Steroid c14β hydroxylase, expression vector, engineered bacterium, and use thereof

Abstract

The present invention relates to the technical field of bioengineering, and relates to a steroid C14β hydroxylase, an expression vector, an engineered bacterium, and a use thereof. The amino acid sequence of the hydroxylase is selected from the sequence as shown in SEQ ID No. 9 or a sequence modified on the basis of the sequence, or a sequence having at least 58% homology with these sequences. The hydroxylation of a steroid C14β is directly completed in one step, and efficient and specific hydroxylation of a steroid compound C14β can be achieved, thereby solving the problem that a C14β hydroxylated steroid cannot be directly synthesized.

Description

A steroidal C14β hydroxylase, its expression vector, engineered bacteria, and their applications Technical Field

[0001] This invention belongs to the field of bioengineering technology and relates to a steroidal C14β hydroxylase, an expression vector, an engineered bacterium, and their applications. Background Technology

[0002] Steroids, also known as sterols, are a class of compounds with a cyclopentane-polyhydrophenanthrene core. These compounds play a crucial role in the treatment of various critical illnesses, including organ transplantation and severe infections, due to their significant anti-inflammatory, anti-infective, and anti-allergic pharmacological effects.

[0003] Cardiac glycosides are a unique class of natural steroidal compounds with potent biological activity against Na+ / K+-ATPase, a ubiquitous enzyme crucial for animals. Represented by digoxin, digitoxin, and deslanoside, cardiac glycosides have become among the most successful plant-derived drug compounds in human history due to their ability to treat congenital heart failure. In addition to their cardiotonic activity, cardiac glycosides have also shown potential in treating atrial arrhythmias, various cancers, and other chronic diseases.

[0004] A key characteristic of cardiac glycosides is the presence of a β-configuration hydroxyl group at the C14 position of the steroid backbone. Since introducing a hydroxyl group at the C14 position via chemical synthesis remains challenging, many researchers have focused on biosynthesis. Although cardiac glycosides are widely distributed in plants and animals, steroidal C14 β-hydroxylases suitable for production applications have not yet been identified. In 2022, Huiming Ge and colleagues conducted extensive metabolomics and transcriptomics studies on the plant *Calotropis gigantea* and the animal *Bufo gargarizans*, but only identified a cytochrome P450 C14 α-hydroxylase with low enzymatic activity (Zhao et al., 2022). Similarly, Xudong Qu and colleagues identified a C14 α-hydroxylase (CYP14A) from *Cochliobolus lunatus* (Song et al., 2023). However, C14β-hydroxylated steroids cannot be directly produced through these steroid C14α-hydroxylases.

[0005] To obtain C14β-hydroxylated steroids, they employed a chemoenzymatic synthesis method. First, C14α-hydroxylated steroids were obtained through biocatalysis using C14α-hydroxylase. Then, the biosynthesized C14α-hydroxylated steroids were converted to C14β-hydroxylated steroids via chemical synthesis through dehydration and hydration. The biocatalytic process produced numerous byproducts, and this was even more pronounced during the chemical conversion, resulting in a low final yield of C14β-hydroxylated steroids. Currently, highly selective steroid C14β-hydroxylases are lacking; therefore, the development of such enzymes has significant application value.

[0006] Furthermore, the research and application of steroid C14β hydroxylases will help promote green biomanufacturing technologies for steroid drug production, reduce environmental impact, and improve production efficiency, which is of great significance for the sustainable development of the steroid drug industry. By utilizing synthetic biology techniques to create microbial cell factories capable of efficiently synthesizing steroids de novo, the industrial model of steroid pharmaceuticals can be completely transformed, achieving green manufacturing of steroid drugs. Summary of the Invention

[0007] In view of the above-mentioned shortcomings of the prior art, the technical problem to be solved by the present invention is how to obtain a highly efficient steroid C14β hydroxylase that can directly complete the hydroxylation of steroid C14β in one step, thereby achieving efficient and specific hydroxylation of steroid compounds C14β and solving the problem of not being able to directly synthesize C14β hydroxylated steroids.

[0008] In a first aspect, the present invention provides a steroidal C14β hydroxylase, which adopts the following technical solution:

[0009] The first type of steroidal C14β hydroxylase has an amino acid sequence selected from the sequence shown in SEQ ID No. 9, or a sequence having at least 58% homology with SEQ ID No. 9, or a sequence that, when modified from the sequence shown in SEQ ID No. 9, still has steroidal C14β hydroxylase activity.

[0010] Furthermore, the nucleic acid sequence encoding the amino acid shown in SEQ ID No. 9 is shown in SEQ ID No. 1.

[0011] The second type of steroidal C14β hydroxylase has an amino acid sequence selected from the sequence shown in SEQ ID No. 10 or a sequence with at least 58% homology to SEQ ID No. 10. The sequence shown in SEQ ID No. 10 is based on the sequence shown in SEQ ID No. 9 with 1-38 amino acids removed from the N-terminus, which improves protein water solubility and protein yield in prokaryotic expression.

[0012] Furthermore, the nucleic acid sequence encoding the amino acid shown in SEQ ID No. 10 is shown in SEQ ID No. 2.

[0013] The third type of steroidal C14β hydroxylase has an amino acid sequence selected from the sequence shown in SEQ ID No. 11 or a sequence with at least 58% homology to SEQ ID No. 11. The sequence shown in SEQ ID No. 11 is based on the sequence shown in SEQ ID No. 9 with a Trigger Factor tag fused to the N-terminus, which greatly improves protein water solubility and protein yield in prokaryotic expression.

[0014] Furthermore, the nucleic acid sequence encoding the amino acid shown in SEQ ID No. 11 is shown in SEQ ID No. 3.

