Transgenic maize event LP007-21 and detection method therefor

Abstract

The present invention belongs to the technical field of plant breeding and relates to transgenic maize event LP007-21 and a detection method therefor. A nucleic acid molecule used for detecting transgenic maize event LP007-21 comprises a sequence selected from any one or more of SEQ ID NO: 1-7 and complementary sequences thereof. The nucleic acid molecule is derived from transgenic maize event LP007-21. Maize seeds containing the transgenic maize event LP007-21 have been deposited in the China Center for Type Culture Collection with the accession number CCTCC NO: P202431. The maize plants of the transgenic maize event LP007-21 have the following advantages: resistance to losses caused by lepidopteran pests; tolerance to glyphosate-containing herbicides; no reduction in yield; and improved breeding efficiency, enabling molecular markers to track the transgenic insertion fragments in breeding populations and progeny thereof.

Description

Genetically modified corn incident LP007-21 and its detection method

[0001] This application claims priority to Chinese Patent Application No. 202510075120.6, filed on January 17, 2025, entitled “Genetically Modified Maize Incident LP007-21 and its Detection Method”, the entire contents of which are incorporated herein by reference. Technical Field

[0002] This application belongs to the field of plant breeding technology and relates to the transgenic maize incident LP007-21 and its detection method. Background Technology

[0003] Maize (Zea mays L.) is a major food crop in many parts of the world. Biotechnology has been applied to maize to improve its agronomic traits and quality. Insect resistance is an important agronomic trait in maize production, especially resistance to lepidopteran insects (such as the corn borer, cotton bollworm, fall armyworm, and armyworm). Maize resistance to lepidopteran insects can be obtained by expressing lepidopteran resistance genes in maize plants through transgenic methods. Another important agronomic trait is herbicide tolerance, especially tolerance to glyphosate herbicides. Maize tolerance to glyphosate herbicides can be obtained by expressing glyphosate tolerance genes (such as epsps) in maize plants through transgenic methods.

[0004] It is known that the expression of exogenous genes in plants is influenced by their chromosomal location, possibly due to the proximity of chromatin structures (such as heterochromatin) or transcriptional regulatory elements (such as enhancers) to the integration site. Therefore, it is often necessary to screen a large number of events to identify those suitable for commercialization (i.e., events where the introduced target gene is optimally expressed). For example, significant differences in the expression levels of introduced genes have been observed between events in plants and other organisms; differences may also exist in spatial or temporal patterns of expression, such as the relative expression of transgenes differing between different plant tissues. These differences manifest as the actual expression pattern potentially not matching the expected expression pattern of the transcriptional regulatory elements in the introduced gene construct. Therefore, it is often necessary to generate hundreds or thousands of different events and screen them for a single event with the expected transgene expression levels and patterns for commercial purposes. Such transformation events result in superior resistance to lepidopteran pests (such as the Asian corn borer, fall armyworm, oriental armyworm, cotton bollworm, cutworm, and peach borer) and glyphosate herbicides without affecting maize yield. These transgenic traits can be backcrossed into other genetic backgrounds using conventional breeding methods. Offspring produced through this hybridization retain the transgenic expression characteristics and phenotypic traits of the original transformant. Applying this strategy ensures reliable gene expression in many varieties, providing stable resistance to lepidopteran pests (such as the Asian corn borer, fall armyworm, oriental armyworm, cotton bollworm, cutworm, and peach borer) and glyphosate herbicides, protecting these varieties from major lepidopteran pests, providing broad-spectrum weed control, and allowing them to adapt well to local growing conditions.

[0005] Being able to detect the presence of specific events to determine whether the offspring of sexual hybridization contain the target gene would be beneficial. Furthermore, methods for detecting specific events would aid in compliance with relevant regulations, such as the requirement for formal approval and labeling of foods derived from recombinant crops before they can be placed on the market. Detecting the presence of transgenes using any well-known polynucleotide detection method is possible, such as polymerase chain reaction (PCR) or DNA hybridization using polynucleotide probes. These methods typically focus on commonly used genetic elements, such as promoters, terminators, marker genes, etc. Therefore, unless the sequence of the chromosomal DNA adjacent to the inserted transgenic DNA (“flanking DNA”) is known, the aforementioned methods cannot be used to distinguish between different events, especially those produced using the same DNA construct.

[0006] Currently, there is a lack of a detection method that can accurately and rapidly identify whether a biological sample contains DNA molecules from the specific transgenic maize event LP007-21. Summary of the Invention

[0007] The purpose of this application is to provide the transgenic maize event LP007-21 and its detection method, which can accurately and rapidly identify whether a biological sample contains DNA molecules of the specific transgenic maize event LP007-21.

[0008] To achieve the above objectives, this application provides a nucleic acid molecule for detecting transgenic maize event LP007-21. The sequence of the nucleic acid molecule comprises a sequence selected from any one of the sequences SEQ ID NO:1-5 and their complementary sequences. The nucleic acid molecule is derived from transgenic maize plants, seeds, or cells containing transgenic maize event LP007-21. The maize seeds containing transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection (CCTCC, address: Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, 430072, China) with the accession number CCTCCNO:P202431 and are classified as: Maize Seed LP007-21 (Zeamays L.LP007-21).

[0009] In some embodiments, the sequences of the nucleic acid molecules are shown in one or more of SEQ ID NO:1-2, SEQ ID NO:3-4, SEQ ID NO:5 or their complementary sequences, and the nucleic acid molecules are derived from transgenic maize event LP007-21. Maize seeds containing the transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

[0010] In some embodiments, the nucleic acid molecules are derived from plants, seeds, or cells that include the transgenic maize event LP007-21.

[0011] In some embodiments of this application, a nucleic acid molecule is provided comprising at least 11 consecutive nucleotides of SEQ ID NO:3 or its complementary sequence, and / or at least 11 consecutive nucleotides of SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:1 or its complementary sequence, and / or SEQ ID NO:2 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:3 or its complementary sequence, and / or SEQ ID NO:4 or its complementary sequence. In some embodiments, the nucleic acid sequence comprises SEQ ID NO:5 or its complementary sequence.

[0012] In some embodiments of this application, SEQ ID NO:1 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence in transgenic maize event LP007-21. SEQ ID NO:1 or its complementary sequence spans the flanking genomic DNA sequence of the maize insertion site and the DNA sequence at the 5' end of the inserted sequence. The presence of SEQ ID NO:1 or its complementary sequence is sufficient to identify the transgenic maize event LP007-21. Similarly, SEQ ID NO:2 or its complementary sequence is a 22-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence in transgenic maize event LP007-21. SEQ ID NO:2 or its complementary sequence spans the DNA sequence at the 3' end of the inserted sequence and the flanking genomic DNA sequence of the maize insertion site. The presence of SEQ ID NO:2 or its complementary sequence is sufficient to identify the transgenic maize event LP007-21.

[0013] The nucleic acid molecule provided in this application may be at least 11 or more consecutive polynucleotides (first nucleic acid sequence) of any portion of the transgenic insertion sequence in SEQ ID NO:3 or its complementary sequence, or at least 11 or more consecutive polynucleotides (second nucleic acid sequence) of any portion of the 5' flanking maize genomic DNA region in SEQ ID NO:3 or its complementary sequence. The nucleic acid molecule may further be a portion of SEQ ID NO:3 that is homologous to or complementary to the complete SEQ ID NO:1. When the first and second nucleic acid sequences are used together, these nucleic acid sequences include a DNA primer pair in a DNA amplification method that generates the amplification product. When the amplification product generated in the DNA amplification method using the DNA primer pair is an amplification product including SEQ ID NO:1, the presence of transgenic maize event LP007-21 or its progeny can be diagnosed. Those skilled in the art will appreciate that the first and second nucleic acid sequences do not necessarily consist solely of DNA, but may also include RNA, a mixture of DNA and RNA, or a combination of DNA, RNA, or other nucleotides or analogues that do not serve as templates for one or more polymerases. Furthermore, the DNA probes or primers described in this application should be at least about 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 consecutive nucleotides in length, which may be selected from the nucleotides described in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5. When selected from the nucleotides shown in SEQ ID NO:3, SEQ ID NO:4, and SEQ ID NO:5, the DNA probes and primers may be at least about 17 to about 50 or more consecutive nucleotides in length. The SEQ ID NO:3 or its complementary sequence is a 1027-nucleotide sequence located near the insertion junction at the 5' end of the inserted sequence in transgenic maize event LP007-21. The SEQ ID NO:3 or its complementary sequence consists of a 531-nucleotide maize flanking genomic DNA sequence (nucleotides 1-531 of SEQ ID NO:3), a 379-nucleotide pLP007 construct DNA sequence (nucleotides 532-910 of SEQ ID NO:3), and a 117-nucleotide 3' end DNA sequence of the Nos terminator (nucleotides 911-1027 of SEQ ID NO:3). The presence of the SEQ ID NO:3 or its complementary sequence is sufficient to identify the transgenic maize event LP007-21.

[0014] In some embodiments of this application, the nucleic acid molecule may be at least 11 or more consecutive polynucleotides (third nucleic acid sequence) of any portion of the transgenic insertion sequence in SEQ ID NO:4 or its complementary sequence, or at least 11 or more consecutive nucleotides (fourth nucleic acid sequence) of any portion of the 3' flanking maize genomic DNA region in SEQ ID NO:4 or its complementary sequence. The nucleic acid molecule may further be a portion of SEQ ID NO:4 that is homologous to or complementary to the complete SEQ ID NO:2. When the third and fourth nucleic acid sequences are used together, these nucleic acid sequences include DNA primer pairs in DNA amplification methods that produce amplification products. When the amplification product produced in a DNA amplification method using DNA primer pairs is an amplification product including SEQ ID NO:2, the presence of transgenic maize event LP007-21 or its progeny can be diagnosed. The SEQ ID NO:4 or its complementary sequence is an 847-nucleotide sequence located near the insertion junction at the 3' end of the inserted sequence in transgenic maize event LP007-21. The SEQ ID NO:4 or its complementary sequence consists of a 53-nucleotide tNos (carmine synthase) transcription terminator sequence (nucleotides 1-53 of SEQ ID NO:4), a 155-nucleotide pLP007 construct DNA sequence (nucleotides 54-208 of SEQ ID NO:4), and a 639-nucleotide maize integration site flanking genomic DNA sequence (nucleotides 209-847 of SEQ ID NO:4). The presence of the SEQ ID NO:4 or its complementary sequence is sufficient to identify the transgenic maize event LP007-21.

[0015] The SEQ ID NO:5 or its complementary sequence is a 17307-nucleotide sequence characterizing the transgenic maize event LP007-21, and its specific genomic and genetic elements are shown in Table 1. The presence of the transgenic maize event LP007-21 can be identified by the presence of the SEQ ID NO:5 or its complementary sequence.

[0016] Table 1. Genome and genetic elements contained in SEQ ID NO:5

[0017] The nucleic acid molecules can be used in DNA amplification methods to generate amplification products, and the presence of transgenic maize event LP007-21 or its progeny in biological samples can be diagnosed by detecting the amplification products; the nucleic acid molecules can also be used in nucleotide detection methods to detect the presence of transgenic maize event LP007-21 or its progeny in biological samples.

[0018] This application provides a DNA primer pair comprising a first primer and a second primer, wherein when the first primer and the second primer are used together with DNA containing transgenic maize event LP007-21 for an amplification reaction, an amplicon for detecting transgenic maize event LP007-21 in a sample is generated;

[0019] The first primer is selected from SEQ ID NO:8 or SEQ ID NO:12, and the second primer is selected from SEQ ID NO:9 or SEQ ID NO:13; or the first primer is selected from SEQ ID NO:10 or SEQ ID NO:15, and the second primer is selected from SEQ ID NO:11 or SEQ ID NO:14;

[0020] The maize seeds containing the aforementioned transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

[0021] In some embodiments of this application, the amplification product comprises at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence.

[0022] Further, the amplification product includes consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:2 or its complementary sequence.

[0023] Furthermore, the amplification product includes SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, or SEQ ID NO:7 or its complementary sequence.

[0024] This application also provides a DNA probe comprising a fragment of SEQ ID NO:5 or its complementary sequence, wherein the DNA probe hybridizes under strict hybridization conditions with DNA molecules comprising nucleic acid sequences selected from SEQ ID NO:1-5 or their complementary sequences, and does not hybridize under strict hybridization conditions with DNA molecules not comprising nucleic acid sequences selected from SEQ ID NO:1-5 or their complementary sequences.

[0025] In some embodiments, the DNA probe comprises a sequence selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and SEQ ID NO:7 or its complementary sequence.

[0026] In some embodiments, the DNA probe is labeled with a fluorescent group.

[0027] In some embodiments, the DNA probe comprises at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence; further, the DNA probe comprises consecutive nucleotides at positions 1-11 or 12-22 in SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 in SEQ ID NO:2 or its complementary sequence.

[0028] This application also provides a marker nucleic acid molecule comprising a fragment of SEQ ID NO:5 or its complementary sequence, wherein the marker nucleic acid molecule hybridizes under strict hybridization conditions with DNA molecules comprising nucleic acid sequences selected from SEQ ID NO:1-5 or their complementary sequences, and does not hybridize under strict hybridization conditions with DNA molecules not comprising nucleic acid sequences selected from SEQ ID NO:1-5 or their complementary sequences.

[0029] In some embodiments, the marker nucleic acid molecule comprises a sequence selected from SEQ ID NO:1 or its complementary sequence, SEQ ID NO:2 or its complementary sequence, SEQ ID NO:6 or its complementary sequence, and SEQ ID NO:7 or its complementary sequence.

[0030] In one embodiment, the marker nucleic acid molecule comprises at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence.

[0031] In some embodiments, the marker nucleic acid molecule comprises consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:2 or its complementary sequence.

