1,532,248; US Patent 11,406,716; US Patent 10,668,170; US Patent 9,796,974; US Patent 8,754,201; US Patent 10,837,013; US Patent 7,732,593; US Patent 7,015,315; US Patent 7,750,144; US Patent 8,420,799; US Patent 8,809,516; US Patent 8,796,436; US Patent 8,859,749; US Patent 9,708,615; US Patent 10,233,448; US Patent 10,273,477; US Patent 10,612,024; US Patent 10,612,027; US Patent 10,669,544; US Patent 11,401,517; USSN 2020 / 0031862; USSN 2016 / 0272970).

[0241] In certain embodiments, dsRNA oligomeric compounds disclosed herein, such as siRNAs, have chemically modified subunits arranged into motifs to confer on to the dsRNA oligomeric compounds beneficial properties including, but not Limited to: enhanced inhibitory activity to increase potency; increased binding affinity to increase specificity for a target nucleic acid, thereby limiting off-target effects and / or increasing safety; or enhanced resistance to degradation by in vivo nucleases thereby increasing stability and durability. In certain embodiments, the dsRNA oligomeric compounds are chimeras where the peripheral nucleobases of the dsRNA oligomeric compounds comprise motifs with various modified or unmodified nucleobases so as to confer increased stability, specificity, safety and potency, while the central region of the compound comprises various modified or unmodified nucleobases to serve as substrates for RISC mediated degradation. Each distinct region can comprise uniform sugar moieties, modified, or alternating sugar moieties. Each region can comprise a varied pattern of phosphate and phosphorothioate linkages.

[0242] In certain embodiments, the dsRNA oligomeric compounds targeted to a CFB nucleic acid comprise a sense strand with sequence and chemical modification motif as shown in Tables 2, 6 or 10. In certain embodiments, the dsRNA oligomeric compounds targeted to a CFB nucleic acid comprise an antisense strand with sequence and chemical modification motif as shown in 'Fables 2, 6 or 10.Target Nucleic Acids, Target Regions and Nucleotide Sequences

[0243] Several embodiments are directed to methods of modulating gene expression by dsRNA inhibition.

[0244] In certain embodiments, a method of inhibiting CFB gene expression in a cell comprises administering to the cell a dsRNA compound targeted to an mRNA (or its corresponding cDNA) transcript of CFB (GenBank NM_001710.6, incorporated herein as SEQ ID NO:1).

[0245] Nucleotide sequences and chemical modification motifs of dsRNA compounds targeting the CFB transcript are shown in e.g,, 'Fables 2, 6 or 10. It is understood that the nucleotide sequence set forth in each SEQ ID NO in the examples contained herein can be independent of any modification to a sugar moiety, an internucleoside linkage, or a nucleobase. Also, in accordance with the practice of the invention, each SEQ ID NO refers to a nucleotide sequence, with or without chemical modifications, independent of a conjugate moiety. As such, siRNA compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an internucleoside linkage, or a nucleobase or may further comprise a conjugate moiety, siRNA compounds denoted by ARNATAR designations indicate a combination of sequence and motif.

[0246] Hybridization

[0247] In some embodiments, hybridization occurs between a strand of a dsRNA oligomeric compound disclosed herein and an mRNA. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

[0248] In Watson-Crick canonical base pairings, adenine (A) is complementary to thymine (T) in DNA, adenine (A) is complementary to uracil (U) in RNA, and guanine (G) is complementary to cytosine (C) in both DNA and RNA. Base pairs, or complementary nucleobases, are usually Watson-Crick base pairs (C: G, A: U, A: T), but, non-canonical base pairs such as Hoogsteen base pairs (e.g., A: G, A: U), Wobble base pairs (e.g., G: U, 1: U, I: A, I: C, wherein I is hypoxanthine) and the like are also permitted during hybridization of the oligomeric compound to a target nucleic acid or target region. Wobble base pairs in RNAi agents have previously been described (see e.g., US Patent 7,732,593: US Patent 7,750,144).Nucleobase complementarity facilitates hybridization of the dsRNA oligomeric compounds described herein to their target nucleic acids with the stronger the pairing (e.g., the more base pairs and / or the stronger the hydrogen bond), the stronger the hybridization of the oligomeric compound to the target. Hybridization can occur under varying conditions. Stringent conditions are sequence-dependent and are determined by the composition of the oligomeric compound to be hybridized.

[0249] Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the oligomeric compounds provided herein are specifically hybridizable with a target mRNA with little to no off-target binding.

[0250] Complementarity

[0251] An oligomeric compound and a target nucleic acid are complementary to each other when a sufficient number of nucleobases of the oligomeric compound can hybridize with the corresponding nucleobases of the target nucleic acid, such that a desired effect will occur (e.g., inhibition of a target nucleic acid, such as an mRNA nucleic acid).

[0252] Non-complementary nucleobases between an oligomeric compound and an mRNA nucleic acid may be tolerated provided that the oligomeric compound remains able to specifically hybridize to a target nucleic acid. Moreover, an oligomeric compound may hybridize over one or more segments of an mRNA nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, a mismatch, or a hairpin structure).

[0253] In certain embodiments, the oligomeric compounds provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to an mRNA nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an oligomeric compound with a target nucleic acid can be determined using routine methods.

[0254] For example, a dsRNA oligomeric compound in which 18 of 20 nucleobases of the antisense strand of the oligomeric compound are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. Percentcomplementarity of a dsRNA oligomeric compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al., 1990, J. Mol. Biol., 215:403-410; Zhang and Madden, 1997, Genome Res., 7:649-656) and available through the website for the National Center for Biotechnology Information (NCBI, https: / / blast.ncbi.nlm.nih.gov / Blast.cgi). Percent homology, sequence identity, or complementarity, can be determined by, for example, NCBI Blast (Johnson et al., Nucleic Acids Res. 2008, 36 (Web Server issue): W5-W9).

[0255] In certain embodiments, the dsRNA oligomeric compounds provided herein, or specified portions thereof, are fully complementary (i.e,, 100% complementary) to a target nucleic acid, or specified portion thereof. For example, a strand of the dsRNA oligomeric compound may be fully complementary to an mRNA nucleic acid, or a target region, or a target segment, or a target sequence thereof. As used herein, “fully complementary” means each nucleobase of a dsRNA oligomeric compound strand is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20-nucleobase dsRNA oligomeric compound strand is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20-nucleobase portion of the target nucleic acid that is fully complementary to the dsRNA oligomeric compound strand.

[0256] Fully complementary can also be used in reference to a specified portion of the dsRNA oligomeric compound strand or the nucleic acid target. For example, a 20-nucleobase portion of a 30-nucleobase dsRNA oligomeric compound strand can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20-nucleobase portion of the 30-nucleobase dsRNA oligomeric compound strand is fully complementary to the target sequence, if the target sequence has a corresponding 20-nucleobase portion wherein each nucleobase is complementary to the 20- nucleobase portion of the dsRNA oligomeric compound strand. At the same time, the entire 30-nucleobase dsRNA oligomeric compound strand may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the dsRNA oligomeric compound strand are also complementary to the target sequence.

[0257] The location of a non-complementary nucleobase may be at the 5’ end or 3’ end of the dsRNA oligomeric compound. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the dsRNA oligomeric compound. When two or more non-complementary nucleobases are present, they may be contiguous (i.e., linked) or non-contiguous.In certain embodiments, dsRNA oligomeric compound strands that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20 or 21 nucleobases in length comprise no more than 6, no more than 5. no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an mRNA nucleic acid, or specified portion thereof.

[0258] In certain embodiments, dsRNA oligomeric compound strands that are, or are up to 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 8, no more than 7, no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as an mRNA nucleic acid, or specified portion thereof.

[0259] The dsRNA oligomeric compounds provided herein also include those that are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e., linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of a dsRNA oligomeric compound. In certain embodiments, the dsRNA oligomeric compounds are complementary to at least an 8-nucleobase portion of a target segment. In certain embodiments, the dsRNA oligomeric compounds are complementary to at. least a 9-nucleobase portion of a target segment. In certain embodiments, the dsRNA oligomeric compounds are complementary to at least a 10-nucleobase portion of a target segment. In certain embodiments, the dsRNA oligomeric compounds are complementary to at least an 11 -nucleobase portion of a target segment. In certain embodiments, the dsRNA oligomeric compounds are complementary to at least a 12-nucleobase portion of a target segment. In certain embodiments, the dsRNA oligomeric compounds are complementary to at least a 13-nucleobase portion of a target segment. In certain embodiments, the dsRNA oligomeric compounds are complementary to at least a 14-nucieobase portion of a target segment. In certain embodiments, the dsRNA oligomeric compounds are complementary to at least a 15- nucleobase portion of a target segment. Also contemplated are dsRNA oligomeric compounds that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

[0260] Chemical Modifications

[0261] A nucleoside is a base-sugar combination. The nucleobase (also known as base) portion of the nucleoside is normally a heterocyclic base moiety. Nucleotides are nucleosides that furtherinclude a covalent linkage (e.g., phosphate group or a chemically modified linkage as described infra to the sugar portion of the nucleoside. Oligonucleotides are formed through the covalent linkage of adjacent nucleotides to one another, to form a linear polymeric oligonucleotide. Within the oligonucleotide structure, the linkage groups are commonly referred to as forming the intemucleoside 'linkages of the oligonucleotide. Oligomeric compounds are made up of one (e.g., ssRNAs, antisense oligonucleotides or miRNAs) or more oligonucleotides (e.g., dsRNAs such as siRNAs or shRNAs),

[0262] Modifications to oligomeric compounds encompass substitutions or changes to nucleobases, intemucleoside linkages or sugar moieties. Modified oligomeric compounds are often preferred over native or unmodified forms because of desirable properties such as, for example, enhanced delivery (e.g., increased cellular uptake), enhanced specificity or affinity for a nucleic acid target, increased stability in the presence of nucleases, enhanced safety (e.g., fewer side effects after administration of the compound to a subject) or increased potency (e.g., inhibitory activity).

[0263] Nucleobase Modifications

[0264] A nucleobase is a heterocyclic moiety capable of base pairing with a nucleobase of another nucleic acid. Modifications to nucleobases can be advantageous to an oligomeric compound for various reasons, including, but not limited to, increased stability of the oligomeric compound, increased specificity, decreased immunogenicity of the oligomeric compound, increased affinity of the oligomeric compound, increased potency of the oligomeric compound, and other desirable features.

[0265] Examples of nucleobase modifications and their advantages are well known in the art (Friedrich and Aigner, Therapeutic siRNA: State-of-the-Art and Future Perspectives, 2022, BioDrugs, 36(5):549-571; Hu et al,, Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5:101). Nucleobase modifications can comprise substituting nucleobases with nucleobase analogs or modifying a part of the nucleobase. Examples of nucleobase modifications include, but are not limited to, pseudouridine, 2 ’-thiouridine, N6’-methyladenosine, and 5’~methylcytidine, 5’-fluoro-2’-deoxyuridine, N-ethylpiperidine 5’ triazole-modified adenosine, 5’-nitroindole, 2’,4’-difluorotolylribonucleosidc, N-ethylpiperidinc 7’-EAA triazole- modified adenosine, 6’-phenylpyrrolocytosine, and the like.In certain embodiments, dsRNA oligomeric compounds targeted to an mRNA nucleic acid comprise one or more modified nucleobases. In certain embodiments, the modified nucleobases are, for example, deoxyribonucleosides (D) substituted for ribonucleosides (R). In certain embodiments, a modified nucleobase can be a thymine substitution for an uracil. In certain embodiments, multipie nucleobases of a dsRNA oligomeric compound are modified. In certain embodiments, each nucleobase of a dsRNA oligomeric compound is modified.

[0266] Internucleoside Linkage Modifications

[0267] The naturally occurring internucleoside linkage of RNA and DNA is a 3’ to 5‘ phosphodiester linkage, For nucleosides that include a furanose sugar, the phosphate group can be linked io the 2:, 3' or 5' hydroxyl moiety of the sugar. Oligomeric compounds having one or more modified, i.e., non-naturafiy occurring, internucleoside linkages are often selected over oligomeric compounds having naturally occurring internucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, decrease toxicity, increased stability and / or durability, decreased degradation and / or other desirable features for an oligomeric compound. Some modified internucleoside linkages and their advantages are well known in the art (Friedrich and Aigner, Therapeutic siRNA: State-of-the-Art and Future Perspectives, 2022, BioDrugs, 36(5):549-571; Hu et al., Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5:101).

[0268] Oligomeric compounds having modified internucleoside linkages include internucleoside linkages that retain a phosphorus atom as well as internucleoside linkages that do not have a phosphorus atom. Representative phosphorus-containing internucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates (e.g,, 5’- methylphosphonate (5 ’-MP)), phosphoramidate, and phosphorothioates (e.g., phosphorodithioate Rp Isomer (PS, Rp), phosphorodithioate Rp isomer (PS, Sp), 5’-phosphorothioate (5’-PS)), methoxypropylphosphonate, (S)-5’-C-methyl with Phosphate, peptide nucleic acid (PNA), and 5’-(E)-vinylphosphonate.

[0269] In certain embodiments, dsRNA oligomeric compounds targeted to an mRNA nucleic acid comprise one or more modified internucleoside linkages. In certain embodiments, the modified internucleoside linkages are phosphorothioate (PS) linkages. In certain embodiments, one or more internucleoside linkages of an oligomeric compound is a phosphorothioate internucleosidelinkages. In certain embodiments, the PS linkage is adjacent to a deoxyribonucleoside (sometimes referred to as DNA or “D” herein) or a ribonucleoside (sometimes referred to as RNA, “R” or ”r” herein). In certain embodiments, each intemucleoside linkage of an oligomeric compound is a phosphorothioate internucleoside linkage.

[0270] Sugar Modifications

[0271] Natural sugars are sugar moieties found in DNA (2’-H) or RNA (2’-OH), i.e., 2-deoxy- beta-D-ribofuranose or beta-D-ribofuranose, respectively. Oligomeric compounds provided herein can contain one or more nucleosides wherein the natural sugar moiety has been modified. Such sugar modified nucleosides may impart desirable features such as increased stability, increased durability (e.g., increased half-life), increased binding affinity, decreased off-target effects, decreased immunogenicity, decreased toxicity, increased potency, or some other beneficial biological property to the oligomeric compounds. Sugar modifications and their advantages are known in the art (Friedrich and Aigner, 2022, BioDrugs, 36(5):549-571; Hu et al., Therapeutic siRNA: State of the Art, Signal Transduction and Targeted Therapy, 2020, 5:101; Chiu and Rana, 2003, RNA, 9:1034-1048; Choung et al., Biochem Biophys Res Commun, 2006, 342:919-927; Amarzguioui et al., 2.003, Nucleic Acids Res, 31(2):589-595; Braasch et al., 2003, Biochemistry, 42(26):7967--7975; Czaudema et al., 2003, Nucleic Acids Res, 31(1 l):2705-2716; Allerson et al,, 2005, J Med Chem, 48:901-904; Layzer et al., 2004, RNA, 10:766-771; Ui-Tei, et al., 2008, Nucleic Acids Res, 36(7):2136-51; Bramsen and Kjems, 2012, Frontiers in Genetics, 3(154): I -22; Bramsen et al., 2010, Nucleic Acids Res, 38(17):5761-5773; Muhonen et al., 2007, Chem & Biodiversity, 4:858-873; which are incorporated-by-reference herein).

[0272] In certain embodiments, nucleosides comprise a chemically modified ribofuranose ring moiety. Examples of chemically modified ribofuranose rings can include, without limitation, addition of substituent groups (e.g., 5’ sugar modifications, 2’ sugar modifications); bridging of non-geminal ring atoms to form bicyclic nucleic acids (BNA); replacement of the ribosyl ring oxygen atom with S, N(R), or C(R1)(R)2 (R - H, C1-C12 alkyl or a protecting group); nucleoside mimetic; and / or combinations thereof.

[0273] A 2 ’-modified sugar refers to a furanosy 1 sugar modified at the 2’ position. A 2’-modified nucleoside refers to a nucleoside comprising a sugar modified at the 2’ position of a furanose ring. In certain embodiments, such modifications include substituents selected from: a halide, including,but not limited to, any of substituted and unsubstituted alkoxy, substituted and unsubstituted thioalkyl, substituted and unsubstituted aminoalkyl, substituted and unsubstituted alkyl, substituted and unsubstituted allyl, and substituted and unsubstituted alkynyl. In certain embodiments, 2’ modifications are selected from substituents including, but not limited to: O[(CH2)nO]mCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, OCH2C(-O)N(H)CH3, and O(CH2)nON[(CH2)nCH3]2, where n and m are from 1 to about 10, Other 2’- substituent groups can also be selected from: Cs-Cu alkyl, substituted alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving pharmacokinetic properties, and / or a group for improving the pharmacodynamic properties of an oligomeric compound, and / or other substituents having similar properties.

[0274] Further examples of nucleosides having modified sugar moieties include, without limitation, nucleosides comprising 5’-vinyl, 5 ’-methyl (R or S), 2’-F-5’-methyl, 4’-S, 2’-deoxy- 2’ -fluoro (2’-F), 2’-OCH3(2’-O-methyl, 2’-OMe), 2’-O(CH2)2OCH3(2’-O-methoxyethyI, 2’-O- MOE, 2’-MOE), 2’-O-methyl-4-pyridine, phosphorodiamidate morpholino (PMO), tricyclo-DNA (tcDNA), 2’-arabino-fluoro, 2’-O-benzyl, glycol nucleic acid (GNA), and unlocked nucleic acid (UNA) substituent groups. The substituent at the 2’ position can also be selected from any of allyl, amino, azido, thio, O-allyl, O-C1-C10 alkyl, OCF3, OfCHjjZSCHs, O(CH2)2-O-N(Rm)(Rn), and O-CH2-C(:=:O)-N(Rm)(Rn), where each Rm and Rn is, independently, H or substituted or unsubstituted Ci-Cio alkyl. 2’-OMe or 2’-OCHj or 2’-O-methyl each refers to a nucleoside comprising a sugar comprising an -OCH3 group at the 2’ position of the sugar ring. 2’-F refers to a sugar comprising a fluoro group at the 2’ position. 2’-O-methoxyethyl or 2’-O-MOE or 2’-MOE each refers to a nucleoside comprising a sugar comprising an -O(CH2)2OCH3group at the 2’ position of the sugar ring.

[0275] BNAs refer to modified nucleosides comprising a bicyclic sugar moiety wherein a bridge connecting two carbon atoms of the sugar ring connects the 2’ carbon and another carbon of the sugar ring. Examples of bicyclic nucleosides include, without limitation, nucleosides comprising a bridge between the 4’ and the 2’ ribosyl ring atoms, such as in locked nucleic acid (LNA). In certain embodiments, oligomeric compounds provided herein include one or more bicyclic nucleosides wherein the bridge comprises a 4’ to 2’ bicyclic nucleoside. LNAs and UN As havebeen described by Campbell and Wengel (Chem Soc Rev, 2011, 40(12):5680-9) and are incorporated-by -reference herein.

[0276] In certain embodiments, dsRNA oligomeric compounds comprise one or more nucleotides having modified sugar moieties. In certain embodiments, the modified sugar moiety has a 2’-OMe modification. In certain embodiments, the modified sugar moiety has a 2’-F modification. In certain embodiments, the 2’-OMe and / or 2’-F modified nucleotides are arranged in a motif. In a preferred embodiment, the modifications are arranged in ARNATAR motifs as disclosed in PCT / US2023 / 084688, which is incorporated-by-reference herein.

