Shrna targeting fas and tgfbrii genes

Abstract

Provided herein are improved recombinant nucleic acids that reduce expression of FAS and TGFBR2 and cells comprising such recombinant nucleic acids. Also provided are methods of making and using such cells.

Description

Atorney Ref: ANB-228WOSHRNA TARGETING FAS AND TGFBRII GENES CROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No. 63 / 744,015, filed January 10, 2025, which is hereby incorporated in its entirety by reference.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted via PatentCenter and is hereby incorporated by reference in its entirety. Said XML copy, created on January 7, 2025, is named ANB-228WO_SL.xml, and is 222,402 bytes in size.BACKGROUND

[0003] Cancer is a disease characterized by uncontrollable growth of cells. Many approaches to treating cancer have been tried, including drugs and radiation therapies. Recent cancer treatments have sought to use the body’s own immune cells to attack cancer cells. One promising approach uses T cells that are taken from a patient and genetically engineered to produce chimeric antigen receptors, or CARs, receptor proteins that give the T cells a new ability to target a specific protein. The receptors are chimeric because they combine antigenbinding and T-cell activating functions into a single receptor.

[0004] Immunotherapy using CAR-T cells is promising because the modified T cells have the potential to recognize cancer cells in order to more effectively target and destroy them. After the T cells are engineered with the CARs, the resulting CAR-T cells are introduced into patients to attack tumor cells. Once CAR-T cells are infused into a patient, they come in contact with their targeted antigen on a cell. The CAR-T cells bind to the antigen and become activated. Upon antigen engagement, CAR T cells can proliferate exponentially, initiate antitumor cytokine production, and target tumor cell killing.

[0005] However, there remain some limitations to CAR T cell-based immunotherapy. In particular, CAR-T cells can lack peripheral survival, can have reduced expansion and effector function, are susceptible to suppression and exhaustion, and may not result in memory T cell persistence. Thus, additional therapies targeting T cell intrinsic pathways are needed to address these roadblocks for CAR-T therapy.SUMMARY

[0006] Provided herein are nucleic acids with improved resistance to Fas-mediated apoptosis and to TGFP-driven downregulation of T cell activation when expressed in immune cells, particularly CAR-engineered primary T cells. Also provided inter alia are IPTS / 200259280.1 1Atorney Ref: ANB-228WOcompositions, including pharmaceutical compositions, comprising immune cells containing such nucleic acids, methods of editing an immune cell to contain and express the nucleic acids, methods of treating a disease, e.g., cancer, or methods of enhancing an immune response by administering immune cells containing and expressing the nucleic acids.

[0007] In one aspect, provided herein are one or more nucleic acids comprising four or more nucleic acid sequences comprising the sequences as set forth in SEQ ID NOs: 18, 20, 48, and 59.

[0008] In some embodiments, the four or more nucleic acid sequences each comprise a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double stranded RNA (dsRNA), or an antisense oligonucleotide.

[0009] In some embodiments, the four or more nucleic acid sequences each comprise an shRNA.

[0010] In some embodiments, further comprising one or more microRNA backbones, optionally comprising at least one of miR-E and miR-3G.

[0011] In some embodiments, the one or more nucleic acids comprises a microRNA backbone comprising miR-E, miR-3G, or a miR-3G:miR-E:miR-3G:miR-3G architecture.

[0012] In some embodiments, the four or more nucleic acid sequences each comprise an shRNA each comprising a guide sequence and a cognate passenger sequence, wherein each shRNA comprises, in a 5’ to 3’ direction,i. the guide sequence as set forth in SEQ ID NOs: 18, 48, and 59 and each corresponding cognate passenger sequence; andii. the cognate passenger sequence corresponding to the guide sequence set forth in SEQ ID NO: 20 and the guide sequence as set forth in SEQ ID NO: 20.

[0013] In some embodiments, the four or more nucleic acid sequences each comprise an shRNA (SI, S2, S3, and S4) each comprising a guide sequence and a cognate passenger sequence, wherein SEQ ID NOs: 18, 20, 48, and 59 are the guide sequences of SI, S2, S3, and S4, respectively, and wherein the guide sequences of SI, S3, and S4 are located 5’ of the cognate passenger sequence, and the guide sequence of S2 is located 3’ of the cognate passenger sequence.

[0014] In some embodiments, the one or more nucleic acids comprise, in a 5’ to 3’ direction, SEQ ID NO: 59, SEQ ID NO: 20, SEQ ID NO: 48, and SEQ ID NO: 18.

[0015] In some embodiments, the one or more nucleic acids comprise the sequence as set forth in SEQ ID NO: 80.IPTS / 200259280.1 2Atorney Ref: ANB-228WO

[0016] In one aspect, provided herein are one or more nucleic acids comprising four or more nucleic acid sequences comprising the sequences as set forth in SEQ ID NOs: 18, 20, 48, and 59, and a microRNA backbone comprising a miR-3G:miR-E:miR-3G:miR-3G architecture.

[0017] In some embodiments, the four or more nucleic acid sequences each comprise an shRNA each comprising a guide sequence and a cognate passenger sequence, wherein each shRNA comprises, in a 5’ to 3’ direction,i. the guide sequence as set forth in SEQ ID NOs: 18, 48, and 59 and each corresponding cognate passenger sequence; andii. the cognate passenger sequence corresponding to the guide sequence set forth in SEQ ID NO: 20 and the guide sequence as set forth in SEQ ID NO: 20.

[0018] In some embodiments, the four or more nucleic acids sequences each comprise an shRNA (SI, S2, S3, and S4) each comprising a guide sequence and a cognate passenger sequence, wherein SEQ ID NOs: 18, 20, 48, and 59 are the guide sequences of SI, S2, S3, and S4, respectively, and wherein the guide sequences of SI, S3, and S4 are located 5’ of the cognate passenger sequence, and the guide sequence of S2 is located 3’ of the cognate passenger sequence.

[0019] In some embodiments, the one or more nucleic acids comprise the sequence as set forth in SEQ ID NO: 80.

[0020] In one aspect, provided herein are one or more nucleic acids comprising at least four nucleic acid sequences comprising the sequences as set forth in SEQ ID NOs: 18, 48, 52, and 59.

[0021] In some embodiments, the four or more nucleic acid sequences each comprise a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double stranded RNA (dsRNA), or an antisense oligonucleotide.

[0022] In some embodiments, the four or more nucleic acid sequences each comprise an shRNA.

[0023] In some embodiments, further comprising one or more microRNA backbones, optionally comprising at least one of miR-E and miR-3G.

[0024] In some embodiments, the one or more nucleic acids comprise a microRNA backbone comprising miR-E, miR-3G, or a miR-3G:miR-E:miR-3G:miR-3G architecture.IPTS / 200259280.1 3Atorney Ref: ANB-228WO

[0025] In some embodiments, the four or more nucleic acids sequences each comprise an shRNA each comprising a guide sequence and a cognate passenger sequence, wherein each shRNA comprises, in a 5’ to 3’ direction,i. the guide sequence as set forth in SEQ ID NOs: 18, 48, and 59 and each corresponding cognate passenger sequence; andii. the cognate passenger sequence corresponding to the guide sequence set forth in SEQ ID NO: 52 and the guide sequence as set forth in SEQ ID NO: 52.

[0026] In some embodiments, the four or more nucleic acid sequences each comprise an shRNA (SI, S2, S3, and S4) each comprising a guide sequence and a cognate passenger sequence, wherein SEQ ID NOs: 18, 48, 52, and 59 are the guide sequences of SI, S2, S3, and S4, respectively, and wherein the guide sequences of SI, S3, and S4 are located 5’ of the cognate passenger sequence, and the guide sequence of S2 is located 3’ of the cognate passenger sequence.

[0027] In some embodiments, the one or more nucleic acids comprise, in a 5’ to 3’ direction, SEQ ID NO: 59, SEQ ID NO: 52, SEQ ID NO: 48, and SEQ ID NO: 18.

[0028] In some embodiments, the one or more nucleic acids comprise the sequence as set forth in SEQ ID NO: 84.

[0029] In one aspect, provided herein are one or more nucleic acids comprising four or more nucleic acid sequences comprising the sequences as set forth in SEQ ID NOs: 18, 48, 52, and 59, and a microRNA backbone comprising a miR-3G:miR-E:miR-3G:miR-3G architecture.

[0030] In some embodiments, the four or more nucleic acids sequences each comprise an shRNA each a guide sequence and a cognate passenger sequence, wherein each shRNA comprises, in a 5’ to 3’ direction,i. the guide sequence as set forth in SEQ ID NOs: 18, 48, and 59 and each corresponding cognate passenger sequence; andii. the cognate passenger sequence corresponding to the guide sequence set forth in SEQ ID NO: 52 and the guide sequence as set forth in SEQ ID NO: 52.

[0031] In some embodiments, the four or more nucleic acid sequences each comprise an shRNA (SI, S2, S3, and S4) each comprising a guide sequence and a cognate passenger sequence, wherein SEQ ID NOs: 18, 48, 52, and 59 are the guide sequences of SI, S2, S3, and S4, respectively, and wherein the guide sequences of SI, S3, and S4 are located 5’ of the IPTS / 200259280.1 4Atorney Ref: ANB-228WOcognate passenger sequence, and the guide sequence of S2 is located 3’ of the cognate passenger sequence.

[0032] In some embodiments, the one or more nucleic acids comprise the sequence as set forth in SEQ ID NO: 84.

[0033] In one aspect, provided herein are nucleic acid comprising the sequence as set forth in SEQ ID NO: 80.

[0034] In one aspect, provided herein are nucleic acid comprising the sequence as set forth in SEQ ID NO: 84.

[0035] In some embodiments, further comprising at least an additional nucleic acid sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 3-17, 19-47, 49-58, or 60-66.

[0036] In some embodiments, the nucleic acid reduces expression of Transforming Growth Factor Beta Receptor 2 (TGFBR2) in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.

[0037] In some embodiments, the nucleic acid reduces expression of Fas Cell Surface Death Receptor (FAS) in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.

[0038] In some embodiments, the nucleic acid reduces expression of Fas Cell Surface Death Receptor (FAS) in a cell by at least about 1.1-fold, 1.2-fold, 1.25-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, or 2-fold as much as compared to a control cell that comprises a nucleic acid comprising only the sequences as set forth in SEQ ID NOs: 18, 48, and 59.

[0039] In some embodiments, the nucleic acid reduces expression of TFGBR2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% and reduces expression of FAS in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, each as compared to a control cell that does not comprise the respective nucleic acid.

[0040] In some embodiments, the nucleic acid reduces phosphorylation of SMAD 2 and / or SMAD 3 (SMAD2 / 3) in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.IPTS / 200259280.1 5Atorney Ref: ANB-228WO

[0041] In some embodiments, the nucleic acid(s) further comprises at least one of a nucleotide sequence encoding a priming receptor comprising a first extracellular antigenbinding domain that specifically binds to a first antigen and a nucleotide sequence encoding a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to a second antigen, wherein the first antigen and the second antigen are distinct.

[0042] In some embodiments, the nucleic acid comprises, in a 5’ to 3’ direction:i. the CAR;ii. the one or more nucleic acids provided herein; and iii. the priming receptor.

[0043] In some embodiments, the nucleic acid comprises, in a 5’ to 3’ direction:i. the priming receptor;ii. the one or more nucleic acids provided herein; and iii. the CAR.

[0044] In some embodiments, the one or more nucleic acids further comprises a 5’ homology directed repair arm and / or a 3’ homology directed repair arm complementary to an insertion site in a host cell chromosome.

[0045] In some embodiments, the one or more nucleic acids comprises the 5’ homology directed repair arm and the 3’ homology directed repair arm.

[0046] In some embodiments, each of the one or more nucleic acids are encoded on a plurality of different nucleic acid molecules.

[0047] In some embodiments, each of the one or more nucleic acids are encoded on the same nucleic acid molecule.

[0048] In some embodiments, the one or more nucleic acids are incorporated into a one or more expression cassettes or expression vectors.

[0049] In some embodiments, the expression cassette or the expression vector further comprises a constitutive promoter upstream of the one or more nucleic acids .

[0050] In some embodiments, the expression vector is a non-viral vector.

[0051] In one aspect, provided herein are expression vectors comprising the one or more nucleic acid(s) provided herein.

[0052] In some embodiments, the expression vector is a non-viral vector.

[0053] In some embodiments, the 5’ and 3’ ends of the one or more nucleic acid(s) comprise one or more nucleotide sequences that are homologous to genomic sequences flanking an insertion site in a genome of a cell.IPTS / 200259280.1 6Atorney Ref: ANB-228WO

[0054] In some embodiments, the insertion site is located at a genomic safe harbor (GSH) locus or a T Cell Receptor Alpha Constant (TRAC) locus.

[0055] In some embodiments, the GSH locus is the GS94 locus.

[0056] In one aspect, provided herein are immune cells comprising the one or more nucleic acids provided herein or the vector provided herein.

[0057] In some embodiments, the one or more nucleic acids reduces expression of TGFBR2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the first nucleic acid.

[0058] In some embodiments, expression of TGFBR2 in a cell is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the nucleic acid.

[0059] In some embodiments, the one or more nucleic acids reduces expression of FAS in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the nucleic acid.

[0060] In some embodiments, expression of FAS in a cell is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the nucleic acid.

[0061] In some embodiments, expression of FAS in a cell is reduced by at least about 1.1-fold, 1.2-fold, 1.25-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, or 2-fold as much as compared to a control cell that comprises a nucleic acid comprising only the sequences as set forth in SEQ ID NOs: 18, 48, and 59.

[0062] In some embodiments, the one or more nucleic acids reduces expression of TFGBR2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% and reduces expression of FAS in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, each as compared to a control cell that does not comprise the respective nucleic acid.

[0063] In some embodiments, the nucleic acid reduces phosphorylation of SMAD 2 and / or SMAD 3 (SMAD2 / 3) in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.IPTS / 200259280.1 7Atorney Ref: ANB-228WO

[0064] In some embodiments, expression of TGFBR2 and / or FAS is determined by a nucleic acid assay or a protein assay.

[0065] In some embodiments, the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.

[0066] In some embodiments, the protein assay comprises at least one of immunoblotting, fluorescence activated cell sorting, flow-cytometry, magnetic-activated cell sorting, or affinity-based cell separation.

[0067] In some embodiments, the cell further comprises a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to a first antigen and a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to a second antigen.

[0068] In some embodiments, the immune cell is a primary human immune cell.

[0069] In some embodiments, the primary immune cell is a natural killer (NK) cell, a natural killer T (NKT) cell, a T cell, a yb T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, a T cell progenitor, or an induced pluripotent stem cell (iPSC).

[0070] In some embodiments, the primary immune cell is a primary T cell.

[0071] In some embodiments, the primary immune cell is a primary human T cell.

[0072] In some embodiments, the immune cell is virus-free.

[0073] In some embodiments, the immune cell is an autologous immune cell.

[0074] In some embodiments, the immune cell is an allogeneic immune cell.

[0075] In one aspect, provided herein are primary immune cells comprising the one or more nucleic acids provided herein or the vector provided herein, and wherein the primary immune cell does not comprise a viral vector for introducing the one or more nucleic acid(s) into the primary immune cell.

[0076] In one aspect, provided herein are viable, virus-free, primary cells comprising a ribonucleoprotein (RNP) complex and one or more one or more nucleic acid(s), wherein the RNP comprises a nuclease domain and a guide RNA, wherein the one or more nucleic acids comprise the one or more nucleic acid(s) provided herein or the vector provided herein, and wherein the 5’ and 3’ ends of the one or more nucleic acid(s) comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the genome of the primary cell.

[0077] In some embodiments, the cell further comprises a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to a first antigen and a IPTS / 200259280.1 8Atorney Ref: ANB-228WOchimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to a second antigen, wherein the first antigen and the second antigen are distinct.

[0078] In one aspect, provided herein are populations of cells comprising one or more of the immune cells provided herein.

[0079] In one aspect, provided herein are pharmaceutical compositions comprising the immune cell provided herein or the population of cells provided herein, and a pharmaceutically acceptable excipient.

[0080] In one aspect, provided herein are pharmaceutical compositions comprising the one or more nucleic acids provided herein or the vector provided herein, and a pharmaceutically acceptable excipient.

[0081] In one aspect, provided herein are methods of editing an immune cell, comprising:i. providing a ribonucleoprotein (RNP) complex and one or more nucleic acid(s), wherein the RNP comprises a nuclease domain and a guide RNA, wherein the one or more nucleic acid(s) comprises the one or more nucleic acid(s) provided herein, and wherein the 5’ and 3’ ends of the one or more nucleic acid(s) comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the genome of the immune cell;ii. non-virally introducing the RNP complex and nucleic acid(s) into the immune cell, wherein the guide RNA specifically hybridizes to a target region of the genome of the primary immune cell, and wherein the nuclease domain cleaves the target region to create the insertion site in the genome of the immune cell; andiii. editing the immune cell via insertion of the one or more nucleic acid(s) provided herein into the insertion site in the genome of the immune cell.

[0082] In some embodiments, non-virally introducing comprises electroporation.

[0083] In some embodiments, the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.

[0084] In some embodiments, the target region of the genome of the cell is a genomic safe harbor (GSH) locus or a T Cell Receptor Alpha Constant (TRAC) locus.

[0085] In some embodiments, the GSH locus is the GS94 locus.IPTS / 200259280.1 9Atorney Ref: ANB-228WO

[0086] In some embodiments, the one or more nucleic acid(s) is a double-stranded one or more nucleic acid(s) or a single-stranded one or more nucleic acid(s).

[0087] In some embodiments, the one or more nucleic acid(s) is a linear one or more nucleic acid(s) or a circular one or more nucleic acid(s), optionally wherein the circular one or more nucleic acid(s) is a plasmid.

[0088] In some embodiments, the immune cell is a primary human immune cell.

[0089] In some embodiments, the immune cell is an autologous immune cell.

[0090] In some embodiments, the immune cell is an allogeneic immune cell.

[0091] In some embodiments, the immune cell is a natural killer (NK) cell, a natural killer T (NKT) cell, a T cell, a yb T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, a T cell progenitor, or an induced pluripotent stem cell (iPSC).

[0092] In some embodiments, the immune cell is a primary T cell.

[0093] In some embodiments, the immune cell is a primary human T cell.

[0094] In some embodiments, the immune cell is a primary human CD8+ T cell or a CD4+ T cell.

[0095] In some embodiments, the immune cell is virus-free or does not comprise a viral vector.

[0096] In some embodiments, further comprising obtaining the immune cell from a patient and introducing the one or more nucleic acid(s) in vitro.

[0097] In one aspect, provided herein are methods of treating a disease in a subject comprising administering the immune cell(s) provided herein or the pharmaceutical composition provided herein to the subject.

[0098] In some embodiments, the disease is cancer.

[0099] In some embodiments, the cancer is a solid cancer or a liquid cancer.

[0100] In some embodiments, the cancer is colorectal cancer, ovarian cancer, fallopian cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, pancreatic, kidney cancer, lung cancer, prostate cancer, bladder cancer, breast cancer, liver cancer, or brain cancer.

[0101] In some embodiments, the administration of the cell(s) enhances an immune response.

[0102] In some embodiments, the enhanced immune response is an adaptive immune response.

[0103] In some embodiments, the enhanced immune response is an innate immune response.IPTS / 200259280.1 10Atorney Ref: ANB-228WO

[0104] In one aspect, provided herein are methods of enhancing an immune response in a subject comprising administering the immune cell(s) provided herein or the pharmaceutical composition provided herein to the subject.

[0105] In some embodiments, the enhanced immune response is an adaptive immune response.

[0106] In some embodiments, the enhanced immune response is an innate immune response.

[0107] In some embodiments, expression of TGFBR2 in the immune cell is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.

[0108] In some embodiments, expression of FAS in the immune cell is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.

[0109] In some embodiments, expression of FAS in the immune cell is reduced by at least about 1.1-fold, 1.2-fold, 1.25-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, or 2-fold as much as compared to a control cell that comprises a nucleic acid comprising only the sequences as set forth in SEQ ID NOs: 18, 48, and 59.

[0110] In some embodiments, expression of TGFBR2 and / or FAS in the immune cell is determined by a nucleic acid assay or a protein assay.

[0111] In some embodiments, the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.

[0112] In some embodiments, the protein assay comprises at least one of immunoblotting, fluorescence activated cell sorting, flow-cytometry, magnetic-activated cell sorting, or affinity-based cell separation.

[0113] In some embodiments, further comprising administering an immunotherapy to the subject concurrently with the immune cell or subsequently to the immune cell.BRIEF DESCRIPTION OF THE SEVERAL VIEWS OF THE DRAWINGS

[0114] These and other features, aspects, and advantages of the present disclosure will become better understood with regard to the following description, and accompanying drawings, where:IPTS / 200259280.1 11Atorney Ref: ANB-228WO

[0115] FIG. 1 shows an exemplary insertion cassette encoding a logic gate (priming receptor (primeR) and CAR) and an shRNA module.

[0116] FIG. 2 provides diagram of the various ICT cell transgene cassettes expressing exemplary Logic Gate 1-5 IC T cells, shRNA, and optional SPAs used in Examples 1-4. A quadruple Fas / TGFBR2 shRNA cassette (Fas / TGFBR2 / TGFBR2 / TGFBR2 / ; F / T / T / T quad shRNA) was used in the shRNA cassette of an exemplary ICT cell in Example 5. The additional exemplary Logic Gates 1-5 used in the ICT cells of Examples 6 and 7 have the same structure with the exception of the LNGFR peptide and the use of the quadruple Fas / TGFBR2 shRNA cassette.

[0117] FIG. 3 shows that all ICT cells constitutively expressed the PrimeR construct.

[0118] FIG. 4 shows that the ICT cells induced CAR expression when co-cultured with primeR antigen expressing cell lines.

[0119] FIG. 5 shows that inclusion of the shRNA module in ICT cells resulted in lower MFI for both FAS and TGFBR2 in ICT cells expressing the priming receptor-CAR logic gate (PrimeR+) normalized to non-edited cells (PrimeR-).

[0120] FIG. 6A shows cytotoxicity against parental K562 cells expressing neither CAR antigen or primeR antigen, FIG. 6B shows cytotoxicity against K562 cells expressing only CAR antigen, FIG. 6C cytotoxicity against K562 cells expressing only primeR antigen. FIG.6D shows cytotoxicity against K562 cells expressing both primeR antigen and CAR antigen.

[0121] FIG. 7 shows IFN-y production from ICTs expressing Logic Gates 1-5 only in supernatants taken from co-cultures where the target cells expressed both primeR antigen and CAR antigen.

[0122] FIG. 8A shows that ICTs expressing Logic Gates 1-5 demonstrated in vitro cytotoxicity against the primeR antigen+ cell line expressing endogenous CAR antigen FIG.8B shows IFNy, TNFa, GM-CSF, and IL-2 secretion by ICT cells after co-culture with primeR antigen+ / CAR antigen+ cells.

[0123] FIG. 9 shows that co-culture with HUVEC -primeR antigen+ cells induced expression of the CAR protein on ICT cells and specific killing of CAR antigen+ cells.

[0124] FIG. 10A shows the tumor volume post tumor implant in mice treated with ICTs expressing Logic Gates 1-5, RNP or PBS generated from donor 1. FIG. 10B shows the total T cells and expansion of the ICTs on day 12 post inoculation followed by contraction by day 21. FIG 10C shows total T cells expressing the priming receptor on days 12 and 21. FIG. 10D show the tumor volume post tumor implant in mice treated with ICTs expressing LogicIPTS / 200259280.1 12Atorney Ref: ANB-228WOGates 1-5, RNP or PBS generated from donor 2. FIG. 10E shows the total T cells and expansion of the ICTs on day 12 post inoculation followed by contraction by day 21. FIG 10F shows total T cells expressing the priming receptor on days 12 and 21.

[0125] FIG. 11A shows tumor growth inhibition (TGI) in the single positive CAR antigen-only flank. FIG. 11B shows tumor growth inhibition (TGI) in the dual positive primeR antigen / CAR antigen flank.

[0126] FIG. 12 shows that TGFBR knockdown protects ICT cells against TGFP -mediated inhibition.

[0127] FIG. 13 shows that the ICT+shRNA was more potent than a conventional CAR-T benchmark.

[0128] FIG. 14 shows in vivo tumor volume in the 786-0 xenograft model after injection of the indicated ICTs expressing quad shRNAs.

[0129] FIG. 15 shows in vivo tumor volume in the A498 xenograft model after injection of the ICTs expressing quad shRNAs as compared to FAS-PTPN2 shRNA.

[0130] FIG. 16 shows a schematic of an exemplary triple shRNA expression cassette for expression of shRNAs against FAS and TGFBR2 in the 3G-E-3G format. FIG. 16 discloses SEQ ID NOS 77-79, respectively, in order of appearance.

[0131] FIG. 17 shows a schematic of an exemplary triple shRNA expression cassette for expression of shRNAs against TGFBR2 a A FAS in the 3G-3G-3G format. FIG. 17 discloses SEQ ID NOS 74-76, respectively, in order of appearance.

[0132] FIG. 18 shows a schematic of an exemplary triple shRNA expression cassette for expression of shRNAs against FAS and TGFBR2 in the 3G-3G-3G format. FIG. 18 discloses SEQ ID NOS 71-73, respectively, in order of appearance.

[0133] FIG. 19 shows a schematic of an exemplary quadruple shRNA expression cassette for expression of shRNAs against FAS, PTPN2, and TGFBR2 in the 3G-E-3G-3G format. FIG. 19 discloses SEQ ID NOS 211-213, respectively, in order of appearance.

[0134] FIG. 20 shows a comparison of FAS knockdown in ICTs with a triple Fas / TGFBR2 / TGFBR2 and quad Fas / TGFBR2 / TGFBR2 / TGFBR2 shRNA module.

[0135] FIG. 21 shows triple Fas / TGFBR2 / TGFBR2 and quad Fas / TGFBR2 / TGFBR2 / TGFBR2 shRNA protection of ICTs in an anti-FAS induced apoptosis model.

[0136] FIG. 22 shows phosphorylated SMAD2 / 3 reduction in ICTs with a triple or quad shRNA module.IPTS / 200259280.1 13Atorney Ref: ANB-228WO

[0137] FIG. 23 shows tumor control across TGFP concentrations in ICTs with a triple or quad shRNA module.