[0032] Furthermore, this application provides a method for detecting the presence of DNA from the transgenic maize event LP007-21 in a sample, comprising:

[0033] (1) Contact the sample to be tested with the DNA primer pair in the nucleic acid amplification reaction;

[0034] (2) Perform nucleic acid amplification reaction;

[0035] (3) Detect the presence of amplification products;

[0036] The amplification product includes a nucleic acid sequence of SEQ ID NO:3-4 or its complementary sequence, indicating that the test sample contains DNA from the transgenic maize event LP007-21.

[0037] Furthermore, this application also provides a method for detecting the presence of DNA from the transgenic maize event LP007-21 in a sample, comprising:

[0038] (1) Contact the sample to be tested with the DNA probe and / or the labeled nucleic acid molecule;

[0039] (2) Hybridize the sample to be tested with the DNA probe and / or the marker nucleic acid molecule under strict hybridization conditions;

[0040] (3) Detect the hybridization of the sample to be tested with the DNA probe and / or the marker nucleic acid molecule.

[0041] The stringent conditions can be defined as hybridization at 65°C in a 6×SSC (sodium citrate) and 0.5% SDS (sodium dodecyl sulfate) solution, followed by washing the membrane once each with 2×SSC and 0.1% SDS and 1×SSC and 0.1% SDS.

[0042] The process involves detecting the hybridization of the sample to be tested and the marker nucleic acid molecules, and then using marker-assisted breeding analysis to determine whether insect resistance and / or herbicide tolerance are genetically linked to the marker nucleic acid molecules.

[0043] This application also provides a DNA detection kit, comprising: a DNA primer pair that generates an amplicon for diagnosing transgenic maize event LP007-21; and a probe specific to SEQ ID NO:1-5 or a marker nucleic acid molecule specific to SEQ ID NO:1-5. Specifically, the detection kit includes the probe, primer pair, or marker nucleic acid molecule described in this application.

[0044] Furthermore, this application provides a DNA detection kit comprising the aforementioned DNA primer pair.

[0045] In some embodiments, this application provides a DNA detection kit comprising at least one DNA molecule, said DNA molecule comprising at least 11 consecutive nucleotides in the homologous sequence of SEQ ID NO:3 or its complementary sequence, or at least 11 consecutive nucleotides in the homologous sequence of SEQ ID NO:4 or its complementary sequence, which can serve as a DNA primer or probe specific to the transgenic maize event LP007-21 or its progeny.

[0046] Further, the DNA molecule comprises consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:1 or its complementary sequence, or consecutive nucleotides at positions 1-11 or 12-22 of SEQ ID NO:2 or its complementary sequence.

[0047] Furthermore, the DNA molecule includes the homologous sequence of SEQ ID NO:1 or its complementary sequence, the homologous sequence of SEQ ID NO:2 or its complementary sequence, the homologous sequence of SEQ ID NO:6 or its complementary sequence, or the homologous sequence of SEQ ID NO:7 or its complementary sequence. To achieve the above objectives, this application also provides a plant cell comprising nucleic acid sequences encoding insect resistance Cry1Ab, Cry2Ab, and Vip3Aa proteins, nucleic acid sequences encoding glyphosate herbicide tolerance EPSPS proteins, and nucleic acid sequences in a specific region, wherein the nucleic acid sequences in the specific region include the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, or SEQ ID NO:7.

[0048] The sequences provided in this application include those listed in Table 2 below:

[0049] Table 2. Relevant Sequences of This Application

[0050] This application also provides a method for protecting maize plants from insect infestation, comprising providing transgenic maize plant cells containing transgenic maize event LP007-21 in the diet of target insects; the target insects that ingest the transgenic maize plant cells are inhibited from further ingesting the maize plant, and the maize seeds containing the transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCCNO:P202431.

[0051] This application also provides a method for protecting maize plants from damage caused by glyphosate herbicides, comprising: planting transgenic maize plants containing transgenic maize event LP007-21, applying an effective dose of glyphosate herbicide, wherein maize seeds containing said transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

[0052] This application also provides a method for controlling weeds in a field where maize plants are grown, comprising applying an effective dose of glyphosate herbicide to a field where transgenic maize plants are grown, the transgenic maize plants comprising transgenic maize event LP007-21, and maize seeds comprising transgenic maize event LP007-21 being deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

[0053] This application also provides a method for cultivating maize plants that are resistant to insects and / or tolerant to glyphosate herbicides, comprising: planting maize seeds containing transgenic maize event LP007-21;

[0054] The corn seeds are allowed to grow and develop into corn plants;

[0055] The corn plants were attacked with target insects and / or sprayed with an effective dose of glyphosate herbicide. Plants with reduced plant damage compared to other plants that do not have the transgenic corn event LP007-21 were harvested. The corn seeds containing the transgenic corn event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

[0056] In some embodiments, this application also provides a method for producing insect-resistant maize plants, comprising introducing transgenic maize event LP007-21 into the genome of the maize plant and selecting maize plants that exhibit reduced plant damage from insect feeding. In some embodiments, the method comprises: sexually crossing an insect-resistant transgenic maize event LP007-21 first parental maize plant with an insect-deficient second parental maize plant to produce a large number of progeny plants; attacking the progeny plants with target insects; and selecting the progeny plants that exhibit reduced plant damage compared to other plants without transgenic maize event LP007-21.

[0057] In some embodiments, this application also provides a method for generating glyphosate-tolerant maize plants, comprising introducing transgenic maize event LP007-21 into the genome of the maize plants and selecting glyphosate-tolerant maize plants. In some embodiments, the method comprises: sexually crossing a first parental maize plant tolerant to glyphosate-tolerant transgenic maize event LP007-21 with a second parental maize plant lacking glyphosate tolerance to generate a large number of progeny plants; treating the progeny plants with glyphosate herbicide; and selecting the glyphosate-tolerant progeny plants.

[0058] In some embodiments, this application also provides a method for generating maize plants that are resistant to insects and tolerant to glyphosate herbicide application, comprising: introducing transgenic maize event LP007-21 into the genome of the maize plant; and selecting maize plants that are resistant to glyphosate and have insect resistance. In some embodiments, the method comprises sexually crossing a first parent maize plant of glyphosate-resistant and insect-resistant transgenic maize event LP007-21 with a second parent maize plant lacking glyphosate resistance and / or insect resistance to generate a large number of progeny plants; treating the progeny plants with glyphosate; and selecting the glyphosate-resistant progeny plants that are also resistant to insect feeding damage.

[0059] This application also provides a composition derived from the transgenic maize event LP007-21, said composition being corn flour, cornmeal, corn oil, corn silk, or corn starch. In some embodiments, the composition may be an agricultural product or commodity such as corn flour, cornmeal, corn oil, corn starch, corn gluten, corn cakes, cosmetics, or fillers. If sufficient expression levels are detected in said composition, the composition is expected to contain nucleic acid sequences capable of diagnosing the presence of transgenic maize event LP007-21 material in said composition. Specifically, the composition includes, but is not limited to, corn oil, cornmeal, corn gluten, corn cakes, corn starch, and any other food intended as a food source for animal consumption, or additionally as a leavening agent or ingredient in a cosmetic composition for cosmetic purposes.

[0060] The probe- or primer-based detection methods and / or kits of this application can be used to detect the nucleic acid sequence of transgenic maize event LP007-21, such as shown in SEQ ID NO:1 or SEQ ID NO:2, wherein the probe sequence or primer sequence is selected from the sequences shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, to diagnose the presence of transgenic maize event LP007-21.

[0061] In summary, the genetically modified maize LP007-21 of this application possesses dual traits of insect resistance and herbicide resistance, and has the following advantages:

[0062] 1) Avoid economic losses caused by lepidopteran pests (such as Asian corn borer, fall armyworm, oriental armyworm, cotton bollworm, cutworm and peach borer, etc.). Asian corn borer, fall armyworm, oriental armyworm, fall armyworm, cotton bollworm, cutworm and peach borer are the main pests in corn-growing areas.

[0063] 2) The ability to apply glyphosate-containing agricultural herbicides to corn crops for broad-spectrum weed control.

[0064] 3) Corn yield did not decrease. Specifically, the larvae used to test the resistance level of the target pest in the in vitro experiment of this application were second-instar larvae. The transgenic event LP007-21 of this application can cause a mortality rate of up to 100% in second-instar pests, achieving a high level of resistance. Compared with the standard of using the first-day larvae to test the resistance level in the LP007 series of similar applications, the second-instar pests used in this application have significantly enhanced vitality. Moreover, the second instar is the period of voracious feeding by larvae, which greatly increases the degree of damage to plant leaves. Therefore, the pest resistance of this application is significantly improved, protecting the plant and reducing its damage rate to 0%. It also has high tolerance to glyphosate herbicide, and can tolerate spraying of 4 times the dose of glyphosate herbicide, protecting the plant and reducing its damage rate to 0%. Furthermore, the agronomic traits of plants containing this event are excellent, and the yield percentage can be as high as 102%.

[0065] 4) The genes encoding insect resistance and glyphosate tolerance traits are linked to the same DNA segment and are located at a single locus in the genome of transgenic maize event LP007-21. This provides enhanced breeding efficiency and makes it possible to use molecular markers to track transgenic insertions in breeding populations and their offspring.

[0066] 5) The primer or probe sequences provided in the detection method of this application can generate amplification products that are diagnostic of transgenic maize event LP007-21 or its progeny, and can quickly, accurately and stably identify the presence of plant materials derived from transgenic maize event LP007-21.

[0067] the term

[0068] The following definitions and methods are intended to better define this application and guide those skilled in the art in implementing it. Unless otherwise stated, the terms should be understood in accordance with their conventional usage by those skilled in the art.

[0069] The term "corn" refers to maize (Zeamays) and includes all plant species that can interbreed with maize, including wild maize species.

[0070] The term "comprising" means "including but not limited to". The term "processed product" refers to a product obtained by processing raw materials such as plants and seeds, such as compositions.

[0071] The term "plant" includes the whole plant, plant cells, plant organs, plant protoplasts, plant cell tissue cultures from which plants can regenerate, plant callus, plant clumps, and intact plant cells in a plant or plant part, such as embryo, pollen, ovules, seeds, leaves, flowers, branches, fruits, stems, roots, root tips, anthers, etc. It should be understood that parts of a transgenic plant within the scope of this application include, but are not limited to, plant cells, protoplasts, tissues, callus, embryos, and flowers, stems, fruits, leaves, and roots, all of which are derived from a transgenic plant or its progeny that has been previously transformed with the DNA molecules of this application and is therefore at least partially composed of transgenic cells.

[0072] The term "gene" refers to a nucleic acid fragment that expresses a specific protein, including the regulatory sequence preceding the coding sequence (5' non-coding sequence) and the regulatory sequence following the coding sequence (3' non-coding sequence). A "natural gene" is a gene that is naturally found to have its own regulatory sequence. A "chimeric gene" is any gene that is not a natural gene but contains regulatory and coding sequences not naturally found. An "endogenous gene" is a natural gene located at its natural position in an organism's genome. A "foreign gene" is a foreign gene that is currently present in an organism's genome and was not originally present; it also refers to a gene introduced into a recipient cell through a transgenic process. Foreign genes can include natural genes inserted into non-natural organisms or chimeric genes. A "transgenic gene" is a gene that has been introduced into the genome through a transformation process. The site where recombinant DNA has been inserted into the plant genome can be called an "insertion site" or a "target site."

[0073] "Flanking DNA" can comprise the genome naturally present in organisms such as plants or exogenous (heterologous) DNA introduced through a transformation process, such as fragments associated with the transformation event. Therefore, flanking DNA can include a combination of natural and exogenous DNA. In this application, "flanking region," "flanking sequence," "genome boundary region," or "genome boundary sequence" refers to a sequence of at least 3, 5, 10, 11, 15, 20, 50, 100, 200, 300, 400, 1000, 1500, 2000, 2500, or 5000 base pairs or longer, located directly upstream or downstream of and adjacent to the original exogenous inserted DNA molecule. When the flanking region is downstream, it can also be referred to as a "left boundary flanking region," "3' flanking region," "3' genome boundary region," or "genome 3' boundary sequence," etc. When this flanking region is located upstream, it can also be referred to as the "right boundary flanking region", "5' flanking region", "5' genome boundary region", or "genome 5' boundary sequence", etc.

[0074] Transformation procedures that induce random integration of exogenous DNA result in transformants containing distinct flanking regions, which are unique to each transformant. When recombinant DNA is introduced into plants via conventional hybridization, these flanking regions typically remain unchanged. Transformants also contain unique junctions between segments of the heterologous insert DNA and genomic DNA, or between two segments of genomic DNA, or between two segments of heterologous DNA. A "junction" is the point where two specific DNA segments join. For example, junctions exist where the insert DNA joins flanking DNA. Junction points also exist in transformed organisms, where two DNA segments are joined together in a manner modified from those found in natural organisms. "Junction DNA" refers to DNA containing junction points.

[0075] This application provides a transgenic maize event referred to as LP007-21 and its progeny, wherein the transgenic maize event LP007-21 is the maize plant LP007-21, which includes the plant and seeds of the transgenic maize event LP007-21 and its plant cells or renewable parts thereof. The plant parts of the transgenic maize event LP007-21 include, but are not limited to, cells, pollen, ovules, flowers, buds, roots, stems, silks, inflorescences, ears, leaves and products from the maize plant LP007-21, such as corn flour, cornmeal, corn oil, corn steep liquor, corn silks, corn starch and biomass remaining in the maize crop field.

[0076] The present application for transgenic maize event LP007-21 contains a DNA construct that, when expressed in plant cells, acquires resistance to insects and tolerance to glyphosate herbicide.

