GRF protein and use thereof

By overexpressing or modifying the gene for the GRF protein in soybeans, the expression level of the GRF protein was increased, which solved the problem of low soybean yield and achieved increased soybean seed size and yield.

WO2026153173A1PCT designated stage Publication Date: 2026-07-23SHANDONG SHUNFENG BIOTECH CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
SHANDONG SHUNFENG BIOTECH CO LTD
Filing Date
2026-01-05
Publication Date
2026-07-23

AI Technical Summary

Technical Problem

my country's soybean production is low, resulting in low economic benefits for farmers and a small soybean planting area, which seriously threatens national food security.

Method used

By overexpressing or modifying the gene for the GRF protein in soybeans, the expression level of the GRF protein can be increased, thereby increasing the size of soybean grains or improving soybean yield. Specific methods include constructing expression vectors, synonymous mutations, homologous recombination double crossovers, and other technical means.

Benefits of technology

It significantly increases soybean seed size and yield, increases seed length and width, increases the number of seeds per plant and seed weight, and improves total soybean yield.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN2026070474_23072026_PF_FP_ABST
    Figure CN2026070474_23072026_PF_FP_ABST
Patent Text Reader

Abstract

Provided are a GRF protein and a use thereof. Overexpression of the GRF protein in soybean results in increased seed size and improved yield of the soybean.
Need to check novelty before this filing date? Find Prior Art

Description

A GRF protein and its applications

[0001] This application claims priority to Chinese patent application CN202510073839.6, filed on January 17, 2025. The entire contents of the aforementioned Chinese patent application are incorporated herein by reference. Technical Field

[0002] This invention belongs to the field of biotechnology, specifically relating to a GRF protein and its applications, particularly to increasing the expression level of GRF protein in soybeans to increase soybean grain size and yield. Background Technology

[0003] Soybeans are a major source of oil and protein for humans, one of the world's most important economic crops, and a primary source of plant oils and plant-based proteins. Due to their comprehensive nutritional profile and high protein content, soybeans are widely used in soy product processing and animal feed. However, low soybean yields and low economic returns for farmers in my country have resulted in a small soybean planting area and a total output of only 20 million tons. More than 80% of soybeans are imported, seriously threatening national food security.

[0004] GRF family transcription factors are growth regulators in plants that participate in various physiological processes such as growth and development. This invention studies GRF family genes in soybean in order to obtain soybean germplasm resources with superior traits. Summary of the Invention

[0005] This invention provides a GRF protein and its application in increasing soybean grain size or improving soybean yield.

[0006] On the one hand, the present invention provides the application of GRF protein in increasing soybean grain size or improving soybean yield, or in the preparation of soybeans with increased grain size or yield.

[0007] In another preferred embodiment, the GRF protein is one or more of the following: GRF1 protein, GRF8 protein, or GRF13 protein (e.g., two or three).

[0008] In one embodiment, the GRF protein is derived from soybean.

[0009] In another preferred embodiment, the GRF protein comprises any one or a combination of the following:

[0010] i. The amino acid sequence of the GRF protein has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3;

[0011] ii. Compared with the GRF protein described in I, it has a sequence with one or more amino acid substitutions, deletions, or additions, and retains substantially the same function; the one or more amino acids include substitutions, deletions, or additions of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acids.

[0012] iii. The GRF protein comprises any of the amino acid sequences shown in SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3;

[0013] iv. The amino acid sequence of the GRF protein is shown in any one of SEQ ID No. 1, SEQ ID No. 2 or SEQ ID No. 3.

[0014] Preferably, the GRF protein is derived from soybean.

[0015] In this invention, increasing the expression level of the GRF protein in soybeans (e.g., by overexpression) increases soybean grain size or soybean yield, or produces soybeans with increased grain size or yield.

[0016] In one embodiment, a method for increasing the expression level of the GRF protein in soybean includes constructing the coding gene of the target protein into an expression vector and transferring the expression vector into a plant to express the target gene. In other embodiments, increasing the expression level of the GRF protein in soybean includes performing synonymous substitutions or base mutations on the coding sequence of the target gene to express the target gene; in other embodiments, increasing the expression level of the GRF protein in soybean includes inserting the target gene into the plant genome; preferably, the insertion can be performed using homologous recombination double exchange; in one embodiment, the target gene and homologous arms can be inserted into a vector, and then the vector can be transferred into a plant, utilizing homologous arms to undergo homologous recombination double exchange with the plant genome to insert the target gene into a suitable genomic location.

[0017] In one implementation, the expression level of the GRF protein in soybeans can be increased by increasing the copy number of the GRF gene in soybeans.

[0018] In one implementation, modifying or replacing the promoter of the target gene to increase the expression level of the target gene includes replacing the promoter of the target gene with a strong promoter to increase the expression level of the target gene, or modifying the promoter of the target gene to increase the expression level of the target gene.

[0019] In one embodiment, overexpression of GRF protein refers to an increase in the expression level of GRF protein or an increase in the expression level of the gene encoding GRF protein.

[0020] In one embodiment, increasing the expression level of the GRF protein in soybeans means that the expression level of the GRF protein increases by at least 1 time, preferably at least 2 times, preferably at least 3 times, preferably at least 4 times, preferably at least 5 times, preferably at least 6 times, preferably at least 10 times, preferably at least 20 times, preferably at least 30 times, preferably at least 50 times, preferably at least 70 times, and preferably at least 100 times compared to the control.

[0021] In one embodiment, the plant with increased expression of the GRF protein (e.g., soybean) or the plant overexpressing the GRF protein is homozygous or heterozygous.

[0022] In another preferred embodiment, the expression level of the GRF protein in soybeans is increased by introducing the coding sequence of the GRF protein with a synonymous mutation, or by performing a synonymous mutation on the coding sequence of the GRF protein to increase the expression level of the GRF protein in soybeans; preferably, the expression level of the GRF protein in soybeans is further increased by replacing the promoter of the GRF protein.

