Nucleic acid conjugate targeting cardiomyocytes
By conjugating CD36-targeting ligands with nucleic acid drugs to form nucleic acid conjugates targeting cardiomyocytes, the problem of drug delivery and release within cardiomyocytes in existing technologies has been solved, achieving highly efficient therapeutic effects.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- BEIJING GLYEXO GENE TECH CO LTD
- Filing Date
- 2026-01-14
- Publication Date
- 2026-07-23
Smart Images

Figure PCTCN2026072422-FTAPPB-I100001 
Figure PCTCN2026072422-FTAPPB-I100002 
Figure PCTCN2026072422-FTAPPB-I100003
Abstract
Description
Nucleic acid conjugates targeting cardiomyocytes Technical Field
[0001] This application relates to the field of biomedicine, specifically to a nucleic acid conjugate that targets cardiomyocytes and its use in the treatment of related diseases. Background Technology
[0002] Currently, according to the latest Global Health Survey by the World Health Organization (WHO), approximately 120 million people worldwide suffer from cardiovascular disease, accounting for 1.5% of the global population, significantly increasing the global disease burden. The top five causes of cardiovascular death globally are ischemic heart disease, ischemic stroke, cerebral hemorrhage, hypertensive heart disease, and rheumatic heart disease, demonstrating that heart-related diseases are a major contributor to this cardiovascular burden. Furthermore, other heart-related diseases such as cardiomyopathy, rare heart diseases, heart failure, coronary heart disease, myocardial infarction, and myocarditis also seriously affect human health.
[0003] The heart's unique organ structure forms a closed circulatory system with abundant and rapid blood flow, which is not conducive to targeted drug delivery. Therefore, the treatment of heart-related diseases faces drug delivery challenges. Ensuring effective cellular uptake and release of therapeutic agents within cardiomyocytes, avoiding detection by the immune system, and preventing off-target effects on other tissues and organs have long been difficult problems for drug developers.
[0004] It is known that siRNA conjugates targeting CD71 (transferrin receptor 1) can silence target genes in the heart. However, existing data show that although CD71 siRNA conjugates can be detected at high concentrations in heart tissue, they have failed to achieve high knockdown efficiency.
[0005] CD36 is a 53 kDa transmembrane glycoprotein found in various cell types. It has been found to be expressed in microglia, vascular endothelial cells, adipocytes, astrocytes, and blood-derived macrophages in the brain under pathological conditions. Due to its diverse functions, it is also known as fatty acid translocase (FAT), glycoprotein IIIb (GPIIIb), platelet-reactive protein receptor, etc.
[0006] There are currently no studies on targeted therapy using CD36 of cardiomyocytes. Summary of the Invention
[0007] This application discovers that CD36 in cardiomyocytes is an effective delivery target for treating cardiomyocyte-related diseases. This application conjugates a CD36-targeting ligand with a nucleic acid drug, enabling the nucleic acid drug to target cardiomyocytes. The CD36-targeting ligand-nucleic acid conjugate described herein, when delivered to cardiomyocytes, not only achieves high aggregation concentrations but also exhibits better silencing effects on the target gene, thus solving the problem in existing technologies where nucleic acid drugs achieve high concentrations in targeted delivery tissues but have low knockdown efficiency.
[0008] In a first aspect, this application provides a drug that targets cardiomyocytes, the drug comprising a ligand that targets CD36.
[0009] Secondly, this application provides the use of a CD36-targeting ligand in the preparation of a drug targeting cardiomyocytes.
[0010] Thirdly, this application provides the use of a CD36-targeting ligand in the preparation of conjugates targeting cardiomyocytes.
[0011] Fourthly, this application provides the use of a CD36-targeting nucleic acid conjugate in the preparation of a drug targeting cardiomyocytes.
[0012] Fifthly, this application provides a nucleic acid conjugate comprising a ligand targeting CD36 and a nucleic acid molecule, wherein the ligand binds to the CD36 receptor on cardiomyocytes.
[0013] In a sixth aspect, this application provides a nucleic acid conjugate for cardiomyocyte delivery, comprising a ligand targeting CD36 and a nucleic acid molecule.
[0014] In some embodiments, the ligand is a polypeptide, nucleic acid, and / or a nucleic acid analog.
[0015] In some implementations, the ligand is an aptamer.
[0016] In some embodiments, the ligand is a linear peptide, a cyclic peptide, or a bicyclic peptide.
[0017] In some embodiments, the polypeptide is a skeletal protein.
[0018] In some embodiments, the ligand is an antibody or an antigen-binding fragment.
[0019] In some embodiments, the antibody or antigen-binding fragment is a monovalent antibody or its antigen-binding fragment, or a multivalent antibody or its antigen-binding fragment.
[0020] In some embodiments, the antibody or antigen-binding fragment is a monospecific antibody or its antigen-binding fragment, or a multispecific antibody or its antigen-binding fragment.
[0021] In some embodiments, the antibody or antigen-binding fragment is a monoclonal antibody or its antigen-binding fragment, or a polyclonal antibody or its antigen-binding fragment.
[0022] In some embodiments, the antibody or antigen-binding fragment is selected from conventional antibodies, Fab, Fab', F(ab')2, single-chain variable fragments (scFv), microantibodies, and single-domain antibodies (sdAb).
[0023] In some embodiments, the sdAb is selected from camel-derived VHH (nanobody), shark-derived VNAR, human-derived VH, human-derived VL, mouse-derived VH, and mouse-derived VL.
[0024] In some embodiments, the antibody is an IgG monoclonal antibody.
[0025] In some embodiments, the antibody or antigen-binding fragment is a humanized antibody or its antigen-binding fragment.
[0026] In some embodiments, the CD36-targeting ligand and nucleic acid molecule are coupled via site-directed or non-site-directed coupling.
[0027] In some embodiments, the CD36-targeting ligand and nucleic acid molecule are coupled via Glyco or Cys coupling.
[0028] In some embodiments, the nucleic acid molecule is linked to a ligand targeting CD36 via a linker, wherein the linker is a breakable linker or a non-breakable linker.
[0029] In some embodiments, the unbreakable linker is selected from maleimide hexanoyl (MCC), m-maleimide benzoyl (MB), 4-((4-(cyanoethynyl)benzoyl)oxy)(CB) or bismaleimide (BisMal).
[0030] In some embodiments, the breakable linker is selected from N-succinimide-4-(2-pyridyldithio)valerate, N-succinimide-4-(2-pyridyldithio)-2,2-dimethylbutyrate, valine-citrulline (VC) linker, 3-(2-pyridyldithio)propionate (PDP) or methyl-(2-pyridyldithio)toluene (MPT).
[0031] In some embodiments, the DAR value of the nucleic acid conjugate is 1-4.
[0032] In some embodiments, the DAR value of the nucleic acid conjugate is 2.
[0033] In some embodiments, the nucleic acid molecule is a monovalent nucleic acid molecule or a multivalent nucleic acid molecule.
[0034] In some embodiments, the nucleic acid molecule is a single-specific nucleic acid molecule or a multi-specific nucleic acid molecule.
[0035] In some embodiments, the target gene targeted by the nucleic acid molecule is selected from phosphatase receptor protein (PLN) and / or phosphatase receptor protein (NPPA) genes.
[0036] In some embodiments, when the nucleic acid molecule is multivalent, the target genes targeted by the nucleic acid molecule are optionally selected from PLN and NPPA.
[0037] In some embodiments, when the nucleic acid molecule is multivalent, the sequence of the nucleic acid molecule may be selected from the sequences targeting the PLN and NPPA genes.
[0038] In some embodiments, the nucleic acid molecule is an oligonucleotide.
[0039] In some embodiments, the nucleic acid molecule is selected from siRNA (small interfering RNA), saRNA (small activating RNA), miRNA (microRNA), ASO (antisense oligonucleotide), shRNA (short hairpin RNA), aptamers, sgRNA (single guide RNA), and tinyRNA.
[0040] In some embodiments, the nucleic acid molecule is selected from siRNA or ASO.
[0041] In some embodiments, when the nucleic acid molecule is ASO, the DAR value is selected from 1 to 4.
[0042] In some embodiments, when the nucleic acid molecule is siRNA, the DAR value is 1-2.
[0043] In some embodiments, the nucleic acid conjugate is an antibody nucleic acid conjugate, the nucleic acid molecule is siRNA targeting the PLN gene, the siRNA is coupled to a ligand via a breakable linker, the DAR value is 2, and the coupling method is Glyco coupling.
[0044] In some embodiments, the nucleic acid conjugate is an antibody nucleic acid conjugate, the nucleic acid molecule is an siRNA targeting the NPPA gene, the siRNA is coupled to a ligand via a breakable linker, the DAR value is 2, and the coupling method is Glyco.
[0045] In some embodiments, the nucleic acid conjugate is an antibody nucleic acid conjugate, the nucleic acid molecule is siRNA targeting the NPPA gene and the PLN gene respectively, the siRNA is coupled to the ligand via a breakable linker, the DAR value is 2, and the coupling method is Glyco.
[0046] In some embodiments, the nucleic acid conjugate is an antibody nucleic acid conjugate, the nucleic acid molecule is siRNA targeting the PLN gene, the siRNA is covalently linked to a ligand via a breakable linker, the DAR value is 2, the coupling method is Glyco, and the coupling site is the Asn297 site of the ligand.
[0047] In some embodiments, the nucleic acid conjugate is an antibody nucleic acid conjugate, the nucleic acid molecule is an siRNA targeting the NPPA gene, the siRNA is covalently linked to a ligand via a breakable linker, the DAR value is 2, the coupling method is Glyco, and the coupling site is the Asn297 site of the ligand.
[0048] In some embodiments, the nucleic acid conjugate is an antibody nucleic acid conjugate, the nucleic acid molecule is siRNA targeting the NPPA gene and the PLN gene respectively, the siRNA is covalently linked to a ligand via a breakable linker, the DAR value is 2, the coupling method is Glyco, and the coupling site is the Asn297 site of the ligand.
[0049] In some embodiments, the nucleic acid conjugate is an antibody nucleic acid conjugate, the nucleic acid molecule is siRNA targeting the PLN gene, the siRNA is coupled to a ligand via a non-breakable linker, the DAR value is 2, and the coupling method is Glyco.
[0050] In some embodiments, the nucleic acid conjugate is an antibody nucleic acid conjugate, the nucleic acid molecule is an siRNA targeting the NPPA gene, the siRNA is coupled to a ligand via a non-breakable linker, the DAR value is 2, and the coupling method is Glyco.
[0051] In some embodiments, the nucleic acid conjugate is an antibody nucleic acid conjugate, the nucleic acid molecule is siRNA targeting the NPPA gene and the PLN gene respectively, the siRNA is coupled to the ligand via a non-breakable linker, the DAR value is 2, and the coupling method is Glyco.
[0052] In some embodiments, the nucleic acid conjugate is an antibody nucleic acid conjugate, the nucleic acid molecule is siRNA targeting the PLN gene, the siRNA is covalently linked to a ligand via an unbreakable linker, the DAR value is 2, the coupling method is Glyco, and the coupling site is the Asn297 site of the ligand.
[0053] In some embodiments, the nucleic acid conjugate is an antibody nucleic acid conjugate, the nucleic acid molecule is an siRNA targeting the NPPA gene, the siRNA is covalently linked to a ligand via an unbreakable linker, the DAR value is 2, the coupling method is Glyco, and the coupling site is the Asn297 site of the ligand.
[0054] In some embodiments, the nucleic acid conjugate is an antibody nucleic acid conjugate, the nucleic acid molecule is siRNA targeting the NPPA gene and the PLN gene respectively, the siRNA is covalently linked to a ligand via an unbreakable linker, the DAR value is 2, the coupling method is Glyco, and the coupling site is the Asn297 site of the ligand.
[0055] In some embodiments, the nucleic acid molecule includes at least one modification.
[0056] In some embodiments, the modification is a phosphoric acid modification, a ribose modification, and / or a base modification.
[0057] In some embodiments, the modification is selected from one or more of the following: phosphoryl diamine morpholine (PMO) modification, phosphate thioate (PS) modification, locked nucleic acid (LNA) modification, cyclohexene nucleic acid (cEt) modification, 2'-O-methyl (2'-OMe) modification, 2'-fluoro (2'-F) modification, 2'-methoxyethyl (2'-MOE) modification, 5'-vinyl phosphate (5'-VP) modification, 3'-polyunsaturated fatty acid coupling (3'-PUFA) modification, 2'-deoxyribose modification, and invab modification.
[0058] In a seventh aspect, this application provides a pharmaceutical composition comprising a therapeutically effective amount of any of the drugs, conjugates or nucleotide conjugates described above, and a pharmaceutically acceptable excipient.
[0059] In some embodiments, the pharmaceutical composition targets cardiomyocytes to treat diseases.
[0060] In some embodiments, the disease is associated with or caused by abnormal expression of myocardial cell genes.
[0061] In some embodiments, the diseases include cardiomyopathy, rare cardiac diseases, myocardial ischemia-reperfusion injury, heart failure, coronary artery disease, myocardial infarction, myocarditis, atherosclerosis, arrhythmia, intermittent hypoxia-related myocardial injury, cardiac ion channel-related diseases, hypertensive heart disease, atrial fibrillation, myocardial hypertrophy and fibrosis, acute coronary syndrome, hereditary glycogen storage disease, PRKAG2 cardiac syndrome, and idiopathic ventricular fibrillation (IVF).
[0062] In some embodiments, the cardiomyopathy includes dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, hypoxic-ischemic cardiomyopathy, valvular cardiomyopathy, hypertensive cardiomyopathy, metabolic cardiomyopathy, endocrine cardiomyopathy, alcoholic cardiomyopathy, perinatal cardiomyopathy, drug-induced cardiomyopathy, hereditary cardiomyopathy, Keshan disease, arrhythmogenic cardiomyopathy, and arrhythmogenic right ventricular cardiomyopathy-like phenotype.
[0063] In some embodiments, the heart failure includes new-onset heart failure, acute heart failure, chronic heart failure, acute decompensated heart failure, left heart failure, right heart failure, dual heart failure, systolic dysfunction heart failure, diastolic dysfunction heart failure, systolic and diastolic dysfunction heart failure, high-output heart failure, and restrictive-filling heart failure.
[0064] In some embodiments, the myocardial infarction includes primary acute myocardial infarction, secondary acute myocardial infarction, PCI-related myocardial infarction, and coronary artery bypass grafting-related acute myocardial infarction.
[0065] In some embodiments, the arrhythmia includes: tachycardia (sinus tachycardia, atrial tachycardia, atrial flutter, junctional tachycardia, atrial flutter, supraventricular tachycardia, ventricular tachycardia, etc.); bradycardia (sinus arrest, sinus bradycardia, atrioventricular block, etc.); and irregular heart rate (premature atrial contractions, atrial fibrillation, sick sinus syndrome, junctional premature beats, premature ventricular contractions, ventricular fibrillation, etc.).
[0066] In some embodiments, the coronary heart disease includes asymptomatic myocardial ischemia, angina pectoris, myocardial infarction, and ischemic cardiomyopathy; among which angina pectoris includes exertional angina pectoris, spontaneous angina pectoris, and mixed angina pectoris.