[0138] FIG. 24 shows an exemplary Fas / TGFBR2 / TGFBR2 / TGFBR2 quadruple shRNA expression cassette for expression of shRNAs against FAS and TGFBR2 in the 3G-E-3G-3G format. FIG. 24 discloses SEQ ID NOS 81-83, respectively, in order of appearance

[0139] FIG. 25 shows an exemplary Fas / Fas / TGFBR2 / TGFBR2 quadruple shRNA expression cassette for expression of shRNAs against FAS and TGFBR2 in the 3G-E-3G-3G format. FIG. 25 discloses SEQ ID NOS 85-87, respectively, in order of appearance.

[0140] FIG. 26 shows cytotoxicity of indicated constructs against 786-0 cells expressing primeR antigen at the indicated effector to target (E:T) ratios.

[0141] FIG. 27A shows cytotoxicity of LG 1 ICT cells against cells with medium or high primeR antigen and medium or high CAR antigen expression levels. FIG.27B shows the expression levels of CAR antigen or primeR antigen in the cell lines used for the cytotoxicity analysis in FIG. 27A.

[0142] FIG. 28A shows GM-CSF, fFNy and TNFa production from LG 1 ICT cells with and without a SPA after incubation with target PC3 tumor cells at a 1 : 1 ratio. FIG. 28B shows per cell cytokine levels after incubation of target PC3 tumor cells with LG 1 T cells with and without a SPA at a 1:1 ratio. FIG. 28C shows total cytokine levels after incubation of target PC3 tumor cells with LG 1 T cells with and without a SPA at a 1:1 ratio. In both, cytokine levels in LG 1 T cells with no target cell incubation is shown as a negative control.

[0143] FIG. 29A shows the tumor growth inhibition of 786-O-CAR antigen+ (left panel) and 786-0- primeR antigen+ / CAR antigen+ (right panel) cells in a dual flank mouse model after treatment with IxlO6ICTs expressing Logic Gates 1-5, CAR antigen CAR+ DNR, RNP or PBS generated from donor 1. FIG. 29B shows the tumor growth inhibition of 786-0- CAR antigen+ (left panel) and 786-0- primeR antigen+ / CAR antigen+ (right panel) cells in a dual flank mouse model after treatment with ICTs expressing Logic Gates 1-5, CAR antigen CAR+ DNR, RNP or PBS generated from donor 2.

[0144] FIG. 30A shows the individual mouse tumor growth inhibition of 786-0- CAR antigen+ cells in a single flank mouse model after treatment with IxlO6ICTs expressing LG 1-5, CAR antigen CAR + DNR, or RNP from donor 1. FIG. 30B shows the individual mouse tumor growth inhibition of 786-0- CAR antigen+ cells in a single flank mouse model after treatment with 0.3xl06ICTs expressing LG 1-5, CAR antigen CAR + DNR, or RNP from donor 1. LG 2, LG 4 and LG 5 T cells showed killing of cells expressing the cytolytic antigenIPTS / 200259280.1 14Atorney Ref: ANB-228WO(CAR antigen) in the absence of primeR antigen priming, which was not observed in the LG 1 or LG 3 T cells.

[0145] FIG. 31A shows the individual mouse tumor growth of 786-0- primeR antigen+ / CAR antigen- cells in a single flank mouse model after treatment with ICTs expressing LG 1-5, primeR antigen CAR, or RNP from donor 1. FIG. 31B shows the individual mouse tumor growth of 786-0- primeR antigen+ / CAR antigen- cells in a single flank mouse model after treatment with ICTs expressing LG 1-5, primeR antigen CAR, or RNP from donor 2. None of the LG 1-5 T cells showed killing of cells expressing the priming antigen (primeR antigen) only.

[0146] FIG. 32A shows tumor growth inhibition of PC3- primeR antigen+ / CAR antigen + cells in a single flank mouse model after treatment with ICTs expressing LG 1-5, CAR antigen CAR + DNR, RNP or PBS from donor 1. FIG. 32B shows tumor growth inhibition of PC3- primeR antigen+ / CAR antigen+ cells in a single flank mouse model after treatment with ICTs expressing LG 1-5, CAR antigen CAR + DNR, RNP or PBS from donor 2.

[0147] FIG. 33A shows the individual mouse tumor growth inhibition of PC3- primeR antigen+ / CAR antigen+ cells in a single flank mouse model after treatment with 0.75xl05ICTs expressing LG 1-5, CAR antigen CAR + DNR, or RNP from donor 1. FIG. 33B shows the individual mouse tumor growth inhibition of PC3- primeR antigen+ / CAR antigen + cells in a single flank mouse model after treatment with 0.75xl05ICTs expressing LG 1-5, CAR antigen CAR + DNR, or RNP from donor 2.

[0148] FIG. 34A shows tumor growth inhibition of PC3- primeR antigen+ / CAR antigen + cells in a single flank mouse model after treatment with 0.75xl05or 0.3xl06ICTs expressing LG 1, CAR antigen CAR + DNR, RNP or PBS from donor 1. FIG. 34B shows tumor growth inhibition of PC3- primeR antigen+ / CAR antigen+ cells in a single flank mouse model after treatment with 0.75xl05or 0.3xl06ICTs expressing LG 1, CAR antigen CAR + DNR, RNP or PBS from donor 2.

[0149] FIG. 35A shows the Kaplan Meier probability of survival curves for mice in the PC3- primeR antigen+ / CAR antigen+ tumor model treated with LG 1 ICT cells, CAR antigen CAR + DNR, RNP or PBS from donor 3. FIG. 35B shows the Kaplan Meier probability of survival curves for mice in the PC3- primeR antigen+ / CAR antigen+ tumor model treated with LG 1 ICT cells, CAR antigen CAR + DNR, RNP or PBS from donor 4. Mice treated with the LG 1 T cells showed the highest probability of survival.IPTS / 200259280.1 15Atorney Ref: ANB-228WODETAILED DESCRIPTIONDefinitions

[0150] Terms used in the claims and specification are defined as set forth below unless otherwise specified.

[0151] As used herein, the term “locus” refers to a specific, fixed physical location on a chromosome where a gene or genetic marker is located.

[0152] The term “safe harbor locus” refers to a locus at which genes or genetic elements can be incorporated without disruption to expression or regulation of adjacent genes. These safe harbor loci are also referred to as safe harbor sites (SHS) or genomic safe harbor (GSH) sites. As used herein, a safe harbor locus refers to an “integration site” or “knock-in site” at which a sequence encoding a transgene, as defined herein, can be inserted. In some embodiments the insertion occurs with replacement of a sequence that is located at the integration site. In some embodiments, the insertion occurs without replacement of a sequence at the integration site. Examples of integration sites contemplated are provided in Table D

[0153] As used herein, the term “insert” refers to a nucleotide sequence that is integrated (inserted) at a target locus or safe harbor site. The insert can be used to refer to the genes or genetic elements that are incorporated at the target locus or safe harbor site using, for example, homology-directed repair (HDR) CRISPR / Cas9 genome-editing or other methods for inserting nucleotide sequences into a genomic region known to those of ordinary skill in the art.

[0154] The term “inserting” refers to a manipulation of a nucleotide sequence to introduce a non-native sequence. This is done, for example, via the use of restriction enzymes and ligases whereby the DNA sequence of interest, usually encoding the gene of interest, can be incorporated into another nucleic acid molecule by digesting both molecules with appropriate restriction enzymes in order to create compatible overlaps and then using a ligase to join the molecules together. One skilled in the art is very familiar with such manipulations and examples may be found in Sambrook et al. (Sambrook, Fritsch, & Maniatis, “Molecular Cloning: A Laboratory Manual”, 2nd ed., Cold Spring Harbor Laboratory, 1989), which is hereby incorporated by reference in its entirety including any drawings, figures and tables.

[0155] The “CRISPR / Cas” system refers to a widespread class of bacterial systems for defense against foreign nucleic acid. CRISPR / Cas systems are found in a wide range of eubacterial and archaeal organisms. CRISPR / Cas systems include type I, II, and III sub-IPTS / 200259280.1 16Atorney Ref: ANB-228WOtypes. Wild-type type II CRISPR / Cas systems utilize an RNA-mediated nuclease, Cas9 in complex with guide and activating RNA to recognize and cleave foreign nucleic acid. Guide RNAs having the activity of both a guide RNA and an activating RNA are also known in the art. In some cases, such dual activity guide RNAs are referred to as a small guide RNA (sgRNA).

[0156] Cas9 homologs are found in a wide variety of eubacteria, including, but not limited to bacteria of the following taxonomic groups: Actinobacteria, Aquificae, Bacteroidetes-Ch lor obi, Chlamydiae-Verrucomicrobia, Chlroflexi, Cyanobacteria, Firmicutes, Proteobacteria, Spirochaetes, and Thermotogae. An exemplary Cas9 protein is the Streptococcus pyogenes Cas9 protein. Additional Cas9 proteins and homologs thereof are described in, e.g., Chylinksi, et al., RNA Biol. 2013 May 1; 10(5): 726-737 ; Nat. Rev.Microbiol. 2011 June; 9(6): 467-477; Hou, et al., Proc Natl Acad Sci U S A. 2013 Sep 24;110(39):15644-9; Sampson et al., Nature. 2013 May 9;497(7448):254-7; and Jinek, et al., Science. 2012 Aug 17;337(6096):816-21. The Cas9 nuclease domain can be optimized for efficient activity or enhanced stability in the host cell.

[0157] As used herein, the term “Cas9” refers to an RNA-mediated nuclease (e.g., of bacterial or archeal orgin, or derived therefrom). Exemplary RNA-mediated nuclases include the foregoing Cas9 proteins and homologs thereof, and include but are not limited to, CPF1 (See, e.g., Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015). Similarly, as used herein, the term “Cas9 ribonucleoprotein” complex and the like refers to a complex between the Cas9 protein, and a crRNA (e.g., guide RNA or small guide RNA), the Cas9 protein and a trans-activating crRNA (tracrRNA), the Cas9 protein and a small guide RNA, or a combination thereof (e.g., a complex containing the Cas9 protein, a tracrRNA, and a crRNA guide RNA).

[0158] As used herein, the phrase “immune cell” is inclusive of all cell types that can give rise to immune cells, including hematopoietic cells such hematopoietic stem cells, pluripotent stem cells, and induced pluripotent stem cells (iPSCs). In some embodiments, the immune cell is a B cell, macrophage, a natural killer (NK) cell, an induced pluripotent stem cell (iPSC), a human pluripotent stem cell (HSPC), a T cell or a T cell progenitor or dendritic cell. In some embodiments, the cell is an innate immune cell.

[0159] As used herein, the term “primary” in the context of a primary cell or primary stem cell refers to a cell that has not been transformed or immortalized. Such primary cells can be cultured, sub-cultured, or passaged a limited number of times (e.g., cultured 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 times). In some cases, the primary cells IPTS / 200259280.1 17Atorney Ref: ANB-228WOare adapted to in vitro culture conditions. In some cases, the primary cells are isolated from an organism, system, organ, or tissue, optionally sorted, and utilized, e.g., directly without culturing or sub-culturing. In some cases, the primary cells are stimulated, activated, or differentiated. For example, primary T cells can be activated by contact with (e.g., culturing in the presence of) CD3, CD28 agonists, IL-2, IFN-y, or a combination thereof.

[0160] As used herein, the terms “T lymphocyte” and “T cell” are used interchangeably and refer to cells that have completed maturation in the thymus, and identify certain foreign antigens in the body. The terms also refer to the major leukocyte types that have various roles in the immune system, including activation and deactivation of other immune cells. The T cell can be any T cell such as a cultured T cell, e.g., a primary T cell, or a T cell derived from a cultured T cell line, e.g., a Jurkat, SupTl, etc., or a T cell obtained from a mammal. T cells include, but are not limited to, naive T cells, stimulated T cells, primary T cells (e.g., uncultured), cultured T cells, immortalized T cells, helper T cells, cytotoxic T cells, memory T cells, regulatory T cells, natural killer T cells, combinations thereof, or sub-populations thereof. The T cell can be a CD3 + cell. T cells can be CD4+, CD8+, or CD4+and CD8+. The T cell can be any type of T cell, CD4 + / CD8 + double positive T cells, CD4 + helper T cells (e.g. Thl and Th2 cells), CD8 + T cells (e.g. cytotoxic T cells), peripheral Including but not limited to blood mononuclear cells (PBMC), peripheral blood leukocytes (PBL), tumor infiltrating lymphocytes (TIL), memory T cells, naive T cells, regulatory T cells, y6 T cells, etc. It can be any T cell at any stage of development. Additional types of helper T cells include Th3 (Treg) cells, Thl7 cells, Th9 cells, or Tfh cells. Additional types of memory T cells include cells such as central memory T cells (Tcm cells), effector memory T cells (Tern cells and TEMRA cells). A T cell can also refer to a genetically modified T cell, such as a T cell that has been modified to express a T cell receptor (TCR) or a chimeric antigen receptor (CAR). T cells can also be differentiated from stem cells or progenitor cells.

[0161] “ CD4 + T cells” refers to a subset of T cells that express CD4 on their surface and are associated with a cellular immune response. CD4 + T cells are characterized by a poststimulation secretion profile that can include secretion of cytokines such as IFN-y, TNF-a, IL-2, IL-4 and IL-10. “CD4” is a 55 kD glycoprotein originally defined as a differentiation antigen on T lymphocytes, but was also found on other cells including monocytes / macrophages. The CD4 antigen is a member of the immunoglobulin superfamily and has been implicated as an associative recognition element in MHC (major histocompatibility complex) class II restricted immune responses. On T lymphocytes, the CD4 antigen defines a helper / inducer subset.IPTS / 200259280.1 18Atorney Ref: ANB-228WO

[0162] “ CD8 + T cells” refers to a subset of T cells that express CD8 on their surface, are MHC class I restricted, and function as cytotoxic T cells. The “CD8” molecule is a differentiation antigen present on thymocytes, as well as on cytotoxic and suppressor T lymphocytes. The CD8 antigen is a member of the immunoglobulin superfamily and is an associative recognition element in major histocompatibility complex class I restriction interactions.

[0163] As used herein, the phrase “hematopoietic stem cell” refers to a type of stem cell that can give rise to a blood cell. Hematopoietic stem cells can give rise to cells of the myeloid or lymphoid lineages, or a combination thereof. Hematopoietic stem cells are predominantly found in the bone marrow, although they can be isolated from peripheral blood, or a fraction thereof. Various cell surface markers can be used to identify, sort, or purify hematopoietic stem cells. In some cases, hematopoietic stem cells are identified as c-kit+and lin'. In some cases, human hematopoietic stem cells are identified as CD34+, CD59+, Thyl / CD90+, CD3810', C-kit / CDl 17+, lin'. In some cases, human hematopoietic stem cells are identified as CD34', CD59+, Thyl / CD90+, CD38lo / ', C-kit / CDl 17+, lin'. In some cases, human hematopoietic stem cells are identified as CD133+, CD59+, Thyl / CD90+, CD38lo / ', C-kit / CDl 17+, lin'. In some cases, mouse hematopoietic stem cells are identified as CD34lo / ', SCA-1+, Thyl+ / 1°, CD38+, C-kit+, lin'. In some cases, the hematopoietic stem cells are CD150+CD48'CD244‘.

[0164] As used herein, the phrase “hematopoietic cell” refers to a cell derived from a hematopoietic stem cell. The hematopoietic cell may be obtained or provided by isolation from an organism, system, organ, or tissue (e.g., blood, or a fraction thereof). Alternatively, an hematopoietic stem cell can be isolated and the hematopoietic cell obtained or provided by differentiating the stem cell. Hematopoietic cells include cells with limited potential to differentiate into further cell types. Such hematopoietic cells include, but are not limited to, multipotent progenitor cells, lineage-restricted progenitor cells, common myeloid progenitor cells, granulocyte-macrophage progenitor cells, or megakaryocyte-erythroid progenitor cells. Hematopoietic cells include cells of the lymphoid and myeloid lineages, such as lymphocytes, erythrocytes, granulocytes, monocytes, and thrombocytes.

[0165] As used herein, the term “construct” refers to a complex of molecules, including macromolecules or polynucleotides.

[0166] As used herein, the term “integration” refers to the process of stably inserting one or more nucleotides of a construct into the cell genome, i.e., covalently linking to a nucleic acid sequence in the chromosomal DNA of the cell. It may also refer to nucleotide deletions at a IPTS / 200259280.1 19Atorney Ref: ANB-228WOsite of integration. Where there is a deletion at the insertion site, “integration” may further include substitution of the endogenous sequence or nucleotide deleted with one or more inserted nucleotides.

[0167] As used herein, the term “exogenous” refers to a molecule or activity that has been introduced into a host cell and is not native to that cell. The molecule can be introduced, for example, by introduction of the encoding nucleic acid into host genetic material, such as by integration into a host chromosome, or as non-chromosomal genetic material, such as a plasmid. Thus, the term, when used in connection with expression of an encoding nucleic acid, refers to the introduction of the encoding nucleic acid into a cell in an expressible form. The term “endogenous” refers to a molecule or activity that is present in a host cell under natural, unedited conditions. Similarly, the term, when used in connection with expression of the encoding nucleic acid, refers to expression of the encoding nucleic acid that is contained within the cell and not introduced exogenously.

[0168] The term “heterologous” refers to a nucleic acid or polypeptide sequence or domain which is not native to a flanking sequence, e.g., wherein the heterologous sequence is not found in nature coupled to the nucleic acid or polypeptide sequences occurring at one or both ends.

[0169] The term “homologous” refers to a nucleic acid or polypeptide sequence or domain which is native to a flanking sequence, e.g., wherein the homologous sequence is found in nature coupled to the nucleic acid or polypeptide sequences occurring at one or both ends.

[0170] As used herein, a “polynucleotide donor construct” refers to a nucleotide sequence (e.g. DNA sequence) that is genetically inserted into a polynucleotide and is exogenous to that polynucleotide. The polynucleotide donor construct is transcribed into RNA and optionally translated into a polypeptide. The polynucleotide donor construct can include prokaryotic sequences, cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic (e.g., mammalian) DNA, and synthetic DNA sequences. For example, the polynucleotide donor construct can be a miRNA, shRNA, natural polypeptide (i.e., a naturally occurring polypeptide) or fragment thereof or a variant polypeptide (e.g. a natural polypeptide having less than 100% sequence identity with the natural polypeptide) or fragments thereof.

[0171] As used herein, the term “complementary” or “complementarity” refers to specific base pairing between nucleotides or nucleic acids. Complementary nucleotides are, generally, A and T (or A and U), and G and C. The guide RNAs described herein can compriseIPTS / 200259280.1 20Atorney Ref: ANB-228WOsequences, for example, DNA targeting sequence that are perfectly complementary or substantially complementary (e.g., having 1-4 mismatches) to a genomic sequence in a cell.

[0172] As used herein, the term “transgene” refers to a polynucleotide that has been transferred naturally, or by any of a number of genetic engineering techniques from one organism to another. It is optionally translated into a polypeptide. It is optionally translated into a recombinant protein. A “recombinant protein” is a protein encoded by a gene — recombinant DNA — that has been cloned in a system that supports expression of the gene and translation of messenger RNA (see expression system). The recombinant protein can be a therapeutic agent, e.g. a protein that treats a disease or disorder disclosed herein. As used, transgene can refer to a polynucleotide that encodes a polypeptide.

[0173] The terms “protein,” “polypeptide,” and “peptide” are used herein interchangeably.

[0174] As used herein, the term “operably linked” or “operatively linked” refers to the binding of a nucleic acid sequence to a single nucleic acid fragment such that one function is affected by the other. For example, if a promoter is capable of affecting the expression of a coding sequence or functional RNA (i.e., the coding sequence or functional RNA is under transcriptional control by the promoter), the promoter is operably linked thereto. Coding sequences can be operably linked to control sequences in both sense and antisense orientation.

[0175] As used herein, the term “developmental cell states” refers to, for example, states when the cell is inactive, actively expressing, differentiating, senescent, etc. developmental cell state may also refer to a cell in a precursor state (e.g., a T cell precursor).

[0176] As used, the term “encoding” refers to a sequence of nucleic acids which codes for a protein or polypeptide of interest. The nucleic acid sequence may be either a molecule of DNA or RNA. In preferred embodiments, the molecule is a DNA molecule. In other preferred embodiments, the molecule is a RNA molecule. When present as a RNA molecule, it will comprise sequences which direct the ribosomes of the host cell to start translation (e.g., a start codon, ATG) and direct the ribosomes to end translation (e.g., a stop codon). Between the start codon and stop codon is an open reading frame (ORF). Such terms are known to one of ordinary skill in the art.

[0177] As used herein, the term “subject” refers to a mammalian subject. Exemplary subjects include humans, monkeys, dogs, cats, mice, rats, cows, horses, camels, goats, rabbits, pigs and sheep. In certain embodiments, the subject is a human. In some embodiments the subject has a disease or condition that can be treated with an engineered cell provided herein or population thereof. In some aspects, the disease or condition is a cancer.IPTS / 200259280.1 21Atorney Ref: ANB-228WO

[0178] As used herein, the term “promoter” refers to a nucleotide sequence (e.g. DNA sequence) capable of controlling the expression of a coding sequence or functional RNA. The promoter sequence consists of proximal and more distal upstream elements, the latter elements often referred to as enhancers. A promoter can be derived from natural genes in its entirety, can be composed of different elements from different promoters found in nature, and / or may comprise synthetic DNA segments. A promoter, as contemplated herein, can be endogenous to the cell of interest or exogenous to the cell of interest. It is appreciated by those skilled in the art that different promoters can induce gene expression in different tissue or cell types, or at different developmental stages, or in response to different environmental conditions. As is known in the art, a promoter can be selected according to the strength of the promoter and / or the conditions under which the promoter is active, e.g., constitutive promoter, strong promoter, weak promoter, inducible / repressible promoter, tissue specific Or developmentally regulated promoters, cell cycle-dependent promoters, and the like.

[0179] A promoter can be an inducible promoter (e.g., a heat shock promoter, tetracycline-regulated promoter, steroid-regulated promoter, metal-regulated promoter, estrogen receptor-regulated promoter, etc.). The promoter can be a constitutive promoter (e.g., CMV promoter, UBC promoter). In some embodiments, the promoter can be a spatially restricted and / or temporally restricted promoter (e.g., a tissue specific promoter, a cell type specific promoter, etc.). See for example US Publication 20180127786, the disclosure of which is herein incorporated by reference in its entirety.

[0180] Gene editing, as contemplated herein, may involve a gene (or nucleotide sequence) knock-in or knock-out. As used herein, the term “knock-in” refers to an addition of a DNA sequence, or fragment thereof into a genome. Such DNA sequences to be knocked-in may include an entire gene or genes, may include regulatory sequences associated with a gene or any portion or fragment of the foregoing. For example, a polynucleotide donor construct encoding a recombinant protein may be inserted into the genome of a cell carrying a mutant gene. In some embodiments, a knock-in strategy involves substitution of an existing sequence with the provided sequence, e.g., substitution of a mutant allele with a wild-type copy. On the other hand, the term “knock-out” refers to the elimination of a gene or the expression of a gene. For example, a gene can be knocked out by either a deletion or an addition of a nucleotide sequence that leads to a disruption of the reading frame. As another example, a gene may be knocked out by replacing a part of the gene with an irrelevant (.e.g., non-coding) sequence.IPTS / 200259280.1 22Atorney Ref: ANB-228WO

[0181] As used herein, the term “non-homologous end joining” or NHEJ refers to a cellular process in which cut or nicked ends of a DNA strand are directly ligated without the need for a homologous template nucleic acid. NHEJ can lead to the addition, the deletion, substitution, or a combination thereof, of one or more nucleotides at the repair site.

[0182] As used herein, the term “homology directed repair” or HDR refers to a cellular process in which cut or nicked ends of a DNA strand are repaired by polymerization from a homologous template nucleic acid. Thus, the original sequence is replaced with the sequence of the template. The homologous template nucleic acid can be provided by homologous sequences elsewhere in the genome (sister chromatids, homologous chromosomes, or repeated regions on the same or different chromosomes). Alternatively, an exogenous template nucleic acid can be introduced to obtain a specific HDR-induced change of the sequence at the target site. In this way, specific mutations can be introduced at the cut site.

[0183] As used herein, a single-stranded DNA template or a double-stranded DNA template refers to a DNA oligonucleotide that can be used by a cell as a template for HDR. Generally, the single-stranded DNA template or a double-stranded DNA template has at least one region of homology to a target site. In some cases, the single-stranded DNA template or doublestranded DNA template has two homologous regions flanking a region that contains a heterologous sequence to be inserted at a target cut site.

[0184] The terms “vector” and “plasmid” are used interchangeably and as used herein refer to polynucleotide vehicles useful to introduce genetic material into a cell. Vectors can be linear or circular. Vectors can integrate into a target genome of a host cell or replicate independently in a host cell. Vectors can comprise, for example, an origin of replication, a multicloning site, and / or a selectable marker. An expression vector typically comprises an expression cassette. Vectors and plasmids include, but are not limited to, integrating vectors, prokaryotic plasmids, eukaryotic plasmids, plant synthetic chromosomes, episomes, cosmids, and artificial chromosomes.

[0185] As used herein, the phrase “introducing” in the context of introducing a nucleic acid or a complex comprising a nucleic acid, for example, an RNP-DNA template complex, refers to the translocation of the nucleic acid sequence or the RNP-DNA template complex from outside a cell to inside the cell. In some cases, introducing refers to translocation of the nucleic acid or the complex from outside the cell to inside the nucleus of the cell. Various methods of such translocation are contemplated, including but not limited to, electroporation, contact with nanowires or nanotubes, receptor mediated internalization, translocation via cell penetrating peptides, liposome mediated translocation, and the like.IPTS / 200259280.1 23Atorney Ref: ANB-228WO

[0186] As used herein the term “expression cassette” is a polynucleotide construct, generated recombinantly or synthetically, comprising regulatory sequences operably linked to a selected polynucleotide to facilitate expression of the selected polynucleotide in a host cell. For example, the regulatory sequences can facilitate transcription of the selected polynucleotide in a host cell, or transcription and translation of the selected polynucleotide in a host cell. An expression cassette can, for example, be integrated in the genome of a host cell or be present in an expression vector.