[0023] In another preferred embodiment, the coding sequence of a synonymously mutated GRF protein is introduced into soybean using an overexpression vector, wherein the coding sequence of the GRF protein in the overexpression vector is the coding sequence of the synonymously mutated GRF protein, and the coding sequence of the synonymously mutated GRF protein is shown in any one of SEQ ID No. 7, SEQ ID No. 8 or SEQ ID No. 9.

[0024] In another preferred embodiment, the expression level of the GRF protein is increased by modifying or replacing the promoter of the GRF protein, the promoter sequence of which is shown in SEQ ID No. 10.

[0025] In another preferred embodiment, the GRF protein is the GRF1 protein; the amino acid sequence of the GRF1 protein is shown in SEQ ID No. 1; preferably, the coding sequence of the synonymous mutant GRF1 protein is introduced into soybeans to increase the expression level of the GRF1 protein in soybeans; more preferably, the coding sequence of the synonymous mutant GRF1 protein is introduced into soybeans using an overexpression vector, the coding sequence of the synonymous mutant GRF1 protein being shown in SEQ ID No. 7.

[0026] In another preferred embodiment, the GRF protein is the GRF8 protein; the amino acid sequence of the GRF8 protein is shown in SEQ ID No. 2; preferably, the coding sequence of the synonymous mutant GRF8 protein is introduced into soybeans to increase the expression level of the GRF8 protein in soybeans; more preferably, the coding sequence of the synonymous mutant GRF8 protein is introduced into soybeans using an overexpression vector, the coding sequence of the synonymous mutant GRF8 protein is shown in SEQ ID No. 8; even more preferably, the coding sequence of the synonymous mutant GRF8 protein is introduced into soybeans to increase the expression level of the GRF8 protein in soybeans, the coding sequence of the synonymous mutant GRF8 protein is introduced into soybeans using an overexpression vector, the coding sequence of the synonymous mutant GRF8 protein is shown in SEQ ID No. 8, and the expression level of the GRF8 protein in soybeans is further increased by replacing the promoter of the GRF8 protein, the promoter sequence of the replaced GRF8 protein is shown in SEQ ID No. 10.

[0027] In another preferred embodiment, the GRF protein is the GRF13 protein; the amino acid sequence of the GRF13 protein is shown in SEQ ID No. 3; preferably, the coding sequence of the synonymous mutant GRF13 protein is introduced into soybeans to increase the expression level of the GRF13 protein in soybeans; more preferably, the coding sequence of the synonymous mutant GRF13 protein is introduced into soybeans using an overexpression vector, the coding sequence of the synonymous mutant GRF13 protein being shown in SEQ ID No. 9.

[0028] In another preferred embodiment, the GRF protein is derived from monocotyledonous and / or dicotyledonous plants.

[0029] In another preferred embodiment, the GRF protein is derived from one or more plants selected from the group consisting of: grasses, legumes, chenopodiaceae, and cruciferous plants.

[0030] In another preferred embodiment, the GRF protein is derived from one or more plants selected from the group consisting of: Arabidopsis thaliana, rice, tobacco, corn, sorghum, barley, wheat, millet, soybean, tomato, potato, quinoa, lettuce, rapeseed, cabbage, and strawberry.

[0031] In another preferred embodiment, the GRF protein is derived from soybean; preferably, the GRF protein is derived from soybean yellow 302.

[0032] In another preferred embodiment, the nucleotide sequence of the GRF protein is as shown in any one of SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8 or SEQ ID No. 9.

[0033] In another preferred embodiment, the GRF protein is the GRF1 protein, and the wild-type nucleotide sequence encoding the GRF1 protein is shown in SEQ ID No. 4; preferably, the nucleotide sequence encoding the GRF1 protein is a synonymous mutant nucleotide sequence, and the synonymous mutant nucleotide sequence encoding the GRF1 protein is shown in SEQ ID No. 7.

[0034] In another preferred embodiment, the GRF protein is the GRF8 protein, and the wild-type nucleotide sequence encoding the GRF8 protein is shown in SEQ ID No. 5; preferably, the nucleotide sequence encoding the GRF8 protein is a synonymous mutant nucleotide sequence, and the synonymous mutant nucleotide sequence encoding the GRF8 protein is shown in SEQ ID No. 8.

[0035] In another preferred embodiment, the GRF protein is the GRF13 protein, and the wild-type nucleotide sequence encoding the GRF13 protein is shown in SEQ ID No. 6; preferably, the nucleotide sequence encoding the GRF13 protein is a synonymous mutant nucleotide sequence, and the synonymous mutant nucleotide sequence encoding the GRF13 protein is shown in SEQ ID No. 9.

[0036] In this invention, the wild-type nucleotide sequence of GRF protein refers to the coding sequence of endogenous GRF protein in wild-type plants (such as soybean).

[0037] In another preferred embodiment, the increase in seed size refers to an increase in the length and / or width of the soybean seed.

[0038] In one embodiment, the increase in grain length refers to the fact that soybeans with increased GRF protein expression have a grain length that is at least 3% longer than that of the parent soybean, preferably 5%, preferably 6%, preferably 10%, preferably 15%, preferably 20%, preferably 23%, preferably 25%, preferably 30%, preferably 40%, preferably 50%, and preferably 100%.

[0039] In one embodiment, the increase in grain width refers to the fact that the soybean with increased GRF protein expression has a grain width that is at least 3% larger than that of the parent soybean, preferably 5%, preferably 6%, preferably 10%, preferably 15%, preferably 20%, preferably 23%, preferably 25%, preferably 30%, preferably 40%, preferably 50%, and preferably 100%.

[0040] In another preferred embodiment, the increased yield includes an increase in the number of seeds per plant or an increase in seed weight.

[0041] In one embodiment, the increased yield means that the soybean with increased GRF protein expression levels has a yield that is at least 3% higher than that of the parent soybean, preferably 5%, preferably 6%, preferably 10%, preferably 15%, preferably 20%, preferably 23%, preferably 25%, preferably 30%, preferably 40%, preferably 50%, and preferably 100%.

[0042] In one embodiment, the increase in the number of seeds per plant means that the soybean with increased expression of GRF protein has at least 3% more seeds per plant than the parent soybean, preferably 5%, preferably 6%, preferably 10%, preferably 15%, preferably 20%, preferably 23%, preferably 25%, preferably 30%, preferably 40%, preferably 50%, preferably 100%.