[0277] In certain embodiments, the dsRNA oligomeric compounds targeted to a nucleic acid comprise a sense strand with motif described by one of the following formulas:

[0278] Formula (I): 5;M-(Y)n-Z-(Y)r~D-D 3’,

[0279] Formula (II): 5’ Y-Z-(Y)q-FFNM-(Y)q-M-(Y)v-D-D 3’,

[0280] Formula (III): 5’ M*F*MMN*MN*b FFNMN*MN*MN4FN4*D*D 3’,

[0281] Formula (X): 5’ MFMMNMNMFFNMN NMMNMDD 3’, or

[0282] Formula (XI): 5’ MFMMNMNMFFMMNMNMMFMDD 3’,

[0283] wherein

[0284] each D is a deoxyribonucleoside (D is a modification of R),

[0285] each R is a ribonucleoside,

[0286] each N is a nucleoside, modified or unmodified (e.g., D, R, M, F, UNA modified, or LN A modified),

[0287] each M is a 2’-OMe modified nucleoside,

[0288] each F is a 2’-F modified nucleoside,

[0289] each * is a phosphorothioate (PS) linkage,

[0290] each Y is two adjacent nucleosides with different modifications (e.g., MD, DM, DF, FD, MF or FM) or a modified nucleoside adjacent to an unmodified nucleoside (e.g., DR, RD, MR or RM),

[0291] each Z is two adjacent unmodified nucleosides or two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides (e.g,, MM, DD, RR, or FF),

[0292] each n is 6-8,

[0293] each q is 2-3,

[0294] each r is 1 -2.each v is 0-1, and

[0295] wherein no single modification type modifies more than two consecutive nucleotides. In certain embodiments, the FFNM is FFRM or FFMM.

[0296] In certain embodiments, the oligomeric compounds targeted to a nucleic acid comprise an antisense strand with motif described by one of the following formulas:

[0297] Formula (IV): 5’-L-M-(D)v-(Y)s-(Z)t-(Y)u-Z-N-(Z)r 3’,

[0298] Formula (V): 5' L-(Y)p- M~(FMM)r-(Y)p-(Z)r 3’,

[0299] Formula (VI): 5’ L-M*N*MNMFNMFMMNMFMFMMN*M*M 3’,

[0300] Formula (VII): 5’ L-M*D*MFMFNMFMMFMFMFMMN*M*M 3’,

[0301] Formula (VIII): 5’ L-MNMNMFNMFMMNMFMFMMNMM 3’,

[0302] Formula (IX): 5’ L-M-(Y)p-Z-(Y)p-(Z)r 3’, or

[0303] Formula (XII): 5’ L-MDMFMFNMFMMFMFMFMMNMM 3’,

[0304] wherein

[0305] each D is a deoxyribonucleoside (D is a modification of R),

[0306] each R is a ribonucleoside, each N is a nucleoside, modified or unmodified (e.g., D, R, M, F, UNA modified, or LNA modified),

[0307] each M is a 2’-OMe modified nucleoside,

[0308] each F is a 2’-F modified nucleoside,

[0309] each L is a 5’ phosphate, 5’ vinyl phosphonate, or 5’ OH

[0310] each * is a phosphorothioate (PS) linkage,

[0311] each Y is two adjacent nucleosides with different modifications (e.g., MD, DM, DF, FD, MF or FM) or a modified nucleoside adjacent to an unmodified nucleoside (e.g., DR, RD, MR or RM),

[0312] each Z is two adjacent unmodified nucleosides or two adjacent nucleosides with the same modification or two adjacent unmodified nucleosides (e.g., MM, DD, RR, or FF),

[0313] each (5p) is 5 ’-phosphate,

[0314] each n is 6-8,

[0315] each p is 3-5,

[0316] each r is 1-2,

[0317] each v is 0-1,

[0318] each s is 2-7, 'each t is 0-2, and

[0319] wherein no single modification type modifies more than two consecutive nucleotides. In certain embodiments, the FNM is FMM.

[0320] Oligomeric Compound Delivery Systems

[0321] Oligomeric compounds require entry into target cells to become active, A variety of modalities have been used to traffic oligomeric compounds into target cells, including viral delivery vectors, lipid-based delivery, polymer-based delivery, and conjugate-based delivery (Paunovska et al., Drug Delivery Systems for RN A Therapeutics, 2022, Nature Reviews Genetics, 23(5):265-280; Chen et al., 2022, Molecular Therapy, Nucleic Acids, 29:150-160).

[0322] Lipid-based particles can form specific structures such as micelles, liposomes and lipid nanoparticles (LNPs) to carry oligomeric compounds into cells. To form these particles, LPNs can include one or more of a cationic or ionizable lipid (e.g., DLin-MC3-DMA, SM-102, ALC-0315), cholesterol, a helper lipid, l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), polyethylene glycol) (PEG) modified lipid (e.g., PEG-2000-C-DMG, PEG-2000-DMG, ALC-0159), C 12-200, cKK-E12, and the like. Different combinations of lipids can be formulated to affect the delivery of the oligomeric compound to different types of cells. In one example, therapeutic siRNA patisiran was formulated in cationic ionizable lipid DLin-MC3-DMA, cholesterol, polar phospholipid DSPC, and PEG-2000-C-DMG for delivery to hepatocytes.

[0323] Polymer-based particles are also used in oligomeric compound delivery systems. Such polymers include poly(lactic-co -glycolic acid) (PLGA), polyethylenimine (PEI), poly(l-lysine) (PLL), poly(beta-amino ester) (PBAE), dendrimers (e.g., poly(amidoamine) (PAMAM) or PLL), and other polymers or modified polymers thereof. The polymer composition can be varied depending on the traits desired for delivery of the oligomeric compound.

[0324] The dsRNA oligomeric compounds disclosed herein may be covalently linked to one or more moieties or conjugates which enhance the activity, cellular distribution, or cellular uptake of the resulting compound. Conjugate groups can include cholesterols, lipids, carbohydrates, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, dyes, etc. Conjugate-based delivery can actively deliver oligomeric compounds to specific cell types.In an example, an N-Acetylgalactosamine-comprising moiety (GalNAc) is conjugated to a dsRNA oligomeric compound and delivers it into hepatocytes, Various GalNAc conjugates can be found in several publications, including the following, all of which are incorporated-by-reference herein: Sharma et al., 2018, Bioconjugate Chem, 29:2478-2488; Nair et al., J. Am. Chem. Soc.

[0325] 2014, 136(49): 16958-16961; Ream, 2022, Drugs, 82:1419-1425; US Patent 10,087,208; Prakash et ah, 2014, Nucleic Acids Res, 42(13):8796-807; Debacker et al., 2020, Molecular Therapy, 28(8): 1759-1771; PCT / US2023 / 084692; US Patent 11,110,174; US Patent 9,796,756; US Patent 9,181,549; US Patent 10,344,275; US Patent 10,570,169; US Patent 9,506,030; US Patent 11,692,001; and, US Patent 7,582,744.

[0326] In certain embodiments, the following GalNAc conjugate precursor with solid support can be used to conjugate a CFB dsRNA compound at the 3’ end of the sense strand. In a preferred embodiment, the dsRNA compound is an ARNATAR-designed siRNA compound selected from Tables 2, 6, or 10.

[0327] w

[0328]

[0329] In a preferred embodiment, the GalNAc conjugated to an oligonucleotide is the ARNATAR GalNAc (also known as GA2 or GA-AN, AN-GalNAc, or GalNAc2) shown as follows:

[0330]

[0331] In one embodiment, AN-Gal Ac is conjugated to a sense strand of a dsRNA compound. In a preferred embodiment, AN-GalNAc is conjugated to a dsRNA compound selected from any of the compounds in 'fables 2, 6, or 10,

[0332] Oligomeric Compound Synthesis

[0333] siRNAs were designed, synthesized, and prepared using methods known in the art.

[0334] Solid phase syntheses of oligonucleotides were done on a MerMade™ 48x synthesizer (BioAutomation, LGC, Biosearch Technologies, Hoddesdon, UK), which can make up to 48 IpMole or SpMole scale oligonucleotides per run using standard phosphoramidite chemistry. Phosphoramidite synthesis of oligonucleotides on a solid support is well known in the art (e.g., Beaucage and Caruthers, 1981, Tetrahedron Letters, 22(20): 1859-1862; Roy and Caruthers, 2013, Molecules, 18:14268-14284; and Roy and Caruthers et al., 2021, Nature Communications, 12:2760). Solid support is controlled pore glass (500-1400 A) loaded with universal linkers or loaded with 3 ’-GalNAc conjugates (e.g,, AM Chemicals, Vista, CA, USA; Primetech ALC, Minsk, Belarus; Gene Link, Elmsford, NY, USA: or any GalNAc conjugate disclosed herein) or universal solid support (AM Chemicals, Vista, CA, USA). Ancillary synthesis reagents and standard 2’- cyanoethyl phosphoramidite monomers (2’-fluoro, 2’-O-methyl, RNA, DNA) were obtained from various sources (Hongene Biotech, Shanghai, China: Sigma-Aldrich, St. Louis, MO, USA; Glen Research, Sterling, V A, USA; ThermoFisher Scientific, Waltham, MA, USA; LGC Biosearch Technologies, Hoddesdon, UK). Phosphoramidite mixtures were prepared in anhydrous acetonitrile or 30% DMF: acetonitrile and were coupled using 0.25M 4,5-dicyanoimidazole (DCI) (Sigma-Aldrich, St. Louis, MO, USA) with coupling times ranging from 120-360 seconds.Standard phosphodiester linkages were achieved using 0.02M iodine mixture in Tetrahydrofuran (THF), pyridine and water. Phosphorothiate linkages were generated using 0.05M sulfurizing Reagent II (3-((Dimethylamino-methylidene)amino)-3H-l,2,4-dithiazole-3-thione, DDTT) (40:60, Pyridine / Acetonitrile) (LGC Biosearch Technologies, Hoddesdon, UK) with an oxidation time of 6 minutes. All sequences were synthesized with Dimethoxy Trityl (DMT) protecting group removed.

[0335] Upon completion of solid phase synthesis, the oligonucleotides were cleaved from the solid sispport and deprotection of base labile groups was performed by incubation in ammonium hydroxide at 55CC for 6 hours. Ammonium hydroxide was removed using a centrifugal vacuum concentrator to dryness at room temperature. For sequences containing natural ribonucleotides (2’- OH) protected with tert-butyl dimethyl silyl (TBDMS), a second deprotection was performed using tri ethylamine; trihydrofluoride (TEA:3HF). To each TBDMS protected oligonucleotide 100 uL DMSO and 125pL TEA: 3 HF was added and incubated at 65'C for 2,5 hours. After incubation 25pL of 3M sodium acetate was added to the solution which was subsequently precipitated in butanol at -20’C for 30 minutes. The cloudy solution was centrifuged to a cake, at which time the supernatant was carefully decanted with a pipete. The standard precipitation process was then completed with 75% ethanol: ater, then 100% ethanol as supernatant solutions. The oligonucleotide cake was dried for 30 minutes in a centrifugal vacuum concentrator.

[0336] Desalting without HPLC purification was performed after precipitation with 3M sodium acetate followed by a G25 Sephadex® column (Sigma-Aldrich, St. Louis, MO, USA) elution. Purification of oligonucleotides was afforded by anion exchange chromatography on a Gilson GX271 prep HPLC system (Middleton, WI, USA) using Bio Works Q40 resin (Uppsala, Sweden). Final desalting was performed by Sephadex® G25 column.. All oligonucleotides were analyzed by ion pairing reverse phase HPLC for purity on an Agilent 1200 analytical HPLC (Santa Clara. CA, USA), negative ion mass spectrometry for intact mass on an Agilent 61 0 single quad mass spectrometer (Santa Clara, CA, USA), and A260 quantification by UV / Vis on a Tecan Infinite® M Plex plate reader (Zurich, Switzerland).

[0337] Double-Stranded Oligomeric Compound Duplex Formation

[0338] In general, for a double-stranded oligomeric compound such as an siRNA compound, a sense and antisense oligonucleotide is annealed together to form a duplex. The duplex is formedby contacting the sense strand prepared according to any one of the processes described herein with the antisense strand prepared according to any one of the processes described herein in equimolar concentrations in a solution. Optionally, the solution is heated to a temperature of about 94°C, then the temperature is reduced to about 25°C. In an example, duplex formation of 50- 300mM can be achieved by heating samples at 94°C for 4 mins in lx phosphate-buffered saline in a block heater, followed by removal of the heating block containing the samples from the block heater and allowing it to gradually cool down to room temperature over a time course of 1 hour.

[0339] Compositions and Methods for Formulating Pharmaceutical Compositions

[0340] The dsRNA compounds, such as siRNA compounds targeting CFB described herein, can be combined with pharmaceutically acceptable active or inert substances, such as a diluent, excipient or carrier, for the preparation of pharmaceutical compositions or formulations.

[0341] Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

[0342] In certain embodiments, the pharmaceutical carrier or excipient is a pharmaceutically acceptable solvent, suspending agent, or any other pharmacologically inert vehicle for delivering one or more nucleic acid compounds to an animal. The excipient can be liquid or solid and can be selected, with the planned manner of administration in mind, so as to provide for the desired bulk, consistency, etc., when combined with a nucleic acid and the other components of a given pharmaceutical composition. Typical pharmaceutical carriers include, but are not limited to, binding agents (e.g., pregelatinized maize starch, polyvinylpyrrolidone or hydroxypropyl methylcellulose, etc.); fillers (e.g., lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylates or calcium hydrogen phosphate, etc.); lubricants (e.g., magnesium stearate, talc, silica, colloidal silicon dioxide, stearic acid, metallic stearates, hydrogenated vegetable oils, com starch, polyethylene glycols, sodium benzoate, sodium acetate, etc.); disintegrants (e.g., starch, sodium starch glycolate, etc.); and wetting agents (e.g., sodium lauryl sulphate, etc.).

[0343] Pharmaceutically acceptable organic or inorganic excipients, which do not deleteriously react with nucleic acid compounds, suitable for parenteral or non-parenteral administration, can also be used to formulate the compositions of the present invention. Suitable pharmaceuticallyacceptable carriers include, but are not limited to, water, salt solutions, alcohols, polyethylene glycols, gelatin, lactose, amylose, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxymethylcellulose, polyvinylpyrrolidone, and the like, A pharmaceutically acceptable diluent includes phosphate-buffered saline (PBS), PBS is a diluent suitable for use in compositions to be delivered parenterally, Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising a dsRNA compound targeted to a CFB nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is PBS. In certain embodiments, the dsRNA compound is an siRNA compound.

[0344] Pharmaceutical compositions comprising dsRNA compounds such as siRNA compounds can encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other dsRNA compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to pharmaceutically acceptable salts of dsRNA compounds, prodrugs, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

[0345] In certain embodiments, a pharmaceutical composition is prepared for administration by injection (e.g., intravenous, subcutaneous, intramuscular, etc.), In certain such embodiments, a pharmaceutical composition comprises a carrier and is formulated in aqueous solution, such as water or physiologically compatible buffers such as Hanks's solution, Ringer's solution, or physiological saline buffer (e.g., PBS). In certain embodiments, other ingredients are included (e.g., ingredients that aid in solubility or serve as preservatives). In certain embodiments, injectable suspensions are prepared using appropriate liquid carriers, suspending agents, and the like. Certain pharmaceutical compositions for injection are presented in unit dosage form, e.g., in ampoules or in multi-dose containers.

[0346] Dosages

[0347] For purposes of the disclosure, the amount or dose of the active agent (oligomeric compound of the invention) administered should be sufficient to e.g., inhibit the expression of a CFB in an animal. In the animal (e.g., human), dose will be determined by the efficacy of theparticular active agent and the condition of the animal, as well as the body weight of the animal to be treated.

[0348] Many assays for determining an administered dose are known in the art.

[0349] The dose of the active agent of the present disclosure will also be determined by the existence, nature, and extent of any adverse side effects that might accompany the administration of a particular active agent of the present disclosure. Typically, the attending physician will decide the dosage of the active agent of the present disclosure with which to treat each individual subject, taking into consideration a variety of factors, such as age, body weight, general health, diet, sex, active agent of the present disclosure to be administered, route of administration, and the severity of the condition being treated.

[0350] Dosing

[0351] In certain embodiments, pharmaceutical compositions are administered according to a dosing regimen (e.g., dose, dose frequency, and duration) wherein the dosing regimen can be selected to achieve a desired effect i.e., is therapeutically effective in a subject. The desired effect can be, for example, reduction of CFB or the prevention, reduction, amelioration or slowing the progression of a disease, disorder and / or condition, or symptom thereof, associated with CFB in a subject. In certain embodiments, the variables of the dosing regimen are adjusted to result in a desired concentration of pharmaceutical composition in a subject. " Concentration of pharmaceutical composition" as used with regard to dose regimen can refer to the dsRNA compound or active ingredient(s) of the pharmaceutical composition. For example, in certain embodiments, dose and dose frequency are adjusted to provide a tissue concentration or plasma concentration of a pharmaceutical composition at an amount sufficient to achieve a desired effect.

[0352] Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Dosing is also dependent on drug potency and metabolism differences between subjects. In certain embodiments, a therapeutically effective dosage in a subject is about from 0.01 mg to 50 mg per kg of body weight, 0.01 mg to 100 mg per kg of body weight, or within a range of 0.1 mg to 1000 nig dosing, and may be given once or more daily, weekly, monthly, quarterly or yearly, or even once every 2 to 20 years. Following successful treatment, it may be desirable to have the subject undergo maintenance therapy to prevent therecurrence of the disease state, wherein the dsRNA compound is administered in maintenance doses, ranging from about 0,01 mg to 100 mg per kg of body weight, once or more daily, once or more weekly, once or more monthly, once or more quarterly, once or more yearly, to once every 20 years or ranging from about 0.1 mg to 1500 mg dosing. In certain embodiments, it may be desirable to administer the dsRNA compound from at most once daily, once weekly, once monthly, once quarterly, once yearly, once every two years, once every three years, once every four years, once every five years, once every ten years, to once every 20 years.

[0353] In certain embodiments, the range of therapeutically effective dosing may be between any of about lmg-1500mg, 100mg-I400mg, 100mg~1300mg, 100mg~1200mg, 100mg-l lOOmg, lOOmg-lOOOmg, 100mg-900mg, 200mg-800mg, 300mg-700mg, 400mg-600mg, 100mg-400mg, 200mg-500mg, 300mg-600mg, and 400mg~700mg. In certain embodiments, a therapeutically effective dose is about lOOmg, 150mg, 200mg, 250mg, 300mg, 350rng, 400mg, 450mg, 500mg, 550mg, 600mg, 650mg, 700mg, 800mg, 850mg, 900mg, 950mg, lOOOmg, 1050mg, 1 lOOmg, 1150mg, 1200mg, 1250mg, 1300mg, 1350rag, 1400mg, 1450rag, or 1500mg. In certain embodiments, a preferred dose is selected from 700mg, 800mg and 900mg.

[0354] In certain embodiments, a therapeutically effective amount of the dsRNA compound is dosed at any of about 150mg, 200mg, 300mg, 400mg, 500mg, 600mg, 700mg, 800mg, or 900mg twice a year. In certain embodiments, a therapeutically effective amount of the dsRNA compound is dosed at about 150mg, 200mg, 300mg, 400mg, 500mg, 600mg, 700mg, 800mg, or 900mg quarterly. In certain embodiments, a therapeutically effective amount of the dsRNA compound is dosed at about 150mg, 300mg or 600mg once every 3 months. In certain embodiments, a therapeutically effective amount of the dsRNA compound is dosed at about I50mg, 300mg or 600mg once every 6 months.

[0355] Administration

[0356] The dsRNA compounds, such as siRNA compounds or pharmaceutical compositions of the present invention, can be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated. Administration can be oral, inhaled or parenteral.

[0357] In certain embodiments, the dsRNA compounds and compositions as described herein are administered parenterally. Parenteral administration includes intravenous, intra-arterial,subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration. In certain embodiments, parenteral administration is by infusion. Infusion can be chronic or continuous or short or intermittent, In certain embodiments, infused pharmaceutical agents are delivered with a pump.

[0358] In certain embodiments, parenteral administration is by injection. The injection can be delivered with a syringe or a pump. Tn certain embodiments, the injection is a bolus injection. In certain embodiments, the injection is administered directly to a tissue or organ.

[0359] In certain embodiments, formulations for parenteral, intrathecal or intraventricular administration can include sterile aqueous solutions which can also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.

[0360] In certain embodiments, formulations for oral administration of the compounds or compositions can include, but is not limited to, pharmaceutical carriers, excipients, powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or non-aqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsifiers, dispersing aids or binders can be desirable. In certain embodiments, oral formulations are those in which compounds provided herein are administered in conjunction with one or more penetration enhancers, surfactants and chelators.

[0361] In Vitro Testing of ds RN As

[0362] Described herein are methods for treatment of cells with dsRNA compounds, for example, siRNA compounds, which can be modified appropriately for treatment with other oligomeric compounds.