[0077] In some embodiments of this application, the DNA construct comprises four tandem expression cassettes: a first expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operatively linked to a nucleic acid sequence of the insect-resistant Cry2Ab protein (cCry2Ab) of Bacillus thuringiensis, the Cry2Ab protein exhibiting lepidopteran insect resistance; a second expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operatively linked to a nucleic acid sequence of the insect-resistant Vip3Aa protein (cVip3Aa) of Bacillus thuringiensis, the Vip3Aa exhibiting lepidopteran insect resistance; and a third expression cassette comprises a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operatively linked to a nucleic acid sequence of the Cry1Ab protein, the Cry1Ab protein exhibiting resistance primarily to lepidopteran insects. The fourth expression cassette contains a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operatively linked to a gene encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS), the nucleic acid sequence of which is resistant to glyphosate herbicide. Furthermore, the promoter can be a suitable promoter isolated from plants, including constitutive, inducible, and / or tissue-specific promoters. Suitable promoters include, but are not limited to, the following: cauliflower mosaic virus (CaMV) 35S promoter, Scrophularia mosaic virus (FMV) 35S promoter, ubiquitin promoter, actin promoter, Agrobacterium tumefaciens carmine synthase (NOS) promoter, octopine synthase (OCS) promoter, Cestrum yellow leaf curl virus promoter, potato tuber storage protein (Patatin) promoter, ribulose-1,5-bisphosphate carboxylase / oxygenase (RuBisCO) promoter, glutathione S-transferase (GST) promoter, E9 promoter, GOS promoter, alcA / alcR promoter, and Agrobacterium tumefaciens promoter. The RolD promoter of rhizogenes and the Suc2 promoter of Arabidopsis thaliana.The polyadenylation signal sequence can be a suitable polyadenylation signal sequence that functions in plants. The suitable polyadenylation signal sequence includes, but is not limited to, polyadenylation signal sequences derived from the Agrobacterium tumefaciens cauliflower mosaic virus (CaMV) 35S terminator, polyadenylation signal sequences derived from the protease inhibitor II (PINII) gene, and polyadenylation signal sequences derived from the α-tubulin gene.

[0078] In addition, the expression cassette may also include other genetic elements, including but not limited to enhancers and signal peptide / transporter nucleic acid coding sequences. The enhancers can enhance gene expression levels, and these enhancers include, but are not limited to, tobacco etching virus (TEV) translation activator, CaMV35S enhancer, and FMV35S enhancer. The signal peptide / transporter can guide the transport of Cry1Ab protein and / or EPSPS protein to specific organelles or compartments outside or inside the cell, for example, targeting chloroplasts using sequences encoding chloroplast transport peptides, or targeting the endoplasmic reticulum using 'KDEL' preserved sequences.

[0079] The Cry1Ab, Cry2Ab, and Vip3Aa genes can be isolated from Bacillus thuringiensis (Bt), and the nucleic acid sequences of the Cry1Ab, Cry2Ab, and Vip3Aa genes can be modified by optimizing the codons or by other means to increase the stability and availability of transcripts in transformed cells.

[0080] In some embodiments of this application, maize cells, seeds or plants comprising transgenic maize event LP007-21 contain, in sequence, the nucleic acid sequences of positions 543-16657 of SEQ ID NO:1 and SEQ ID NO:5 and SEQ ID NO:2 in their genome, or contain SEQ ID NO:5.

[0081] The order Lepidoptera, which includes moths and butterflies, is the order with the most agricultural and forestry pests, such as corn borers, cotton bollworms, armyworms, fall armyworms, two-spotted cutworms, and peach borers.

[0082] The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene can be isolated from Agrobacterium tumefaciens sp. CP4 strain, and the stability and availability of the transcript in transformed cells can be increased by optimizing the codon or altering the polynucleotides encoding the EPSPS gene in other ways. The 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) gene can also be used as a selective marker gene.

[0083] The term "glyphosate" refers to N-phosphonomethylglycine and its salts. Treatment with "glyphosate herbicide" means treatment with any herbicide formulation containing glyphosate. The selection of the application rate of a particular glyphosate formulation to achieve an effective biological dose does not exceed the skill level of an average agronomist. Treatment of fields containing plant material derived from the LP007-21 genetically modified maize event with any glyphosate-containing herbicide formulation will control weed growth in the fields without affecting the growth or yield of the plant material derived from the LP007-21 genetically modified maize event.

[0084] The DNA construct is introduced into plants using transformation methods, including but not limited to Agrobacterium-mediated transformation, gene gun transformation, and pollen tube pathway transformation.

[0085] Agrobacterium-mediated transformation is a commonly used method for plant transformation. Exogenous DNA to be introduced into the plant is cloned into the T-DNA region between the common sequences on the left and right boundaries of a vector. The vector is then transformed into Agrobacterium cells, which are subsequently used to infect plant tissues, whereby the T-DNA region of the vector containing the exogenous DNA is inserted into the plant genome.

[0086] The gene gun transformation method refers to bombarding plant cells with a vector containing exogenous DNA (particle-mediated biological bombardment transformation).

[0087] The pollen tube pathway transformation method utilizes the natural pollen tube pathway (also known as pollen tube guiding tissue) formed after plant pollination to carry exogenous DNA into the embryo sac via the nucellus pathway.

[0088] After transformation, transgenic plants must be regenerated from the transformed plant tissues, and offspring with exogenous DNA must be selected using appropriate markers.

[0089] DNA constructs are combinations of interconnected DNA molecules that provide one or more expression cassettes. Specifically, DNA constructs are plasmids capable of self-replication within bacterial cells and containing various restriction endonuclease sites for introducing DNA molecules that provide functional genetic elements, namely promoters, introns, leader sequences, coding sequences, 3' terminator regions, and other sequences. The expression cassettes contained in the DNA constructs include genetic elements necessary for the transcription of messenger RNA, and these cassettes can be designed for expression in prokaryotic or eukaryotic cells. The expression cassettes of this application are designed most specifically for expression in plant cells.

[0090] A transgenic “event” is obtained by transforming plant cells with a heterologous DNA construct, comprising at least one nucleic acid expression cassette containing the target gene, inserted into the plant genome via transgenic methods to generate a plant population, regenerate the plant population, and select specific plants with characteristics of the insertion at a specific genomic site. The term “event” refers to the original transformant containing heterologous DNA and the offspring of that transformant. The term “event” also refers to the offspring obtained by sexual hybridization between the transformant and other varietal individuals containing heterologous DNA, where, even after repeated backcrossing with a backcross parent, the inserted DNA and flanking genomic DNA from the transformant parent are present at the same chromosomal location in the hybrid offspring. The term “event” also refers to a DNA sequence from the original transformant containing the inserted DNA and flanking genomic sequences closely adjacent to the inserted DNA, which is intended to be transferred to offspring produced by sexual hybridization of a parental line containing the inserted DNA (e.g., the original transformant and its self-crossed offspring) with a parental line not containing the inserted DNA, and the offspring receiving the inserted DNA containing the target gene.

[0091] In this application, "recombinant" refers to a form of DNA and / or protein and / or organism that is not normally found in nature and is therefore produced through artificial intervention. Such artificial intervention can produce recombinant DNA molecules and / or recombinant plants. The "recombinant DNA molecule" is obtained by artificially combining two sequence segments that are otherwise separate, for example, by chemical synthesis or by manipulating isolated nucleic acid segments using genetic engineering techniques. Techniques for manipulating nucleic acids are well known.

[0092] The term "transgenic" includes any cell, cell line, callus, tissue, plant part, or plant whose genotype has been altered due to the presence of a heterologous nucleic acid. "Transgenic" includes the original transgenic organism that was so altered, as well as offspring individuals generated from the original transgenic organism through sexual hybridization or asexual reproduction. In this application, the term "transgenic" does not include genomic (chromosomal or extrachromosomal) alterations achieved through conventional plant breeding methods or naturally occurring events such as random allogeneic fertilization, non-recombinant viral infection, non-recombinant bacterial transformation, non-recombinant transposition, or spontaneous mutation.

[0093] In this application, "heterologous" means that the first molecule is not normally found to combine with the second molecule in nature. For example, a molecule may originate from a first species and be inserted into the genome of a second species. Therefore, such a molecule is heterologous to the host and is artificially introduced into the genome of the host cell.

[0094] The transgenic maize event LP007-21, which is resistant to lepidopteran insects and tolerant to glyphosate herbicide, can be cultivated through the following steps: First, a first parent maize plant is sexually crossed with a second parent maize plant to produce diverse first-generation offspring plants. The first parent maize plant consists of maize plants bred from the transgenic maize event LP007-21 and its offspring, which are obtained by transformation using the expression cassette of this application that is resistant to lepidopteran insects and tolerant to glyphosate herbicide. The second parent maize plant lacks resistance to lepidopteran insects and / or is tolerant to glyphosate herbicide. Then, offspring plants that are resistant to lepidopteran insect invasion and / or tolerant to glyphosate herbicide are selected to cultivate maize plants that are resistant to lepidopteran insects and tolerant to glyphosate herbicide. These steps may further include backcrossing progeny plants that are lepidopteran-resistant and / or glyphosate-tolerant with a second or third parent maize plant, and then selecting progeny by lepidopteran invasion, glyphosate herbicide application, or by identification through trait-related molecular markers (such as DNA molecules containing the 5' and 3' junction sites identified in the transgenic maize event LP007-21), thereby producing maize plants that are lepidopteran-resistant and glyphosate-tolerant.

[0095] It should also be understood that two different transgenic plants can be hybridized to produce offspring containing two independent, segregated foreign genes. Self-pollination of appropriate offspring can yield plants that are homozygous for both added foreign genes. Backcrossing of parental plants and heteromorphic hybridization with non-transgenic plants, as mentioned above, are also to be expected, as is asexual reproduction.

[0096] The term "probe" refers to a segment of isolated nucleic acid molecule to which conventional detectable markers or reporter molecules may be bound, such as radioisotopes, ligands, chemiluminescent agents, or enzymes. This probe is complementary to one strand of the target nucleic acid; in this application, the probe is complementary to one DNA strand from the genome of transgenic maize event LP007-21, regardless of whether the genomic DNA originates from transgenic maize event LP007-21, its seeds, or from plants, seeds, or extracts of transgenic maize event LP007-21. The probes of this application include not only deoxyribonucleic acid (DNA) or ribonucleic acid (RNA), but also polyamides and other probe materials that specifically bind to the target DNA sequence and can be used to detect the presence of that target DNA sequence.

[0097] The term "primer" refers to a segment of isolated nucleic acid molecule that binds to a complementary target DNA strand through nucleic acid hybridization and annealing, forming a hybrid between the primer and the target DNA strand. This hybrid then extends along the target DNA strand under the action of a polymerase (e.g., DNA polymerase). The primer pairs of this application relate to their application in the amplification of target nucleic acid sequences, for example, by polymerase chain reaction (PCR) or other conventional nucleic acid amplification methods.

[0098] Methods for designing and using primers and probes are well known in the art. DNA molecules containing full-length or fragmented sequences of SEQ ID NO:1-7 can be used as primers and probes for detecting maize event LP007-21, and can be readily designed by those skilled in the art using the sequences provided herein.

[0099] The probes and primers are typically 11 polynucleotides or longer, preferably 18 polynucleotides or longer, more preferably 24 polynucleotides or longer, and most preferably 30 polynucleotides or longer. These probes and primers specifically hybridize to the target sequence under highly stringent hybridization conditions. Although probes that differ from the target DNA sequence and maintain hybridization ability to the target DNA sequence can be designed using conventional methods, preferably, the probes and primers in this application have complete DNA sequence identity with the continuous nucleic acid of the target sequence.

[0100] The primers and probes for the flanking genomic DNA and insert sequence based on this application can be determined using conventional methods, such as isolating the corresponding DNA molecules from plant material derived from transgenic maize event LP007-21 and determining the nucleic acid sequence of the DNA molecule. The DNA molecule contains the transgenic insert sequence and a flanking region of the maize genome, and fragments of the DNA molecule can be used as primers or probes.

[0101] The nucleic acid probes and primers of this application hybridize with the target DNA sequence under stringent conditions. Any conventional nucleic acid hybridization or amplification method can be used to identify the presence of DNA derived from the transgenic maize event LP007-21 in a sample. Nucleic acid molecules or fragments thereof can specifically hybridize with other nucleic acid molecules under certain conditions. As used in this application, if two nucleic acid molecules can form antiparallel double-stranded nucleic acid structures, it can be said that the two nucleic acid molecules can specifically hybridize with each other. If two nucleic acid molecules exhibit perfect complementarity, one nucleic acid molecule is called a "complement" of the other nucleic acid molecule. As used in this application, when every nucleotide of one nucleic acid molecule is complementary to the corresponding nucleotide of another nucleic acid molecule, the two nucleic acid molecules are said to exhibit "perfect complementarity". If two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under at least conventional "low stringent" conditions, the two nucleic acid molecules are called "minimally complementary". Similarly, if two nucleic acid molecules can hybridize with each other with sufficient stability so that they anneal and bind to each other under conventional "high stringent" conditions, the two nucleic acid molecules are called "complementary". Deviations from perfect complementarity are permissible, as long as such deviations do not completely prevent the two molecules from forming a double-stranded structure. For a nucleic acid molecule to function as a primer or probe, it only needs to be sufficiently complementary in sequence to form a stable double-stranded structure under the specific solvent and salt concentration used.