[0043] In one embodiment, the increase in grain weight means that the soybean with increased GRF protein expression has a grain weight that is at least 3% higher than that of the parent soybean, preferably 5%, preferably 6%, preferably 10%, preferably 15%, preferably 20%, preferably 23%, preferably 25%, preferably 30%, preferably 40%, preferably 50%, preferably 100%.

[0044] In another preferred embodiment, the parent soybean is Zhonghuang 302.

[0045] In another aspect, the present invention provides an isolated nucleic acid molecule that encodes the aforementioned GRF protein.

[0046] In another preferred embodiment, the nucleic acid molecule is selected from the group consisting of: genomic sequences, cDNA sequences, RNA sequences, or combinations thereof.

[0047] In another preferred embodiment, the sequence of the nucleic acid molecule is as shown in any one of SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8 or SEQ ID No. 9.

[0048] In another preferred embodiment, the sequence of the nucleic acid molecule is a synonymous mutation sequence, and the sequence of the nucleic acid molecule is as shown in any one of SEQ ID No. 7, SEQ ID No. 8 or SEQ ID No. 9.

[0049] In another preferred embodiment, the nucleic acid molecule is preferably single-stranded or double-stranded.

[0050] In another preferred embodiment, the nucleic acid molecule further comprises an operatively linked promoter.

[0051] In another preferred embodiment, the promoter is selected from the group consisting of: constitutive promoters, tissue-specific promoters, inducible promoters, or strong promoters.

[0052] In another aspect, the present invention provides a carrier comprising the aforementioned nucleic acid molecule.

[0053] In another preferred embodiment, the vector includes a cloning vector, an expression vector, a shuttle vector, or an integration vector.

[0054] The vector can be of the following types: plasmid, virus, granule, bacteriophage, etc., which are well known to those skilled in the art.

[0055] In another aspect, the present invention provides a host cell comprising the aforementioned nucleic acid molecule or the aforementioned vector.

[0056] In one embodiment, the host cell is introduced into the cell by means selected from the group consisting of: Agrobacterium-mediated transformation, gene gun method, microinjection method, electroporation method, ultrasound method, and polyethylene glycol (PEG) mediated method.

[0057] In another aspect, the present invention provides the use of the aforementioned nucleic acid molecule, or biological material containing the aforementioned nucleic acid molecule (e.g., the aforementioned carrier or host cell), in increasing soybean grain size or improving soybean yield, or in the preparation of soybeans with increased grain size or yield.

[0058] On the other hand, the present invention provides a transgenic reagent or gene editing reagent that can edit soybeans to increase the expression level of the GRF protein.

[0059] This invention also provides the application of the above-mentioned gene editing reagent or transgenic reagent in increasing soybean grain size or improving soybean yield, or in the preparation of soybeans with increased grain size or yield.

[0060] In another aspect, the present invention provides a soybean cell, soybean tissue, soybean portion or soybean, wherein the soybean cell, soybean tissue, soybean portion or soybean includes the GRF protein, or the nucleic acid molecule, or the carrier, or the host cell.

[0061] In another aspect, the present invention provides a soybean cell, soybean tissue, soybean part or soybean, wherein the soybean cell, soybean tissue, soybean part or soybean includes a GRF protein with increased expression.

[0062] In another aspect, the present invention provides a method for increasing soybean grain size or improving soybean yield, or a method for preparing soybeans with increased grain size or yield, the method comprising the step of increasing the expression level of the GRF protein in soybeans.

[0063] In another preferred embodiment, the method includes the step of increasing the expression level of the GRF protein in soybean cells, soybean seeds, soybean tissues, and soybean parts of the soybean.

[0064] In one embodiment, the method includes the steps of obtaining soybeans with increased expression levels of the GRF protein and planting the soybeans.

[0065] In another preferred embodiment, the above method includes the following steps:

[0066] (1) Provides Agrobacterium carrying an expression vector, wherein the expression vector comprises the above-mentioned nucleic acid molecule;

[0067] (2) Soybean cells, soybean tissues, and soybean parts are brought into contact with Agrobacterium in step (1) to increase the expression level of the GRF protein; and

[0068] (3) Select soybean cells, soybean tissues, and soybean parts with increased expression levels of the GRF protein.

[0069] In another preferred embodiment, the method further includes the step of regenerating the soybean cells, soybean tissue, and soybean portions into soybean plants.

[0070] On the other hand, the present invention also provides soybeans obtained using the above method.

[0071] On the other hand, the present invention also provides a method for preparing hybrid soybeans, the method comprising the step of hybridizing a first soybean plant with a second soybean plant to obtain the hybrid soybeans, wherein the first plant is a soybean prepared by the method of the present invention.

[0072] Terminology Definition

[0073] Unless otherwise defined, the technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art.

[0074] The terms “polynucleotide,” “nucleotide sequence,” “nucleic acid sequence,” “nucleic acid molecule,” and “nucleic acid” are used interchangeably and include DNA, RNA, or their hybrids, which can be double-stranded or single-stranded.

[0075] The terms "protein," "polypeptide," and "peptide" are used interchangeably in this invention to refer to polymers of amino acid residues, including polymers in which one or more amino acid residues are chemical analogs of natural amino acid residues. The proteins and polypeptides of this invention can be generated by recombinant synthesis or by chemical synthesis. The term "mutant protein" or "mutant protein" refers to a protein that, compared to the amino acid sequence of a parent protein, has one or more amino acid residues substituted, inserted, deleted, and / or added.

[0076] The term "amino acid" refers to a carboxylic acid containing an amino group. Various proteins in living organisms are composed of 20 basic amino acids.

[0077] The term "encoding" refers to the inherent characteristics of a specific nucleotide sequence in a polynucleotide, such as a gene, cDNA, or mRNA, which serves as a template for the synthesis of other polymers and macromolecules in biological processes that have defined nucleotide sequences (i.e., rRNA, tRNA, and mRNA) or defined amino acid sequences and the biological characteristics they produce. Therefore, if the transcription and translation of the mRNA corresponding to a gene produces a protein in a cell or other biological system, then that gene encodes that protein.

