Method for purifying circular RNA

Abstract

The present invention provides a simple and efficient method for separating circularized RNA from linear form of the RNA in a mixture comprising both by performing phosphate buffer elution on the mixture in a hydroxyapatite chromatography. In an embodiment, the mixture is the result of circularization of RNA from linear form of the RNA acting as the precursor.

Description

[0001] Method for Purifying Circular RNA

[0002] INCORPORATION BY REFERENCE OF A SEQUENCE LISTING XML

[0003] A Sequence Listing is provided herewith as a Sequence Listing XML, “MethodforPurifyingCircularRNA” created on December 31 , 2025 and having a size of 9 KB. The contents of the Sequence Listing XML are incorporated by reference herein in their entirety.

[0004] FIELD OF THE INVENTION

[0005] The present invention is related to the purification of a circular form of a target RNA molecule.

[0006] BACKGROUND OF THE INVENTION

[0007] Circular RNA has attracted increased attention as a novel type of therapeutic RNA compared to traditional linear RNA due to its increased stability both in vitro and in vivo. Circular RNA is often made from a linear RNA precursor using complicated and expensive process involving RNase treatment, high performance liquid chromatography (HPLC) and / or a heating process presenting challenges in the efficiency of circularization from its linear RNA precursor as well as purification of the circular RNA from unwanted products.

[0008] It has been reported in a research article entitled “Hydroxyapatite-mediated separation of double-stranded DNA, single-stranded DNA, and RNA genomes from natural viral assemblages” (Andrews-Pfannkoch et al. Appl Environ Microbiol. 2010 Aug;76(15):5036-45. DOI: 10.1128 / AEM.00204- 10) that hydroxyapatite chromatography may be used to fractionate nucleic acids of varying lengths, sequences and or conformations. The article theorizes that the principle underlying the fractionation of polynucleotides using hydroxyapatite chromatography lies in charge interaction between the positively charged calcium ions on the surface of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acids. Specifically, fractionation or separation of polynucleotides occurs due to differences in polynucleotide characteristics that can affect the number of negatively charged phosphate of the polynucleotide available to interact with the positively charged calcium ions. Andrews-Pfannkoch discloses relevant characteristics being length, sequence and / or conformation of the polynucleotides. However, based on this principle, a skilled person in the art would not have expected that hydroxyapatite chromatography could be used in separating linear polynucleotides and circular polynucleotides having identical or similar sequences since onewould not expect a simple change to circular conformation from linear would adequately affect the number of negatively charged phosphate available for interaction with the positively charged calcium ions to result in separation of the linear and circular polynucleotides. However, our data unexpectedly shows otherwise suggesting that there is much more going on than disclosed in the Andrews-Pfannkoch article as something unexpected other than length, sequence and conformation is at work when purifying circular polynucleotides from linear polynucleotides of the same sequence using hydroxyapatite chromatography. Therefore, there is a need for a simplified and cost-effective method for purifying circular RNA from linear RNA of the same or similar sequence using hydroxyapatite chromatography.

[0009] SUMMARY OF THE INVENTION

[0010] A method of purifying circular target RNA from a mixture comprising the step of performing phosphate buffer elution on the mixture in a hydroxyapatite chromatography, wherein the mixture comprises circular target RNA and linear target RNA, wherein the nucleotide sequence of each of the circular target RNA and the linear target RNA is at least about 80% identical to nucleotide sequence of a target RNA, wherein the circular target RNA is the circular form of the target RNA, wherein the linear target RNA is the linear form of the target RNA and wherein the nucleotide sequence of the circular target RNA is at least about 80% identical to the nucleotide sequence of the linear circular RNA.

[0011] DESCRIPTION OF THE DRAWINGS

[0012] FIG. 1 illustrates a method of preparing circularized RNA from linear precursor.

[0013] FIG. 2 (A)-(G) illustrates purification result of various circular RNAs from linear RNA precursor, the 5’ intron, and the 3’ intron impurities. The purification is performed using phosphate buffer elution purification method of the present invention wherein the circular RNA comprises (A) SMARCA5 sequence, (B) POLR2A sequence, (C) mTR_l-397 sequence, (D) hTR 1-451 sequence, (E) GFP coding sequence, (F) Luciferase coding sequence and (G) hTERT sequence.|0014| FIG. 3 (a) illustrates purification of circular RNA comprising SMARCA5 sequence from the linear RNA precursor, the 5’ intron, and the 3’ intron impurities using the phosphate buffer elution purification method of the present invention. FIG. 3 (b) quantifies the purification result.

[0015] FIG. 4 (a) illustrates purification of circular RNAs comprising hTR sequence from linear RNA precursor, the 5’ intron, and the 3’ intron impurities using the phosphate buffer elution purification method of the present invention. FIG. 4 (b) quantifies the purification result.

[0016] FIG. 5 (a) illustrates purification of linear and circular RNAs comprising GFP coding sequence from linear RNA precursor, the 5’ intron, and the 3’ intron impurities using the phosphate buffer elution purification method of the present invention. FIG. 5 (b) quantifies the purification result.

[0017] FIG. 6 illustrates the expression of linear and circular RNAs comprising GFP coding sequence purified using the method comprising the phosphate buffer elution of the present invention in the HEK293T cells including bright field (BF) imaging.

[0018] FIG. 7 (a) illustrates purification result of circular RNAs comprising hTERT coding sequence from linear RNA precursor, the 5’ intron, and the 3’ intron impurities using the phosphate buffer elution purification method of the present invention. FIG. 7 (b) quantifies the purification result.

[0019] FIG. 8 (a) illustrates purification result of circular RNA comprising luciferase coding sequence from linear RNA precursor, the 5’ intron, and the 3’ intron impurities using the phosphate buffer elution purification method of the present invention. FIG. 8 (b) quantifies the purification result.