[0187] As used herein, the phrase “subject in need thereof’ refers to a subject that exhibits and / or is diagnosed with one or more symptoms or signs of a disease or disorder as described herein.

[0188] A “chemotherapeutic agent” refers to a chemical compound useful in the treatment of cancer. Chemotherapeutic agents include “anti-hormonal agents” or “endocrine therapeutics” which act to regulate, reduce, block, or inhibit the effects of hormones that can promote the growth of cancer.

[0189] The term “composition” refers to a mixture that contains, e.g., an engineered cell or nucleic acid contemplated herein. In some embodiments, the composition may contain additional components, such as adjuvants, stabilizers, excipients, and the like. The term “composition” or “pharmaceutical composition” refers to a preparation which is in such form as to permit the biological activity of an active ingredient contained therein to be effective in treating a subject, and which contains no additional components which are unacceptably toxic to the subject in the amounts provided in the pharmaceutical composition.

[0190] The term “in situ” refers to processes that occur in a living cell growing separate from a living organism, e.g., growing in tissue culture.

[0191] The term “in vivo” refers to processes that occur in a living organism.

[0192] As used herein, the term “ex vivo” generally includes experiments or measurements made in or on living tissue, preferably in an artificial environment outside the organism, preferably with minimal differences from natural conditions.

[0193] The term “mammal” as used herein includes both humans and non-humans and include but is not limited to humans, non-human primates, canines, felines, murines, bovines, equines, and porcines.

[0194] The term percent "identity," in the context of two or more nucleic acid or polypeptide sequences, refer to two or more sequences or subsequences that have a specified percentage of nucleotides or amino acid residues that are the same, when compared and aligned for maximum correspondence, as measured using one of the sequence comparison IPTS / 200259280.1 24Atorney Ref: ANB-228WOalgorithms described below (e.g., BLASTP and BLASTN or other algorithms available to persons of skill) or by visual inspection. Depending on the application, the percent "identity" can exist over a region of the sequence being compared, e.g., over a functional domain, or, alternatively, exist over the full length of the two sequences to be compared.

[0195] For sequence comparison, typically one sequence acts as a reference sequence to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters.

[0196] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2:482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection (see generally Ausubel et al., infra).

[0197] One example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215:403-410 (1990). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (www.ncbi.nlm.nih.gov / ).

[0198] The term “sufficient amount” means an amount sufficient to produce a desired effect, e.g., an amount sufficient to modulate protein aggregation in a cell.

[0199] The term “therapeutically effective amount” is an amount that is effective to ameliorate a symptom of a disease.

[0200] The term “ameliorating” refers to any therapeutically beneficial result in the treatment of a disease state, e.g., a cancer disease state, lessening in the severity or progression, remission, or cure thereof.

[0201] As used herein, the term “effective amount” refers to the amount of a compound e.g., a compositions described herein, cells described herein) sufficient to effect beneficial or desired results. An effective amount can be administered in one or more administrations, applications or dosages and is not intended to be limited to a particular formulation or administration route.IPTS / 200259280.1 25Atorney Ref: ANB-228WO

[0202] As used herein, the term “treating” includes any effect, e.g., lessening, reducing, modulating, ameliorating or eliminating, that results in the improvement of the condition, disease, disorder, and the like, or ameliorating a symptom thereof.

[0203] The terms “modulate” and “modulation” refer to reducing or inhibiting or, alternatively, activating or increasing, a recited variable.

[0204] The terms “increase” and “activate” refer to an increase of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 2-fold, 3-fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater in a recited variable.

[0205] The terms “reduce” and “inhibit” refer to a decrease of 10%, 20%, 30%, 40%, 50%, 60%, 70%, 75%, 80%, 85%, 90%, 95%, 2-fold, 3 -fold, 4-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold, or greater in a recited variable.

[0206] It must be noted that, as used in the specification and the appended claims, the singular forms “a,” “an” and “the” include plural referents unless the context clearly dictates otherwise.Recombinant Nucleic Acid Compositions

[0207] Provided herein are nucleic acids with improved resistance to Fas-mediated apoptosis and to TGFP-driven downregulation of T cell activation when expressed in immune cells, particularly CAR-engineered primary T cells. Also provided inter alia are compositions, including pharmaceutical compositions, comprising immune cells containing such nucleic acids, methods of editing an immune cell to contain and express the nucleic acids, methods of treating a disease, e.g., cancer, or methods of enhancing an immune response by administering immune cells containing and expressing the nucleic acids.

[0208] Transforming Growth Factor Beta Receptor 2 (TGFBR2; HGNC: 11773, NCBI Entrez Gene: 7048, UniProtKB / Swiss-Prot: P37173) is a transmembrane serine / threonine protein kinase and forms a heterodimeric complex with TGF-beta receptor type-1 (TGFBR1) when bound to TGF-beta, resulting in transduction of the TGF-beta signal from the cell surface to the cytoplasm.

[0209] Fas Cell Surface Death Receptor (FAS, Tumor Necrosis Factor Receptor Superfamily, Member 6 TNFRSF6; HGNC: 11920, NCBI Entrez Gene: 355, UniProtKB / Swiss-Prot: P25445) FAS is an apoptosis-inducing TNF receptor superfamily member. FAS is involved in the physiological regulation of programmed cell death, and has been implicated in the pathogenesis of various malignancies and diseases of the immune systemIPTS / 200259280.1 26Atorney Ref: ANB-228WO

[0210] As used herein, “target gene” refers to a nucleic acid sequence in a cell, wherein the expression of the sequence may be specifically and effectively modulated using the recombinant nucleic acid molecules and methods described herein. In certain embodiments, the target gene may be implicated in the growth (proliferation), maintenance (survival), and / or immune behavior of an individual's immune cells.

[0211] In some embodiments, the target gene is Transforming Growth Factor Beta Receptor 2 (TGFBR2). In some embodiments, three or more nucleic acid molecules target the TFGBR2 gene and one or more nucleic acid molecules target the FAS gene. In some embodiments, two or more nucleic acid molecules target the TFGBR2 gene and two or more nucleic acid molecules target the FAS gene.

[0212] In some embodiments, expression of more than one target gene is modulated using a recombinant nucleic acid molecule and methods described herein. In some embodiments, at least two target gene are modulated using the recombinant nucleic acid molecules and methods described herein. In some embodiments, the at least two target genes are at least FAS and TGFBR2. In some embodiments, the recombinant nucleic acid molecule(s) is an shRNA.

[0213] In some embodiments, expression of additional target genes are modulated using a recombinant nucleic acid molecule and methods described herein. Exemplary additional target genes are Transforming Growth Factor Beta Receptor 1 (TGFBR1), Protein Tyrosine Phosphatase Non-Receptor Type 2 (PTPN2), or thymocyte selection associated high mobility group box (TOX). Exemplary nucleic acid molecules for modulation of TGFBR1, PTPN2, and TOX are provided in International Patent Application WO2024059618, hereby incorporated by reference in its entirety.

[0214] In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human Transforming Growth Factor Beta Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 1. In some embodiments, the recombinant nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length complementary to nucleotides 2215-2236, 4430-4451, or 3761-3782 of an mRNA encoding human Transforming Growth Factor Beta Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 1.

[0215] In some embodiments, the one or more nucleic acids further comprises at least an additional nucleic acid sequence at least 15 nucleotides in length, wherein the additional nucleic acid sequence comprises a nucleic acid sequence complementary to an mRNA encoding human Fas Cell Surface Death Receptor (FAS) comprising the sequence set forth in IPTS / 200259280.1 27Atorney Ref: ANB-228WOSEQ ID NO: 2. In some embodiments, the one or more nucleic acids further comprises at least an additional nucleic acid sequence at least 15 nucleotides in length, wherein the at least a third nucleic acid sequence comprises a nucleic acid sequence complementary to nucleotides 1126 to 1364 of an mRNA encoding human Fas Cell Surface Death Receptor (FAS) comprising the sequence set forth in SEQ ID NO: 2.

[0216] In one aspect, provided herein are nucleic acids comprising a nucleic acid sequence at least 15 nucleotides in length complementary to a nucleic acid encoding human Transforming Growth Factor Beta Receptor 2 (TGFBR2) (SEQ ID NO: 1), wherein the nucleic acid sequence at least 15 nucleotides in length is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a nucleic acid encoding human Transforming Growth Factor Beta Receptor 2 (TGFBR2) (SEQ ID NO: 1). In some embodiments, the nucleic acid comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 3-51. In some embodiments, the nucleic acid comprises at least two sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 3-51. In some embodiments, the nucleic acid comprises at least three sequence with at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 3-51. In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 18, 20, and / or 48. In some embodiments, the nucleic acid comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 18, 20, and / or 48. In some embodiments, the nucleic acid comprises four or more nucleic acid sequences comprising the sequences as set forth in SEQ ID NOs: 18, 20, 48, and 59. In some embodiments, the nucleic acid comprises four or more nucleic acid sequences comprising a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 18, 20, 48, and 59.

[0217] In some embodiments, the nucleic acid comprises a nucleic acid sequence at least 15 nucleotides in length complementary to a nucleic acid encoding human Fas Cell Surface Death Receptor (FAS) comprising the sequence set forth in SEQ ID NO: 2. In some embodiments, the nucleic acid sequence is complementary to nucleotides 1126 to 1364 of a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO: 2.IPTS / 200259280.1 28Atorney Ref: ANB-228WO

[0218] In one aspect, provided herein are nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO: 2, wherein the nucleic acid sequence at least 15 nucleotides in length is at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a nucleic acid encoding human FAS comprising the sequence set forth in SEQ ID NO: 2. In some embodiments, the nucleic acid comprises at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to a sequence as set forth in SEQ ID NO: 52-66. In some embodiments, the nucleic acid comprises a sequence as set forth in SEQ ID NO: 59. In some embodiments, the nucleic acid comprises a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 59.

[0219] In some embodiments, the nucleic acid comprises four or more nucleic acid sequences comprising the sequences as set forth in SEQ ID NOs: 18, 20, 48, and 59. In some embodiments, the nucleic acid comprises four or more nucleic acid sequences comprising a sequence at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to a sequence as set forth in SEQ ID NO: 18, 20, 48, and 59.

[0220] In some embodiments, the one or more nucleic acid(s) comprises four or more nucleic acid sequences at least 15 nucleotides (e.g., 15, 16, 17, 18, 19 or 20 nucleotides) of the sequences as set forth in SEQ ID NOs: 18, 20, 48, and 59.

[0221] In some embodiments, the one or more nucleic acid(s) four or more nucleic acid sequences at least 15 nucleotides (e.g., 15, 16, 17, 18, 19 or 20 nucleotides) of the sequences as set forth in SEQ ID NOs: 18, 48, 52, and 59.

[0222] In some embodiments, the one or more nucleic acid(s) comprise four or more nucleic acid sequences comprising the sequences as set forth in SEQ ID NOs: 18, 20, 48, and 59.

[0223] In some embodiments, the one or more nucleic acid(s) comprise four or more nucleic acid sequences comprising the sequences as set forth in SEQ ID NOs: 18, 48, 52, and 59.

[0224] In some embodiments, the one or more nucleic acids further comprises at least an additional nucleic acid sequence at least 15 nucleotides in length, wherein the additional nucleic acid sequence comprises a nucleic acid sequence complementary to an mRNA encoding human Transforming Growth Factor Beta Receptor 2 (TGFBR2) comprising the sequence set forth in SEQ ID NO: 1 and / or an mRNA encoding human Fas Cell Surface Death Receptor (FAS) comprising the sequence set forth in SEQ ID NO: 2.IPTS / 200259280.1 29Atorney Ref: ANB-228WO

[0225] In some embodiments, the additional nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 3-17, 19-47, 49-58, or 60-66. In some embodiments, the additional nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 3-17, 19-47, and 49-51. In some embodiments, the additional nucleic acid comprises a sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 52-58 and 60-66.

[0226] In some embodiments, the nucleic acid sequence is at least 16, 17, 18, 19, 20, 21, or 22 nucleotides in length. In some embodiments, the nucleic acid sequence complementary to FAS and / or TGFBR2 is no more than or up to 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 nucleotides in length.

[0227] In some embodiments, the nucleic acid is a an RNA interference (RNAi) molecule. Exemplary RNAi molecules include short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double stranded RNA (dsRNA), or an antisense oligonucleotide. In some embodiments, the nucleic acid is a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double stranded RNA (dsRNA), or an antisense oligonucleotide. In some embodiments, the nucleic acid is an shRNA.

[0228] Single-stranded hairpin ribonucleic acids (shRNAs) are short duplexes where the sense and antisense strands are linked by a hairpin loop. They consist of a stem-loop structure that can be transcribed in cells from an RNA polymerase II or RNA polymerase III promoter on a plasmid construct. Once expressed, shRNAs are processed into RNAi species.Expression of shRNA from a plasmid is known to be relatively stable, thereby providing strong advantages over, for example, the use of synthetic siRNAs. shRNA expression units may be incorporated into a variety of plasmids, liposomes, viral vectors, and other vehicles for delivery and integration into a target cell. Expression of shRNA from a plasmid can be stably integrated for constitutive expression. shRNAs are synthesized in the nucleus of cells, further processed and transported to the cytoplasm, and then incorporated into the RNA-induced silencing complex (RISC) for activity. The shRNAs are converted into active siRNA molecules (which are capable of binding to, sequestering, and / or preventing the translation of mRNA transcripts encoded by target genes).

[0229] The Argonaute family of proteins is the major component of RISC. Within the Argonaute family of proteins, only Ago2 contains endonuclease activity that is capable of cleaving and releasing the passenger strand from the stem portion of the shRNA molecule. The remaining three members of Argonaute family, Agol, Ago3 and Ago4, which do not IPTS / 200259280.1 30Atorney Ref: ANB-228WOhave identifiable endonuclease activity, are also assembled into RISC and are believed to function through a cleavage-independent manner. Thus, RISC can be characterized as having cleavage-dependent and cleavage-independent pathways.

[0230] RNAi (e.g., antisense RNA, siRNA, microRNA, shRNA, etc.) are described in International Publication Nos. WO2018232356A1, WO2019084552A1, WO2019226998 Al, W02020014235A1, WO2020123871A1, and WO2020186219A1, each of which is herein incorporated by reference for all purposes.

[0231] Antisense oligonucleotide structure and chemical modifications are described in International PCT Publication No.WO20 / 132521, which is hereby incorporated by reference.

[0232] dsRNA and shRNA molecules and methods of use and production are described in US Patent No. 8,829,264; US Patent No. 9,556,431; and US Patent No. 8,252,526, each of which are hereby incorporated by reference

[0233] siRNA molecules and methods of use and production are described in US Patent No. 7,361,752 and US Patent Application No. US20050048647, both of which are hereby incorporated by reference.

[0234] Additional methods and compositions for RNA interference such as shRNA, siRNA, dsRNA, and antisense oligonucleotides are generally known in the art, and are further described in US Patent No. 7,361,752; US Patent No. 8,829,264; US Patent No. 9,556,431; US Patent No. 8,252,526, International PCT Publication No. WOOO / 44895; International PCT Publication No. WOOl / 36646; International PCT Publication No. WO99 / 32619;International PCT Publication No. WO00 / 01846; International PCT Publication No.W001 / 29058; and International PCT Publication No. WOOO / 44914; International PCT Publication No. W004 / 030634; each of which are hereby incorporated by reference.

[0235] The nucleic acid sequences (or constructs) that may be used to encode the RNAi molecules, such as an shRNA described herein, may comprise a promoter, which is operably linked (or connected), directly or indirectly, to a sequence encoding the RNAi molecules. Such promoters may be selected based on the host cell and the effect sought. Non-limiting examples of suitable promoters include constitutive and inducible promoters, such as inducible RNA polymerase II (pol II)-based promoters. Non-limiting examples of suitable promoters further include the tetracycline inducible or repressible promoter, EFla, RNA polymerase I or Ill-based promoters, the pol II dependent viral promoters, such as the CMV-IE promoter, and the pol III U6 and Hl promoters. The bacteriophage T7 promoter may also be used (in which case it will be appreciated that the T7 polymerase must also be present). The nucleic acid sequences need not be restricted to the use of any single promoter, IPTS / 200259280.1 31Atorney Ref: ANB-228WOespecially since the nucleic acid sequences may comprise two or more shRNAs (i.e., a combination of effectors), including but not limited to incorporated shRNA molecules. Each incorporated promoter may control one, or any combination of, the shRNA molecule components.

[0236] In certain embodiments, the promoter may be preferentially active in the targeted cells, e.g., it may be desirable to preferentially express at least one recombinant nucleic acid in immune cells using an immune cell-specific promoter. Introduction of such constructs into host cells may be effected under conditions whereby the two or more recombinant nucleic acids that are contained within the recombinant nucleic acid precursor transcript initially reside within a single primary transcript, such that the separate RNA molecules (for example, shRNA each comprising its own stem-loop structure) are subsequently excised from such precursor transcript by an endogenous ribonuclease. The resulting mature recombinant nucleic acids (e.g., shRNAs) may then induce degradation, and / or translation repression, of target gene mRNA transcripts produced in the cell. Alternatively, each of the precursor stemloop structures may be produced as part of a separate transcript, in which caseeach recombinant nucleic acid sequence will preferably include its own promoter and transcription terminator sequences. Additionally, the multiple recombinant nucleic acid precursor transcripts may reside within a single primary transcript.

[0237] The stem-loop structures of the shRNA recombinant nucleic acids described herein may be about 40 to 100 nucleotides long or, preferably, about 50 to 75 nucleotides long. The stem region may be about 15-45 nucleotides in length (or more), or about 20-30 nucleotides in length. In some embodiments, the stem region is 20 nucleotides in length. In some embodiments, the stem region is 22 nucleotides in length. In some embodiments, the stem region is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 272829, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, or 45 nucleotides in length.

[0238] The stem may comprise a perfectly complementary duplex (but for any 3' tail), however, bulges or interior loops may be present on either arm of the stem. The number of such bulges and asymmetric interior loops are preferably few in number (e.g., 1, 2 or 3) and are about 3 nucleotides or less in size. The terminal loop portion may comprise about 4 or more nucleotides, but preferably not more than about 25. The loop portion will preferably be 6-15 nucleotides in size.

[0239] As described herein, the stem regions of the shRNAs comprise passenger strands and guide strands, whereby the guide strands contain sequences complementary to the target mRNA transcript encoded by the target gene(s). Preferably, the G-C content and matching of IPTS / 200259280.1 32Atorney Ref: ANB-228WOguide strand and passenger strand is carefully designed for thermodynamically-favorable strand unwind activity with or without endonuclease cleavage. Furthermore, the specificity of the guide strand is preferably confirmed via a BLAST search (ncbi.nim.nih.qov / BLAST).

[0240] In some embodiments, the nucleic acids are shRNA comprising a stem-loop structure comprising a guide sequence and a cognate passenger sequence. The guide sequence can be provided in the shRNA at either the 5’ end or the 3’ end of the shRNA. For example, in some embodiments, the guide sequence of the shRNA is located 5’ of the cognate passenger sequence. In other embodiments, the guide sequence is located 3’ of the cognate passenger sequence.

[0241] In some embodiments, the one or more nucleic acids comprises one or more shRNA, wherein the one or more shRNA comprise the guide sequence of any one or more (e.g., one, two, three, or four) of the guide sequences provided in SEQ ID NOs: 18, 20, 48, and / or 59, a loop region, and the cognate (e.g., complementary) passenger sequence corresponding to the guide sequence of any one or more (e.g., one, two, three, or four) of the guide sequences provided in SEQ ID NOs: 18, 20, 48, and / or 59. In some embodiments, the one or more nucleic acids comprises four or more shRNA comprising each of the guide sequences provided in SEQ ID NOs: 18, 20, 48, and 59, a loop region, and the cognate (e.g., complementary) passenger sequence corresponding to each of the guide sequences provided in SEQ ID NOs: 18, 20, 48, and / or 59.

[0242] The disclosure provides that the expression level of multiple target genes may be modulated using the methods and recombinant nucleic acids described herein. For example, the disclosure provides that a first set of recombinant nucleic acids may be designed to include a sequence (a guide strand) that is designed to reduce the expression level of a first target gene, whereas a second set of recombinant nucleic acids may be designed to include a sequence (a guide strand) that is designed to reduce the expression level of a second target gene. The different sets of recombinant nucleic acids may be expressed and reside within the same, or separate, preliminary transcripts. In certain embodiments, such multiplex approach, i.e., the use of the recombinant nucleic acids described herein to modulate the expression level of two or more target genes, may have an enhanced therapeutic effect on a patient. For example, if a patient is provided with cells expressing the recombinant nucleic acid molecules described herein to treat, prevent, or ameliorate the effects of cancer, it may be desirable to provide the patient with two or more types of recombinant nucleic acid molecules, which are designed to reduce the expression level of multiple genes that are implicated in activation or repression of immune cells.IPTS / 200259280.1 33Atorney Ref: ANB-228WO

[0243] The one or more recombinant nucleic acid molecule(s) described herein may be capable of reducing target gene expression in a cell by at least more than about 50% as compared to a control cell that does not comprise the recombinant nucleic acid molecule(s). For example, the recombinant nucleic acid molecule(s) (e.g., shRNA) can be capable of reducing expression of a target gene selected from the group consisting of TGFBR2 and / or FAS in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or more as compared to a control cell that does not comprise the respective recombinant nucleic acid molecule(s). The one or more recombinant nucleic acid molecule(s) can be capable of reducing expression of a target gene selected from the group consisting of TGFBR2 and / or FAS in the cell by at least between about 10-50%, 10-20%, 10-30%, 10-40%, 20-50%, 30-50%, 40-50%, 10-100%, 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55%, or as compared to a control cell that does not comprise the respective recombinant nucleic acid molecule(s). In some embodiments, the one or more recombinant nucleic acid molecule(s)reduces expression of TGFBR2 in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the recombinant nucleic acid molecule(s). In some embodiments, the one or more recombinant nucleic acid molecule(s) reduces expression of FAS in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the recombinant nucleic acid molecule(s).

[0244] The recombinant nucleic acid molecule(s) may be chemically synthesized, or in vitro transcribed, and may further include one or more modifications to phosphate-sugar backbone or nucleosides residues.

[0245] Other methods known in the art for introducing nucleic acids to cells may be used, such as lipid-mediated carrier transport, chemical mediated transport, such as calcium phosphate, and the like. Thus, the recombinant nucleic acid molecule(s) construct may be introduced along with components that perform one or more of the following activities: enhance RNA uptake by the cell, promote annealing of the duplex strands for shRNA, stabilize the annealed shRNA strands, or otherwise increase inhibition of the target gene.

[0246] In some embodiments, the one or more recombinant nucleic acid(s) further comprises a 5’ homology directed repair arm and / or a 3’ homology directed repair arm complementary to an insertion site in a host cell chromosome. In some embodiments, the one or more recombinant nucleic acid(s) comprises the 5’ homology directed repair arm and the IPTS / 200259280.1 34Atorney Ref: ANB-228WO3’ homology directed repair arm. In some embodiments, the one or more recombinant nucleic acid(s) is incorporated into an expression cassette or an expression vector. In some embodiments, the expression cassette or the expression vector further comprises a constitutive promoter upstream of the one or more recombinant nucleic acid(s).

[0247] In some embodiments, the one or more recombinant nucleic acid(s) comprises at least a first nucleic acid and at least a second nucleic acid. In some embodiments, the one or more recombinant nucleic acid(s) further comprises at least a third nucleic acid and at least a fourth nucleic acid. The first, second, third, and / or fourth nucleic acids can be RNAi molecules, such as shRNA. In some embodiments, the first nucleic acid and the second nucleic acid are incorporated into a single expression cassette or a single expression vector. In some embodiments, the third nucleic acid and the fourth nucleic acid are incorporated into a single expression cassette or a single expression vector. In some embodiments, the first, second, third, and fourth nucleic acid are incorporated into a single expression cassette or a single expression vector. In some embodiments, the expression cassette or the expression vector further comprises a constitutive promoter upstream of the first nucleic acid and / or upstream of the second nucleic acid. In some embodiments, the expression cassette or the expression vector further comprises a constitutive promoter upstream of the third nucleic acid and / or upstream of the fourth nucleic acid. In some embodiments, the expression cassette or the expression vector further comprises a constitutive promoter upstream of the first nucleic acid, upstream of the second nucleic acid, upstream of the third nucleic acid, and / or upstream of the fourth nucleic acid. In some embodiments, the expression vector is a non-viral vector. In some embodiments, the expression cassette comprises as sequence as set forth in SEQ ID NOs: 81-83, 85-87, or 71-79.

[0248] In some embodiments the shRNA module is a dual shRNA module. In some embodiments the shRNA module comprises, from 5’ to 3’, (1) a 5’ backbone of a first miR (e.g., a miR-3G 5’ backbone), (2) a first strand of a first shRNA, (3) a loop of the first miR (e.g., a miR-3G loop), (4) a second strand of the first shRNA, (5) a 3’ backbone of the first miR (e.g., a miR-3G 3’ backbone), (6) a first spacer, (7) a 5’ backbone of a second miR (e.g., a miR-E 5’ backbone), (8) a first strand of a second shRNA, (9) a loop of the second miR (e.g., a miR-E loop), (10) a second strand of the second shRNA, (11) a 3’ backbone of the second miR (e.g., a miR-E 3’ backbone), (12) a second spacer, and (13) a PPT sequence. In some embodiments, the first and second miRs are identical. In some embodiments, the first miRs is miR-3G and the second miR is miR-E (“3G-E format”). In some embodiments, the first and second miRs are distinct.IPTS / 200259280.1 35Atorney Ref: ANB-228WO

[0249] In some embodiments the shRNA module is a triple shRNA module. In some embodiments the shRNA module comprises, from 5’ to 3’, (1) a 5’ backbone of a first miR (e.g., a miR-3G 5’ backbone), (2) a first strand of a first shRNA, (3) a loop of the first miR (e.g., a miR-3G loop), (4) a second strand of the first shRNA, (5) a 3’ backbone of the first miR (e.g., a miR-3G 3’ backbone), (6) a first spacer, (7) a 5’ backbone of a second miR (e.g., a miR-E 5’ backbone), (8) a first strand of a second shRNA, (9) a loop of the second miR (e.g., a miR-E loop), (10) a second strand of the second shRNA, (11) a 3’ backbone of the second miR (e.g., a miR-E 3’ backbone), (12) a second spacer, (13) a 5’ backbone of a third miR (e.g., a miR-3G 5’ backbone), (14) a first strand of a third shRNA, (15) a loop of the third miR (e.g., a miR-3G loop), (16) a second strand of the third shRNA, (17) a 3’ backbone of the third miR (e.g., a miR-3G 3’ backbone), and (18) a PPT sequence. In some embodiments, the first, second, and third miRs are identical. In some embodiments, the first, second, and third miRs are all distinct. In some embodiments, the first and second miRs are identical and the third miR is distinct. In some embodiments, the first and third miRs are identical and the second miR is distinct. In some embodiments, the second and third miRs are identical and the first miR is distinct. In some embodiments, the first and third miRs are miR-3G and the second miR is miR-E (“3G-E-3G format”). In some embodiments, the first, second, and third miRs are all miR-3G (“3G-3G-3G format”).