[0078] The term "synonymous mutation" refers to a mutation in a genetic code where, due to the degeneracy of the genetic code, the bases are mutated, the codon changes, but the amino acid it encodes remains the same.

[0079] As used herein, the term "identity" refers to the sequence matching between two polypeptides or two nucleic acids. Two compared sequences are identical at a position when the same base or amino acid monomeric subunit occupies the same location (e.g., a position in each of two DNA molecules is occupied by adenine, or a position in each of two polypeptides is occupied by lysine). The "percentage identity" between two sequences is a function of the number of matching positions shared by the two sequences divided by the number of positions compared × 100. For example, if six out of ten positions in two sequences match, then the two sequences have 60% identity. For example, the DNA sequences CTGACT and CAGGTT share 50% identity (three out of six positions match). Typically, two sequences are compared to produce the maximum identity. Such comparisons can be made using methods readily available, for example, computer programs such as the Align program (DNAstar, Inc.) Needleman et al. (1970) J. Mol. Biol. 48: 443-453. The percentage identity between two amino acid sequences can also be determined using the algorithm of E. Meyers and W. Miller (Comput. Appl Biosci., 4:11-17 (1988)) integrated into the ALIGN program (version 2.0), which uses a PAM120 weight residue table, a gap length penalty of 12, and a gap penalty of 4. Alternatively, the percentage identity between two amino acid sequences can be determined using the Needleman and Wunsch algorithm (J MoI Biol. 48:444-453 (1970)) in the GAP program integrated into the GCG software package (available at www.gcg.com), which uses a Blossum 62 matrix or a PAM250 matrix, along with gap weights of 16, 14, 12, 10, 8, 6, or 4, and length weights of 1, 2, 3, 4, 5, or 6.

[0080] The term "regulatory element," as used herein, is intended to include promoters, terminator sequences, leader sequences, polyadenylation sequences, signal peptide coding regions, marker genes, enhancers, internal ribosome entry sites (IRES), and other expression control elements (e.g., transcription termination signals such as polyadenylation signals and poly-U sequences), for detailed description in Goeddel, *Gene Expression Technology: Methods in Enzymology*, 185, Academic Press, San Diego, California (1990). In some cases, regulatory elements include those sequences that direct constitutive expression of a nucleotide sequence in many types of host cells and those sequences that direct expression of that nucleotide sequence only in certain host cells (e.g., tissue-specific regulatory sequences). Tissue-specific promoters can primarily direct expression in the desired tissue of interest, such as muscle, neurons, bone, skin, blood, specific organs (e.g., liver, pancreas), or specific cell types (e.g., lymphocytes). In some cases, regulatory elements can also direct expression in a time-dependent manner (e.g., cell cycle-dependent or developmental stage-dependent manner), which may or may not be tissue- or cell type-specific. In some cases, the term "regulatory element" encompasses enhancer elements such as WPRE; CMV enhancer; the R-U5' fragment in the LTR of HTLV-I (Mol. Cell. Biol., Vol. 8(1), pp. 466-472, 1988); SV40 enhancer; and the intron sequence between exons 2 and 3 of rabbit β-globin (Proc. Natl. Acad. Sci. USA., Vol. 78(3), pp. 1527-31, 1981).

[0081] As used herein, the term "promoter" has the meaning known to those skilled in the art, referring to a non-coding nucleotide sequence located upstream of a gene that initiates the expression of a downstream gene. A constitutive promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell under most or all physiological conditions of the cell. An inducible promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when an inducer corresponding to the promoter is present in the cell. A tissue-specific promoter is a nucleotide sequence that, when operably linked to a polynucleotide encoding or defining a gene product, results in the production of the gene product in the cell substantially only when the cell is a cell of the tissue type corresponding to that promoter.

[0082] As used herein, the term “operably linked” is intended to mean that the nucleotide sequence of interest is linked to one or more regulatory elements in a manner that allows the expression of that nucleotide sequence (e.g., in an in vitro transcription / translation system or in the host cell when the vector is introduced into the host cell).

[0083] wild type

[0084] As used herein, the term “wildtype” has the meaning commonly understood by those skilled in the art as referring to the typical form of an organism, strain, or gene, or the characteristic that distinguishes it from mutant or variant forms when it exists in nature, is separable from its natural source and has not been intentionally modified by humans.

[0085] carrier

[0086] The term "vector" refers to a nucleic acid molecule capable of delivering another nucleic acid molecule linked to it. Vectors include, but are not limited to, single-stranded, double-stranded, or partially double-stranded nucleic acid molecules; nucleic acid molecules including one or more free ends, or without free ends (e.g., circular); nucleic acid molecules including DNA, RNA, or both; and a wide variety of other polynucleotides known in the art. A vector can be introduced into a host cell through transformation, transduction, or transfection, thereby enabling the expression of its carried genetic material elements in the host cell. A vector can be introduced into a host cell to produce transcripts, proteins, or peptides, including proteins, fusion proteins, isolated nucleic acid molecules, etc., as described herein (e.g., CRISPR transcripts, such as nucleic acid transcripts, proteins, or enzymes). A vector may contain a variety of elements controlling expression, including, but not limited to, promoter sequences, transcription initiation sequences, enhancer sequences, selection elements, and reporter genes. Additionally, the vector may contain a replication initiation site.

[0087] One type of vector is a "plasmid," which is a circular double-stranded DNA loop into which another DNA fragment can be inserted, for example, using standard molecular cloning techniques.

[0088] Another type of vector is the viral vector, in which a virus-derived DNA or RNA sequence is present in a vector used to package the virus (e.g., retroviruses, replication-defective retroviruses, adenoviruses, replication-defective adenoviruses, and adeno-associated viruses). Viral vectors also contain polynucleotides carried by the virus used for transfection into a host cell. Some vectors (e.g., bacterial vectors with bacterial origins of replication and episodic mammalian vectors) are capable of autonomous replication in the host cells into which they are introduced.