[0067] In some embodiments, the rare cardiac diseases include Brugada syndrome, left ventricular myocardial noncompaction (LVNSC), idiopathic pulmonary hypertension (IPAH), and transthyretin amyloid cardiomyopathy.
[0068] In some embodiments, the cardiac ion channel-related diseases include long QT syndrome, short QT syndrome, BrS syndrome, and catecholamine-sensitive polymorphic ventricular tachycardia (CPVT).
[0069] Other aspects and advantages of this application will readily be apparent to those skilled in the art from the detailed description below. Only exemplary embodiments of this application are shown and described in the following detailed description. As will be appreciated by those skilled in the art, the content of this application enables them to make modifications to the disclosed specific embodiments without departing from the spirit and scope of the invention to which this application pertains. Accordingly, the descriptions in the accompanying drawings and specification of this application are merely exemplary and not restrictive. Attached Figure Description
[0070] The specific features of the invention involved in this application are shown in the appended claims. The features and advantages of the invention can be better understood by referring to the exemplary embodiments and drawings described in detail below. A brief description of the drawings is as follows:
[0071] Figure 1 is a schematic diagram of the introduction of azide groups at the glycosylation site of the Fc fragment of the antibody.
[0072] Figure 2 shows the RT-qPCR analysis results of TfR1 in different tissues.
[0073] Figure 3 shows the RT-qPCR analysis results of CD36 in different tissues.
[0074] Figures 4A-D show the ELISA results of anti-CD36 antibody. Figure 4A shows the ELISA data of YJ117E antibody binding to human CD36.ECD, cynomolgus monkey CD36.ECD, and mouse CD36.ECD; Figure 4B shows the calculated EC50 value of YJ117E antibody from Figure 4A; Figure 4C shows the ELISA data of ONA antibody binding to human CD36.ECD and mouse CD36.ECD; Figure 4D shows the calculated EC50 value of ONA antibody from Figure 4C.
[0075] Figure 5 shows the surface plasmon resonance (SPR) results of human CD36 and YJ117E antibodies.
[0076] Figure 6 shows the SPR results of CD36 and YJ117E antibodies against cynomolgus monkeys.
[0077] Figure 7 shows the SPR results of mouse CD36 and YJ117E antibodies.
[0078] Figure 8 shows the SPR results for human CD36 and YJ117E-Fab.
[0079] Figure 9 shows the SPR results for human CD36 and YJ117E-scFv.
[0080] Figure 10 shows the SPR results for human CD36 and 1E5 HcAb.
[0081] Figure 11 is a chromatogram of aCD36-Cys-siSOD1 (a mixture of crude reaction products).
[0082] Figure 12 shows the HPLC identification results of aCD36-Cys-siSOD1 DAR1.
[0083] Figure 13 shows the HPLC identification results of aCD36-Cys-siSOD1 DAR2.
[0084] Figure 14 shows the SDS-PAGE identification results of aCD36-Cys-siSOD1.
[0085] Figure 15 shows the SDS-PAGE identification results of the aCD36-Glyco-siSOD1 conjugate.
[0086] Figure 16 shows the AEX-HPLC identification results of aCD36-Glyco-Mono-siSOD1.
[0087] Figure 17 shows the AEX-HPLC identification results of aCD36-Glyco-Mono-siSOD1 DAR1.
[0088] Figure 18 shows the AEX-HPLC identification results of aCD36-Glyco-Mono-siSOD1 DAR2.
[0089] Figure 19 shows the AEX-HPLC identification results of aCD36-Glyco-Di-siSOD1.
[0090] Figure 20 shows the AEX-HPLC identification results of aCD36-Glyco-Di-siSOD1 DAR1.
[0091] Figure 21 shows the AEX-HPLC identification results of aCD36-Glyco-Di-siSOD1 DAR2.
[0092] Figure 22 shows the AEX-HPLC identification results of aCD36-Cys-ASO DAR1.
[0093] Figure 23 shows the AEX-HPLC identification results of aCD36-Cys-ASO DAR2.
[0094] Figure 24 shows the SDS-PAGE identification results of aCD36-Cys-ASO.
[0095] Figure 25 shows the SDS-PAGE identification results of aCD36-Glyco-ASO.
[0096] Figure 26 shows the HPLC-HRMS identification results of aCD36-Glyco-ASO DAR1.
[0097] Figure 27 shows the HPLC-HRMS identification results of aCD36-Glyco-ASO DAR2.
[0098] Figures 28A-F show the results of ligand-nucleic acid conjugate internalization verification. Figure 28A shows the fluorescence intensity over time; Figure 28B shows the AOC level co-localized with lysosomes over time; Figure 28C shows the fluorescence intensity of CD36 antigen on the surface of SW48 cells after siCD36 transfection; Figure 28D shows the fluorescence intensity of CD36 antigen detected by flow cytometry after siCD36 transfection; Figure 28E shows the AOC level co-localized with lysosomes after siCD36 transfection; and Figure 28F shows the fluorescence intensity after siCD36 transfection.
[0099] Figure 29 shows the AniView multimodal animal in vivo imaging results over time after administration of different doses of aCD36-Cys-siSOD1-Cy5.
[0100] Figure 30 shows the results of quantitative analysis of fluorescence intensity based on Figure 29.
[0101] Figure 31 shows the in vivo drug distribution results after administration of different doses of aCD36-Cys-siSOD1-Cy5.
[0102] Figure 32 shows the results of heart slices after the administration of different drugs.
[0103] Figures 33A-C show the results of stem-loop quantitative PCR (SL-qPCR) in different tissues after application of aCD36-Cys-siSOD1. Figure 33A shows the results in heart tissue; Figure 33B shows the results in liver tissue; and Figure 33C shows the results in kidney tissue.
[0104] Figures 34A-B and 35A-B show the delivery of aCD36-Cys-siSOD1 DAR2 in different types of mouse heart cells. Figure 34A shows the fluorescence in situ hybridization (FISH) results of fluorescently labeled siSOD1; Figure 34B shows the hematoxylin-eosin staining results of heart tissue; Figure 35A shows the FISH results of fluorescently labeled siSOD1; and Figure 35B shows the hematoxylin-eosin staining results of heart tissue.
[0105] Figure 36 shows the results of hematoxylin-eosin staining, FISH, and immunofluorescence after administration of aCD36-Cys-siSOD1 DAR2.
[0106] Figure 37 shows the immunohistochemical staining results after administration of aCD36-Cys-siSOD1 DAR2.
[0107] Figures 38A-B show the knockdown results of Sod1 mRNA after administration of aCD36-Glyco-siSOD1 DAR1. Figure 38A shows the RT-qPCR analysis results of wild-type male mice; Figure 38B shows the RT-qPCR analysis results of obese male mice.
[0108] Figures 39A-B show the knockdown results of Sod1 mRNA in different cell types after administration of aCD36-Cys-siSOD1 DAR1. Figure 39A shows the single-cell sequencing results of C57BL / 6 wild-type male mice; Figure 39B shows the single-cell sequencing results of OB / OB obese male mice.
[0109] Figure 40 shows the expression percentage of CD36 in different cell types of cardiac tissue.
[0110] Figures 41A-B show the knockdown effect of Sod1 mRNA in cardiac tissue after administration of aCD36-Cys-siSOD1 DAR2. Figure 41A shows the RT-qPCR analysis results of Sod1 mRNA at different drug doses and time points; Figure 41B is a line graph representation of the data in Figure 41A.
[0111] Figures 42A-B show the knockdown effect of Sod1 mRNA in liver tissue after administration of aCD36-Cys-siSOD1 DAR2. Figure 42A shows the RT-qPCR analysis results of Sod1 mRNA at different drug doses and time points; Figure 42B is a line graph representation of the data in Figure 42A.
[0112] Figures 43A-B show the knockdown effect of Sod1 mRNA in kidney tissue after administration of aCD36-Cys-siSOD1 DAR2. Figure 43A shows the RT-qPCR analysis results of Sod1 mRNA at different drug doses and time points; Figure 43B is a line graph representation of the data in Figure 43A.
[0113] Figure 44 shows the RT-qPCR analysis results of CD36 antibody delivery and L96 delivery of siSOD1.
[0114] Figure 45 shows the drug distribution results over time after the administration of different drugs.
[0115] Figures 46A-B show the delivery efficiency of conjugates containing CD36 targeting ligand and conjugates containing transferrin targeting ligand. Figure 46A shows the RT-qPCR analysis results containing transferrin ligand; Figure 46B shows the RT-qPCR analysis results containing CD36 targeting ligand.
[0116] Figure 47 shows the results of RT-qPCR analysis in cardiac tissue after administration of different doses of aCD36-Cys-siSOD1 DAR2.
[0117] Figure 48 shows the results of RT-qPCR analysis of cardiac tissue over time after administration of aCD36-Cys-siSOD1 DAR2.
[0118] Figure 49 shows the RT-qPCR analysis results in different tissues on day 14 after administration of different doses of aCD36-Cys-siSOD1 DAR2.
[0119] Figure 50 shows the RT-qPCR analysis results in different tissues on day 28 after administration of different doses of aCD36-Cys-siSOD1 DAR2.
[0120] Figure 51 shows the results of RT-qPCR analysis in cardiac tissue after administration of different doses of aCD36-Glyco-Mono-siSOD1 DAR2.
[0121] Figure 52 shows the results of RT-qPCR analysis of cardiac tissue over time after administration of aCD36-Glyco-Mono-siSOD1 DAR2.
[0122] Figure 53 shows the RT-qPCR analysis results in different tissues after administration of different doses of aCD36-Glyco-Mono-siSOD1 DAR2.
[0123] Figure 54 shows the results of RT-qPCR analysis in cardiac tissue after administration of AOC drugs conjugated with cysteine at different DAR values.
[0124] Figure 55 shows the results of RT-qPCR analysis in heart tissue after administration of AOC drugs with different DAR values of glycosylated conjugated monovalent nucleic acid molecules.
[0125] Figure 56 shows the results of RT-qPCR analysis in cardiac tissue after administration of AOC drugs with different DAR values of glycosylated conjugated bivalent nucleic acid molecules.
[0126] Figure 57 shows the results of RT-qPCR analysis in cardiac tissue after administration of aCD36-Cys-ASO DAR2.
[0127] Figure 58 shows the results of RT-qPCR analysis in cardiac tissue after administration of different doses of aCD36-Cys-ASO DAR2.
[0128] Figure 59 shows the RT-qPCR analysis results in different tissues after administration of different doses of aCD36-Cys-ASO DAR2.
[0129] Figure 60 shows the results of RT-qPCR analysis in cardiac tissue after administration of aCD36-Glyco-ASO DAR2.
[0130] Figure 61 shows the results of RT-qPCR analysis in cardiac tissue after administration of different doses of aCD36-Glyco-ASO DAR2.
[0131] Figure 62 shows the RT-qPCR analysis results in different tissues after administration of different doses of aCD36-Glyco-ASO DAR2.
[0132] Figure 63 shows the results of RT-qPCR analysis in heart tissue after administration of different antibody strains coupled with nucleic acid molecules in AOC.
[0133] Figure 64 shows the RT-qPCR analysis results in heart tissue after AOC was treated with different coupling methods to conjugate nucleic acid molecules.
[0134] Figure 65 shows the results of RT-qPCR analysis in cardiac tissue after AOC administration of different linkers.
[0135] Figures 66A-B show the activity verification results of AOC prepared by cysteine conjugation in cardiac tissue. Figure 66A shows the activity verification results of AOC of cysteine-conjugated nucleic acid molecules of YJ117E antibody strain at different DAR values; Figure 66B shows the activity verification results of AOC of cysteine-conjugated nucleic acid molecules of ONA antibody strain at different DAR values.
[0136] Figures 67A-B demonstrate the activity verification of AOCs prepared via site-directed glycosylation in cardiac tissue. Figure 67A shows the activity verification results of AOCs prepared by site-directed glycosylation of ONA antibody strains with monovalent nucleic acid molecules; Figure 67B shows the activity verification results of AOCs prepared by site-directed glycosylation of ONA antibody strains with divalent nucleic acid molecules.
[0137] Figure 68 shows the activity verification results of AOC conjugated with different antibody strains and ASO in cardiac tissue.
[0138] Figure 69 shows the activity verification results of AOC coupled with the PPIB gene siRNA sequence in cardiac tissue.
[0139] Figures 70A-D are schematic diagrams of different ligand-nucleic acid conjugates. Figure 70A is aCD36-Glyco-siSOD1 DAR1; Figure 70B is aCD36-Glyco-siPPIB DAR1; Figure 70C is aCD36-Glyco-siSOD1-siPPIB DAR1; and Figure 70D is aCD36-Glyco-siPPIB-siSOD1 DAR1.
[0140] Figures 71A-B demonstrate the in vivo efficacy of delivering nucleic acid molecules targeting multiple different sites. Figure 71A shows the expression of Ppib mRNA in cardiac tissue after treatment with different drugs; Figure 71B shows the expression of Sod1 mRNA in cardiac tissue after treatment with different drugs.
[0141] Figure 72 shows the transcriptome sequencing results at different time points after drug administration.
[0142] Figure 73 shows the detection results of immune cells after administration of different doses of aCD36-Cys-siSOD1 DAR2.
[0143] Figure 74 shows the platelet count results after administration of different doses of aCD36-Cys-siSOD1 DAR2.
[0144] Figure 75 shows the results of RT-qPCR analysis in cardiac tissue after administration of aCD36-Cys-siPLN-1DAR1.
[0145] Figure 76 shows the results of RT-qPCR analysis in heart tissue after administration of different siRNA sequences conjugated with NPPA in AOC.
[0146] Figure 77 shows the results of RT-qPCR analysis in heart tissue after administration of AOC with different ligand types coupled with siRNA molecules.
[0147] Figures 78A-D are schematic diagrams of AOC for monovalent or bivalent DAR and different DAR values. Figure 78A is the AOC diagram for monovalent DAR1; Figure 78B is the AOC diagram for bivalent DAR1; Figure 78C is the AOC diagram for monovalent DAR2; and Figure 78D is the AOC diagram for bivalent DAR2.
[0148] Figure 79 shows the results of RT-qPCR analysis of heart, liver, and kidney tissues after administration of aCD36-Glyco-siSOD1 DAR2 to pigs. Detailed Implementation
[0149] The following specific embodiments illustrate the implementation of the invention. Those skilled in the art can easily understand other advantages and effects of the invention from the content disclosed in this specification.
[0150] Terminology Definition
[0151] In this application, the terms "nucleotide," "nucleic acid molecule," and "nucleic acid" refer to a class of important biomolecules in living organisms that carry genetic information and participate in protein synthesis. They are mainly composed of nucleotide polymers and typically contain bases, sugars, and phosphate groups. They can be divided into two main categories: DNA and RNA.
[0152] In this application, the term "targeting" refers to the process by which a substance is precisely directed and acts on a specific biological target based on the specific recognition of molecules. "Targeting" can refer to the process by which an antibody specifically targets an antigen, or it can refer to the process by which a nucleic acid molecule specifically binds to mRNA based on the principle of complementary base pairing.