[0015] The fourth type of steroidal C14β hydroxylase has an amino acid sequence selected from the sequence shown in SEQ ID No. 12 or a sequence with at least 58% homology to SEQ ID No. 12. The sequence shown in SEQ ID No. 12 is based on the sequence shown in SEQ ID No. 9 with 1-38 amino acids removed from the N-terminus and a Trigger Factor tag fused to the N-terminus, which greatly improves protein water solubility and protein yield in prokaryotic expression.

[0016] Furthermore, the nucleic acid sequence encoding the amino acid shown in SEQ ID No. 12 is shown in SEQ ID No. 4.

[0017] The fifth type of steroidal C14β hydroxylase has an amino acid sequence selected from the sequences shown in SEQ ID No. 13, SEQ ID No. 14, and SEQ ID No. 15, or sequences having at least 58% homology with SEQ ID No. 13, SEQ ID No. 14, and SEQ ID No. 15, or sequences that, after modification of the sequences shown in SEQ ID No. 13, SEQ ID No. 14, and SEQ ID No. 15, still possess steroidal C14β hydroxylase activity. SEQ ID No. 13, SEQ ID No. 14, and SEQ ID No. 15 were obtained by screening other species using the protein sequences or conserved domains of the first type of steroidal C14β hydroxylase, and have at least 58% homology with the first type of steroidal C14β hydroxylase and possess steroidal C14β hydroxylase activity.

[0018] Furthermore, the nucleic acid sequences encoding the amino acids shown in SEQ ID No. 13, SEQ ID No. 14 and SEQ ID No. 15 are shown in SEQ ID No. 5, SEQ ID No. 6 and SEQ ID No. 7.

[0019] In a second aspect, the present invention provides an expression vector for steroidal C14β hydroxylase, which can express steroidal C14β hydroxylase.

[0020] The first type of expression vector is a prokaryotic expression vector, which can be used to express and purify steroid C14β hydroxylase or to achieve the production of 14β hydroxypregnenolone through biotransformation.

[0021] Furthermore, the prokaryotic expression vectors include, but are not limited to, the pET series and the pCold series vectors.

[0022] The second type of expression vector is a eukaryotic expression vector, which can be produced using the synthetic biology of 14β-hydroxypregnenolone in plant chassis.

[0023] Furthermore, eukaryotic expression vectors include the pEAQ series vectors.

[0024] A third aspect of the present invention provides an engineered bacterium comprising the expression vector described in the second aspect above.

[0025] More preferably, the engineered bacteria are Escherichia coli or Agrobacterium.

[0026] More preferably, the Agrobacterium is Agrobacterium tumefaciens.

[0027] In a fourth aspect, the invention provides the application of the engineered bacteria described in the third aspect for the synthesis of 14β-hydroxypregnenolone.

[0028] In a fifth aspect, the present invention provides a method for synthesizing 14β-hydroxypregnenolone, wherein engineered Escherichia coli is used to produce 14β-hydroxypregnenolone through fermentation biotransformation of pregnenolone, wherein the engineered Escherichia coli contains the expression vector described in the second aspect above.

[0029] In a sixth aspect, the present invention provides a method for synthesizing 14β-hydroxypregnenolone, wherein 14β-hydroxypregnenolone is synthesized in a plant chassis using an engineered strain of Agrobacterium tumefaciens, the engineered strain of Agrobacterium tumefaciens comprising the expression vector described in the second aspect above.

[0030] A seventh aspect of the present invention provides a method for screening and functionally validating other steroidal C14β hydroxylases in other species using existing steroidal C14β hydroxylases. This method allows for the retrieval of potential steroidal C14β hydroxylases in other species and their functional verification. "Other species" here refers to species other than those disclosed or functionally verified in this application, and "other steroidal C14β hydroxylases" refers to steroidal C14β hydroxylases other than those disclosed or functionally verified in this application.

[0031] By implementing the above technical solution, the present invention has the following beneficial effects:

[0032] 1. This invention is the first to discover a C14β-hydroxylase, rather than a C14α-hydroxylase, involved in the biosynthesis of cardiac glycosides in plants. Using the C14β-hydroxylase described in this invention, a steroid substrate (pregnenolone) can be directly converted into a C14β-hydroxylated steroid (14β-hydroxy-pregnenolone) through a one-step in vitro enzymatic reaction or biotransformation.

[0033] 2. The C14β-hydroxylase described in this invention can directly obtain 14β-hydroxy-pregnenolone, which can greatly shorten the production process of 14β-hydroxylated steroids, simplify production steps, improve the yield of final products, and save production raw materials.

[0034] 3. This invention designs three feasible application methods for the C14β-hydroxylase: in vitro enzymatic catalysis, engineered bacterial biotransformation, and plant chassis production, to achieve the production of 14β-hydroxy-pregnenolone. This contributes to promoting green biomanufacturing technology for steroid drug production, reducing environmental impact, and improving production efficiency, which is of great significance for the sustainable development of the steroid drug industry. Attached Figure Description

[0035] Figure 1 is an SDS-PADE electrophoresis gel image of the 14βPH purified protein prepared in Example 1 of the present invention;

[0036] Figure 2 shows the in vitro enzyme activity of 14βPH purified protein with pregnenolone as a substrate in Example 2 of the present invention by LC-MS detection.

[0037] Figure 3 shows the product 14β-hydroxypregnenolone from Example 2 of the present invention. 1 1H NMR spectrum (600MHz, DMSO-d6);

[0038] Figure 4 shows the product 14β-hydroxypregnenolone from Example 2 of the present invention. 13 C10 NMR spectrum (600MHz, DMSO-d6);

[0039] Figure 5 is a DEPT spectrum (600 MHz, DMSO-d6) of the product 14β-hydroxypregnenolone in Example 2 of the present invention.

[0040] Figure 6 is the COSY spectrum (600MHz, DMSO-d6) of the product 14β-hydroxypregnenolone in Example 2 of the present invention.

[0041] Figure 7 is the HSQC spectrum (600MHz, DMSO-d6) of the product 14β-hydroxypregnenolone in Example 2 of the present invention.