[0089] Other vectors (e.g., non-attachment mammalian vectors) integrate into the host cell's genome upon introduction and thereby replicate along with the host genome. Furthermore, some vectors are capable of directing the expression of genes they are operatively linked to. Such vectors are referred to herein as "expression vectors."

[0090] host cells

[0091] As used herein, the term “host cell” refers to a cell that can be used to introduce a vector, including but not limited to prokaryotic cells such as Escherichia coli or Bacillus subtilis, and eukaryotic cells such as microbial cells, fungal cells, animal cells, and plant cells.

[0092] Those skilled in the art will understand that the design of expression vectors can depend on factors such as the selection of host cells to be transformed and the desired expression level.

[0093] plant

[0094] The term "plant" should be understood as any differentiated multicellular organism capable of photosynthesis, including crop plants at any stage of maturity or development, particularly monocotyledonous or dicotyledonous plants, vegetable crops including artichokes, kohlrabi, arugula, leeks, asparagus, lettuce (e.g., head lettuce, leaf lettuce, longleaf lettuce), bok choy, taro, cucurbits (e.g., melons, watermelons, crenshaw, cantaloupes, Roman melons), rapeseed crops (e.g., Brussels sprouts, cabbage, cauliflower, broccoli, kale, headless cabbage, Chinese cabbage, bok choy), artichokes, carrots, napa cabbage, okra, onions, celery, parsley, chickpeas, parsnip, chicory, peppers, potatoes, gourds (e.g., zucchini, cucumbers, baby zucchini, squash, pumpkin), radishes, dried artichokes, etc. Onions, turnips, purple eggplant (also known as eggplant), ginseng, lettuce, scallions, chicory, garlic, spinach, green onions, squash, leafy greens, beets (sugar beets and fodder beets), sweet potatoes, romaine lettuce, wasabi, tomatoes, turnips, and spices; fruits and / or vine crops such as apples, apricots, cherries, nectarines, peaches, pears, plums, prunes, cherries, quince, almonds, chestnuts, hazelnuts, pecans, pistachios, walnuts, citrus fruits, blueberries, boysenberry. y), cranberries, currants, raspberries, strawberries, blackberries, grapes, avocados, bananas, kiwis, persimmons, pomegranates, pineapples, tropical fruits, pears, melons, mangoes, papayas, and lychees; field crops such as clover, alfalfa, evening primrose, miscanthus, corn / maize (feed corn, sweet corn, popcorn), hops, jojoba, peanuts, rice, safflower, small grain cereals (barley, oats, rye, wheat, etc.), sorghum, tobacco, kapok, legumes (beans, lentils, peas, soybeans). Oil-bearing plants (rapeseed, mustard, poppy, olive, sunflower, coconut, castor oil plants, cocoa beans, peanuts), Arabidopsis, fiber plants (cotton, flax, hemp, jute), Lauraceae (cinnamon, camphor), or a plant such as coffee, sugarcane, tea, and natural rubber plants; and / or bedding plants, such as flowering plants, cacti, succulents and / or ornamental plants, and trees such as forests (broadleaf trees and evergreen trees, such as conifers), fruit trees, ornamental trees, and nut-bearing trees, as well as shrubs and other seedlings.

[0095] The term "plant tissue" or "plant part" includes plant cells, protoplasts, plant tissue cultures, plant callus, plant masses, as well as plant embryos, pollen, ovules, seeds, leaves, stems, flowers, branches, seedlings, fruits, kernels, spikes, roots, root tips, anthers, etc.

[0096] The term “plant cell” should be understood as any cell that is derived from or found in a plant and is capable of forming, for example: undifferentiated tissues such as callus, differentiated tissues such as embryos, components of a plant, or seeds.

[0097] In this invention, amino acid residues can be represented by a single letter or by three letters, for example: alanine (Ala, A), valine (Val, V), glycine (Gly, G), leucine (Leu, L), glutamic acid (Gln, Q), phenylalanine (Phe, F), tryptophan (Trp, W), tyrosine (Tyr, Y), aspartic acid (Asp, D), asparagine (Asn, N), glutamic acid (Glu, E), lysine (Lys, K), methionine (Met, M), serine (Ser, S), threonine (Thr, T), cysteine ​​(Cys, C), proline (Pro, P), isoleucine (Ile, I), histidine (His, H), and arginine (Arg, R).

[0098] GRF

[0099] Growth Regulating Factor (GRF) family genes are a class of transcription factors that participate in various physiological processes in plants, such as growth and development, stress, and hormones, as growth regulators. The amino acid sequences of soybean GRF1, GRF8, and GRF13 are shown in SEQ ID No. 1-3, and the nucleotide sequences are shown in SEQ ID No. 4-6, respectively.

[0100] The sequence involved in this invention is as follows:

[0101] The main advantages of this invention are:

[0102] This invention provides a GRF protein and its application. Increasing the expression level of the GRF protein in soybeans can increase soybean grain size and improve soybean yield. Attached Figure Description

[0103] Figure 1. Example of synonymous mutations in the coding sequence of the GRF protein.

[0104] Figure 2. Expression of GRF protein in different plants.

[0105] Figure 3. Comparison of seed size among different plants.

[0106] Figure 4. Comparison of grain length and width of grains from different plants.

[0107] Figure 5. Comparison of seed count and yield per plant for different plants. Detailed Implementation

[0108] The present invention will be further described below with reference to embodiments. The following description is merely a preferred embodiment of the present invention and is not intended to limit the invention in any other way. Any person skilled in the art may make equivalent modifications to the disclosed technical content to create equivalent embodiments. Any simple modifications or equivalent changes made to the following embodiments based on the technical essence of the present invention without departing from the scope of the invention are all within the protection scope of the present invention.

[0109] Example 1: Overexpression of GRF1, GRF8 and GRF13 increases soybean seed size

[0110] This embodiment investigates the effects of increasing the expression levels of GRF1, GRF8, and GRF13 in soybean on soybean seed size. The amino acid sequences of soybean GRF1, GRF8, and GRF13 proteins are shown in SEQ ID No. 1, SEQ ID No. 2, and SEQ ID No. 3, respectively, and their nucleotide sequences are shown in SEQ ID No. 4, SEQ ID No. 5, and SEQ ID No. 6, respectively.