[0153] In this application, the term "nucleic acid conjugate" refers to a novel drug form in which nucleic acid molecules (such as oligonucleotides) are covalently linked to other molecules (such as small molecules, antibodies, peptides, etc.) through chemical or biological means.
[0154] In this application, the term "CD36" or "CD36 antigen" or "fatty acid translocase" refers to a transmembrane glycoprotein with a molecular weight of 88 kDa, whose core function is to assist in the transport of long-chain fatty acids from the extracellular space to the intracellular space.
[0155] In this application, the term "ligand" refers to a molecule, such as a peptide, protein, nucleic acid, or nucleic acid analog, that can target a specific target. The term "targeting" refers to: (1) a process that facilitates the delivery of a reagent to a specific organ, tissue, cell, and / or intracellular compartment (target site) more than any other organ, tissue, cell, or intracellular compartment (non-target site); and (2) a process in which a nucleic acid molecule highly specifically recognizes and binds to a target mRNA. In this application, targeted delivery is achieved through the specific binding of the target portion to a cell surface molecule. In the context of this application, "ligand targeting CD36" generally refers to a molecule that can specifically bind to CD36, such as a natural ligand, a synthetically designed peptide, an antibody, or a small molecule compound, for the specific delivery of a drug carrier (such as a nucleic acid molecule) to cells expressing CD36 on their cell surface.
[0156] In this application, the term "conjugation" or "coupling" refers to the process by which two or more molecules are linked together by chemical bonds (usually covalent bonds) to form a conjugation / coupling.
[0157] In this application, the term "nucleic acid analog" refers to a synthetic molecule obtained by modifying the chemical structure (sugar ring, phosphate backbone, or base) of a natural nucleotide.
[0158] As used herein, the term "aptamer" refers to a class of short single-stranded DNA or RNA oligonucleotides. Aptamers typically comprise DNA or RNA nucleotide sequences ranging from about 10 to about 100 nucleotides, about 10 to about 75 nucleotides, about 10 to about 50 nucleotides, about 10 to about 35 nucleotides, and about 10 to about 25 nucleotides in length. Aptamers are often modified (e.g., phosphate thioester modifications) to enhance nuclease resistance, binding affinity, or otherwise alter their pharmacokinetic properties. Exemplary modifications are given in U.S. Patent Nos. 6,455,308, 4,469,863, 5,536,821, 5,541,306, 5,637,683, 5,637,684, 5,700,922, 5,717,083, 5,719,262, 5,739,308, 5,773,601, 5,886,165, 5,929,226, 5,977,296, and 6,140,482, as well as in WIPO Publications WO00 / 56746 and WO01 / 14398. Methods for synthesizing oligonucleotides containing such analogues or derivatives are disclosed, for example, in the patent publications cited above, and in U.S. Patent Nos. 6,455,308, 5,614,622, 5,739,314, 5,955,599, 5,962,674, 6,117,992 and WO00 / 75372.
[0159] In this application, the term "peptide" refers to a biomolecule composed of two or more amino acids linked by an amide bond. The amide bond is formed by the dehydration condensation of the carboxyl group (-COOH) of one amino acid with the amino group (-NH2) of another amino acid. The biomolecule can be linear or branched, may contain modified amino acids, and may be intercalated with non-amino acid components. These modifications may include disulfide bond formation, glycosylation, esterification, acetylation, phosphorylation, or any other manipulation (e.g., binding to a labeled component). The amino acids include natural and / or non-natural or synthetic amino acids, including glycine, D- and L-optical isomers, as well as amino acid analogs and peptide mimics. The term "protein" or "protein complex" refers to a polypeptide molecule with a complex, stable three-dimensional folded structure.
[0160] In this application, the term "linear peptide" refers to a short peptide molecule composed of amino acids linearly linked by peptide bonds (amide bonds), which typically does not form complex structures and does not contain cross-linked structures such as disulfide bonds.
[0161] In this application, the term "cyclic peptide" refers to a peptide whose amino acid residues are linked together in a cyclic structure by various chemical bonds (such as amide bonds, lactone bonds, ether bonds, thioether bonds, and disulfide bonds).
[0162] In this application, the term "bicyclic peptide" refers to a polypeptide having two rings in its structure, typically consisting of 9-20 amino acids.
[0163] In this application, the terms "skeleton protein," "framework protein," and "structural protein" can be used interchangeably. Skeleton protein is an artificially designed non-antibody scaffold protein derived from the fibronectin subtype domain of human tenascin. It includes an amino acid sequence capable of binding to specific antigens, exhibiting antibody-like high affinity and specificity, but with a smaller molecular weight and higher stability, and can withstand extreme pH, high temperatures, and protease degradation. In this application, "skeleton protein" or "framework protein" can specifically bind to cell surface receptors, mediating endocytosis, and is mainly used for targeted delivery of drug carriers. For example, it can specifically bind to CD36 for targeted delivery of drug carriers or conjugates.
[0164] In this application, the term "antibody" or "conventional antibody" refers to a symmetrical glycoprotein assembled from four polypeptide chains via disulfide bonds and non-covalent interactions. The conventional antibody has two identical heavy chains (H chains) consisting of approximately 440 amino acids each and two identical light chains (L chains) consisting of approximately 220 amino acids each. The H chains consist of a heavy chain variable region (VH), a heavy chain constant region 1 (CH1), a heavy chain constant region 2 (CH2), and a weight constant region 3 (CH3), while the L chains consist of a light chain variable region (VL) and a light chain constant region (CL).
[0165] In this application, the term "antigen-binding fragment" refers to an amino acid residue that specifically binds to an antigen, including but not limited to VH / VL, Fab, and VHH containing a complementarity-determining region (CDR), excluding the Fc region, and possessing the protein properties of an antibody.
[0166] In this application, the term "variable region" or "variable region sequence" refers to a portion of the light or heavy chain of an antibody, typically located at the amino terminus of the light or heavy chain, with a length of approximately 120-130 amino acids in the heavy chain and approximately 100-110 amino acids in the light chain, reflecting the binding and specificity of a particular antibody to its specific antigen. The variable region of the heavy chain may be referred to as "VH," and the variable region of the light chain may be referred to as "VL."
[0167] The term "valence" describes the number of binding sites that each single type of molecule or structure exhibits with respect to a target (such as an antigen, receptor, or mRNA). Therefore, in the context of this application, a bivalent antibody is capable of binding to two binding sites, and a bivalent siRNA is capable of binding to two mRNA binding sites that are complementary or partially complementary. Furthermore, examples of multivalent antibodies include, but are not limited to, bivalent, trivalent, tetravalent, and pentavalent antibodies.
[0168] In this application, the term "monovalent" generally refers to a molecule or structure of a single type possessing only one site for binding to a target. The term "multivalent" refers to a molecule or structure of a single type possessing multiple sites for binding to a target, enabling it to bind to multiple targets simultaneously (such as antigens, receptors, and mRNA). The "site" can be an antigen-binding site or a nucleic acid molecule-binding site. These multiple target-binding sites can be monospecific or multispecific, and their binding specificity is independent of molecular potency; that is, they can be bivalent monospecific or bivalent bispecific. Furthermore, the multiple sites in a "multivalent" molecule that bind to a specific target can be the same or different. In the context of this application, "monovalent" can be used for monovalent antibodies, monovalent antigen-binding fragments, and monovalent nucleic acid molecules, etc. For example, monovalent Fab, scFv, and monovalent siRNA. In the context of this application, the term "multivalent" can be used to refer to multivalent antibodies, multivalent antigen-binding fragments, etc., which can bind to more than one binding site on a target receptor. Examples of such structures include F(ab')2, IgG antibodies, etc. It can also refer to multivalent siRNAs, such as multiple siRNAs linked by a "spacer".
[0169] In this application, the term "single-specific" means that a biomolecule can only bind to one specific biomolecule. For example, a single-specific antibody can only bind to one specific antigen, or an AOC can only bind to the mRNA of one target gene. The terms "bispecific" and "multispecific" mean that a biomolecule can bind to one or more specific biomolecules.
[0170] In this application, the term "monoclonal antibody" refers to a highly homogeneous antibody produced by a single B cell clone that recognizes only a single epitope of an antigen.
[0171] In this application, the term "polyclonal antibody" refers to a heterogeneous mixture of antibodies that bind to different epitopes of the same antigen.
[0172] In this application, the term "Fab" refers to a fragment obtained after papain cleavage of an antibody, containing a complete antigen-binding site, typically consisting of a complete L chain (VL and CL) along with a VH and a CH1 chain. In this application, the term "Fab'" differs from the stated "Fab" in that the hinge region of "Fab'" typically has a free thiol group at its end.
[0173] In this application, the term "F(ab')2" is obtained by two Fab's being connected by a covalent disulfide bond formed by the thiol groups in the hinge region, and as those skilled in the art will understand, F(ab')2 is a divalent or bivalent protein.
[0174] In this application, the term "single-chain variable fragment" or "scFv" refers to a single-chain protein consisting of a VH and a VL linked by an artificially designed short peptide linker (typically 15-20 amino acids).
[0175] In this application, the term "microantibody" refers to an artificially designed antibody-like molecule composed of an scFv, a hinge-like linker, and a CH3 domain. The scFv acts as the "head," connected to the CH3 domain via the hinge-like linker. Due to the self-aggregation tendency of the CH3 domain, the microantibody can spontaneously form a dimer through hydrophobic interactions.
[0176] In this application, the term "single-domain antibody" or "sdAb" refers to an antibody fragment containing only one variable domain. The variable domain can be VH, VL, VHH (e.g., from camel heavy chain antibodies), and VNAR (e.g., from shark heavy chain antibodies), etc.
[0177] In this application, the term "nanobody" or "VHH" refers to a camel-derived variable heavy chain protein that, similar to the conventional VH domain, contains four FRs and three CDRs. Nanobodies offer advantages over conventional antibodies: they are approximately ten times smaller than IgG molecules, and functional nanobodies, as a result, can be produced in high yields through in vitro expression. Furthermore, nanobodies are highly stable and resistant to proteases. Harmsen and De Haard HJ (Appl. Microbiol. Biotechnol. 2007 Nov; 77(1): 13-22) have reviewed the properties and production of nanobodies.
[0178] The terms “siRNA oligonucleotide,” “RNAi oligonucleotide,” “short interfering RNA,” “dsRNA,” or “siRNA” used in this article are used interchangeably to refer to oligonucleotides that function through posttranscriptional gene splicing, also known as RNA interference (RNAi). These terms refer to double-stranded nucleic acid molecules capable of performing RNA interference “RNAi” (see Kreutzer et al., WO 00 / 44895; Zernicka Goetz et al., WO01 / 36646; Fire, WO 99 / 32619; Mello and Fire, WO 01 / 29058). siRNA molecules are typically RNA molecules, but also include chemically modified nucleotides and non-nucleotides.
[0179] In this application, the term "saRNA" refers to a short double-stranded RNA molecule that upregulates the expression of target genes through an RNA activation (RNAa) mechanism, the opposite of the effects of traditional siRNA (gene silencing). saRNA promotes gene transcription by binding to gene promoter or enhancer regions, recruiting transcription activation complexes.
[0180] In this application, the term "miRNA," as used herein in its usual sense in the art, refers to a small, non-protein-coding RNA molecule expressed in a variety of eukaryotes, including mammals, and involved in RNA-based gene regulation. A mature, fully processed miRNA is approximately 15 to approximately 30 nucleotides in length. A representative group of known endogenous miRNA species is described in the publicly available miRBase sequence database, described in Griffith-Jones et al., Nucleic Acids Research, 2004, 32:D109-D111 and Griffith-Jones et al., Nucleic Acids Research, 2006, 34:D140-D144, and accessible on the World Wide Web of the Wellcome Trust Sanger Institute website. Mature, fully processed miRNAs publicly available on the miRBase sequence database are incorporated herein by reference. Each mature miRNA is partially complementary to one or more messenger RNA (mRNA) molecules that are the target of the miRNA, thereby regulating the expression of target-related genes.
[0181] In this application, the term "ASO" refers to a single-stranded oligonucleotide, typically composed of 15-25 bases, that binds to target RNA (such as mRNA, pre-mRNA, or non-coding RNA) through complementary base pairing, thereby regulating gene expression. Its mechanisms of action are diverse, including degrading target RNA, regulating splicing, or blocking translation.
[0182] In this application, the term "shRNA" refers to an artificial single-stranded interfering RNA molecule that contains both the sense and antisense strands of a "siRNA double strand" in a stem-loop or hairpin structure. The length of the stem in this hairpin structure is typically in the range of 19 to 29 nucleotides, and the length of the loop is typically in the range of 4 to 15 nucleotides (see, for example, Siolas, D. et al. (2004) Nat. Biotechnol. 23, 227-231).
[0183] In this application, the term "sgRNA" is also referred to as "single guide RNA," typically referring to a single RNA molecule that can target target DNA, and may contain crRNA and tracRNA covalently linked to the crRNA via nucleotides. The term "crRNA," also referred to as CRISPR RNA, typically refers to a nucleotide sequence complementary to the target DNA, while the term "tracrRNA" typically refers to a scaffold RNA that can bind to Cas proteins. In nature, crRNA and tracrRNA usually exist as two separate RNA molecules, forming gRNA (guide RNA). However, sgRNA has become the most common form of gRNA used by those skilled in the art in CRISPR technology; therefore, the terms "sgRNA" and "gRNA" may have the same meaning herein. sgRNA can be synthesized artificially or prepared from a DNA template in vitro or in vivo.
[0184] In this application, the term "tinyRNA" refers to a non-classical small RNA molecule with a length of <17nt that can exert a therapeutic effect by specifically binding to target mRNA and regulating gene expression.
[0185] In this application, the term "nucleic acid modification" refers to a unit in a nucleic acid polymer that contains modified bases, sugars, or phosphate groups, or that incorporates non-natural structural parts into its structure. Modification methods have accelerated the development of siRNA drugs. Due to the uniqueness of the drugs, the specific applications of chemical modification methods still need to be explored in different specific scenarios. "Ribosaccharide modification" refers to chemical modification at various positions of the sugar ring of ribonucleic acid, including substituent modifications, such as 2'-ribose modifications (e.g., 2'-O-methyl (2'-OMe), 2'-fluoro (2'-F or 2'F), 2'-methoxyethyl (2'-MOE); 5' modifications (e.g., 5'-Mo); and isomer modifications (e.g., LNA, GNA). In the context of this application, dt refers to 2'-deoxyribose modification of ribose. "Phosphate modification" mainly refers to modifications made to the phosphodiester backbone between ribose in siRNA, including modifications of thiophosphate (PS), dithiophosphate (PS2), methylphosphate (MP), 5'-vinyl phosphate (5'-VP), methoxypropyl phosphate (MOP), and peptide nucleic acid (PNA). "Base modification" refers to chemical modifications made to the bases of siRNA, mainly divided into three forms: purine modification (such as N6-methyladenosine), pyrimidine modification (such as 5-methylcytidine), and base substitution. When applying specific modifications to a particular siRNA, it is necessary to consider the impact of modifications at different positions and in different quantities on the overall function of the siRNA. These different overall modification rules are referred to as "motifs" in this application. In this application, the uppercase letters C, G, U, T, and A appearing in the motif context of the nucleotide sequence represent cytosine, guanine, uracil, thymine, and adenine nucleotides; the lowercase letter m indicates that the nucleotide adjacent to the left of the letter m is a methoxy-modified nucleotide; the lowercase letter f indicates that the nucleotide adjacent to the left of the letter f is a fluorinated nucleotide; the lowercase letter s indicates that the two nucleotides adjacent to the letter s are linked by a thiophosphate subunit; and the letter combination VP indicates that the nucleotide adjacent to the right of the letter combination VP is a vinyl phosphate-modified nucleotide.