[0363] Cells may be treated with siRNA compounds when the cells reach approximately 60-80% confluency in culture.

[0364] One reagent commonly used to introduce siRNAs into cultured cells includes the cationic lipid transfection reagent LipofectamineFMRNAiMAX (Invitrogen, Waltham, MA). siRNAs may be mixed with Lipofectamine™ RNAiMAX in OPTI-MEM™ 1 (ThermoFisher Scientific, Waltham, MA) to achieve the desired final concentration of siRNA and a Lipofectamine™ RNAiMAX concentration that may range from 0.001 to 300 nM siRNAs. Transfection procedures are done according to the manufacturer’s recommended protocols.Another technique used to introduce siRNA compounds into cultured cells includes electroporation.

[0365] siRNA compounds conjugated with an N-Acetylgalactosamme-comprising moiety (GalNAc) can be introduced to cells through incubation of the siRNA compounds with cells without transfection reagents, referenced herein as “free uptake”. The siRNA-GalNAc conjugates are transported into asialoglycoprotein receptor (ASGR) positive cells, such as hepatocytes, via endocytosis.

[0366] Cells are treated with siRNA compounds by routine methods. Cells may be harvested 4 -144 hours after siRNA compounds treatment, at which time mRNA (harvested at 4-144 hrs) or protein levels (extracted at 24-96 hrs) of target nucleic acids are measured by methods known in the art and described herein. In general, treatments are performed in multiple replicates, and the data are presented as the average of the replicate treatments plus the standard deviation.

[0367] The coneentration of siRNA compounds used varies from cell line to cell line and target to target. Methods to determine the optimal siRNA compound concentration for a particular target in a particular cell line are well known in the art. In general, cells are treated with siRNA compounds in a dose-dependent manner to allow' for the calculation of the half-maximal inhibitory concentration value (IC50). siRNA compounds are typically used at concentrations ranging from about 0.001 nM to 300 nM when transfected with Lipofectamine1MRNAiMAX. siRNA compounds are used at higher concentrations ranging from about 625 to 20,000 nM when transfected using electroporation or free uptake.

[0368] RNA Isolation

[0369] RNA analysis of CFB mRNA levels can be performed on total cellular RNA or poly(A)+ mRNA. Methods of RNA isolation are well known in the art. RNA is prepared using methods well known in the art, for example, using the TR1ZOL Reagent (ThermoFisher Scientific, Waltham, MA), Qiagen RNeasy kit (Qiagen, Hilden, Germany), or AcroPrep Advance 96-well Filler Plates (Pall Corporation, Port Washington, New York) using Qiagen’s RLT, R. W1, and RPE buffers. RNA extraction procedures are done according to the manufacturer’s recommended protocols.In Vivo Testing of dsRNA Compounds

[0370] dsRNA compounds, for example, siRNA compounds, are tested in animals to assess their ability to inhibit expression of CFB and produce phenotypic changes such as a decrease in one or more CFB related diseases, disorders, and / or conditions. Testing may be performed in normal animals, or in experimental disease models. For administration to animals, dsRNA compounds are formulated in a pharmaceutically acceptable diluent, such as phosphate- buffered saline. Administration includes parenteral routes of administration, such as intraperitoneal, intravenous, and subcutaneous. Calculation of dsRNA compound dosage and dosing frequency depends upon factors such as route of administration and animal body weight. In one embodiment, following a period of treatment with dsRNA compounds, R. NA encoding CFB is isolated from liver tissue, and changes in CFB expression are measured. Changes in CFB protein levels can also be measured. Changes in CFB related diseases, disorders and / or conditions may be used as markers for determining the level of CFB inhibition in the animal.

[0371] Certain Indications

[0372] In certain embodiments, the invention provides methods of treating a subject comprising administering one or more compounds and / or pharmaceutical compositions of the present invention to the subject. In certain embodiments, the subject has, or is at risk for, a CFB related disease, disorder and / or condition, or symptom thereof. In certain embodiments, the invention provides methods for prophylactically reducing CFB expression in a subject. Certain embodiments include treating a subject in need thereof by administering to the subject a therapeutically effective amount of a dsRNA compound, such as an siRNA compound, targeted to a CFB nucleic acid.

[0373] In certain embodiments, administration to a subject of a therapeutically effective amount of a dsRNA compound targeted to a CFB nucleic acid is accompanied by monitoring of CFB levels in the blood plasma or tissue of the subject, to determine a subject's response to administration of the dsRN A compound. A subject's response to administration of the dsRNA compound is used by a physician to determine the amount and duration of therapeutic intervention.

[0374] In certain embodiments, administration to a subject of a dsRNA compound targeted to a CFB nucleic acid results in reduction of CFB expression by at least about 15%, 20%, 25%, 30%,.35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% or a range defined by any two of these values, In certain embodiments, administration of a dsRNAcompound targeted to a CFB nucleic acid results in inhibition of CFB by at least about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% or a range defined by any two of these values. In certain embodiments, administration of a dsRNA compound targeted to a CFB nucleic acid results in a change in the CFB related disease, disorder, condition, symptom and / or marker (e.g., symptoms of inflammation such as redness, swelling, heat, loss of function and / or pain) in the subject. In certain embodiments, administration of a CFB dsRNA compound increases or decreases the CFB related disease, disorder, condition, symptom and / or marker by at least about 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%;, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99% or 100% or a range defined by any two of these values in the subject.

[0375] In certain embodiments, pharmaceutical compositions comprising a dsRNA compound targeted to CFB are used for the preparation of a medicament for treating a subject suffering or susceptible to a CFB related disease, disorder and / or condition.

[0376] In certain embodiments, the dsRNA compound is an siRNA compound targeting CFB as listed in Tables 2, 6 or 10.

[0377] Certain Combination Therapies

[0378] In certain embodiments, a first agent comprising a dsRNA compound provided herein is co-administered with one or more secondary agents to a subject. In certain embodiments, the dsRNA compound is an siRNA compound listed in Tables 2, 6 or 10.

[0379] In certain embodiments, such second agents are designed to treat in a subject the same CFB related disease, disorder and / or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat in a subject a different disease, disorder, and / or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat in a subject an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, such first agents are designed to treat an undesired side effect of a second agent. In certain embodiments, second agents are co¬ administered with the first agent to treat an undesired effect of the first agent. In certain embodiments, second agents are co-administered with the first agent to produce a combinational or additive effect. In certain embodiments, second agents are co-administered with the first agent to produce a synergistic effect.In certain embodiments, the co-administration of the first and second agents permits use of lo wer dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy. In certain embodiments the dose of a co-administered second agent is the same as the dose that would be administered if the second agent was administered alone. In certain embodiments the dose of a co-administered second agent is greater than the dose that would be administered if the second agent was administered alone.

[0380] In certain embodiments, a first agent and one or more second agents are administered at the same time, in certain embodiments, the first agent and one or more second agents are administered at different times. In certain embodiments, the first agent and one or more second agents are prepared together in a single pharmaceutical formulation. In certain embodiments, the first agent and one or more second agents are prepared separately.

[0381] In certain embodiments, second agents include, but are not limited to, certain procedures to reduce weight, diet changes, lifestyle changes, and additional therapeutic agents to treat the same CFB related disease, disorder and / or condition as the first agent described herein. Examples of additional therapeutic agents include immunosuppressants, non-steroidal anti-inflammatory drugs (NSAIDs), disease modifying anti-rheumatic drugs (DMARDs), intravenous immunoglobulins (IV IG), and insulin. In certain embodiments, the immunosuppressant is a steroid (e.g., prednisone, methylprednisolone, or dexamethasone), colchicine, hydroxychloroquine, sulfasalazine, dapsone, methotrexate, mycophenolate mofetil, azathioprine, anti-IL-1 biologic (e.g.. anakinra, canakinumab, or rilonacept), anti-TNF biologic (e.g,, infliximab, adalimumab, golimumab, etanercept, or certolizumab), anti-IL-6 biologic (e.g., tocilizumab, or sarilumab), anti¬ complement biologic (e.g., eculizumab), anti-CD20 biologic (e.g., rituximab), anti-B cell growth factor biologic (e.g., belimumab), cyclosporine, anti-CTLA4 biologic (e.g., abatacept), anti-IL-17 biologic (e.g., secukinumab, ixekizumab, or brodalumab), anti-IL-23 biologic (e.g., guselkumab or ustekinumab), anti-IL-5 biologic (e.g,, mepolizumab, reslizumab, or benralizumab), anti-IL- 4 / anti-IL-13 biologic (e.g., dupilumab), anti-IgE biologic (e.g., omalizumab), anti-a4|37 integrin biologic (e.g., vedolizumab), or JAK inhibitor (e.g., tofacitinib, upadacitinib, or baricitinib). In certain embodiments, the NS AID is diclofenac, difluni sal, etodolac, fenoprofen, flurbiprofen, ibuprofen, indomethacin, ketoprofen, ketorolac, mefenamic acid, meloxicam, nabumetone, naproxen, oxaprozin, piroxicam, sulindac, tolmetin, celecoxib, rofecoxib, or valdecoxib. In certain embodiments, the DMARD is methotrexate, leflunomide, hydroxychloroquine, sulfasalazine,infliximab, adalimumab, etanercept, rituximab, abatacept, rituximab, tocilizumab, tofacitinib, and JAK inhibitors. In certain embodiments, the additional therapeutic agent(s), when used in combination with the compounds or compositions comprising a dsRNA compound described herein in a subject, may provide a synergistic or additive effect in treating a CFB associated disease, disorder and / or condition.

[0382] The second agent can be used in combination with a first agent described herein to decrease a CFB related disease, disorder and / or condition in a subject. Such CFB related disease, disorder and / or condition include inflammatory diseases, disorders and / or conditions such as age-related macular degeneration (AMD), atypical hemolytic uremic syndrome (aHUS), paroxysmal nocturnal hemoglobinuria (PNH), diabetes (Type 2), metabolic syndrome, insulin resistance, cardiovascular disease, dyslipidemia, systemic lupus erythematosus (SEE), psoriasis, dermatomyositis, eczema, vitiligo, psoriasis, primary immunoglobulin A nephropathy (I AN), arthritis (e.g., reactive arthritis, rheumatoid arthritis (RA)), diabetes (Type 1), Addison's disease, Graves' disease, Hashimoto's thyroiditis, myasthenia gravis, scleroderma, multiple sclerosis (MS), Guillain-Barre syndrome, Crohn's disease, ulcerative colitis (UC), vasculitis, Kawasaki disease, Celiac disease, inflammatory bowel disease (1BD), pernicious anemia, Raynaud's phenomenon, or Sjogren's syndrome.

[0383] Kits of the Invention

[0384] According to another aspect of the invention, kits are provided. Kits according to the invention include package(s) comprising any of the compositions of the invention or oligomeric compound of the invention. In various aspects, the kit comprises any of the compositions of the invention as a unit dose. For purposes herein “unit dose" refers to a discrete amount dispersed in a suitable carrier.

[0385] The phrase "package" means any vessel containing compositions presented herein. In preferred embodiments, the package can be a box or wrapping. Packaging materials for use in packaging pharmaceutical products are well known to those of skill in the art. Examples of pharmaceutical packaging materials include, but are not limited to, blister packs, bottles, tubes, inhalers, pumps, bags, vials, containers, syringes (including pre-filled syringes), bottles, and any- packaging material suitable for a selected formulation and intended mode of administration and treatment.The kit can also contain items that are not contained within the package but are attached to the outside of the package, for example, pipettes.

[0386] Kits may optionally contain instructions for administering compositions of the present invention to a subject having a condition in need of treatment. Kits may also comprise instructions for approved uses of components of the composition herein by regulatory agencies, such as the United States Food and Drug Administration. Kits may optionally contain labeling or product inserts for the present compositions. The package(s) and / or any product insert(s) may themselves be approved by regulatory agencies. The kits can include compositions in the solid phase or in a liquid phase (such as buffers provided) in a package. The kits also can include buffers for preparing solutions for conducting the methods, and pipettes for transferring liquids from one container to another.

[0387] The kit may optionally also contain one or more other compositions for use in combination therapies as described herein. In certain embodiments, the package(s) is a container for any of the means for administration such as intravitreal delivery, intraocular delivery, intratumoral delivery, peritumoral delivery, intraperitoneal delivery, intrathecal delivery, intramuscular injection, subcutaneous injection, intravenous delivery, intra-arterial delivery, intraventricular delivery, intrastemal delivery, intracranial delivery, or intradermal injection.

[0388] Methods of Use

[0389] The invention provides methods for inhibiting the expression of a CFB in a subject and methods of treating and / or preventing a CFB associated disease, disorder and / or condition or the symptoms thereof in a subject comprising administering an effective amount of a dsRNA compound of the invention or a pharmaceutical composition of the invention, so as to inhibit the expression of CFB in the subject. The invention also provides the compounds for use in treating ans / or preventing an CFB associated disease, disorder and / or condition in a subject.

[0390] In some embodiments of the present disclosure, the subject is a mammal, including, but not limited to, mammals of the order Rodentia, such as mice and hamsters, and mammals of the order Logomorpha, such as rabbits* mammals from the order Carnivora, including Felines (cats) and Canines (dogs), mammals from the order Artiodactyla, including Bovines (cows) and Swines (pigs) or of the order Perissodactyla, including Equines (horses). In some aspects, the mammalsare of the order Primates, Ceboids, or Simoids (monkeys) or of the order Anthropoids (humans and apes). In a preferred aspect, the mammal is a human.

[0391] ADVANTAGES OF THE INVENTION

[0392] Disclosed herein are dsRNA compounds (e.g., siRNAs) targeting CFB improved with Advanced RNA Targeting (ARNATAR) abilities that enhance their gene silencing activity. 'The dsRNA compounds utilize ARNATAR motifs in conjunction with CFB targeting sequences to produce stable and / or durable therapeutic compounds allowing longer lasting benefits for acute and / or chronic diseases and / or less frequent dosing of the therapeutic compound. In addition to stability and / or durability, the dsRNA compounds utilizing ARNATAR motifs may have a quicker mode of action (for example, by knocking down CFB expression at an earlier time than the reference compound), which would be beneficial for acute diseases. In some instances, ARNATAR dsRNA compounds have been found to be more potent than a reference compound.

[0393] Another benefit of ARNATAR designed dsRNA compounds targeting CFB is a shortness of length. This shortness of length allows a shorter synthesis protocol, shorter synthesis time and / or decreases the cost of manufacturing the compounds.

[0394] Additionally, ARNATAR designed dsRNA compounds are very potent inhibitors of CFB. The high potency allows CFB reduction in tissues other than liver.

[0395] Accordingly, there is a need for improved dsRNA compounds to treat diseases. ARNATAR dsRNA compounds targeting CFB have been designed to improve speed, stability, specificity, safety and / or potency in order to produce an improved therapeutic.

[0396] EXAMPLES

[0397] While certain compounds, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is herein incorporated-by-reference in its entirety.EXAMPLE 1. DESIGN OF siRNAs TARGETING CEB

[0398] siRNAs were designed with ARNATAR motifs to target a human CFB mRNA transcript (Table 1, SEQ ID NO:1) at different regions within the mRNA transcript.

[0399] Table 1: CFB Target Sequences

[0400] Name SEQ ID KO

[0401] Human C FB, Gen B an k N M 001710.6 | 1

[0402]

[0403] siRNAs targeting human CFB mRNA (SEQ ID NO: 1) were designed and pre-screened in cells for activity. siRNAs were designed as 21 linked nucleosides with 2 nucleoside overhangs at the 3’ end of each strand.

[0404] The following applies to all modified sequences disclosed herein:

[0405] A notation is made before each nucleoside indicating the type of chemical modification, if any, made to the nucleoside. If" no modification notation is made before a letter designating a nucleotide, the nucleotide is a deoxyribonucleotide. Notations for the chemical modifications to the strands can be found as follows:

[0406] (5p) 5 ’-phosphate

[0407] r = ribonucleotide

[0408] d or no notation before the nucleoside:= deoxyribonucleotide, which has been substituted for a ribonucleotide

[0409] f= 2’-F

[0410] m = 2 ’-OMe

[0411] * “ phosphorothioate (PS) linkage, which has been substituted for a phosphate (PO) linkage

[0412] If more than one sequence is disclosed in one row of the tables (e.g., Tables 2, 6. and 10) disclosed herein, the SEQ ID NO applies to the modified sequence (“Sequence + Chemistry”).

[0413] Based on pre-screening results, 14 active siRNAs, shown in Table 2 and Figure 1, were further tested, A reference siRNA (ATsi 1005), as shown in Table 2 A and Figure 1, was synthesized and used as a control in some studies described herein. This reference siRNA ATsi 1005 mirrorsthe sequence and chemistry of a compound known as AD-560132 in the prior art (PCT Publication WO2021222549).

[0414] Table 2. Sequence and Chemistry of Amatar CEB siRNAs

[0415] Sense or Strand Sequence and Chemistry i Sequence SEQ, 1 D Name

[0416] Antisense Name 5' to 3’ i 5' to 3' NO (5pj(mA) * (T) * (mU) (fG) (mA) (fU) (T) | ATOGAUTUCAII Antisense ATa991 * (mU) (fC) (mA) (mU) (fU) (mG) (fA) i 2 ATsi- 991 (nA

[0417] (mG) * (fC) * (mA) (mG) (fC) (mU) (fC) | rrACriiCAAUC Sense ATs991 (mA) (fA) (fU ) (mG) (mA) (fA) (mA) (fU) 3

[0418] (mC) (mA) (fA) (mU) * ( T) * (T) AAAUCAAUTT

[0419] . UT^UUCCUGAG Antisense ATa992 * (mU) (fG) (mA) (mG) (fC) (mU) (fU)CUUGAUCAGG4 ATsi- (mG) (fA) (mU) (mC) (A) * (mG) * (mG)

[0420] 992 (mU) * (fG) * (mA) (mU) (fC) (mA) (fA)

[0421] Sense ATs992 (mG) (fC) (fU) (mC) (mA) (fG) (mG) (fA)Arr AAHAATT 5

[0422] (mA) (mU) (fA) (mA) * ( T) * (T)

[0423] "(5pXmUr

[0424] Antisense ATa993 * (mU) (fC) (mA) (mG) (fG) (mG) (fU) GGUGCUCCAG ’ 6 ATsi- (mG) (fC) (mU) (mC) (C) * (mA) * (mG)

[0425] 993 (mG) * (fG) * (mA) (mG) (fC) (mA) (fC)

[0426] Sense ATs993 (mC) (fC) (fU) (mG) (mA) (fA) (mG) (fA) ' X. TT 7

[0427] (mC) (mU) (fCHmA) * ( T) - |T) MGACUCATT (5p)(mA) • (A) • (mU) (fG) (mAHfA) (A)

[0428] Antisense ATa994 • (mC) (fG) (mA) (mC) (fU) (mU) (fC) 8 ATsi- (mU) (fC) (mU) (mU) (G) * (mU) * (mG)

[0429] 994 (mC) * (fA) * (mA) (mG) (fA) (mG) (fA)

[0430] Sense ATs994 (mA) (fG) (fU) (mC) (mG) (fU) (mU) (fU) ^AG X? GUC 9

[0431] (mC) (mA) (fU) (mU) * ( T) * (T)

[0432] (5p)(mU) * (T) * (mA) (fU) (mA) (fG) (G) UTAUAGGAAACAntisense ATa995 * (mA) (fA) (mA) (mC) (fC) (mC) (fA) ^A^cnir 10 ATsi- (mA) (fA) (mU) (mC) (C) * (mU) * (mC)

[0433] 995 (mG) * (fG) * (mA) (mU) (fU) (mU) (fG)

[0434] ,,,......... UUAU UUUkJvj U Sense ATs995 (mG) (fG) (fU) (mU) (mU) (fC) (mC) (fU) 11

[0435] (mA) (mU) (fA) (mA) * ( T) * (T)

[0436] (5p)(mU) * (G) * (mA) (fG) (mU) (fG) (T)frTl irn iAntisense ATa996 * (mU) (fC) (mC) (mU) (fU) (mG) (fU) UO ICAUCCAC 12 ATsi- (mC) (fA) (mU) (mC) (C) * (mA) * (mC) |

[0437] 996 (mG) * (fG) * (mA) (mil) (fG) (mA) (fC) |GGAUGACAAGSense ATs996 (mA) (fA) (fG) (mG) (mA) (fA) (mC) (fA) i ^^fn. CATT 13