[0020] FIG. 9 (a) quantifies the expression of luciferase coding circular RNA in mice wherein the luciferase coding circular RNA is delivered by LNP encapsulating the luciferase coding circular RNA produced and purified using the method comprising the phosphate buffer elution of the present invention. FIG. 9 (b) visually illustrates the expression of luciferase coding circular RNA in mice and various mice organs wherein the luciferase coding circular RNA is delivered by LNP encapsulating the luciferase coding circular RNA produced and purified using the method comprising the phosphate buffer elution of the present invention.

[0021] FIG. 10 (a) illustrates purification of circular RNA comprising POLAR2A sequence from the linear RNA precursor, the 5’ intron, and the 3' intron impurities using the phosphate buffer elution purification method of the present invention. FIG. 10 (b) quantifies the purification result.

[0022] FIG. 11 (a) illustrates the separation of circular GFP and nicked GFP (fractions A2-A4) from the linear RNA product comprising the 3’ intron and the 5’ intron (fraction A5) using the method comprising hydroxyapatite chromatography coupled with phosphate buffer elution of the present invention. FIG. 11 (b) illustrates the RNA products collected in fractions A2-A5 using gel electrophoresis-based methods.

[0023] FIG. 12 illustrates the separation of GTP from other NTPs including ATP, CTP, and UTP using the method comprising hydroxyapatite chromatography coupled with phosphate buffer elution of the present invention.

[0024] DESCRIPTION OF THE INVENTION

[0025] As used in this specification and in claims which follow, the singular forms “a”, “an” and “the” include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to “an ingredient” includes mixtures of ingredients, reference to “an active pharmaceutical agent” includes more than one active pharmaceutical agent, and the like.

[0026] As used herein, the term “about” as a modifier to a quantity is intended to mean ± 20%, ± 15%, ± 10% or ± 5% inclusive of the quantity being modified.

[0027] A “polynucleotide,” “nucleic acid,” or “nucleotide sequence” is a sequence of nucleotide bases, and may be RNA, DNA or DNA-RNA hybrid sequences (including both naturally occurring and non-naturally occurring nucleotide) but is preferably either single or double stranded DNA sequences. The term should also be understood to include, as equivalents, analogs of either RNA or DNA made from nucleotide analogs, and, as applicable to the embodiment being described, single (sense or antisense) and double-stranded polynucleotides. The terms “polynucleotide sequence” and “nucleotide sequence” are also used interchangeably herein.

[0028] A “coding sequence” or a sequence which “encodes” a particular protein, is a nucleic acid sequence which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a start codon at the 5’ (amino) terminus and a translation stop codon at the 3’ (carboxy) terminus. A coding sequence can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and even synthetic DNA sequences. A transcription termination sequence will usually be located 3’ to the coding sequence.

[0029] A “linear RNA precursor” is an RNA sequence that comprises a 5’ end and a 3’ end that is not linked by a bond comprising a covalent bond. Either the 5’ end or the 3’ end of the RNA sequence can be modified to improve the use of said RNA sequence in the present invention.

[0030] As used herein, “sequence identity” and “% identity,” refers to the value determined by comparing two optimally aligned sequences over a comparison window, wherein a portion ofthe sequence in the comparison window may comprise additions or deletions as compared to the reference sequence for optimal alignment of the two sequences. The number of positions at which identical amino acid residues occur in both sequences is determined, yielding the number of matched positions, which is divided by the total number of positions in the window of comparison and the result multiplied by 100 to yield the percentage of sequence identity. The comparison window is the entire length of the sequence being referred to unless indicated otherwise.

[0031] The present invention provides a method of purifying circular form of a target RNA (circular target RNA) from a mixture comprising the circular target RNA and impurities comprising the step of applying hydroxyapatite chromatography coupled with phosphate buffer elution to the mixture. In an embodiment, the impurities of the mixture comprise linear form of the target RNA (linear target RNA). In an embodiment, the nucleotide sequence of the linear form of the target RNA is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% identical to the nucleotide sequence of the target RNA or the circular target RNA. In an embodiment, the length of the linear form of the target RNA is at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% as long as the target RNA or the circular target RNA. In an embodiment, the circular target RNA is circularized from the linear target RNA such that the linear target RNA in the impurities comprises linear target RNA precursor that failed to circularize during the RNA circularization process. In an embodiment, the impurities of the mixture further comprise fragments of the linear target RNA. In an embodiment, the mixture is a result of preparing the circular target RNA from the linear target RNA precursor. In an embodiment, the mixture with impurities is a result mixture of preparing the circular form of a target RNA from linear form of the target RNA by any RNA circularization method.

[0032] In connection with the method for purifying circular target RNA of the present invention, the present invention also provides a method of preparing the mixture comprising the circular target RNA and the impurities upon which the method for purifying circular target RNA of the present invention may be applied; the method of preparing the mixture comprises the steps of:a. preparing a DNA template comprising a nucleotide sequence reverse-complementary to the target RNA molecule;b. preparing a linear RNA precursor comprising the target RNA molecule from the DNA template of step a;c. purifying the RNA sample comprising the linear RNA precursor of step b; andd. preparing a circular form of the target RNA molecule from the linear RNA precursor of step c to result in a mixture of both circular and linear forms of the target RNA molecule.