[0250] In some embodiments the shRNA module is a quadruple shRNA module. In some embodiments the shRNA module comprises, from 5’ to 3’, (1) a 5’ backbone of a first miR (e.g., a miR-3G 5’ backbone), (2) a first strand of a first shRNA, (3) a loop of the first miR (e.g., a miR-3G loop), (4) a second strand of the first shRNA, (5) a 3’ backbone of the first miR (e.g., a miR-3G 3’ backbone), (6) a first spacer, (7) a 5’ backbone of a second miR (e.g., a miR-E 5’ backbone), (8) a first strand of a second shRNA, (9) a loop of the second miR (e.g., a miR-E loop), (10) a second strand of the second shRNA, (11) a 3’ backbone of the second miR (e.g., a miR-E 3’ backbone), (12) a second spacer, (13) a 5’ backbone of a third miR (e.g., a miR-3G 5’ backbone), (14) a first strand of a third shRNA, (15) a loop of the third miR (e.g., a miR-3G loop), (16) a second strand of the third shRNA, (17) a 3’ backbone of the third miR (e.g., a miR-3G 3’ backbone), (18) a third spacer, (19) a 5’ backbone of a fourth miR (e.g., a miR-3G 5’ backbone), (20) a first strand of a fourth shRNA, (21) a loop of the fourth miR (e.g., a miR-3G loop), (22) a second strand of the fourth shRNA, (23) a 3’ backbone of the fourth miR (e.g., a miR-3G 3’ backbone), (24) a PPT sequence. In some embodiments, the first, second, third, and fourth miRs are identical. In some embodiments, the first, second, third, and fourth miRs are all distinct. In some embodiments, a first group of IPTS / 200259280.1 36Atorney Ref: ANB-228WOtwo miRs are identical and a second group of two miRs are identical but distinct from the first group. In some embodiments, a first group of two miRs are identical and the remaining two miRs are each distinct from the first group and each other. In some embodiments, three of the miRs are identical and the last miR is distinct. In some embodiments, the first, third, and fourth miRs are miR-3G and the second miR is miR-E (“3G-E-3G-3G format”). In some embodiments, the first, second, and fourth miRs are miR-3G and the third miR is miR-E (“3G-3G-E-3G format”). In some embodiments, the second, third, and fourth miRs are miR-3G and the first miR is miR-E (“E-3G-3G-3G format”). In some embodiments, the first, second, and third miRs are miR-3G and the fourth miR is miR-E (“3G-3G-3G-E format”).

[0251] In some embodiments, the expression cassette is a quadruple shRNA expression cassette. In some embodiments, the quadruple expression cassette comprises, from 5’ to 3’, (1) a promoter (e.g., an EFla promoter, e.g., SEQ ID NO: 69), (2) a 5’ backbone of a first miR (e.g., a miR-3G 5’ backbone), (3) a first strand of a first shRNA, (4) a loop of the first miR (e.g., a miR-3G loop), (5) a second strand of the first shRNA, (6) a 3’ backbone of the first miR (e.g., a miR-3G 3’ backbone), (7) a first spacer, (8) a 5’ backbone of a second miR (e.g., a miR-E 5’ backbone), (9) a first strand of a second shRNA, (10) a loop of the second miR (e.g., a miR-E loop), (11) a second strand of the second shRNA, (12) a 3’ backbone of the second miR (e.g., a miR-E 3’ backbone), (13) a second spacer, (14) a 5’ backbone of a third miR (e.g., a miR-3G 5’ backbone), (15) a first strand of a third shRNA, (16) a loop of the third miR (e.g., a miR-3G loop), (17) a second strand of the third shRNA, (18) a 3’ backbone of the third miR (e.g., a miR-3G 3’ backbone), (19) a third spacer, (20) a 5’ backbone of a fourth miR (e.g., a miR-3G 5’ backbone), (21) a first strand of a fourth shRNA, (22) a loop of the fourth miR (e.g., a miR-3G loop), (23) a second strand of the fourth shRNA, (24) a 3’ backbone of the fourth miR (e.g., a miR-3G 3’ backbone), (25) a PPT sequence, (26) a 5’ untranslated region (UTR), (27) an optional transgene (e.g., a chimeric antigen receptor), and (28) a polyadenylation (poly A) sequence (e.g., a human growth hormone (GH1) polyA sequence, e.g., SEQ ID NO: 70). In some embodiments, the first, second, third, and fourth miRs are identical (e.g., are all miR-3G or miR-E). In some embodiments, the first, second, third, and fourth miRs are all distinct (e.g., are a mixture of miR-3G and miR-e). In some embodiments, a first group of two miRs are identical and a second group of two miRs are identical but distinct from the first group. In some embodiments, a first group of two miRs are identical and the remaining two miRs are each distinct from the first group and each other. In some embodiments, three of the miRs are identical and the last miR is distinct. In some embodiments, the first, third, and fourth miRs IPTS / 200259280.1 37Atorney Ref: ANB-228WOare miR-3G and the second miR is miR-E (“3G-E-3G-3G format”). In some embodiments, the microRNA (miR) backbone comprises miR-E, miR-3G, or a miR-3G:miR-E:miR-3G:miR-3G architecture. In some embodiments, the quadruple expression cassette comprises the nucleic acid sequence set forth in SEQ ID NO: 80 or 84, or a nucleic acid having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity thereto. An exemplary quadruple shRNA expression cassette is shown in FIGs. 24 and 25.

[0252] In some embodiments, the quadruple expression cassette comprises four or more shRNA each comprising a guide sequence and a cognate passenger sequence, wherein each shRNA comprises, in a 5’ to 3’ direction, the passenger sequence and the guide sequence. In some embodiments, the quadruple expression cassette comprises four or more shRNA each comprising a guide sequence and a cognate passenger sequence, wherein each shRNA comprises, in a 5’ to 3’ direction, the guide sequence and the passenger sequence.

[0253] In some embodiments, the quadruple expression cassette comprises four or more shRNA each comprising a guide sequence and a cognate passenger sequence, wherein the orientation of the guide and passenger sequences are the same in each of the four or more nucleic acids. In some embodiments, the quadruple expression cassette comprises four or more shRNA each comprising a guide sequence and a cognate passenger sequence, wherein the orientation of the guide and passenger sequences are distinct in each of the four or more nucleic acids.

[0254] For example, the four or more nucleic acid sequences can each comprise an shRNA (SI, S2, S3, and S4), wherein SI comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence or the passenger sequence and the guide sequence, S2 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence or the passenger sequence and the guide sequence, S3 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence or the passenger sequence and the guide sequence, and S4 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence or the passenger sequence and the guide sequence.

[0255] In another example, the four or more nucleic acid sequences can each comprise an shRNA (SI, S2, S3, and S4), wherein SI comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence, S2 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence, S3 comprises in a 5’ to 3’ direction, the guide sequence and theIPTS / 200259280.1 38Atorney Ref: ANB-228WOpassenger sequence, and S4 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence.

[0256] In another example, the four or more nucleic acid sequences can each comprise an shRNA (SI, S2, S3, and S4), wherein SI comprises in a 5’ to 3’ direction, the passenger sequence and the guide sequence, S2 comprises in a 5’ to 3’ direction, the passenger sequence and the guide sequence, S3 comprises in a 5’ to 3’ direction, the passenger sequence and the guide sequence, and S4 comprises in a 5’ to 3’ direction, the passenger sequence and the guide sequence.

[0257] In another example, the four or more nucleic acid sequences can each comprise an shRNA (SI, S2, S3, and S4), wherein SI comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence, S2 comprises in a 5’ to 3’ direction, the passenger sequence and the guide sequence, S3 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence, and S4 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence.

[0258] In another example, the four or more nucleic acid sequences can each comprise an shRNA (SI, S2, S3, and S4), wherein SI comprises in a 5’ to 3’ direction, the passenger sequence and the guide sequence, S2 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence, S3 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence, and S4 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence.

[0259] In another example, the four or more nucleic acid sequences can each comprise an shRNA (SI, S2, S3, and S4), wherein SI comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence, S2 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence, S3 comprises in a 5’ to 3’ direction, the passenger sequence and the guide sequence, and S4 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence.

[0260] In another example, the four or more nucleic acid sequences can each comprise an shRNA (SI, S2, S3, and S4), wherein SI comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence, S2 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence, S3 comprises in a 5’ to 3’ direction, the guide sequence and the passenger sequence, and S4 comprises in a 5’ to 3’ direction, the passenger sequence and the guide sequence.

[0261] In some embodiments, the one or more nucleic acids comprises four or more shRNA wherein the four or more nucleic acid sequences each comprise an shRNA each IPTS / 200259280.1 39Atorney Ref: ANB-228WOcomprising a guide sequence and a cognate passenger sequence, wherein each shRNA comprises, in a 5’ to 3’ direction, the guide sequence as set forth in SEQ ID NOs: 18, 48, and 59 and each corresponding cognate passenger sequence; and the cognate passenger sequence corresponding to the guide sequence set forth in SEQ ID NO: 20 and the guide sequence as set forth in SEQ ID NO: 20.

[0262] In some embodiments, the one or more nucleic acids comprises four or more shRNA wherein the four or more nucleic acid sequences each comprise an shRNA each comprising a guide sequence and a cognate passenger sequence, wherein each shRNA comprises, in a 5’ to 3’ direction, the guide sequence as set forth in SEQ ID NOs: 18, 48, and 59 and each corresponding cognate passenger sequence; and the cognate passenger sequence corresponding to the guide sequence set forth in SEQ ID NO: 52 and the guide sequence as set forth in SEQ ID NO: 52.

[0263] In some embodiments, the four or more nucleic acid sequences each comprise an shRNA (SI, S2, S3, and S4) each comprising a guide sequence and a cognate passenger sequence, wherein SEQ ID NOs: 18, 20, 48, and 59 are the guide sequences of SI, S2, S3, and S4, respectively, and wherein the guide sequences of SI, S3, and S4 are located 5’ of the cognate passenger sequence, and the guide sequence of S2 is located 3’ of the cognate passenger sequence.

[0264] In some embodiments, the four or more nucleic acid sequences each comprise an shRNA (SI, S2, S3, and S4) each comprising a guide sequence and a cognate passenger sequence, wherein SEQ ID NOs: 18, 48, 52, and 59 are the guide sequences of SI, S2, S3, and S4, respectively, and wherein the guide sequences of SI, S3, and S4 are located 5’ of the cognate passenger sequence, and the guide sequence of S2 is located 3’ of the cognate passenger sequence.

[0265] In some embodiments, the one or more nucleic acids comprise, in a 5’ to 3’ direction, SEQ ID NO: 59, SEQ ID NO: 20, SEQ ID NO: 48, and SEQ ID NO: 18.

[0266] In some embodiments, the four or more nucleic acid sequences comprise the sequences as set forth in SEQ ID NOs: 18, 20, 48, and 59, and a microRNA backbone comprising a miR-3G:miR-E:miR-3G:miR-3G architecture.

[0267] In some embodiments, the four or more nucleic acid sequences comprise the sequences as set forth in SEQ ID NOs: 18, 48, 52, and 59, and a microRNA backbone comprising a miR-3G:miR-E:miR-3G:miR-3G architecture.

[0268] In some embodiments, the one or more nucleic acids comprise, in a 5’ to 3’ direction, SEQ ID NO: 59, SEQ ID NO: 52, SEQ ID NO: 48, and SEQ ID NO: 18.IPTS / 200259280.1 40Atorney Ref: ANB-228WO

[0269] In some embodiments, the quadruple expression cassette comprises the nucleic acid sequence set forth in SEQ ID NO: 80 or 84, or a nucleic acid having at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5%, or at least 99.9% sequence identity thereto. An exemplary quadruple shRNA expression cassette is shown in FIGs. 24 and 25 and SEQ ID NOs: 80 and 84.Recombinant Cells

[0270] Also provided herein is a recombinant cell, such as primary sell or an immune cell, comprising at least one recombinant nucleic acid(s) non-virally inserted into a target region of the genome of the cell.

[0271] In one aspect, provided herein are immune cells comprising one or more recombinant nucleic acids at least 15 nucleotides in length complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO: 1.

[0272] In one aspect, provided herein are immune cells comprising one or more recombinant nucleic acids comprising: a first nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human TGFBR2 comprising the sequence set forth in SEQ ID NO: 1, and a second nucleic acid sequence at least 15 nucleotides in length complementary to an mRNA encoding human FAS comprising the sequence set forth in SEQ ID NO: 2.

[0273] In some embodiments, the cell is a primary immune cell. In some embodiments, the cell is a viable, virus-free, primary cell.

[0274] In some embodiments, the expression of the gene targeted (e.g., TGFBR2 and / or FAS) by the recombinant nucleic acid molecule(s) is reduced or decreased in the target cell. The target gene expression can be reduced by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or more. The target gene expression can be reduced by between about 10-50%, 10-20%, 10-30%, 10-40%, 20-50%, 30-50%, 40-50%, 10-100%, 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55%, or as compared to a control cell that does not comprise the recombinant nucleic acid molecule(s).

[0275] A cell comprising a recombinant nucleic acid molecule(s) insert at a target locus or safe harbor site as described in the present disclosure can be referred to as an engineered cell. In some embodiments, the engineered cell is an immune cell. In some embodiments, the immune cell is any cell that can give rise to a pluripotent immune cell. In some embodiments,IPTS / 200259280.1 41Atorney Ref: ANB-228WOthe immune cell can be an induced pluripotent stem cell (iPSC) or a human pluripotent stem cell (HSPC). In some embodiments, the immune cell comprises primary hematopoietic cells or primary hematopoietic stem cells. In some embodiments, that engineered cell is a stem cell, a human cell, a primary cell, an hematopoietic cell, an adaptive immune cell, an innate immune cell, a natural killer (NK) cell, a T cell, a CD8+ cell, a CD4+ cell, or a T cell progenitor. In some embodiments, the immune cells are T cells. In some embodiments, the T cells are regulatory T cells, effector T cells, or naive T cells. In some embodiments, the T cells are CD8+T cells. In some embodiments, the T cells are CD4+T cells. In some embodiments, the T cells are CD4+CD8+T cells.

[0276] In some embodiments, the engineered cell is a stem cell, a human cell, a primary cell, an hematopoietic cell, an adaptive immune cell, an innate immune cell, a T cell or a T cell progenitor. Non-limiting examples of immune cells that are contemplated in the present disclosure include T cell, B cell, natural killer (NK) cell, NKT / iNKT cell, macrophage, myeloid cell, and dendritic cells. Non-limiting examples of stem cells that are contemplated in the present disclosure include pluripotent stem cells (PSCs), embryonic stem cells (ESCs), induced pluripotent stem cells (iPSCs), embryo-derived embryonic stem cells obtained by nuclear transfer (ntES; nuclear transfer ES), male germline stem cells (GS cells), embryonic germ cells (EG cells), hematopoietic stem / progenitor stem cells (HSPCs), somatic stem cells (adult stem cells), hemangioblasts, neural stem cells, mesenchymal stem cells and stem cells of other cells (including osteocyte, chondrocyte, myocyte, cardiac myocyte, neuron, tendon cell, adipocyte, pancreocyte, hepatocyte, nephrocyte and follicle cells and so on). In some embodiments, the engineered cells is a T cell, NK cells, iPSC, and HSPC. In some embodiments, the engineered cells used in the present disclosure are human cell lines grown in vitro (e.g. deliberately immortalized cell lines, cancer cell lines, efc.).

[0277] In some embodiments, the immune cell is an autologous immune cell. In some embodiments, the immune cell is an allogeneic immune cell.

[0278] Also provided herein are populations of cells comprising a plurality of the engineered cells. In some embodiments, the genome of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or greater of the cells comprises at least one recombinant nucleic acid molecule(s). In some embodiments, the genome of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or greater of the cells comprises at least two shRNA molecules. In some embodiments, the genome of at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 99% or greater of the cells comprises at least three, four, five, six, seven, eight, nine, ten or more recombinant nucleic acid molecule(s).IPTS / 200259280.1 42Atorney Ref: ANB-228WO

[0279] Also provided herein are populations of cells comprising the recombinant nucleic acid(s).

[0280] The cell can further comprise chimeric proteins such as chimeric antigen receptors (CAR) or priming receptors. In some embodiments, the cell comprises at least one chimeric antigen receptor. In some embodiments, the cell comprises at least one priming receptor. In some embodiments, the cell comprises at least one chimeric antigen receptor and at least one priming receptor. The at least one recombinant nucleic acid molecule(s) encoding at least one RNAi molecule can encoded on the same DNA template or nucleic acid fragment as the at least one RNAi molecule(s) or on a different DNA template or nucleic acid fragment as the RNAi molecule(s). In the case that the CAR, priming receptor, and RNAi recombinant nucleic acid molecule(s) are encoded on the same DNA template or nucleic acid fragment, the various components can be placed in any order on the DNA template. For example, the DNA template may comprise, in a 5’ to 3’ direction: the CAR, the at least one RNAi recombinant nucleic acid, and the priming receptor. Alternatively, the DNA template may comprise, in a 5’ to 3’ direction: i) the priming receptor, the at least one RNAi recombinant nucleic acid, and the CAR; ii) the at least one RNAi recombinant nucleic acid, the priming receptor, and the CAR; iii) the at least one RNAi recombinant nucleic acid, the CAR, and the priming receptor; iv) the priming receptor, the CAR, and the at least one RNAi recombinant nucleic acid; v) the CAR, the priming receptor, and the at least one RNAi recombinant nucleic acid; vi) the at least one RNAi recombinant nucleic acid, the priming receptor, the CAR; vii) the at least one RNAi recombinant nucleic acid, the CAR, and the priming receptor. In some embodiments, the at least one RNAi recombinant nucleic acid comprises two recombinant nucleic acids. In some embodiments, the recombinant nucleic acid comprises a nucleic acid that is complementary to TGFBR2. In some embodiments, the recombinant nucleic acid comprises a nucleic acid that is complementary to FAS.

[0281] In some embodiments, the priming receptor comprises a first extracellular antigenbinding domain that specifically binds to a first antigen and the chimeric antigen receptor (CAR) comprises a second extracellular antigen-binding domain that specifically binds to a second antigen.Methods of Reducing Gene Expression

[0282] Another aspect disclosed herein provides a method for attenuating expression of a target gene in mammalian cells, comprising introducing into the mammalian cells a recombinant nucleic acid complementary to the target gene mRNA, such as a single-strandedIPTS / 200259280.1 43Atorney Ref: ANB-228WOhairpin ribonucleic acid (shRNA), siRNA, dsRNA, or antisense oligonucleotide. In some embodiments, the recombinant nucleic acid complementary to the target gene mRNA is an shRNA. In some embodiments, the shRNA comprises self-complementary sequences of 19 to 100 nucleotides that form a duplex region, which self-complementary sequences hybridize under intracellular conditions to a target gene mRNA transcript. In some embodiments, the shRNA comprises self-complementary sequences of 22 nt. In some embodiments, the shRNA: (i) is a substrate for cleavage by a RNaselll enzyme to produce a double-stranded RNA product, (ii) does not produce a general sequence-independent killing of the mammalian cells, and (iii) reduces expression of said target gene in a manner dependent on the sequence of said complementary regions.

[0283] In some embodiments, the target gene is TGFBR2. In some embodiments, the target gene is human TGFBR2. In some embodiments, the target gene is FAS. In some embodiments, the target gene is human FAS

[0284] The cell comprising the recombinant nucleic acid can have reduced or decreased expression of a target gene selected from FAS and / or TGFBR2. In some embodiments, the cell has reduced FAS and / or TGFBR2 expression of between about 50-100%, 50-99%, 50-95%, 50-90%, 50-85%, 50-80%, 50-75%, 50-70%, 50-65%, 50-60%, 50-55%, as compared to a control cell that does not comprise the respective nucleic acid molecule(s). In some embodiments, the cell has reduced FAS expression in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the nucleic acid molecule(s). In some embodiments, the cell has reduced TGFBR2 expression in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the nucleic acid molecule(s). In some embodiments, the cell has reduced FAS and TGFBR2 expression in the immune cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% each, as compared to a control cell that does not comprise the respective recombinant nucleic acid molecule(s).

[0285] In some embodiments, expression of TGFBR2 in the cell is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the nucleic acid. In some embodiments, the second nucleic acid reduces expression of FAS in the cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the nucleic acid. In some IPTS / 200259280.1 44Atorney Ref: ANB-228WOembodiments, expression of TGFBR2 and FAS in the cell are reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the nucleic acid.

[0286] In some embodiments, the nucleic acid reduces expression of Fas Cell Surface Death Receptor (FAS) in a cell by at least about 1.1-fold, 1.2-fold, 1.25-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, or 2-fold as much as compared to a control cell that comprises a nucleic acid comprising only the sequences as set forth in SEQ IDNOs: 18, 48, and 59.

[0287] In some embodiments, the nucleic acid reduces phosphorylation of SMAD 2 and / or SMAD 3 (SMAD2 / 3) in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.

[0288] In some embodiments, the nucleic acid reduces phosphorylation of SMAD 2 and / or SMAD 3 (SMAD2 / 3) in a cell by at least about 1.1-fold, 1.2-fold, 1.25-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, or 2-fold as much as compared to a control cell that comprises a nucleic acid comprising only the sequences as set forth in SEQ IDNOs: 18, 48, and 59.

[0289] In some embodiments, expression of TGFBR2 and / or FAS, is determined by a nucleic acid assay or a protein assay. In some embodiments, the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.Method of Treating Cancer

[0290] In another aspect, the disclosure herein provides methods of treating an immune-related condition or disease (e.g., cancer) in an individual comprising administering to the individual an effective amount of a composition comprising a cell comprising at least one recombinant nucleic acid that comprises a nucleic acid sequence at least 15 nucleotides in length complementary to a target selected from the group consisting of FAS and / or TGFBR2.

[0291] In some embodiments, the recombinant nucleic acid is an shRNA molecule. In some embodiments, the shRNA is a FAS shRNA molecule or a TGFBR2 shRNA. In some embodiments, the cell comprises at least one TGFBR2 shRNA molecule. In some embodiments, the cell comprises at least two TGFBR2 shRNA molecules. In some embodiments, the cell comprises at least three TGFBR2 shRNA molecules. In someIPTS / 200259280.1 45Atorney Ref: ANB-228WOembodiments, the cell comprises at least three TGFBR2 shRNA molecule and a FAS shRNA molecule.

[0292] In another aspect, the disclosure herein provides methods of enhancing an immune response in an individual comprising administering to the individual an effective amount of a composition comprising a cell comprising at least one shRNA molecule, wherein the shRNA molecule is selected from the group consisting of at least one TGFBR2 shRNA molecule and at least one a FAS shRNA molecule.

[0293] In some embodiments, the methods of treating an individual or of enhancing an immune response in the individual comprise further administering to the individual an effective amount of a composition comprising a cell comprising at least one recombinant nucleic acid that comprises a nucleic acid sequence at least 15 nucleotides in length complementary to a target selected from the group consisting of FAS and / or TGFRB2.

[0294] In some embodiments, the recombinant nucleic acid is an shRNA molecule.

[0295] In some embodiments, the shRNA is selected from the group consisting of a FAS shRNA molecule anda TGFRB2 shRNA molecule. In some embodiments, the cell comprises at least three TGFBR2 shRNA molecules, and a FAS shRNA molecule.

[0296] In some embodiments, the methods provided herein are useful for the treatment of an immune-related condition in an individual. In one embodiment, the individual is a human.

[0297] In some embodiments, the methods provided herein (such as methods of enhancing an immune response) are useful for the treatment of cancer and as such an individual receiving the system described herein has cancer. In some embodiments, the cancer is a solid cancer. In some embodiments, the cancer is a liquid cancer. In some embodiments, the cancer is immunoevasive. In some embodiments, the cancer is colorectal cancer, ovarian cancer, fallopian cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, pancreatic, kidney cancer, lung cancer, prostate cancer, bladder cancer, breast cancer, liver cancer, or brain cancer. In some embodiments, the cancer is ovarian, kidney, lung, breast, or prostate cancer.

[0298] In some embodiments, the treatment results in a decrease in the cancer volume or size. In some embodiments, the treatment is effective at reducing a cancer volume as compared to the cancer volume prior to administration of the recombinant nucleic acid or recombinant cell. In some embodiments, the treatment results in a decrease in the cancer growth rate. In some embodiments, the treatment is effective at reducing a cancer growth rate as compared to the cancer growth rate prior to administration of the or recombinant cell. In some embodiments, the treatment is effective at eliminating the cancer.IPTS / 200259280.1 46Atorney Ref: ANB-228WOMethod of Immune Modulation

[0299] Methods of administration of a cell comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2 can result in modulation of an immune response. Modulation can be an increase or decrease in an immune response. In some embodiments, modulation is an increase in an immune response.

[0300] Methods of administration of a cell comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2 can result in modulation of an immune response. Modulation can be an increase or decrease in an immune response. In some embodiments, modulation is an increase in an immune response.

[0301] In one aspect, administration of a cell comprising a system comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2 as described herein can result in induction of pro-inflammatory molecules, such as cytokines or chemokines. In some embodiments, the cytokine is IFNg. Generally, induced pro-inflammatory molecules are present at levels greater than that achieved with isotype control. Such pro-inflammatory molecules in turn result in activation of anti-tumor immunity, including, but not limited to, T cell activation, T cell proliferation, T cell differentiation, Ml-like macrophage activation, andNK cell activation. Thus, the administration of a system comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2 can induce multiple anti-tumor immune mechanisms that lead to tumor destruction.