[0438]

[0439] (mC) (mil) (fC) (mA) * ( T) * (T) i(5p)(mU) * (A) * (mA) (fU) (mC) (fG) (G) j

[0440] Antisense ATa997 * (mU) (fA) (mC) (mC) (fC) (mU) (fU) ri ii irri ICTCI J ATsi- (mC) (fC) (mU) (mG) (T) * (mG) * (mU)1

[0441] 997

[0442] , ir^\ trm i..i f A k i -.1 ACAbbAAbUb

[0443] Sense ATs997 (mG) (fG) (fG) (mU) (mA) (fC) (mC) (fG) 15 i i 1 1\ t£i i\ t ±! -i-k i j UACCQJAUUAJ I (5p)(mU) * (A) * (mG) (fA) (mU) (fC) (T)

[0444] • - -. - s UAGAUC I (JCAW Antisense ATa998 * (mG) (fC) (mA) (mG) (fG) (mil) (fA) 16 GUACGUGTCU ATsi- y ). J yi *?)..* JT y )

[0445] 998 (mA) * (fC) * (mA) (mC) (fG) (mU) (fA)

[0446] ACACGUACCUG

[0447] 5 Sense ATs998 (mC) (fC) (fU) (mG) (mC) (fA) (mG) (fA)

[0448] CAGAUCUATT

[0449] (mU) (mC) (fU) (mA) * ( T) * (T)

[0450] IspRmU)^

[0451] UAAUGATUGAG

[0452] | Antisense ATa999 * (mU) (fG) (mA) (mG) (fA) (mU) (fC) 18 AUCUUGGCCU ATsi- | (mil) (fU ) (mG) (mG) (C) * (mC) * (mU)

[0453] 999 | (mG) * (fC) * (mC) (mA) (fA) (mG) (fA)

[0454] GCCAAGAUCUC

[0455] Sense ATs999 (mil) (fC) (fU) (mC) (mA) (fA) (mH) (fC) | 19 AAUCAUUATT

[0456] (mA) (mU) (fU) (mA) * ( T) * (T) i I t. j (5pj^

[0457] UGAUAGTCUGG

[0458] Antisense ATalOOO * (mC) (fU) (mG) (mG) (fC) (mC) (fA) I 20 CCAUAUUTCA ATsi- (mU) (fA) (mH) (mU) (T) * (mC) * (mA) I ) 1000 (mA) * (fA) * (mA) (mU) (fA) (mU) (fG)

[0459] AAAUAUGGCCA

[0460] Sense ATs 1OOO (mG) (fC) (fC) (mA) (mG) (fA) (mC) (fU)

[0461] GACUAUCATT

[0462] (mA) (mil) (fC) (mA) * ( T) * (T)

[0463] UAAUCCAUCAG

[0464] Antisense ATalOOl * (mil) (fC) (mA) (mG) (fU) (mC) (fA)

[0465] UCAUGAGGAU ATsi- (mil) (fG) (mA) (mG) (G) * (mA) * (mil)

[0466] 1001 (mC) * (fC) * (mU) (mC) (fA) (mU) (fG)

[0467] CCUCAUGACUG ( Sense ATslOOl (mA) (fC) (fU) (mG) (mA) (fU) (mG) (fG) 23 AUGGAUUATT (. ]..(mA) (mU) (fU) (mA) " ( T) * (T). ‘

[0468] 1 (5pj(mU) * (A) * (mA) (fA) (mG) (fC) (f )

[0469] UAAAGCTCGAG i Antisense ATal002 * (mC) (fG) (mA) (mG) (fU) (mU) (fG)

[0470] UUGUUCCCUC ( ATsi- (mU) (fU) (mC) (mC) 1 (C) * (mU) * (mC)

[0471] 1002 (mG) * (fG) * (mG) (mA) (fA) (mC) (fA)

[0472] GGGAACAACUC ( Sense ATS1002 (mA) (fC) (fU) (mC) (mG) (fA) (mG) (fC) '

[0473] GAGCUUUATT ) _ | (mU) (mU) (fU) (mA) * ( T) * (T) ’

[0474] | (5p)(mU) * (C) * (mA) (fG) (mA) (fG) (A)

[0475] UCAGAGACUGG ( Antisense ATal003 * (mC) (fU) (mG) (mG) (fC) (mU) (fU)

[0476] CUUUCAUCGA ( ATsi- ( (mU) (fC) (mA) (mU) (C) * (mG) * (mA)

[0477] 1003 [ (mG) * (fA) * (mil) (mG) (fA) (mA) (fA)i

[0478] GAUGAAAGCCA ) Sense ATS1003 | (mG) (fC) (fC) (mA) (mG) (fU) (mC) (fU) '

[0479] GUCUCUGATT (

[0480]

[0481] j (mC) (mU) (fG) (mA) * ( T) * (T) _ [ '(5p)(mA) * (A) * (mC) (fU) (mA) (fG ) (A) |

[0482] Antisense ATal004 28 ATsi- (mil) (fU n) ( / mTG)u (m TG)u (Crf) * (mil) * (mi,l n) j 1 AUCUUGGCUU

[0483] 1004 (mG) * (fC) * (mC) (mA) (fA) (mG) (fA) j

[0484] Sense ATs 1004 (mU) (fA) (fU) (mG) (mG) (fU) (mC) (fU) j ““A.r?^TT 29 (mA) (mG) (fU) (mU) « ( T) ♦ (I) _ _ L 21.

[0485]

[0486] ..

[0487] Table 2A. Sequence and Chemistry of Reference CFB siRNA

[0488] Sense or Strand Sequence and Chemistry Sequence Name Antisense Name 5' to 3' 5' to 3' ATsi- ) (mA)*(fU)*(mG)(mG)(mA)(fG)(mU)(fU)! AUGGAGUUUCUC 1005 Antisense ATal005 (fU)(mC)(mU)(mC)(mC)(fU)(mU)(fC)(m | CUUCAGCCAGG A)(mG)(mC)(mC)(mA)*(mG)*(mG) | AD- (m U ) *(mGj*(mG ij(mC )(m U Jj(mG j(fAHm ] UGGCUG 56013 A)(fG)(fG)(fA)(mG)(mA)(mA)(mA)(mC)( | AAACUCCAU Sense ATS1005 2 mll)(mC)(mC)(mA)(mU)

[0489]

[0490] The siRNAs were synthesized with Mermade 48 in-house, purified, and annealed to form duplexes as described hereinabove.

[0491] EXAMPLE 2. IN VITRO ACTIVITY OF SIRNAS TRANSFECTED INTO CRL5826TMCELLS

[0492] Human CRL5826TMCelis (ATCC, Manassas, VA, USA) were grown to approximately 60-80% confluency before varying doses (0, 0.02, 0.08, 0.4, 2 and 10 nM) of siRNA were transfected into cells using RNAiMAX (InVitrogen, Waltham, MA) according to the manufacturer’s recommended protocol, and the cells were further cultured for 20 hours. Total RNA was prepared from the cells using AcroPrep™ Advance 96-well Filter Plates (Pall Corporation, Port Washington, New York) using Qiagen’s RLT, RW1, and RPE buffers (Qiagen, Hiiden, Germany). RNA extraction procedures were done according to the manufacturer’s recommended protocols. siRNA activity was determined by measuring the levels of target mRNA through qRT-PCR using the CFB primer-probe sets listed in Table 3. The primer-probe sets were designed by Arnatar and synthesized by integrated DNA Technologies (Coralville, IA, USA), qRT-PCR was performed using AgPath-ID™ One-Step RT-PCR Reagents in QS3 real-time PCR system (ThermoFisher Scientific, Waltham, MA, USA). The target RNA levels detected in qRT-PCR assay were normalized to total RNA levels measured with RiboGreen™ (ThermoFisher Scientific, Waltham, MA, USA) in the aliquots of RNA samples used in qRT-PCR, The relative CFB mRNA levels arc shown in Figures 2-3. The IC50s were calculated and shown in Table 4. The activity fold change was calculated relative to the IC50 of reference siRNA ATsi 1005, which was set as 1,

[0493] Table 3: Primer-Probe Sets for Human (hs), Monkey (mk), and Mouse (ms) CFB mRNA j Primer Name Primer Sequence (5’ to 3’) SEQ ID NO; | hsCFB-F 'I CC CTC CTG AAG GCT GGA A 130 | hsCFB-R TGI” ATA GCA AGT CCC GGA TCT CA 131

[0494] - - [ hsCFB-P CT GAT GGA TT GCA CAA CAT GGG CG 132 J msCFB-F AGTCTCTGTGGCATGGTGTG 133 | msCFB-R AGAGGGCGAGTGACTGAGAT 134

[0495] msCFB-P TCATAAGCAACCATGGCAAGCCAAG 135 | mkCFB-F CCT TCA TCT TGG GCC TCT TAT C 136 | mkCFB-R GGA GCC ACC TTT GAT CTC TAC 137

[0496] [ mkCFB-P TG ACC ACC AC TCC ATT GTC TTC GG 138

[0497]

[0498] Table 4, siRNA Inhibition of CFB mRNA in CRL5826TMCells 20 Hrs After Transfection siRNAs IC50 (nM) Fold

[0499] ATsi991 l.,46 5,58

[0500] ATsi.992 4,13 1.98

[0501] ATsi993 3,31 2.46

[0502] ATsi994 2.26 3.61

[0503] ATsi995 2.03 4,02

[0504] AT s i996 3.91 2.09

[0505] AT'si997 7,09.1,15

[0506] ATsi998 4.33 1.89

[0507] ATsi999 4.64.1,76

[0508]

[0509] ATsiltiOO 14,12 0.57

[0510] ATsilOOl 3.54 2.31

[0511] ATsi1002 6.6 1.24

[0512] ATsilt)03 1.94 4,21

[0513] ATsi 1004 2.72.3

[0514] ATsilOOS 8.16

[0515]

[0516] The results show that most of the Amatar designed siRNAs have better inhibitory activity than the reference siRNA ATsilOOS,

[0517] EXAMPLE 3. LV VITRO ACTIVITY OF SELECT SIRNAS TRANSFECTED INTO CRL5826 ™ CELLS

[0518] Several active siRNAs from the previous example were selected for further assessment, Human CRL5826TMCells (ATCC, Manassas, VA, USA) were grown to approximately 60-80% confluency before varying doses (0, 0.02, 0,08, 0.4, 2 and 10 nM) of siRNA were transfected into cells using RNAiMAX (InVitrogen, Waltham, MA) according to the manufacturer’s recommended protocol, and the cells were further cultured for 24 or 48 hours. Total RNA was prepared from the cells using AcroPrep™ Advance 96-well Filter Plates (Pall Corporation, Port Washington, New York) using Qiagen’s RLT, RW1, and RPE buffers (Qiagen, Hilden, Germany). RNA extraction procedures were done according to the manufacturer’s recommended protocols. siRNA activity was determined by measuring the levels of target mRNA through qRT-PCR using the CFB primer-probe sets listed in Table 3.

[0519] qRT-PCR was performed using AgPath-ID™ One-Step RT-PCR Reagents in QS3 real¬ time PCR system (ThermoFisher Scientific, Waltham, MA, USA). The target RNA levels detected in the qRT-PCR assay were normalized to total RNA levels measured using RiboGreenTM (ThermoFisher Scientific, Waltham, MA, USA) in aliquots of the RNA samples used in the qRT- PCR. The relative CFB mRNA levels are shown in Figures 4 and 5. The IC50 Values were calculated and are shown in Table 5. The activity fold change was calculated relative to the IC50 of reference siRN A ATsil005, which was set as I.Table 5, Inhibition of CFB mRNA in CRL5826TMCells after Transfection of Select siRNAs 24 hr 48 hr

[0520] siRNAs ICso (nM) | Fold IC50 (nM) Fold ATsi.991. | 2,28 | 2,01 1.02 2.43 ATsi992 22.2.09 119 2,07 ATsi994 1,69 2,72 0,7 3,5.1 ATsi995 1.93 2.38 0.94 2,63 ATsi998 15 3.07 0,62 3.99 ATsi 1003 1.23 3.75 0.13 18.61 ATsi.l0i)4 1.94 2.37 0.81 3.05 A.'rsij.()()5 4,59 1 2.47 1

[0521]

[0522] The results show that all of the tested siRNAs, ATsi991, ATsi992, ATsi994, ATsi995, ATsi998, ATsi 1003, and ATsi 1004, have better inhibitory activity than the reference siRNA ATsi 1005 in cells after transfection.

[0523] EXAMPLE 4. DESIGN OF GalNAc-CON JUGATED siRNAs

[0524] To evaluate the activity of siRNAs under free uptake conditions (i.e., incubating siRNAs with cells in the absence of transfection reagents), selective siRNAs which showed good activity in the previous example (ATsi991, ATsi992, ATsi994, ATsi995, ATsi998, ATsi 1003, ATsi 1004) and the reference siRNA (ATsil005) were conjugated with a GalNAc moiety and listed in Table 6, Table 6A, and Figure 6 (where the corresponding parental and GalN Ac-conjugated siRNAs are disclosed). A notation is made before each nucleoside indicating the type of chemical modification, if any, made to the nucleoside. If no modification notation is made before a letter designating a nucleotide, the nucleotide is a deoxyribonucleotide. Notations for the chemical modifications to the strands can be found as follows:

[0525] (5p) = 5’ -phosphater = ribonucleoside

[0526] d or no notation before the nucleoside - deoxyribonucleoside, which has been substituted for a ribonucleoside

[0527] f=2’-F

[0528] in === 2’-0Me

[0529] * = phosphorothioate (PS) linkage, which has been substituted for a phosphate (PO) linkage

[0530] If more than one sequence is disclosed in one row of the tables, the SEQ ID NO applies to the modified sequence (“Sequence + Chemistry”).

[0531] The siRNAs selected from Table 2 were conjugated on the sense strand with an N- Acetylgalactosamine-comprising moiety (GalNAc), ARNATAR GalNAc (also known as GA2), which is described hereinabove and in WO2024137545 (incorporated-by-reference herein). The new siRNAs are shown in Table 6. The reference siRNA ATsi 1005 was conjugated with a GalNAc (AL-GalNAc) disclosed in WO2021222549, and the new compound was designated ATsi 1023 as shown in Table 6A.

[0532] Table 6. Sequence and Chemistry of GalNAc-Conjugated CFB siRNAs

[0533] Sense or Strand Sequence and Chemistry Sequence SEQ NameA.

[0534] 1 Antisense Name 5' to 3' 5' to 3' ID NO (5p)(mA) * (T) * (mil) (fG) (mA) (fU)

[0535] (T) * (mil) (fC) (mA) (mH) (fll) (mG) ATUGAUTUCAU Antisense ATa991 2

[0536] (fA) (mG) (fC) (mil) (mG) (C) * (mil) UGAGCUGCUU ATsi- * (mil)

[0537] 1016 (mG) * (fC) * (mA) (mG) (fC) (mil)

[0538] (fC) (mA) (fA) (fll) (mG) (mA) (fA) GCAGCUCAAUG Sense ATslOlG 3

[0539] (mA) (f U) (mC) (mA) (fA) (mil) * ( T) AAAUCAAUTT

[0540] * (T)-[GA2]

[0541] (5p)(mll) * (T) * (mA) (fU) (mil) (fC)

[0542] (C) * (mil) (fG) (mA) (mG) (fC) (mil) UTAULICCUGAG Antisense ATa992 4 ATsi- (fll) (mG) (fA) (mil) (mC) (A) * (mG) CUUGAUCAGG 1017 | * (mG)

[0543] (mil) * (fG) * (mA) (mil) (fC) (mA) UGAUCAAGCUC Sense ATS1017 5

[0544] AGGAAUAATT

[0545]

[0546] (fA) (mG) (fC) (fU) (mC) (mA) (fG)(mG) (fA) (mA) (mU) (fA) (mA) * ( T)

[0547] .. rjIMGA2]

[0548] (5p)(mA) * (A) * (mU) (fG) (mA) (fA)

[0549] (A) * (mC) (fG) (mA) (mC) (fU) (mU) AAUGAAACGAC Antisense 8a 4] (fC) (mil) (fC) (mH) (mil) (G) * (mil) | UUCUCUUGUG ATsi- _

[0550] 1018 | (mC) * (fA) * (mA) (mG) (fA) (mG)

[0551] Sense AT 101 R I CAAGAGAAGUC 9

[0552] 5| (mU) (fU) (mC) (mA) (fU) (mU) * ( T) GUUUCAUUTT

[0553] I * (T)-[GA2]

[0554] | (5p)(mU) * (T) * (mA) (fU) (mA) (fG)

[0555] I UTAUAGGAAAC

[0556] Antisense 10

[0557] 3| (fA) (mA) (fA) (mU) (mC) (C) * (mU) CCAAAUCCUC ATsi- ) * (mC) j

[0558] 1019 (mG) * (fG) * (mA) (mU) (fU) (mU) |

[0559] (fG) (mG) (fG) (fU) (mU) (mU) (fC) GGAUUUGGGU Sense ATS1019 11

[0560] (mC) (fU) (mA) (mU) (fA) (mA) * ( T) UUCCUAUAATT * (T)-[GA2^ _

[0561] (5p)(mU) * (A) * (mG) (fA) (mil) (fC) s

[0562] (T) * (mG) (fC) (mA) (mG) (fG) (mU) | UAGAUCTGCAG Antisense ATa998 16

[0563] (fA) (mC) (fG) (mil) (mG) (T) * (mC) | GUACGUGTCU ATsi- * (mU)

[0564] 1020 (mA) * (fC) * (mA) (mC) (fG) (mU)

[0565] (fA) (mC) (fC) (fU) (mG) (mC) (fA) ACACGUACCUG Sense ATs 1020 17

[0566] (mG) (fA) (mU) (mC) (fU ) (mA) * ( T) CAGAUCUATT

[0567] * (T)-[GA2]

[0568] ( (5p)(mU) * (C) * (mA) (fG) (mA) (fG)

[0569] Antisense A AT!a 1Wfin03J(fu) (mU) (fC)(^mmAG))((mm(JG)) *(mG) CUUCAUGUACGAAUCCUGGAG 26 ATsi- | * (mA) j

[0570] 1021 (mG) * (fA) * (mU) (mG) (fA) (mA) ]

[0571] (fA) (mG) (fC) (fC) (mA) (mG) (fU) GAUGAAAGCCA Sense 27

[0572] S(mC) (fU) (mC) (mU) (fG) (mA) * ( T) GUCUCUGATT.,1[[HGA?!..

[0573] (5p)(mA) * (A) * (mC) (fU) (mA) (fG)

[0574] Antisense AT 1004 (mA) AACUAGACCAU 28 ATsi-a(fC) (mU) (fU) (mG) (mG) (C) * (mU) AUCUUGGCUU 1022

[0575] .. f - - Sense ATsl022 1 (mG) * (mA) ^A^ GCCAAGAUAUG 29

[0576]

[0577] SS (fA) (mU) (fA) (fU) (mG) (mG) (fU) GUCUAGUUTT(mC) (fU) (mA) (mG) (fU) (mil) * ( T)

[0578] * (T)-[GA2]

[0579]

[0580] Table 6A. Sequence and Chemistry of GalNAc-Conjugated Reference CFB siRNA

[0581] Sense or Strand Sequence and Chemistry j Sequence SEQ ID Name

[0582] Antisense Name 5' to 3' | 5' to 3' NO (mA)*(fU)*(mG)(mG)(mA)(fG)(mU)(fU)(f AUGGAGUUUCU

[0583] ATsi- Antisense ATal005 U)(mC)(mU)(mC)(mC)(fU)(mU)(fC)(mA)( CCUUCAGCCAGG 30 1023

[0584] mG)(mC)(mC)(mA)*(mG)*(mG) (mU)*(mG)*(mG)(mC)(mU)(mG)(fA)(mA | UGGCUGAAGGA

[0585] AD- Sense ATS1023 )(fG)(fG)(fA)(mG)(mA)(mA)(mA)(mC)(m GAAACUCCAU 31 560132

[0586] U)(mC)(mC)(mA)(mU)-[AL-GalNAc] j

[0587]

[0588] EXAMPLE 5. CFB siRNA INHIBITION IN CRL5826TMCELLS

[0589] The GalNAc-conjugated siRNAs described in Example 4 were assessed in cells by transfection.