[0042] Figure 8 is the HMBC spectrum (600MHz, DMSO-d6) of the product 14β-hydroxypregnenolone in Example 2 of the present invention.

[0043] Figure 9 is a NOESY spectrum (600MHz, DMSO-d6) of the product 14β-hydroxypregnenolone in Example 2 of the present invention.

[0044] Figure 10 is a high-resolution mass spectrometry (HRMS) spectrum of the product 14β-hydroxypregnenolone in Example 2 of the present invention;

[0045] Figure 11 shows the change in relative activity of C14β-hydroxylase catalyzing pregnenolone as a function of pH in an embodiment 3 of the present invention.

[0046] Figure 12 shows the change in the relative activity of C14β hydroxylase catalyzing pregnenolone as a function of temperature in an embodiment 3 of the present invention.

[0047] Figure 13 shows the enzyme kinetic parameters of C14β hydroxylase catalyzing pregnenolone in an embodiment 3 of the present invention;

[0048] Figure 14 shows the in vitro enzyme activity LC-MS detection results of C14β hydroxylase using pregnenolone, progesterone, and pregnanolone as substrates under optimal reaction conditions in Example 4 of the present invention.

[0049] Figure 15 shows the in vitro enzyme activity LC-MS detection results of C14β hydroxylase using 5 androstanes and 3 estrostanes as substrates in Example 4 of the present invention under optimal reaction conditions;

[0050] Figure 16 shows the LC-MS results of the supernatant and pellet of the fermentation broth of the engineered Escherichia coli with steroidal C14β hydroxylase as a substrate in Example 5 of the present invention.

[0051] Figure 17 shows the LC-MS results of metabolites in tobacco leaves that transiently expressed the C14β hydroxylase gene in Example 6 of the present invention;

[0052] Figure 18 shows the tobacco subcellular localization results of 14βPH, t14βPH and upstream gene CYP87N10 in an embodiment 6 of the present invention.

[0053] Figure 19 is a phylogenetic tree of 14βPH and its homologous genes in one embodiment 7 of the present invention.

[0054] Figure 20 shows the LC-MS detection of metabolites in tobacco leaves that transiently express candidate genes for steroidal C14β hydroxylase from other species in an embodiment 7 of the present invention. Detailed Implementation

[0055] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0056] Experimental methods not specifically described in the following examples are generally performed under standard conditions, such as those described in Sambrook et al. Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.

[0057] The steroid 14β-hydroxylases involved in the following examples, along with their corresponding abbreviations, amino acids, and nucleotide sequences, are shown in Table 1.

[0058] Table 1. Steroidal 14β-hydroxylases and their corresponding abbreviations, amino acid and nucleotide sequences.

[0059] Example 1: Preparation of steroidal C14β-hydroxylase protein

[0060] Total RNA was extracted from cardiac glycoside-rich tissues (old stems or roots) of *E. coli* using the Trizol RNA Extraction Kit (Sangon Biotech, China), and reverse transcribed into cDNA using the HiScript II 1st Strand cDNA Synthesis Kit (Vazyme, China). Steroid 14β-hydroxylase and its truncated form were amplified by PCR using corresponding primers and Phanta Flash Super-Fidelity DNA Polymerase (Vazyme, China). The gene fragments were then ligated into the multiple cloning sites of the conventional *E. coli* protein expression vectors pET28a(+) and pCold-TF, yielding recombinant *E. coli* expression plasmids pET28a-14βPH, pET28a-t14βPH, pCold-TF-14βPH, and pCold-TF-t14βPH. These plasmids were then transformed into *E. coli* Rosetta(DE3) using standard methods to obtain strains expressing the corresponding proteins.

[0061] The primer sequence used (5'-3') is as follows: pET28a-14βPH-F:

[0062] CAGCAAATGGGTCGCGGATCCATGGCTATTCGAATGCCCACC,(SEQ ID No.17);

[0063] pET28a-14βPH-R:

[0064] CTCGAGTGCGGCCGCAAGCTTTCAAATCCCGCAATAGGCTTT,(SEQ ID No.18)。

[0065] pET28a-t14βPH-F:

[0066] CAGCAAATGGGTCGCGGATCCATGCTTGAGAACCATGGCCG,(SEQ ID No.19);

[0067] pET28a-t14βPH-R:

[0068] CTCGAGTGCGGCCGCAAGCTTTCAAATCCCGCAATAGGCTTT,(SEQ ID No.20)。

[0069] pCold-TF-14βPH-F:

[0070] GAAGGTAGGCATATGGAGCTCATGGCTATTCGAATGCCCACC,(SEQ ID No.21);

[0071] pCold-TF-14βPH-R:

[0072] AGACTGCAGGTCGACAAGCTTTCAAATCCCGCAATAGGCTTT,(SEQ ID No.22)。

[0073] pCold-TF-t14βPH-F:

[0074] GAAGGTAGGCATATGGAGCTCATGCTTGAGAACCATGGCCG,(SEQ ID No.23);

[0075] pCold-TF-t14βPH-R:

[0076] AGACTGCAGGTCGACAAGCTTTCAAATCCCGCAATAGGCTTT,(SEQ ID No.24)。

[0077] LB broth containing *E. coli* expressing plasmids pET28a-14βPH, pET28a-t14βPH, pCold-TF-14βPH, and pCold-TF-t14βPH was cultured at 37°C for 2–4 hours until OD600 = 0.4–0.6. Then, 0.5 mM IPTG was added, and expression was induced at 16°C and 160 rpm for 16–18 hours. The bacterial culture was centrifuged and sonicated to obtain crude protein. The crude protein was purified using a conventional Ni column purification method. SDS-PAGE gel electrophoresis was used to analyze the purified protein. The results showed that the molecular weights of the expressed proteins 14βPH, t14βPH, TF-14βPH, and TF-t14βPH were consistent with the predicted values. The SDS-PAGE gel electrophoresis image of the purified protein is shown in Figure 1.