[0102] As used in this application, the substantially homologous sequence is a nucleic acid molecule that, under highly stringent conditions, can specifically hybridize with the complementary strand of a matching nucleic acid molecule. Suitable stringent conditions for promoting DNA hybridization, such as treatment with 6.0× sodium chloride / sodium citrate (SSC) at approximately 45°C followed by washing with 2.0× SSC at 50°C, are well known to those skilled in the art. For example, the salt concentration in the washing step can be selected from approximately 2.0× SSC, 50°C for low-stringent conditions to approximately 0.2× SSC, 50°C for high-stringent conditions. Furthermore, the temperature conditions in the washing step can be increased from approximately 22°C (room temperature) for low-stringent conditions to approximately 65°C for high-stringent conditions. Both temperature conditions and salt concentration can be changed, or one can remain constant while the other is changed. Specifically, a nucleic acid molecule of this application can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences, under moderately stringent conditions, such as about 2.0 × SSC and about 65°C. More specifically, a nucleic acid molecule of this application can specifically hybridize with one or more nucleic acid molecules of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, and SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences, under highly stringent conditions. In this application, the preferred marker nucleic acid molecule has SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6, or SEQ ID NO:7, or their complementary sequences, or any fragments of the aforementioned sequences. Another preferred marker nucleic acid molecule of this application has 80% to 100% or 90% to 100% sequence identity with SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:7 or their complementary sequences, or any fragment of the above sequences. SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 and SEQ ID NO:7 can be used as markers in plant breeding methods to identify offspring of genetic hybridization. Hybridization of the probe with the target DNA molecule can be detected by any method well known to those skilled in the art, including but not limited to fluorescent labeling, radioactive labeling, antibody labeling and chemiluminescent labeling.

[0103] Regarding amplification of a target nucleic acid sequence using specific amplification primers (e.g., by PCR), "strict conditions" refer to conditions in which primers are allowed to hybridize only with the target nucleic acid sequence during a DNA thermal amplification reaction. Primers having a wild-type sequence (or its complementary sequence) corresponding to the target nucleic acid sequence are able to bind to the target nucleic acid sequence and preferably produce a unique amplification product, i.e., an amplicon.

[0104] The term "specific binding (target sequence)" means that, under strict hybridization conditions, the probe or primer hybridizes only with the target sequence in a sample containing the target sequence.

[0105] As used in this application, "amplified DNA," "amplification product," or "amplifier" refers to the nucleic acid amplification product of a target nucleic acid sequence that is part of a nucleic acid template. For example, to determine whether a maize plant was produced by sexual hybridization containing the transgenic maize event LP007-21 of this application, or whether a maize sample collected from a field contains the transgenic maize event LP007-21, or whether maize extracts, such as flour, powder, or oil, contain the transgenic maize event LP007-21, DNA extracted from maize plant tissue samples or extracts can be amplified using a primer pair nucleic acid amplification method to generate an amplifier that is diagnostic for the presence of DNA related to the transgenic maize event LP007-21. The primer pair includes a first primer derived from a flanking sequence in the plant genome adjacent to the insertion site of the inserted exogenous DNA, and a second primer derived from the inserted exogenous DNA. The amplifier has a specific length and sequence that is also diagnostic for the transgenic maize event LP007-21. The length of the amplicon can be the binding length of the primer pair plus one nucleotide base pair, preferably about fifty nucleotide base pairs, more preferably about two hundred and fifty nucleotide base pairs, and most preferably about four hundred and fifty nucleotide base pairs or more.

[0106] Optionally, primer pairs can be derived from flanking genomic sequences on either side of the inserted DNA to generate amplicons comprising the entire inserted nucleic acid sequence. One of the primer pairs derived from plant genome sequences can be located at a distance from the inserted DNA sequence, ranging from one nucleotide base pair to approximately 20,000 nucleotide base pairs. The use of the term "amplifier" specifically excludes primer dimers formed during thermal amplification of DNA.

[0107] Nucleic acid amplification reactions can be performed using any nucleic acid amplification method known in the art, including polymerase chain reaction (PCR). Various nucleic acid amplification methods are well known to those skilled in the art. PCR amplification methods have been developed to amplify 22kb of genomic DNA and 42kb of bacteriophage DNA. These methods, as well as other DNA amplification methods in the art, can be used in this application. The inserted exogenous DNA sequence and the flanking DNA sequence from the transgenic maize event LP007-21 can be amplified using the provided primer sequences to amplify the genome of the transgenic maize event LP007-21, followed by standard DNA sequencing of the PCR amplicons or cloned DNA.

[0108] DNA detection kits based on DNA amplification methods may contain DNA primer molecules that specifically hybridize to target DNA and amplify diagnostic amplicones under appropriate reaction conditions. The kits may provide agarose gel-based detection methods or many other methods known in the art for detecting diagnostic amplicones. Kits containing DNA primers homologous to or complementary to any portion of the maize genome region of SEQ ID NO:3 or SEQ ID NO:4, and homologous to or complementary to any portion of the transgenic insertion region of SEQ ID NO:5, are provided in this application. Specifically, primer pairs useful in DNA amplification methods are SEQ ID NO:8 and SEQ ID NO:9, which amplify diagnostic amplicones homologous to a portion of the 5' transgenic / genomic region of transgenic maize event LP007-21, wherein the amplicon includes SEQ ID NO:1. Other DNA molecules used as DNA primers may be selected from SEQ ID NO:5.

[0109] The amplicon generated by these methods can be detected using a variety of techniques. One such method is Genetic BitAnalysis, which designs a DNA oligonucleotide chain spanning the insert DNA sequence and adjacent flanking genomic DNA sequences. This oligonucleotide chain is immobilized within the wells of a microplate. After PCR amplification of the target region (using one primer each in the insert sequence and adjacent flanking genomic sequences), the single-stranded PCR product hybridizes with the immobilized oligonucleotide chain and serves as a template for a single-base extension reaction using DNA polymerase and ddNTPs specifically labeled for the next expected base. Results can be obtained using fluorescence or ELISA-like methods. The signal indicates the presence of the insert / flanking sequence, signifying successful amplification, hybridization, and single-base extension.

[0110] Another method is pyrosequencing. This method designs an oligonucleotide chain that spans the insertion DNA sequence and the binding site of adjacent genomic DNA. This oligonucleotide chain is hybridized with single-stranded PCR products of the target region (using one primer each within the insertion sequence and in adjacent flanking genomic sequences), and then incubated with DNA polymerase, ATP, thioacylase, luciferase, adenosine triphosphate diphosphatase, adenosine-5'-phosphate sulfate, and luciferin. dNTPs are added separately, and the resulting light signal is measured. The light signal represents the presence of the insertion / flanking sequence, indicating that amplification, hybridization, and single- or multi-base extension reactions were successful.

[0111] The fluorescence polarization phenomenon described by Chen et al. (Genome Res. 9:492-498, 1999) can also be used to detect the amplicon in this application. This method requires designing an oligonucleotide chain that spans the insertion DNA sequence and the binding site of adjacent genomic DNA. This oligonucleotide chain is hybridized with a single-stranded PCR product of the target region (using one primer within the insertion sequence and one primer in the adjacent flanking genomic sequence), and then incubated with DNA polymerase and a fluorescently labeled ddNTP. Single-base extension results in the insertion of ddNTPs. This insertion can be measured using a fluorometer to determine the change in polarization. The change in polarization indicates the presence of the insertion / flanking sequence, signifying that the amplification, hybridization, and single-base extension reactions were successful.

[0112] Taqman is described as a method for detecting and quantifying the presence of DNA sequences, detailed in the manufacturer's instructions for use. A brief example is provided below: a FRET oligonucleotide probe is designed to bind across the insert DNA sequence and adjacent flanking genomic regions. This FRET probe and PCR primers (one primer within the insert sequence and one primer in adjacent flanking genomic sequences) are cycled in the presence of a thermostable polymerase and dNTPs. Hybridization of the FRET probe results in the splitting of the fluorescent and quenched portions of the probe, and the release of the fluorescent portion. The generation of a fluorescent signal indicates the presence of the insert / flanking sequence, signifying successful amplification and hybridization.

[0113] Based on the principle of hybridization, suitable techniques for detecting plant material derived from the transgenic maize event LP007-21 may also include Southern blot hybridization, Northern blot hybridization, and in situ hybridization. Specifically, these suitable techniques include incubating the probe and sample, washing to remove unbound probes, and detecting whether the probe has hybridized. The detection method depends on the type of label attached to the probe; for example, radiolabeled probes can be detected by X-ray exposure and development, or enzyme-labeled probes can be detected by a color change resulting from substrate transformation.

[0114] Tyangi et al. (Nature Biotech 14:303-308, 1996) described the application of molecular markers in sequence detection. Briefly, a FRET oligonucleotide probe was designed that spans the insertion DNA sequence and the adjacent flanking genomic region. The unique structure of this FRET probe results in a secondary structure that allows for the retention of fluorescent and quenched portions in close proximity. The FRET probe and PCR primers (one primer within the insertion sequence and one primer in the adjacent flanking genomic sequence) were cyclically reacted in the presence of a thermostable polymerase and dNTPs. Upon successful PCR amplification, hybridization of the FRET probe and the target sequence leads to the loss of the probe's secondary structure, causing spatial separation of the fluorescent and quenched portions and generating a fluorescent signal. The generation of the fluorescent signal indicates the presence of the insertion / flanking sequence, signifying successful amplification and hybridization.

[0115] Other described methods, such as microfluidics, provide methods and devices for isolating and amplifying DNA samples. Optical dyes are used to detect and determine specific DNA molecules. Nanotube devices containing electronic sensors for detecting DNA molecules or nanobeads that bind specific DNA molecules and are thus detectable are useful for detecting the DNA molecules described in this application.

[0116] DNA detection kits can be developed using the compositions described in this application and methods described or known in the field of DNA detection. These kits are advantageous for identifying the presence of DNA from the transgenic maize event LP007-21 in samples and can also be used to cultivate maize plants containing DNA from the transgenic maize event LP007-21. The kits may contain DNA primers or probes homologous to or complementary to at least a portion of SEQ ID NO: 1, 2, 3, 4, or 5, or other DNA primers or probes homologous to or complementary to DNA contained in transgenic genetic elements, these DNA sequences being used for DNA amplification reactions or as probes in DNA hybridization methods.

[0117] The DNA structure of the transgenic insertion sequence and its binding site in the maize genome, as illustrated in Figure 1 and Table 1, includes: a flanking genomic region of maize LP007-21 located at the 5' end of the transgenic insertion sequence; a portion of the insertion sequence from the right boundary region (RB) of Agrobacterium; a first expression cassette operatively linked to the Scrophularia mosaic virus 35S promoter (pFMV); operatively linked to the intron of the maize heat shock protein gene HSP70 (iZmHSP); operatively linked to the maize chloroplast transport peptide (ZmCTP); and operatively linked to... The first expression cassette consists of a tandem repeat of the maize ubiquitin gene promoter Ubi (pZmUbi) containing an enhancer region, which is operably linked to the Bacillus thuringiensis insect resistance gene Vip3Aa (Vip3Aa), operably linked to the 9th intron (iPEEC) of the maize phosphoenolpyruvate carboxykinase gene, and operably linked to the 35S chromosome of the cauliflower mosaic virus genome. The third expression cassette consists of the cauliflower mosaic virus 35S promoter (p35S), operably linked to the 5' untranslated leading strand sequence (WtCab) of wheat chloroplast a / b binding protein, operably linked to the intron of rice actin gene 1 (iOsAct1), operably linked to the insect resistance Cry1Ab protein (Cry1Ab) of Bacillus thuringiensis, and operably linked to the terminator (In2) of benzenesulfonamide-induced gene 2; the fourth expression cassette consists of the rice actin 1 promoter (pOsAct1), operably linked to the Arabidopsis EPSPS chloroplast transport peptide (AtCTP), operably linked to the glyphosate-resistant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) of Agrobacterium CP4 strain, and operably linked to the transcription terminator (Nos) of annattoline synthase. A portion of the insert sequence from the left boundary region (LB) of Agrobacterium, and a flanking genomic region of maize plant LP007-21 located at the 3' end of the transgenic insert sequence (SEQ ID NO:5). In the DNA amplification method, the DNA molecule used as the primer can be any part of the transgenic insert sequence from transgenic maize event LP007-21, or any part of the DNA region of the flanking maize genome from transgenic maize event LP007-21.

[0118] The transgenic maize event LP007-21 can be combined with other transgenic maize varieties, such as herbicide-tolerant maize (e.g., glufosinate, dicamba, etc.) or transgenic maize varieties carrying other insect-resistant genes (e.g., scarab beetles, grubs, two-spotted leaf beetles, etc.). Various combinations of all these different transgenic events, bred together with the transgenic maize event LP007-21 of this application, can provide improved hybrid transgenic maize varieties resistant to multiple insect pests and multiple herbicides. These varieties can exhibit superior traits such as increased yield compared to non-transgenic varieties and single-trait transgenic varieties.

[0119] This application provides a transgenic maize event LP007-21, a method for detecting the nucleic acid sequence of maize plants containing this event, and a transgenic maize event LP007-21 that is resistant to feeding damage from lepidopteran pests and tolerant to the phytotoxic effects of glyphosate-containing agricultural herbicides. This dual-trait maize plant expresses the Cry1Ab, Cry2Ab, and Vip3Aa proteins of Bacillus thuringiensis, which provides resistance to feeding damage from lepidopteran pests (such as the Asian corn borer and fall armyworm); and it expresses the glyphosate-resistant 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) protein of Agrobacterium CP4, which confers tolerance to glyphosate. Dual-trait maize has the following advantages: 1) Protection from economic losses caused by lepidopteran pests (such as the Asian corn borer, fall armyworm, oriental armyworm, cotton bollworm, cutworm, and peach borer, which are major pests in maize-growing areas); 2) The ability to apply glyphosate-containing agricultural herbicides to maize crops for broad-spectrum weed control; 3) No reduction in maize yield. Specifically, event LP007-21 of this application exhibits high resistance to insects, resulting in pest mortality rates up to 100%, protecting plants to a damage rate as low as 0%; it also shows high tolerance to glyphosate herbicides, protecting plants to a damage rate as low as 0%; and plants containing this event exhibit excellent agronomic traits, with yield percentages up to 100%. Furthermore, the genes encoding insect resistance and glyphosate tolerance traits are linked to the same DNA segment and exist at a single locus in the genome of transgenic maize event LP007-21. This provides enhanced breeding efficiency and enables the use of molecular markers to track transgenic insertion fragments in breeding populations and their progeny. Simultaneously, the primer or probe sequences provided in the detection method of this application can generate amplification products that diagnose transgenic maize event LP007-21 or its progeny, enabling rapid, accurate, and stable identification of the presence of plant material derived from transgenic maize event LP007-21.