[0111] The amino acid sequence of the GRF1 protein (SEQ ID No. 1):

[0112] The nucleotide sequence encoding the GRF1 protein (SEQ ID No. 4):

[0113] The amino acid sequence of the GRF8 protein (SEQ ID No. 2):

[0114] The nucleotide sequence encoding the GRF8 protein (SEQ ID No. 5):

[0115] The amino acid sequence of the GRF13 protein (SEQ ID No. 3):

[0116] The nucleotide sequence encoding the GRF13 protein (SEQ ID No. 6):

[0117] 1. RNA extraction

[0118] use RNA was extracted from soybean leaves of variety ZH302 using the Plant Total RNA Isolation Kit (RC401). The experimental steps are as follows:

[0119] (1) Weigh an appropriate amount of plant sample ground with liquid nitrogen, add 500 μl of Buffer PRL Plus (add 5% β-mercaptoethanol before use), vortex vigorously for 30-60 seconds to fully lyse it, and centrifuge at 12,000 rpm (13,400 × g) for 5 min.

[0120] (2) Transfer the supernatant to FastPure gDNA-Filter Column II (FastPure gDNA-Filter Column II has been placed in the collection tube), centrifuge at 12,000 rpm (13,400×g) for 2 min, and collect the filtrate.

[0121] (3) Add 0.5 times the volume of anhydrous ethanol to the filtrate and immediately mix by blowing.

[0122] (4) Transfer the above mixture to FastPure RNA Column IV (FastPure RNA Column IV has been placed in the collection tube), centrifuge at 12,000 rpm (13,400×g) for 2 min, and discard the filtrate.

[0123] (5) Add 700 μl of Buffer PRW1 to FastPure RNAColumn IV, incubate at room temperature for 1 min, centrifuge at 12,000 rpm (13,400×g) for 30 sec, and discard the filtrate.

[0124] (6) Add 500 μl of Buffer PRW2 to FastPure RNA Column IV (please check that 48 ml of anhydrous ethanol has been added before use), centrifuge at 12,000 rpm (13,400 × g) for 30 seconds, and discard the filtrate.

[0125] (7) Repeat step (6).

[0126] (8) Place the FastPure RNA Column IV adsorption column back into the collection tube, centrifuge at 12,000 rpm (13,400×g) for 2 min to remove the residual Buffer PRW2 in FastPure RNA Column IV.

[0127] After centrifugation of the empty column, leave it in a fume hood with the lid open for 2-5 minutes to allow any residual ethanol to evaporate completely.

[0128] (9) Transfer FastPure RNA Column IV to a new RNase-free Collection Tubes 1.5ml centrifuge tube, add 30-100μl of RNase-free ddH2O to the center of the adsorption column membrane, incubate at room temperature for 2min, and centrifuge at 12,000rpm (13,400×g) for 1min.

[0129] 2. Reverse transcription

[0130] Using PrimeScript TM Reverse transcription was performed using the RT reagent kit with gDNA Eraser reagent.

[0131] (1) Genomic DNA removal reaction

[0132] Prepare the reaction mixture on ice using the ingredients listed in the table below. To ensure the accuracy of the reaction mixture preparation, prepare the Master Mix by the reaction number + 2 before each reaction, then aliquot it into each reaction tube, and finally add the RNA sample.

[0133] (2) Reverse transcription reaction

[0134] The reaction mixtures were prepared on ice. To ensure the accuracy of the reaction mixture preparation, for each reaction, a Master Mix was first prepared in increments of 2 (reaction number + 2), and then 10 μl was dispensed into each reaction tube*3. After gentle mixing, the reverse transcription reaction was performed immediately.

[0135] (3) Using cDNA as a template, amplify the CDS sequence of GRF1 / 8 / 13, where,

[0136] The CDS amplification primers for GRF1 are F: atgagcgttcctccgccgta, R: aacattggcatctgggttgca;

[0137] The CDS amplification primers for GRF8 are F: atgagcgttcctccgccgtctacggcgg, R: atcaacattgacatctgggttgcagtt;

[0138] GRF13 CDS amplification primers: F: atgaacatcagtggcggaggag, R: attachcatgtggggactgagag.

[0139] (4) The above GRF1 / 8 / 13 amplification fragments were constructed into the pUBI-Vector backbone to obtain pUBI:GRF1, pUBI:GRF8 and pUBI:GRF13 vectors.

[0140] (5) Construction of pUBI:rGRF1 / 8 / 13 overexpression vector (Since plant endogenous miR396 can recognize and cleave GRF1 / 8 / 13 transcripts, reducing the expression level of GRF1 / 8 / 13 protein. Therefore, in this embodiment, the miR396 recognition sequence of GRF1 / 8 / 13 is synonymously mutated to achieve the purpose of overexpressing GRF1 / 8 / 13 protein. That is, a base mutation is performed in the miR396 recognition GRF1 / 8 / 13 sequence region, but the amino acid sequence of the translated GRF1 / 8 / 13 protein remains unchanged. This invention will utilize this method...) The GRF1 / 8 / 13 protein overexpressed by this method was named rGRF1 / 8 / 13; the corresponding overexpression vector was named pUBI:rGRF1 / 8 / 13. Figure 1 shows an example of synonymous mutations. The GRF sequence is a partial coding sequence of the wild-type GRF protein. The miR396 sequence can correspond to and recognize the coding sequence of the wild-type GRF. The rGRF sequence is the coding sequence of the GRF constructed in this embodiment for overexpressing the GRF protein. miR396 cannot recognize rGRF, but the amino acid sequences encoded by the wild-type GRF and rGRF are the same.

[0141] pUBI::rGRF1 was constructed using HK587 / HK353 and HK352 / HK355 primers.

[0142] HK587:attgttgactcgacagCCTGCAGGtacatcacaatcacacaaaact;

[0143] HK353:ttcGacaggTttCcttgaCcggtaacgccgccgtatcat;

[0144] HK352:ccgGtcaagGaaAcctgtCgaatcatctcaaactcactc;

[0145] HK355:tcgtggtccttatagtccatGGATCCaacattggcatctgggttgca.