[0033] In an embodiment, step d results in less than about 0.001% to about 40% by weight of impurities of the resulting composition such as less than about 0.001%, about 0.002%, about 0.004%, about 0.006%, about 0.008%, about 0.01%, about 0.012%, about 0.014%, about 0.016%, about 0.018%, about 0.02%, about 0.04%, about 0.06%, about 0.08%, about 0.1%, about 0.2%, about 0.4%, about 0.6%, about 0.8%, about 1%, about 2%, about 4%, about 6%, about 8%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, or about 40% including any percentages or percentage ranges falling within these values. In an embodiment, the impurities comprise impurities resulting from steps a-d. In an embodiment, the impurities comprise any RNA that is not the circular target RNA. In an embodiment, the impurities comprise linear RNA such as the linear RNA precursor and / or any linear RNA or linear RNA fragments produced during step c. In an embodiment, the impurity is measured using agarose gel electrophoresis wherein the circular form of the target RNA can be separated from unwanted RNAs such as the linear RNA precursor.100341 In an embodiment, the circular target RNA is functional in vitro, in vivo, or both. In an embodiment, the circular target RNA is capable of expressing a protein in a cell of a subject wherein the circular target RNA molecule encodes the nucleotide sequence or at least a part of the nucleotide sequence of said protein. In an embodiment, the expressed protein is functional. In an embodiment, the cell can be any cell derived from a subject. In an embodiment, the subject comprises a prokaryotic organism or a eukaryotic organism. In an embodiment, the subject comprises a mammal such as a mouse, a rat, or a human.

[0035] In an embodiment, the target RNA comprises an RNA comprising one or more nucleic acid sequence of interest. In an embodiment, the target RNA comprises at least a part of an RNA with regulatory functions such as a messenger RNA (mRNA) or a non-coding RNA (ncRNA). In an embodiment, the target RNA molecule comprises a nucleotide sequence at least about 10%, about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100% identical to a naturally occurring nucleotide sequence. In an embodiment, the target RNA molecule comprises at least a part of the coding sequence of a mRNA or an alternative splicing variant thereof. In an embodiment, the target RNA molecule comprises at least 1 exon of a mRNA or an alternative splicing variant thereof. In an embodiment, the target RNA molecule comprises all the exons of a mRNA or an alternative splicing variant thereof. In an embodiment, the target RNA molecule does not comprise the 5’-end capping structure, 5 ’-untranslated region (5’UTR), 3’-UTR, adenylate tail (poly A tail), ora combination thereof of a mRNA or an alternative splicing variant thereof. In an embodiment, the target RNA molecule comprises a nucleotide sequence that does not exist in nature. In an embodiment, the size of the target RNA molecule is about 100 nt to about 8000 nt such as about 100 nt, about 200 nt, about 300 nt, about 400 nt, about 500 nt, about 1000 nt, about 1500 nt, about 2000 nt, about 2500 nt, about 3000 nt, about 3500 nt, about 4000 nt, about 4500 nt, about 5000 nt, about 5500 nt, about 6000 nt, about 6500 nt, about 7000 nt, about 7500 nt, about 8000 nt including any size or size ranges falling within these values.

[0036] In an embodiment, the DNA template further comprises a nucleotide sequence reverse-complementary to a ribozyme sequence. In an embodiment, the ribozyme sequence is derived from prokaryotes, eukaryotes, or viruses. In an embodiment, the ribozyme sequence is derived from bacteriophages comprising bacteriophages of gram-positive bacteria or gram-negative bacteria. In an embodiment, the ribozyme sequence comprises the nucleotide sequence of group I catalytic intron, group I catalytic intron, hairpin ribozyme, or a combination thereof. In an embodiment, the ribozyme sequence comprises the nucleotide sequence of group I selfsplicing intron derived from T4 bacteriophages. In an embodiment, the ribozyme sequence comprises a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 1. In an embodiment, the ribozyme sequence comprises a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 2. In an embodiment, the nucleotide sequence reverse-complementary to the target RNA molecule of the DNA template is flanked by the nucleotide sequence reverse-complementary to a ribozyme sequence.

[0037] SEQ ID NO.l (T4 td upstream sequence):

[0038] GGG AATTCTAG AG A AAATTTCGTCTGG ATTAGTTACTTATCGTGTAAAATC TGATAAATGGAATTGGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGAGTA GGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATATAG TCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAACGAC CTTATCTGAACATAACGCTACCGTT

[0039] SEQ ID NO. 2 (T4 td downstream sequence):

[0040] CTCAGTAGATGTTTTCTTGGGTTAATTGAGGCCTGAGTATAAGGTGACTTA TACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAAT TGTAGGACTGCCCTTTAATAAATACTTCTATATTTAAAGAGGTATTTATGAAAAG CGGAATTTATCAGATTAAAAATACTTTCTCTAGAGTCGACCTGCAG

[0041] In an embodiment, the DNA template further comprises a promoter sequence that can be recognized and bound by an RNA polymerase. In an embodiment, the promoter sequencecomprises a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to the promoter sequence of T7 promoter, T3 promoter, SP6 promoter, or other promoter that can be recognized and bound by an RNA polymerase. In an embodiment, the promoter sequence comprises a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 3.

[0042] SEQ ID NO. 3 (T7 promoter): TAATACGACTCACTATAGGG

[0043] In an embodiment, the DNA template further comprises one or more nucleotide sequences reverse-complementary to one or more nucleotide sequence for circularization. In an embodiment, the one or more nucleotide sequences for circularization comprise a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 4, SEQ ID NO. 5, or a combination thereof.

[0044] SEQ ID NO. 4 (sequence for circularization-1):

[0045] GTTAACAAAAAAAAAAAAAAAAAAAAAAAATCACCGACCGATCTATCTG AACCGGT

[0046] SEQ ID NO. 5 (sequence for circularization-2):100471 ACGCG1TC AGA TAGATCGG TCGGTGAAAAAAAAAAAAAAAAA AAAAAAA AAGCGGCCGCCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTT TTGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

[0048] In an embodiment, the DNA template further comprises a nucleotide sequence reverse-complementary to a nucleotide sequence that allows the binding of ribosomes such as an internal ribosome entry site (IRES) or a Kozak sequence.