[0302] In another aspect, provided herein are methods of increasing an immune response in an individual comprising administering to the individual an effective amount of a cell comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2. In some embodiments, the method of increasing an immune response in a subject comprises administering to the subject a cell comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2.

[0303] In another aspect, provided herein are methods of increasing an immune response in an individual comprising administering to the individual an effective amount of a cell comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2. In some embodiments, the IPTS / 200259280.1 47Atorney Ref: ANB-228WOmethod of increasing an immune response in a subject comprises administering to the subject a cell comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2.

[0304] In some embodiments, the cell is present in a pharmaceutical composition further comprising a pharmaceutically acceptable excipient.

[0305] In any and all aspects of increasing an immune response as described herein, any increase or decrease or alteration of an aspect of characteristic(s) or function(s) is as compared to a cell not comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2.

[0306] Increasing an immune response can be both enhancing an immune response or inducing an immune response. For instance, increasing an immune response encompasses both the start or initiation of an immune response, or ramping up or amplifying an on-going or existing immune response. In some embodiments, the treatment induces an immune response. In some embodiments, the induced immune response is an adaptive immune response. In some embodiments, the induced immune response is an innate immune response. In some embodiments, the treatment enhances an immune response. In some embodiments, the enhanced immune response is an adaptive immune response. In some embodiments, the enhanced immune response is an innate immune response. In some embodiments, the treatment increases an immune response. In some embodiments, the increased immune response is an adaptive immune response. In some embodiments, the increased immune response is an innate immune response. In some embodiments, the immune response is started or initiated by administration of a cell a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2. In some embodiments, the immune response is enhanced by administration of cell comprising a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2.

[0307] In another aspect, the present application provides methods of genetically editing a cell with a recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2, which results in the modulation of the immune function of the cell. The modulation can be increasing an immune response. In some embodiments, the modulation is an increase in immune function. In some embodiments, the modulation of function leads to the activation of a cell comprising the recombinant nucleic acid comprising a nucleic acid sequence at least 15 nucleotides in length complementary to FAS and / or TGFBR2.IPTS / 200259280.1 48Atorney Ref: ANB-228WO

[0308] In some embodiments, the cell is a natural killer (NK) cell, a T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, or a T cell progenitor. In some embodiments, the cell is an immune cell. In some embodiments, the cell is a primary immune cell. In some embodiments, the cell is a primary human immune cell.

[0309] In some embodiments, the modulation of function of the cells comprising the recombinant nucleic acid(s) as described herein leads to an increase in the cells’ abilities to stimulate both native and activated T-cells, for example, by increasing cytokine or chemokine secretion by the cells expressing the recombinant nucleic acid(s). In some embodiments, the modulation of function enhances or increases the cells’ ability to produce cytokines, chemokines, CARs, or costimulatory or activating receptors. In some embodiments, the modulation increases the T-cell stimulatory function of the cells expressing the recombinant nucleic acid(s), including, for example, the cells’ abilities to trigger T-cell receptor (TCR) signaling, T-cell proliferation, or T-cell cytokine production.

[0310] In some embodiments, the increased immune response is secretion of cytokines and chemokines. In some embodiments, the recombinant nucleic acid(s) induces increased expression of at least one cytokine or chemokine in a cell as compared to an isotype control cell.

[0311] In some embodiments, the enhanced immune response is anti-tumor immune cell recruitment and activation.

[0312] In some embodiments, the cell expressing the recombinant nucleic acid(s) induces a memory immune response as compared to an isotype control cell. In general, a memory immune response is a protective immune response upon a subsequent exposure to pathogens or antigens that the immune system encountered previously. Exemplary memory immune responses include the immune response after infection or vaccination with an antigen. In general, memory immune responses are mediated by lymphocytes such as T cells or B cells. In some embodiments, the memory immune response is a protective immune response to cancer, including cancer cell growth, proliferation, or metastasis. In some embodiments, the memory immune response inhibits, prevents, or reduces cancer cell growth, proliferation, or metastasis.Methods of Editing Cells

[0313] The terms “gene editing” or “genome editing”, as used herein, refer to a type of genetic manipulation in which DNA is inserted, replaced, or removed from the genome using artificially manipulated nucleases or “molecular scissors”. It is a useful tool for elucidatingIPTS / 200259280.1 49Atorney Ref: ANB-228WOthe function and effect of sequence-specific genes or proteins or altering cell behavior (e.g. for therapeutic purposes).

[0314] Currently available genome editing tools include zinc finger nucleases (ZFN) and transcription activator-like effector nucleases (TALENs) to incorporate genes at safe harbor loci (.e.g. the adeno-associated virus integration site 1 (AAVS1) safe harbor locus). The DICE (dual integrase cassette exchange) system utilizing phiC31 integrase and Bxbl integrase is a tool for target integration. Additionally, clustered regularly interspaced short palindromic repeat / Cas9 (CRISPR / Cas9) techniques can be used for targeted gene insertion.

[0315] Site specific gene editing approaches can include homology dependent mechanisms or homology independent mechanisms.

[0316] All methods known in the art for targeted insertion of gene sequences are contemplated in the methods described herein to insert constructs at gene targets or safe harbor loci.

[0317] Provided herein are methods of inserting one or more recombinant RNAi nucleic acids, in the absence of a viral vector. In some embodiments, the one or more recombinant nucleic acids can be inserted into the genome of a primary immune cell, in the absence of a viral vector

[0318] Described herein are methods and compositions for achieving integration of a nucleotide sequence encoding one or more recombinant nucleic acids into the genome of a cell. In some methods the efficiency of integration is increased, off-target effects are reduced and / or loss of cell viability is reduced.

[0319] A plasmid encoding one or more recombinant nucleic acids is introduced into an immune cell with a nuclease, such as a CRISPR-associated system (Cas). The nuclease can be introduced in a ribonucleoprotein format with a guide RNA (gRNA) that targets a specific site on the genome of the immune cell. The nuclease cuts the genomic DNA at this specific site. The specific site may be a portion of the genome that encodes an endogenous immune cell receptor. Thus, cutting the genome at this site will cause the immune cell to no longer express an endogenous immune cell receptor.

[0320] The plasmid may include 5’ and 3’ homology-directed repair arms complementary to sequences at a specific site on the genome of the immune cell. The complementary sequences are on either side of the site cut by the nuclease, which allows the plasmid to be incorporated at a specified insertion site on the immune cell’s genome. Once the plasmid is incorporated, the cell will express the shRNA.IPTS / 200259280.1 50Atorney Ref: ANB-228WO

[0321] Initially, an immune cell, such as a T cell, is activated. The immune cell may be obtained from a patient. Thus, the present disclosure provides methods in which immune cells, such as T cells, are harvested from a patient. Then, the plasmid that encodes the one or more recombinant nucleic acids is introduced into a T cell. Advantageously, the plasmids of the present disclosure can be introduced using electroporation. When introducing the plasmid via electroporation, the nuclease may also be introduced. By using electroporation, methods of the present disclosure avoid the use of viral vectors for introducing transgenes, which is a known bottleneck in immune cell engineering. The immune cells are then expanded and cocultured to create a sufficient quantity of engineered immune cells to be used as a therapeutic treatment.

[0322] Methods for editing the genome of a cell can include a) providing a ribonucleoprotein (RNP) complex, wherein the RNP comprises a nuclease domain and a guide RNA, wherein the guide RNA specifically hybridizes to a target region of the genome of the cell, and wherein the Cas9 nuclease domain cleaves the target region to create an insertion site in the genome of the cell; and one or more nucleic acid(s) (e.g., a doublestranded or single-stranded DNA template), wherein the 5’ and 3’ ends of the one or more nucleic acid(s) comprise nucleotide sequences that are homologous to genomic sequences flanking the insertion site, and wherein the molar ratio of RNP to the one or more nucleic acid(s) in the mixture is from about 3:1 to about 100:1; and b) introducing the RNP complex and nucleic acid(s)into the cell.

[0323] In some embodiments, the methods described herein provide an efficiency of delivery of the ribonucleoprotein (RNP) complex and one or more nucleic acid(s) of at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or higher. In some cases, the efficiency is determined with respect to cells that are viable after introducing the ribonucleoprotein (RNP) complex and one or more nucleic acid(s) into the cell. In some cases, the efficiency is determined with respect to the total number of cells (viable or non-viable) in which the ribonucleoprotein (RNP) complex and one or more nucleic acid(s) is introduced into the cell.

[0324] As another example, the efficiency of delivery can be determined by quantifying the number of genome edited cells in a population of cells (as compared to total cells or total viable cells obtained after the introducing step). Various methods for quantifying genome editing can be utilized. These methods include, but are not limited to, the use of a mismatchspecific nuclease, such as T7 endonuclease I; sequencing of one or more target loci (e.g., byIPTS / 200259280.1 51Atorney Ref: ANB-228WOsanger sequencing of cloned target locus amplification fragments); and high-throughput deep sequencing.

[0325] In some embodiments, loss of cell viability is reduced as compared to loss of cell viability after introduction of naked DNA into a cell or introduction of DNA into a cell using a viral vector. The reduction can be a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or any percentage in between these percentages. In some embodiments, off-target effects of integration are reduced as compared to off-target integration after introduction of naked DNA into a cell or introduction of DNA into a cell using a viral vector. The reduction can be a reduction of at least 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or any percentage in between these percentages.

[0326] In some cases, the methods described herein provide for high cell viability of cells to which the RNP-DNA template has been introduced. In some cases, the viability of the cells to which the RNP-DNA template has been introduced is at least about 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97.5%, 99%, 99.5%, 99%, or higher. In some cases, the viability of the cells to which the RNP-DNA template has been introduced is from about 20% to about 99%, from about 30% to about 90%, from about 35% to about 85% or 90% or higher, from about 40% to about 85% or 90% or higher, from about 50% to about 85% or 90% or higher, from about 50% to about 85% or 90% or higher, from about 60% to about 85% or 90% or higher, or from about 70% to about 85% or 90% or higher.

[0327] In the methods provided herein, the molar ratio of RNP to DNA template (e.g., one or more nucleic acid(s)) can be from about 3 : 1 to about 100: 1. For example, the molar ratio can be from about 5:1 to 10:1, from about 5:1 to about 15:1, 5:1 to about 20:1; 5:1 to about 25:1; from about 8:1 to about 12:1; from about 8:1 to about 15:1, from about 8:1 to about 20 : 1 , or from about 8 : 1 to about 25:1.

[0328] In some embodiments, the DNA template (e.g., one or more nucleic acid(s)) is at a concentration of about 2.5 pM to about 25 pM. For example, the concentration of DNA template can be about 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25 pM or any concentration in between these concentrations.

[0329] In some embodiments, the amount of DNA template (e.g., one or more nucleic acid(s)) is about 1 pg to about 10 pg. For example, the amount of DNA template can be about 1 pg to about 2 pg, about 1 pg to about 3 pg, about 1 pg to about 4 pg, about 1 pg to about 5 pg, about 1 pg to about 6 pg, about 1 pg to about 7 pg, about 1 pg to about 8 pg, IPTS / 200259280.1 52Atorney Ref: ANB-228WOabout 1 pg to about 9 jug, about 1 pg to about 10 pg. In some embodiments the amount of DNA template is about 2 pg to about 3 pg, about 2 pg to about 4 pg, about 2 pg to about 5 pg, about 2 pg to about 6 pg, about 2 pg to about 7 pg, about 2 pg to about 8 pg, about 2 pg to about 9 pg, or 2 pg to about 10 pg. In some embodiments the amount of DNA template is about 3 pg to about 4 pg, about 3 pg to about 5 pg, about 3 pg to about 6 pg, about 3 pg to about 7 pg, about 3 pg to about 8 pg, about 3 pg to about 9 pg, or about 3 pg to about 10 pg. In some embodiments, the amount of DNA template (e.g., one or more nucleic acid(s)) is about 4 pg to about 5 pg, about 4 pg to about 6 pg, about 4 pg to about 7 pg, about 4 pg to about 8 pg, about 4 pg to about 9 pg, or about 4 pg to about 10 pg. In some embodiments, the amount of DNA template (e.g., one or more nucleic acid(s)) is about 5 pg to about 6 pg, about 5 pg to about 7 pg, about 5 pg to about 8 pg, about 5 pg to about 9 pg, or about 5 pg to about 10 pg. In some embodiments, the amount of DNA template (e.g., one or more nucleic acid(s)) is about 6 pg to about 7 pg, about 6 pg to about 8 pg, about 6 pg to about 9 pg, or about 6 pg to about 10 pg. In some embodiments, the amount of DNA template (e.g., one or more nucleic acid(s)) is about 7 pg to about 8 pg, about 7 pg to about 9 pg, or about 7 pg to about 10 pg. In some embodiments, the amount of DNA template is about 8 pg to about 9 pg, or about 8 pg to about 10 pg. In some embodiments, the amount of DNA template is about 9 pg to about 10 pg.

[0330] In some embodiments, the DNA template (e.g., one or more nucleic acid(s)) encodes an shRNA molecule or a fragment thereof. In some embodiments, the DNA template encodes at least one shRNA molecule. In some embodiments, the DNA template encodes at least two shRNA molecules. In some embodiments, the DNA template encodes one, two, three, four, five, six, seven, eight, nine, ten, or more shRNA molecules.

[0331] In some embodiments, the DNA template (e.g., one or more nucleic acid(s)) includes regulatory sequences, for example, a promoter sequence and / or an enhancer sequence to regulate expression of the heterologous protein or fragment thereof after insertion into the genome of a cell.

[0332] In some cases, the DNA template (e.g., one or more nucleic acid(s)) is a linear DNA template. In some cases, the DNA template (e.g., one or more nucleic acid(s)) is a single-stranded DNA template. In some cases, the single-stranded DNA template is a pure single-stranded DNA template. As used herein, by “pure single-stranded DNA” is meant single-stranded DNA that substantially lacks the other or opposite strand of DNA. By “substantially lacks” is meant that the pure single-stranded DNA lacks at least 100-fold more of one strand than another strand of DNA.IPTS / 200259280.1 53Atorney Ref: ANB-228WO

[0333] In some cases, the a complex of the ribonucleoprotein (RNP) complex and one or more nucleic acid(s) is formed by incubating the RNP with the one or more nucleic acid(s) (e.g., a DNA template) for less than about one minute to about thirty minutes, at a temperature of about 20° C to about 25° C. For example, the RNP can be incubated with the DNA template for about 5 seconds, 10 seconds, 15 seconds, 20 seconds, 25 seconds, 30 seconds, 35 seconds, 40 seconds, 45 seconds, 50 seconds, 55 seconds, 1 minute, 2 minutes, 3 minutes, 4 minutes, 5 minutes, 6 minutes, 7 minutes, 8 minutes, 9 minutes, 10 minutes, 11 minutes, 12 minutes, 13 minutes, 14 minutes, 15 minutes, 16 minutes, 17 minutes, 18 minutes, 19 minutes, 20 minutes, 21 minutes, 22 minutes, 23 minutes, 24 minutes, 25 minutes, 26 minutes, 27 minutes, 28 minutes, 29 minutes or 30 minutes or any amount of time in between these times, at a temperature of about 20° C, 21° C, 22° C, 23° C, 24° C, or 25° C. In another example, the RNP can be incubated with the DNA template for less than about one minute to about one minute, for less than about one minute to about 5 minutes, for less than about 1 minute to about 10 minutes, for about 5 minutes to 10 minutes, for about 5 minutes to 15 minutes, for about 10 to about 15 minutes, for about 10 minutes to about 20 minutes, or for about 10 minutes to about 30 minutes, at a temperature of about 20° C to about 25° C. In some embodiments, the ribonucleoprotein (RNP) complex and one or more nucleic acid(s) and the cell are mixed prior to introducing the ribonucleoprotein (RNP) complex and one or more nucleic acid(s) complex into the cell.

[0334] In some embodiments introducing the ribonucleoprotein (RNP) complex and one or more nucleic acid(s) comprises electroporation. Methods, compositions, and devices for electroporating cells to introduce a ribonucleoprotein (RNP) complex and one or more nucleic acid(s) can include those described in the examples herein. Additional or alternative methods, compositions, and devices for electroporating cells to introduce a RNP -DNA template complex can include those described in WO / 2006 / 001614 or Kim, J. A. et al.Biosens. Bioelectron. 23, 1353-1360 (2008). Additional or alternative methods, compositions, and devices for electroporating cells to introduce a ribonucleoprotein (RNP) complex and one or more nucleic acid(s) can include those described in U.S. Patent Appl. Pub. Nos. 2006 / 0094095; 2005 / 0064596; or 2006 / 0087522. Additional or alternative methods, compositions, and devices for electroporating cells to introduce a ribonucleoprotein (RNP) complex and one or more nucleic acid(s) can include those described in Li, L.H. et al. Cancer Res. Treat. 1, 341-350 (2002); U.S. Patent Nos.: 6,773,669; 7,186,559; 7,771,984; 7,991,559; 6485961; 7029916; and U.S. Patent Appl. Pub. Nos: 2014 / 0017213; and 2012 / 0088842, all of which are hereby incorporated by reference. Additional or alternative IPTS / 200259280.1 54Atorney Ref: ANB-228WOmethods, compositions, and devices for electroporating cells to introduce a ribonucleoprotein (RNP) complex and one or more nucleic acid(s) can include those described in Geng, T. et al. J. Control Release 144, 91-100 (2010); and Wang, J., etal. Lab. Chip 10, 2057-2061 (2010), all of which are hereby incorporated by reference.

[0335] In some embodiments, the Cas9 protein can be in an active endonuclease form, such that when bound to target nucleic acid as part of a complex with a guide RNA or part of a complex with a DNA template, a double strand break is introduced into the target nucleic acid. The double strand break can be repaired by NHEJ to introduce random mutations, or HDR to introduce specific mutations. Various Cas9 nucleases can be utilized in the methods described herein. For example, a Cas9 nuclease that requires an NGG protospacer adjacent motif (PAM) immediately 3’ of the region targeted by the guide RNA can be utilized. Such Cas9 nucleases can be targeted to any region of a genome that contains an NGG sequence. As another example, Cas9 proteins with orthogonal PAM motif requirements can be utilized to target sequences that do not have an adjacent NGG PAM sequence. Exemplary Cas9 proteins with orthogonal PAM sequence specificities include, but are not limited to, CFP1, those described in Nature Methods 10, 1116-1121 (2013), and those described in Zetsche et al., Cell, Volume 163, Issue 3, p759-771, 22 October 2015, both of which are hereby incorporated by reference.

[0336] In some cases, the Cas9 protein is a nickase, such that when bound to target nucleic acid as part of a complex with a guide RNA, a single strand break or nick is introduced into the target nucleic acid. A pair of Cas9 nickases, each bound to a structurally different guide RNA, can be targeted to two proximal sites of a target genomic region and thus introduce a pair of proximal single stranded breaks into the target genomic region. Nickase pairs can provide enhanced specificity because off-target effects are likely to result in single nicks, which are generally repaired without lesion by base-excision repair mechanisms. Exemplary Cas9 nickases include Cas9 nucleases having a D10A or H840A mutation.

[0337] In some embodiments, the RNP comprises a Cas9 nuclease. In some embodiments, the RNP comprises a Cas9 nickase. In some embodiments, the RNP -DNA template complex comprises at least two structurally different RNP complexes. In some embodiments, the at least two structurally different RNP complexes contain structurally different Cas9 nuclease domains In some embodiments, the at least two structurally different RNP complexes contain structurally different guide RNAs. In some embodiments, wherein the at least two structurally different RNP complexes contain structurally different guide RNAs, each of theIPTS / 200259280.1 55Atorney Ref: ANB-228WOstructurally different RNP complexes comprises a Cas9 nickase, and the structurally different guide RNAs hybridize to opposite strands of the target region.

[0338] In some cases, a plurality of ribonucleoprotein (RNP) complexes and one or more nucleic acid(s) comprising structurally different ribonucleoprotein complexes is introduced into the cell. For example a Cas9 protein can be complexed with a plurality (e.g., 2, 3, 4, 5, or more, e.g., 2-10, 5-100, 20-100) of structurally different guide RNAs to target insertion of a DNA template at a plurality of structurally different target genomic regions.

[0339] In the methods and compositions provided herein, cells include, but are not limited to, eukaryotic cells, prokaryotic cells, animal cells, plant cells, fungal cells and the like. Optionally, the cell is a mammalian cell, for example, a human cell. The cell can be in vitro, ex vivo or in vivo. The cell can also be a primary cell, a germ cell, a stem cell or a precursor cell. The precursor cell can be, for example, a pluripotent stem cell, or a hematopoietic stem cell. In some embodiments, the cell is a primary hematopoietic cell or a primary hematopoietic stem cell. In some embodiments, the primary hematopoietic cell is an immune cell. In some embodiments, the immune cell is a T cell. In some embodiments, the T cell is a regulatory T cell, an effector T cell, or a naive T cell. In some embodiments, the T cell is a CD4+T cell. In some embodiments, the T cell is a CD8+T cell. In some embodiments, the T cell is a CD4+CD8+T cell. In some embodiments, the T cell is a CD4 CD8' T cell.Populations of any of the cells modified by any of the methods described herein are also provided. In some embodiments, the methods further comprise expanding the population of modified cells.

[0340] In some cases, the cells are removed from a subject, modified using any of the methods described herein and administered to the patient. In other cases, any of the constructs described herein is delivered to the patient in vivo. See, for example, U.S. Patent No. 9737604 and Zhang et al. “Lipid nanoparticle-mediated efficient delivery of CRISPR / Cas9 for tumor therapy,” NPG Asia Materials Volume 9, page e441 (2017), both of which are hereby incorporated by reference.

[0341] In some embodiments, the ribonucleoprotein (RNP) complex and one or more nucleic acid(s) are introduced into about 1 x 105to about 2 x 106cells. For example, the ribonucleoprotein (RNP) complex and one or more nucleic acid(s) can be introduced into about 1 x 105to about 5 x 105cells, about 1 x 105to about 1 x 106, 1 x 105to about 1.5 x 106, 1 x 105to about 2 x 106, about 1 x 106to about 1.5 x 106cells or about 1 x 106to about 2 x 106.IPTS / 200259280.1 56Atorney Ref: ANB-228WO

[0342] In some cases, the methods and compositions described herein can be used for generation, modification, use, or control of recombinant immune cells, such as chimeric antigen receptor T cells (CAR T cells). Such CAR T cells can be used to treat or prevent cancer, an infectious disease, or autoimmune disease in a subject. For example, in some embodiments, one or more gene products are inserted or knocked-in to a T cell to express a heterologous protein (e.g., a chimeric antigen receptor (CAR) or a priming receptor).Insertion sites

[0343] Methods for editing the genome of an immune cell include a method of editing the genome of a human T cell comprise inserting a nucleic acid sequence or construct into a target region in exon 1 of the TCR-a subunit (TRAC) gene in the human immune cell. In some embodiments, the target region is in exon 1 of the constant domain of TRAC gene. In other embodiments, the target region is in exon 1, exon 2 or exon 3, prior to the start of the sequence encoding the TCR-a transmembrane domain.

[0344] Methods for editing the genome of an immune cell also include a method of editing the genome of a human immune T cell comprise inserting a nucleic acid sequence or construct into a target region in exon 1 of a TCR-P subunit (TRBC) gene in the human T cell. In some embodiments, the target region is in exon 1 of the TRBC1 or TRBC2 gene.

[0345] Methods for editing the genome of an immune cell, specifically, include a method of editing the genome of a human immune cell comprise inserting a nucleic acid sequence or construct into a target region of a genomic safe harbor (GSH).

[0346] Methods for editing the genome of a T cell also include a method of editing the genome of a human T cell comprise inserting a nucleic acid sequence or construct into a GS94 target region (locus chrl 1 : 128340000-128350000).

[0347] In some embodiments, the target region is the GS94 locus at chrl 1 : 128342576.

[0348] Gene editing therapies include, for example, vector integration and site specific integration. Site-specific integration is a promising alternative to random integration of viral vectors, as it mitigates the risks of insertional mutagenesis or insertional oncogenesis (Kolb et al. Trends Biotechnol. 2005 23:399-406; Porteus c / a / . Nat Biotechnol. 2005 23:967-973; Paques etal. Curr Gen Ther. 20077:49-66). However, site specific integration continues to face challenges such as poor knock-in efficiency, risk of insertional oncogenesis, unstable and / or anomalous expression of adjacent genes or the transgene, low accessibility (e.g. within 20 kB of adjacent genes), etc. These challenges can be addressed, in part, through the identification and use of safe harbor loci or safe harbor sites (SHS), which are sites in which IPTS / 200259280.1 57Atorney Ref: ANB-228WOgenes or genetic elements can be incorporated without disruption to expression or regulation of adjacent genes.

[0349] The most widely used of the putative human safe harbor sites is the AAVS1 site on chromosome 19q, which was initially identified as a site for recurrent adenoassociated virus insertion. Other potential SHS have been identified on the basis of homology, with sites first identified in other species (e.g., the human homolog of the permissive murine Rosa26 locus) or among the growing number of human genes that appear non-essential under some circumstances. One putative SHS of this type is the CCR5 chemokine receptor gene, which, when disrupted, confers resistance to human immunodeficiency virus infection. Additional potential genomic SHS have been identified in human and other cell types on the basis of viral integration site mapping or gene-trap analyses, as was the original murine Rosa26 locus. The three top SHS, AAVS1, CCR5, and Rosa26, are in close proximity to many protein coding genes and regulatory elements. (See Sadelain, M., et al. (2012). Safe harbours for the integration of new DNA in the human genome. Nature reviews Cancer, 12(1), 51-58, the relevant disclosures of which are herein incorporated by reference in their entirety).

[0350] The AAVS1 (also known as the PPP1R12C locus) on human chromosome 19 is a known SHS for hosting transgenes (e.g. DNA transgenes) with expected function. It is at position 19ql3.42. It has an open chromatin structure and is transcription-competent. The canonical SHS locus for AAVS1 is chrl9: 55,625,241-55,629,351. See Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor" Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference. An exemplary AAVS1 target gRNA and target sequence are provided below:• AAVS1 -gRNA sequence:ggggccactagggacaggatGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTA GTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTTTTT (SEQ ID NO: 89)• AAVS1 target sequence: ggggccactagggacaggat (SEQ ID NO: 90)

[0351] CCR5, which is located on chromosome 3 at position 3p21.31, encodes the major co-receptor for HIV-1. Disruption at this site in the CCR5 gene has been beneficial in HIV / AIDS therapy and prompted the development of zinc-finger nucleases that target its third exon. The canonical SHS locus for CCR5 is chr3: 46,414,443-46,414,942. See Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor" Potential for Targeted TransgeneIPTS / 200259280.1 58Atorney Ref: ANB-228WOInsertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference.