[0146] pUBI::rGRF8 was constructed using HK587 / HK382 and HK352 / HK383 primers.

[0147] HK587:attgttgactcgacagCCTGCAGGtacatcacaatcacacaaaact;

[0148] HK382:ttcGacaggTttCcttgaCcggtaacgacgtcgtatcat;

[0149] HK352:ccgGtcaagGaaAcctgtCgaatcatctcaaactcactc;

[0150] HK383:tcgtggtccttatagtccatGGATCCatcaacattgacatctgggttg.

[0151] pUBI::rGRF13 was constructed using HK587 / HK400 and HK401 / HK402 primers.

[0152] HK587:attgttgactcgacagCCTGCAGGtacatcacaatcacacaaaact;

[0153] HK400:ttcGacaggTttCcttgaCcggttgcggccacggtgcat;

[0154] HK401:ccgGtcaagGaaAcctgtCgaatcacaaactatgactca;

[0155] HK402:tcgtggtccttatagtccatGGATCCattatcatgtggggactgaga.

[0156] The nucleotide sequence of rGRF1 (SEQ ID No. 7):

[0157] The nucleotide sequence of rGRF8 (SEQ ID No. 8):

[0158] The nucleotide sequence of rGRF13 (SEQ ID No. 9):

[0159] (6) Using the pUBI:rGRF8 overexpression vector as the backbone, further replace the promoter with one that has better performance to construct the pNative:rGRF8 overexpression vector.

[0160] DNA was extracted from soybean ZH302 leaves using the CTAB method.

[0161] HK919 / HK920 amplifies the GRF8 promoter.

[0162] HK919:

[0163] HK920:

[0164] The promoter sequence of GRF8 (SEQ ID No. 10):

[0165] 3. Obtaining recombinant bacteria

[0166] (1) Transformation of Escherichia coli

[0167] The overexpression vector from step 1 is transformed into E. coli. The transformed E. coli are subjected to bacterial PCR. The amplified products with the correct PCR band size are sequenced. The E. coli with the correct sequencing results are recombinant E. coli containing the overexpression vector.

[0168] (2) Transformation of Agrobacterium tumefaciens

[0169] After culturing the recombinant E. coli containing the overexpression vector in step (1), plasmid DNA was extracted, added to Agrobacterium competent cells, and placed on ice for 5 min, liquid nitrogen for 5 min, water bath at 37℃ for 5 min, and on ice for 5 min.

[0170] Remove the centrifuge tube, add 700 μl of culture medium (antibiotic-free), and incubate at 28°C with shaking for 2–4 hours;

[0171] Take out the bacterial culture and spread it on a culture medium plate containing the corresponding antibiotic. Incubate it upside down in an incubator. After about 2 days, colonies will be visible. Perform PCR on the colonies according to the method in step (1) and sequence the amplified products. Agrobacterium with correct sequencing results is recombinant Agrobacterium containing the overexpression vector.

[0172] 4. Plant genetic transformation

[0173] (1) Sterilization of soybean seeds

[0174] Place the selected soybean seeds (Zhonghuang 302) in a petri dish in a desiccator. Slowly add 10 ml of concentrated hydrochloric acid along the wall of a beaker containing 150 ml of sodium hypochlorite in the desiccator, and quickly close the desiccator lid. Sterilize with chlorine gas generated by the sodium hypochlorite and concentrated hydrochloric acid for 16 hours.

[0175] (2) Seed germination

[0176] Insert the sterilized seeds from step (1) into the culture medium with the hilum facing down, and incubate in the dark at 22°C for 24 hours.

[0177] (3) Preparation of Agrobacterium tumefaciens bacterial culture

[0178] Take the bacterial culture stored at -80℃, streak it on a YEP plate containing antibiotics, incubate at 28℃ for 2 days, pick colonies and inoculate them into 5ml of YEP liquid medium in a 50ml centrifuge tube, shake overnight at 28℃; take 300μl of bacterial culture, add it to 250ml of YEP liquid medium, incubate overnight until OD600 = 0.3-0.4, centrifuge at 4000rpm for 10min, and redissolve with infection solution until OD600 = 0.3-0.4 for later use.

[0179] (4) Cotyledon node laceration, infection and co-culture

[0180] One day after the seeds in step (2) germinate, cut off part of the hypocotyl, separate the two cotyledons, clamp the half of the cotyledon with the cotyledon node, remove the two true leaves, prick the growing point 2-3 times, and put the cut beans into the soaking solution.

[0181] (5) Restore culture

[0182] After co-culture, the explants were inserted into the recovery culture medium and placed under light at around 28°C for 5–7 days to recover.

[0183] (6) Screening and Cultivation

[0184] After the cotyledons have recovered, part of the hypocotyl is cut off and inserted into the selection medium. The samples are then selected under light at around 28°C. Subculture is performed every 10 days for a total of 2 subcultures.

[0185] (7) Bud elongation culture

[0186] Remove the yellow leaves from the selected explants, gently tap the surface of the culture medium and rotten leaves every 10-15 days, cut off the bottom surface of the cotyledon nodes, insert the treated cotyledon nodes into the elongation medium (S5 medium), and culture them under light at 28℃.

[0187] (8) Rooting and transplanting

[0188] When the seedlings grow to 3-4cm during the elongation period, cut them off and place them on rooting soil to root. You will get at least three roots of about 1cm each and three green leaves. Move them to an artificial light cultivation room to harden them off. After about two weeks, when new leaves grow, move them to a 28℃ artificial climate chamber to continue growing.

[0189] 5. Detection and phenotypic observation of soybean transformants

[0190] Positive seedlings were selected from E0 generation transformed seedlings using PCR and Bar test strips, yielding pUBI:rGRF1, pNative:rGRF8, and pUBI:rGRF13 positive seedlings. Phenotypic changes were observed using wild-type soybean (Zhonghuang 302) as a control.

[0191] 6. Results

[0192] The positive seedlings obtained above were obtained by overexpression of Zhonghuang 302 as the parent.