[0049] In an embodiment, the linear RNA precursor comprises a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to the nucleotide sequence of the target RNA molecule. In an embodiment, the linear RNA precursor further comprises a ribozyme sequence. In an embodiment, the ribozyme sequence is derived from prokaryotes, eukaryotes, or viruses. In an embodiment, the ribozyme sequence is derived from bacteriophages comprising bacteriophages of gram-positive bacteria or gram-negative bacteria. In an embodiment, the ribozyme sequence comprises the nucleotide sequence of group I catalytic intron, group I catalytic intron, hairpin ribozyme, or a combination thereof. In an embodiment, the ribozyme sequence comprises the nucleotide sequence of group I self-splicing intron derived from T4 bacteriophages. In an embodiment, the ribozyme sequence comprises a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 1. In an embodiment, the ribozyme sequence comprises a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical toSEQ ID NO. 2. In an embodiment, the target RNA molecule of the linear RNA precursor is flanked by the ribozyme sequences. In an embodiment, the linear RNA precursor further comprises a nucleotide sequence that allows the binding of ribosomes such as an IRES or a Kozak sequence as described by Chen et al. Engineering circular RNA for enhanced protein production. Nat Biotechnol 41, 262-272 (2023). https: / / doi.org / 10.1038 / s41587-022-01393-Q, and hereby incorporated by reference in its entirety.

[0050] In an embodiment, the linear RNA precursor further comprises one or more nucleotide sequence for circularization. In an embodiment, the one or more nucleotide sequences for circularization comprise a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 4, SEQ ID NO. 5, or a combination thereof.

[0051] In an embodiment, the linear RNA precursor comprises a target RNA molecule flanked by a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 6 and a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 7. In an embodiment, the nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 6 is upstream of the target RNA molecule. In an embodiment, the nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to SEQ ID NO. 7 is downstream of the target RNA molecule. In an embodiment, the linear RNA precursor is at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to a nucleotide sequence reverse complementary to the DNA template of the present invention.

[0052] SEQ ID NO. 6 (T4 upstream plus seq for circularization):

[0053] GTTAACAAAAAAAAAAAAAAAAAAAAAAAATCACCGACCGATCTATCTG AACCGGTGGGAATTCTAGAGAAAATTTCGTCTGGATTAGTTACTTATCGTGTAAA ATCTGATAAATGGAATTGGTTCTACATAAATGCCTAACGACTATCCCTTTGGGGA GTAGGGTCAAGTGACTCGAAACGATAGACAACTTGCTTTAACAAGTTGGAGATA TAGTCTGCTCTGCATGGTGACATGCAGCTGGATATAATTCCGGGGTAAGATTAAC GACCTTATCTGAACATAACGCTACCGTT

[0054] SEQ ID NO. 7 (T4 downstream plus seq for circularization):

[0055] CTCAGTAGATGTTTTCTTGGGTTAATTGAGGCCTGAGTATAAGGTGACTTA TACTTGTAATCTATCTAAACGGGGAACCTCTCTAGTAGACAATCCCGTGCTAAAT TGTAGGACTGCCCTTTAATAAATACTTCTATATTTAAAGAGGTATTTATGAAAAG CGGAATTTATCAGATTAAAAATACTTTCTCTAGAGTCGACCTGCAGACGCGTTCA GATAGATCGGTCGGTGAAAAAAAAAAAAAAAAAAAAAAAAAAGCGGCCGCCTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAA

[0056] In an embodiment, the linear RNA precursor comprises at least a secondary structure, a tertiary structure, or a combination thereof. In an embodiment, the linear RNA precursor does not comprise a secondary structure, a tertiary structure, or a combination thereof. In an embodiment, a secondary structure, a tertiary structure, or a combination thereof in the linear RNA precursor remains in the circular form of a target RNA molecule produced using said linear RNA precursor. In an embodiment, a secondary structure, a tertiary structure, or a combination thereof in the linear RNA precursor does not exist in the circular form of a target RNA molecule produced using said linear RNA precursor.

[0057] In an embodiment, step b preparation of the linear RNA precursor of the present invention is performed using artificial chemical synthesis, in vivo transcription, in vitro transcription, or other methods of RNA synthesis. In an embodiment, in vivo transcription of the linear RNA precursor may be performed using one or a combination of prokaryotic or eukaryotic host cell systems such as but not limited to bacteria, yeast, mammalian cells, plants, insect cells, transgenic animal cells, etc. In an embodiment, the host cell system comprises E. coli cells. In an embodiment, the method of producing the linear RNA precursor comprises in vitro transcription, wherein the in vitro transcription comprises the steps of mixing the DNA template with ribonucleoside triphosphate, an RNA polymerase, and a reaction buffer. In an embodiment, the ribonucleoside triphosphate comprises adenosine triphosphate or derivatives thereof, guanosine triphosphate or derivatives thereof, uridine triphosphate or derivatives thereof, cytidine triphosphate or derivatives thereof, or a combination thereof. In an embodiment, the RNA polymerase comprises T7 RNA polymerase, T3 RNA polymerase, SP6 RNA polymerase, or other RNA polymerases. In an embodiment, the RNA polymerase binds to the promoter sequence on the DNA template during the in vitro transcription. In an embodiment, the promoter sequence comprises a nucleotide sequence at least about 80%, about 85%, about 90%, about 95%, or about 100% identical to the promoter sequence of T7 promoter, T3 promoter, SP6 promoter, or other promoter that can be recognized and bound by an RNA polymerase.