[0590] Human CRL5826TMCells (ATCC, Manassas, VA, USA) were grown to approximately 60- 80% confluency before varying doses (0, 0.02, 0,08, 0.4, 2 and 10 nM) of siRNA were transfected into cells using RNAiMAX (InVitrogen, Waltham, MA) according to the manufacturer’s recommended protocol, and the cells were further cultured for 26 hours. Total RNA was prepared from the cells using AcroPrep’MAdvance 96-well Filter Plates (Pall Corporation, Port Washington, New York) using Qiagen’s RLT, RW1, and RPE buffers (Qiagen, Hilden, Germany). RNA extraction procedures were done according to the manufacturer’s recommended protocols, siRNA activity was determined by measuring the levels of target mRNA through qRT-PCR using the CFB primer-probe sets listed in Table 3.

[0591] qRT-PCR was performed using AgPath-ID™ One-Step R. T-PCR Reagents in QS3 realtime PCR system (ThermoFisher Scientific, Waltham, MA, USA). The target RNA levels detected in qRT-PCR assay were normalized to total RNA levels measured with RiboGreen™ (ThermoFisher Scientific, Waltham, MA, USA) in the aliquots of RNA samples used in qRT-PCR. The relative CFB mRNA levels are shown in Figure 7. The ICSOs were calculated and shown in Table 7. The activity fold change was calculated relative to the IC50 of reference siRNA ATsilO23, which was set as 1,Table 7. CFB siRNA Inhibition in CRL5826TMCells 26 Hrs After Transfection

[0592] siRNA ICso (nM) Fold

[0593] ATsilO16 1,19 5.71

[0594] ATsiiOl? 1 / 74 3 y

[0595] 1 ATsil018 1,24 5.45

[0596] | ATsilO19 1.48 4.58

[0597] j ATsilOgO | r.02 6.62

[0598] | ATsilO21 | L05 6.47

[0599] | ATsilO22 1,76 3.86

[0600] i I

[0601] | AT ’si 1023 | 6.78

[0602]

[0603] The results show that the Arnatar designed siRNAs with GalNAc conjugation have better activity upon transfection than the reference control siRNA ATsilO23.

[0604] EXAMPLE 6. CFB siRNA INHIBITION IN HUMAN PRIMARY HEPATOCYTE (HPH) CELLS BY FREE UPTAKE

[0605] Since asialoglycoprotein receptors (ASGRs) are mainly expressed in liver hepatocytes, the activities of siRNAs disclosed in Table 6 were evaluated in human primary hepatocytes (HPH, from XenoTech, Kansas City, KS, USA). The siRNAs were incubated with HPH and taken up by the cells through free uptake, i.e., siRNAs enter cells through endocytosis via GalNAc-conjugate and ASGR receptor interactions. Cells were incubated at different final concentrations of the siRNAs (0, 0.001, 0,01, 0.1, 1, and 10 pM) and activity was assessed after 64 hrs.

[0606] Total RNA was prepared from the cells using AcroPrepTMAdvance 96-well Filter Plates (Pall Corporation, Port Washington, New York) using Qiagen’s RLT, RW1, and RPE buffers (Qiagen, Hilden, Germany). RNA extraction procedures were done according to the manufacturer’s recommended protocols. siRNA activity was determined by measuring the levelsof target mRNA through qRT-PCR using the human CFB primer-probe set listed in Table 3, qRT- PCR was performed using AgPath-ID™ One-Step RT-PCR Reagents in QS3 real-time PCR system (ThermoFisher Scientific. Waltham, MA, USA). The target RNA levels detected in qRT- PCR assay were normalized to total RNA levels measured with RiboGreenTM(ThermoFisher Scientific, Waltham, MA, USA) in the aliquots of RNA samples used in qRT-PCR. The relative CFB mRNA levels are shown in Figure 8. The IC50s were calculated and shown in Table 8. The activity fold change was calculated relative to the IC50 of reference siRNA ATsil023, which was set as 1.

[0607] 'fable 8. CFB siRNA Inhibition in HPH Cells After 64hrs Free Uptake

[0608] siRNA IC50 (uM) Fold

[0609] ATsilO16 | 0.001 107,4

[0610] ATsilOl? 1 0.015 8.9

[0611] ATsilO18 J 0.003 1 48.7

[0612] ATsilO19 | 0.005 26.3

[0613] ATsil020 | 0,0Q2 85,2

[0614] ATsil()21 | 0.007 19,6

[0615] ATsil022 1 0.009 14.3

[0616] ATsilO23 1 0,135 | 1

[0617]

[0618] The results clearly indicate that several siRNAs. ATsilO16, ATsilO17, ATsi1018, ATsilO19, ATsil020, ATsilO21, and ATsilO22, have better activity than the reference siRNA ATsilO23 in HPH cells upon free uptake.EXAMPLE 7. CFB siRNA ACTIVITY IN MICE

[0619] To evaluate the activity of the human CFB siRNAs in vivo, a mouse model expressing human CFB (hCFB) protein was made. Seven-week old BALB / c (Charles River Laboratories, Wilmington, MA, USA) mice were injected intravenously with 2.5 X 1011virus genome / mouse adeno-associated virus (. AAV) serotype AAV8 expressing hCFB mRNA based on the mRNA sequence of GenBank NM 001710.6 (Sands MS, AAV-Mediated Liver-Directed Gene Therapy, 2014, Methods Mol Biol, 807:141-157) tagged with 3xHA peptide at the 5’ and 3xFLAG tag at the 3’ end. When expressed, the double-tagged hCFB protein is fused with 3xHA at the N-terminus and 3xFLAG tag at the C-terminus and is slightly larger than the endogenous mouse CFB (mCFB) protein, enabling the detection of hCFB using a hCFB antibody (Abeam, Cambridge, UK; Catalog #abl 92577).

[0620] To determine a baseline level of hCFB for each mouse, two weeks after AAV-virus administration, blood was collected from the submandibular vein of each mouse and assessed for hCFB protein levels. About 50-100 pL of blood was collected in EDTA anticoagulation tubes (Sarstedt, Numbrecht, Germany). Blood samples were kept on ice for 30 min, centrifuged at 4°C, 3,500 rpm for 15 min, and then the supernatant plasma was collected. The plasma hCFB protein level from each mouse sample was assessed using Human Factor B ELISA Kit (Abeam, Cambridge, UK; Catalog #abl37973) according to the manufacturer’s protocol. After determining hCFB levels in each mouse, twenty-four mice with comparable plasma hCFB levels were selected, randomized, and divided into six groups.

[0621] To determine siRNA activity in vivo, the day after baseline blood collection, CFB targeting siRNAs (ATsilOl 8, ATsilO19, ATsil020, ATsilO21, and ATsilO23) were dosed subcutaneously at 3 mg / kg in the hCFB transgenic mice (N~4 for each group). Blood was collected at 1, 2, 3, 4, 6, and 8 weeks after siRNA injection. The hCFB protein was detected by ELISA using Human Factor B ELISA Kit (Abeam, Cambridge, UK; Catalog #ab 137973). Two controls were used: 1) BALB / c mice without AAV, and 2) AAV mice dosed with PBS. Average hCFB protein levels relative to PBS control levels (measured at different weeks) are shown in Figure 9 A and Table 9.Table 9. Relative Levels of hCFB Protein in Plasma of Mice Expressing Human 3F1A-CFB- 3FLAG at 1, 2, 3, 4, 6, and 8 Weeks After siRNA Treatment.

[0622] F ’lasma hC] ’B Protein Remainin g

[0623] Relative to AAV+I:’BS (%)

[0624] Cohort

[0625] 0 W 1 W 2 W 3 W 4 W 6 W 1 8 W BALB / c 2.80 | 6.07 3.11 1.26 4.54 8.01 12.36 AAV+PBS 100.00 I 100.00 100.00 100.00 100.00 100.00 100.00 AAV+ATsil018 99.75 1 16.81 25.82 38.72 37.68 39.02 55.52 AAV+ATsi 1019 99.40 1 15.75 24.00 23.40 33.01 36.87 46.51 AAV+ATsi 1020 100.11 | 15.53 34.72 33.40 43.35 54.16 69.66 AAV+ATsi 1021 99.72 1 13.16 19.14 16.44 33.68 73.33 66.92 AAV+ATsi.1023 99.77 | 32.31 23.79 52.67 42.67 56.08 55.57

[0626]

[0627] _

[0628] 'fhe results show that at 3 mg / kg, Arnatar siRNAs ATsilO18 and ATsilO19 demonstrated better activity and longer duration in vivo than reference siRNA ATsil 023 during the over 8- 'ee time frame tested. Consistent between in vitro and in vivo results, these CFB siRNAs were previously shown to be more active than the reference siRNA in cell culture by free uptake and transfection.

[0629] A second study with selected siRNAs (ATsilO18, ATsilO21 and reference siRNA ATsilO23) was performed as described above, with the exception, the number of mice was N=6 per group. Average hCFB protein levels relative to PBS control levels (measured at different weeks) are shown in Figure 9B and Table 9A.

[0630] Table 9A. Relative Levels of hCFB Protein in Plasma of Mice Expressing Human 3HA-CFB- 3FLAG at 1, 2, 3, 4, 6, and 8 Weeks After siRNA Treatment.

[0631] Plasma hCFB protein remaining

[0632] Group relative to AAV+PBS (%)

[0633] (n=6)

[0634] 0 W 1 w 2 W 3 W 4 W 6 W 8 W BALB / c 0.40 22.10 7.11 10.28 2.35 7.34 7.07 AAV+PBS 100.00 100.00 100.00 100.00 100.00 100.00 100.00

[0635]

[0636] AAV+ATsil018 99.14 9.96 25.04 | 34.87 j 47.90 | 65.03 68.62 AAV+ATsilO21 99.19 5.26 15.60 24.02 | 33.67 62.73 77.58 AAV+ATsi!023 99.09 63.16 55.71 j 51.96 | 72.88 | 80.38 94.93

[0637]

[0638] Again the results show that at 3 mg / kg, Arnatar siRNA ATsil018 demonstrated better activity and longer duration in vivo than reference siRNA ATsil023 during the 8-week time frame tested. However, in this study, Arnatar siRNA ATsilO21 also demonstrated better activity and longer duration than reference siRNA ATsilO23 during the 8-week time frame.

[0639] EXAMPLE 8, ASSESSMENT OF ADDITIONAL siRNAs TARGETING CEB

[0640] siRNAs targeting human CFB mRNA (SEQ ID NO: 1) were designed and screened in CRL5826TMcells for activity. siRNAs were designed as 21 linked nucleosides with 2 nucleoside overhangs at the 3’ end of each strand. The sequence and chemistry of each new siRNA is shown in Table 10.

[0641] A notation is made before each nucleoside indicating the type of chemical modification, if any, made to the nucleoside. If no modification notation is made before a letter designating a nucleotide, the nucleotide is a deoxyribonucleotide. Notations for the chemical modifications to the strands can be found as follows:

[0642] (5p)::::5 ’-phosphate

[0643] r ribonucleotide

[0644] d or no notation before the nucleoside = deoxyribonucleotide, which has been substituted tor a ribonucleotide

[0645] f= 2’-F

[0646] in 2’-OMe

[0647] * = phosphorothioate (PS) linkage, which has been substituted for a phosphate (PO) linkage

[0648] If more than one sequence is disclosed in one row of the tables, the SEQ ID NO applies to the modified sequence (“Sequence + Chemistry”).

[0649] Selective siRNAs were conjugated on the sense strand with GalNAc moiety ARNATAR GalNAc (also known as GA2), which is described hereinabove.Table 10. Sequence and Chemistry of GalNAc-Conjugated CFB siRNAs

[0650] ■ Sense or Strand Sequence and Chemistry Sequence i SEQ Name

[0651] Antisense Name 5' to 3' 5' to 3' ID NO (5p)(mU)*T*(mA)(fA)(mA)(fA)T*(mU)(fC)(m HTAAAATOCA i Antisense ATal317 A)(mG)(fG)(mA)(fA)(mU)(fU)(mC)(mC)T*(mG GGAAUUCCTG 32 ATsi- )*(mG)

[0652] 1317 (mA)*(fG)*(mG)(rnA)(fA)(mU)(fU)(mC)(fC)(f AGGAAUUCCU i Sense ATS1317 U)(mG)(mA)(fA)(mU)(fU)(mU)(mU)(fA)(mA)* GAAUUUUAAT j 33

[0653] T*T

[0654] (5p)(mU)*A*(mU)(fC)(mU)(fC)A*(mU)(fC)(m UAUCUCAUCA i Antisense ATal318 A)(mC)(fU)(mC)(fA)(mC)(fA)(mU)(mU)G*(mU CUCACAUUGG i 34

[0655] )*(mG) G

[0656] ATsi- 1318 CAAUGUGAGC i (mC)*(fA)*(mA)(mU)(fG)(mU)(fG)(mA)(fG)(f

[0657] GAUGAGADAT i Sense ATS1318 U)(mG)(mA)(fU)(mG)(fA)(mG)(mA)(fU)(mA)*r„ i 35

[0658] T*T

[0659] (5p)(mU)*T*(mU)(fG)(mA)(fA)A*(rnA)(fG)(m UTUGAAAAGA i Antisense ATal319 A)(mA)(fA)(mU)(fC)(mU)(fG)(mG)(mU)C*(rn AAUCUGGUCA ] 36

[0660] A)*(mC)

[0661] ATsi- 1319 GACCAGAUGu i (mG)*(fA)*(mC)(mC)(fA)(mG)(fA)(mU)(fU)(f

[0662] CUUuUCAAAT i Sense ATS1319 U)(mC)(mU)(fU)(mU)(fU)(mC)(mA)(fA)(mA)* i 37 y *y

[0663] (5p)(mU)*A*(mU)(fG)(mC)(fC)A*(mC)(fA)(m UAUGCCACAG | Antisense ATal32O G)(mA)(fG)(mA)(fC)(mU)(fC)(mA)(mG)A*(mG AGACUCAGAG ] 38

[0664] )*(mA)

[0665] ATsi- (mU)*(fC)*(mU)(mG)(fA)(mG)(fU)(mC)(fU)(f

[0666] 1320 UCUGAGUCUC | C)(mU)(mG)(fU)(mG)(fG)(mC)(mA)(fU)(mA)* UGlJGGCAUAT i Sense ATS132O y * y i 39

[0667] (5p)(mU)*A*(mG)(fA)(mA)(fA)A*(mC)(fC)(m GAGAAAACCC i Antisense ATal321 C)(mA)(fA)(mA)(fU)(mC)(fC)(mU)(mC)A*(mU AAAUCCUCAU = 40

[0668] )*(mC)

[0669] ATsi- T. I. 1321 (mU)*(fG)*(mA)(mG)(fG)(mA)(fU)(mU)(fU)(f UGAGGAUUUG i G)(mG)(mG)(fU)(mU)(fU)(mU)(mC)(fU)(mA)* GGUUUnCUAT i Sense ATS1321 y #y T i41

[0670]

[0671] (5p)(mU)*C*(mU)(fG)(mA)(fU)C*(mC)(fA)(m UCVGAUCCAU Antisense ATal322 U)(mC)(fU)(mA)(fG)(mC)(fA)(mC)(mC)A*(mG CUAGCACCAG 42

[0672] )*(mG) G

[0673] ATsi- 1322 (mU)*(fG)*(mG)(mU)(fG)(mC)(fU)(mA)(fG)(f UGGUGCUAGA A)(mU)(mG)(fG)(mA)(fU)(mC)(mA)(fG)(mA)* UGGAUCAGAT Sense ATS1322 43

[0674] T*T T

[0675] (5p)(mA)*G*(mA)(fA)(mA)(fA)C*(mC)(fC)(m AGAAAACCCA Antisense ATal323 A)(mA)(fA)(mU)(fU)(mC)(fU)(mC)(mA)T*(mC AAUUCUCATC 44

[0676] )*(mU) U

[0677] ATsi- 1323 (mA)*(fU)*(mG)(mA)(fG)(mA)(fA)(mU)(fU)(f AUGAGAAUUU U)(mG)(mG)(fG)(mU)(fU)(mU)(mU)(fC)(mU) GGGUUUUCUT Sense ATs 1323 45

[0678] *T*T T

[0679] .

[0680] (5p)(mA)*A*(mA)(fG)(mC)(fA)T*(mU)(fG)(m AAAGCATUGA Antisense ATal324 A)(mU)(fG)(mU)(fU)(mC)(fA)(mC)(mU)T*(mG UGUUCACUTG 46

[0681] )*(mG)

[0682] ATsi- 1324 (mA)*(fA)*(mG)(mU)(fG)(mA)(fA)(mC)(fA)(f AAGUGAACAU U)(mC)(mA)(fA)(mU)(fG)(mC)(mU)(fU)(mU)* CAAUGCyUUT Sense ATs 1324 47

[0683] T*T J.

[0684] (5p)(mA)*A*(mA)(fU)(mU)(fA)A*(mG)(fU)(m AAAUUAAGUU Antisense ATal325 U)(mG)(fA)(mC)(fU)(mA)(fG)(mA)(mC)A*(mC GACUAGACAC 48

[0685] )*(mU) U

[0686] ATsi- 1325 (mU)*(fG)*(mU)(mC)(fU)(mA)(fG)(mU)(fC)(f UGUCUAGUCA A)(mA)(mC)(fU)(mU)(fA)(mA)(mU)(fU)(mU)* ACUUAAUUUT Sense ATS1325 49

[0687] T*T T

[0688] (5p)(mA)*T*(mA)(fA)(mC)(fU)T*(mG)(fC)(mC ATAACUTGCC Antisense ATal326 )(mA)(fC)(mC)(fU)(mU)(fC)(mll)(mC)A*(mA) ACCUUUUCAA 50

[0689] *(mU) U

[0690] ATsi- 1326 (mU)*(fG)*(mA)(mG)(fA)(mA)(fG)(mG)(fU)(f UGAGAAGGUG G)(mG)(mC)(fA)(mA)(fG)(m(J)(mll)(fA)(mU)* GC / kAGUUAUT Sense ATS1326 51

[0691] T*T T

[0692] (5p)(mA)*A*(mU)(fA)(mU)(fC)T*(mU)(fG)(m AAUAUCTUGG Antisense ATal327 G)(mC)(fU)(mU)(fC)(mA)(fC)(mA)(mC)C*(mA CUUCACACCA 52 ATsi- U

[0693] 1327 (mG)*(fG)*(mU)(mG)(fU)(mG)(fA)(mA)(fG)(f GGUGUGAAGC Sense ATS1327 C)(mC)(mA)(fA)(mG)(fA)(mU)(mA)(fU)(mU)* CAAGAUAUUT 53

[0694] T*T T

[0695]

[0696] (5p)(mA)*A*(mU)(fA)(mU)(fG)T*(mC)(fA)(m AAUAUGTCAC Antisense ATal328 C)(mU)(fA)(mG)(fA)(mC)(fC)(mA)(mU)A*(mU UAGACCAUAU 54

[0697] )*(mC) c

[0698] ATsi- (mU)*(fA)*(mU)(mG)(fG)(mU)(fC)(mU)(fA)(f

[0699] 1328 UAUGGUCuAG G)(mU)(mG)(fA)(mC)(fA)(mll)(mA)(fU)(mU)* UGACAUAUUT Sense ATs 1328 55

[0700] T*T T

[0701] (5p)(mA)*T*(rnC)(fA)(mG)(fA)C*(rnA)(FC)(m ATCAGACACU Antisense ATal329 U)(mll)(fU)(mG)(fA)(mC)(fC)(mC)(mA)A*(mA UUGAGCCAAA 56

[0702] U ATsi- (mU)*(fU)*(mG)(mG)(fG)(mU)(fC)(mA)(fA)(f

[0703] 1329 GUGGGUCAAA A)(mG)(mU)(fG)(mU)(fC)(mU)(mG)(fA)(mU)* GUGUGUGAUT Sense ATs 1329 57

[0704] T*T T

[0705] (5p)(mA)*G*(mC)(fC)(mU)(fU)C*(mU)(fU)(m AGCCUUCUUG Antisense ATal330 G)(mG)(fU)(mG)(fU)(mU)(fA)(mG)(mU)C*(m GUGUUAGUCC 58