[0352] The mouse Rosa26 locus is particularly useful for genetic modification as it can be targeted with high efficiency and is expressed in most cell types tested. Irion et al. 2007 ("Identification and targeting of the ROSA26 locus in human embryonic stem cells." Nature biotechnology 25.12 (2007): 1477-1482, the relevant disclosure of which are herein incorporated by reference) identified the human homolog, human ROSA26, in chromosome 3 (position 3p25.3).The canonical SHS locus for human Rosa26 (hRosa26) is chr3: 9,415,082-9,414,043. See Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor" Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference.

[0353] Additional examples of safe harbor sites are provided in Pellenz et al. “New Human Chromosomal Sites with "Safe Harbor" Potential for Targeted Transgene Insertion.” Human gene therapy vol. 30,7 (2019): 814-828, the relevant disclosures of which are herein incorporated by reference. Examples of additional integration sites are provided in Table 1.

[0354] In some embodiments, the safe harbor sites allow for high transgene expression (sufficient to allow for transgene functionality or treatment of a disease of interest) and stable expression of the transgene over several days, weeks or months. In some embodiments, knockout of the gene at the safe harbor locus confers benefit to the function of the cell, or the gene at the safe harbor locus has no known function within the cell. In some embodiments the safe harbor locus results in stable transgene expression in vitro with or without CD3 / CD28 stimulation, negligible off-target cleavage as detected by iGuide-Seq or CRISPR-Seq, less off-target cleavage relative to other loci as detected by iGuide-Seq or CRISPR-Seq, negligible transgene-independent cytotoxicity, negligible transgene-independent cytokine expression, negligible transgene-independent chimeric antigen receptor expression, negligible deregulation or silencing of nearby genes, and positioned outside of a cancer-related gene.

[0355] As used, a “nearby gene” can refer to a gene that is within about lOOkB, about 125kB, about 150kB, about 175kB, about 200kB, about 225kB, about 250kB, about 275kB, about 300kB, about 325kB, about 350kB, about 375kB, about 400kB, about 425kB, about 450kB, about 475kB, about 500kB, about 525kB, about 550kB away from the safe harbor locus (integration site).

[0356] In some embodiments, the present disclosure contemplates nucleic acid inserts that comprise one or more recombinant RNAi nucleic acids, such as at least one shRNA molecule. The integration of the one or more recombinant RNAi nucleic acids can result in, IPTS / 200259280.1 59Atorney Ref: ANB-228WOfor example, enhanced therapeutic properties. These enhanced therapeutic properties, as used herein, refer to an enhanced therapeutic property of a cell when compared to a typical immune cell of the same normal cell type. For example, an NK cell having “enhanced therapeutic properties” has an enhanced, improved, and / or increased treatment outcome when compared to a typical, unmodified and / or naturally occurring NK cell. The therapeutic properties of immune cells can include, but are not limited to, cell transplantation, transport, homing, viability, self-renewal, persistence, immune response control and regulation, survival, and cytotoxicity. The therapeutic properties of immune cells are also manifested by: antigen-targeted receptor expression; HLA presentation or lack thereof; tolerance to the intratumoral microenvironment; induction of bystander immune cells and immune regulation; improved target specificity with reduction; resistance to treatments such as chemotherapy.

[0357] As used herein, the term “insert size” refers to the length of the nucleotide sequence being integrated (inserted) at the target locus or safe harbor site.

[0358] The inserts of the present disclosure refer to nucleic acid molecules or polynucleotide inserted at a target locus or safe harbor site. In some embodiments, the nucleotide sequence is a DNA molecule, e.g., genomic DNA, or comprises deoxyribonucleotides. In some embodiments, the insert comprises a smaller fragment of DNA, such as a plastid DNA, mitochondrial DNA, or DNA isolated in the form of a plasmid, a fosmid, a cosmid, a bacterial artificial chromosome (BAC), a yeast artificial chromosome (YAC), and / or any other sub-genome segment of DNA. The nucleotides in the insert are contemplated as naturally occurring nucleotides, non-naturally occurring, and modified nucleotides. Nucleotides may be modified chemically or biochemically, or may contain nonnatural or derivatized nucleotide bases, as will be readily appreciated by those of skill in the art. Such modifications include, for example, labels, methylation, substitution of one or more of the naturally occurring nucleotides with an analog, intemucleotide modifications. The polynucleotides can be in any topological conformation, including single-stranded, doublestranded, partially duplexed, triplexed, hairpinned, circular conformations, and other three-dimension conformations contemplated in the art.

[0359] The inserts can have coding and / or non-coding regions. The insert can comprises a non-coding sequence e.g., control elements, e.g., a promoter sequence). In some embodiments, the insert encodes one or more recombinant RNAi nucleic acids.

[0360] In some embodiments, the nucleic acid sequence is inserted into the genome of the immune cell via non-viral delivery. In non-viral delivery methods, the nucleic acid can be naked DNA, or in a non-viral plasmid or vector. Non-viral delivery techniques can be site- IPTS / 200259280.1 60Atorney Ref: ANB-228WOspecific integration techniques, as described herein or known to those of ordinary skill in the art. Examples of site-specific techniques for integration into the safe harbor loci include, without limitation, homology-dependent engineering using nucleases and homology independent targeted insertion using Cas9 or other CRISPR endonucleases.

[0361] In some embodiments, the insert is integrated at a safe harbor site by introducing into the engineered cell, (a) a targeted nuclease that cleaves a target region in the safe harbor site to create the insertion site; and (b) the nucleic acid sequence (insert), wherein the insert is incorporated at the insertion site by, e.g., HDR. Examples of non-viral delivery techniques that can be used in the methods of the present disclosure are provided in US Application Nos.16 / 568,116 and 16 / 622,843, the relevant disclosures of which are herein incorporated by reference in their entirety.

[0362] Examples of integration sites contemplated are provided in Table D.Table D: sgRNA sequencesIPTS / 200259280.1 61Atorney Ref: ANB-228WOIPTS / 200259280.1 62Atorney Ref: ANB-228WOIPTS / 200259280.1 63Atorney Ref: ANB-228WOCRISPR-Cas Editins

[0363] One effective example of gene editing is the CRISPR-Cas approach (e.g. CRISPR- Cas9). This approach incorporates the use of a guide polynucleotide (e.g. guide ribonucleic acid or gRNA) and a cas endonuclease (e.g. Cas9 endonuclease).

[0364] As used herein, a polypeptide referred to as a “Cas endonuclease” or having “Cas endonuclease activity” refers to a CRISPR-related (Cas) polypeptide encoded by a Cas gene, wherein a Cas polypeptide is a target DNA sequence that can be cleaved when operably linked to one or more guide polynucleotides (see, e.g., US Pat. No. 8,697,359). Also included in this definition are variants of Cas endonuclease that retain guide polynucleotide-dependent endonuclease activity. The Cas endonuclease used in the donor DNA insertion method detailed herein is an endonuclease that introduces double-strand breaks into DNA at the target site (e.g., within the target locus or at the safe harbor site).

[0365] As used herein, the term “guide polynucleotide” relates to a polynucleotide sequence capable of complexing with a Cas endonuclease and allowing the Cas endonuclease to recognize and cleave a DNA target site. The guide polynucleotide can be a single molecule or a double molecule. The guide polynucleotide sequence can be an RNA sequence, a DNA sequence, or a combination thereof (RNA-DNA combination sequence). A guide polynucleotide comprising only ribonucleic acid is also referred to as “guide RNA”. In some embodiments, a polynucleotide donor construct is inserted at a safe harbor locus using a guide RNA (gRNA) in combination with a cas endonuclease (e.g. Cas9 endonuclease).

[0366] The guide polynucleotide includes a first nucleotide sequence domain (also referred to as a variable targeting domain or VT domain) that is complementary to a nucleotide sequence in the target DNA, and a second nucleotide that interacts with a Cas IPTS / 200259280.1 64Atorney Ref: ANB-228WOendonuclease polypeptide. It can be a double molecule (also referred to as a double-stranded guide polynucleotide) comprising a sequence domain (referred to as a Cas endonuclease recognition domain or CER domain). The CER domain of this double molecule guide polynucleotide comprises two separate molecules that hybridize along the complementary region. The two separate molecules can be RNA sequences, DNA sequences and / or RNA-DNA combination sequences.

[0367] Genome editing using CRISPR-Cas approaches relies on the repair of site-specific DNA double-strand breaks (DSBs) induced by the RNA-guided Cas endonuclease (e.g. Cas 9 endonuclease). Homology-directed repair (HDR) of these DSBs enables precise editing of the genome by introducing defined genomic changes, including base substitutions, sequence insertions, and deletions. Conventional HDR-based CRISPR / Cas9 genome-editing involves transfecting cells with Cas9, gRNA and donor DNA containing homologous arms matching the genomic locus of interest.

[0368] HITI (homology independent targeted insertion) uses a non-homologous end joining (NHEJ)-based homology -independent strategy and the method can be more efficient than HDR. Guide RNAs (gRNAs) target the insertion site. For HITI, donor plasmids lack homology arms and DSB repair does not occur through the HDR pathway. The donor polynucleotide construct can be engineered to include Cas9 cleavage site(s) flanking the gene or sequence to be inserted. This results in Cas9 cleavage at both the donor plasmid and the genomic target sequence. Both target and donor have blunt ends and the linearized donor DNA plasmid is used by the NHEJ pathway resulting integration into the genomic DSB site. (See, for example, Suzuki, K., et al. (2016). In vivo genome editing via CRISPR / Cas9 mediated homology -independent targeted integration. Nature, 540(7631), 144-149, the relevant disclosures of which are herein incorporated in their entirety).

[0369] Methods for conducing gene editing using CRISPR-Cas approaches are known to those of ordinary skill in the art. (See, for example, US Application Nos. US16 / 312,676, US 15 / 303,722, and US 15 / 628,533, the disclosures of which are herein incorporated by reference in their entirety). Additionally, uses of endonucleases for inserting transgenes into safe harbor loci are described, for example, in US Application No. 13 / 036,343, the disclosures of which are herein incorporated by reference in their entirety.

[0370] The guide RNAs and / or mRNA (or DNA) encoding an endonuclease can be chemically linked to one or more moieties or conjugates that enhance the activity, cellular distribution, or cellular uptake of the oligonucleotide. Non-limiting examples of such moieties include lipid moieties such as a cholesterol moiety, cholic acid, a thioether, a IPTS / 200259280.1 65Atorney Ref: ANB-228WOthiocholesterol, an aliphatic chain (e.g., dodecandiol or undecyl residues), a phospholipid, e.g., di-hexadecyl-rac-glycerol or triethylammonium 1 ,2-di-O-hexadecyl- rac-glycero-3-H-phosphonate, a polyamine or a polyethylene glycol chain, adamantane acetic acid, a palmityl moiety and an octadecylamine or hexylamino-carbonyl-t oxycholesterol moiety. See for example US Patent Publication No. 20180127786, the disclosure of which is herein incorporated by reference in its entirety.Therapeutic Applications

[0371] For therapeutic applications, the engineered cells, populations thereof, or compositions thereof are administered to a subject, generally a mammal, generally a human, in an effective amount.

[0372] The engineered cells may be administered to a subject by infusion e.g., continuous infusion over a period of time) or other modes of administration known to those of ordinary skill in the art.

[0373] The engineered cells provided herein not only find use in gene therapy but also in non-pharmaceutical uses such as, e.g., production of animal models and production of recombinant cell lines expressing a recombinant nucleic acid of interest.

[0374] The engineered cells of the present disclosure can be any cell, generally a mammalian cell, generally a human cell that has been modified by integrating a transgene at a safe harbor locus described herein. Exemplary cells are provided in the Recombinant Cells section.

[0375] The engineered cells, compositions and methods of the present disclosure are useful for therapeutic applications such as immune or T cell therapy. In some embodiments, the insertion of a sequence encoding an shRNA molecule within a safe harbor locus maintains the TCR expression relative to instances when there is no insertion and enables transgene expression while maintaining TCR function.

[0376] In some embodiments, the present disclosure provides methods of treating a subject in need of treatment by administering to the subject a composition comprising any of the engineered cells described herein. In some embodiments, administration of the engineered cell composition results in a desired pharmacological and / or physiological effect. That effect can be partial or complete cure of the disease and / or adverse effects resulting from the disease. In some embodiments, treatment encompasses any treatment of a disease in a subject (e.g., mammal, e.g., human). Further, treatment may stabilize or reduce undesirable clinicalIPTS / 200259280.1 66Atorney Ref: ANB-228WOsymptoms in subjects (e.g., patients). The cells provided herein populations thereof, or compositions thereof may be administered during or after the occurrence of the disease.

[0377] In certain embodiments, the subject has a disease, condition, and / or injury that can be treated and / or ameliorated by cell therapy. In some embodiments, the subject in need of cell therapy is a subject having an injury, disease, or condition, thereby causing cell therapy (e.g., therapy in which cellular material is administered to the subject). However, it is contemplated that it is possible to treat, ameliorate and / or reduce the severity of at least one symptom associated with the injury, disease or condition.Method of Administration

[0100] An effective amount of the immune cell comprising the system may be administered for the treatment of cancer. The appropriate dosage of the immune cell comprising the system may be determined based on the type of cancer to be treated, the type of the immune cell comprising the system, the severity and course of the cancer, the clinical condition of the individual, the individual’s clinical history and response to the treatment, and the discretion of the attending physician.Pharmaceutical compositions

[0378] The engineered recombinant cells or recombinant nucleic acids provided herein can be administered as part of a pharmaceutical compositions. These compositions can comprise, in addition to one or more of the recombinant cells, a pharmaceutically acceptable excipient, carrier, buffer, stabiliser or other materials well known to those skilled in the art. Such materials should be non-toxic and should not interfere with the efficacy of the active ingredient. The precise nature of the carrier or other material can depend on the route of administration, e.g. oral, intravenous, cutaneous or subcutaneous, nasal, intramuscular, intraperitoneal routes. The pharmaceutical composition may comprise one or more pharmaceutical excipients. Any suitable pharmaceutical excipient may be used, and one of ordinary skill in the art is capable of selecting suitable pharmaceutical excipients.Accordingly, the pharmaceutical excipients provided below are intended to be illustrative, and not limiting. Additional pharmaceutical excipients include, for example, those described in the Handbook of Pharmaceutical Excipients, Rowe el al. (Eds.) 6th Ed. (2009), incorporated by reference in its entirety.

[0379] Various modes of administering the additional therapeutic agents are contemplated herein. In some embodiments, the additional therapeutic agent is administered by any suitable mode of administration.IPTS / 200259280.1 67Atorney Ref: ANB-228WO

[0380] A composition can be administered alone or in combination with other treatments, either simultaneously or sequentially dependent upon the condition to be treated.Kits and Articles of Manufacture

[0381] The present application provides kits comprising any one or more of the recombinant nucleic acids or cell compositions described herein along with instructions for use. The instructions for use can be present in the kits as a package insert, in the labeling of the container of the kit or components thereof, or can be in digital form (e.g. on a CD-ROM, via a link on the internet). A kit can include one or more of a genome-targeting nucleic acid, a polynucleotide encoding a genome-targeting nucleic acid, a site-directed polypeptide, and / or a polynucleotide encoding a site-directed polypeptide. Additional components within the kits are also contemplated, for example, buffer (such as reconstituting buffer, stabilizing buffer, diluting buffer), and / or one or more control vectors.

[0382] In some embodiments, the kits further contain a component selected from any of secondary antibodies, reagents for immunohistochemistry analysis, pharmaceutically acceptable excipient and instruction manual and any combination thereof. In one specific embodiment, the kit comprises a pharmaceutical composition comprising any one or more of the recombinant nucleic acids or cell compositions described herein, with one or more pharmaceutically acceptable excipients.

[0383] The present application also provides articles of manufacture comprising any one of the recombinant nucleic acids or cell compositions or kits described herein. Examples of an article of manufacture include vials (including sealed vials).EXAMPLES

[0384] Below are examples of specific embodiments for carrying out the present disclosure herein. The examples are offered for illustrative purposes only, and are not intended to limit the scope of the present disclosure in any way. Efforts have been made to ensure accuracy with respect to numbers used (e.g., amounts, temperatures, etc.), but some experimental error and deviation should, of course, be allowed for.

[0385] The practice of the present disclosure will employ, unless otherwise indicated, conventional methods of protein chemistry, biochemistry, recombinant DNA techniques and pharmacology, within the skill of the art. Such techniques are explained fully in the literature. See, e.g., T.E. Creighton, Proteins: Structures and Molecular Properties (W.H. Freeman and Company, 1993); A.L. Lehninger, Biochemistry (Worth Publishers, Inc., current addition); Sambrook, et al., Molecular Cloning: A Laboratory Manual (2nd Edition, 1989); Methods In IPTS / 200259280.1 68Atorney Ref: ANB-228WOEnzymology (S. Colowick and N. Kaplan eds., Academic Press, Inc.); Remington's Pharmaceutical Sciences, 18th Edition (Easton, Pennsylvania: Mack Publishing Company, 1990); Carey and Sundberg Advanced Organic Chemistry 3rdEd. (Plenum Press) Vols A and B(1992).Example 1: In vitro Characterization of a Logic Gate in combination with FAS and TGFBR2 shRNA

[0386] Materials and Methods

[0387] PrimeR / CAR ICT construct expression in T cells

[0388] Integrated circuit T (ICT) cells targeting a first exemplary primeR antigen (priming receptor) and first exemplary CAR antigen were generated through site directed CRISPR mediated knock in (KI). T cells were activated for two days using CD3-CD28 beads. At day 2, beads were removed followed by the delivery of the ICT transgene to the GS94 site in the genome of the T cells. Transgene integration was performed using a CRISPR-based process and electroporation step that combined activated T cells, CRISPR / Cas9 RNP targeting the GS94 non-coding autosomal integration site, and plasmid DNA constituting a repair template to effect insertion of the transgene cassette via cellular DNA repair machinery.

[0389] The GS94 CRISPR / Cas9 RNP used was generated by complexing single guide RNA (sgRNA) with recombinant Streptococcus pyogenes Cas9 (SpCas9). The sgRNA contained a protospacer sequence directing the CRISPR / Cas9 RNP to the GS94-transgene integration site. The plasmid DNA repair template contained the ICT transgene cassette, flanked by 450 base pair (bp) sequences homologous to the regions flanking the integration site to effect repair-mediated insertion.

[0390] A diagram of the various ICT transgene cassettes generated is provided in FIG.2.The ICT constructs 1, 2, 3, and 4 comprised a constitutively expressed priming receptor, an inducible CAR (forming a Logic Gate or “LG”), constitutively expressed shRNAs targeting FAS (1 shRNA) and TGFBR2 (2 shRNA), and a synthetic pathway activator (SPA). One ICT also included an shRNA targeting PTPN2 in addition to FAS and TGFBR2 and LNGFR in place of the SPA (LG 5 IC). The sequence of the FAS and dual TGFBR2 shRNA cassette (triple shRNA) is provided in SEQ ID NO: 68, while the sequence of the FAS / PTPN2 / dual TGFBR2 shRNA cassette (quad shNRA) is provided in SEQ ID NO: 88. The full transgene cassettes comprising a logic gate with the shRNA and optional SPA are termed Logic Gate 1 integrated circuit (“IC” or LG 1 IC), Logic Gate 2 IC (LG 2 IC), Logic Gate 3 IC (LG 3 IC), Logic Gate 4 IC (LG 4 IC), or Logic Gate 5 IC (LG 5 IC).IPTS / 200259280.1 69Atorney Ref: ANB-228WO

[0391] Following electroporation, cells were recovered and expanded in T cell media for 7 days. When indicated, negative control T cells were generated using a mock electroporation process that edited T cells with ribonucleoprotein (RNP) in the absence of donor plasmid and are referred to as “RNP control”.

[0392] ICT cells were assessed for transgene KI and the expression of the PrimeR and CAR using flow based staining. Constructs contained tags myc and flag on the distal extracellular portion of the PrimeR and CAR respectively following the signal peptide. ICT cells at day 7 post activation were stained with myc, flag and CD3 antibodies for 30 min at 4c. Following activation, cells were washed in FACs buffer and run by flow cytometry. ICTs were analyzed for PrimeR and CAR expression following gating each sample for live CD3+ cells.

[0393] ICT induction of CARs

[0394] ICTs were generated as described above from the T cells of 2 donors. On day 11 post activation, ICTs were measured for CAR and PrimeR expression by Flag and Myc staining. % KI was quantify by summing the % of T cells in a sample that were PrimeR+ or CAR+. Before co-culture setup, ICTs were normalized to the same % KI using the addition of donor matched RNP only cell. IxlO7ICTs were co-cultured with IxlO7target cells or media for 72 hours and stained to calculate the % of CAR+ cells using flag staining. Basal CAR expression was measured during assay set up.

[0395] shRNA knockdown

[0396] ICT cells contain a constitutive shRNA module targeting knockdown of FAS and TGFBR2, whereas cells without a transgene KI (PrimeR negative cells) have normal expression of FAS and TGFBR2 and can be used as an internal control. Multicolor flow cytometry was performed on four productions of ICT cells to characterize transgene expression and assess shRNA-miR knockdown of FAS and TGFBR2. Antibodies against CD4, CD8, CD95 (FAS) and TGFBR2 were used in the flow cytometry. The panel also included rh-primeR antigent for PrimeR detection and rhCAR antigen for CAR detection as well as Zombi NIR for live vs dead cell staining.

[0397] Surface protein knockdown of FAS and TGFBR2 in ICT cells was determined using flow cytometry. Cells were stained with anti-FAS and anti-TGFBR2 antibodies, and geometric mean fluorescence intensity (gMFI) was measured for both PrimeR-positive and PrimeR-negative subsets of ICT cells. Data are representative of 4 donors. The formula used to calculate %KD (percent knockdown) = 100%(l - (MFI PrimeR+) / (MFI PrimeR-)).

[0398] Synthetic pathway activatorsIPTS / 200259280.1 70Atorney Ref: ANB-228WO

[0399] Synthetic Pathway Activators (SPAs) constitutively drive STAT signaling without the need for external cytokine input. SPAs can be designed to engage activity of multiple STAT family transcription factors at variable levels through rational design. Exemplary Class 1 SPAs primarily increase pSTAT3 activity and exemplary Class II SPAs primarily increase pSTAT5 activity.

[0400] To demonstrate the ability of the SPA module to drive constitutive STAT3 phosphorylation, ICTs expressing the SPA module under non-stimulated conditions were fixed, permeabilized, and stained for pSTAT3 and the myc epitope tag to distinguish between edited and non-edited cells (data not shown).

[0401] Cytotoxicity, engineered K562 cells

[0402] ICT cells expressing the integrated circuits comprising Logic Gate 1 IC, Logic Gate 2 IC, Logic Gate 3 IC, Logic Gate 4 IC, or Logic Gate 5 IC with shRNA and optionally a SPA were co-cultured with K562 EFG, K562 EFG CAR antigen, K562_EFG_primeR antigen, or K562 EFG CAR antigen_primeR antigen at varying E:T ratios for 72 hours at 37°C. Following incubation, cytotoxicity was measured using a luciferase reporter assay. Data are presented as the mean ± standard deviation of 4 donors.

[0403] Cytokine secretion

[0404] To further assess the specificity and function of ICT cells expressing Logic Gate 1-5 Ics, supernatants were collected from K562 target cytotoxicity co-cultures (EffectorTarget ratio of 1:1, 72 hour co-culture). Following incubation, supernatants were collected at endpoint and cytokine release levels were measured using a Luminex assay. Data from 4 donors are shown.

[0405] Cytotoxicity in endogenous / engineered cells

[0406] ICT cells expressing LG 1-5 Ics were co-cultured with CAR antigen_ primeR antigen cells (cells endogenously expresses CAR antigen and engineered to express primeR antigen) at varying E:T ratios for 72 hours at 37°C. Following incubation, cytotoxicity was measured using a luciferase reporter assay. Data are presented as the mean ± standard deviation of 4 donors. Prior to luciferase readout described above, supernatants were collected at endpoint and cytokines (B) IFN-g, (C) TNFa, (D) GM-CSF and (E) IL-2 were measured using a Luminex assay. Data from 4 donors are shown.

[0407] Mixed co-culture cytotoxicity

[0408] ICT cells expressing Logic Gates 1-5 were co-cultured with primeR antigen+ / CAR antigen- HUVEC cells and luciferase expressing primeR antigen- / CAR antigen+ cells (K562-EFG- CAR antigen) at varying E:T ratios for 72 hours at 37°C. Following incubation, IPTS / 200259280.1 71Atorney Ref: ANB-228WOcytotoxicity was measured using a luciferase reporter assay. Data are from one normal donor. ICT-mediated CAR antigen+ target cell killing was evaluated relative to an RNP-electroporated negative control using a luciferase reporter assay.

[0409] Results

[0410] All ICT cells constitutively expressed the PrimeR construct as shown by myc expression (FIG. 13). The inducible CAR was not expressed at basal state in the ICT cells, as indicated by the lack of FLAG expression (FIG.3), indicating that the priming receptor had not induced expression of the CAR.

[0411] As shown in FIG. 4, the ICT cells induced CAR expression when co-cultured with primeR antigen expressing cell lines. Numbers shown in FIG. 4 are the (%CAR) / (% KI normalized to at the start of the assay)* 100. Thus, the logic gate circuit functioned correctly by not expressing the CAR in the absence of binding of the primeR to its cognate antigen (FIG. 3) and induction of expression of the CAR upon binding of the primeR to its cognate ligand on a target cell (FIG. 4).

[0412] Inclusion of the shRNA module in ICT cells showed lower MFI for both FAS and TGFBR2 in ICT cells expressing the priming receptor-CAR logic gate (PrimeR+) normalized to non-edited cells (PrimeR-), indicating knockdown of both FAS and TGFBR2 in ICT PrimeR+ cells (FIG. 5).