[0058] In an embodiment, the reaction buffer of step b comprises Tris-HCl, Mg CIDCOO , spermidine, triton X-100, DTT or a combination thereof. In an embodiment, the reaction buffer comprises from about 20 mM to about 60 mM Tris-IICl such as about 20 mM, about 25 mM, about 30 mM, about 35 mM, about 40 mM, about 45 mM, about 50 mM, about 55 mM or about 60 mM including any concentration or concentration ranges falling within these values. In anembodiment, the reaction buffer comprises from about 4 mM to about 8 mM Mg(CH3COO)2 such as about 4 mM, about 4.5 mM, about 5 mM, about 5.5 mM, about 6 mM, about 6.5 mM, about 7 mM, about 7.5 mM, or about 8 mM including any concentration or concentration ranges falling within these values. In an embodiment, the reaction buffer of step b of the present invention comprises from about 0.1 mM to about 4 mM spermidine such as about 0.1 mM, about 0.2 mM, about 0.4 mM, about 0.6 mM, about 0.8 mM, about 1 mM, about 1.2 mM, about 1.4 mM, about 1.6 mM, about 1.8 mM, about 2 mM, about 2.5 mM, about 3 mM, about 3.5 mM, or about 4 mM including any concentration or concentration ranges falling within these values. In an embodiment, the reaction buffer of step b of the present invention comprises from about 0.0001% to about 0.004% by weight triton X-100 such as about 0.0001%, about 0.0002%, about 0.0004%, about 0.0006%, about 0.0008%, about 0.001%, about 0.0012%, about 0.0014%, about 0.0016%, about 0.0018%, about 0.002%, about 0.0022%, about 0.0024%, about 0.0026%, about 0.0028%, about 0.003%, about 0.0032%, about 0.0034%, about 0.0036%, about 0.0038%, or about 0.004% including any percentages or percentage ranges falling within these values. In an embodiment, the reaction buffer of step b comprises from about 1 to about 20 mM D1T such as about 1 mM, about 2 mM, about 4 mM, about 6 mM, about 8 mM, about 10 mM, about 12 mM, about 14 mM, about 16 mM, about 18 mM, about 20 mM including any concentrations or concentration ranges falling within these values. In an embodiment, the pH of the reaction buffer is from about 7 to about 10 such as about 7, about 7.5, about 8, about 8.5, about 9, about 9.5, or about 10 including any pH or pH ranges falling within these values. In an embodiment, the reaction buffer of step b of the present invention comprises about 40 mM Tris-HCl, about pH 8.0, about 6 mM Mg(CH3COO)2, about 2 mM spermidine, about 0.002% by weight triton X-100, and about 10 mM DTT.

[0059] In an embodiment, step c purification of the RNA sample of step b comprises lithium chloride precipitation. In an embodiment, the RNA sample is collected in the precipitate after treating the solution mixture obtained in step b with lithium chloride, wherein the lithium chloride working concentration is from about 1.0 M to about 5.0 M such as about 1.0 M, about 1.5 M, about 2.0 M, about 2.5 M, about 3.0 M, about 3.5 M, about 4.0 M, about 4.5 M, about 5.0 M, or any concentrations falling within these values. In an embodiment, the lithium chloride working concentration is about 2.5 M. In an embodiment, the RNA sample comprises the linear RNA precursor. In an embodiment, the RNA sample comprises the linear RNA precursor and circular RNA, wherein the circular RNA is spontaneously formed after the production of the linear RNA precursor. In an embodiment, the circular RNA comprises a circular form of the target RNA molecule of the present invention.

[0060] In an embodiment, step d preparation of circular RNA from the linear RNA precursor of step c is performed using chemical ligation method or biosynthesis ligation method. In an embodiment, the chemical ligation method comprises an addition of cyanogen bromide (BrCN), l-ethyl-3-(3-dimethylaminopropyl) carbodiimide (EDC), or catalysts that could be used for phosphodiester bond formation. In an embodiment, the biosynthesis ligation method comprises an addition of a ligase, a ribozyme, or any molecule derived from an organism that could be used to achieve the circularization of a linear RNA. In an embodiment, the ligase comprises T4 DNA ligase (T4 Dnl), T4 RNA ligase 1 (T4 Rnl 1), T4 RNA ligase 2 (T4 Rnl 2), or T7 DNA ligase. In an embodiment, the ribozyme comprises group I catalytic intron, group II catalytic intron, hairpin ribozyme, or a combination thereof.

[0061] In an embodiment, step d preparation of circular RNA from the linear RNA precursor of step c is performed using ligase method wherein an additional polynucleotide sequence is added as a template to produce the circular RNA from the linear RNA precursor. In an embodiment, the additional polynucleotide sequence comprises a first part comprising at least about 3, at least about 5, at least about 10, at least about 15, at least about 20 constitutive nucleotides reverse-complementary to a first part of the nucleotide sequence of the linear RNA precursor, wherein the first part of the nucleotide sequence of the linear RNA precursor locates at the 3’ end of the linear RNA precursor. In an embodiment, the additional polynucleotide sequence comprises a second part comprising at least about 3, at least about 5, at least about 10, at least about 15, at least about 20 constitutive nucleotides reverse-complementary to a second part of the nucleotide sequence of the linear RNA precursor, wherein the second part of the nucleotide sequence of the linear RNA precursor locates at the 5’ end of the linear RNA precursor.

[0062] In an embodiment, the step d preparation of circular RNA from the linear RNA precursor of step c further comprising the step of mixing the linear RNA precursor with GTP and Mg2+. In an embodiment, the GTP, Mg2+, or their combination required for the preparation of circular RNA is presented already in the reaction mixture or the host cell systems used to prepare the linear RNA precursor of step b. In an embodiment, the GTP, Mg2+, or their combination required for the production of circular RNA is added to the mixture after the preparation the linear RNA precursor of step b and / or purification of the linear RNA precursor of step c. In an embodiment, the production of circular RNA from the linear RNA precursor spontaneously occurs after the production of the linear RNA precursor.

[0063] In an embodiment, the method of purifying the circular target RNA from the mixture with impurities of the present invention is performed using hydroxyapatite chromatographywherein the impurities comprise linear form of the target RNA. In an embodiment, the mixture comprising impurities is the resultant mixture of step d of the method of preparing the mixture comprising the circular target RNA and the impurities of the present invention. In an embodiment, the stationary phase of hydroxyapatite chromatography comprises ceramic hydroxyapatite (CHT) such as a ceramic hydroxyapatite column. In an embodiment, the particle size of the CHT column is from about 10 pm to about 100 pm such as about 10 pm, about 20 pm, about 30 pm, about 40 pm, about 50 pm, about 60 pm, about 70 pm, about 80 pm, about 90 pm or about 100 pm including any sizes or size ranges falling within these values. In an embodiment, the particle size of the CHT column is about 40 pm.