[0706] C)*(mC) C

[0707] ATsi- (mG)*(fA)*(mC)(mU)(fA)(mA)(fC)(mA)(fC)(fC

[0708] 1330 GACUAACACC )(mA)(mA)(fG)(mA)(fA)(mG)(mG)(fC)(mU)*T AAGAAGGCUT Sense ATS1330 59

[0709] *T T

[0710] (5p)(mA)*A*(mU)(fC)(mA)(fU)G*(mC)(fU)(m AAUCAUGCUG Antisense ATal331 G)(mU)(fA)(mC)(fA)(mC)(fU)(mG)(mC)C*(mU UACACUGCCG 60

[0711] )*(mG) G

[0712] ATsi- (mG)*(fG)*(mC)(mA)(fG)(mU)(fG)(mU)(fA)(f

[0713] 1331 GGCAGUGUAC C)(mA)(mG)(fC)(mA)(fU)(mG)(mA)(fU)(mU)* AGCAUGAUUT Sense ATS1331T*T 61

[0714] T

[0715] (5p)(mA)*A*(mG)(fG)(mA)(fG)G*(mG)(fA)(m A A A G GA U Antisense ATal332 C)(mG)(fU)(mC)(fA)(mU)(fC)(mU)(mG)G*(mC GUCAUCUGGC 62

[0716] )*(mC)

[0717] ATsi- (mC)*(fC)*(mA)(mG)(fA)(mU)(fG)(mA)(fC)(fG

[0718] 1332 CCAGAUGACG )(mU)(mC)(fC)(mC)(fU)(mC)(mC)(fU)(mU)*T* ucccaccuuT Sense ATS1332 63

[0719] T T

[0720] (5p)(mA)*A*(mU)(fG)(mU)(fU)G*(mU)(fG)(m AAUGUUGUGC ATsi- Antisense ATal333 C)(mA)(fA)(mU)(fC)(mC)(fA)(mU)(mC)A*(mG AAUCCAiJCAG 64 1333

[0721] )*(mU) U

[0722]

[0723] (mU)*(fG)*(mA)(mU)(fG)(mG)(fA)(mU)(fU)(f UGAUGGAUDG G)(mC)(mA)(fC)(mA)(fA)(mC)(mA)(fU)(mU)* CACAACAUUT Sense ATS1333 65

[0724] T*T T

[0725] (5p)(mA)*T*(mU)(fG)(mC)(fC)A*(mA)(fU)(m ATUGCCAAUG Antisense ATal334 G)(mU)(fA)(mU)(fA)(mG)(fC)(mA)(mA)G*(m UAUAGCAAGU 66

[0726] U)*(mC) C

[0727] ATsi- (mC)*(fU)*(mU)(mG)(fC)(mU)(fA)(mU)(fA)(f

[0728] 1334 CUUGCUAUAC C)(mA)(mU)(fU)(mG)(fG)(mC)(mA)(fA)(mU)* ADUGGCAAUT Sense ATS1334 67

[0729] T*T T

[0730] (5p)(mA)*A*(mG)(fA)(mU)(fA)A*(mU)(fC)(m AAGAUAAUCC Antisense ATal335 C)(mU)(fC)(mC)(fC)(mU)(fU)(mG)(mG)G*(m UCCCUUGGGU 68

[0731] U ATsi- 1335 (mC)*(fC)*(mC)(mA)(fA)(mG)(fG)(mG)(fA)(fG CCCAAGGGAG )(mG)(mA)(fU)(mU)(fA)(mU)(mC)(fU)(mU)*T GAUUAUCUUT Sense ATS1335 69

[0732] *T T

[0733] (5p)(mA)*A*(mA)(fC)(mA)(fC)A*(mU)(fA)(m AAACACAUAG Antisense ATal336 G)(mA)(fC)(mA)(fU)(mC)(fC)(mA)(mG)A*(mU ACAUCCAGAU 70

[0734] )*(mA) A

[0735] ATsi- 1336 (mU)*(fC)*(mU)(mG)(fG)(mA)(fU)(mG)(fU)(f UCUGGAUGUC C)(mU)(mA)(fU)(mG)(fU)(mG)(mU)(fU)(mU)* UAUGUGUUUT Sense ATS1336 71

[0736] T*T T

[0737] (5p)(mA)*A*(mA)(fA)(mG)(fC)A*(mll)(fU)(m AAAAGCAUUG Antisense ATal337 G)(mA)(fU)(mG)(fU)(mU)(fC)(mA)(mC)T*(mU AUGUUCACTU 72

[0738] )*(mG) G

[0739] ATsi- 1337 (mA)*(fG)*(mU)(mG)(fA)(mA)(fC)(mA)(fU)(fC AGGGAACAUC )(mA)(mA)(fU)(mG)(fC)(mU)(mU)(fU)(mU)*T AAUGCUUUUT Sense ATS1337 73

[0740] *T T

[0741] (5p)(mA)*G*(mA)(fC)(mU)(fU)T*(mG)(fA)(m AGACUUTGAA Antisense ATal338 A)(mC)(fA)(mC)(fA)(mU)(fG)(mU)(mll)G*(mC CACAUGUUGC 74

[0742] )*(mU) U

[0743] ATsi- 1338 (mC)*(fA)*(mA)(mC)(fA)(mU)(fG)(mU)(fG)(f CAAOAUGUGG U)(mU)(mC)(fA)(mA)(fA)(mG)(mU)(fC)(mU)* UCAAAGUCUT Sense ATs 1338 75

[0744] T*T T

[0745]

[0746] .(5p)(mA)*A*(mU)(fU)(mU)(fG)G*(mU)(fA)(m GL Antisense ATal339 G)(mA)(fA)(mA)(fA)(mC)(fA)(mU)(mC)T*(mU 76 ATsi- (mA)*(fG)*(mA)(mU)(fG)(mU)(fU)(mU)(fU)(f 1339

[0747] C)(mU)(mA)(fC)(mC)(fA)(mA)(mA)(fU)(mU)* Sense ATS1339

[0748] (5p)(mA)*A*(mG)(fA)(mG)(fA)C*(mU)(fG)(m i Antisense ATal340 G)(mC)(fU)(mU)(fU)(mC)(fA)(mU)(mC)G*(m i C{ 78

[0749] (mb) _ | G ATsi- 1340 (mC)*(fGj*(mA)(mU)(fG)(mA)(fA)(mA)(fGj(fC | c<

[0750] )(mC)(mA)(fG)(m(J)(fC)(mU)(mC)(fU)(mU)*T i CJ Cl Sense ATS1340 79

[0751] *T i T (5p)(mA)*A*(mU)(fG)(mC)(fC)A*(mC)(fA)(m Antisense ATal341 G)(mA)(fG)(mA)(fC)(mU)(fC)(mA)(rnG)A*(mG 80 ATsi- 1341 (mU)*(fC)*(mU)(mG)(fA)(mG)(fU)(mC)(fU)(f C)(mU)(mG)(fU)(mG)(fG)(mC)(mA)(fU)(mll)* Sense ATS13411| 81

[0752] (5p)(mA)*G*(mU)(fA)(mC)(fC)C*(mU)(fU)(m i AGUAC XU Antisense AT81342 C)(mC)(fU)(mG)(fU)(mG)(fU)(mU)(mC)C*(mC | CUGUC 82

[0753] )*(mA) | A ATsi- 1342 ( m G ) * (fG f* ( m A) (m A) (f C ) ( m A) (fC) (m A ) ( f G ) (fG |" GGAAC )(mA)(mA)(fG)(mG)(fG)(mU)(mA)(fC)(mU)*T i AA. GGC Sense ATS1342

[0754] (5p)(mA)*A*(mU)(fG)(mG)(fU)T*(mG)(fC)(m; AAUGC Antisense ATal343 U)(mU)(fG)(mU)(fG)(mG)(fU)(mA)(mA)T*(m i UGUGC 84

[0755] C)*(mG) I G ATsi- (mA)*(fU)*(mU)(mA)(fC)(mC)(fA)(mC)(fA)(fA | AGUAC 1343 A )(mG)(mC)(fA)(mA)(fC)(mC)(mA)(fU)(mU)*T* GGAAC Sense ATS1343 85

[0756] T I T

[0757] (5p)(mA)*C*(mC)(fA)(mll)(fA)C*(mA)(fG)(m i AGt Antisense ATal344 C)(mU)(fC)(mU)(fC)(mG)(fU)(mG)(mU)C*(mC i UCi 86 ATsi- |. I C 1344 I (mG)*(fA)*(mC)(mA)(fC)(mG)(fA)(mG)(fA)(fG GAf Sense ATsl344 )(mC)(mU)(fG)(mU)(fA)(mU)(mG)(fG)(mU)*T CU< 87

[0758] *T T

[0759]

[0760] (5p)(mA)*A*(mC)(fA)(mA)(fA)G*(mU)(fA)(m P' A C A, A A G A C Antisense ATal345 C)(mU)(fC)(mA)(fG)(mA)(fC)(mA)(mC)C*(mA) I J C A G A C A C C A 88

[0761] *(mC) r

[0762] ATsi- (mG)*(fG)*(mll)(mG)(fU)(mC)(fU)(mG)(fA)(f

[0763] 1345 GGUGUCUGAG G)(mU)(mA)(fC)(mU)(fU)(mU)(mG)(fU)(mU)* iJACi’iJ UGGiJT Sense ATS1345 89

[0764] T

[0765] (5p)(mA)*A*(mG)(fU)(mG)(fA)A*(mA)(fC)(m

[0766] Antisense ATal346 A)(mA)(fU)(mG)(fU)(mG)(fC)(mU)(mG)C*(m AUGUGCUGCU 90

[0767] U)*(mG) G

[0768] ATsi- (n'iG)*(fC)*(mA)(mG)(fC)(mA)(fC)(mA)(fU)(fU

[0769] 1346 GCAGCACAUU )(mG)(mU)(fU)(mU)(fC)(mA)(mC)(fU)(mU)*T GUUUCACUUT Sense ATS1346 91

[0770] *T T

[0771] (5p)(mA)*A*(mC)(fC)(mU)(fU)G*(mA)(fU)(m AACCU^GAU^ Antisense Ala 1347 U)(mG)(fA)(mG)(fU)(mG)(fU)(mU)(mC)C*(m 92

[0772] U)*(mU) u

[0773] ATsi- (mG)*(fG)*(mA)(mA)(fC)(mA)(fC)(mU)(fC)(fA

[0774] 1347 GGAACACUCA )(mA)(mU)(fC)(mA)(fA)(mG)(mG)(fll)(mU)*T AUCAAGGUUT Sense ATS1347 93

[0775] *T T

[0776] (5p)(mA)*G*(mU)(fG)(mA)(fA)A*(mll)(fA)(m AGUGAAAUAG Antisense ATal348 G)(mG)(fA)(mC)(fU)(mA)(fC)(mU)(mU)C*(m GACUACUUCU 94

[0777] U)*(mA) A

[0778] ATsi-..... -. -... -.... - (mG)*(fA)*(mA)(mG)(fU)(mA)(fG)(mU)(fC)(f

[0779] 1348 GAAGUAGUCC C)(mU)(mA)(fU)(mU)(fU)(mC)(mA)(fC)(mU)* UAUUUCACUT Sense ATS1348 95

[0780] T

[0781] — (5p)(mA)*T*(mA)(fG)(mU)(fC)A*(mU)(fA)(m ATAGUCAUAA Antisense ATal349 A)(mA)(fA)(mU)(fU)(mC)(fA)(mG)(mG)A*(mA / kAGGCAGGAA 96

[0782] )*(mU) U

[0783] ATsi- 1349 (mU)*(fC)*(mC)(mU)(fG)(mA)(fA)(mU)(fU)(f UCCOGAAUUU U)(mU)(mA)(fU)(mG)(fA)(mC)(mU)(fA)(mU)* UAUGACUAUT Sense ATS1349 ysK'y 97

[0784] T

[0785] (5p)(mA)*T*(mU)(fG)(mA)(fU)C*(mA)(fG)(m ATUGAUCAGG ATsi- Antisense ATal35O G)(mG)(fC)(mA)(fA)(mC)(fG)(mU)(mC)A*(mU GCAACGUCAU 98 1350

[0786] )*(mA) A

[0787]

[0788] _(mU)*(fG)*(mA)(mC)(fG)(mU)(fU)(nnG)(fC)(f J

[0789] ATS1350 ICMmC)(mU)(fG)(mA)(fU)(mC)(mA)(fA)(mU)* |

[0790] Sense 99

[0791] I T*T

[0792] (5p)(mA)*A*(mG)(fA)(mC)(fA)A*(mA)(fU)(m AAC

[0793] Antisense ATal351 G)(mG)(fG)(mC)(fC)(mU)(fG)(mA)(mU)A*(m GGC 100

[0794] G)*(mU) U

[0795] ATsi- (mU)*(fA)*(mU)(mC)(fA)(mG)(fG)(mC)(fC)(fC UAL

[0796] 1351

[0797] )(mA)(mU)(fU)(mU)(fG)(mU)(mC)(fU)(mU)*T AUL

[0798] Sense ATs 1351 101

[0799] *T T (5p)(mA)*C*(mA)(fA)(mA)(fG)C*(mU)(fC)(m ACZtAAG Antisense ATal352 G)(mA)(fG)(mU)(fU)(mG)(fU)(mU)(mC)C*(m AGUUGU 102

[0800] C)*(mU) [

[0801] ATsi- 1352 (mG)*(fG)*(mA)(mA)(fC)(mA)(fA)(mC)(fU)(fC GGAACA )(mG)(mA)(fG)(mC)(fU)(mU)(mU)(fG)(mU)*T GAGCCO

[0802] Sense ATS1352 103

[0803] *T T (5p)(mA)*A*(mA)(fC)(mA)(fG)A*(mG)(fC)(m A

[0804] Antisense ATal353 U)(mU)(fU)(mG)(fA)(mU)(fA)(mll)(mC)C*(m U 104

[0805] U)*(mG) G

[0806] ATsi- 1353 (mG)*(fG)*(mA)(mU)(fA)(mU)(fC)(mA)(fA)(f I G A)(mG)(mC)(fU)(mC)(fU)(mG)(mU)(fU)(mll)* G

[0807] Sense ATs 1353 105

[0808] T*T T (5p)(mA)*G*(mA)(fG)(mA)(fU)G*(mU)(fC)(m A

[0809] Antisense ATal354 C)(mU)(fU)(mG)(fA)(mC)(fU)(mU)(mU)G*(m U 106

[0810] U)*(mc) Ic

[0811] ATsi- 1354 (mC)*(fA)*(mA)(mA)(fG)(mU)(fC)(mA)(fA)(fG | c )(mG)(mA)(fC)(mA)(fU)(mC)(mU)(fC)(mU)*T G

[0812] Sense ATS1354 107

[0813] *T T (5p)(mA)*C*(mU)(fC)(mC)(fA)G*(mU)(fA)(m

[0814] Antisense ATal355 C)(mA)(fA)(mA)(fG)(mG)(fA)(mA)(mC)C*(mG 108

[0815] )*(mA)

[0816] ATsi- 1355 (mG)*(fG)*(mU)(mU)(fC)(mC)(fU)(mU)(fU)(f cu G)(mU)(mA)(fC)(mU)(fG)(mG)(mA)(fG)(mU)*

[0817] Sense ATsl355 109

[0818]

[0819] ; i | (5p)(mA)*G*(mU)(fC)(mA)(fG)C*(mA)(fU)(m s Antisense i ATal356 A)(mG)(fG)(mG)(fA)(mC)(fU)(mC)(mA)C*(mU 110 ATsi" i s r i i (mG)*(fU)*(mG)(mA)(fG)(mU)(fC)(mC)(fC)(f 1356

[0820] U)(mA)(mU)(fG)(mC)(fll)(mG)(mA)(fC)(mU)* sense: Aisiobb • 111 i (5p)(mA)*A*(mA)(fC)(mG)(fA)C*(mU)(fU)(m Antisense ATal357 C)(mU)(fC)(mU)(fU)(mG)(fU)(mG)(mA)A*(m 11? ATsi- 1357 i (mU)*(fU)*(mC)(mA)(fC)(mA)(fA)(mG)(fA)(fG AT )(mA)(mA)(fG)(mU)(fC)(mG)(mU)(fU)(m(J)*T Sense A I 113

[0821] *T (5p)(mA)*G*(mA)(fU)(mU)(fA)C*(mA)(fC)(m Antisense ATal358 C)(mA)(fA)(mC)(fU)(mli)(fG)(mA)(mA)T*(mG 114

[0822] )*(mA) ATsi- 1358 (mA)*(fU)*(mU)(mC)(fA)(mA)(fG)(mU)(fU)(f G)(mG)(mU)(fG)(mU)(fA)(mA)(mU)(fC)(mU)* Sense ATsl358 115

[0823] (5p)(mA)*T*(mU)(fU)(mG)(fC)A*(mG)(fA)(m § Antisense ATal359 C)(mA)(fU)(mC)(fC)(mA)(fC)(mU)(mA)C*(mU 116

[0824] )*(mC) (mG)*(fU)*(mA)(mG)(fUKmG)(fG)(mA)(fU)(f G)(mU)(mC)(fU)(mG)(fC)(mA)(mA)(fA)(mU)* UCUGCAAAUT Sense I ATsl359 117

[0825] T*T(5p)(mA)*T*(mG)(fC)(mU)(fU)T*(mU)(fG)(m | ATGCUUTUGC Antisense ATal360 C)(mC)(fG)(mC)(fU)(mU)(fC)(mU)(mG)G*(m; CGCUUCUGGU 118

[0826] U)*(mU) I U (mC)*(fC)*(mA)(mG)(fA)(mA)(fG)(mC)(fG)(fG CCAGAAGCGG Sense ATS1360 )(mC)(mA)(fA)(mA)(fA)(mG)(mC)(fA)(mU)*T* i CAAAAGCAUT 119 |

[0827] T i T (5p)(mA)*C*(mA)(fG)(mG)(fG)C*(mA)(fG)(m Antisense CHmA)(fC)(mU)(fU)(mG)(fA)(mA)(mA)G*(mA 120 |

[0828] )*(mG) ATsi- 1361 (mC)*(f(J)*(mU)(mU)(fC)(mA)(fA)(mG)(fU)(f CUGuCAAGUG G)(mC)(mU)(fG)(mC)(fC)(mC)(mU)(fG)(mU)* CUGCCCuGUT Sense ATS1361 121

[0829]

[0830] > > > > (5p)(mA)*T*(mA)(fU)(mA)(fG)A*(mA)(fA)(m ATAUAGAAAA Antisense ATal362 A)(mC)(fC)(mC)(fA)(mA)(fA)(mU)(mC)C*(mU CCCAAAUCCU 122

[0831] )*(mC) C ATsi- >

[0832] (mG)*(fG)*(mA)(mU)(fU)(mU)(fG)(mG)(fG)(f GGAUUUGGG 1362

[0833] U)(mU)(mU)(fU)(mC)(fU)(mA)(mll)(fA)(mU)* UUUCGAUAU Sense ATS1362 123

[0834] T*T T > (5p)(mA)*T*(mG)(fU)(mU)(fU)T*(mA)(fA)(m i Antisense ATal363 U)(mU)(fC)(mA)(fA)(mU)(fC)(mC)(mC)A*(mC UCAAUCCCAC 124

[0835] )*(mG) _ ATsi- i - >

[0836] (mU)*(fG)*(mG)(mG)(fA)(mU)(fU)(mG)(fA)(f 1363 | b (j Lv A U U <-JAA A)(mU)(mU)(fA)(mA)(fA)(mA)(mC)(fA)(mU)* i Sense i ATS1353 125

[0837] T

[0838] > (5p)(mA)*A*(mU)(fG)(mA)(fA)(mA)(mC)(fG)( U L-JZ^S / VAC G A i Antisense ATal374 mA)(mC)(fU)(mU)(fC)(mU)(fC)(mU)(mU)(fG) CUUCUCUUGU 126

[0839] *(mU)*(mG) i ATsi- 1374 U A. A G A A G U (mC)*(fA)*(mA)(mG)(fA)(mG)(fA)(mA)(fG)(f CGUUUCAUUT

[0840] Sense ATS1018 U)(mC)(mG)(fU)(mU)(fU)(mC)(mA)(fll)(mU)* 9

[0841] T*T-[GA2] > >

[0842] (5p)(mU)*A*(mA)(fG)(mU)(fA)C*(mll)(fC)(m i Antisense ATal376 A)(mG)(fA)(mC)(fA)(mC)(fU)(mA)(mC)A*(mG 127 i i T i i > )*(mC) c A s - - 1376 i UGUGGDGUCU i (mU)*(fG)*(mU)(mG)(fG)(mU)(fG)(mU)(fC)(f 3 G A G I J A C U U A T i Sense ATS1376 U)(mG)(mA)(fG)(mU)(fA)(mC)(mU)(fU)(mA)* i 128: i T*T-[GA2] i r - = J (5pHmU)M*(mA)(fG)(mU)(fA)(mC)(mU)(fC)( i i Antisense ATal377 ImA)<mG)(fA)(rnC)(fA)(mC)(fu>(mA)(mC)(fA)* i 129

[0843] J (mG)*(mC) i i i ATsi- | 1377 i.