[0078] Using bovine serum albumin as the standard protein, the protein concentration was determined by the Coomassie brilliant blue method. The purified protein concentrations of 14βPH, t14βPH, TF-14βPH, and TF-t14βPH were 2.23 mg / mL, 2.36 mg / mL, 14.44 mg / mL, and 17.04 mg / mL, respectively. It was calculated that 6.85 mg, 11.81 mg, 72.20 mg, and 85.20 mg of purified protein could be obtained per liter of culture medium through induction, respectively.

[0079] Based on the protein electrophoresis gel images and protein concentration measurements, it can be seen that the full-length 14βPH protein without the solubilization tag has the lowest yield, and the purified protein contains a lot of impurities; the truncated t14βPH protein yield is higher than the full-length protein; and the fusion of the TF solubilization tag can greatly improve the protein yield and purity.

[0080] Example 2: Detection of steroid C14β-hydroxylase activity

[0081] 1) In vitro enzyme activity reaction system

[0082] The reaction was carried out in 50 mM Tris-HCl buffer (containing 200 mM NaCl, pH 8.0), with the addition of 0.2 mM pregnenolone, 1 mM 2OG (α-ketoglutarate), 1 mM L-ascorbic acid, 1 mM Fe(NH4)2(SO4)2 and 10 μM of the purified protein obtained in Example 1 (the actual concentrations for the four recombinant proteins were 0.4655, 0.4241, 0.9563 and 0.9149 μg / μL, respectively). The reaction was carried out at 30 °C for 1 hour, and the reaction was terminated by adding 2 volumes of pre-cooled methanol. The mixture was centrifuged at 12000 rpm for 15 min, and the products and substrates in the supernatant were analyzed by LC-MS.

[0083] 2) Metabolite detection methods

[0084] UPLC-MS analysis was performed using a Thermo Fisher Vanquish UPLC system coupled with an ISQ EM single quadrupole mass spectrometer and a HESI (thermal electrospray ionization) source. Separation was performed using an Accucore C18 column (2.1 mm id × 50 mm, 2.2 μm, Thermo Fisher) and an Accucore C18 pre-column (2.1 mm id × 50 mm, 2.6 μm, Thermo Fisher). The mobile phase consisted of water containing 0.1% formic acid (phase A) and acetonitrile (phase B). The standard (30 min) operating conditions for the HPLC method were as follows: 5% B hold for 2 min, 5% B to 40% B for 16 min, 40% B to 50% B for 6 min, 50% B to 100% B for 2.5 min, 100% B hold for 1 min, switch to 5% B within 1.5 min, and then continue holding at 5% B for 1 min. Mass spectrometry was performed using HESI in positive mode with the ion spray voltage set to 3000 V. The MS scan range was from 150 to 400 m / z, with a solvent delay of 2 min.

[0085] The LC-MS results of the in vitro enzyme activity of the purified protein are shown in Figure 2. Based on the LC-MS results, the four C14β-hydroxylase recombinant proteins converted pregnenolone into another compound, the high-resolution mass spectrometry results of which are shown in Figure 3. This compound, after separation and purification by NMR, was identified as 14β-hydroxypregnenolone, and its NMR results (…). 1 H NMR, 13 The C14β hydroxylases (DEPT, COSY, HSQC, HMBC, and NOES) are shown in Figure 4-10. Combined with LC-MS and NMR results, it can be seen that the four recombinant C14β hydroxylase proteins can catalyze the C14β hydroxylation of pregnenolone in vitro. The full-length 14βPH (P1) exhibits the lowest catalytic activity, the truncated t14βPH (P2) shows the strongest catalytic activity, and the truncated TF-t14βPH (P4), fused with a solubilizing tag, exhibits the second strongest catalytic activity.

[0086] Example 3: Optimization of in vitro enzyme activity conditions and exploration of enzyme kinetic parameters for steroid C14β-hydroxylase

[0087] Although the truncated form t14βPH(P2) exhibits the strongest catalytic activity, its recombinant protein yield is relatively low. In contrast, the truncated form fused with a solubilizing tag TF-t14βPH(P4) shows the second strongest catalytic activity and the highest recombinant protein yield. Therefore, this recombinant protein (P4) was used as the material to explore the optimal pH, optimal reaction temperature, and enzyme kinetic parameters of C14β hydroxylase.

[0088] To determine the optimal pH for testing the activity of TF-t14βPH(P4) protein, experiments were conducted in different reaction buffers with pH ranges of 5-5.5 (40 mM citrate-sodium citrate buffer), 6.0-7.0 (40 mM K2HPO4-KH2PO4 buffer), and 7.5-9.0 (40 mM Tris-HCl buffer). To prevent the reaction from becoming too rapid, the protein concentration in the reaction system was reduced to 0.4 μg / μL, while other reaction conditions remained unchanged. The experimental results are shown in Figure 11. The optimal pH buffer was 40 mM Tris-HCl buffer at pH 8.0.

[0089] To determine the optimal reaction temperature for testing the activity of TF-t14βPH(P4) protein, experiments were conducted at different temperatures (0-60℃) to establish the optimal reaction temperature, with the 0℃ reaction performed in an ice bath. In the optimal reaction buffer (40mM Tris-HCl buffer at pH 8.0), the protein concentration was reduced to 0.4 μg / μL, while other reaction conditions remained constant. The experimental results are shown in Figure 12, indicating that the optimal reaction temperature was 30℃.

[0090] To explore the enzyme kinetic parameters (K14βPH(P4)) of TF-t14βPH(P4) m K cat and K cat / K m Under optimal reaction buffer and optimal reaction temperature, the protein concentration was reduced to 0.1 μg / μL, the reaction time was shortened to 5 min, and other conditions remained unchanged.

[0091] The kinetic parameters of TF-t14βPH(P4) enzyme are shown in Figure 13. Its Km, Kcat, and Kcat / Km values ​​are 5.731±0.583 μM, 154.753±3.142 s, and 154.753±3.142 s, respectively. -1 ,and 27.005s -1 ·μM -1 .