[0186] In this application, the term "linker" refers to a molecular bridge that covalently links a ligand and a nucleic acid molecule, and can be divided into cleavable linkers and non-cleavable linkers. A "cleavable linker" can break under specific physiological conditions to release the nucleic acid molecule, while a "non-cleavable linker" requires the complete degradation of the ligand before releasing the nucleic acid molecule.
[0187] In this application, the term "spacer" refers to a structural unit inserted between two nucleotides that does not itself have coding or gene regulatory functions. Its main function is to provide spatial separation and structural flexibility to ensure that each nucleic acid molecule can bind to the target (such as mRNA) independently and effectively, avoiding steric hindrance.
[0188] In this application, the term "Glyco conjugation" or "Glyco" refers to a conjugation method that covalently links a sugar (such as an oligosaccharide, polysaccharide, or sugar derivative) to a drug molecule (such as a nucleic acid molecule in this application). For example, covalently linking oligonucleotides (such as siRNA, ASO) via the N-glycan chain (Asn297) of the antibody Fc region.
[0189] In this application, the terms "Cys coupling," "cysteine coupling," or "Cys" refer to a coupling method that means covalently linking the thiol group (-SH) of a cysteine residue to a drug molecule (such as the nucleic acid molecule in this application). For example, this can be achieved by introducing or utilizing naturally occurring cysteine residues in an antibody, using their -SH group to covalently link them to an active group on an oligonucleotide.
[0190] In this application, the term "site-specific conjugation" refers to the specific liganding of a nucleic acid molecule in this application to a specific site on the ligand. For example, Glyco conjugation to the Fc segment Asn-297 of an IgG antibody.
[0191] In this application, the term "non-site coupling" refers to chemical linking using amino acid residues (such as Lys and Cys) that are widely present on the surface of the antibody. Because these amino acids are numerous and widely distributed in the antibody, the nucleic acid molecules in this application are randomly linked to multiple different sites on the antibody molecule.
[0192] In this application, the term "DAR" refers to the ratio of the number of nucleic acid molecules (B) conjugated to a binding site A (e.g., an antibody or its binding fragment), i.e., the drug (nucleic acid molecule) - ligand (antibody or its binding fragment) ratio. In this application, the conjugated nucleic acid molecule can be monovalent or polyvalent, meaning that molecules linked by a spacer are considered as a single nucleic acid molecule when calculating the DAR value with respect to the antibody or its binding fragment.
[0193] In this application, the term "AOC" refers to an antibody-oligonucleotide conjugate (AOC), which consists of three parts: an antibody, an oligonucleotide, and a cleavable / non-cleavable linker. The antibody specifically recognizes an antigen (CD36) on the surface of a target cell (cardiomyocytes in this application), and is crucial for targeted delivery; the oligonucleotide is used in this application to reduce the expression of a specific gene; and the linker is a chemical bridge connecting the antibody and the oligonucleotide.
[0194] In this application, the term "target gene" refers to the gene specifically recognized and regulated by the nucleic acid molecules in this application.
[0195] In this application, the term "subject" refers to an animal, including but not limited to primates (e.g., humans), cattle, pigs, sheep, goats, horses, dogs, cats, rabbits, rats, and mice. The terms "subject" and "patient" are used interchangeably herein.
[0196] In this application, the term "pharmaceuticalally acceptable excipient" means a pharmaceutically acceptable material, composition, or medium, such as a liquid or solid filler, diluent, solvent, or encapsulating material. Each component is suitable for contact with human or animal tissues or organs without excessive toxicity, irritation, allergic reactions, immunogenicity, or other problems or complications.
[0197] In this application, the term “treatment” generally means: (1) preventing a patient who may be susceptible to a disease, condition and / or symptom but has not yet been diagnosed with the disease from developing the disease, condition or symptom; (2) suppressing the disease, condition or symptom, i.e., curbing its development; and (3) alleviating the disease, condition or symptom, i.e., achieving the relief of the disease, condition and / or symptom and / or symptoms associated with the disease, condition and / or symptom.
[0198] In this application, the term "and / or" should be understood to mean any one of the options or both of the options.
[0199] In this application, the term "comprising" generally means including the explicitly specified features, but does not exclude other elements. In some cases, "comprising" also covers the situation where only the specified components are included. For example, "comprising" also means "consisting of".
[0200] In this application, the term "about" generally refers to a variation within a range of 0.5% to 10% above or below a specified value, such as a variation within a range of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below a specified value.
[0201] Invention Details
[0202] ligands targeting CD36
[0203] On the one hand, this application provides a ligand that targets CD36, wherein the CD36-targeting ligand is a substance that can specifically bind to the CD36 molecule.
[0204] In this application, the ligand targeting CD36 can be selected from natural ligands or synthetic ligands.
[0205] In this application, the ligand targeting CD36 can be composed of peptides, proteins, nucleic acids, and / or nucleic acid analogs. In this application, the ligand targeting CD36 can be an aptamer. In this application, the ligand targeting CD36 can be a linear peptide, a knotted peptide, a cyclic peptide, or a bicyclic peptide. In this application, the ligand targeting CD36 can be an aptamer. In this application, the ligand targeting CD36 can be a backbone protein / framework protein. In this application, the ligand targeting CD36 can be an antibody or an antigen-binding fragment.
[0206] In this application, the aptamer may be a single-specific aptamer or a bispecific aptamer. In this application, the aptamer may have one or more modifications. In this application, the aptamer may comprise a nucleic acid analog. In this application, the nucleic acid analog may have sugar ring modifications, phosphate backbone modifications, base modifications, and / or full backbone substitutions.
[0207] In this application, the nucleic acid analogs may have sugar ring modifications including 2'-fluorine (2'-F), 2'-amino (2'-NH2), 2'-O-methyl (2'-O-Me), etc. In this application, the nucleic acid analogs may have phosphate backbone modifications including phosphate thiophosphate (PS) modification, etc. In this application, the nucleic acid analogs may have base modifications including the introduction of hydrophobic groups and aromatic groups, etc. In this application, the nucleic acid analogs may have complete backbone substitutions including peptide nucleic acids (PNA) and locked nucleic acids (LNA), etc.
[0208] In this application, the peptide can be an oligopeptide or a polypeptide. In this application, the peptide can be an amino acid polymer of any length. In this application, the peptide can be a bioactive molecule composed of about 2-50 amino acids and a size of about 0.5-5 kDa. In this application, the peptide can have one or more modifications, including methylation, acylation, glycosylation, and phosphorylation, wherein acylation can be acetylation. In this application, the peptide can have non-amino acid insertions. In this application, the peptide can also be modified with PEGylation and fatty acid chains. In this application, the peptide can be natural or non-natural. For example, the peptide can be a natural peptide, a synthetic peptide, or a recombinant peptide. In this application, the peptide can be linear or branched. In this application, the peptide can be a linear peptide, a cyclic peptide, or a knotted peptide. In this application, the cyclic peptide can be a natural cyclic peptide or a synthetic cyclic peptide. In this application, the cyclic peptide can be a head-tail cyclic peptide, a side-chain cyclic peptide, a branched cyclic peptide, a monocyclic peptide, a bicyclic peptide, or a polycyclic peptide. In this application, the lateral cyclic peptide can be a disulfide-bonded cyclic peptide or a non-disulfide-bonded cyclic peptide. In this application, the cyclic peptide can contain non-natural amino acids. In this application, the peptide can be a D-type or L-type optical isomer. In this application, the peptide can be an amino acid analog and a peptide mimic.
[0209] In this application, the sequence of the linear peptide can be any sequence capable of specifically targeting the NPPA gene or the PLN gene. For example, the sequence of the linear peptide is SEQ ID NO:48 or a sequence homologous to it, and its homology can be at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 94%, at least about 96%, at least about 98%, or at least about 99%. For example, the sequence of the linear peptide can be formed by deleting, adding, or substituting one or more amino acids based on the sequence shown in SEQ ID NO:48.
[0210] In this application, the ligand targeting CD36 can be a cytoskeletal protein, the size of which can be about 10-20 kDa. For example, the size of the cytoskeletal protein can be about 10-15 kDa. For example, the size of the cytoskeletal protein can be about 10 kDa, about 11 kDa, about 12 kDa, about 13 kDa, about 14 kDa, or about 15 kDa.
[0211] In this application, the cytoskeletal protein may be a non-antibody cytoskeletal protein or an antibody mimic. In this application, the motifs of the cytoskeletal protein may include motifs such as α-helical bundles, β-sheets, circular / nodular structures, repeating proteins, and single-domain antibodies.
[0212] In this application, the cytoskeleton protein can link nucleic acid molecules through specific sites. For example, the specific sites can be the C-terminus and the loop region of the cytoskeleton protein.
[0213] In this application, the sequence of the skeletal protein can be any sequence capable of specifically targeting the NPPA gene or the PLN gene. For example, the sequence of the skeletal protein is SEQ ID NO:47 or a sequence homologous to it, and its homology can be at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 94%, at least about 96%, at least about 98%, or at least about 99%. For example, the sequence of the skeletal protein can be formed by deleting, adding, or substituting one or more amino acids based on the sequence shown in SEQ ID NO:47.
[0214] In this application, the antibody or antigen-binding fragment generally refers to an immunoglobulin or fragment thereof capable of specifically binding to the CD36 antigen. In this application, the antibody may comprise a protein containing at least two heavy chains and two light chains interconnected by disulfide bonds, or an antigen-binding fragment thereof.
[0215] In this application, the antibody may be a conventional antibody, Fab, Fab', F(ab')2, single-chain variable fragment (scFv), microantibody, or single-domain antibody (sdAb). For example, the sdAb may be selected from camel-derived VHH (nanobody), shark-derived VNAR, human VH, human VL, mouse-derived VH, and mouse-derived VL.
[0216] For example, in this application, the antibody may be a conventional antibody, which may be IgG, IgM, IgA, IgD and IgE, and the IgG antibody may be IgG1, IgG2, IgG3 and IgG4 antibodies.
[0217] In this application, the antibody may be a chimeric antibody, a humanized antibody, or a fully human antibody. In this application, the antibody may be a monoclonal antibody or a polyclonal antibody. In this application, the antibody may be a bispecific antibody or a multispecific antibody. In this application, the antibody may be a monovalent antibody or a multivalent antibody. In this application, the antibody may be a recombinant, hybrid, mutated, or transplanted antibody.
[0218] In this application, the heavy chain may include a heavy chain variable region (VH) and a heavy chain constant region (CH). The heavy chain constant region contains three domains: CH1, CH2, and CH3. In this application, the light chain may include a light chain variable region (VL) and a light chain constant region (CL). The light chain constant region contains one domain. In this application, the VH and VL regions may contain hypervariable regions and more conserved regions. The hypervariable regions are called complementarity-determining regions (CDRs) or hypervariable regions (HVRs), which alternate with more conserved regions called framework regions (FRs). In this application, the VH and VL of a conventional antibody each contain three CDRs and four FRs, arranged in the following order from the amino terminus to the carboxyl terminus: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. In this application, the CDRs can be determined by various coding systems. For example, the CDRs can be determined by CCG, Kabat, Chothia, IMGT, AbM, or a combination of Kabat / Chothia, etc. In this application, the CDR encompasses a CDR sequence partitioned according to any CDR partitioning method. For example, the CDR encompasses variants. For example, the amino acid sequence of the CDR may be substituted, deleted, and / or added with one or more amino acids, such as 1-30, 1-20, or 1-10, or for example, 1, 2, 3, 4, 5, 6, 7, 8, or 9 amino acids. For example, the CDR encompasses homologs. For example, the homolog can be an amino acid sequence having at least about 85% (e.g., having at least about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or higher) sequence homology with the amino acid sequence of the CDR.
[0219] In this application, the anti-CD36 antibody may include three complementary determinant regions HCDR1, HCDR2 and HCDR3 of the antibody heavy chain variable region, and three complementary determinant regions LCDR1, LCDR2 and LCDR3 of the antibody light chain variable region.
[0220] In this application, the amino acid sequence of the CDR is selected from any of the following combinations:
[0221] (1) The amino acid sequence of HCDR (heavy chain complementarity-determining region) 1 is shown in SEQ ID NO:23, the amino acid sequence of HCDR 2 is shown in SEQ ID NO:24, and the amino acid sequence of HCDR 3 is shown in SEQ ID NO:25; the amino acid sequence of LCDR (light chain complementarity-determining region) 1 is shown in SEQ ID NO:20, the amino acid sequence of LCDR 2 is shown in SEQ ID NO:21, and the amino acid sequence of LCDR 3 is shown in SEQ ID NO:22; and
[0222] (2) The amino acid sequence of HCDR1 is shown in SEQ ID NO:33, the amino acid sequence of HCDR2 is shown in SEQ ID NO:34, the amino acid sequence of HCDR3 is shown in SEQ ID NO:35; the amino acid sequence of LCDR1 is shown in SEQ ID NO:30, the amino acid sequence of LCDR2 is shown in SEQ ID NO:31, and the amino acid sequence of LCDR3 is shown in SEQ ID NO:32.
[0223] In this application, the anti-CD36 antibody comprises an antibody heavy chain variable region VH, the amino acid sequence of which is shown in SEQ ID NO:27 or SEQ ID NO:37. In this application, the anti-CD36 antibody comprises an antibody light chain variable region VL, the amino acid sequence of which is shown in SEQ ID NO:26 or SEQ ID NO:36.
[0224] In this application, the amino acid sequences of VH and VL are selected from any of the following combinations:
[0225] (1) The amino acid sequence of VH is shown in SEQ ID NO:27, and the amino acid sequence of VL is shown in SEQ ID NO:26; and
[0226] (2) The amino acid sequence of VH is shown in SEQ ID NO:36, and the amino acid sequence of VL is shown in SEQ ID NO:36.
[0227] In this application, the sequences of Fab, Fab', F(ab')2, single-chain variable fragment (scFv), microantibody, and single-domain antibody (sdAb) can be any sequence capable of specifically targeting the NPPA gene or PLN gene.
[0228] In this application, the light chain sequence of the Fab can be SEQ ID NO:28, and the heavy chain sequence can be SEQ ID NO:44.
[0229] In this application, the amino acid sequence of the scFv can be SEQ ID NO:45.
[0230] In this application, the amino acid sequences of CDR1, CDR2, and CDR3 of the heavy chain antibody can be SEQ ID NO:40, SEQ ID NO:41, and SEQ ID NO:42, respectively. In this application, the full-length amino acid sequence of the heavy chain antibody can be SEQ ID NO:43.