[0844] UGiJGGUGUCU i | (mU)*(fG)*(mU)(mG)(fG)(mU)(fG)(mU)(fC)(f GAG GAG U GAT

[0845] i Sense ATS1376 | U)(mG)(mA)(fG)(mU)(fA)(mC)(mU)(fU)(mA)* 128 i i | T*T-[GA2] i _ i | (5p)(mA)*A*(mU)(fU)(mU)(fG)G*(mU)(fA)(m AAUUUGGUAG ATal339 | G)(mA)(fA)(mA)(fA)(mC)(fA)(mU)(mC)T*(mU AAAACAUCTU ATsi- C 1394 (mA)*(fG)*(mA)(mU)(fG)(mU)(fU)(mU)(fU)(f AGAUGGUUUC Sense ATsl394 C)(mU)(mA)(fC)(mC)(fA)(mA)(mA)(fU)(mU)* UACCAAAUUT | T*T- [GA2] T

[0846]

[0847] (5p)(mA)*A*(mA)(fC)(mG)(fA)C*(mU)(fU)(m AAACGACUOC | Antisense ATal357 C)(mU)(fC)(mU)(fU)(mG)(fU)(mG)(mA)A*(m UCUUGUGAAC 1 112 C)*(mU) U 1 ATsi- (mU)*(fU)*(mC)(mA)(fC)(mA)(fA)(mG)(fA)(fG

[0848] 1395 GUCACAAGAG 1:

[0849] )(mA)(mA)(fG)(mU)(fC)(mG)(mU)(fU)(mU)*T

[0850] Sense | ATS1395 AAGUCGuUGT | 113 *T- [GAZ]

[0851]

[0852] The siRNAs were synthesized with Mermade 48 in-house, purified, and annealed to form duplexes as described hereinabove.

[0853] fa l-'ifro TraMslw w H) Humm CR 1.5 26mCells

[0854] Human CRL5826 ™ Cells (ATCC, Manassas, VA, USA) were grown to approximately 60-80% confluency before 1 nM of siRNA was transfected into cells using Lipofectamine1MRNAiMAX (InVitrogen. Waltham, MA, USA) according to the manufacturer’s recommended protocol, and the cells were further cultured for 24 hours or 48 hours. Total RNA was prepared from the cells using AcroPrepTMAdvance 96-well Filter Plates (Pall Corporation, Port Washington, New York, USA) using Qiagen’s RLT, RW1, and RPE buffers (Qiagen, Hilden, Germany). RNA extraction procedures were done according to the manufacturer’s recommended protocols. siRNA activity was determined by measuring the levels of target mRNA through qRT- PCR using the CFB primer-probe sets listed in Table 3. The primer-probe sets were designed by Amatar and synthesized by Integrated DNA Technologies (Coralville. LA, USA). qRT-PCR was performed using AgPath-ID™ One-Step RT-PCR Reagents in QS3 real-time PCR system (ThermoFisher Scientific, Waltham, MA, USA). The target RNA levels detected in the qRT-PCR assay were normalized to total RNA levels measured using RiboGreenTM (ThermoFisher Scientific, Waltham, MA, USA) in aliquots of the RNA samples used in the qRT-PCR. The relative CFB mRNA levels are shown in Figures 10 and 11.

[0855] Based on the screening results in Figures 10-11, active siRNAs were selected for a dose assessment compared to a previously disclosed potent siRNA, ATsilO'18, in human CRL5826TMcells. The siRNAs, with doses of 0 nM, 0.032 nM, 0.016 nM, 0.8 nM, 4 nM, and 20 nM, were transfected into CRL5826TMas described above for 24 hours. The relative CFB mRNA levels are shown in Figure 12. The IC50s were calculated and shown in Table 11. The activity fold changewas calculated relative to the IC50 of CFB levels in ATsilO18 transfected cells. Several siRNAs, ATsil317, ATsil323, ATsil348, ATsil349, ATsi.1351, ATsil354, and ATsil356, exhibit significantly better activities than siRNA ATsilO18.

[0856] Table 11. Inhibition of CFB mRNA in CRL5826TMCells after Transfection of siRNAs 24.hr

[0857] .... - - - - - —

[0858] siRNAs A&c (nM) J Fold

[0859] . 1.

[0860] 1317 2.52 14.44

[0861] 1318 0.25 1.44

[0862] | 1321 0.11 0.66

[0863] !

[0864] 1 1323 0.38 2.20

[0865] . “■.

[0866] | 1325 0.25 1.42

[0867] | 1327 0.23 1.33

[0868] : 1339 0.26 1.47

[0869] | 1348 0.63 3.61

[0870] | 1349 0.45 2.60

[0871] | 1351 2.64 15.13

[0872] | 1354 3.44 19.68

[0873] | 1356 1.06 6.09

[0874] | 1357 0.16 0.89

[0875] | 1363 0.14 0.77

[0876] _ _ _

[0877] j 1018 0.17 1.00

[0878]

[0879] CFB siRNA Inhibition in HP PI Cells by Free Uptake

[0880] siRNAs with GalNAc conjugation disclosed in Table 10 can be assessed for activity in human primary hepatocyte (HPH) cells after free uptake in the method as described in Example 6, supra.

[0881]

[0882] hi 'h'h.kirh / y

[0883] siRNAs with GalNAc conjugation disclosed in Table 10 can be assessed for activity in mice after treatment in the method as described in Example 7, supra.

[0884] Table 11. SEQUENCE MASTER LIST

[0885]

[0886] AGCCAAAAAGTGTCTAGTCAACTTAATTGAGAAGGTGGCAAGTTA GTGTGAAGCCAAGATATGGTCTAGTGACATATGCCACA1

[0887] ATa991

[0888] ATs99I,

[0889] ATS1016

[0890] ATa992

[0891]

[0892] ATs992,

[0893] mU * f G *mAmU f CmAf AmGf C f UmCmAf GmG f AmAmU f AmA *T*T 5 ATslO17

[0894] ( 5p) mU *G*mAf GmUf CT*mUf CmAmGf GmGf UmGf CmUmCC*mA* ATa993

[0895] mG 6 ATs993 mG * f G * mAmG f CmA f CmC f C f U mGin A f Ain G f AmCm U f Cm A * T * T 7

[0896] ( 5p; mA* A*mU f GmAf AA *mC f GmAmC f UmUf CmU f CmUmUG *mU * ATa994 8 mG

[0897] ATs994,

[0898] mC * f A * mAmG f AmG f AmA f G f UmCmG f UmU f UmCmA f Um U * T * T 9 ATs1018

[0899] ; ( 5p ) mU *T*mAfUmAfGG*nAf ArrAmC.fCmC.fAmA.fAmUmCC*mU* AT&995

[0900] mC 10 ATs995,

[0901] mG * f G *mAmU £ UmU f GmG £ Gf UmUmU £ CmC £ UmAmU f AmA* T * T 11 ATslO19

[0902] H 5p ) mU*G*mAf GmUf GT*mUf CmCmUfUmGf UmCfAmUmCC*mA* ATa996 i2 mC

[0903] ATs996 mG * f G * mAm U f Gm A f CmA f A f GmGmA f AraC f AmCmU f CmA * T * T 13

[0904] ( 5 p ) mU * A * mA f UmC f GG *mU f AmCrnC £ CmU £ UrnC f Cm UmG T * m G * ATa997 14 ATs997 * f C *ra AmG f GmA f AmG f G f GrnUmA f CmU f Gm Amu f UmA * T * T 15 i ( 5p) mU *A*mGf AmUfCT*mGf CmAmGfGmUf AmCfGmUmGT*mC * ATa998

[0905] : m U 16 AI's998,

[0906] mA* f C*iriAmC f GmU f AmC f C f UmGmC f AmG f AmUmCf UmA* T * T 17 ATsl020

[0907] = 5p) mU*A*mAfUmG£AT*mUf GmAmGf AmUf CmUf UmGmGC*mC* ATa999 18 mU

[0908] ATs999 i mG * f C *mCmAf AmG f AmU f C f UmCmA f AmU f CmAmU f UmA * T * T 19

[0909] : ( 5p ) mU *G*mAf UmAf GT*rnCf UmGmGfCmCf AmUf AmUmUT*mC* ATalOOO 20 mA

[0910] ATslOOO mA * f A * mAm U f Am U f Gm G f C f Cm Am G f AmC f Um AmU f C in A * T * T 21

[0911] ( 5 p ) mU * A * mA f UrnC f C A * mU £ CmAmG f U mC f Am U f GmAmGG * ntA * ATalOOl 22 mU

[0912] ATslOOl mC * f C*mUmCf AmU £ GmAf CfUm. GmAf UmG f GmAmU f UmA* T * T 23

[0913]

[0914] ( 5p) mU*A*mAf AmGfCT*mClGinAmGf UmUfGmUf UmCmCC*mU* ATal002 24 mC

[0915] ATs 1002 mG * f G * mGmA f AmC f AmA f C f UmCmG f AmG f CmUm U f UmA * T T 25

[0916] ( 5p) mU*C*mAf GmA f GA * mC f UmGmG f CmU f Um U f CmAmU C * mG * ATalOO3 26 mA

[0917] ATs 1003,

[0918] mG * f A*mUniGf Am A f AmG f C f CmAmG f UmC f UmCmU f GmA * T * T; 27 ATs 1021

[0919] { 5p } mA* A*mCfUmAfGA*mCf CmAmU f AmUf CmUf UmGmGC *mU * ATa1004 28 mU

[0920] ATs! 004,

[0921] mG * f C *mCmAf AmGf AmUf Af UmGmG f UmCf UmAmGf UraU*T *T 29 ATs 1022

[0922] mA* f U*mGmGmAf GmUf Of UmCmUmCmCf UmUf CmAmGmOnCmA*m ATalOO5 30

[0923] G*mG

[0924] ATs 1005,

[0925] mU * mG * mGmCmUmG f AmA f G f G f Am GmAmAmAm CmUmCmCmAm 0 31 ATs 1023

[0926] ( 5p ) mU*T*mAf AmAf AT*mUf CmAmGf GrnAf AmUf UmCmCT*mG* ATal317 32 mG

[0927] Z\Tsl317 mA* f G*mGmAf AmU f UmCf Of UmGmAf AmUf UmUmU f AmA * T * T 33

[0928] ( 5p ) mU * A*mUf CmUf CA*mUfCmAmC f UmC f AmCf AmUmUG *mU * ATal318 34 mG

[0929] ATsl318 m C * f A * m Am U f Gm U f GmA f G f U mGmA f Um G f Am GmA f Uni A * T * T 35

[0930] ( 5 p ) mU * T * mU f GmA f AA * mA f GmAmA f Am 0 f CmU f GrnGmU C * mA * ATal319 36 mC

[0931] ATsl319 mG * f A * mCmC f AmGf AmU f 0 f UmCmU f UmU f UmCmAf AmA* T * T 37

[0932] ( 5 p ) niU * A * mU f GmC f C A * mC f AmGmA f GmA f CmU f CmAmG A * mG ATal320 38 nA

[0933] ATs 1320 mU * f C * m UmG f AmG f UmC f U f CmUmG f UmG f GmCmA f UmA * T * T 39

[0934] :( 5p ) mU*A*mGf AmAf AA*mCf CmCmAf AmAf UmCf CmUmCA*mU * ATal321 40 mC

[0935] ATs 1321 m U * f G * mAmG f GmA f UmU f U f GmGmG f UmU f UmUmC f UmA * T * T 41

[0936] ( 5p ) mU * C * mU f GmA f U C *mC f AmUmC f Um A f GmC f AmCmC A * mG * ATal322 42 mG

[0937] ATs 1322 mu * f G * mGmU f GmC f UmA f G f AmUmG f GmA f UrnCniA f GmA * T * T 43

[0938]

[0939] ■ 5p) mA *G*mA fAmAf AC* mCf CmAraAfAmU fUmC fUmCmAT*mC* ATal323 44 mU

[0940] ATsl 323 mA* 1 U *mGmAf GmAf AmU f U f UmGmGf GmUf UmUmU f CmU *T*T 45 ( 5 p } mA * A*mAf GmC f AT *mU f GmAmUf GmUf UmC f AmCmUT *mG * ATal324 46 mG

[0941] ATsl 324; mA * f A*mGmU f GmAf AmC fAfUmCmAfAmUfGmCmUf UmU * T * T 47 ( 5p ) mA*A*mAfUmUf AA*mGfUmUmGf AmCfUmAf GniAmCA*mC* ATal325 48 HiU

[0942] ATsl 325 mU * f G *mUmC f UmA f GrnU f C f AmAmC f UmU f Am Am U f Um U * T * T 49 ( 5p) mA*T*mAf AmCfUT*mGfCmCirLAfCmCfUmUfCmUmCA*m2\*

[0943] A l ai 326 50 mU

[0944] A 'I si 326?m U * f G * mAmG f AmA f GmG f U f GmGmC f AmA f GmUmU f AmU * T * T 51 ( 5 p ) mA * A * mU f AmU f CT * m U f Gm GmC f UmU f Cm A f CmAm C C * mA *

[0945] Al a 1327 52 mU

[0946] ATsl 327 mG*f G*mUmGf UmGf AmAf Gf CmCmAf AmGf AmUmAf UmU 53 ( 5 p ) mA* A*mUf AmUf GT *mC f AmCmU f AmG f AmC f CmAmUA*mU * ATal328 54 miC

[0947] ATsl328? mU * f A *mUmGf GrnU f CmU f Af GmUmG f AmC f AmUmAf UmU * T *T 55 i i jp ) mA*T*mCf AmGf AC *mAf CmUmUf UmGf AmCf CmCmAA*mA* ATal329

[0948] mU56ATsl 329 ImU * f U *mGmGf GmU f CmAf Af AmGmU f GrnU f CmUmG f AmU * T * T 57 ( 5p) mA*G*mCf CmUfUC*mU.fUmGmGf UmGf UmUf AmGmUC *mC* ATal.330 58 mC

[0949] ATsl 330 mG * f A * mCxtiU f AmA f CmA f C f Cir AmA f Gm Af AmGmG f CmU * T * T 59 ( 5p; mA*A*mUf CmAfUG*mCf UmGmUfAmCf AmCf UmGmCC*mU* ATal331 60 mG

[0950] ATsl 331 mG * f G * mCmA f GmU f GmU f A f CmAmG f CmA f UmGirA f UmU * T * T 61 ( 5p) mA*A*mGf GmAf GG*mGfAmCmGfUmCf AmU fCmUmGG*mC* ATal332 62 mC

[0951] ATsl 332 mC * f C * mAmG f AmU f GmA f C f GmUmC f CmC f UmCmC f UmU * T * T 63 ( 5p ) mA*A*mUfGmUfUG*mUfGmCmAf AmUfCmCf Amr; UmCA*mG* ATa1333 64 mU

[0952]

[0953] ATs i 333 mU * f y * mAmU f GmG f AinU f U f GmCmA f CmA £ ZunCmA f UmU * T * T 65 ( 5p) mA*T*mUf GmCf CA*mAfUmGmU f AmUf AmGf CmAmAG*m. U* ATal 334 66 mC

[0954] Al si 334 mC * f U * mUmG f CmU f AmU f Af CmAmU f UmG f GmCmA f AmU * T * T 67

[0955] ( 5p) mA*A*mGf AmUf AA*mUf CmCmUf CmCf Cm. Uf UmGmGG*mU* ATal335 68 mU

[0956] ATs 1335 mC * f C*mCmAf AmGf GmGf Af GmGmAf UmUf AmUmC f UmU * T * T 69

[0957] ( 5p) mA*A*mAfCmAfCA*mUfAmGmAfCmAfUmCfCmAmGA*mU* ATal 336 70

[0958] :lilA

[0959] ATS1336 ImU AC * mUmG £ GmA f UmG £ U f CmUmA £ UmG £ UmGmU f UmU * T * T 71 t 5p • mA* ArmAf AinGfCA*mUf UmGmAf UmGf UmUf CmAmCT*mU*:ATal337 72

[0960] : iaG

[0961] ATsI 337 i mA * f G *mUmG f AmA f CmA f U f CmAmA f UmG f CmUm U f Um U * T * T 73

[0962] 1 ( 5p ) mA*G*mAf CmUf UT*mGf AmAmCf AmCf AmUf GmUmUG*mC* ATal 338 74 mU

[0963] ATs 1338 m. C * f A*mAmC f AmU f GmU f G f UmUmC f AmAf AmGmU £ CmU *T* T 75

[0964] ( 5p ) mA*A*mUf UmUf GG*mUf AmGmAf AmAf AmCf AmUmCT*mU * ATal 339 76

[0965] < mC

[0966] ATs 1339,

[0967] mA * f G * mAmU f GmU f UmU f U f Cm UmA f CmC f AmAmA f Um U * T * T 77 ATs 1394

[0968] ( 5 p ) mA* A *mG f AmG f AC *mU f GmGmC f UmU f UmC.f AmUmCG *mA * ATal 340 78 mU

[0969] ATs 1340 mC * f G *mAmU f GmAf AmAf G f CmCmAf GmU f CmUmC f UmU * T * T 79

[0970] ( 5 p ) mA * A * mU f GmC f C A * mC f AmGmA f GmA f CmU f CmAmG A * mG * ATal 341 80 mA

[0971] ATs 1341 mU*fC*mUmGf AmGfUmCfUfCmUmGfUmGfGmCmAfUmU*T *T 81

[0972] ( 5p) mA*G*mUf AmCfCC*mUfUm. CmCf UmGfUmGf UmUmCC*mC ATal 342 82

[0973] *mA

[0974] ATs 1342 mG * f G * mAmA f CmA f CmA f G f GmAmA f GmG f GmUmA f CmU * T * T 83

[0975] ( 5 p ) mA * A *mU f GmG f UT * mG f CmUmU f GmU f GmG f UmAmAT * mC ATal 343 84

[0976] ATs 1343 mA*fU*mUmAfCmCfAmCf AfAmGmCf AmAf CmCmAf UmU *T*T 85

[0977]

[0978] i: ( bp) mA*C*mCf AmUf AC*mAf GmCmUf CmUf CmGfUmGmUC*mC ATal 344 86

[0979] *mC

[0980] ATsl344 mG* f A*mCmAf CmGf AmGf Af GmCmUf GmUf AmUmGf GmU*T *T 87

[0981] ( 5p ) mA*A*mCf AmAf AG *mUf AmCmUf CmAf GmAf CmAmCC *mA ATal 345 88

[0982] *IP, C

[0983] ATsl345 mG * f G *mUmG f U mC f UmG f A f Gm UmA f Cm U f UmUm G f Um I) * T * T 89

[0984] ( 5p) mA*A*mGf UmGf AA*mAf CmAmAf UmGf UmGfCmUmGC*mU ATal 346 90

[0985] *mG

[0986] ATs1346 mG * f C * mAmG f CmA f CmA f U f UmGmU f UmU f CmArnC f UmU * T * T 91

[0987] ( 5p) mA* A*mCf CmUf UG*mAf UmUmGf AmGf UmGf UmUmCC*mU ATal 347 92

[0988] *inU

[0989] ATsl347 j mG* f G*mAmAf CmAf CmUf Cf AmAmU f CmAf AmGmGf UmU*T *T 93

[0990] ( 5p ) mA*G*mUf GmAf AA*mUf AmGmGf AmCfUmAfCmUmUC*mU ATal 348 94

[0991] > *mA

[0992] ATS1348 f mG * f A* mAmG f U mA f GmU f C f Cm Um A f UmU f UmCmA f Cm U * T * T 95