[0064] In an embodiment, method of purifying the circular target RNA of the present invention comprises performing phosphate buffer elution on the mixture comprising the circular target RNA and impurities in the hydroxyapatite chromatography. In an embodiment, the mixture comprises the resultant mixture of step d. In an embodiment, purifying the circular target RNA from the resultant mixture of step d comprises performing phosphate buffer elution in the hydroxyapatite chromatography. In an embodiment, the mixture is mixed with a phosphate buffer prior to loading to a column of the hydroxyapatite chromatography. In an embodiment, the mixture is mixed with a phosphate buffer comprising a phosphate concentration from about 80 mM to about 140 mM such as about 80 mM, about 85 mM, about 90 mM, about 95 mM, about 100 mM, about 105 mM, about 110 mM, about 115 mM, about 120 mM, about 130 mM or about 140 mM, or any concentrations or concentration ranges falling within these values prior to loading to a column of the hydroxyapatite chromatography. In an embodiment, the phosphate buffer elution is performed at a flowrate about 2 mL / min to about 10 mL / min such as about 2 mL / min, about 3 mL / min, about 4 mL / min, about 5 mL / min, about 6 mL / min, about 7 mL / min, about 8 mL / min, about 9 mL / min, about 10 mL / min, or any numbers falling in between these values. In an embodiment, the phosphate buffer elution is performed at a flowrate of about 5.2 mL / min. In an embodiment, the phosphate buffer elution comprises elution using low concentration phosphate buffer, wherein the low concentration phosphate buffer comprises a phosphate concentration from about 100 mM to about 140 mM, such as about 100 mM, about 105 mM, about 110 mM, about 115 mM, about 120 mM, about 125 mM, about 130 mM, about 135 mM, about 140 mM, or any concentrations or concentration ranges falling within these values. In an embodiment, the phosphate buffer elution comprises the step of elution using high concentration phosphate buffer, wherein the high concentration phosphate buffer comprises a phosphate concentration from about 140 mM to about 180 mM, such as about 140 mM, about 145 mM, about 150 mM, about 155 mM, about 160 mM, about 165 mM,about 170 mM, about 175 mM, about 180 mM, or any concentrations or concentration ranges falling within these values. In an embodiment, the CHT column is eluted using an ultrahigh concentration phosphate buffer comprising a phosphate concentration from about 400 mM to about 600 mM such as about 400 mM, about 450 mM, about 500 mM, about 550 mM, about 600 mM, or any concentrations or concentration ranges falling within these values prior to the reuse of said column for additional rounds of circular RNA purification of the present invention.

[0065] In an embodiment, the phosphate concentration of the high concentration phosphate buffer is at least about 1%, about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, or about 60% higher than the phosphate concentration of the low concentration phosphate buffer. In an embodiment, the phosphate buffer elution comprises a first set of elutions using a low concentration phosphate buffer and a second set of elutions using a high concentration phosphate buffer. In an embodiment, the phosphate buffer elution comprises a first set of elutions using a low concentration phosphate buffer, a second set of elutions using a high concentration phosphate buffer and a third set of elutions using an ultrahigh concentration phosphate buffer.|0066| In an embodiment, the phosphate buffer elution comprises a continuous elution from a low concentration phosphate buffer to a high concentration phosphate buffer. In an embodiment, the pH of the high concentration phosphate buffer is from about 5.4 to about 7 such as about 5.4, about 5.6, about 5.8, about 6.0, about 6.2, about 6.4, about 6.6, about 6.8, about 7, or any pH or pH ranges falling within these values. In an embodiment, the pH of the high concentration phosphate buffer is about 6.8. In an embodiment, the pH of the low concentration phosphate buffer is from about 5.4 to about 7 such as about 5.4, about 5.6, about 5.8, about 6.0, about 6.2, about 6.4, about 6.6, about 6.8, about 7, or any pH or pH ranges falling within these values. In an embodiment, the pH of the low concentration phosphate buffer is about 6.8. In an embodiment, the phosphate buffer comprises potassium phosphate, sodium phosphate, or a combination thereof.

[0067] In an embodiment, up to about 50%, up to about 60%, up to about 70%, up to about 80%, up to about 90%, or up to about 100% of the circular RNA is collected in the flow-through after eluting using a low concentration phosphate buffer. In an embodiment, up to about 50%, up to about 60%, up to about 70%, up to about 80%, up to about 90%, or up to about 100% of the linear RNA precursor is bound to the CHT column after eluting using a low concentration phosphate buffer. In an embodiment, the linear RNA precursor bound to the CHT column after eluting using a low concentration phosphate buffer is collected in the flow-through followed by eluting using a high concentration phosphate buffer. In an embodiment, at least about 100pg, about 125 ng, about 150 j g, about 175 pg, about 200 pg, about 225 pg, about 250 pg, about 275 pg, about 300 pg, about 325 pg, about 350 pg, about 375 pg, about 400 pg, or any amount or amount ranges falling within these values of RNA sample from step d can be loaded the CHT column containing 5 mL resin for one round of the purification of the circular form of the target RNA from the linear RNA precursor. In an embodiment, the CHT column can be reused for additional rounds of circular RNA purification using the phosphate buffer elution. In an embodiment, the CHT column is further eluted using an ultrahigh concentration phosphate buffer comprising a phosphate concentration from about 400 mM to about 600 mM such as about 400 mM, about 450 mM, about 500 mM, about 550 mM, about 600 mM, or any concentrations or concentration ranges falling within these value prior to the reuse of said column for additional rounds of circular RNA purification of the present invention. In an embodiment, each set of elution at a particular phosphate buffer concentration can be repeated more than 2 rounds, 3 rounds, 4 rounds, 5 rounds, 6 rounds, 7 rounds, 8 rounds, 9 rounds, 10 rounds, 12 rounds, 14 rounds, 16 rounds, 18 rounds, 20 rounds, 25 rounds, 30 rounds, or more than 40 rounds. In an embodiment, purification of the circular target RNA from the mixture is repeated 5 times with the first 2 times using phosphate buffer of low phosphate concentration, 2 times using phosphate buffer of high phosphate concentration and 1 time using phosphate buffer of ultrahigh phosphate concentration.