[0120] Biological Preservation Instructions

[0121] Genetically modified corn case LP007-21 was deposited on November 25, 2024, at the China Center for Type Culture Collection (CCTCC), located at Wuhan University, No. 299 Bayi Road, Wuchang District, Wuhan, Hubei Province, China. The accession number is CCTCCNO:P202431. Attached Figure Description

[0122] Figure 1 is a schematic diagram of the binding site between the transgenic insertion sequence and the maize genome of the nucleic acid sequence of maize plant LP007-21 used in this application and its detection method;

[0123] Figure 2 is a schematic diagram of the recombinant expression vector pLP007 used in this application for detecting the nucleic acid sequence of maize plant LP007-21 and its detection method;

[0124] Figure 3 shows the in vitro resistance effect of the transgenic maize containing transgenic maize event LP007-21 of this application on second-instar lepidopteran pests;

[0125] Figure 4 shows the effect of artificial inoculation of transgenic maize containing transgenic maize event LP007-21 in this application in a field of two-year-old corn borers.

[0126] Figure 5 shows the effect of artificial inoculation of second-instar cotton bollworms in the field with the transgenic maize containing transgenic maize event LP007-21 of this application.

[0127] Figure 6 shows the effect of artificial inoculation of the transgenic maize containing transgenic maize event LP007-21 in this application with two-year-old peach borer in a field.

[0128] Figure 7 shows the field effect of the genetically modified maize containing the genetically modified maize event LP007-21 of this application at the recommended field concentration of glyphosate herbicide at 8 times the recommended field concentration. Detailed Implementation

[0129] The present application will be further described in detail below through examples. Through these exemplary descriptions, the features and advantages of the present application will become clearer and more apparent.

[0130] In this context, the technical term "exemplary" means "used as an example, embodiment, or illustration." Any embodiment illustrated herein as "exemplary" is not necessarily to be construed as superior to or better than other embodiments.

[0131] Furthermore, the technical features involved in the different embodiments of this application described below can be combined with each other as long as they do not conflict with each other.

[0132] The technical solution of this application for detecting the nucleic acid sequence of maize plant LP007-21 and its detection method is further illustrated below through specific embodiments.

[0133] Example 1: Cloning and Transformation

[0134] 1.1 Vector Cloning

[0135] The recombinant expression vector pLP007 (as shown in Figure 2) was constructed using standard gene cloning techniques. The pLP007 vector contains four tandem transgenic expression cassettes. The first cassette consists of the Scrophularia mosaic virus 35S promoter (pFMV), operably linked to the intron of the maize heat shock protein gene HSP70 (iZmHSP), operably linked to the maize chloroplast transport peptide (ZmCTP), operably linked to the Bacillus thuringiensis insect resistance Cry2Ab protein (Cry2Ab), and operably linked to the transcription terminator (Nos) of cauliflower base synthase. The second expression cassette consists of the maize ubiquitin gene promoter Ubi (ZmUbi) containing a tandem repeat of an enhancer region, operably linked to the Bacillus thuringiensis insect resistance gene Vip3Aa (Vip3Aa), operably linked to the 9th intron of the maize phosphoenolpyruvate carboxykinase gene (iPEPC), and operably linked to the 35S promoter of the cauliflower mosaic virus genome. The third expression cassette consists of the cauliflower mosaic virus 35S promoter (p35S), operably linked to the 5' untranslated leading strand sequence (WtCab) of wheat chloroplast a / b binding protein, operably linked to the intron of rice actin gene 1 (OsAct1), operably linked to the insect resistance Cry1Ab protein (Cry1Ab) of Bacillus thuringiensis, and operably linked to the terminator (In2) of benzenesulfonamide-induced gene 2; the fourth expression cassette consists of the rice actin 1 promoter (pOsAct1), operably linked to the Arabidopsis EPSPS chloroplast transport peptide (AtCTP), operably linked to the glyphosate-resistant 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) of Agrobacterium CP4 strain, and operably linked to the transcription terminator (Nos) of annattoline synthase. The vector pLP007 was transformed into Agrobacterium LBA4404 (Invitrgen, Chicago, USA; Cat. No: 18313-015) using liquid nitrogen, and the transformed cells were screened using 5-enol-pyruvylshikimate-3-phosphate synthase (EPSPS) as a selectable marker.

[0136] 1.2 Plant Transformation

[0137] Transformation was performed using the conventional Agrobacterium infection method. Aseptically cultured maize embryos were co-cultured with the Agrobacterium described in Example 1.1 to transfer the T-DNA from the constructed recombinant expression vector pLP007 into the maize chromosome, thereby generating transgenic maize event LP007-21.

[0138] For Agrobacterium-mediated maize transformation, briefly, immature embryos are isolated from maize and contacted with an Agrobacterium suspension, wherein Agrobacterium can deliver the nucleic acid sequences of the cry1Ab, cry2Ab, vip3Aa genes and the epsps gene to at least one cell of one of the embryos (step 1: infection step). In this step, the embryos are specifically immersed in an Agrobacterium suspension (OD660 = 0.4-0.6, infection medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 68.5 g / L, glucose 36 g / L, acetylsuccinone (AS) 40 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, pH 5.3) to initiate inoculation. Co-culture with Agrobacterium for a period of time (3 days) (Step 2: Co-culture step). Specifically, after the infection step, the immature embryos are cultured on solid medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 20 g / L, glucose 10 g / L, acetylsuccinone (AS) 100 mg / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, agar 8 g / L, pH 5.8). After this co-culture stage, a selective "recovery" step can be performed. In the "recovery" step, recovery medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, plant gel 3 g / L, pH 5.8) is used. 5.8) contains at least one known antibiotic that inhibits the growth of Agrobacterium (cephalosporin), without the addition of a selector for plant transformants (Step 3: Recovery Step). Specifically, the embryos are cultured on a solid medium containing antibiotics but without a selector to eliminate Agrobacterium and provide a recovery period for infected cells. Next, the inoculated embryos are cultured on a medium containing a selector (N-(phosphonocarboxymethyl)glycine) and the growing transformed callus is selected (Step 4: Selection Step). Specifically, the embryos are cultured on a screening solid medium containing a selector (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, N-(phosphonocarboxymethyl)glycine 0.25 mol / L, 2,4-dichlorophenoxyacetic acid (2,4-D) 1 mg / L, plant gel 3 g / L, pH 1. 5.8) is cultured on a medium containing a selector, resulting in selective growth of the transformed cells. Then, the callus regenerates into a plant (step 5: regeneration step), specifically, the callus grown on a medium containing a selector is cultured on solid media (MS differentiation medium and MS rooting medium) to regenerate a plant.

[0139] The selected resistant callus tissues were transferred to the MS differentiation medium (MS salt 4.3 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, 6-benzyladenine 2 mg / L, N-(phosphonocarboxymethyl)glycine 0.125 mol / L, plant gel 3 g / L, pH 5.8) and cultured at 25°C for differentiation. The differentiated seedlings were transferred to the MS rooting medium (MS salt 2.15 g / L, MS vitamins, casein 300 mg / L, sucrose 30 g / L, indole-3-acetic acid 1 mg / L, agar 8 g / L, pH 5.8) and cultured at 25°C until approximately 10 cm tall. They were then transferred to a greenhouse for further cultivation until fruit set. In the greenhouse, the seedlings were cultured at 28°C for 16 hours daily, followed by 8 hours at 20°C.

[0140] 1.3 Identification and Screening of Genetically Modified Organisms

[0141] A total of 1,500 independent transgenic T0 single plants were produced.

[0142] Example 2: Detection of transgenic maize event LP007-21 using TaqMan

[0143] Approximately 100 mg of leaves from the transgenic maize event LP007-21 was collected as a sample. Genomic DNA was extracted using the Qiagen DNeasyPlant Maxi Kit, and the copy numbers of cry1Ab, cry2Ab, vip3Aa, and epsps were detected by TaqMan probe-based quantitative PCR. Wild-type maize plants were used as controls, and the same analysis was performed. The experiment was conducted in triplicate, and the average value was used.

[0144] The specific method is as follows:

[0145] Step 11: Take 100 mg of leaves from transgenic maize event LP007-21, grind them into a homogenate in a mortar with liquid nitrogen, and take 3 replicates for each sample;

[0146] Step 12: Use Qiagen's DNeasy PlantMini Kit to extract genomic DNA from the above samples. Refer to the product instructions for specific methods.

[0147] Step 13: Determine the genomic DNA concentration of the above samples using NanoDrop 2000 (Thermo Scientific);

[0148] Step 14: Adjust the genomic DNA concentration of the above samples to the same concentration value, wherein the concentration value ranges from 80-100 ng / μl;

[0149] Step 15: The copy number of the samples was identified using TaqMan probe-based quantitative real-time PCR. Samples with known copy numbers were used as standards, and wild-type maize plant samples were used as controls. Each sample was tested in triplicate, and the average value was taken. The primer and probe sequences for quantitative real-time PCR were as follows:

[0150] The following primers and probes are used to detect the cry1Ab gene sequence: Primer 1: TGGGAGGACGGAATGATATTG as shown in SEQ ID NO:16 of the sequence listing; Primer 2: AACTCGTCCGTGAGCATCATC as shown in SEQ ID NO:17 of the sequence listing; Probe 1: AACTCCGCGCTGCGATGAATCC as shown in SEQ ID NO:18 of the sequence listing.

[0151] The following primers and probes were used to detect the cry2Ab gene sequence: Primer 3: GGACAGAGGCACCGCATT as shown in SEQ ID NO:19 in the sequence listing; Primer 4: CGGGTCTGCAAGCAAACG as shown in SEQ ID NO:20 in the sequence listing; Probe 2: TCCACTTGGCGGTTGAACTCCTCC as shown in SEQ ID NO:21 in the sequence listing.

[0152] The following primers and probes are used to detect the vip3Aa gene sequence: Primer 5: GGTGTCCTCGTAGTGGATGT as shown in SEQ ID NO:22 in the sequence listing; Primer 6: TGATCCAGTACACCGTGAAG as shown in SEQ ID NO:23 in the sequence listing; Probe 3: TTCAGGTGAATCGATGGC as shown in SEQ ID NO:24 in the sequence listing;

[0153] The following primers and probes are used to detect the epsps gene sequence: Primer 7: GCAAATCCTCTGGCCTTTCC as shown in SEQ ID NO:25 in the sequence listing; Primer 8: TGAAGGACCGGTGGGAGAT as shown in SEQ ID NO:26 in the sequence listing; Probe 4: CGTCCGCATTCCCGGCGA as shown in SEQ ID NO:27 in the sequence listing;

[0154] The PCR reaction system is as follows:

[0155] The 50× primer / probe mixture contains 45 μL of each primer at a concentration of 1 mM, 50 μL of the probe at a concentration of 100 μM, and 860 μL of 1×TE buffer, and is stored in amber tubes at 4°C.

[0156] The PCR reaction conditions are as follows:

[0157] Data were analyzed using SDS2.3 software (Applied Biosystems) to obtain the single-copy transgenic maize event LP007-21.

[0158] Example 3: Detection of the LP007-21 transgenic maize incident

[0159] 3.1 Genomic DNA Extraction

[0160] DNA extraction was performed using the conventional CTAB (hexadecyltrimethylammonium bromide) method: 2 grams of young transgenic maize leaves from the LP007-21 event were ground into powder in liquid nitrogen, and then 0.5 mL of DNA extraction CTAB Buffer [20 g / L CTAB, 1.4 M NaCl, 100 mM Tris-HCl, 20 mM...] was added. EDTA (ethylenediaminetetraacetic acid) was added, and the pH was adjusted to 8.0 with NaOH. After thorough mixing, the mixture was extracted at 65°C for 90 min. 0.5 volumes of phenol and chloroform were added, and the mixture was inverted and mixed. The mixture was centrifuged at 12,000 rpm for 10 min. The supernatant was collected, and 1 volume of isopropanol was added. The centrifuge tube was gently shaken and incubated at -20°C for 30 min. The mixture was then centrifuged again at 12,000 rpm for 10 min. The DNA was collected at the bottom of the tube. The supernatant was discarded, and the precipitate was washed with 0.5 mL of 70% ethanol. The mixture was centrifuged at 12,000 rpm for 5 min. The precipitate was vacuum dried or air-dried in a clean bench. The DNA precipitate was dissolved in an appropriate amount of TE buffer (10 mM Tris-HCl, 1 mM EDTA, pH 8.0) and stored at -20°C.