[0993] ( 5p } mA*T *mAf GmUf CA*mUf AmAmAf AmUf UmCf AmGmGA*mA Alai 349 96

[0994] AG ATsl349 ' m U * f C * mCmU f GmA f AmU f U f UmUmA f UmG f AmCmU f AmU * T * T 97

[0995] : ( 5 p ) mA * T * mU f GmA f U C * mA f GmGmG f Cm A f AmC f Gm UmCA * mU ATal 350 98

[0996] *rA

[0997] ATS1350: mU * fG*mAmCf GmUf UmGf CfCmCmUf GmAf UmCmAf AmU*T*T 99

[0998] ( 5p) mA*A*mGf AmCf AA*mAf UmGmGf GmCf CmUfGmAmUA*mG ATal 351 100

[0999] *mU

[1000] ATsl351 mU * f A * mUmC f AmG f GmC f C f CmAmU f UmU f GmUmC f UmU * T * T 101 j ( 5p ) mA*C*mAf AmAfGC*mUfCmGmAf GmUf UmGf UrnUmCC*mC ATal 352 102

[1001] *mU

[1002] ATsl352 mG * f G * mAmA f CmA f AmC f U f CmGmA f GmC f UmUmU f GmU * T * T 103 r ( 5pj mA*A*mAf CmAf GA*mGfCmUmUf UmGf AmUfAmUmCC*mU ATal 353 104

[1003] < *mG

[1004] ATsl353 mG * f G *mAmU f AmU f CmAf Af AmGmC f UmC f UmGmU f UmU *T *T 105

[1005] ! ( 5p) mA*G*mAfGmA.fUG*mUfCmCmUfUmGfAn-iCfUmUmUG*mU ATal 354 106

[1006] *mC

[1007]

[1008] ATsl.354 mC * f A * mAmA f GmU f CmA £ A f GmGrrA f CmA f UmCm U f Cm U * T * T 107 ( 5p) mA*C*mUf CmCf AG*mUf AmCmAf AmAf GmGf AmAmCC*mG ATal355 108

[1009] ATS1355. niG * f G*mUmU f CmCf UmU f U £ GrnUmAf CmUf GmGmA f GmU * T * T 109 ( 5 p ) mA * G * mU f CmA f G C * mA f Um iAmG f GmG f AmC f U mCmAC * mU ATal356 110 AiC

[1010] ATS1356 mG * f U *mGmA f Gm U f CmC f C f UmAmU f GmC f UmGmAf CmU * T * T 111 ( 5p) mA*A*mAf CmGf AC*mUf UmCmUf CmUf UmGf UmGmAA*mC ATal357 112 *mU

[1011] ATsl357,

[1012] mU * f U * mCmA f CmA f Am G f A f GmAmA f GmU f CmGmU f UmU * T * T 113 ATsl395

[1013] ( 5p) mA*G*mAf UmUf AC*mAf CmCmAf AmCf UmUfGmAmAT*mG ATal358 114 *mA

[1014] ATS1358 mA *fU*mUmCf AnA f GmU f U f GmG mU f GmU f AmAmU £ CmU * T * T 115 ( 5p ) mA*T*mUfUmGf CA*mGfAmCmAfUmCfCrrAfCmUmAC*mV

[1015] A'l a 1359 116

[1016] ATS1359 f mG* f U*mAmGf UmGf GmAf □£ GmUmCf UmGf CmAmAfAmU*T* T 117 ( 5p) mA*T*mGfCmUf UT*mUfGmCmCfGmCfUmUfCmUmGG*mU ATal360 118

[1017] ■AnU

[1018] ATs1360 mC*f C*mAmGf AmAfGmCfGf GmCmAf AmAfAmGmCf AmU*T*T 119 ( 5p) mA*C*xnAf GmGf GC*mAf GmCmAf CmUf UmGf AmAmAG*mA ATal361 120 ‘mG

[1019] ATS1361 mC * f U *mUmU f CmAf AmG f U f GmCmU f GmC f CmCmU f GmU *T * T 121 ( 5 p ) mA * T * mA f Um A f G A * mA f Am Am C f Cm C f Am A f Am UmC C * mU ATA1362 122 *mC

[1020] ATsl362 mG * f G * mAmlJ f GmU f GmG f G f UmUmU f UmCf UmAmU f AmU *T * T 123 ( 5p ) mA*T*mGf UmUf UT*mAfAmUmUf CmAfAmUfCmCmCA*mC ATal363 124 *mG

[1021] ATsl363 mU * f G *mGinG f AmU f UmG f Af AmUmU f AmAf AmAmC f AmU * T ‘ T 125 ( 5p ) mA*A*mUf GmAfAmAmCf GmAmCf UmUf CmUfCmUmUf G*m ATal 374 126;

[1022] U*mG

[1023]

[1024] 5p) mU *A*mAf GinUf AC*mUf CmAinGf AmCf AinC.fUiuAntCA*mG ATal376 127

[1025] TnC

[1026] ATsl376 mU * f G *mUmG f GmU f Gmt1f C f UmGmAf GmU f AmCmUf UraA*T* T 128

[1027] ( 5 p ) mU * A*iriAf GmU f AniCinU f CmAmGf AmCf AiaC f UmAmC f A'" in AT&1377 129

[1028] ' mC

[1029] hsCFB-F TCCCTCCTGAAGGCTGGAA 130 hsCFB~R TGTATAGCAAGTCCCGGATCTCA 131 hsCFB-P CTGATGGATTGCACAACATGGGCG 132 msCFB-F AGTCTCTGTGGCATGGTGTG 133 msCFB-R AG2\GGGCGAGTGACTGAGAT 134 msCFB-P TCATAAGCAACCATGGCAAGCCAAG 135 mkCFB-F CCTTCATCTTGGGCCTCTTATC 136 mkCFB~R. GGAGCCACCTTTGATCTCTAC 137 mkCFB-P TGACCACCACTCCATTGTCTTCGG 138 Ala991 ATUGAUTuCAUUGAGCUGCUU 139 ATs991,

[1030] GCAGCUGAAUGAAAUCAAUTT 140 ATs 1016

[1031] AFa992 UTAUUCCUGAGCiJUGAUCAGG 141 ATs992,

[1032] U G AU C A AG C U C AGG AAU AAT T 142 ATS1017

[1033] ATa993 UGAGUCTUCAGGGUGCUCCAG 143 ATs993 GGAGCACCCUG / kAGACUCATT 144 ATa994,

[1034] AAUGAAACGACUUCUCUUGUG 145 ATal374

[1035] ATs994,

[1036] C AAG AG AAG 0 CG G U U C AU U T T 146 ATs 1018

[1037] ATa995 U TA U AGG AAAC C C AAA U C C U C 147 ATs995,

[1038] GGAUUUGGGUUUCCUAUAATT 148 ATS1019

[1039] ATa996 UGAGUGTUCCUUGUCAUCCAC 149 ATs996 GGAUGACAAGGAACACUCATT 150

[1040]

[1041] ATa997 UAAUCGGUACCCUUCCUGTGU 151 ATs997 ACAGGAAGGGUACCGAUUATT; i52 ATa998 UAGAUCTGCAGGUACGUGTCU 153 ATs998, ACAGGUACCUGCAGAUCUATT 154 ATsl020

[1042] ATa999 U AAU GAT U G AG AU C U U GG U C U 155 ATs999 GC C AAG AU C U C AAU C AUU AT T 156 ATalOOO U G AU AG T C U GG C C AU AUU T C A 157 ATslOOO AAAUAUGGCCAGACUAUCATT 158 ATalOOl U AAU CC AU C AGU GAU G AGGAU 159 ATslOOl CCUCAUGACUGAUGGAUUATT 160 AT&1002 UAAAGCTCGAGUUGUUCCCUC 161 Al si 002 GGGAACAACUCGAGCUUUATT 162 Alai 003 UCAGAGACUGGCUUUCAUCGA 163 ATsl003, GAUGAAAGCCAGUCUCUGATT 164 ATslO21

[1043] Alai 004 AACUAGACCAUAUCUUGGCUU 165 ATslOO4,

[1044] G C C AAG AU A OGG U G U AG U U T T 166 ATsI022

[1045] ATal005 AUGGAGUUUCUCCUUCAGCCAGG 167 ATslOO5,

[1046] UGGCUGAAGGAGAAACUCCAU 168 ATslO23

[1047] . ATal317 UTAAAATUCAGGAAUUCCTGG 169 ATsl317 AGGAAUUCCUGAAUUUUAATT 170 ATal3l8 UAUCUCAUCACUCACAUUGUG 171 ATsl318 CAAUGl GAGt'GAUGAGAUATT 172 ATal319 U T U G A AAAG AA AU CUGGUC AC 173 ATS1319 GACCAGAUUUCUUUUCAAATT 174 ATal320 UAUGCCACAGAGACUCAGAGA 175

[1048]

[1049] ATs 1320 UCUGAGUCUCUGUGGCAUATT 176 ATaI321 UAGAAAACCCAAAUCCUCAUC 177 ATs 1321 UGAGGAUUUGGGUUUUCUATT 178 ATal 322 UCUGAUCCAUCUAGCACCAGG 179 ATs 1322 UGGUGCUAGAUGGAUCAGATT 180 ATal 323 AGAAAACCCAAAUUCUCATCU 181 ATs! 323 AUGAGAAUUUGGGUUUUCUTT 182 ATal 324 1 AAAG C A T U G A U G UU C ACU T G G 183 ATs 1324 AAGUGAACAUCAAUGCUUUTT 184 ATal 325 AAAUUAAGUUGACUAGACACU 185 ATs 1325 UGUCUAGUCAACUUAAUUUTT 186 ATal 326 ATAACUTGCCACCUUCUCAAU 187 ATs 1326 UGAGAAGGUGGCAAGUUAUTT 188 ATal 327 AAUAUCTUGGCUUCACACCAU 189:ATs 1327; GGUGUGAAGCCAAGAUAUUTT 190 ATal 328: AAUAUGTCACU AGACG AUAUC 191 ATs 1328 U AU G GU C U AG UG AC AU AU UTT 192 ATal 329 ATCAGACACUUUGACCCAAAU 193 ATs 1329 UUGGGUCAAAGUGUCUGAUTT 194 ATal 330 AGCCUUCUUGGUGUUAGUCCC 195 ATsl330 GACU AACACCAAGAAGGCUTT 196 ATal 331 AAUCAUGCUGUACACUGCCUG 197 ATs 1331 1 GGCAGUGUACAGCAUGAUUTT 198 ATal 332 AAGGAGGGACGUCAUCUGGCC 199 ATs 1332 CCAGAUGACGUCCCUCCUUTT 200 ATal 333 AAUGUUGUGCAAUCCAUCAGU 201 ATsl333 UGAUGGAU UGCACAACAUUTT 202

[1050]

[1051] r4 •

[1052] ATal 334 ATuGCCAAUGuAUAGCAAGUC 203 ATsl334 C U U GC U AU AC AU U G G C AAU T T 204 ATal 335 AAGAUAAUCCUCCCUUGGGUU 205

[1053] —. ATs 1335 CCCAAGGGAGGAUUAUCUUTT 206 ATal 336 AAACACAUAGACAUCCAGAUA 207 ATsl336 UCUGGAUGUCUAUGUGUUUTT 208 ATal 337 AAAAGCAUUGAUGUUCACTUG 209 ATs 1337 AG U G AAC AU C AA U GC U UU U T T 210 ATal 338 AGACUUTGAACACAUGUUGCU 211 ATsl338 CAACAUGUGUUCAAAGUCUTT 212 ATal 339 t AAU U U G GU AGAAAACA U CT UC 213 ATs 1339, AG AU GUUUUp UAC C AAAQ U T T 214 ATs! 394

[1054] A 'Fa 1340 AAGAGACUGGCUUUCAUCGAU 215 ATs 1340 C GAU G A AAG C GAG U C U C U U T T 216 ATal 341 AAUGCCACAGAGACUCAGAGA 217 ATs 1341 1 UGUGAGUCUCUGUGGCAUUTT 218 ATal 342 AGUACCCUUCCUGUGUUCCCA 219 ATs 1342; GGAACACAGGAAGGGUACUTT 220 ATal 343: AAU G G U T G G U U G U GG U AAT C G 221 ATs 1343 1 AUUAUCACAAGCAACCAUUTT 222 ATal 344 1 ACCAUACAGCUCUCGUGUCCC 223 ATs 1344 GACACGAGAGCUGUAUGGUTT 224 ATal 345 AACAAAGUACUCAGACACCAC 225 ATsl.345 GGUGUCUGAGUACUUUGUUTT 226 ATal 346 AAGUGAAACAAUGUGCUGCUG 227 ATs 1346 GCAGCACAUUGUUUCAUUUTT 228 ATal 347 AAC U U U GAU U G AG U G U U C C U U

[1055]

[1056] ATs 1347 GGAACACUCAAUCAAGGUUTT 230 ATal 348 AGUGAAAUAGGACUACUUCUA 231 ATsl 348 GAAGU AGU C C U AU U U C AC UT T 232 ATal 349 ATAGUCAUAAZ^AUUCAGGAAU 233 ATsl 349 UCCuGAAUUUUAUGACUAUTT 234 ATal 350 ATUGAUCAGGGCAACGUCAUA 235 ATs 1350? UGACGUUGCCCUGAUCAAUTT 236 ATal 351 AAGACAAAUGGGCCUGAUAGU 237 ATs 1351 UAUCAGGCCCAUUUGUCUUTT 238 ATal 352 ACAAAGCUCGAGUCGUUCCCU 239 ATsl 352 GGAACAACUCGAGCUUUGUTT 240 ATal 353; AAACAGAGCUUUGA’J2\UCCUG:241ATs 1353 GG AU AU CAAAG C U C U G U U U T T 242 ATal 354 AGAGAUGUCCUUGACUUUGUC 1 243 ATs 1354 CAAAGUCAAGGACAUCUCUTT;244 _ _ _

[1057] ATal 355 ACUCCAGUACAAAGGAACCGA 245 ATsl 355 GGUUCCUUUGUACUGGAGUTT 246 ATal 356 AGUCAGCAUAGGGACUCACUC 247 ATs 1356 < GUGAGUCCCUAUGCUGACUTT 248 ATal 357 1 AAACGACUUCuCUOGUGAACU 249 ATs 1357,

[1058] j UUCACAAGAGAAGUCGUUUTT 250 ATs 1395

[1059] ATal 358 j AGAUUACACCAACUUGAATGA 251 ATsl 358 AUUCAAGUUGGUGU / ViUCUTT 252 ATal 359 1 ATUUGCAGACAUCCACUACUC 253 ATsl 359 f GUAGUGGAUGUCUGCAAAUTT: 254 ATal 360 1 ATGCUUTUGCCGCUUCUGGUU 255 ATs 1360: CCAGAAGCGGCAAAAGCAUIT 256

[1060]

[1061] ATal361 ACAGGGCAGCACUUGAAAGAG 257 ATs 1361 CUUUCAAGUGCUGCCCUGUTT 258 AT&1362 AT AC AGAAAAC C CAAAU C C U C 25$) ATs 1362 GGAUUUGGGUUUUCUAUAUTT 260 AT&1363 ATGUUUTAAUUCAAUCCCACG 261 ATs 1363 UGGGAUUGAAUUAAAACAUTT 262 ATal376,

[1062] UAAGUACUCAGACACUACAGC 263 ATal377

[1063] ATs 1376 U GO G GU G > CU GAGD AC U DAT T 264

[1064]

Claims

What is Claimed1. A double-stranded ribonucleic acid (dsRNA) compound for inhibiting expression of Complement Factor B (CFB) in a cell, wherein the dsRNA compound comprises a sense strand and an antisense strand forming the dsRNA compound, wherein the antisense strand comprises or is any of the antisense sequences in any one of Tables 2, 6 or 10.

2. A double-stranded ribonucleic acid (dsRNA) compound for inhibiting expression of Complement Factor B (CFB) in a cell, wherein the dsRNA compound comprises a sense strand and an antisense strand forming the dsRNA compound, wherein the sense strand comprises any of the sense sequences in any one of Tables 2, 6 or 10.

3. The double-stranded ribonucleic acid (dsRNA) compound of claim 1 or 2, wherein the dsRNzX compound comprises the sense strand of claim 2 and the antisense strand of claim I.

4. The double-stranded ribonucleic acid (dsRNA) compound of any preceding claim, wherein the dsRNA compound is an shRNA compound or an siRNA compound.

5. The double-stranded ribonucleic, acid (dsRNA) compound of any preceding claim, wherein the dsRNA comprises at least one modified nucleotide.

6. The double-stranded ribonucleic acid (dsRNA) compound of any preceding claim, wherein the strand comprises at least one phosphorothioate internucleotide (PS) linkage.

7. The double-stranded ribonucleic acid (dsRNA) compound of any of the preceding claims which is an siRNA comprising any one of siRNAs in any one of Tables 2, 6 or 10.

8. The double-stranded ribonucleic acid (dsRNA) compound of any preceding claim, further comprising a conjugate.

9. The double-stranded ribonucleic acid (dsRNA) compound of claim 8, wherein the conjugate is an N-Acetylgaiactosamine-comprising moiety (GalNAc).

10. The double-stranded ribonucleic acid (dsRNA) compound of any preceding claim, wherein the dsRNA compound inhibits expression of a CFB target nucleic acid by at least about 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99%.

11. A pharmaceutical composition for inhibiting expression of Complement Factor B (CFB) comprising the double-stranded ribonucleic acid (dsRNA) compound of any preceding claims, alone or in combination with a pharmaceutically acceptable carrier or excipient,12. A method of treating and / or preventing a Complement Factor B (CFB) - associated disease, disorder and / or condition in a subject, comprising administering to the subject a therapeutically effective amount of the dsRNA compound of any claim 1 to 10 or the pharmaceutical composition comprising the dsRNA compound of claim 11, thereby treating and / or preventing the CFB associated disease, disorder and / or condition in the subject.

13. The method of claim 12, wherein the CFB associated disease, disorder and / or condition is an inflammatory disease, disorder and / or condition.

14. The method of claim 12, wherein the inflammatory disease, disorder and / or condition is an autoimmune disease, disorder and / or condition.

15. The method of any one of claims 12-14, wherein the subject is an animal, preferably a human.

16. The method of any one of claims 1 -15, further comprising administering to the subject an additional therapeutic agent for treatment of a CFB-associated disease, disorder and / or condition.

17. A kit comprising the dsRNA compound of any one of claims 1-10, or the pharmaceutical composition of claim 11, and optionally, a label.

18. A process for preparing the sense and / or antisense strand of the double-stranded ribonucleic acid (dsRNA) compound of any one of claims 1-10, wherein the process comprises the steps of:a. preparing the sense and / or antisense strand by sequential coupling of modified and / or unmodified nucleotides via the phosphoramidite oligonucleotide synthesis on a solid support;b. optionally, coupling an N -Acetylgalactosamine-comprising moiety (GalNAc) to the sense and / or antisense strand on the solid support via the phosphoramidite oligonucleotide synthesis;c. detaching the sense and / or antisense strand from the solid support and removing the solid support; andd. optionally, further purifying the sense and / or antisense strand, optionally using chromato graphy.

19. A process for preparing the sense and / or antisense strand of the double-stranded ribonucleic acid (dsRN ) compound of any one of claims 1-10, wherein the process comprises the steps of:a. coupling an N-Acetylgalactosamine-comprising moiety (GalNAc) to a solid support via the phosphoramidite oligonucleotide synthesis,b. coupling a modified and / or unmodified nucleotide via the phosphoramidite oligonucleotide synthesis to the GalNAc on the solid support:c. sequentially coupling additional modified and / or unmodified nucleotides via the phosphoramidite oligonucleotide synthesis to prepare the sense and / or antisense strand; d. detaching the sense and / or antisense strand from the solid support and removing the solid support; ande. optionally, further purifying the sense and / or antisense strand, optionally using chromato graph y,20. A process of preparing the double-stranded ribonucleic acid (dsRNA) compound of any one of claims 1-10, comprising:a) contacting the sense strand prepared according to claim 18 or 19 with the antisense strand prepared according to claim 18 or 19 in equimolar concentrations in a solution;b) optionally heating the solution to a temperature of about 94°C; andc) optionally reducing the temperature of the solution to about 25°C.

Images