[0193] Figures 2A-C show the expression of the GRF gene in positive seedlings. Figure 2A shows that the expression level of the GRF1 gene in the seeds and leaves of pUBI:rGRF1 positive seedlings was significantly higher than that of wild-type soybean WT (Zhonghuang 302). Figure 2B shows that the expression level of the GRF8 gene in the seeds and leaves of pNative:rGRF8 positive seedlings was significantly higher than that of wild-type soybean WT (Zhonghuang 302). Figure 2C shows that the expression level of the GRF13 gene in pUBI:rGRF13 positive seedlings was significantly higher than that of wild-type soybean WT (Zhonghuang 302) (in Figure 2C, pUBI:rGRF13#1 and pUBI:rGRF13#2 represent different pUBI:rGRF13 positive seedlings).

[0194] The grain length and width of the planted wild-type soybeans and the transgenic soybeans (positive seedlings) obtained above were statistically analyzed, and the results are shown in Figure 3-4.

[0195] Figures 3A-C show soybeans harvested from wild-type soybean plants (Zhonghuang 302) and pUBI:rGRF1, pNative:rGRF8, and pUBI:rGRF13 positive plants, respectively. It can be seen that compared with soybeans harvested from wild-type soybean plants (ZH302 in Figures 3A-C), soybeans harvested from pUBI:rGRF1, pNative:rGRF8, and pUBI:rGRF13 positive plants have significantly larger grains (in Figure 3C, pUBI:rGRF13#1 and pUBI:rGRF13#2 represent different pUBI:rGRF13 positive plants).

[0196] Figures 4A-F show the seed length and seed width of soybeans harvested from wild-type soybean plants (Zhonghuang 302), pUBI:rGRF1 positive plants, pNative:rGRF8 positive plants, pUBI:rGRF13 positive plants, and a positive control plant (miR396bcdfi, the edited plant bcdfi in patent CN118591629A, which, compared to Zhonghuang 302, has significantly increased seed size, seed length, and seed width). Comparing the widths, it can be seen that compared with wild-type soybean (ZH302 in Figure 4A-F), soybeans harvested from pUBI:rGRF1 and pNative:rGRF8 positive plants showed significantly increased grain length and width (grain length and width increased by 7.0% and 5.7% respectively for pUBI:rGRF1 positive plants, and by 14.09% and 9.4% respectively for pNative:rGRF8 positive plants). Soybeans harvested from pUBI:rGRF13 positive plants showed increased grain length by 6.5% and 9.1%, with no significant difference in grain width (in Figure 4E-F, pUBI:rGRF13#1 and pUBI:rGRF13#2 represent different pUBI:rGRF13 positive plants).

[0197] The number of seeds per plant and yield per plant were statistically analyzed for wild-type soybean (ZH302 in Figures 5A-D) and the transgenic soybeans pUBI:rGRF1 (OE-rGRF1 in Figures 5A-B) and pNative:rGRF8 (OE-rGRF8 in Figures 5C-D). The results are shown in Figures 5A-D. It can be seen that compared with wild-type soybean, the number of seeds per plant and yield per plant of soybeans harvested from positive pUBI:rGRF1 and pNative:rGRF8 plants were significantly increased.

[0198] The yields of wild-type soybean (ZH302) and the transgenic soybeans pUBI:rGRF1 and pNative:rGRF8 obtained above were statistically analyzed in different plots. The results are shown in the table below. It can be seen that, compared with wild-type soybean, the yield of soybeans harvested from pUBI:rGRF1 and pNative:rGRF8 positive plants was significantly increased.

[0199] In conclusion, overexpression of soybean GRF1, GRF8, and GRF13 can increase soybean grain size, increase the number of seeds per soybean plant, and improve soybean yield.

[0200] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. The application of GRF protein in increasing soybean seed size or improving soybean yield, or in the preparation of soybeans with increased seed size or yield, characterized in that, The GRF protein is one or more of GRF1, GRF8, or GRF13 proteins.

2. The application according to claim 1, characterized in that, The amino acid sequence of the GRF protein has at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.1%, at least 99.2%, at least 99.3%, at least 99.4%, at least 99.5%, at least 99.6%, at least 99.7%, at least 99.8%, or at least 99.9% sequence identity with SEQ ID No. 1, SEQ ID No. 2, or SEQ ID No. 3; preferably, the GRF protein is derived from soybean.

3. The application according to claim 1, characterized in that, Increasing the expression level of the GRF protein in soybeans can increase soybean grain size or soybean yield, or can produce soybeans with increased grain size or yield.

4. The application according to claim 3, characterized in that, The expression level of the GRF protein in soybeans can be increased by introducing the coding sequence of the GRF protein with a synonymous mutation, or by performing a synonymous mutation on the coding sequence of the GRF protein to increase the expression level of the GRF protein in soybeans.

5. The application according to claim 3, characterized in that, Increasing the copy number of the GRF protein-encoding gene or replacing the promoter of the GRF protein can increase the expression level of the GRF protein in soybeans.

6. The application according to claim 1, characterized in that, The increase in seed size refers to an increase in soybean seed length and / or seed width; the increase in yield includes an increase in the number of seeds per plant or an increase in seed weight.

7. The use of a nucleic acid molecule encoding the GRF protein of any one of claims 1-6 or a biological material containing said nucleic acid molecule in increasing soybean grain size or improving soybean yield, or in preparing soybeans with increased grain size or yield; said biological material is selected from a carrier or host cell containing said nucleic acid molecule.

8. A method for increasing soybean grain size or improving soybean yield, or a method for preparing soybeans with increased grain size or yield, characterized in that, The method includes the step of increasing the expression level of the GRF protein of any one of claims 1-6 in soybean.

9. The method according to claim 8, characterized in that, The method includes the step of increasing the expression level of the GRF protein in soybean cells, soybean seeds, soybean tissues, and soybean parts of the soybean.

10. The method according to claim 8, characterized in that, The method includes the steps of obtaining soybeans with increased expression levels of the GRF protein and planting the soybeans.

11. A method for preparing hybrid soybeans, the method comprising the step of hybridizing a first soybean plant with a second soybean plant to obtain the hybrid soybeans, characterized in that, The first soybean plant is a soybean prepared using the method described in any one of claims 8-10.