[0231] In this application, the amino acid sequences of conventional antibodies' VH, VL, Fab, scFv, and / or heavy chain antibodies can be adjusted as needed. For example, the amino acid sequences of VH and / or VL can be altered without reducing the binding activity / affinity of the anti-CD36 antibody. For example, one or more amino acid sequences in VH and / or VL can be mutated or optimized without reducing the binding activity / affinity of the anti-CD36 antibody. For example, the VH and / or VL can be variants thereof, which include substitutions, deletions, and / or additions of one or more amino acids in the amino acid sequences of the VH and / or VL. For example, 1-30, 1-20, or 1-10 amino acids, or, for example, 1, 2, 3, 4, 5, 6, 7, 8, or 9 amino acid substitutions, deletions, and / or insertions. For example, the VH and / or VL can be homologs, which can be amino acid sequences having at least about 85% (e.g., having at least about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99% or higher) sequence homology with the amino acid sequences of the VH and / or VL.
[0232] Nucleic acid conjugates
[0233] On the other hand, this application provides a nucleic acid conjugate comprising a CD36-targeting ligand and a nucleic acid molecule, wherein the ligand can target cardiomyocytes. The nucleic acid conjugate is a targeted therapy technique that combines the cell / tissue-specific targeting effect of the ligand with the gene regulation capability of the nucleic acid molecule, delivering the nucleic acid molecule to cardiomyocytes via the CD36-targeting ligand.
[0234] In this application, the DAR value of the ligand-nucleic acid molecule can be 1-8, and can be DAR1, DAR2, DAR3, DAR4, DAR5, DAR6, DAR7, or DAR8. In this application, when the nucleic acid molecule is siRNA, the DAR value can be 1 or 2. In this application, when the nucleic acid molecule is ASO, the DAR value is 1-4. For example, the DAR value of the ASO is DAR1, DAR2, DAR3, or DAR4. For example, the DAR value of the ASO molecule is 1 or 2.
[0235] In this application, the nucleic acid conjugate may be an antibody nucleic acid conjugate. In any embodiment, the DAR of the antibody nucleic acid conjugate may be 1-8, and may be DAR1, DAR2, DAR3, DAR4, DAR5, DAR6, DAR7, or DAR8. Those skilled in the art will understand that in the antibody nucleic acid conjugate, when "DAR" is described in this application, the nucleic acid molecule is considered as a whole for ratio calculation, that is, multiple siRNAs connected by "spacers" are considered as a complete molecule or structure. Therefore, Figure 78B shows a conjugate of bivalent siRNA and DAR1.
[0236] In this application, "monovalent" generally refers to a molecule or structure possessing only one binding site for a specific target (such as mRNA). "Multivalent" refers to a molecule or structure possessing multiple binding sites for specific targets, enabling it to bind to multiple targets (such as mRNA) simultaneously. The "site" can be an antigen-binding site or a nucleic acid molecule binding site. These multiple binding sites for specific targets can be monospecific or multispecific, and their binding specificity is independent of molecular valence; that is, they can be bivalent monospecific or bivalent bispecific. Furthermore, the multiple binding sites for specific targets in a "multivalent" structure can be the same or different. The "valence" describes the number of binding portions of each molecule or structure exhibiting for a target (such as an antigen, receptor, or mRNA). In the context of this application, multivalent siRNAs, such as multiple siRNAs linked by a "spacer," which is a structural unit inserted between two nucleotides that does not itself have coding or gene regulatory functions. Its main function is to provide spatial separation and structural flexibility, ensuring that each nucleic acid molecule can bind to the target (such as mRNA) independently and effectively, avoiding steric hindrance.
[0237] In this application, the antibody-nucleic acid conjugate may be monovalent or polyvalent. In any embodiment, the antibody-nucleic acid conjugate may be bivalent.
[0238] In this application, the antibody nucleic acid conjugate is a conjugate of a bivalent antibody, a monovalent siRNA, and DAR1 (as shown in Figure 78A). In any embodiment, the antibody nucleic acid conjugate is a conjugate of a bivalent antibody, a bivalent siRNA, and DAR1 (as shown in Figure 78B). In any embodiment, the antibody nucleic acid conjugate is a conjugate of a bivalent antibody, a monovalent siRNA, and DAR2 (as shown in Figure 78C). In any embodiment, the antibody nucleic acid conjugate is a conjugate of a bivalent antibody, a bivalent siRNA, and DAR2 (as shown in Figure 78D). In any embodiment, the antibody nucleic acid conjugate is a conjugate of a monovalent antibody, a monovalent siRNA, and DAR1. In any embodiment, the antibody nucleic acid conjugate is a conjugate of a monovalent antibody, a bivalent siRNA, and DAR1. In any embodiment, the antibody nucleic acid conjugate is a conjugate of a monovalent antibody, a monovalent siRNA, and DAR2. In any embodiment, the antibody nucleic acid conjugate is a conjugate of a monovalent antibody, a bivalent siRNA, and DAR2.
[0239] In this application, the nucleic acid conjugate may be named “(valence-nucleic acid molecule)-DAR1”, “(valence-nucleic acid molecule, valence-nucleic acid molecule)-DAR2”, “(valence-nucleic acid molecule, valence-nucleic acid molecule, valence-nucleic acid molecule)-DAR3” or “(valence-nucleic acid molecule, valence-nucleic acid molecule, valence-nucleic acid molecule, valence-nucleic acid molecule)-DAR4”.
[0240] The term "valence" refers to the valence of a nucleic acid molecule, which can be monovalent, divalent, or trivalent, represented by "Mono", "Di", and "Tri" respectively.
[0241] When the nucleic acid molecule is siRNA, it can be represented independently as XsiRNA, X'siRNA or X”siRNA. When the nucleic acid molecule is ASO, it can be represented independently as XASO, X'ASO or X”ASO. X, X', and X” represent the genes targeted by the nucleic acid molecule, which can be selected from SOD1, PPIB, NPPA, and PLN.
[0242] For example, Di-XsiRNA represents a bivalent X-target siRNA, and Di-XsiRNA-X'siRNA represents a bivalent bispecific siRNA, one of which is an X-target siRNA and the other is an X'-target siRNA.
[0243] When the ligand is an antibody and the nucleic acid molecule is siRNA, the DAR value is preferably 1 or 2.
[0244] For example, conjugates of single-specific siRNAs with a DAR value of 1 can be represented as (mono-XsiRNA)-DAR1 (Figure 78A), (Di-XsiRNA)-DAR1 (Figure 78B), and (Tri-XsiRNA)-DAR1.
[0245] A conjugate of bispecific siRNA with a DAR value of 1 can be represented as (Di-XsiRNA-X'siRNA)-DAR1, (Tri-XsiRNA-XsiRNA-X'siRNA)-DAR1, etc.
[0246] A conjugate of three specific siRNAs, with a DAR value of 1, can be (Tri-XsiRNA-X'siRNA-X”siRNA)-DAR1.
[0247] For example, a conjugate of bispecific siRNA with a DAR value of 2 can be represented as (Mono-XsiRNA, Di-X'siRNA)-DAR2, (Mono-XsiRNA, Di-X'siRNA-XsiRNA)-DAR2, (Mono-XsiRNA, Mono-X'siRNA)-DAR2 (structure shown in Figure 78C), (Mono-XsiRNA, Tri-X'siRNA)-DAR2, (Mono-XsiRNA, Tri-XsiRNA ... The structures include (RNA-X'siRNA)-DAR2, (Mono-XsiRNA, Tri-XsiRNA-XsiRNA-X'siRNA)-DAR2, (Di-XsiRNA, Di-X'siRNA)-DAR2 (structure shown in Figure 78D), (Di-XsiRNA, Di-XsiRNA-X'siRNA)-DAR2 (structure shown in Figure 78D), and (Di-XsiRNA-X'siRNA, Di-XsiRNA-X'siRNA)-DAR2 (structure shown in Figure 78D), etc.
[0248] A conjugate of three specific siRNAs with a DAR value of 2 can be represented as (Mono-XsiRNA, Di-X'siRNA-X”siRNA)-DAR2, (Di-XsiRNA-X'siRNA, Di-X”siRNA)-DAR2, (Di-XsiRNA-X'siRNA, Di-X”siRNA-XsiRNA)-DAR2, and (Di-XsiRNA-X'siRNA, Di-X”siRNA-X'siRNA)-DAR2, etc. In this application, the aforementioned conjugates can be named “(valence-X nucleic acid molecule, valence-X' nucleic acid molecule)-DARY”, where “valence” can be monovalent, divalent, or trivalent, represented by “Mono”, “Di”, and “Tri”, respectively. X, X', or X” represents the gene targeted by the nucleic acid molecule, which can be selected from SOD1, PPIB, NPPA, and PLN. Y represents the DAR value of the ligand-nucleic acid conjugate, which can be selected from 1 to 4. For example, the aforementioned single-specific conjugates can be represented as mono-XsiRNA-DARY, Di-XsiRNA-DARY, etc. NA-DARY and Tri-XsiRNA-DARY, etc. For example, the above-mentioned bispecific conjugates can be represented as (Mono-XsiRNA, Di-X'siRNA)-DARY, (Mono-XsiRNA, Di-X'siRNA-XsiRNA)-DARY, (Mono-XsiRNA, Mono-X'siRNA)-DARY, (Mono-XsiRNA, Tri-X'siRNA)-DARY, (Mono-XsiRNA, Tri-XsiRNA)-DARY, (Mono-XsiRNA, Tri-XsiRNA)-DARY, (Mono-XsiRNA, Tri-XsiRNA)-DARY, (Mono-XsiRNA, Tri-XsiRNA)-DARY, etc. NA-X'siRNA-X'siRNA)-DARY, (Mono-XsiRNA, Tri-XsiRNA-XsiRNA-X'siRNA)-DARY, (Di-XsiRNA, Di-X'siRNA)-DARY, (Di-XsiRNA, Di-XsiRNA-X'siRNA)-DARY and (Di-XsiRNA-X'siRNA, Di-XsiRNA-X'siRNA)-DARY, etc. For example, the above-mentioned trispecific conjugates can be (Tri-XsiRNA-X'siRNA-X"siRNA)-DARY, (Mono-XsiRNA, Di-X'siRNA-X"siRNA)-DARY, (Di-XsiRNA-X'siRNA , Di-X”siRNA)-DARY, (Di-XsiRNA-X’siRNA, Di-X”siRNA-XsiRNA)-DARY and (Di-XsiRNA-X’siRNA, Di-X”siRNA-X’siRNA)-DARY, etc.
[0249] In this application, the nucleic acid conjugate may comprise a ligand and a nucleic acid molecule, which may be coupled via a linker (L). When the nucleic acid molecule is siRNA, L is coupled to the 5' end of the sense strand of the siRNA. The function of L may include one or more of the following: (1) making the nucleic acid molecule more stable; (2) controlling drug release; and (3) optimizing drug loading.
[0250] In this application, L can be a breakable linker or a non-breakable linker. In this application, the breakable linker can be any linker that can break and release nucleic acid molecules under specific conditions. In this application, the breakable linker can be an acid-sensitive linker, a reduction-sensitive linker, an enzyme-sensitive linker, or a phosphatase-sensitive linker.
[0251] In this application, the enzyme-sensitive linker can be a cathepsin B-sensitive linker. For example, the enzyme-sensitive linker can be Val-Cit (valine-citrulline), Val-Ala (valine-alanine), cBu-Cit (cyclobutane-1,1-dicarboxamide-citrulline), or GGFG (tetrapeptide linker).
[0252] In this application, the acid-sensitive linker may be a hydrazone bond, a carbonate linker, or a silyl ether linker.
[0253] In this application, the reduction-sensitive linker may be a disulfide bond or a methylated disulfide bond.
[0254] In this application, the breakable linker may also be selected from N-succinimidyl 4-(2-pyridyldithio)valerate, N-succinimidyl 4-(2-pyridyldithio)-2,2-dimethylbutyrate, valine-citrulline (VC) linker, 3-(2-pyridyldithio)propionate (PDP), and methyl-(2-pyridyldithio)toluene (MPT).
[0255] In this application, the unbreakable linker can be any ligand that causes the ligand to be completely degraded within the lysosome, releasing the nucleic acid molecule. For example, the unbreakable linker can be a thioether bond or a maleimide hexanoyl group (MCC).
[0256] In this application, the unbreakable linker may also be selected from m-maleimide benzoyl (MB), 4-((4-(cyanoethynyl)benzoyl)oxy (CB) and bismaleimide (BisMal).
[0257] In this application, L may include L1-L2-L3, where L1 is the portion covalently linked to the ligand, L2 is the extension portion, and L3 is the portion covalently linked to the nucleic acid molecule.
[0258] In this application, L1 is formed from any group that reacts with the ligand molecule, such as a thiol reactive group, an amino reactive group, a carboxyl reactive group, a proline residue reactive group, a tyrosine residue reactive group, a disulfide bridging group, etc. For antibodies introducing non-natural amino acids, it can also be selected from click chemistry reactive groups such as ketones, azides, alkynes, cyclopropenes, or dienes. For example, L1 can be a thiol reactive group. In this application, L1 can be a breakable link that releases nucleic acid molecules under physiological or targeted conditions.
[0259] In this application, L1 can be a maleimide group or a substituted maleimide group, and L1 can have the following structure:
[0260] (1) A fragment prepared from (N-maleimidemethyl)-carboxylic acid-N-hydroxysuccinimide ester, with the structure (q is an integer from 0 to 10, preferably 1, 2, 3, 4, 5, 6, 7 or 8):
[0261] (2) The fragment prepared from 4-(N-maleimidemethyl)-cyclohexane-1-carboxylic acid succinimide ester (SMCC) has the following structure:
[0262] (3) The methylsulfone pyrimidine group has the following structure:
[0263] (4) Click on the chemical group; the structure is:
[0264] In this application, the L1 fragment, after reacting with a ligand carrying an azide group, forms the following structure (the wavy line indicates the connection position):
[0265] In this application, when the ligand targeting CD36 in the nucleic acid conjugate is selected from an antibody or an antigen-binding fragment, an azide group can be introduced into the antibody through the glycosylation site of the Fc fragment, as shown in Figure 1, where the square represents N-acetylglucosamine (GlcNAc) and the triangle represents fucose (Fuc).
[0266] In this application, L2 is a bond or an optional divalent chemical linker, which can be a cleavable chemical linker or an uncleavable chemical linker. The cleavable chemical linker includes chemically unstable chemical linkers and enzyme-cleavable chemical linkers. Chemically unstable chemical linkers include acid-cleavable chemical linkers and reducible or disulfide chemical linkers. The enzyme-cleaving chemical linker can be a peptide linker, specifically the -Xaa- peptide linker, which is known in existing technology and can be a peptide segment composed of 2-8 natural or non-natural amino acids, such as -ValCit-; -CitVal-; -AlaAla-; -AlaCit-; -CitAla-; -AsnCit-; -CitAsn-; -CitCit-; -ValGlu-; -GluVal-; -SerCit-; -CitSer-; -LysCit-; -CitLys-; -AspCit-; -CitAsp-; -AlaVal-; -ValAla-; -PheAla-; -AlaPhe-; -PheLys-; -LysPhe-; -ValLys-; -LysVal-; -AlaLys-; -LysAla -PheCit--CitPhe--LeuCit--CitLeu--IleCit--CitIle--PheArg--ArgPhe--CitTrp--TrpCit--PhePheLys--LysPhePhe--DPhePheLys--DLysPhePhe--GlyP heLys-;-LysPheGly-;-GlyPheLeuGly-;-GlyLeuPheGly-;-AlaLeuAlaLeu-, -GlyGlyGly-;-GlyGlyGlyGly-; The insulator may be selected from straight-chain alkanes, straight-chain PEGs, branched alkanes, cycloalkanes, heterocycloalkanes, aryl or heteroaryl groups, or combinations thereof.