[0068] In an embodiment, method of purification of the circular form of the target RNA molecule of the present invention from impurities does not comprise an RNase treatment, high performance liquid chromatography (HPLC), a heating process, or a combination thereof. In an embodiment, the method of purification of the circular target RNA is performed at room temperature. In an embodiment, the method of purification of the circular target RNA from impurities of the present invention takes no more than about 2 hours, no more than about 4 hours, no more than about 6 hours, no more than about 8 hours, no more than about 10 hours, no more than about 12 hours, no more than about 16 hours, no more than about 20 hours, or no more than about 24 hours.

[0069] In an embodiment, method of purification of the circular target RNA of the present invention does not comprise RNase treatment, high performance liquid chromatography (HPLC), heating process, or a combination thereof. In an embodiment, the method of purification of the circular target RNA of the present invention is performed at room temperature. In an embodiment, the method of purification of the circular target RNA from the mixture with impurities takes no more than about 2 hours, no more than about 4 hours, no more than about 6 hours, no more than about 8 hours, no more than about 10 hours, no more thanabout 12 hours, no more than about 16 hours, no more than about 20 hours, or no more than about 24 hours.

[0070] It is to be understood that both the foregoing general description and detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. In general, the terms used in the disclosure should not be construed to limit the technology to the specific embodiments disclosed in the specification, unless the above detailed description explicitly defines such terms. Accordingly, the actual scope of the technology encompasses the disclosed embodiments and all equivalent ways of practicing or implementing the technology.

[0071] Examples

[0072] Materials and Methods

[0073] Hydroxyapatite chromatography

[0074] Hydroxyapatite chromatography (EconoFit CHT Type II column, 40 pm, BIO-RAD) coupled to FPLC was used for the separation of circular RNAs from the linear RNAs in an RNA mixture. The RNA mixture was mixed with 100 mM potassium phosphate and then injected into the FPLC machine. In the first elution step, concentrations of potassium phosphate are 120 mM, which is collected in three fractions. Each fraction is 5 ml. In the second elution step, concentrations of potassium phosphate are 160 mM, which is collected in three fractions. Each fraction is 5 ml. In the third elution step, concentrations of potassium phosphate are 180 mM, which is collected in three fractions. Each fraction is 5 ml. In the final elution step, concentrations of potassium phosphate are 500 mM, which is collected in three fractions. Each fraction is 5 ml. The entire process takes approximately 19 minutes, with a flow rate of 5.2 ml / min. Linear RNA is isolated in fraction 5, while circular RNA is purified in fractions 2, 3, and 4 (FIG. 3, FIG. 4, FIG. 5, FIG. 7, FIG. 8, FIG. 10, FIG. 11, FIG. 12). The purification efficiency achieves 50-90% of the target RNA.

[0075] Preparation of LNP by microfluidic system

[0076] LNP was prepared by microfluidic method which make use of microscopic channels (in the size range of 5-500 pm), in which ionizable lipids (such as MC3, SM102 and ALC-0315 but not limited to), helper lipids (such as DSPC, DOPE but not limited to), cholesterol and its analogs, and PEGylated lipid are dissolved in an appropriate organic solvent (ethanol or isopropanol) and the RNA solution is propelled perpendicularly to the aqueous medium. The continuous axial mixing of the organic and aqueous solutions leads to nanoparticle formation because of local diffusion of phospholipids in aqueous phase, which encourages the self-assembly process. The resulting LNP dispersions are further processed for buffer exchange and suspended in PBS containing 10% sucrose.

[0077] LNP encapsulating circular RNA comprising luciferase coding sequence is prepared using the methods described above. The 10 pg of circular RNA comprising luciferase coding sequence encapsulated in the MC3-based LNP is then injected into mice as well as various organ tissues including heart, liver, spleen, lung, kidney and brain tissues. Results are shown in FIG. 9 (a) and 9 (b). As shown in FIG. 9 (a) injection of the LNP encapsulating circular RNA comprising luciferase coding sequence resulted in clear expression of luciferase in mice. FIG. 9(a) shows that cell viability is not affected by injection of the LNP. Lastly, FIG. 9(b) illustrates that expression of luciferase occurs highest in liver cells by far as compared to other organ tissues tested.

[0078] Mechanisms behind the separation of nucleic acids using hydroxyapatite chromatography coupled with phosphate buffer elution