[0092] Example 4: Detection of catalytic activity of steroid C14β-hydroxylase on different pregnane substrates

[0093] To explore the catalytic activity of TF-t14βPH(P4) on different pregnane substrates, in vitro enzyme activity assays were performed using pregnenolone, progesterone, and pregnanolone as substrates. The enzyme activity reaction was carried out in 50 μL of 50 mM Tris-HCl (containing 200 mM NaCl, pH 8.0) buffer, which included 0.2 mM substrate, 1 mM 2OG (α-ketoglutarate), 1 mM L-ascorbic acid, 1 mM Fe(NH4)2(SO4)2, and 1 μg / μL purified protein. The reaction was incubated at 30 °C for 1 h, terminated by adding 2 volumes of pre-cooled methanol, and centrifuged at 12000 rpm for 15 min. The product and substrate in the supernatant were analyzed using LC-MS.

[0094] The LC-MS results are shown in Figure 14. The results indicate that TF-t14βPH has strong catalytic activity towards pregnenolone. Calculations show that approximately 82.8% of pregnenolone is converted to 14β-hydroxypregnenolone after 1 hour of reaction. However, a small product peak was detected when progesterone was used as the substrate, and no theoretical hydroxylation product was detected for pregnenolone substrates. This demonstrates that TF-t14βPH has strong substrate specificity, exhibiting the strongest catalytic activity towards pregnenolone and a weak catalytic activity towards progesterone. Subsequent amino acid mutations can yield a mutant with strong catalytic activity towards progesterone.

[0095] Example 5: Detection of the catalytic activity of steroid C14β-hydroxylase on androstane and estradiol substrates.

[0096] Besides pregnane steroids such as pregnenolone and progesterone, androstane and estradiol are also important steroid compounds. To explore the catalytic activity of TF-t14βPH(P4) on androstane and estradiol substrates, five androstane and three estradiol substrates were used as substrates (see Table 2) for in vitro enzyme activity assays. The enzyme activity reaction was carried out in 50 μL of 50 mM Tris-HCl (containing 200 mM NaCl, pH 8.0) buffer system, which contained 0.2 mM substrate, 1 mM 2OG (α-ketoglutarate), 1 mM L-ascorbic acid, 1 mM Fe(NH4)2(SO4)2 and 1 μg / μL purified protein. The reaction was incubated at 30 °C for 1 h, terminated by adding 2 volumes of pre-cooled methanol, centrifuged at 12000 rpm for 15 min, and the product and substrate in the supernatant were analyzed by LC-MS.

[0097] Table 2. English-Chinese comparison table of androstane and estrostane substrates used in Example 5.

[0098] The LC-MS results are shown in Figure 15. The results indicate that TF-t14βPH incubation with dehydroepiandrosterone (DHEA) also produces a new peak, while no significant new peaks were observed when incubated with other androstanes and estrostanes. Based on the in vitro enzyme activity results of TF-t14βPH and DHEA, the reaction produced three distinct new compounds. Compound 6 had the largest peak area; its mass spectra suggest that compound 6's molecular weight increased by 48, possibly due to the addition of three hydroxyl groups. Compounds 7 and 8 had smaller peak areas; mass spectra suggest that compound 7's molecular weight decreased by 2, possibly due to the removal of two hydrogens, thus introducing one degree of unsaturation; compound 8's molecular weight increased by 14, possibly due to the addition of one hydroxyl group and the introduction of one degree of unsaturation. DHEA is very similar to pregnenolone, with identical steroidal skeletons except for a difference in the C-17 structure. This may be one reason why TF-t14βPH can also use DHEA as a substrate. However, due to the difference in the C-17 side chain structure of the two substrates, the main product of the reaction between TF-t14βPH and pregnenolone is monohydroxylated 14β-hydroxypregnenolone, while the product of TF-t14βPH and dehydroepiandrosterone is trihydroxylated.

[0099] Example 6: Engineered Escherichia coli biotransformed pregnenolone into 14β-hydroxypregnenolone.

[0100] Inoculate a single colony of recombinant *E. coli* into 10 mL of LB medium containing antibiotics and incubate overnight at 37°C and 220 rpm. Alternatively, inoculate 1% of the overnight culture of recombinant *E. coli* into 1 L of LB medium containing antibiotics and incubate for 2–4 hours until OD (Organic Dose) is reached. 600 When the pH reached 0.4–0.6, IPTG was added to a final concentration of 0.5 mM, and simultaneously, pregnenolone ethanol solution was added to a final concentration of 200 μM. Protein induction was performed at 16°C for 18 h, followed by substrate transformation at 25°C for 42 h. 1 mL of bacterial culture was taken, centrifuged, and the fermentation broth precipitate (mainly bacterial cells and insoluble substrate) and supernatant were separated. The supernatant was extracted twice with an equal volume of ethyl acetate, then the ethyl acetate phase was dried by rotation and reconstituted with 200 μL for LC-MS detection. 200 μL of methanol was added to the precipitate and extracted using an ultrasonic water bath for 30 min. After centrifugation, the supernatant was used for LC-MS detection.

[0101] Figure 16 shows the LC-MS results of the fermentation broth supernatant (medium) and precipitate (Pellet). The engineered *E. coli* strain expressing steroidal C14β-hydroxylase can bioconvert pregnenolone substrates into 14β-hydroxypregnenolone. Calculations show that approximately 40.1% of the substrate was consumed, with about 95.7% converted to 14β-hydroxypregnenolone. The majority (approximately 96.1%) of the 14β-hydroxypregnenolone product was distributed in the fermentation broth supernatant, with only a small portion (approximately 17.0%) of the remaining unconverted pregnenolone substrate also located in the supernatant. The accumulation of most of the product in the fermentation broth supernatant, while the precipitate mainly consists of bacterial cells and insoluble substrate, greatly facilitates the product separation and purification process. Most of the product can be obtained simply by centrifugation followed by ethyl acetate extraction of the supernatant. The separated bacterial cells and insoluble substrate can be used for repeated fermentation, improving the overall conversion rate and reducing production costs.