[0267] In this application, L may also include L1-L 2A -XL 2B -L3, the L 2A and L 2B X represents any divalent linker group, and X represents any divalent functional group such as -O-, -S-, -SS-, -CONH-, -C(O)O-, -C(O)-, -OC(O)-, -OC(O)NH-, etc.
[0268] In this application, X is formed by the reaction of X1 and X2, that is, the coupling is obtained through the following reaction:
[0269] (1) Step 1: L1-L 2A -X1+X2-L 2B -L3-nucleic acid——>L1-L 2A -XL 2B -L3-nucleic acid
[0270] For example:
[0271] (2) Second step: Ligand + L1-L 2A -XL 2B -L3-nucleic acid->ligand-(L1-L 2A -XL 2B -L3-nucleic acid) n
[0272] For example:
[0273] In this application, the antibody is introduced with coupling groups through biological or chemical methods. For example, one or more of the disulfide bond sites between the light and heavy chains (two sites between the heavy chain and two sites between the heavy and light chains) are reduced to form an antibody containing free thiol groups; another example is an antibody with click chemical linking groups introduced at the N-glycosylation site of the Fc region through glycoengineering.
[0274] In this application, L 2A or L 2B Or X is selected from the substituted C1-C. 12 Alkylene, C2-C 10 alkyne group, C2-C 10 imidene group, -CR a =CR a - Optionally substituted 6 to 14 arylene groups, Optionally substituted C3-C 10 Cycloalkylene, -[CH2O] 1-18- -[CH2CH2O] 1-18 -、-[CH2CH2CH2O] 1-18 - Optionally substituted 5- to 14-membered heterocyclic aryl groups, Optionally substituted 3- to 10-membered heterocyclic aryl groups, -NR a -、-N=CR a -、-CR a =N-, -S-, -OP(O)OR a O-、-O-、-CR b2-, -C(O)-, -C(O)O-, -OC(O)-, -C(O)S-, -SC(O)-, -C(O)NR a -、-NR a C(O)-, OC(O)O-, -OC(O)S-, -SC(O)O-, -OC(O)NR a -、-NR a C(O)O-、-SC(O)NR a -、-NR a C(O)S-, -XAA-, or a combination of the above groups; each R a Each R is independently selected from hydrogen, optionally substituted alkyl, optionally substituted haloalkyl, optionally substituted cycloalkyl, optionally substituted cycloalkylalkyl, optionally substituted aryl, optionally substituted aralkyl, optionally substituted heteroalkyl, optionally substituted heterocycloalkyl, optionally substituted heterocycloalkylalkyl, optionally substituted heteroaryl, and optionally substituted heteroarylalkyl; b Each occurrence is independently selected from hydrogen, halides, -OH, -SO3H, -OPO3H2, -PO3H2, -C(O)NR a 2. -CO2R a -NR a 2. Optionally substituted alkyl, optionally substituted fluoroalkyl, optionally substituted cycloalkyl, optionally substituted cycloalkylalkyl, optionally substituted aryl, optionally substituted aralkyl, optionally substituted heteroalkyl, optionally substituted heterocycloalkyl, optionally substituted heterocycloalkylalkyl, optionally substituted heteroaryl and optionally substituted heteroarylalkyl; or two independent R b The groups together form an optionally substituted cycloalkyl, optionally substituted aryl, optionally substituted heterocycloalkyl, or optionally substituted heteroaryl; -XAA- represents a peptide fragment as defined above. For example, L 2A or L 2B For C1-C 12 Alkylene, C3-C 10 Cycloalkylene, 3 to 10-membered heterocyclic or C6-C 14 aryl or combinations thereof, L 2A or L 2B It can be a homo-bifunctional connective or a hetero-bifunctional connective. For example, L 2B Contains heterocyclic alkyl linking segments, such as The wavy line indicates the connection point.
[0275] In this application, L3 can be selected from ether bonds, thioether bonds, amide bonds, and -NR bonds. a’ -(R a’The linkage is selected from H or C1-6 alkyl groups, phosphodiester bonds, thiophosphate bonds, dithiophosphate bonds, alkyl phosphonates, alkyl thiophosphate bonds, phosphotriester bonds, phosphoramidite bonds, siloxane groups, carbonate bonds, alkoxyformyl groups, acetamipate bonds, aminoformipate bonds, morpholino groups, boronyl groups, thioether bonds, bridged phosphoramidite bonds, bridged methylene phosphonates, bridged thiophosphate bonds, or sulfone nucleoside bonds. In this application, L3 can be a breakable link that releases oligonucleotide molecules under physiological or targeted conditions. In this application, L3 can be linked to a nucleoside base, sugar moiety, or internucleotide bond in a nucleic acid molecule. In this application, L3 is a phosphodiester bond or thiophosphate diester bond linked to a 3' or 5' hydroxyl group on the sugar ring.
[0276] Nucleic acid molecules
[0277] On the other hand, this application provides a nucleic acid molecule conjugated with an anti-CD36 antibody, said nucleic acid molecule being able to regulate the expression of a target gene in cardiomyocytes.
[0278] In this application, the nucleic acid molecule can be: double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), multi-stranded DNA, double-stranded RNA (dsRNA), single-stranded RNA (ssRNA), multi-stranded RNA, DNA-RNA hybrids (single-stranded or multi-stranded), peptide nucleic acid (PNA), PNA-DNA hybrids (single-stranded or multi-stranded), PNA-RNA hybrids (single-stranded or multi-stranded), locked nucleic acid (LNA), LNA-DNA hybrids (single-stranded or multi-stranded), or LNA-RNA hybrids (single-stranded or multi-stranded).
[0279] In this application, the nucleic acid molecule can be siRNA, saRNA, miRNA, ASO, shRNA, aptamer, sgRNA, or tinyRNA. For example, in this application, the nucleic acid molecule can be siRNA or ASO.
[0280] In this application, the nucleic acid molecules typically contain phosphodiester bonds, including nucleic acid analogs that can have an alternative backbone, such as phosphoramide.
[0281] In this application, the ASO length can be approximately 12-16 nt, approximately 16-20 nt, approximately 18-30 nt, approximately 20-25 nt, or approximately 25-30 nt. For example, the length can be approximately 15 nt, approximately 16 nt, approximately 17 nt, approximately 18 nt, approximately 19 nt, approximately 20 nt, approximately 21 nt, approximately 22 nt, approximately 23 nt, approximately 24 nt, or approximately 25 nt.
[0282] In this application, the siRNA length can be about 19-27 nt, about 21-23 nt, or greater than 27 nt. For example, the siRNA length is about 21-23 nt. For example, the siRNA sense strand length can be about 21 nt, and the antisense strand length can be about 23 nt.
[0283] In this application, the siRNA molecule may have a 2-3 nt 3' overhang. In this application, the 3' overhang may be UU, dTdT, AU, CA, AG, or GG, etc.
[0284] In this application, the siRNA may have blunt ends and no 3' protrusions.
[0285] In this application, the target gene regulated by the small nucleic acid molecule can be phosphoprotein (PLN) and / or natriuretic peptide precursor A (NPPA). For example, the target gene can be PLN.
[0286] In this application, the nucleic acid conjugate may include one nucleic acid molecule or at least two nucleic acid molecules. In this application, the target gene regulated by any nucleic acid molecule may be selected from PLN and / or NPPA. For example, the target gene may be PLN and NPPA.
[0287] In this application, the nucleic acid molecule can be tandemly linked with one or more nucleic acid molecules via a spacer. The spacer can be selected from nucleotide / oligonucleotide spacers or non-nucleotide spacers.
[0288] In this application, the nucleotide / oligonucleotide spacer is composed of natural or modified nucleotides linked by phosphodiester bonds. In this application, the nucleotide / oligonucleotide spacer can be a homopolymer sequence or a heteropolymer sequence. In this application, the nucleotide / oligonucleotide spacer can be chemically modified. In this application, the homopolymer sequence can be selected from Poly-dT or Poly-dA. In this application, the Poly-dT can be three deoxythymidine nucleotides (dTdTdT).
[0289] In this application, the non-nucleotide spacer includes any artificially synthesized chemical molecule that is not a nucleotide. In this application, the non-nucleotide spacer can be a PEG-type spacer or an alkane chain spacer, etc. In this application, the PEG-type spacer can be PEG6, PEG9, and PEG. 12 In this application, the alkane chain spacer can be propylene glycol, hexanediol, etc.
[0290] In this application, the Spacer can be a cleavable Spacer, such as a disulfide bond Spacer or an enzymatic sequence cleavage Spacer.
[0291] In this application, the target genes regulated by the nucleic acid molecules tandemly linked by the Spacer are selected from PLN and NPPA, respectively.
[0292] In this application, the antisense strand of the siRNA targeting the NPPA gene is selected from at least one of SEQ ID NOs:13-17. In this application, the antisense strand of the siRNA targeting the PLN gene is SEQ ID NO:19.
[0293] In this application, the siRNA or ASO sequence that is homologous to any one of the sequences in SEQ ID NOs:8-19 and can specifically target the NPPA or PLN gene may have a homology of at least about 60%, at least about 70%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 94%, at least about 96%, at least about 98%, or at least about 99%. For example, this can be achieved by deleting or adding nucleotides to any one of the sequences in SEQ ID NOs:8-19.
[0294] Nucleic acid modification
[0295] On the other hand, this application provides a chemical modification of a nucleic acid molecule, which is a key means of optimizing its stability, specificity, delivery efficiency and pharmacodynamic properties.
[0296] In this application, the modification of the nucleic acid molecule can be selected from phosphate modification, ribose modification, or base modification.
[0297] In this application, the phosphate modification can be selected from: PS (phosphothiophosphate) modification, PS2 (dithiophosphate) modification, MP (methylphosphonate) modification, MOP (methoxyphosphonate) modification, 5'-(E)-VP (5'-vinyl phosphate) modification, 5'-MP (5'-methylphosphonate) modification, (S)-5'-C-methylphosphate modification, 5'-PS (5'-phosphophosphate) modification, and PNA (peptide nucleic acid) modification. In this application, the PS modification can be either an Rp configuration or a Sp configuration.
[0298] In this application, the ribose modification may be selected from: 2'-OMe (2'-O-methyl) modification, 2'-methoxyethyl (2'-MOE) modification, 2'-F (2'-fluorine) modification, 2'-Ara-F (2'-deoxy-2'-fluoro-arabinose) modification, 2'-O-benzyl modification, 2'-O-CH2-Py(4)(2'-O-(4-pyridinemethyl)) modification, LNA (locked nucleic acid) modification, (S)-cET-BNA (restricted ethyl-bridged nucleic acid) modification, tcDNA (tricyclic DNA) modification, PMO (phosphoryldiamine morpholino oligomer) modification, UNA (unlocked nucleic acid) modification, and GNA (glycolic acid) modification.
[0299] In this application, the base modification can be selected from: ψ (pseudouridine) modification, s2U (2-thiouridine) modification, m 6 A(N6-methyladenosine) modification, m 5 C(5-methylcytosine) modification, FdU / FUDR(5'-fluoro-2'-deoxyuridine) modification, N-ethylpiperidine 7'-EAA triazole modification, adenine modification, N-ethylpiperidine 6'-triazole modification, adenine modification, PhpC (benzothiazine-3-one) modification, rF (2,4-difluorotolyl) modification, and 5'-nitroindole modification.
[0300] In this application, the nucleic acid molecule may also include a 5' end modification, including but not limited to phosphate ester modification, end blocking modification, hydrophobic modification, polyethylene glycolation, and fluorescent labeling.
[0301] In this application, the phosphate ester modification includes natural 5'-phosphate ester modification and phosphate ester analog modification. For example, the phosphate ester analog can be PS, 5'-vinyl phosphate (5'-VP), and 5'-borane phosphate (5'-BH3).
[0302] In this application, the terminal blocking modification can be any modification that chemically blocks the 5'-OH or replaces the natural phosphate ester structure. For example, the terminal blocking modification can be an inverted nucleotide (such as 5'-invab modification), a 5'-amino modification (5'-NH2), a 5'-alkyl modification, a 5'-aryl modification, a 5'-fluorescent label (such as FAM modification, Cy3 modification, Cy5 modification, TAMRA modification), and a 5'-PEG (polyethylene glycol) modification.
[0303] In this application, the hydrophobic modification can be any modification that introduces a hydrophobic group at the 5' end of a nucleic acid molecule. For example, the hydrophobic modification can be cholesterol modification, fatty acid chain modification (such as palmitic acid (C16) modification, stearic acid (C18) modification, and docosahexaenoic acid (DHA, C22:6) modification), vitamin derivative modification (such as α-tocopherol modification, vitamin A modification), bile acid modification, and naphthaleneacetic acid modification.
[0304] In this application, polyethylene glycolation can be any modification that covalently links polyethylene glycol (PEG) to the 5' end of a nucleic acid molecule. In this application, the chain length of the PEG can be PEG6-PEG. 40 For example, the chain length of the PEG is PEG. 12 -PEG 24 In this application, the linking sites of the PEG can be 5'-OH, 5'-NH2, and 5'-SH. In this application, the PEG can be linear PEG or branched PEG. In this application, the PEG can be degradable or non-degradable.
[0305] In this application, the fluorescent groups of the fluorescent markers include, but are not limited to, FAM, Cy3, Cy5, TAMRA, ATTO 488 / 647, and Alexa. series.
[0306] In this application, at least a portion of the phosphate ester groups in the phosphate-sugar backbone of at least one single strand of the sense and antisense strands of the siRNA are phosphate ester groups with modifying groups. In some embodiments, the phosphate ester group with modifying groups is a thiophosphate ester group formed by replacing at least one oxygen atom in the phosphodiester bond of the phosphate ester group with a sulfur atom. In some embodiments, the phosphate ester group with modifying groups is a thiophosphate ester group.
[0307] In this application, when the ASO length is 20 nt, the nucleotides at positions 1-5 and 16-20 are 2'-MOE modified in the direction from the 5' end to the 3' end, the nucleotides at positions 6-15 are deoxyribose modified, and there is PS modification among all nucleotides.
[0308] In this application, the phosphothioester group of the siRNA is present at least one of the following positions: between the first and second nucleotides of the sense strand and / or the antisense strand; between the second and third nucleotides of the sense strand and / or the antisense strand; between the 19th and 20th nucleotides of the antisense strand; between the 20th and 21st nucleotides of the antisense strand; between the 21st and 22nd nucleotides of the antisense strand; between the 22nd and 23rd nucleotides of the antisense strand; or any combination thereof.