[0079] It has been reported in a research article entitled “Hydroxyapatite-mediated separation of double-stranded DNA, single-stranded DNA, and RNA genomes from natural viral assemblages” (Andrews-Pfannkoch et al. Appl Fnviron Microbiol. 2010 Aug;76(15):5036-45. DOI: 10.1128 / AEM.00204- 10) that the principle behind the fractionation of nucleic acids using hydroxyapatite chromatography lies in the charge interaction between the positively charged calcium ions on the surface of the hydroxyapatite and the negatively charged phosphate backbone of the nucleic acids. And that polynucleotides of different lengths, sequences and / or conformations would fractionalize due to different number of negatively charged phosphate available to interact with the positively charged calcium ions. Based on this principle, a skilled person in the art would not have expected that the same method could be used in separating linear nucleotides and circular nucleotides having identical sequences since circular conformation would not affect the number of negatively charged phosphate available for interaction with the positively charged calcium ions. However, our data unexpectedly shows otherwise. Specifically, our data demonstrates fractionalization using hydroxyapatite chromatography coupled with phosphate buffer elution resulted in clear separation between linear RNA (fraction A5) and circular RNA (fractions A2-A3) having identical nucleotide sequence with linear RNA having only an additional triphosphate group at the 5’ end (FIG. 4, FIG. 5, FIG. 7). We hypothesize such clear separation may be associated with the different conformation between linear RNA and circular RNA, which is the mechanism of separating linear and circular nucleotides having identical sequence using gel electrophoresis-based methods. We then analyze the separation efficiency between circular RNA and nicked RNA(circular GFP vs. nicked GFP) that share identical sequence and phosphate number using the method of the present invention. Surprisingly, our data in FIG. 11 demonstrates that circular GFP cannot be separated from nicked GFP as they present at a similar ratio in each fraction. This data suggests that none of the above theories including (1) phosphate-calcium interaction and (2) nucleotide conformation alone or in combination could explain the mechanism of separating linear and circular RNA having identical sequence using hydroxyapatite chromatography coupled with phosphate buffer elution. Indeed, we demonstrate in an independent experiment that the content of guanine in a nucleotide may also be part of the separation mechanism as our data in FIG. 12 shows that GTP could be separated from other NTPs including ATP, CTP, and UTP using the method comprising hydroxyapatite chromatography coupled with phosphate buffer elution of the present invention. Overall, our data demonstrates an unexpected application of hydroxyapatite chromatography coupled with phosphate buffer elution in separating linear nucleotides from circular nucleotides having identical sequences.

[0080] It can be appreciated by those skilled in the art that changes could be made to the examples described above without departing from the broad inventive concept thereof. It is understood, therefore, that this invention is not limited to the particular examples disclosed, but it is intended to cover modifications within the spirit and scope of the present invention as defined by the appended claims.

Claims

What is claimed is:

1. A method of purifying circular target RNA from a mixture comprising the step of performing phosphate buffer elution on the mixture in a hydroxyapatite chromatography, wherein the mixture comprises circular target RNA and linear target RNA, wherein the nucleotide sequence of each of the circular target RNA and the linear target RNA is at least about 80% identical to nucleotide sequence of a target RNA, wherein the circular target RNA is the circular form of the target RNA, wherein the linear target RNA is the linear form of the target RNA and wherein the nucleotide sequence of the circular target RNA is at least about 80% identical to the nucleotide sequence of the linear circular RNA.

2. The method of claim 1, wherein the mixture further comprise fragments of the linear target RNA.

3. The method of claim 1, wherein the circular target RNA is produced from the linear target RNA by circularizing the linear target RNA.

4. The method of claim 1 , wherein the target RNA comprises a nucleotide sequence capable of performing biological functions such as a messenger RNA (mRNA), a non-coding RNA (ncRNA), or a combination thereof.

5. The method of claim 1, wherein the circular target RNA does not comprise a 5 ’-untranslated region (5’UTR), a 3’-UTR, a 5’-end capping structure, an adenylate tail (poly A tail), or a combination thereof of a mRNA or an alternative splicing variant thereof.

6. The method of claim 1, wherein stationary phase of the hydroxyapatite chromatography comprises ceramic hydroxyapatite (CHT).

7. The method of claim 6, wherein the CHT can be reused for additional rounds of circular target RNA purification.

8. The method of claim 6, wherein the particle size of the CHT is from about 10 pm to about 100 pm.

9. The method of claim 1, wherein the mixture comprising the circular target RNA and the linear target RNA is mixed with a phosphate buffer comprising a phosphate concentration from about 80 mM to about 120 mM prior to phosphate buffer elution in the hydroxyapatite chromatography.

10. The method of claim 1, wherein the phosphate buffer elution uses a phosphate buffer with phosphate concentration from about 100 mM to about 140 mM.

11. The method of claim 1, wherein the phosphate buffer elution step comprises the steps of:a. performing a first elution using a low concentration phosphate buffer; and b. performing a second elution using a high concentration phosphate buffer, wherein the phosphate concentration of the high concentration phosphate buffer is at least about 10% higher than the phosphate concentration of the low concentration phosphate buffer.

12. The method of claim 11 , wherein the phosphate concentration of the low concentration phosphate buffer is from about 100 mM to about 140 mM.

13. The method of claim 11, wherein the phosphate concentration of the high concentration phosphate buffer is from about 140 mM to about 180 mM.

14. The method of claim 11, wherein the phosphate buffer elution step further comprises the step of performing a third elution using an ultra-high concentration phosphate buffer, wherein the phosphate concentration of the ultra-high concentration phosphate buffer is from about 400 mM to about 600 mM.

15. The method of claim 1, wherein the phosphate buffer elution step comprises continuous gradient elution from a lower concentration phosphate buffer to a higher concentration phosphate buffer.

16. The method of claim 1, wherein the pH of the phosphate buffer is from about 5.4 to about 7.0.

17. The method of claim 1, wherein the phosphate buffer comprises potassium phosphate.

18. The method of claim 1, wherein the flowrate of the phosphate buffer elution is from about 2 mL / min to about 10 mT / min.

19. The method of claim 1, wherein the method is performed at room temperature.

20. The method of claim 1, wherein the method does not comprise an RNase treatment, a high performance liquid chromatography (HPLC), a heating process, or a combination thereof.

21. The method of claim 1, wherein the mixture comprising the circular target RNA and the linear target RNA is the result of a RNA circularization process.

22. The method of claim 21, where in the RNA circularization process comprises the steps of:a. preparing a DNA template comprising a nucleotide sequence reverse- complementary to the target RNA molecule;b. preparing a linear RNA precursor comprising the target RNA molecule from the DNA template of step a;c. purifying the RNA sample comprising the linear RNA precursor of step b; and d. preparing a circular target RNA from the linear RNA precursor of step c to result in mixture comprising the circular target RNA and linear target RNA.

Images