[0102] Example 7: Synthetic Biological Production of 14β-hydroxypregnenolone in Plant Cartridges

[0103] Fermentation by engineered microorganisms plays a crucial role in synthetic biology production as a commonly used biotransformation method. However, most microorganisms are heterotrophic, requiring external carbon sources to maintain cell activity. Plants, as autotrophic organisms, can perform photosynthesis to produce organic matter, making the exploration of their feasibility as C14β-hydroxylated steroids also significant. The following is an example of using the model plant *Nicotiana benthamiana* as a plant chassis to produce 14β-hydroxypregnenolone.

[0104] 1) Transient expression and metabolite detection in tobacco

[0105] Using the corresponding primers and Phanta Flash Super-Fidelity DNA Polymerase (Vazyme, China), steroid 14β-hydroxylase and truncated gene fragments were amplified from *Symplocos edulis* cDNA. These gene fragments were then ligated into the plant transient expression vector pEAQ plasmid to obtain the plant transient expression recombinant plasmids pEAQ-14βPH and pEAQ-t14βPH. The *Symplocos edulis* sterol side-chain lyase PsCYP87N10 gene fragment (SEQ ID No. 16) was amplified from *Symplocos edulis* cDNA using the same method and ligated into the plant transient expression vector pEAQ plasmid. PsCYP87N10 can produce pregnenolone from sterols in tobacco, providing a substrate for steroid 14β-hydroxylase during transient transformation of tobacco.

[0106] The primer sequences used (5'-3') are as follows:

[0107] pEAQ-14βPH-F:

[0108] CTGCCCAAATTCGCGCTCGAGATGGCTATTCGAATGCCCACC, (SEQ ID No. 25);

[0109] pEAQ-14βPH-R:

[0110] TGAACCAGAGTTAACTCGAGTCAAATCCCGCAATAGGCTTT, (SEQ ID No. 26).

[0111] pEAQ-t14βPH-F:

[0112] CTGCCCAAATTCGCGCTCGAGATGCTTGAGAACCATGGCCG, (SEQ ID No. 27);

[0113] pEAQ-t14βPH-R:

[0114] TGAACCAGAGTTAACTCGAGTCAAATCCCGCAATAGGCTTT, (SEQ ID No. 28).

[0115] pEAQ-CYP87N10-F:

[0116] CTGCCCAAAATTCGCGCTCGAGATGTTGTTCCCCATTGTTCTTGC, (SEQ ID No. 29);

[0117] pEAQ-CYP87N10-R:

[0118] TGAACCAGAGTTAACTCGAGTCATTCTGCCTTTCCCGAGA, (SEQ ID No. 30).

[0119] The recombinant plasmid was transformed into Agrobacterium tumefaciens strain LBA4404 using standard methods to obtain the corresponding plant-infecting strain. The strain carrying the expression construct was cultured on LB medium containing the corresponding antibiotic and incubated at 28°C and 220 rpm for approximately 16 hours until OD (Organic Growth Rate). 600=2. Collect LBA4404 cells by centrifugation at 4500g for 20 min, discarding the supernatant. The precipitate was then resuspended in freshly prepared MMA buffer (10mM MgCl2, 10mM MES / KOH pH 5.6, 150μM acetylsylcholine) and diluted to OD600 = 0.2. Infection was performed using Nicotiana benthamiana plants that had grown to approximately six leaves. For different combination experiments, strains carrying different recombinant plasmids were mixed and infiltrated into tobacco leaves using a needleless syringe. Leaves were harvested on day 6 post-infection and freeze-dried for LC-MS detection.

[0120] 2) Plant sample extraction and detection

[0121] 50 mg of tobacco leaf powder was added to 1 mL of 75% ethanol and allowed to stand overnight at room temperature. Then, it was extracted in an ultrasonic bath (40 kHz) for 2 h, and the extraction was repeated twice. The extract was centrifuged at 13000 rpm for 10 min, the supernatant was collected, and the solvent was removed by vacuum concentration. Before UPLC-MS analysis, the extract was reconstituted in 250 μL of acetone / methanol (1:1, V:V). Metabolites in the tobacco leaves were detected using the same LC-MS method as for in vitro enzyme activity.

[0122] 3) Subcellular localization of steroid 14β-hydroxylase and its truncated form

[0123] To determine the location of steroid 14β hydroxylase and its truncated form, as well as the upstream enzyme gene CYP87N10, in plant cells, gene fragments were ligated into pEAQ-mNeonGreen to obtain plant transient expression recombinant plasmids pEAQ-14βPH-mNeonGreen and pEAQ-t14βPH-mNeonGreen.

[0124] Agrobacterium tumefaciens GC3101 strain was transformed using standard methods to obtain the corresponding plant-infecting strain. Positive colonies were selected and resuspended in 10 mL LB medium, incubated at 28°C with stirring at 220 rpm until the OD600 value was between 0.8 and 1, followed by centrifugation at 4000g for 10 min. The bacterial culture was then resuspended in 5 mL MMA buffer (10 mM MES, 10 mM MgCl2, 200 μM acetylsylcholine) and incubated at 28°C in the dark for 1 h. The Agrobacterium suspension (final OD600 = 0.2 for each strain) was injected into the abaxial surface of 4-6 week old Nicotiana benthamiana leaves using a 5 mL syringe. The injected plants were stored in the dark for 2 days, and the localization of the expressed proteins was observed using a confocal laser scanning microscope (Ni-E A1 HD25, Nikon, Japan). The endoplasmic reticulum marker ER-rk CD3-959 was used for co-localization with CYP87N10.