[0309] In this application, the 5' terminal nucleotide of the antisense strand of the siRNA can be a 5'-phosphate nucleotide or a nucleotide modified with a 5'-phosphate analog.
[0310] In this application, the modification of the siRNA is selected from 2'-O-methyl modification, 2'-fluoro modification, PS modification, 5'-VP modification and invab modification.
[0311] In this application, the siRNA can be modified in the following ways:
[0312] (1) One or more nucleotides at positions 7, 9, 10, and 11 of the siRNA sense strand are fluorinated in the direction from 5' end to 3' end; and one or more nucleotides at positions 2, 6, 8, 9, 14, and 16 of the siRNA antisense strand are fluorinated in the direction from 5' end to 3' end.
[0313] (2) In the direction from the 5' end to the 3' end, one or more nucleotides at positions 7, 9, 10, and 11 of the siRNA sense strand are fluorinated, and one or more nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 of the siRNA sense strand are 2'-O-methyl modified; and in the direction from the 5' end to the 3' end, one or more nucleotides at positions 2, 6, 8, 9, 14, and 16 of the siRNA antisense strand are fluorinated, and one or more nucleotides at positions 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 of the siRNA sense strand are 2'-O-methyl modified.
[0314] (3) In the direction from the 5' end to the 3' end, one or more nucleotides at positions 7, 9, 10, and 11 of the siRNA's positive strand are fluorinated; one or more nucleotides at positions 1, 2, 3, 4, 5, 6, 8, 12, 13, 14, 15, 16, 17, 18, 19, 20, and 21 are 2'-O-methyl; and one or more positions between positions 1 and 2, between positions 2 and 3, between positions 19 and 20, and between positions 20 and 21 are thiophosphate modified; and The siRNA antisense strand has one or more nucleotides at positions 2, 6, 8, 9, 14, and 16 fluorinated, one or more nucleotides at positions 1, 3, 4, 5, 7, 10, 11, 12, 13, 15, 17, 18, 19, 20, 21, 22, and 23 2'-O-methyl, and one or more phosphate thioesters at positions between positions 1 and 2, between positions 2 and 3, between positions 21 and 22, and between positions 22 and 23.
[0315] In this application, the modification of the ASO can be as follows: one or more nucleotides at positions 6, 7, 8, 9, 10, 11, 12, 13, 14, and 15 of the ASO are modified with 2' deoxyribose, one or more nucleotides at positions 1, 2, 3, 4, 5, 16, 17, 18, 19, and 20 are modified with 2'-methoxyethyl, and modifications are made between positions 1 and 2, between positions 2 and 3, and between positions 3... Thiophosphate modification exists at one or more positions between position 4, between positions 4 and 5, between positions 5 and 6, between positions 6 and 7, between positions 7 and 8, between positions 8 and 9, between positions 9 and 10, between positions 11 and 12, between positions 12 and 13, between positions 13 and 14, between positions 14 and 15, between positions 15 and 16, between positions 16 and 17, between positions 17 and 18, between positions 18 and 19, and between positions 19 and 20.
[0316] Indications
[0317] On the other hand, the pharmaceutical compositions provided in this application can treat diseases including any disease related to cardiomyocytes. For example, the disease may be related to or caused by abnormal expression of cardiomyocyte genes. In this application, the disease may be primary cardiomyopathy, secondary cardiomyopathy, ion channelopathies, metabolic cardiomyopathy, developmental abnormality-related diseases, and acquired gene expression abnormalities.
[0318] In this application, the primary cardiomyopathy includes, but is not limited to, dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, and arrhythmogenic right ventricular cardiomyopathy.
[0319] In this application, the secondary cardiomyopathy includes, but is not limited to, ischemic cardiomyopathy, metabolic cardiomyopathy, inflammatory cardiomyopathy, and stress cardiomyopathy.
[0320] In this application, the ion channelopathies include, but are not limited to, long QT syndrome (LQTS), Brugada syndrome, and catecholamine-sensitive polymorphic ventricular tachycardia (CPVT).
[0321] In this application, the metabolic heart disease includes, but is not limited to, mitochondrial cardiomyopathy, glycogen storage diseases (such as Danon's disease), and Fabry's disease.
[0322] In this application, the developmental abnormality-related diseases include, but are not limited to, left ventricular noncompaction (LVNC) and Noonan syndrome with cardiomyopathy.
[0323] In this application, the acquired gene expression disorders include, but are not limited to, stress cardiomyopathy (Takotsubo syndrome) and diabetic cardiomyopathy.
[0324] In this application, the disease may be related to abnormal expression of the PLN and NPPA genes.
[0325] In this application, the diseases described include cardiomyopathy, rare cardiac diseases, myocardial ischemia-reperfusion injury, heart failure, coronary artery disease, myocardial infarction, myocarditis, atherosclerosis, arrhythmia, intermittent hypoxia-related myocardial injury, cardiac ion channel-related diseases, hypertensive heart disease, atrial fibrillation, myocardial hypertrophy and fibrosis, acute coronary syndrome, hereditary glycogen storage disease, PRKAG2 cardiac syndrome, and idiopathic ventricular fibrillation (IVF).
[0326] In this application, the cardiomyopathy includes dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, hypoxic-ischemic cardiomyopathy, valvular cardiomyopathy, hypertensive cardiomyopathy, metabolic cardiomyopathy, endocrine cardiomyopathy, alcoholic cardiomyopathy, perinatal cardiomyopathy, drug-induced cardiomyopathy, hereditary cardiomyopathy, Keshan disease, arrhythmogenic cardiomyopathy, and arrhythmogenic right ventricular cardiomyopathy-like phenotype.
[0327] In this application, the heart failure includes new-onset heart failure, acute heart failure, chronic heart failure, acute decompensated heart failure, left heart failure, right heart failure, dual heart failure, systolic dysfunction heart failure, diastolic dysfunction heart failure, systolic and diastolic dysfunction heart failure, high-output heart failure, and restrictive-filling heart failure.
[0328] In this application, the myocardial infarction includes primary acute myocardial infarction, secondary acute myocardial infarction, PCI-related myocardial infarction, and coronary artery bypass grafting-related acute myocardial infarction.
[0329] In this application, the arrhythmias include: excessively fast heart rate: sinus tachycardia, atrial tachycardia, atrial flutter, junctional tachycardia, atrial flutter, supraventricular tachycardia, ventricular tachycardia, etc.; excessively slow heart rate: sinus arrest, sinus bradycardia, atrioventricular block, etc.; and irregular heart rate: premature atrial contractions, atrial fibrillation, sick sinus syndrome, junctional premature beats, premature ventricular contractions, ventricular fibrillation, etc.
[0330] In this application, the coronary heart disease includes asymptomatic myocardial ischemia, angina pectoris, myocardial infarction, and ischemic cardiomyopathy; among which, angina pectoris includes exertional angina pectoris, spontaneous angina pectoris, and mixed angina pectoris.
[0331] In this application, the rare cardiac diseases include Brugada syndrome, left ventricular noncompaction (LVNSC), idiopathic pulmonary hypertension (IPAH), and transthyretin amyloid cardiomyopathy.
[0332] In this application, the cardiac ion channel-related diseases include long QT syndrome, short QT syndrome, BrS syndrome, and catecholamine-sensitive polymorphic ventricular tachycardia (CPVT).
[0333] In this application, the disease has one or more of the following clinical manifestations: ventricular dilatation with systolic dysfunction (reduced ejection fraction), abnormal thickening of the ventricular wall (often involving the interventricular septum), limited diastolic function, ventricular stiffness leading to diastolic dysfunction, replacement of right ventricular myocardium with fibrofatty tissue, and myocardial ischemia and necrosis due to coronary artery disease, myocardial hypertrophy, and myocardial fibrosis.
[0334] In this application, when treating the aforementioned disease, suitable dosage levels are approximately 0.001 mg / kg to approximately 100 mg / kg per day, approximately 0.01 mg / kg to approximately 75 mg / kg per day, approximately 0.1 mg / kg to approximately 50 mg / kg per day, approximately 0.5 mg / kg to approximately 25 mg / kg per day, or approximately 1 mg / kg to approximately 20 mg / kg per day, which may be administered as a single dose or in multiple doses. For example, approximately 0.005 mg / kg to approximately 0.05 mg / kg, approximately 0.05 mg / kg to approximately 0.5 mg / kg, approximately 0.5 mg / kg to approximately 5.0 mg / kg, approximately 1 mg / kg to approximately 15 mg / kg, approximately 1 mg / kg to approximately 20 mg / kg, approximately 1 mg / kg to approximately 20 mg / kg, or approximately 1 mg / kg to approximately 50 mg / kg per day.
[0335] Pharmaceutical Composition
[0336] On the other hand, this application provides a pharmaceutical composition that can be applied to patients suffering from the above-mentioned indications.
[0337] In this application, the pharmaceutical composition includes a pharmaceutically acceptable excipient. The excipient may include sugars (e.g., lactose, mannitol), milk protein, gelatin, starch, vitamins, cellulose and its derivatives, polyethylene glycol, and the pH and exact concentration of the various components of the pharmaceutical composition may be adjusted according to conventional practice in the art.
[0338] In this application, the route of administration of the pharmaceutical composition may be selected from: intravenous administration, subcutaneous administration, intrathecal injection, intramuscular administration, transdermal administration, airway administration (aerosol), ocular administration, nasal administration, rectal administration, pulmonary administration, and local administration (including oral administration and sublingual administration). Preferably, the route of administration of the pharmaceutical composition may be intravenous administration.
[0339] The embodiments described below are not intended to be limited by any theory, but are merely for illustrating the fusion protein, preparation method and use of this application, and are not intended to limit the scope of the invention.
[0340] Example
[0341] Example 1: CD36 Tissue Distribution Experiment
[0342] TfR1 (transferrin receptor 1), also known as CD71, is a transmembrane glycoprotein whose main function is to mediate the entry of transferrin-bound iron ions into cells via receptor-mediated endocytosis. It is often used as a target for drug delivery to cardiac tissues. To demonstrate the tissue distribution of CD36, this experiment detected and compared the expression of CD36 and TfR1 in different mouse tissues.
[0343] 1.1 Experimental Procedure
[0344] (1) TfR1 tissue distribution experiment
[0345] Wild-type male mice (C57BL / 6) were selected, and tissues from the gastrocnemius, soleus, triceps, quadriceps femoris, diaphragm, heart, brown adipose tissue (BAT), epididymal white adipose tissue (eWAT), subcutaneous white adipose tissue (iWAT), liver, kidney, lung, intestines, artery, vein, cortex, cerebellum, and hippocampus were collected. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0346] (2) CD36 tissue distribution experiment
[0347] Wild-type male mice (C57BL / 6) were selected, and the following tissues were collected: gastrocnemius muscle, triceps brachii muscle, BAT, eWAT, iWAT, heart, liver, kidney, lung, brain, artery, and vein. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0348] 1.2 Results Analysis
[0349] (1) Use the software of the 7500 real-time fluorescence quantitative PCR instrument (Thermo Fisher) to automatically calculate the Ct value;
[0350] (2) Calculate the relative expression level of the gene using the following formula:
[0351] ΔCt1=Ct(SOD1 of the drug-treated group)–Ct(ACTIN of the drug-treated group)
[0352] ΔCt2=Ct(SOD1 in PBS group)–Ct(ACTIN in PBS group)
[0353] ΔCt = ΔCt1 (drug administration group) - ΔCt2 (PBS group),
[0354] mRNA expression relative to the PBS group = 2 -ΔΔCt
[0355] (3) Statistical analysis
[0356] Use appropriate tests, such as one-way ANOVA and multiple t-tests, to analyze the statistical significance of the data. Mark p < 0.05 as *; p < 0.01 as **; p < 0.001 as ***.
[0357] 1.3 Experimental Results
[0358] As shown in Figures 2-3, TfR1 has a wide tissue distribution, while CD36 exhibits high tissue specificity, with significantly higher expression levels in cardiac and adipose tissues compared to other tissues. These results indicate that CD36 possesses the potential to serve as a candidate target for tissue / cell-specific delivery.
[0359] Example 2: Preparation and affinity study of ligands targeting CD36
[0360] 2.1 Preparation of traditional antibodies targeting CD36
[0361] The nucleotide conjugate comprises two parts: a ligand targeting CD36 and a nucleic acid molecule. The CD36-targeting ligand can be an anti-CD36 antibody (hereinafter referred to as aCD36), and the preparation process of the antibody is as follows.
[0362] 2.1.1 Experimental Materials
[0363] The commercial experimental materials used in the experiment (including but not limited to instruments, reagents, animals, reagent kits, etc.) are shown in Table 1.
[0364] Table 1 Experimental Materials
[0365] 2.1.2 Experimental Procedure
[0366] Using the antibody sequences in the patents (YJ117E reference CN119095872A; ONA references WO2023007472A1, CN115768465A and CN118488964A; TfR1 references CN113508136A), the antibody sequences were cloned into human IgG heavy chain vectors and human kappa light chain vectors, respectively, and then purified by transient transfection expression in HEK293 cells to obtain the following full-length antibodies.
[0367] 2.1.3 Experimental Results
[0368] This embodiment prepares exemplary anti-CD36 antibodies: YJ117E and ONA; and an anti-TfR1 antibody: TfR1. The specific sequences are shown in Table 2.
[0369] Table 2 Antibody Sequences
[0370] 2.2 Preparation of CD36-targeting cytoskeletal / structural proteins
[0371] 2.2.1 Experimental Procedure
[0372] The ligand targeting CD36 can be a cytoskeletal protein that can bind to CD36, and the preparation process is as follows.
[0373] The FN3 structural protein was obtained through multiple rounds of screening using a constructed ribosome display library to identify cDNA fragments with high affinity for the hCD36 antigen. These fragments were then amplified by PCR and constructed into a pET vector. The gene sequence encoding the N-terminal His tag was added to the structural protein gene sequence, and a cysteine coupling site (position 54) was introduced into the protein. The vector carrying the structural protein gene was transformed into BL21(DE3) bacteria for induced expression, followed by purification using a nickel column to obtain the FN3 structural protein with high affinity for the hCD36 antigen. The sequence of the backbone protein is shown in SEQ ID NO:47.
[0374] 2.3 Preparation of CD36-targeting scFv
[0375] 2.3.1 Experimental Procedure
[0376] The VH and VL fragments of the CD36 antibody were linked together using three flexible GGGS links. The N-terminus or C-terminus of the protein was linked to a His tag using a flexible GGGS link, with a cysteine coupling site (SEQ ID NO:46) added between the flexible GGGS links. The protein gene sequence was then constructed into a eukaryotic expression vector. Expression was performed by transfection into HEK293 cells, and the CD36-binding scFv was obtained after nickel column purification. The sequence of the scFv is shown in SEQ ID NO:45.
[0377] 2.4 Preparation of Fab Targeting CD36
[0378] 2.4.1 Experimental Procedure
[0379] The light chain (VL and CL), heavy chain (VH), and CH1 protein sequences of a CD36 antibody (any antibody prepared in this example) were designed, and a cysteine coupling site was added to the C-terminus of CH1. The protein gene sequence was then constructed into a eukaryotic expression vector. The constructed expression vector and the CD36 antibody light chain expression vector were co-transfected into HEK293 cells for expression. The CD36-binding Fab protein was obtained by purification using a protein L chromatography column.