[0413] ICTs expressing LG 1-5 Ics demonstrated cytotoxicity against only dual CAR antigen and primeR antigen expressing cells as compared to unedited control cells (RNP). FIG. 6A shows cytotoxicity against parental K562 cells expressing neither CAR antigen or primeR antigen, FIG. 6B shows cytotoxicity against K562 cells expressing only CAR antigen, FIG. 6C shows cytotoxicity against K562 cells expressing only primeR antigen, and FIG. 6D shows cytotoxicity against K562 cells expressing both primeR antigen and CAR antigen. As shown in FIG. 6D, the ICTs exhibited cytotoxicity against only cells expressing both primeR antigen and CAR antigen as compared to unedited cells (RNP).

[0414] IFN-y production from ICTs expressing LG 1-5 Ics was observed only in supernatants taken from co-cultures where the target cells expressed both primeR antigen and CAR antigen (FIG. 7). Results from the cytokine analysis were consistent with the cytotoxicity data. Together, these data further demonstrate that ICT activity is driven by coexpression of primeR antigen and CAR antigen.

[0415] ICTs expressing LG 1-5 Ics demonstrated in vitro cytotoxicity against the primeR antigen-med cell line expressing endogenous CAR antigen (FIG. 8A). ICTs also secrete cytokines after co-culture. FIG. 8B shows IFNy, TNFa, GM-CSF, and IL-2 secretion by ICT IPTS / 200259280.1 72Atorney Ref: ANB-228WOcells after co-culture with primeR antigen+ / CAR antigen+ cells. Thus, ICTs expressing LG 1-5 Ics secreted cytokines and killed ccRCC cell lines that express endogenous CAR antigen in the presence of primeR antigen.

[0416] Co-culture with HUVEC-primeR antigen induced expression of the CAR protein on ICT cells and specific killing of CAR antigen+ cells was confirmed (FIG. 9). Thus, ICTs expressing LG 1-5 Ics were capable of inducing CAR expression through interaction with primeR antigen+ endothelial cells and subsequently specifically engaging and killing CAR antigen+ tumor cells. Therefore, without wishing to be bound by theory, ICTs can be primed by binding to endothelial cells expressing primeR antigen in order to express the CAR and then kill CAR antigen+ target tumor cells.

[0417] Thus, logic gated ICT cells that utilize the presence of two antigens to trigger tumor cell killing to improve the therapeutic index of CAR T cells were developed, thereby enhancing tumor specificity. Induction of the CAR was gated on the expression of primeR antigen found on the tumor neovasculature of ccRCC. In this example, the PrimeR antigen and CAR antigen were not known to be co-expressed in normal tissues. When the priming receptor (PrimeR) binds its cognate antigen, PrimeR engagement triggers proteolytic release of a transcription factor that induces expression of a CAR. The feasibility of vascular priming was confirmed using a transwell assay where ICTs were primed by a primeR antigen expressing endothelial cell line and then migrated across the transwell membrane to kill CAR antigen expressing RCC cells.

[0418] To further increase the potency and persistence of the ICT cells, an shRNA cassette targeting both FAS and TGFBR2, a receptor used for TGFB signaling in T cells, was inserted into the ICTs. Addition of FAS / TGFBR2 shRNAs enhanced antitumor activity of primeR antigen x CAR antigen logic gate expressing T cells during in vitro chronic stimulation assays conducted in the presence of exogenous TGFb (data not shown). Furthermore, FAS / TGFBR shRNA containing ICTs demonstrated enhanced antitumor activity in multiple xenograft RCC models (Example 5, FIG. 12). Collectively, these results demonstrate that primeR antigen-CAR antigen ICT cells can (i) selectively target antigens that cannot generally be safely targeted by conventional CARs; and (ii) overcome multiple suppressive mechanisms in the tumor microenvironment.Example 2: In vivo efficacy of primeR and CAR Logic Gate T Cells expressing FAS and TGFBR2 shRNA

[0419] Materials and Methods

[0420] A498 RCC Efficacy ModelIPTS / 200259280.1 73Atorney Ref: ANB-228WO

[0421] Human ccRCC cells express endogenous levels of the CAR antigen and were engineered to express physiological levels of primeR antigen. 2 xl06primeR antigen+ / CAR antigen+ cells were inoculated into the right dorsal flank of five- six weeks old, female NSG MHC I / II DKO mice. Day 35 post tumor inoculation, mean tumor volume of 150 mm3was reached and tumor-bearing animals were randomized into various treatment groups such that mean tumor volume per group was within 10% of the overall mean. Seven mice / group were injected intravenously with a single dose of 0.15 xlO6of PrimeR+ ICT cells expressing one of the five LG ICTs described in Example 1 (LG 1 IC, LG 2 IC, LG 3 IC, LG 4 IC, or LG 5 IC), RNP or PBS. The study was repeated with ICTs generated from two different normal donors. Tumor volumes and body weight were recorded bi-weekly. Tumor volume was calculated as per formulaL*W2, where L is tumor length and W is tumor width.

[0422] Blood pharmacokinetics demonstrated the expansion of ICTs on day 14 followed by complete contraction by day 42 post T cell injection. PrimeR+ ICTs in mouse blood were quantified to track expansion of ICTs using flow cytometry with count bright beads for T cell quantification / volume. Mean and SEM plotted.

[0423] Dual Flank Model

[0424] Human ccRCC 786-0 cells were engineered to express either CAR and primeR antigen or CAR only. 2 xlO6786-O-CAR+ and 786-O-CAR+- primeR antigen+ cells were inoculated into the left and right dorsal flank respectively of five- six weeks old, female NSG MHC I / II DKO mice. Day 35 post tumor inoculation, mean tumor volume of 150-200 mm3was reached on each flank and tumor-bearing animals were randomized into various treatment groups such that mean tumor volume per group on the right flank was within 10% of the overall mean. Seven mice / group were injected intravenously with a single dose of 0.25 xlO6or 1 xlO6of PrimeR+ ICT cells, constitutive CAR T cells, RNP or PBS control. Tumor volumes and body weight were recorded bi-weekly. Tumor volume was calculated as per formula L*W2, where L is tumor length and W is tumor width. (B) tumor volumes on the 786-0 CAR antigen only flank (left), and (C) tumor volumes on the 786-O-CAR+ / primeR antigen+ flank (right). Data represents a single donor study with 7 mice per group, mean and SEM plotted.

[0425] Results

[0426] A498 RCC Efficacy Model

[0427] ICTs expressing LG 1-5 Ics showed tumor elimination in a ccRCC model. FIGs. 10A and 10D show the tumor volume post tumor implant in mice treated with ICTs expressing Logic Gates 1-5, RNP or PBS generated from T cells from either donor 1 (FIGs.IPTS / 200259280.1 74Atorney Ref: ANB-228WO10A-C) or donor 2 (FIGs. 10D-F). FIG. 10B and 10E show the total T cells and expansion of the ICTs on day 12 post inoculation followed by contraction by day 21. FIGs IOC and 10F show total T cells expressing the priming receptor on days 12 and 21. In both replicates, the ICT cells demonstrated significant tumor-growth inhibition in mice (P <0.05).

[0428] Dual Flank Model

[0429] The ICTs expressing LG 1-5 Ics showed specificity in a dual flank model (FIG. 11A-B). Greater tumor growth inhibition (TGI) was observed in the dual positive primeR antigen+ / CAR antigen+ flank (FIG. 11B) than the single positive CAR-only flank (FIG. 11 A). Thus, the dual flank xenograft model shows that logic gated circuits (ICTs) more selectively killed tumors that express both CAR antigen and primeR antigen, and not tumors that express CAR antigen alone.Example 3: Synthesis and characterization of primeR and CAR logic gate T cells with TGFBR knockdown or a synthetic pathway activator

[0430] T cells expressing the primeR and CAR logic gate (also called integrated circuit T cells (ICTs)) as well as a synthetic pathway activator and FAS and TGFBR shRNA or FAS, TGFBR2, and PTPN2 shRNA were constructed and characterized. The results are provided in FIGs. 12 and 13. FIG. 12 shows that TGFBR knockdown protected ICT cells against TGFP-mediated inhibition in vitro. FIG. 13 shows that ICT cells are a potent and specific cell therapy in a Renal Cell Carcinoma model in vivo. ICT cells expressing a CAR and primeR logic gate demonstrated significant and specific tumor reduction against tumor cells expressing both CAR antigen and primeR antigen in a dual flank model as described in Example 2. The ICT cells were also more potent than a conventional CAR T cell used as a benchmark.Example 4: In vivo efficacy of primeR and CAR Logic Gate T Cells expressing FAS and TGFBR2 shRNA in RCC models

[0431] Materials and methods

[0432] 786-0 ccRCC model

[0433] 2e6768-0 cells engineered to express ALPG and MSLN proteins were injected into the mouse flank, and mice were staged when tumors reached 300 mm3. ICTs expressing an exemplary, corresponding primeR+CAR logic gate and one of four selected quad shRNAs (FAS / PTPN2 / TGFBR2 / TGFBR2 shRNA, see Example 1) were administered by tail vein injection at a stress dose of 3e5 cells / mouse 28 days after the tumor inoculation. Blood was collected on day 42 after the tumor inoculation for PK analysis (data not shown). Tumor volume was measured for 62 days post T cell injection on day 28 for a total of 90 days.IPTS / 200259280.1 75Atorney Ref: ANB-228WOControl T cells used were unedited (RNP) or ICTs expressing the logic gate with luciferase (dual luc), a FAS / PTPN2 shRNA module, or had FAS / PTPN2 / TFGBR2 knockout via CRISPR. N=7

[0434] A498 ccRCC model

[0435] An additional in vivo model of RCC was developed to assess the efficacy of the ICTs with TGFBR2 shRNA. A498 ccRCC cells express endogenous levels of a first exemplary CAR antigen and were engineered to express physiological levels of a s first exemplary primeR antigen. The engineered A498 cells were injected into the mouse flank and mice were staged when tumors reached 150 mm3. ICTs expressing a primeR+CAR logic gate and a quad shRNA (FAS / PTPN2 / TGFBR2 / TGFBR2 shRNA, SEQ ID NO: 88) as well as the exemplary SPA described in Example 1 were administered by tail vein injection at a stress dose of 3e5 cells / mouse 25 days after the tumor inoculation. Blood was collected on day 39 after the tumor inoculation for PK analysis (data not shown). Tumor volume was measured for 28 days post T cell injection for a total of 54 days. Control T cells used were unedited T cells (RNP) or ICTs expressing the logic gate with FAS / PTPN2 shRNA module and the SPA. N=7.

[0436] Results

[0437] 786-0 ccRCC model

[0438] The ICTs with any of the quad shRNA cassettes demonstrated significantly improved tumor clearance as compared to the control T cells in the 786-0 ccRCC model (FIG. 14). The ICTs expressing only the FAS / PTPN2 shRNA demonstrated intermediate levels of tumor clearance as compared to the control cells and the ICTs expressing the quad shRNAs. Thus, inclusion of TGFBR2 shRNA in the ICTs resulted in increased tumor clearance as compared to ICTs comprising the FAS / PTPN2 shRNA alone. ICTs expressing only the logic gate did not demonstrate an antitumor effect in the 786-0 RCC model at the 3e5 stress dose used in the study. Non-edited T cells did not demonstrate an antitumor effect in the 786-0 RCC model.

[0439] A498 ccRCC model

[0440] The ICTs with any of the quad shRNA cassettes demonstrated significantly improved tumor clearance and potent anti-tumor response as compared to the control T cells in the A498 ccRCC model (FIG. 15). The ICTs expressing only the FAS / PTPN2 shRNA demonstrated improved tumor clearance as compared to the control cells, but not as significant tumor reduction as the cells expressing the quad shRNA. Thus, the inclusion of TGFBR2 shRNA in the ICTs resulted in increased tumor clearance as compared to ICTs IPTS / 200259280.1 76Atorney Ref: ANB-228WOcomprising the FAS / PTPN2 shRNA alone. Non-edited T cells did not demonstrate an antitumor effect in the 786-0 RCC model.

[0441] Thus, this data shows enhancement of anti-tumor efficacy by shRNA knock down of TFGBR2 in two different RCC xenograft models that secrete TGF-B.Example 5: Characterization of quadruple FAS and TGFBR2 shRNA cassette

[0442] Materials and Methods

[0443] FAS shRNA knockdown

[0444] The sequence of a quadruple Fas / TGFBR2 shRNA cassette (Fas / TGFBR2 / TGFBR2 / TGFBR2 / ; F / T / T / T quad shRNA) is provided in SEQ ID NO: 80. Flow cytometry was used to determine surface FAS protein expression and changes in a T cell due to inclusion of the quad shRNA module. Briefly, engineered ICTs expressing the F / T / T / T quad shRNA module were incubated with human Fc block and then stained with Zombie NIR Live / Dead, anti-CD95 PE-Cy7, and an edited cell marker for 30 mins at 4C. The cells were then washed and the mean fluorescence intensity (MFI) of Fas was measured with an Attune NxT flow cytometer. The FAS MFI of edited cells was compared to the FAS MFI of unedited cells to calculate the percent knockdown. ICTs containing an exemplary logic gate with the triple F / T / T shRNA module described in Examples 1-4, the new F / T / T / T quad shRNA module, and a complete Fas KO were compared. The formula used to calculate %KD (percent knockdown) = 100%(l - (MFI PrimeR+) / (MFI PrimeR-)).

[0445] FAS-mediated apoptosis

[0446] To measure resistance to FAS-mediated apoptosis, engineered ICTs were cocultured with anti-FAS agonist antibody at concentrations ranging from 0-20 ug / mL in cytokine free media containing 3% human serum. After a 24 hr incubation at 37°C, T cells were washed and stained with Zombie Aqua Live / Dead, ApoTracker-PE to measure cell viability, and an edited cell marker. The cells were then washed and %Live cells was measured via flow cytometry.

[0447] Phospho- SMAD2 / 3 assessment

[0448] The measurement of phosphorylated SMAD2 / 3 via flow cytometry was used as an indirect measurement of TGFBR2 expression as TGFBR2 mediated-signaling is transduced via SMAD2 and SMAD3 phosphorylation. Briefly, engineered ICTs were incubated with 5 ng / mL TGFP for 15 minutes and then fixed and permeabilized for intracellular staining. T cells were then incubated with pSMAD2 / 3-PE for 30 mins at room temperature, washed, and sampled on an Attune NxT flow cytometer to measure mean fluorescence intensity (MFI) ofIPTS / 200259280.1 77Atorney Ref: ANB-228WOpSMAD2 / 3. The % reduction in SMAD2 / 3 phosphorylation was calculated as the pSMAD2 / 3 MFI of edited T cells divided by the pSMAD 2 / 3 MFI of unedited T cells.

[0449] Repetitive stimulation assay

[0450] To evaluate functional resistance to TGFp, a repetitive stimulation assay was conducted with increasing concentrations of soluble TGFP, 0 pg / ml, 500 pg / ml, 2,000 pg / ml, and 10,000 pg / ml TGFp. Briefly, engineered ICTs were enriched for gene insertion and then cocultured at a 1 :2 E:T ratio with 20,000 PC3 cells that expressed the exemplary priming (e.g., the priming receptor cognate antigen) and cytolytic (e.g., the CAR cognate antigen) antigens. The PC3 cells naturally secrete approximately 500 mg / ml TGFp. Every three days, a rechallenge was performed by transferring a split of the well volume (first rechallenge: 1 / 5 and second rechallenge: 1 / 2) into a new plate containing 20,000 PC3 cells that express the prime and cytolytic antigen. Co-cultures were set up with 4 different TGFP concentrations ranging from 0 to 10,000 pg / mL and TGFP was refreshed at each rechallenge. Tumor control was measured over time by quantifying total area of remaining tumor cells in each well (um2 / well).

[0451] Results

[0452] The F / T / T / T quad shRNA module showed a mean KD of -60% compared to the mean KD of -35% for the F / T / T triple shRNA module. These results demonstrated an unexpected improvement in Fas KD with the F / T / T / T quad shRNA cassette compared to the triple F / T / T shRNA module (FIG. 20). Unexpectedly, the addition of a third TGFBR2 shRNA in the F / T / T / T quad shRNA module increased Fas knockdown by 1.7-fold as compared to the triple shRNA module. This increased FAS knockdown was observed even though no additional FAS shRNA was added to the F / T / T / T quad shRNA module relative to the triple F / T / T shRNA module.

[0453] Engineered ICTs with the F / T / T / T quad shRNA module maintained resistance to anti-FAS agonist antibody up to 20 ug / mL, while shRNA negative controls had significantly lower cell viability at 0.2 ug / mL and above. These results demonstrated a functional benefit of the F / T / T / T quad shRNA module against the inhibitory FAS / FASL pathway (FIG. 21).

[0454] Engineered ICTs with the F / T / T / T quad shRNA module showed a mean pSMAD 2 / 3 % reduction of -60% compared to the mean KD of -50% for the F / T / T shRNA module. The negative control (luciferase targeted shRNA) has close to 0% KD and the sgRNA TGFBR2 KO positive control showed -70% KD. These results showed an improvement in pSMAD 2 / 3 reduction with the new F / T / T / T quad shRNA cassette compared to the tripleIPTS / 200259280.1 78Atorney Ref: ANB-228WOF / T / T shRNA module and indicated stronger downregulation of the TGFBR2 signaling pathway (FIG. 22).

[0455] Repetitive restimulation assay

[0456] Engineered ICTs with the F / T / T / T quad shRNA module sustained tumor control as indicated by lower tumor cell total area across all TGFp amounts tested. The T cells with the F / T / T / T quad shRNA also outperformed the triple F / T / T shRNA module in killing tumor cells as indicated by the lower tumor cell total area in the samples incubated with T cells expressing the F / T / T / T quad shRNA as compared to the T cells expressing the triple F / T / T shRNA. The tumor control gap between the quad and triple shRNAs increased with higher TGFP concentrations, indicating better resistance to TGFP in the T cells expressing the F / T / T / T quad shRNA as compared to the triple F / T / T shRNA. Negative control ICTs (luciferase-targeted) lost control after the second rechallenge at 500 pg / mL or more. Positive control ICTs (TGFBR2 KO) showed the highest potency and resistance to TGFP, confirming TGFP’s impact on tumor suppression (FIG. 23). Thus, the F / T / T / T quad shRNA module resulted in improved, relative T cell cytotoxicity and anti-tumor activity.Example 6: In vitro Characterization of a Logic Gate In Combination With a Quadruple FAS and TGFBR2 shRNA Cassette

[0457] Materials and Methods

[0458] PrimeR / CAR ICT construct expression in T cells

[0459] Integrated circuit T (ICT) cells targeting a second exemplary primeR (priming receptor) antigen and second exemplary CAR antigen were generated as described previously in Example 1.

[0460] Five different exemplary logic gates (LG 1-5) using different priming receptors targeting the second exemplary priming antigen and different chimeric antigen receptors targeting the second exemplary cytolytic antigen were tested with the F / T / T / T quad shRNA module and optionally a SPA.

[0461] Cytotoxicity in 786-O-CAR cells

[0462] ICT cells expressing LG 1-5 ICs were co-cultured with 786-O-CAR cells (786-0-TKO(triple knockout of beta-2 microglobulin)-CAR-H cells engineered to express the second exemplary CAR antigen) at varying E:T ratios for 72 hours at 37°C. Following incubation, cytotoxicity was measured using a luciferase reporter assay. Data are presented as the mean ± standard error mean of 3 donors.

[0463] LG 1 Sensitivity CytotoxicityIPTS / 200259280.1 79Atorney Ref: ANB-228WO

[0464] LG 1 ICT cells were co-cultured with cell lines expressing below average primeR antigen and CAR antigen levels at a 3 : 1 E:T ratio for 72 hours at 37°C. Data are presented as the mean ± standard error mean of 2 donors.

[0465] Cytokine secretion

[0466] To further assess the specificity and function of ICT cells expressing Logic Gate 1 with and without SPAs, supernatants were collected from target tumor cells co-cultured with the ICT cells in a cytotoxicity assay (Effector: Target ratio of 1 : 1, two 48 hour co-culture stimulations). Following incubation, supernatants were collected at endpoint and cytokine release levels were measured using a Luminex assay. Data from 2 donors are shown.

[0467] Results

[0468] To assess prime-dependent activity, cytotoxicity was measured after incubation of the T cells with primeR antigen-only expressing cells (786-O-primeR antigen-H) at various E:T ratios (FIG. 26). Minimal cytotoxic activity was observed across all constructs, with LG 1 exhibiting the least prime antigen-only induced activity.

[0469] The sensitivity of LG 1 to cells expressing primeR antigen below the average patient expression was also assessed using cell lines that exhibit below-average expression levels of CAR antigen and primeR antigen (medium primeR antigen and / or medium CAR antigen). FIG. 27B shows the expression levels of CAR antigen or primeR antigen in the cell lines used for the cytotoxicity sensitivity analysis. As shown in FIG. 27A, LG 1 retained killing activity against cells with medium primeR antigen and medium CAR antigen expression levels.

[0470] Cytokine secretion in T cells expressing LG 1 with and without expression of the SPA was also assessed after incubation with target PC3 tumor cells at a 1:1 ratio. FIG. 28A shows that T cells with LG 1 produced less pro-inflammatory cytokines associated with hyper-immune syndromes such as cytokine release syndrome (CRS) compared to T cells lacking the SPA portion of LG 1. Additionally, FIG. 28B and 28C show the per cell and absolute concentrations for most pro-inflammatory cytokines. Lower expression of most pro-inflammatory cytokines (GM-CSF, IFNy, TNFa, IL-2, IL-6, CXCL10, CCL3 and CCL4) was observed in the T cells expressing the LG 1 comprising the SPA as compared to T cells expressing LG 1 without the SPA. Higher expression of IL-10 was observed in the T cells expressing the LG 1 comprising the SPA as compared to T cells expressing LG 1 without the SPA. This reduction in inflammatory cytokines and increase in IL- 10 expression per cell was unexpected.IPTS / 200259280.1 80Atorney Ref: ANB-228WOExample 7: In vivo efficacy of Logic Gate T cells expressing the

[0471] Materials and Methods

[0472] Dual Flank Model

[0473] Human 786-O-TKO cells were engineered to express either the second exemplary primeR antigen and CAR antigen or CAR antigen only. 786-0- CAR antigen + and 786-0-primeR antigen+ / CAR antigen+ cells were inoculated into the left and right dorsal flank respectively of six-eight weeks old, female NSG MHC I / II DKO mice. Day 45 post tumor inoculation, mean tumor volume of 150-200 mm3was reached on each flank and tumorbearing animals were randomized into various treatment groups such that mean tumor volume per group on the right flank was within 10% of the overall mean. Seven mice / group were injected intravenously with a single dose of 1 xlO6of PrimeR+ ICT cells expressing one of LG 1-5, a CAR antigen constitutive CAR with a dominant negative TGFP receptor (CAR antigen CAR + DNR), RNP or PBS control. Tumor volumes and body weight were recorded bi-weekly. Tumor volume was calculated as per formulaL*W2, where L is tumor length and W is tumor width. Data represents a single donor study with 7 mice per group, mean and SEM plotted.

[0474] Single Flank CAR Antigen Only Model (prime antigen-independent killing assay)

[0475] Human 786-O-TKO cells were engineered to express CAR antigen only. 786-0-CAR antigen+ cells were inoculated into six-eight weeks old, female NSG MHC I / II DKO mice. Day 45 post tumor inoculation, mean tumor volume of 150 mm3was reached and tumor-bearing animals were randomized into various treatment groups such that mean tumor volume per group was within 10% of the overall mean. Seven mice / group were injected intravenously with a single dose of 0.3 xlO6or 1 xlO6of PrimeR+ ICT cells expressing LG 1-5, CAR antigen constitutive CAR with a dominant negative TGFP receptor (CAR antigen CAR + DNR), RNP or PBS control. Tumor volumes and body weight were recorded biweekly. Tumor volume was calculated as per formulaL*W2, where L is tumor length and W is tumor width. Data represents a single donor study with 7 mice per group, mean and SEM plotted.

[0476] Single Flank primeR antigen Only Model (prime antigen-only killing assay)

[0477] Human 786-O-TKO cells were engineered to express primeR antigen only. 786-0-primeR antigen+ / CAR antigen- cells were inoculated into six-eight weeks old, female NSG MHC I / II DKO mice. Day 45 post tumor inoculation, mean tumor volume of 150 mm3was reached and tumor-bearing animals were randomized into various treatment groups such that mean tumor volume per group was within 10% of the overall mean. Seven mice / group were IPTS / 200259280.1 81Atorney Ref: ANB-228WOinjected intravenously with a single dose of 1 xlO6of PrimeR+ ICT cells expressing LG 1-5, CAR antigen constitutive CAR (CAR antigen CAR), RNP or PBS control. Tumor volumes and body weight were recorded bi-weekly. Tumor volume was calculated as per formulaL*W2, where L is tumor length and W is tumor width. Data represents a single donor study with 7 mice per group, mean and SEM plotted.

[0478] Single Flank PC3 Efficacy Model

[0479] Human PC3-TKO (triple knockout of beta-2 microglobulin, primeR antigen, and CAR antigen) cells were engineered to express primeR antigen and CAR antigen. PC3-primeR antigen+ / CAR antigen+ cells were inoculated into six-eight weeks old, male NSG MHC I / II DKO mice. Day 23 post tumor inoculation, mean tumor volume of 150 mm3was reached and tumor-bearing animals were randomized into various treatment groups such that mean tumor volume per group was within 10% of the overall mean. Eight mice / group were injected intravenously with a single dose of 0.75 xlO5or 0.3 xlO6of PrimeR+ ICT cells, CAR antigen targeting chimeric antigen receptor (CAR) with a dominant negative TGFb receptor (CAR antigen CAR +DNR), RNP or PBS control. Tumor volumes and body weight were recorded bi-weekly. Tumor volume was calculated as per formulaL*W2, where L is tumor length and W is tumor width. Data represents a single donor study with 8 mice per group, mean and SEM plotted.