[0161] 3.2 Analysis of flanking DNA sequences

[0162] The concentration of the extracted DNA samples was determined to be between 80-100 ng / μL. Genomic DNA was digested with the selected restriction endonucleases SpeI, PstI, BssHII (5' end analysis) and SacI, KpnI, XmaI, NheI (3' end analysis). Each digestion system contained 26.5 μL of genomic DNA, 0.5 μL of the selected restriction endonuclease, and 3 μL of digestion buffer, and was digested at an appropriate temperature for 1 hour. After digestion, 70 μL of anhydrous ethanol was added to the digestion system, the mixture was incubated on ice for 30 min, centrifuged at 12000 rpm for 7 min, the supernatant was discarded, and the mixture was dried. Then, 8.5 μL of double-distilled water (ddH2O), 1 μL of 10X T4 buffer, and 0.5 μL of T4 ligase were added, and ligation was performed overnight at 4°C. PCR amplification was performed using a series of nested primers to separate the 5' and 3' transgenic / genomic DNA. Specifically, the primer combination for isolating 5' transgenic / genomic DNA includes SEQ ID NO:13 and SEQ ID NO:34 as the first primer, SEQ ID NO:35 and SEQ ID NO:36 as the second primer, and SEQ ID NO:13 as the sequencing primer. The primer combination for isolating 3' transgenic / genomic DNA includes SEQ ID NO:15 and SEQ ID NO:37 as the first primer, SEQ ID NO:38 and SEQ ID NO:39 as the second primer, and SEQ ID NO:15 as the sequencing primer. The PCR reaction conditions are shown in Table 3.

[0163] The obtained amplicon was electrophoresed on a 2.0% agarose gel to separate the PCR reaction products, and the target fragment was then isolated from the agarose matrix using the QIAquick Gel Extraction Kit (catalog #28704, Qiagen Inc., Valencia, CA). The purified PCR products were then sequenced (e.g., ABIprism™ 377, PE Biosystems, Foster City, CA) and analyzed (e.g., DNASTAR Sequencing Software, DNASTARInc., Madison, WI).

[0164] The 5' and 3' flanking and junction sequences were confirmed using standard PCR methods. The 5' flanking and junction sequences can be confirmed using SEQ ID NO:8 or SEQ ID NO:12, in combination with SEQ ID NO:9, SEQ ID NO:13, or SEQ ID NO:34. The 3' flanking and junction sequences can be confirmed using SEQ ID NO:11 or SEQ ID NO:14, in combination with SEQ ID NO:10, SEQ ID NO:15, or SEQ ID NO:37. The PCR reaction system and amplification conditions are shown in Tables 2 and 3. Those skilled in the art will understand that other primer sequences can also be used to confirm the flanking and junction sequences.

[0165] DNA sequencing of PCR products provides DNA that can be used to design other DNA molecules, which can be used as primers and probes for the identification of maize plants or seeds derived from the transgenic maize event LP007-21.

[0166] Nucleotide positions 1-1070 of SEQ ID NO:5 show the right flanking (5' flanking sequence) of the maize genome sequence inserted in transgenic maize event LP007-21, and nucleotide positions 17368-18372 of SEQ ID NO:5 show the left flanking (3' flanking sequence) of the maize genome sequence inserted in transgenic maize event LP007-21. The 5' conjugation sequence is listed in SEQ ID NO:1, and the 3' conjugation sequence is listed in SEQ ID NO:2.

[0167] 3.3 PCR Conjugation Assay

[0168] The conjugation sequences are relatively short polynucleotide molecules, which are novel DNA sequences that are diagnostic for the DNA of transgenic maize event LP007-21 when detected in polynucleotide assays. The conjugation sequence of SEQ ID NO:1 consists of 11 bp on each side of the T-DNARB region insertion site of transgenic maize event LP007-21 and the maize genomic DNA insertion site. The conjugation sequence of SEQ ID NO:2 consists of 11 bp on each side of the T-DNALB region insertion site of transgenic maize event LP007-21 and the maize genomic DNA insertion site. Longer or shorter polynucleotide conjugation sequences can be selected from SEQ ID NO:3 or SEQ ID NO:4. The conjugation sequences (5' conjugation region SEQ ID NO:1 and 3' conjugation region SEQ ID NO:2) are useful as DNA probes or as DNA primer molecules in DNA detection methods. Conjugation sequences SEQ ID NO:6 and SEQ ID NO:7 are also novel DNA sequences from transgenic maize event LP007-21 and can also be used as DNA probes or as DNA primer molecules to detect the presence of DNA from transgenic maize event LP007-21. The SEQ ID NO:6 (nucleotides 610-1062 of SEQ ID NO:3) spans the LP007 construct DNA sequence and the tNos transcription termination sequence, and the SEQ ID NO:7 (nucleotides 1-263 of SEQ ID NO:4) spans the tNos transcription termination sequence and the LP007 construct DNA sequence.

[0169] In addition, amplicon is generated by using primers from at least one of SEQ ID NO:3 or SEQ ID NO:4, which, when used in a PCR method, produce diagnostic amplicon for transgenic maize event LP007-21.

[0170] Specifically, a PCR product was generated from the 5' end of the transgenic insertion sequence. This PCR product comprised a portion of genomic DNA flanking the 5' end of the T-DNA insertion sequence from the genome of plant material derived from the transgenic maize event LP007-21. This PCR product contains SEQ ID NO:3. For PCR amplification, primer 11 (SEQ ID NO:8) was designed to hybridize with the genomic DNA sequence flanking the 5' end of the transgenic insertion sequence, and primer 12 (SEQ ID NO:9) was designed to pair with it at the transgenic tNos transcription termination sequence.

[0171] A PCR product was generated from the 3' end of the transgenic insert sequence. This PCR product contained a portion of genomic DNA flanking the 3' end of the T-DNA insert sequence from the genome of plant material derived from the transgenic maize event LP007-21. This PCR product contained SEQ ID NO:4. For PCR amplification, primer 14 (SEQ ID NO:11) was designed to hybridize with the genomic DNA sequence flanking the 3' end of the transgenic insert sequence, and primer 13 (SEQ ID NO:10) was designed to pair with it with the tNos transcription termination sequence located at the 3' end of the insert.

[0172] The DNA amplification conditions described in Tables 3 and 4 can be used for the above-described PCR conjugation assays to generate diagnostic amplicones for transgenic maize event LP007-21. Amplicon detection can be performed using a Stratagene Robocycle, MJ Engine, Perkin-Elmer 9700, or Eppendorf Mastercycler Gradient thermal cycler as shown in Table 3, or by methods and equipment known to those skilled in the art.

[0173] Table 3. PCR steps and reaction mixture conditions for identification of the 5' transgenic insert / genome junction region in transgenic maize event LP007-21.

[0174] Table 4. Conditions for the Perkin-Elmer 9700 Thermal Cyclist

[0175] Mix gently. If the thermal cycler does not have an insulation cap, add 1-2 drops of mineral oil above each reaction mixture. Perform PCR using the following cycling parameters (Table 3) on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJR-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler. The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. For the Perkin-Elmer 9700 thermal cycler, set the ramp speed to its maximum value.

[0176] The experimental results showed that primers 11 and 12 (SEQ ID NO: 8 and 9) produced an amplification product of a 1027 bp fragment when used in the PCR reaction of transgenic maize event LP007-21 genomic DNA, but no fragment was amplified when used in the PCR reaction of untransformed maize genomic DNA and non-LP007-21 maize genomic DNA; primers 13 and 14 (SEQ ID NO: 10 and 11) produced an amplification product of an 847 bp fragment when used in the PCR reaction of transgenic maize event LP007-21 genomic DNA, but no fragment was amplified when used in the PCR reaction of untransformed maize genomic DNA and non-LP007-21 maize genomic DNA.

[0177] PCR conjugation assays can also be used to identify whether materials derived from transgenic maize event LP007-21 are homozygous or heterozygous. Primers 15 (SEQ ID NO:12), 16 (SEQ ID NO:13), and 17 (SEQ ID NO:14), or primers 16 (SEQ ID NO:13), 17 (SEQ ID NO:14), and 18 (SEQ ID NO:15) are used in the amplification reaction to generate diagnostic amplicon for transgenic maize event LP007-21. The DNA amplification conditions described in Tables 5 and 6 can be used for the above conjugation assays to generate diagnostic amplicon for transgenic maize event LP007-21.

[0178] Table 5. Reaction solution for bonding test

[0179] Table 6. Adhesion determination conditions using the Perkin-Elmer 9700 thermal cycler.

[0180] Perform PCR on a Stratagene Robocycler (Stratagene, La Jolla, CA), MJ Engine (MJR-Biorad, Hercules, CA), Perkin-Elmer 9700 (Perkin Elmer, Boston, MA), or Eppendorf Mastercycler Gradient (Eppendorf, Hamburg, Germany) thermal cycler using the following cycling parameters (Table 5). The MJ Engine or Eppendorf Mastercycler Gradient thermal cycler should be run in calculated mode. For the Perkin-Elmer 9700 thermal cycler, the ramp speed should be set to its maximum value.

[0181] In the amplification reaction, the biological sample containing template DNA contains DNA that diagnoses the presence of transgenic maize event LP007-21 in the sample. Alternatively, the reaction will generate two distinct DNA amplicones from a biological sample containing DNA derived from the maize genome, wherein the maize genome DNA is heterozygous relative to the allele corresponding to the inserted DNA present in transgenic maize event LP007-21. These two distinct amplicones will correspond to a first amplicon derived from a wild-type maize genome locus and a second amplicon diagnosing the presence of transgenic maize event LP007-21 DNA. A maize DNA sample that produces only a single amplicon corresponding to the second amplicon described for a heterozygous genome can diagnose the presence of transgenic maize event LP007-21 in the sample, and this sample is produced from maize seeds that are homozygous relative to the allele corresponding to the inserted DNA present in transgenic maize plant LP007-21.

[0182] It should be noted that the primer pairs from the transgenic maize event LP007-21 were used to generate diagnostic amplicones for the genomic DNA of transgenic maize event LP007-21. These primer pairs include, but are not limited to, primers 11 and 12 (SEQ ID NO: 8 and 9), and primers 13 and 14 (SEQ ID NO: 10 and 11), used in the DNA amplification method described above. Additionally, a control primer set 9 and 10 (SEQ ID NO: 28 and SEQ ID NO: 29) for amplifying endogenous maize genes is included as an intrinsic standard for the reaction conditions. Analysis of DNA samples extracted from transgenic maize event LP007-21 should include a positive tissue DNA extract control from transgenic maize event LP007-21, a negative DNA extract control from non-transgenic maize event LP007-21, and a negative control without template maize DNA. In addition to these primer pairs, any primer pairs from SEQ ID NO:3 or SEQ ID NO:4, or their complementary sequences, can be used to generate, when used in a DNA amplification reaction, amplicon containing SEQ ID NO:1 or SEQ ID NO:2 that is diagnostic for tissues derived from the transgenic maize plant LP007-21. The DNA amplification conditions described in Tables 2-5 can be used to generate diagnostic amplicones for transgenic maize event LP007-21 using appropriate primer pairs. Extracts of maize plant or seed DNA presumed to contain transgenic maize event LP007-21, or products derived from transgenic maize event LP007-21, that produce diagnostic amplicones for transgenic maize event LP007-21 when tested in DNA amplification methods, can be used as templates for amplification to determine the presence of transgenic maize event LP007-21.

[0183] Example 4: Detection of transgenic maize event LP007-21 by Southern blot hybridization

[0184] 4.1 DNA Extraction for Southern Blot Hybridization

[0185] Southern blot analysis was performed using homozygous transformation events at generations T4 and T5. Approximately 5–10 g of plant tissue was ground in liquid nitrogen using a mortar and pestle. The plant tissue was resuspended in 12.5 mL of extraction buffer A (0.2 M Tris pH 8.0, 50 mM EDTA, 0.25 M NaCl, 0.1% v / v β-mercaptoethanol, 2.5% w / v polyvinylpyrrolidone) and centrifuged at 4000 rpm for 10 min (2755 g). After discarding the supernatant, the precipitate was resuspended in 2.5 mL of extraction buffer B (0.2 M Tris pH 8.0, 50 mM EDTA, 0.5 M NaCl, 1% v / v β-mercaptoethanol, 2.5% w / v polyvinylpyrrolidone, 3% sarcosyl, 20% ethanol) and incubated at 37 °C for 30 min. During incubation, the sample was mixed once with a sterile loop. After incubation, add an equal volume of chloroform / isoamyl alcohol (24:1), gently mix by inversion, and centrifuge at 4000 rpm for 20 minutes. Collect the aqueous layer and centrifuge at 4000 rpm for 5 minutes after adding 0.54 volumes of isopropanol to precipitate DNA. Discard the supernatant and resuspend the DNA precipitate in 500 μL TE. To degrade any RNA present, incubate DNA and 1 μL of 30 mg / mL RNAase A at 37°C for 30 minutes, centrifuge at 4000 rpm for 5 minutes, and precipitate DNA by centrifugation at 14000 rpm for 10 minutes in the presence of 0.5 volumes of 7.5 M ammonium acetate and 0.54 volumes of isopropanol. Discard the supernatant, wash the precipitate with 500 μL of 70% ethanol, and resuspend it in 100 μL TE after drying.

[0186] 4.2 Restriction enzyme digestion

[0187] DNA concentration was quantitatively detected using a spectrophotometer or fluorometer (using 1×TAE and GelRED dye). 5 μg of DNA was digested in a 100 μL reaction system each time. Genomic DNA was digested with restriction endonucleases AvrII and HindIII, respectively, using partial sequences of Cry2Ab and EPSPS on T-DNA as probes. Genomic DNA was also digested with restriction endonucleases AvrII and HindIII, respectively, using partial sequences of Cry1Ab and Vip3Aa on T-DNA as probes. For each enzyme, the digests were incubated overnight at an appropriate temperature. The samples were then evaporated using a speedvacuum to reduce the volume to 30 μL.

[0188] 4.3 Gel electrophoresis

[0189] Add bromophenol blue loading dye to each sample derived from Example 4.2 and load each sample onto a 0.7% agarose gel containing ethidium bromide. Separate the samples by electrophoresis in TBE electrophoresis buffer and incubate the gel overnight at 20 volts.