[0125] The metabolite detection results are shown in Figure 17. The results show that 14β-hydroxypregnenolone (1) can be detected in tobacco by transient expression of the CYP87N10 gene and either 14βPH or t14βPH gene. In addition to this product, three other compounds (2, 3, and 4) are also produced along with 14β-hydroxypregnenolone, which may be products of endogenous modification of 14β-hydroxypregnenolone in tobacco. The subcellular localization results of 14βPH, t14βPH, and the upstream gene CYP87N10 are shown in Figure 18. The results show that CYP87N10 is located in the endoplasmic reticulum in tobacco leaves, that is, the catalysis of steroid to pregnenolone by CYP87N10 takes place in the endoplasmic reticulum; while the steroid 14β-hydroxylase 14βPH is located in the chloroplast, that is, the 14β-hydroxylation of pregnenolone takes place in the chloroplast, and the truncated form of steroid 14β-hydroxylase t14βPH is not located in the chloroplast but is distributed in the cytoplasm.

[0126] Calculations showed that the yield of 14-hydroxypregnenolone per gram of dried tobacco leaves ranged from 0.143 to 0.221 mg for each transient expression combination, and a significant amount of the product was converted into other compounds (compounds 2, 3, 4, etc.) by endogenous modification in tobacco. In actual production, the yield of 14-hydroxypregnenolone can be increased through synthetic biology strategies such as gene editing of the tobacco plant chassis to knock out endogenous modifying enzyme genes and increasing the expression level of upstream genes.

[0127] Example 8: Discovery and functional verification of steroid C14β hydroxylases in other species

[0128] *Salix viminalis* is a plant belonging to the genus *Salix* in the family Apocynaceae. Other plants in this genus are also rich in cardiac glycosides and pregnane glycosides with C14 hydroxylated steroidal skeletons, and these species may also possess steroidal C14β hydroxylases. The following provides an example of mining homologous proteins of *Salix viminalis* steroidal C14β hydroxylase in other plants.

[0129] 1) Discovery of candidate steroid C14β hydroxylase proteins in other plants

[0130] Blast analysis was performed on the genomes or transcriptomes of other species using the protein sequence of 14βPH (e.g., SEQ ID No. 9), or hmmsearch was performed on the genomes or transcriptomes of other species using the conserved 14βPH domain PFAM (PF14226, PF03171) to screen for candidate homologous protein sequences of 14βPH.

[0131] Table 3. Species genomes or transcriptomes and data sources used in this embodiment.

[0132] The Geneious software was used to calculate the sequence identity between the candidate protein and the 14βPH protein. LOCALIZER, iPSORT, and TargetP-2.0 were used to predict whether the candidate protein possessed a chloroplast transport peptide. The MUSCLE software was used to align the sequences of the candidate protein, the maker protein, and the 14βPH protein. The FastTree software was used to construct phylogenetic trees for 14βPH and its homologous proteins using maximum likelihood estimation and the Jones–Taylor–Thornton model, repeated 1000 times to evaluate the topological structure of the system.

[0133] The phylogenetic tree of 14βPH and its homologous genes is shown in Figure 19. The results indicate that there are several homologous proteins with high protein homology (≥50%) near the Ps14βPH evolutionary branch of the steroidal C14β hydroxylase: such as Apg6759 (74%), Mt_EVM0005808 (58%), cal_g013628 (59%), and cal_g018279 (50%). Software was used to predict whether these Ps14βPH homologous proteins possess potential chloroplast transport peptides.

[0134] 2) Functional verification of candidate steroid C14β hydroxylase proteins in other plants

[0135] Due to the large number of Ps14βPH homologous proteins, only two candidate proteins, Mt_EVM0005808 from *Tetrapanax papyriferus* and cal_g013628 from *Calamus esculenta*, were subsequently validated for their functions. The transient expression of tobacco and metabolite detection methods were used to verify whether the candidate proteins possess steroidal C14β hydroxylase activity, as described in Example 6. The primer sequences (5'-3') used are as follows:

[0136] pEAQ-Mt_EVM0005808-F:

[0137] AAATTCGCGCTCGAGGTCGACATGGCTACCATATGCAGGCTG, (SEQ ID No. 31);

[0138] pEAQ-Mt_EVM0005808-R:

[0139] ACCTTTGCTGACCATGTCGACATTAATGCCGGAATAGGCTTGG, (SEQ ID No. 32).

[0140] pEAQ-cal_g013628-F:

[0141] AAATTCGCGCTCGAGGTCGACATGGCTACCTTATGCACCCG, (SEQ ID No. 33);

[0142] pEAQ-cal_g013628-R:

[0143] ACCTTTGCTGACCATGTCGACATTAATGCCAGAATAGGCTTGGA, (SEQ ID No. 34).

[0144] The transient expression and LC-MS detection results in tobacco are shown in Figure 20. The transient expression of the *Thunbergia odorifera* Mt_EVM0005808 and *Calamus niger* cal_g013628 genes, along with the CYP87N10 gene, both produced the 14β-hydroxypregnenolone (1) product in tobacco. In addition to this product, three other compounds (2, 3, and 4) were also produced alongside 14β-hydroxypregnenolone. This is consistent with the transient expression results of the steroidal C14β hydroxylase Ps14βPH in tobacco, indicating that *Thunbergia odorifera* Mt_EVM0005808 and *Calamus niger* cal_g013628 also possess steroidal C14β hydroxylase activity. Therefore, these two proteins were named Mt14βPH and Cg14βPH, respectively. Although this embodiment did not perform functional verification on the Ps14βPH homolog Apg6759 from white hemp, the protein identity of white hemp Apg6759 with Ps14βPH is higher than that of the verified functions of Mt14βPH and Cg14βPH. This candidate protein is highly likely to have steroidal C14β hydroxylase activity, therefore it was named Ap14βPH. The nucleotide and protein sequences of Mt14βPH, Cg14βPH, and Ap14βPH are shown in the sequence listing.