[0480] Results

[0481] Dual Flank Model

[0482] The ICTs expressing LG 1-5 ICs showed on-target, on-tumor and on-target, off-tumor specificity in a dual flank model for two donors. FIGs. 29A and 29B show the tumor volume post-tumor implant in mice treated with ICTs expressing Logic Gates 1-5, a CAR antigen targeting chimeric antigen receptor (CAR) with a dominant negative TGFb receptor (CAR + DNR), RNP (ribonucleoprotein / Cas protein only) as a negative control or PBS generated from T cells from either donor 1 (FIG. 29 A) or donor 2 (FIG. 29B). Greater tumor growth inhibition (TGI) was observed for LG 1 and LG 3 ICs in the dual positive CAR antigen-primeR antigen flank (FIG. 29A and FIG. 29B, right panel) than the single positive CAR antigen-only flank (FIG. 29A and FIG. 29B, left panel). Thus, the dual flank xenograft model shows that logic gate 1 (LG 1) and logic gate 3 (LG 3) IC T cells more selectively killed tumors that express both primeR antigen and CAR antigen, and not tumors that express CAR antigen alone.

[0483] Single Flank CAR Antigen Only Model (prime antigen-independent killing assay)IPTS / 200259280.1 82Atorney Ref: ANB-228WO

[0484] To assess prime antigen independent killing (e.g., killing of cells expressing the CAR antigen cytolytic target antigen without the initial primeR antigen priming to induce CAR expression), a single-flank model with CAR antigen only expressing tumor cells was used.FIGs. 30A and 30B show the tumor volume in mice treated with T cells expressing Logic Gates 1-5, an exemplary CAR antigen CAR+DNR, or RNP. LG 1 and LG 3 T cells showed no significant prime antigen-independent killing of tumor cells in mice treated with either the IxlO6(FIG. 30A) and 0.3xl06(FIG. 30B) doses. Thus, the CAR antigen single flank model demonstrated that T cells expressing LG 1 and LG 3 demonstrated high selectivity with no killing after contacting cells expressing only the cytolytic antigen (CAR antigen).

[0485] Single Flank PrimeR Antigen Only Model (prime antigen-only killing assay)

[0486] To assess killing of prime antigen only expressing cells (e.g., off target killing of cells expressing only the priming antigen), a single-flank model with primeR antigen only expressing tumor cells was used. FIGs. 31A and 31B show the tumor volume in mice treated with T cells expressing Logic Gates 1-5, an exemplary primeR antigen targeting chimeric antigen receptor (primeR antigen CAR) as a positive control, or RNP as a negative control. None of LG 1-5 T cells exhibited prime antigen-only killing at either the IxlO6(FIG. 31A) or 0.3xl06(FIG. 31B) doses. Thus, none of the LG ICs demonstrated cytolytic activity in vivo in the absence of CAR tumor target.

[0487] Taken with the single flank prime antigen independent killing data, this data indicates that LG 1 and LG 3 T cells showed the highest specificity and selectivity for tumors that express both primeR antigen and CAR antigen, and not tumors that express primeR antigen or CAR antigen alone.

[0488] Single Flank PC3 Efficacy Model

[0489] A PC3 prostate cancer cell in vivo model was used to rank the potency of the LG 1-5 T cells. FIGs. 32A and 32B show the tumor volume in mice treated with T cells expressing Logic Gates 1-5, CAR antigen CAR + DNR, RNP or PBS generated from T cells from either donor 1 (FIG. 32A) or donor 2 (FIG. 32B). LG 1, LG 2, and LG 5 T cells reduced PC3 tumor volume in mice after treatment. At the 0.3xl06dose LG 1 was able to clear tumors while LG 3 was not able to inhibit tumor growth. Similar anti-tumor potency trends were observed for LG 1 T cells after mice were treated with a lower 0.75xl05dose in the same model (FIGs. 33A and 33B). Two doses were tested in order to measure dose response of LG 1 T cells and compare to CAR antigen CAR + DNR T cells. LG 1 IC showed a 4-fold increase in anti-tumor potency as compared to the CAR antigen CAR+ DNR positive control (FIGs. 34A and 34B). Kaplan Meier probability of survival curves for mice treated with the IPTS / 200259280.1 83Atorney Ref: ANB-228WOindicated LG T cells or controls in the PC3 tumor model are provided in FIG. 35A and 35B.Comparison of the Kaplan Meier curves in FIGs. 35A and 35B show that mice treated with LG 1 ICs had a more durable response compared to CAR antigen CAR+ DNR positive control.

[0490] While the invention has been particularly shown and described with reference to a preferred embodiment and various alternate embodiments, it will be understood by persons skilled in the relevant art that various changes in form and details can be made therein without departing from the spirit and scope of the invention.

[0491] All references, issued patents and patent applications cited within the body of the instant specification are hereby incorporated by reference in their entirety, for all purposes.IPTS / 200259280.1 84Atorney Ref: ANB-228WOINFORMAL SEQUENCE LISTINGIPTS / 200259280.1 85Atorney Ref: ANB-228WOIPTS / 200259280.1 86Atorney Ref: ANB-228WOIPTS / 200259280.1 87Atorney Ref: ANB-228WOIPTS / 200259280.1 88Atorney Ref: ANB-228WOIPTS / 200259280.1 89Atorney Ref: ANB-228WOIPTS / 200259280.1 90Atorney Ref: ANB-228WOIPTS / 200259280.1 91Atorney Ref: ANB-228WOIPTS / 200259280.1 92Atorney Ref: ANB-228WOIPTS / 200259280.1 93Atorney Ref: ANB-228WOIPTS / 200259280.1 94

Claims

Atorney Ref: ANB-228WOCLAIMS1. One or more nucleic acids comprising four or more nucleic acid sequences comprising the sequences as set forth in SEQ ID NOs: 18, 20, 48, and 59.

2. The one or more nucleic acids of claim 1, wherein the four or more nucleic acid sequences each comprise a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double stranded RNA (dsRNA), or an antisense oligonucleotide.

3. The one or more nucleic acids of claims 1 or 2, wherein the four or more nucleic acid sequences each comprise an shRNA.

4. The one or more nucleic acids of any one of claims 1-3, further comprising one or more microRNA backbones, optionally comprising at least one of miR-E and miR-3G.

5. The one or more nucleic acids of any one of claims 1-4, wherein the one or more nucleic acids comprises a microRNA backbone comprising miR-E, miR-3G, or a miR- 3 G: miR-E: miR-3 G: miR-3 G architecture.

6. The one or more nucleic acids of any one of claims 1-5, wherein the four or more nucleic acid sequences each comprise an shRNA each comprising a guide sequence and a cognate passenger sequence, wherein each shRNA comprises, in a 5’ to 3’ direction,a. the guide sequence as set forth in SEQ ID NOs: 18, 48, and 59 and each corresponding cognate passenger sequence; andb. the cognate passenger sequence corresponding to the guide sequence set forth in SEQ ID NO: 20 and the guide sequence as set forth in SEQ ID NO:

20.

7. The one or more nucleic acids of any one of claims 1-5, wherein the four or more nucleic acid sequences each comprise an shRNA (SI, S2, S3, and S4) each comprising a guide sequence and a cognate passenger sequence, wherein SEQ ID NOs: 18, 20, 48, and 59 are the guide sequences of SI, S2, S3, and S4, respectively, and wherein the guide sequences of SI, S3, and S4 are located 5’ of the cognate passenger sequence, and the guide sequence of S2 is located 3’ of the cognate passenger sequence.

8. The one or more nucleic acids of any one of claims 1-7, wherein the one or more nucleic acids comprise, in a 5’ to 3’ direction, SEQ ID NO: 59, SEQ ID NO: 20, SEQ ID NO: 48, and SEQ ID NO: 18.IPTS / 200259280.1 95Atorney Ref: ANB-228WO9. The one or more nucleic acids of any one of claims 1-8, wherein the one or more nucleic acids comprise the sequence as set forth in SEQ ID NO: 80.

10. One or more nucleic acids comprising four or more nucleic acid sequences comprising the sequences as set forth in SEQ ID NOs: 18, 20, 48, and 59, and a microRNA backbone comprising a miR-3G:miR-E:miR-3G:miR-3G architecture.

11. The one or more nucleic acids of claim 10, wherein the four or more nucleic acid sequences each comprise an shRNA each comprising a guide sequence and a cognate passenger sequence, wherein each shRNA comprises, in a 5’ to 3’ direction,a. the guide sequence as set forth in SEQ ID NOs: 18, 48, and 59 and each corresponding cognate passenger sequence; andb. the cognate passenger sequence corresponding to the guide sequence set forth in SEQ ID NO: 20 and the guide sequence as set forth in SEQ ID NO: 20.

12. The one or more nucleic acids of claim 10, wherein the four or more nucleic acids sequences each comprise an shRNA (SI, S2, S3, and S4) each comprising a guide sequence and a cognate passenger sequence, wherein SEQ ID NOs: 18, 20, 48, and 59 are the guide sequences of SI, S2, S3, and S4, respectively, and wherein the guide sequences of SI, S3, and S4 are located 5’ of the cognate passenger sequence, and the guide sequence of S2 is located 3’ of the cognate passenger sequence.

13. The one or more nucleic acids of claim 10 or 12, wherein the one or more nucleic acids comprise the sequence as set forth in SEQ ID NO: 80.

14. One or more nucleic acids comprising at least four nucleic acid sequences comprising the sequences as set forth in SEQ ID NOs: 18, 48, 52, and 59.

15. The one or more nucleic acids of claim 14, wherein the four or more nucleic acid sequences each comprise a short hairpin RNA (shRNA), a small interfering RNA (siRNA), a double stranded RNA (dsRNA), or an antisense oligonucleotide.

16. The one or more nucleic acids of claims 14 or 15, wherein the four or more nucleic acid sequences each comprise an shRNA.

17. The one or more nucleic acids of any one of claims 14-16, further comprising one or more microRNA backbones, optionally comprising at least one of miR-E and miR-3G.IPTS / 200259280.1 96Atorney Ref: ANB-228WO18. The one or more nucleic acids of any one of claims 14-17, wherein the one or more nucleic acids comprise a microRNA backbone comprising miR-E, miR-3G, or a miR- 3 G: miR-E: miR-3 G: miR-3 G architecture.

19. The one or more nucleic acids of any one of claims 14-18, wherein the four or more nucleic acids sequences each comprise an shRNA each comprising a guide sequence and a cognate passenger sequence, wherein each shRNA comprises, in a 5’ to 3’ direction,a. the guide sequence as set forth in SEQ ID NOs: 18, 48, and 59 and each corresponding cognate passenger sequence; andb. the cognate passenger sequence corresponding to the guide sequence set forth in SEQ ID NO: 52 and the guide sequence as set forth in SEQ ID NO: 52.

20. The one or more nucleic acids of any one of claims 14-18, wherein the four or more nucleic acid sequences each comprise an shRNA (SI, S2, S3, and S4) each comprising a guide sequence and a cognate passenger sequence, wherein SEQ ID NOs: 18, 48, 52, and 59 are the guide sequences of SI, S2, S3, and S4, respectively, and wherein the guide sequences of SI, S3, and S4 are located 5’ of the cognate passenger sequence, and the guide sequence of S2 is located 3’ of the cognate passenger sequence.

21. The one or more nucleic acids of any one of claims 14-20, wherein the one or more nucleic acids comprise, in a 5’ to 3’ direction, SEQ ID NO: 59, SEQ ID NO: 52, SEQ ID NO: 48, and SEQ ID NO: 18.

22. The one or more nucleic acids of any one of claims 14-21, wherein the one or more nucleic acids comprise the sequence as set forth in SEQ ID NO: 84.

23. One or more nucleic acids comprising four or more nucleic acid sequences comprising the sequences as set forth in SEQ ID NOs: 18, 48, 52, and 59, and a microRNA backbone comprising a miR-3G:miR-E:miR-3G:miR-3G architecture.

24. The one or more nucleic acids of claim 23, wherein the four or more nucleic acids sequences each comprise an shRNA each a guide sequence and a cognate passenger sequence, wherein each shRNA comprises, in a 5’ to 3’ direction,a. the guide sequence as set forth in SEQ ID NOs: 18, 48, and 59 and each corresponding cognate passenger sequence; andb. the cognate passenger sequence corresponding to the guide sequence set forth in SEQ ID NO: 52 and the guide sequence as set forth in SEQ ID NO:

52. IPTS / 200259280.1 97Atorney Ref: ANB-228WO25. The one or more nucleic acids of claim 23, wherein the four or more nucleic acid sequences each comprise an shRNA (SI, S2, S3, and S4) each comprising a guide sequence and a cognate passenger sequence, wherein SEQ ID NOs: 18, 48, 52, and 59 are the guide sequences of SI, S2, S3, and S4, respectively, and wherein the guide sequences of SI, S3, and S4 are located 5’ of the cognate passenger sequence, and the guide sequence of S2 is located 3’ of the cognate passenger sequence.

26. The one or more nucleic acids of claim 23 or 25, wherein the one or more nucleic acids comprise the sequence as set forth in SEQ ID NO: 84.

27. A nucleic acid comprising the sequence as set forth in SEQ ID NO: 80.

28. A nucleic acid comprising the sequence as set forth in SEQ ID NO: 84.

29. The one or more nucleic acids of any one of claims 1-26 or the nucleic acid of claims 27-28, further comprising at least an additional nucleic acid sequence selected from the group consisting of the sequences set forth in SEQ ID NOs: 3-17, 19-47, 49-58, or 60-66.

30. The one or more nucleic acids of any one of claims 1-29, wherein the nucleic acid reduces expression of Transforming Growth Factor Beta Receptor 2 (TGFBR2) in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.

31. The one or more nucleic acids of any one of claims 1-30, wherein the nucleic acid reduces expression of Fas Cell Surface Death Receptor (FAS) in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.

32. The one or more nucleic acids of any one of claims 1-30, wherein the nucleic acid reduces expression of Fas Cell Surface Death Receptor (FAS) in a cell by at least about 1.1-fold, 1.2-fold, 1.25-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, or 2-fold as much as compared to a control cell that comprises a nucleic acid comprising only the sequences as set forth in SEQ ID NOs: 18, 48, and 59.

33. The one or more nucleic acids of any one of claims 1-31, wherein the nucleic acid reduces expression of TFGBR2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% and reduces expression of FAS in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, IPTS / 200259280.1 98Atorney Ref: ANB-228WO75%, 80%, 85%, 90%, 95%, or 99%, each as compared to a control cell that does not comprise the respective nucleic acid.

34. The one or more nucleic acids of any one of claims 1-33, wherein the nucleic acid reduces phosphorylation of SMAD 2 and / or SMAD 3 (SMAD2 / 3) in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.

35. The one or more nucleic acids of any one of claims 1-34, wherein the nucleic acid(s) further comprises at least one of a nucleotide sequence encoding a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to a first antigen and a nucleotide sequence encoding a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to a second antigen, wherein the first antigen and the second antigen are distinct.

36. The one or more nucleic acids of claim 35, wherein the nucleic acid comprises, in a 5’ to 3’ direction:a. the CAR;b. the one or more nucleic acids of any one of claims 1 to 35; andc. the priming receptor.

37. The one or more nucleic acids of claim 35, wherein the nucleic acid comprises, in a 5’ to 3’ direction:a. the priming receptor;b. the one or more nucleic acids of any one of claims 1 to 35; andc. the CAR.

38. The one or more nucleic acids of any one of claims 1 to 37, wherein the one or more nucleic acids further comprises a 5’ homology directed repair arm and / or a 3’ homology directed repair arm complementary to an insertion site in a host cell chromosome.

39. The one or more nucleic acids of claim 38, wherein the one or more nucleic acids comprises the 5’ homology directed repair arm and the 3’ homology directed repair arm.

40. The one or more nucleic acids of any one of claims 1-39, wherein each of the one or more nucleic acids are encoded on a plurality of different nucleic acid molecules.IPTS / 200259280.1 99Atorney Ref: ANB-228WO41. The one or more nucleic acids of any one of claims 1-39, wherein each of the one or more nucleic acids are encoded on the same nucleic acid molecule.

42. The one or more nucleic acids of any one of claims 1-41, wherein the one or more nucleic acids are incorporated into a one or more expression cassettes or expression vectors.

43. The one or more nucleic acids of claim 42, wherein the expression cassette or the expression vector further comprises a constitutive promoter upstream of the one or more nucleic acids .

44. The one or more nucleic acids of any one of claims 1-43, wherein the expression vector is a non-viral vector.

45. An expression vector comprising the one or more nucleic acid(s) of any one of claims 1-44.

46. The expression vector of claim 45, wherein the expression vector is a non-viral vector.

47. The vector of claim 45 or 46, wherein the 5’ and 3’ ends of the one or more nucleic acid(s) comprise one or more nucleotide sequences that are homologous to genomic sequences flanking an insertion site in a genome of a cell.

48. The vector of claim 47, wherein the insertion site is located at a genomic safe harbor (GSH) locus or a T Cell Receptor Alpha Constant (TRAC) locus.

49. The vector of claim 48, wherein the GSH locus is the GS94 locus.

50. An immune cell comprising the one or more nucleic acids of any one of claims 1-44 or the vector of any one of claims 45-49.

51. The immune cell of claim 50, wherein the one or more nucleic acids reduces expression of TGFBR2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the first nucleic acid.

52. The immune cell of claim 51, wherein expression of TGFBR2 in a cell is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the nucleic acid.IPTS / 200259280.1 100Atorney Ref: ANB-228WO53. The immune cell of any one of claims 50-52, wherein the one or more nucleic acids reduces expression of FAS in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the nucleic acid.

54. The immune cell of claim 53, wherein expression of FAS in a cell is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the nucleic acid.

55. The immune cell of claim 53, wherein expression of FAS in a cell is reduced by at least about 1.1-fold, 1.2-fold, 1.25-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, or 2-fold as much as compared to a control cell that comprises a nucleic acid comprising only the sequences as set forth in SEQ ID NOs: 18, 48, and 59.

56. The immune cell of any one of claims 50-55, wherein the one or more nucleic acids reduces expression of TFGBR2 in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% and reduces expression of FAS in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99%, each as compared to a control cell that does not comprise the respective nucleic acid.

57. The immune cell of any one of claims 50-56, wherein the nucleic acid reduces phosphorylation of SMAD 2 and / or SMAD 3 (SMAD2 / 3) in a cell by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.

58. The immune cell of any one of claims 50-57, wherein expression of TGFBR2 and / or FAS is determined by a nucleic acid assay or a protein assay.

59. The immune cell of claim 58, wherein the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.

60. The immune cell of claim 58, wherein the protein assay comprises at least one of immunoblotting, fluorescence activated cell sorting, flow-cytometry, magnetic-activated cell sorting, or affinity-based cell separation.

61. The immune cell of any one of claims 50 to 60, wherein the cell further comprises a priming receptor comprising a first extracellular antigen-binding domain that specifically IPTS / 200259280.1 101Atorney Ref: ANB-228WObinds to a first antigen and a chimeric antigen receptor (CAR) comprising a second extracellular antigen-binding domain that specifically binds to a second antigen.

62. The immune cell of any one of claims 50 to 61, wherein the immune cell is a primary human immune cell.

63. The immune cell of any one of claims 50-62, wherein the primary immune cell is a natural killer (NK) cell, a natural killer T (NKT) cell, a T cell, a yb T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, a T cell progenitor, or an induced pluripotent stem cell (iPSC).

64. The immune cell of any one of claims 50-63, wherein the primary immune cell is a primary T cell.

65. The immune cell of any one of claims 50-64, wherein the primary immune cell is a primary human T cell.

66. The immune cell of any one of claims 50-65, wherein the immune cell is virus-free.

67. The immune cell of any one of claims 50-66, wherein the immune cell is an autologous immune cell.

68. The immune cell of any one of claims 50-66, wherein the immune cell is an allogeneic immune cell.

69. A primary immune cell comprising the one or more nucleic acids of any one of claims 1-44 or the vector of any one of claims 45-49, and wherein the primary immune cell does not comprise a viral vector for introducing the one or more nucleic acid(s) into the primary immune cell.

70. A viable, virus-free, primary cell comprising a ribonucleoprotein (RNP) complex and one or more one or more nucleic acid(s), wherein the RNP comprises a nuclease domain and a guide RNA, wherein the one or more nucleic acids comprise the one or more nucleic acid(s) of any one of claims 1-44 or the vector of any one of claims 45-49, and wherein the 5’ and 3’ ends of the one or more nucleic acid(s) comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the genome of the primary cell.

71. The cell of claims 69 or 70, wherein the cell further comprises a priming receptor comprising a first extracellular antigen-binding domain that specifically binds to a first antigen and a chimeric antigen receptor (CAR) comprising a second extracellular antigenbinding domain that specifically binds to a second antigen, wherein the first antigen and the second antigen are distinct.IPTS / 200259280.1 102Atorney Ref: ANB-228WO'll. A population of cells comprising one or more of the immune cells of any one of claims 50-71.

73. A pharmaceutical composition comprising the immune cell of any one of claims SO-71 or the population of cells of claim 72, and a pharmaceutically acceptable excipient.

74. A pharmaceutical composition comprising the one or more nucleic acids of any one of claims 1 to 44 or the vector of any one of claims 45-49, and a pharmaceutically acceptable excipient.

75. A method of editing an immune cell, comprising:a. providing a ribonucleoprotein (RNP) complex and one or more nucleic acid(s), wherein the RNP comprises a nuclease domain and a guide RNA, wherein the one or more nucleic acid(s) comprises the one or more nucleic acid(s) of any one of claims 1-44, and wherein the 5’ and 3’ ends of the one or more nucleic acid(s) comprise nucleotide sequences that are homologous to genomic sequences flanking an insertion site in the genome of the immune cell;b. non-virally introducing the RNP complex and nucleic acid(s) into the immune cell, wherein the guide RNA specifically hybridizes to a target region of the genome of the primary immune cell, and wherein the nuclease domain cleaves the target region to create the insertion site in the genome of the immune cell; andc. editing the immune cell via insertion of the one or more nucleic acid(s) of any one of claims 1-44 into the insertion site in the genome of the immune cell.

76. The method of claim 75, wherein non-virally introducing comprises electroporation.

77. The method of claim 75 or 76, wherein the nuclease domain comprises a CRISPR-associated endonuclease (Cas), optionally a Cas9 nuclease.

78. The method of any one of claims 75 to 77, wherein the target region of the genome of the cell is a genomic safe harbor (GSH) locus or a T Cell Receptor Alpha Constant (TRAC) locus.

79. The method of claim 78, wherein the GSH locus is the GS94 locus.IPTS / 200259280.1 103Atorney Ref: ANB-228WO80. The method of any one of claims 75 to 79, wherein the one or more nucleic acid(s) is a double-stranded one or more nucleic acid(s) or a single-stranded one or more nucleic acid(s).

81. The method of any one of claims 75 to 80, wherein the one or more nucleic acid(s) is a linear one or more nucleic acid(s) or a circular one or more nucleic acid(s), optionally wherein the circular one or more nucleic acid(s) is a plasmid.

82. The method of any one of claims 75 to 81, wherein the immune cell is a primary human immune cell.

83. The method of any one of claims 75 to 82, wherein the immune cell is an autologous immune cell.

84. The method of any one of claims 75 to 82, wherein the immune cell is an allogeneic immune cell.

85. The method of any one of claims 75 to 83, wherein the immune cell is a natural killer (NK) cell, a natural killer T (NKT) cell, a T cell, a y6 T cell, a CD8+ T cell, a CD4+ T cell, a primary T cell, a T cell progenitor, or an induced pluripotent stem cell (iPSC).

86. The method of any one of claims 75 to 85, wherein the immune cell is a primary T cell.

87. The method of any one of claims 75 to 86, wherein the immune cell is a primary human T cell.

88. The method of any one of claims 75 to 87, wherein the immune cell is a primary human CD8+ T cell or a CD4+ T cell.

89. The method of any one of claims 75 to 88, wherein the immune cell is virus-free or does not comprise a viral vector.

90. The method of any one of claims 75 to 89, further comprising obtaining the immune cell from a patient and introducing the one or more nucleic acid(s) in vitro.

91. A method of treating a disease in a subject comprising administering the immune cell(s) of any one of claims 50-72 or the pharmaceutical composition of claims 73 or 74 to the subject.

92. The method of claim 91, wherein the disease is cancer.

93. The method of claim 92, wherein the cancer is a solid cancer or a liquid cancer.IPTS / 200259280.1 104Atorney Ref: ANB-228WO94. The method of claim 92 or 93, wherein the cancer is colorectal cancer, ovarian cancer, fallopian cancer, primary peritoneal cancer, uterine cancer, mesothelioma, cervical cancer, pancreatic, kidney cancer, lung cancer, prostate cancer, bladder cancer, breast cancer, liver cancer, or brain cancer.

95. The method of any one of claims 91-94, wherein the administration of the cell(s) enhances an immune response.

96. The method of claim 95, wherein the enhanced immune response is an adaptive immune response.

97. The method of claim 95, wherein the enhanced immune response is an innate immune response.

98. A method of enhancing an immune response in a subject comprising administering the immune cell(s) of any one of claims 50-72 or the pharmaceutical composition of claims 73 or 74 to the subject.

99. The method of claim 98, wherein the enhanced immune response is an adaptive immune response.

100. The method of claim 99, wherein the enhanced immune response is an innate immune response.

101. The method of any one of claims 91-100, wherein expression of TGFBR2 in the immune cell is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.

102. The method of any one of claims 91-101, wherein expression of FAS in the immune cell is reduced by at least 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 75%, 80%, 85%, 90%, 95%, or 99% as compared to a control cell that does not comprise the respective nucleic acid.

103. The method of any one of claims 91-101, wherein expression of FAS in the immune cell is reduced by at least about 1.1 -fold, 1.2-fold, 1.25-fold, 1.3-fold, 1.4-fold, 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, or 2-fold as much as compared to a control cell that comprises a nucleic acid comprising only the sequences as set forth in SEQ ID NOs: 18, 48, and 59.IPTS / 200259280.1 105Atorney Ref: ANB-228WO104. The method of any one of claims 101-103, wherein expression of TGFBR2 and / or FAS in the immune cell is determined by a nucleic acid assay or a protein assay.

105. The method of claim 104, wherein the nucleic acid assay comprises at least one of polymerase chain reaction (PCR), quantitative PCR (qPCR), RT-qPCR, microarray, gene array, or RNAseq.

106. The method of claim 104, wherein the protein assay comprises at least one of immunoblotting, fluorescence activated cell sorting, flow-cytometry, magnetic-activated cell sorting, or affinity-based cell separation.

107. The method of any one of claims 91-106, further comprising administering an immunotherapy to the subject concurrently with the immune cell or subsequently to the immune cell.IPTS / 200259280.1 106

Images