[0190] Wash the gel in 0.25M HCl for 15 minutes to depurify the DNA, then wash with water. Set up Southern blotting hybridization as follows: Place 20 thick sheets of dry blotting paper in a dish, then place 4 thin sheets of dry blotting paper on top. Pre-wet one sheet of thin blotting paper in 0.4M NaOH and place it on top of the stack, followed by a Hybond-N+ transfer membrane (Amersham Pharmacia Biotech, #RPN303B) pre-wetted in 0.4M NaOH. Place the gel on top, ensuring there are no air bubbles between the gel and the membrane. Place 3 additional pre-soaked blotting papers on top of the gel, and fill the buffer dish with 0.4M NaOH. Connect the gel stack and the buffer dish with a wick pre-soaked in 0.4M NaOH to transfer the DNA onto the membrane. Perform DNA transfer at room temperature for approximately 4 hours. After transfer, rinse the Hybond membrane in 2×SSC for 10 seconds; the DNA binds to the membrane via UV cross-linking.

[0191] 4.4 Hybridization

[0192] Suitable DNA sequences were amplified by PCR for probe preparation. The DNA probes were SEQ ID NO:30, SEQ ID NO:31, SEQ ID NO:32, and SEQ ID NO:33, or sequences homologous to or complementary to these sequences. 25 ng of probe DNA was boiled in 45 μL of water for 5 minutes, placed on ice for 7 minutes, and then transferred to a Redimone II (Amersham Pharmacia Biotech, #RPN1633) tube. 5 μl of 32P-labeled dCTP was added to the Redimone tube, and the probe was incubated at 37°C for 15 minutes. The probe was purified by centrifugation using a G-50 microcentrifuge column (Amersham Pharmacia Biotech, #27-5330-01) to remove unincorporated dNTPs, according to the manufacturer's instructions. Probe activity was measured using a scintillation counter. The Hybond membrane was prehybridized by wetting it for 30 minutes at 65°C with 20 mL of preheated Church prehybridization buffer (500 mM Na3PO4, 1 mM EDTA, 7% SDS, 1% BSA). The labeled probe was boiled for 5 minutes and then placed on ice for 10 minutes. An appropriate amount of probe was added to the prehybridization buffer (1 million counts per 1 mL of prehybridization buffer), and hybridization was performed overnight at 65°C. The next day, the hybridization buffer was discarded, and the membrane was washed with 20 mL of Church wash solution 1 (40 mM Na3PO4, 1 mM EDTA, 5% SDS, 0.5% BSA), followed by washing in 150 mL of Church wash solution 1 at 65°C for 20 minutes. This process was repeated twice with Church wash solution 2 (40 mM Na3PO4, 1 mM EDTA, 1% SDS). The membrane was then exposed to a phosphor screen or X-ray film to detect the probe binding sites.

[0193] Each Southern sample includes two control samples: (1) DNA from negative (untransformed) isolates, used to identify any endogenous maize sequence that can hybridize with the element-specific probe; and (2) DNA from positive isolates, in which HindIII-digested pLP007 is introduced in an amount based on the probe length equivalent to one copy number, to illustrate the sensitivity of the experiment in detecting single gene copies within the maize genome.

[0194] Hybridization data provided confirmatory evidence supporting TaqMan. TMPCR analysis revealed that the maize plant LP007-21 contains single copies of the Cry1Ab, Cry2Ab, Vip3Aa, and EPSPS genes. Using the Cry1Ab probe, digestion with AvrII and HindIII yielded single bands of approximately 7.9 kb and 12.2 kb, respectively; using the Cry2Ab probe, digestion with AvrII and HindIII yielded single bands of approximately 21.1 kb and 5.8 kb, respectively; using the Vip3Aa probe, digestion with AvrII and HindIII yielded single bands of approximately 21.1 kb and 12.2 kb, respectively; and using the EPSPS probe, digestion with AvrII and HindIII yielded single bands of approximately 7.9 kb and 12.2 kb, respectively. This indicates that one copy each of Cry1Ab, Cry2Ab, Vip3Aa, and EPSPS is present in the maize transformation event LP007-21.

[0195] Example 5: Insect resistance detection

[0196] 5.1 Bioassay of LP007-21 in maize plants

[0197] The genetically modified corn incidents LP007-21, LP007-1 to LP007-8 (see the applicant's prior series of applications "Genetically Modified Corn Incident LP007-1 and its Detection Method", "Genetically Modified Corn Incident LP007-2 and its Detection Method", "Genetically Modified Corn Incident LP007-3 and its Detection Method", "Genetically Modified Corn Incident LP007-4 and its Detection Method", "Genetically Modified Corn Incident LP007-5 and its Detection Method", "Genetically Modified Corn Incident LP007-6 and its Detection Method", "Genetically Modified Corn Incident LP007-7 and its Detection Method"), and "Genetically Modified Corn Incident LP007-21, LP007-1 to LP007-8 (see the applicant's prior series of applications "Genetically Modified Corn Incident LP007-1 and its Detection Method", "Genetically Modified Corn Incident LP007-6 and its Detection Method", "Genetically Modified Corn Incident LP007-7 and its Detection Method"), and "Genetically Modified Corn Incident LP007-21 and its Detection Method"). The prior application, "Corn Incident LP007-8 and its Detection Method," targets insect resistance testing for early-stage pests. It is well known that early-stage pests are far less damaging than second-stage pests, and their eradication is also far easier. Ten plants (non-GMO, transformation recipient control (CK)) and wild-type corn plants were subjected to bioassays on second-stage Asian corn borer (Ostriniafurnacalis), peach borer (Conogethespunctiferalis), cotton bollworm (Helicoverpaarmigera), fall armyworm (Spodoptera frugiperda), two-spotted cutworm (Athetis lepigone), oriental armyworm (Mythimnaseperata), cutworm (Agrotis ipsilon), and beet armyworm (Spodoptera exigua) using the following methods:

[0198] Fresh leaves (V3-V4 stage) from the above 10 plants were taken, rinsed with sterile water, and dried with gauze. The veins of the corn leaves were removed, and the leaves were cut into strips approximately 1cm × 3cm. One to three strips (the number of leaves determined by the insect's feeding behavior) were placed on filter paper at the bottom of a round plastic petri dish. The filter paper was moistened with distilled water. Ten artificially raised, voracious second-instar larvae were placed in each petri dish. After covering the petri dishes, they were placed under conditions of 26-28℃, 70%-80% relative humidity, and a photoperiod (light / dark) of 16:8 for 5 days. The results were then statistically analyzed. The mortality rate was calculated, and the resistance level was identified by correcting the mortality rate. Corrected mortality rate (%) = (1 - number of survivors / number of insects inoculated - wild-type control mortality rate) / (1 - wild-type control mortality rate) × 100%. The resistance results of the second-instar pests are shown in Table 7, and the in vitro biological resistance test effect is shown in Figure 3.

[0199] Table 7. Bioassay results of resistance to second-instar insects in transgenic maize incidents - mortality rate (%)

[0200] 5.2 Field effects of the LP007-21 genetically modified maize incident

[0201] (1) Corn borer

[0202] The resistance of insect- and herbicide-tolerant corn variety LP007-21 to the Asian corn borer, a major target pest, was validated through field infestation. Second-instar larvae were inoculated twice during the 4-6 leaf stage and the silking stage (3-5 cm of silk on the female ear), with 50 larvae in each inoculation, one week apart. Fourteen days after inoculation at the whorl stage, the extent of Asian corn borer feeding on the upper and middle leaves of each corn plant was investigated, and the leaf-feeding level was recorded. After inoculation at the silking stage, the degree of damage to the female ear and the overall plant damage before harvest were assessed, including the length of damaged ears, the number of borer holes, the length of borer tunnels, the surviving larval instars, and the number of surviving larvae. The "whorl damage level grading standard" was used as the evaluation indicator, and the results are shown in Figure 4 and Table 12. A dissection of the ears was conducted during the silking stage, and the statistical results are shown in Table 13.

[0203] Table 8. Grading Standards for Damage to the Whorl of Corn by the Asian Corn Borer

[0204] Table 9 Evaluation criteria for maize resistance to Asian corn borer

[0205] Table 10 Grading Standards for Damage Caused by the Asian Corn Borer During the Maize Ear Stage

[0206] Table 11 Evaluation criteria for maize resistance to Asian corn borer at the tasseling stage

[0207] Table 12 Results of resistance to the two-year-old Asian corn borer at the heart leaf stage in transgenic maize events.

[0208] Table 13 Results of resistance to Asian corn borer at the silking stage of transgenic maize.

[0209] The results showed that transgenic maize event LP007-21 exhibited good resistance to the second-instar Asian corn borer at both the whorl and silking stages. At the whorl stage, the average leaf-eating severity of transgenic maize event LP007-21 was significantly lower than that of the transgenic recipient control (CK-) and other transgenic maize events. At the silking stage, the ear damage rate, larval survival rate, tunnel length, and ear damage severity of transgenic maize event LP007-21 were all significantly lower than those of the transgenic recipient control and other transgenic maize events.

[0210] (2)Bollworm

[0211] The experimental design and methods were largely consistent with those described above for evaluating resistance to the Asian corn borer. The difference was that artificial inoculation was conducted only during the silking stage of the corn plant, with two inoculations. Approximately 20 artificially reared second-instar larvae were inoculated into the silks of each corn plant. Three days after the first inoculation, a second inoculation was performed with the same number of larvae. 14-21 days after inoculation, the damage rate of the female ear, the number of surviving larvae per ear, and the length of damage to the ear were investigated on a plant-by-plant basis. Investigations typically began 14 days after inoculation. If the damage level of the negative control (CK) reached susceptible or highly susceptible, the inoculation was considered valid. If not, the investigation could be appropriately postponed. However, if the corresponding level was not reached 21 days after inoculation, the inoculation was considered invalid. Based on the damage rate of the female ear, the number of surviving larvae, and the length of damage to the ear (cm), the average damage level of the bollworm to the female ear in each plot was calculated. The judgment criteria are shown in Table 14. Then, the resistance level of the corn to the bollworm at the ear stage was determined according to the criteria in Table 15. The results of resistance to bollworm during the silking stage of the transgenic maize event LP007-21 are shown in Figure 5 and Table 16.

[0212] Table 14 Grading Standards for the Degree of Bollworm Damage to Maize Ears

[0213] Table 15 Evaluation criteria for maize female ears' resistance to bollworm.

[0214] Table 16 Results of resistance to bollworm during the silking stage of transgenic maize events.

[0215] The results showed that transgenic maize event LP007-21 had a good resistance level to cotton bollworm, and the female ear damage rate, larval survival rate, female ear damage length, and female ear damage level of transgenic maize event LP007-21 were significantly lower than those of the transgenic recipient control (CK-) and other transgenic maize events.

[0216] (3)Peach borer

[0217] The experimental design and methods were basically consistent with those described above for evaluating bollworm resistance. Artificial inoculation was conducted only during the corn silking stage, with two inoculations. Approximately 20 artificially reared second-instar larvae were inoculated into the silks of each corn plant. Three days after the first inoculation, a second inoculation was performed with the same number of larvae. 14-21 days after inoculation, the damage rate of the female ear, the number of surviving larvae per ear, and the length of damage to the ear were investigated on a plant-by-plant basis. Investigations typically began 14 days after inoculation. If the damage level of the negative control (CK) reached susceptible or highly susceptible, it was considered valid. If not, the investigation could be appropriately postponed. However, if the corresponding level was not reached 21 days after inoculation, the inoculation was considered invalid. Based on the female ear damage rate, the number of surviving larvae, and the length of damage to the ear (cm), the average damage level of the peach borer on the female ear during the corn ear stage was calculated for each plot. The judgment criteria are shown in Table 17. Then, the resistance level of corn to the peach borer during the ear stage was determined according to the criteria in Table 18. The resistance results of transgenic maize at the silking stage to peach borer are shown in Figure 6 and Table 19.

[0218] Table 17 Grading Standards for the Degree of Damage to Maize Ears by the Peach Borer

[0219] Table 18 Evaluation Criteria for Resistance of Maize Female Ears to Peach Borer

[0220] Table 19 Results of resistance to peach borer during the silking stage of transgenic maize.

[0221] The results showed that transgenic maize event LP007-21 had a good resistance level to peach borer, and the female ear damage rate, larval survival rate, female ear damage length and female ear damage level of transgenic maize event LP007-21 were significantly lower than those of the transgenic recipient control (CK-) and other transgenic maize events.

[0222] Example 6: Herbicide Tolerance Testing of an Event

[0223] This experiment used Roundup herbicide (41% glyphosate isopropylammonium salt solution) for spraying. A randomized block design was employed with three replicates. The plot area was 15m². 2(5m × 3m), row spacing 60cm, plant spacing 25cm, conventional cultivation management, with a 1m wide isolation strip between plots. Each transgenic maize event was treated in two ways: 1) no spraying; 2) Roundup herbicide was sprayed at a dose of 3360g ae / ha (4 times the dose) at the V3 leaf stage, and then sprayed again at the same dose at the V8 stage. It should be noted that different concentrations and formulations of glyphosate herbicides, when converted to an equivalent amount of glyphosate acid, are applicable to the following conclusions. Symptoms of herbicide damage were investigated 1 week and 2 weeks after application, and plot yields were measured at harvest. The symptom grading is shown in Table 20. Herbicide damage rate was used as an evaluation index to assess herbicide tolerance in the transformation event. Specifically, the herbicide damage rate (%) = ∑(number of affected plants of the same level × number of levels) / (total number of plants × highest level); where the herbicide damage rate refers to the glyphosate damage rate, which was determined based on the herbicide damage survey results two weeks after glyphosate treatment. The maize yield for each plot was the total yield (weight) of the maize kernels in the middle three rows of each plot. The yield difference between different treatments was measured as a percentage of yield, where the yield percentage (%) = sprayed yield / unsprayed yield. The results of herbicide tolerance and maize yield for the transgenic maize event LP007-21 are shown in Figure 7 and Table 21.