[0145] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A steroidal C14β-hydroxylase, characterized in that, Its amino acid sequence is selected from the sequence shown in SEQ ID No. 9, or a sequence that has at least 58% homology with SEQ ID No. 9, or a sequence that, after modification of the sequence shown in SEQ ID No. 9, still has steroidal C14β hydroxylase activity.

2. The steroidal C14β-hydroxylase according to claim 1, characterized in that, The nucleic acid sequence encoding the amino acid shown in SEQ ID No. 9 is shown in SEQ ID No.

1.

3. A steroidal C14β-hydroxylase, characterized in that, Its amino acid sequence is selected from the sequence shown in SEQ ID No. 10 or a sequence that has at least 58% homology with SEQ ID No.

10. The sequence shown in SEQ ID No. 10 is based on the sequence shown in SEQ ID No. 9 with 1-38 amino acids removed from the N-terminus.

4. The steroidal C14β-hydroxylase according to claim 3, characterized in that, The nucleic acid sequence encoding the amino acid shown in SEQ ID No. 10 is shown in SEQ ID No.

2.

5. A steroidal C14β-hydroxylase, characterized in that, Its amino acid sequence is selected from the sequence shown in SEQ ID No. 11 or a sequence that has at least 58% homology with SEQ ID No.

11. The sequence shown in SEQ ID No. 11 is based on the sequence shown in SEQ ID No. 9 with a Trigger Factor tag fused to the N-terminus.

6. A steroidal C14β-hydroxylase according to claim 5, characterized in that, The nucleic acid sequence encoding the amino acid shown in SEQ ID No. 11 is shown in SEQ ID No.

3.

7. A steroidal C14β-hydroxylase, characterized in that, Its amino acid sequence is selected from the sequence shown in SEQ ID No. 12 or a sequence that has at least 58% homology with SEQ ID No.

12. The sequence shown in SEQ ID No. 12 is based on the sequence shown in SEQ ID No. 9, with 1-38 amino acids removed from the N-terminus and a Trigger Factor tag fused to the N-terminus.

8. A steroidal C14β-hydroxylase according to claim 7, characterized in that, The nucleic acid sequence encoding the amino acid shown in SEQ ID No. 12 is shown in SEQ ID No.

4.

9. A steroidal C14β-hydroxylase, characterized in that, Its amino acid sequence is selected from any of the sequences shown in SEQ ID No. 13, SEQ ID No. 14 and SEQ ID No. 15, or sequences that have at least 58% homology with SEQ ID No. 13, SEQ ID No. 14 and SEQ ID No. 15, or sequences that, after modification of the sequences shown in SEQ ID No. 13, SEQ ID No. 14 and SEQ ID No. 15, still have steroidal C14β hydroxylase activity.

10. A steroidal C14β-hydroxylase according to claim 9, characterized in that, The nucleic acid sequences encoding the amino acids shown in SEQ ID No. 13, SEQ ID No. 14 and SEQ ID No. 15 are shown in SEQ ID No. 5, SEQ ID No. 6 and SEQ ID No. 7, respectively.

11. An expression vector for steroidal C14β-hydroxylase, characterized in that, It contains a nucleic acid sequence encoding the steroid C14β hydroxylase as described in any one of claims 1-10.

12. The expression vector for steroidal C14β-hydroxylase according to claim 11, characterized in that, The expression vector is a prokaryotic expression vector, which can be used to express and purify steroid C14β hydroxylase or to achieve the production of 14β hydroxypregnenolone through biotransformation.

13. The expression vector for steroidal C14β-hydroxylase according to claim 12, characterized in that, The prokaryotic expression vectors include the pET series or the pCold series vectors.

14. The expression vector for steroidal C14β-hydroxylase according to claim 11, characterized in that, The expression vector is a eukaryotic expression vector, which can be produced using the synthetic biology of 14β-hydroxypregnenolone from plant chassis.

15. The expression vector for steroidal C14β-hydroxylase according to claim 14, characterized in that, Eukaryotic expression vectors include the pEAQ series vectors.

16. An engineered bacterium, characterized in that, It includes the expression vector as described in any one of claims 11-15.

17. The engineered bacteria according to claim 16, characterized in that, The engineered bacteria is Escherichia coli.

18. The engineered bacteria according to claim 16, characterized in that, The engineered bacteria is Agrobacterium.

19. The engineered bacteria according to claim 18, characterized in that, The Agrobacterium is Agrobacterium tumefaciens.

20. The application of the engineered bacteria as described in any one of claims 16-19, characterized in that, Used to synthesize 14β-hydroxypregnenolone.

21. A method for synthesizing 14β-hydroxypregnenolone, characterized in that, 14β-hydroxypregnenolone was synthesized using engineered Escherichia coli, wherein the engineered Escherichia coli contained the expression vector described in any one of claims 11-15.

22. The method for synthesizing 14β-hydroxypregnenolone according to claim 21, characterized in that, The engineered Escherichia coli synthesized 14β-hydroxypregnenolone using pregnenolone as a substrate.

23. A method for synthesizing 14β-hydroxypregnenolone, characterized in that, 14β-hydroxypregnenolone was synthesized using an engineered strain of Agrobacterium tumefaciens, wherein the engineered strain of Agrobacterium tumefaciens comprises the expression vector described in any one of claims 11-15.

24. The method for synthesizing 14β-hydroxypregnenolone according to claim 23, characterized in that, The engineered Agrobacterium tumefaciens synthesizes 14β-hydroxypregnenolone in the plant chassis.

25. A method for screening and functionally validating other steroidal C14β hydroxylases in other species, characterized in that, By searching for potential steroidal C14β hydroxylases in other species using the steroidal C14β hydroxylase described in any one of claims 1-10, and performing functional verification, the other species being species other than *Gynostemma pentaphyllum*, *Gynostemma pentaphyllum*, *Gynostemma pentaphyllum*, and *Hemp scabra*.

Images