[0224] Table 20 Grading Standards for the Severity of Glyphosate Herbicide Damage to Corn

[0225] Table 21 Results of glyphosate herbicide tolerance and maize yield in transgenic maize events.

[0226] The results show that, regarding the herbicide (glyphosate) damage rate: 1) the damage rate of transgenic maize event LP007-21 under glyphosate herbicide treatment (3360 ga.e. / ha) was basically 0. Therefore, transgenic maize event LP007-21 has excellent tolerance to high doses of glyphosate herbicide.

[0227] In terms of yield: the yield of LP007-21 genetically modified maize did not decrease under two treatments: no spraying (water spraying) and spraying with 3360g ae / ha glyphosate. After spraying with glyphosate herbicide, the yield of LP007-21 genetically modified maize was slightly higher than that of CK (non-genetically modified), which further indicates that LP007-21 genetically modified maize has good tolerance to glyphosate herbicide.

[0228] In summary, TaqMan™ analysis (see Example 2) was used to detect the presence of the cry1Ab, cry2Ab, vip3Aa, and epsps genes in regenerated transgenic maize plants, and to characterize the copy numbers of insect resistance and glyphosate herbicide tolerance lines. Based on the copy number of the target genes, good insect resistance, glyphosate herbicide tolerance, and agronomic traits (see Examples 5 and 6), event LP007-21 was selected as superior through screening, possessing a single-copy transgene, good insect resistance, glyphosate herbicide tolerance, and agronomic traits (Examples 5 and 6).

[0229] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application and are not intended to limit it. Although this application has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of this application without departing from the spirit and scope of the technical solutions of this application.

Claims

1. A nucleic acid molecule for detecting the transgenic maize incident LP007-21, characterized in that, The nucleic acid molecule contains a sequence selected from any one or more of the sequences SEQ ID NO:1 to 7 and their complementary sequences; the nucleic acid molecule originates from the transgenic maize event LP007-21.

2. The nucleic acid molecule according to claim 1, characterized in that, The sequence of the nucleic acid molecule is one or more of the following sequences: 1) A sequence containing at least 11 consecutive nucleotides of SEQ ID NO:3 or its complementary sequence; 2) A sequence containing at least 11 consecutive nucleotides of SEQ ID NO:4 or its complementary sequence; 3) Sequences that are homologous to or complementary to a portion of SEQ ID NO:3 that includes the complete SEQ ID NO:1; 4) Sequences that are homologous to or complementary to a portion of SEQ ID NO:4 that includes the complete SEQ ID NO:2; 5) A sequence comprising the first to 11th or the second to 22nd consecutive nucleotides in SEQ ID NO:1 or its complementary sequence; 6) A sequence including the first to 11th or the second to 22nd consecutive nucleotides in SEQ ID NO:2 or its complementary sequence.

3. The nucleic acid molecule according to claim 2, characterized in that, The sequence of at least 11 consecutive nucleotides in SEQ ID NO:3 or its complementary sequence includes at least 11 consecutive nucleotides of any portion of the maize genomic DNA region flanking 5' in SEQ ID NO:3 or its complementary sequence; the sequence of at least 11 consecutive nucleotides in SEQ ID NO:4 or its complementary sequence includes at least 11 consecutive nucleotides of any portion of the maize genomic DNA region flanking 3' in SEQ ID NO:4 or its complementary sequence.

4. A nucleic acid molecule for detecting the transgenic maize incident LP007-21, characterized in that, The sequences of the nucleic acid molecules are shown in one or more of SEQ ID NO:1-2, SEQ ID NO:3-4, SEQ ID NO:5 or their complementary sequences. The nucleic acid molecules are derived from transgenic maize event LP007-21. Maize seeds containing the transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

5. The use of the nucleic acid molecule as described in any one of claims 1 to 4 as a detection target in detecting the presence of transgenic maize event LP007-21 or its progeny in biological samples.

6. A DNA primer pair, characterized in that, The device comprises a first primer and a second primer, characterized in that when the first primer and the second primer are used together with DNA containing transgenic maize event LP007-21 or its progeny in an amplification reaction, an amplicon for detecting transgenic maize event LP007-21 in a sample is generated; The first primer is selected from SEQ ID NO:8 or SEQ ID NO:12, and the second primer is selected from SEQ ID NO:9 or SEQ ID NO:13; or the first primer is selected from SEQ ID NO:10 or SEQ ID NO:15, and the second primer is selected from SEQ ID NO:11 or SEQ ID NO:14; The maize seeds containing the aforementioned transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

7. A DNA probe or marker nucleic acid molecule, characterized in that, The DNA probe contains a fragment of SEQ ID NO:5 or its complementary sequence; the DNA probe hybridizes with any DNA molecule containing nucleic acid sequences of SEQ ID NO:1-5 or their complementary sequences under strict hybridization conditions, and does not hybridize with DNA molecules that do not contain nucleic acid sequences selected from SEQ ID NO:1-5 or their complementary sequences under strict hybridization conditions.

8. The DNA probe or marker nucleic acid molecule according to claim 7, characterized in that, The DNA probe or marker nucleic acid molecule includes at least one of the following sequences: 1) A sequence of SEQ ID NO:1 or its complementary sequence; 2) A sequence of SEQ ID NO:2 or its complementary sequence; 3) A sequence of SEQ ID NO:6 or its complementary sequence; 4) A sequence of SEQ ID NO:7 or its complementary sequence; 5) A sequence comprising at least 11 consecutive nucleotides of SEQ ID NO:3 or its complementary sequence; 6) A sequence comprising at least 11 consecutive nucleotides of SEQ ID NO:4 or its complementary sequence; 7) A sequence comprising the first 11th or the second 12th to the second 22nd consecutive nucleotides in SEQ ID NO:1 or its complementary sequence; 8) A sequence comprising the first 11th or the second 12th to the second 22nd consecutive nucleotides in SEQ ID NO:2 or its complementary sequence.

9. A method for detecting the presence of DNA from transgenic maize event LP007-21 or its progeny in a sample, characterized in that, include: (1) The sample to be tested is brought into contact with the DNA primer pair as described in claim 6 during a nucleic acid amplification reaction; (2) Perform nucleic acid amplification reaction; (3) Detect the presence of amplification products; The amplification product includes a nucleic acid sequence of SEQ ID NO:3-4 or its complementary sequence, indicating that the test sample contains DNA of the transgenic maize event LP007-21. The maize seeds containing the transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

10. A method for detecting the presence of DNA from transgenic maize event LP007-21 or its progeny in a sample, characterized in that, The method includes: (1) Contact the sample to be tested with the DNA probe of claim 7 and / or the marker nucleic acid molecule of claim 7; (2) Hybridize the sample to be tested with the probe and / or the labeled nucleic acid molecule under strict hybridization conditions; (3) Detect the hybridization of the sample to be tested with the probe and / or the labeled nucleic acid molecules; The stringent conditions were: hybridization at 65°C in a 6× sodium citrate and 0.5% sodium dodecyl sulfate solution, followed by washing the membrane once each with a 2× sodium citrate and 0.1% sodium dodecyl sulfate solution and a 1× sodium citrate and 0.1% sodium dodecyl sulfate solution.

11. A DNA detection kit, characterized in that, Includes the DNA primer pair as described in claim 6.

12. The DNA detection kit according to claim 11, characterized in that, It also includes at least one DNA molecule; The DNA molecule includes at least one of the following sequences: 1) A sequence of the homologous sequence of SEQ ID NO:1 or its complementary sequence; 2) A sequence of the homologous sequence of SEQ ID NO:2 or its complementary sequence; 3) A sequence of the homologous sequence of SEQ ID NO:6 or its complementary sequence; 4) A sequence of the homologous sequence of SEQ ID NO:7 or its complementary sequence; 5) A sequence comprising at least 11 consecutive nucleotides of SEQ ID NO:3 or its complementary sequence; 6) A sequence comprising at least 11 consecutive nucleotides of SEQ ID NO:4 or its complementary sequence; 7) A sequence comprising the first 11th or the second 12th to the second 22nd consecutive nucleotides in SEQ ID NO:1 or its complementary sequence; 8) A sequence comprising the first 11th or the second 12th to the second 22nd consecutive nucleotides in SEQ ID NO:2 or its complementary sequence.

13. A plant cell, characterized in that, It includes nucleic acid sequences encoding insect resistance Cry1Ab, Cry2Ab and Vip3Aa proteins, nucleic acid sequences encoding glyphosate herbicide tolerance EPSPS proteins, and nucleic acid sequences of specific regions; The nucleic acid sequence of the specific region includes the sequence shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:6 or SEQ ID NO:

7.

14. A method for protecting corn plants from insect infestation, characterized in that, The invention includes providing transgenic maize plant cells containing transgenic maize event LP007-21 to the diet of target insects; the target insects that ingest the transgenic maize plant cells are inhibited from further ingesting the maize plant; maize seeds containing the transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

15. A method for protecting corn plants from damage caused by glyphosate herbicides, characterized in that, Transgenic maize plants containing transgenic maize event LP007-21 were planted and treated with an effective dose of glyphosate herbicide; maize seeds containing said transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

16. A method for controlling weeds in fields where maize is planted, characterized in that, This includes applying an effective dose of glyphosate herbicide to a field planted with genetically modified maize plants containing genetically modified maize event LP007-21; maize seeds containing genetically modified maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

17. A method for cultivating maize plants resistant to insects and / or tolerant to glyphosate herbicides, characterized in that, include: Planting corn seeds that contain genetically modified corn incident LP007-21; The corn seeds are allowed to grow and develop into corn plants; The corn plants were attacked with target insects and / or sprayed with an effective dose of glyphosate herbicide, and plants with reduced plant damage compared to other plants that did not have the transgenic corn event LP007-21 were harvested; corn seeds containing the transgenic corn event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

18. A method for cultivating maize plants resistant to insects, characterized in that, include: Transgenic maize event LP007-21 was introduced into the genome of the maize plants, and maize plants that exhibited reduced plant damage due to insect feeding were selected. Maize seeds containing transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

19. A method for cultivating maize plants resistant to insects, characterized in that, include: The first parent maize plant of the insect-resistant transgenic maize event LP007-21 was sexually crossed with the second parent maize plant lacking insect resistance, thereby producing a large number of offspring plants; The progeny plants were attacked with target insects; the progeny plants that showed reduced plant damage compared to other plants that did not have the transgenic maize event LP007-21 were selected. The maize seeds containing the aforementioned transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

20. A method for cultivating maize plants tolerant to glyphosate herbicide, characterized in that, include: Transgenic maize event LP007-21 was introduced into the genome of the maize plants, and glyphosate-tolerant maize plants were selected. The maize seeds containing the aforementioned transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

21. A method for cultivating maize plants tolerant to glyphosate herbicide, characterized in that, include: The first parent maize plant of the transgenic maize event LP007-21, which is tolerant to glyphosate herbicide, was sexually crossed with the second parent maize plant lacking glyphosate tolerance, thereby producing a large number of offspring plants. The progeny plants were treated with glyphosate herbicide; glyphosate-tolerant progeny plants were selected. The maize seeds containing the aforementioned transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

22. A method for cultivating maize plants that are resistant to insects and tolerant to glyphosate herbicide application, comprising: Transgenic maize event LP007-21 was introduced into the genome of the maize plants, and maize plants that were tolerant to glyphosate and had insect resistance were selected. The maize seeds containing the aforementioned transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

23. A method for cultivating maize plants that are resistant to insects and tolerant to glyphosate herbicide application, comprising: The first parent maize plant of transgenic maize event LP007-21, which is tolerant to glyphosate and resistant to insects, was sexually crossed with a second parent maize plant lacking glyphosate tolerance and / or insect resistance, thereby producing a large number of progeny plants; the progeny plants were treated with glyphosate; the progeny plants that are tolerant to glyphosate were selected, and the progeny plants that are tolerant to glyphosate are also resistant to insect feeding damage. The maize seeds containing the aforementioned transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

24. Genetically modified maize event LP007-21 or its progeny, characterized in that, The maize seeds containing the aforementioned transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection with accession number CCTCC NO:P202431.

25. The transgenic maize event LP007-21 or its progeny according to claim 24, characterized in that, The transgenic maize event LP007-21 comprises a DNA construct; when the DNA construct is expressed in plant cells, the transgenic maize event LP007-21 acquires resistance to insects and tolerance to glyphosate herbicide.

26. The transgenic maize event LP007-21 or its progeny according to claim 25, characterized in that, The DNA construct contains four tandem expression cassettes; The first expression cassette contains a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operatively linked to the nucleic acid sequence of the insect-resistant Cry2Ab protein of Bacillus thuringiensis; The first expression cassette contains a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operatively linked to the nucleic acid sequence of the insect-resistant Cry2Ab protein of Bacillus thuringiensis; The third expression cassette contains a suitable promoter for expression in plants and a suitable polyadenylation signal sequence, the promoter being operatively linked to the nucleic acid sequence of the Cry1Ab protein; The fourth expression cassette contains a suitable promoter and a suitable polyadenylation signal sequence for expression in plants, the promoter being operatively linked to a gene encoding 5-enolpyruvylshikimate-3-phosphate synthase. The transgenic maize event LP007-21 or its progeny is characterized in that the maize seeds of said transgenic maize event LP007-21 have been deposited at the China Center for Type Culture Collection (CCTCC) with accession number CCTCC NO: P202431.

27. A corn-based food product derived from the genetically modified corn event LP007-21, characterized in that, The corn seeds of the genetically modified corn event LP007-21 have been deposited at the China Center for Type Culture Collection with the accession number CCTCC NO:P202431; the corn foods are corn flour, corn noodles, corn oil, corn gluten, corn cakes, corn cob shreds, or corn starch.

Images