[0380] 2.5 Preparation of heavy chain antibody (HcAb) targeting CD36
[0381] 2.5.1 Experimental Procedure
[0382] The protein sequence was obtained by linking the 1E5 variable region sequence from patent CN118725117A with the hinge region and CH2CH3 of IgG1, and the protein gene sequence was constructed into a eukaryotic expression vector. This vector was transfected into HEK293 cells for expression, and the protein was purified using a protein A chromatography column to obtain the 1E5 HcAb protein. The sequences of CDR1, CDR2, and CDR3 of the heavy chain antibody are shown in SEQ ID NO:40, SEQ ID NO:41, and SEQ ID NO:42, respectively, and the full-length sequence of the heavy chain antibody is shown in SEQ ID NO:43.
[0383] 2.6 Affinity study of CD36 ligands
[0384] 2.6.1 Enzyme-linked immunosorbent assay (ELISA) to verify the affinity of traditional antibodies
[0385] To verify that the anti-CD36 antibody prepared in this application can bind to CD36 in vivo, the ECGs of YJ117E and ONA were detected by ELISA. 50 The value of .
[0386] 2.6.1.1 Experimental Procedure
[0387] Recombinant His-tagged human CD36.ECD protein, His-tagged cynomolgus monkey CD36.ECD protein, or His-tagged mouse CD36.ECD protein (purchased from Sino Biological) were immobilized at a concentration of 1 μg / mL in coating solution (SeraCare) on 96-well microtiter plates and incubated overnight at 4°C. The wells were washed with washing buffer (0.05% Tween 20 in PBS) and blocked with 1% BSA in PBS. Serial dilutions of YJ117E and ONA (anti-CD36 antibody) were added to the wells. After incubation at 37°C for 1 hour, the wells were washed with washing buffer. Peroxidase-conjugated goat anti-human kappa light chain antibody (Sigma) was applied to each well and incubated at 37°C for 1 hour. After washing, the wells were developed with TMB substrate at room temperature for 5–10 minutes, then terminated with 1N HCl. The absorbance was then measured at 450 nm. The EC50 value was calculated using statistical analysis software.
[0388] 2.6.1.2 Experimental Results
[0389] Figure 4 shows ELISA data of the binding of full-length IgG anti-CD36 antibodies (YJ117E and ONA) to human CD36.ECD (hCD36), cynomolgus monkey CD36.ECD (CynoCD36), or mouse CD36.ECD (mCD36), demonstrating high affinity for human, mouse, and monkey CD36.
[0390] 2.6.2 Surface plasmon resonance (SPR) verification of the affinity of conventional antibodies
[0391] Biacore is a commonly used method for molecular interaction analysis based on the principle of optical surface plasmon resonance (SPR). SPR is an optical phenomenon in which a metal film approximately 50 nm thick is placed at the interface of a sensor chip where total internal reflection occurs. When polarized light is incident on one end of a prism, a plasma wave is generated at the interface between the prism and the metal film. When the propagation constant of the incident light wave matches the propagation constant of the surface plasmon wave, the free electrons in the metal film resonate, forming a surface plasmon resonator.
[0392] First, a molecule, i.e., a ligand, is immobilized onto the surface of the biosensor. In this experiment, an antigen molecule is first immobilized, and then a solution containing another biomolecule that can interact with the target molecule is injected and flows through the surface of the biosensor. In this experiment, the target molecule is the antibody corresponding to the immobilized antigen. The binding between biomolecules increases the surface mass of the biosensor, leading to a change in refractive index. By monitoring the change in the SPR angle, parameters such as the kinetic binding and dissociation constants, affinity, and specificity of the analyte can be automatically obtained, thereby characterizing the affinity.
[0393] Affinity, reflected by the dissociation equilibrium constant (KD), is a parameter describing the binding strength between a ligand and an analyte molecule. For biopharmaceutical development, affinity is one of the key functional attributes for determining efficacy and provides a basis for the development of novel antibody drugs. Kinetic parameters, namely the binding rate (ka) and dissociation rate (kd) between the analyte and ligand, are also important parameters for characterizing molecular binding.
[0394] To investigate the entire process of binding and dissociation between the anti-CD36 antibody prepared in this application and CD36, the binding / dissociation of YJ117E and CD36 from different species was detected by SPR.
[0395] 2.6.2.1 Experimental Procedure
[0396] On the Biacore 1K biosensor equipped with a pre-immobilized Protein A sensor chip, SPR was used to determine the binding affinity of the prepared anti-C36 antibody to His-tagged human CD36 (hCD36-His, ACROBiosystems, Cat#:CD6-H5221), cynomolgus monkey CD36 (CynoCD36-His, ACROBiosystems, Cat#:CD6-C52H8), and mouse CD36 (mCD36-His, ACROBiosystems, Cat#:CD6-C52H8).
[0397] Purified anti-CD36 antibody was captured and detected using a Protein A chip (Cytiva, catalog number: 29127556). 1 μg / mL of purified anti-CD36 antibody was loaded at a rate of 10 μL / min to bind hCD36-His, CynoCD36-His, and mCD36-His (200 nM). The flow rate was 30 μL / min. Binding and dissociation times were set to 180 seconds and 600 seconds, respectively. After the last injection of each titration, the chip was regenerated with glycine solution (pH 2.0) at a rate of 30 μL / min for 30 seconds under the following regeneration conditions: Glycine (pH approximately 1.5, Cytiva, catalog number: BR100354).
[0398] The affinity test data were analyzed using Biacore Insight Evaluation Software based on the SPR principle, employing a 1:1 binding mode and Fit Local Kinetics mode.
[0399] 2.6.2.2 Experimental Results
[0400] As shown in Figures 5-7 and Table 3, the results indicate that this conventional antibody meets the requirements of the AOC drug delivery system for antigen-antibody affinity.
[0401] Table 3 Results of conventional antibody SPR experiments
[0402] Note: ka represents the binding rate constant, kd represents the dissociation rate constant, and KD represents the equilibrium dissociation constant.
[0403] 2.6.3 SPR verification of the affinity of Fab, scFv and HcAb
[0404] 2.6.3.1 Experimental Procedure
[0405] (1)Fab
[0406] On a Biacore 1K biosensor equipped with a pre-immobilized Human Fab Binder sensor chip, SPR was used to determine the binding affinity of the prepared anti-CD36 antibody to the His-tagged human CD36 (hCD36-His, ACROBiosystems, Cat#:CD6-H5221). The purified YJ117E-Fab antibody was captured using a Human Fab Capture Kit (Cytiva, catalog number: 10350177) for detection. 1 μg / mL of purified anti-CD36 antibody was loaded at a rate of 10 μL / min to bind hCD36-His. The flow rate was 30 μL / min. The binding and dissociation times were set to 180 seconds and 600 seconds, respectively.
[0407] (2)scFv
[0408] The binding affinity of the prepared anti-CD36 antibody to Fc-labeled human CD36 (hCD36-Fc, ACROBiosystems, Cat#:CD6-H5258) was determined using SPR on a Biacore 1K biosensor equipped with a pre-immobilized anti-histidine antibody sensor chip. Purified YJ117E-scFv antibody was captured using a His Capture Kit (Cytiva, catalog number: 10365471) for detection. 1 μg / mL of purified anti-CD36 antibody was loaded at a rate of 10 μL / min to bind hCD36-His. The flow rate was 30 μL / min. The binding and dissociation times were set to 180 seconds and 600 seconds, respectively.
[0409] (3) 1E5-HcAb
[0410] The binding affinity of the prepared anti-C36 antibody to the His-tagged human CD36 (hCD36-His, ACROBiosystems, Cat#:CD6-H5221) was determined using SPR on the Biacore 1K biosensor equipped with a pre-immobilized Protein A sensor chip. Purified 1E5-HcAb antibody was captured using a Protein A chip (Cytiva, catalog number 29127556) for detection. 1 μg / mL of purified anti-CD36 antibody was loaded at a rate of 10 μL / min to bind hCD36-His. The flow rate was 30 μL / min. The binding and dissociation times were set to 180 seconds and 600 seconds, respectively.
[0411] 2.6.3.2 Experimental Results
[0412] As shown in Figures 8-10 and Table 4, the Fab, scFv, and HcAb meet the antigen-antibody affinity requirements of the AOC drug delivery system.
[0413] Table 4. Experimental results of Fab, scFv, and HcAb SPR Note: ka represents the binding rate constant, kd represents the dissociation rate constant, and KD represents the equilibrium dissociation constant.
[0414] Example 3: Preparation of ligand-nucleic acid conjugates
[0415] 3.1 Preparation of aCD36-Cys-siRNA conjugates by cysteine non-site-specific coupling method
[0416] 3.1.1 Experimental Procedure
[0417] 3.1.1.1 Synthesis of SMCC-C7-siRNA
[0418] siRNA-C7-NH2 was synthesized according to a standard oligonucleotide solid-phase synthesis protocol. The siRNA sequence is shown in Table 5.
[0419] All siRNA single-stranded RNAs were synthesized using standard phosphoramidite chemistry on a solid-phase synthesizer and purified by HPLC. The purified AS and SS single strands were annealed to obtain double-stranded siRNAs. All siRNA SS strands contained a C7-NH2 conjugate linker at their 3' or 5' end.
[0420] 1.0 equivalent of siRNA-C7-NH2 was dissolved in pH 7.4 PBS, and 10 equivalents of SMCC (14 mM, acetonitrile) were added. The mixture was reacted overnight at 25°C. After the reaction was completed, it was concentrated by rotary evaporation and then buffered with pure water (3 kDa MWCO Amicon). The concentration was determined by NanoDrop. The resulting SMCC-C7-siRNA product (as shown in Reaction 1) can be directly used for the next step of antibody conjugation.
[0421] Table 5 siRNA sequence listing Note: YG-SOD1 targets the SOD1 gene, and siSOD1 is a modified YG-SOD1. YG-PPIB targets the PPIB gene, and siPPIB is a modified YG-PPIB. (Ns)(N') indicates that there is a thiophosphate modification between the two nucleotides N and N', where N and N' are selected from A, T, C, U, and G, respectively. For example, (Us)(G) indicates that there is a thiophosphate modification between the phosphodiester bond of U and G; (mN) indicates that nucleotide N has a 2'-O-methyl modification, where N is selected from A, T, C, U, and G; (fN) indicates that nucleotide N has a fluorinated modification, where N is selected from A, T, C, U, and G.
[0422] 3.1.1.2 Synthesis of aCD36-Cys-siRNA conjugates coupled with antibody cysteine
[0423] (1) Reduce the interchain disulfide bonds of the antibody with TCEP.
[0424] The antibody was buffer-exchanged using 25 mM borate buffer (pH 8) to achieve a concentration of 5–10 mg / mL.
[0425] Add 4 equivalents of TCEP aqueous solution to the solution, mix well, place on a rotary mixer, and react at room temperature for 3 hours to reduce the disulfide bonds between antibody chains.
[0426] (2) Antibody conjugation
[0427] To the mixture resulting from the reduction reaction, add 1.5 equivalents of SMCC-C7-siRNA, mix immediately and thoroughly, and place on a rotary mixer for coupling. React at room temperature for 1 hour. Monitor the degree of coupling reaction by analyzing the reaction mixture using analytical AEX-HPLC. After the coupling reaction is complete, add 5 equivalents of L-cysteine aqueous solution to quench the reaction. Quench the reaction at room temperature for 20 minutes to remove unreacted SMCC-C7-siRNA.
[0428] (3) Product purification
[0429] The crude product mixture from the coupling reaction was purified using anion exchange chromatography (RESOURCE Q) via AKTAexplorer FPLC. The purification process employed Buffer A (50 mM Tris-HCl, pH 7.5) and Buffer B (50 mM Tris-HCl, pH 7.5, 1.0 M NaCl). Specifically, the RESOURCE Q column was equilibrated with 10 CV of Buffer A (50 mM Tris-HCl, pH 7.5), followed by sample loading, washing with 10 CV of Buffer A, and gradient elution (1 mL / min, 30 min, 0-100% Buffer B) to separate and collect fractions containing the CD36 antibody-Cys-SMCC-siRNA conjugates of DAR1 and DAR2. These fractions were then concentrated by ultrafiltration (30 kDa MWCO Amicon) and buffer-exchanged with pH 7.4 PBS (10 CV exchange volume).
[0430] (4) Analysis of CD36 antibody-Cys-siRNA conjugate
[0431] The characterization and purity of the isolated aCD36-Cys-siRNA conjugates were evaluated by analytical HPLC using anion exchange chromatography and SEC methods.
[0432] 3.1.2 Experimental Results
[0433] As shown in Figures 11-14, CD36 antibody-Cys-siRNA conjugates (hereinafter referred to as aCD36-Cys-siSOD1) can be successfully prepared using the antibody-cysteine conjugate method described above. Furthermore, by controlling and optimizing the feed ratio, CD36 antibody-Cys-siRNA conjugates with DAR1 or DAR2 as the main products (hereinafter referred to as aCD36-Cys-siSOD1DAR1 and aCD36-Cys-siSOD1DAR2) can be prepared, with stable yields between batches.
[0434] 3.2 Preparation of aCD36-Glyco-siRNA conjugates by site-specific glycosylation conjugation
[0435] 3.2.1 Experimental Procedure
[0436] 3.2.1.1 Glycosyl azidation modification of antibodies
[0437] The glycosidic bond between the two innermost N-acetylglucosamines of the N297 glycan chain of the antibody is cleaved by Endo S2 enzyme, and then the azide-modified disaccharide oxazoline is transferred to the core N-acetylglucosamine to generate an antibody carrying an azide active group linker, as detailed in CN114949236B.
[0438] 3.2.1.2 Preparation of monovalent small nucleic acid AOC (aCD36-Glyco-Mono-siRNA conjugate)
[0439] (1) Synthesis of DBCO-C7-Mono-siRNA
[0440] The synthesis method of Mono-siRNA-C7-NH2 is described in 3.1.1.1, and the siRNA sequence is shown in Table 5.
[0441] 1.0 equivalent of Mono-siRNA-C7-NH2 was dissolved in pH 7.4 PBS, and 10 equivalents of DBCO-NHS ester (14 mM, acetonitrile) were added. The mixture was reacted overnight at 25°C. After the reaction was completed, it was concentrated by rotary evaporation and then buffered with pure water (3 kDa MWCO Amicon). The concentration was determined by NanoDrop. The resulting DBCO-C7-Mono-siRNA product (reaction 2 below) can be directly used for the next step of antibody conjugation.
[0442] (2) Antibody glycosylation site-directed conjugation
[0443] To the antibody carrying the azide-active linker, 1.5 equivalents of DBCO-C7-Mono-siRNA were added, mixed thoroughly, and coupled using a rotary mixer at 37°C for 3 hours. The degree of coupling reaction was monitored by analytical AEX-HPLC. After the coupling reaction was complete, the mixture was separated and purified.
[0444] (3) Product purification
[0445] The crude product mixture of the coupling reaction was purified using anion exchange chromatography (RESOURCE Q) via AKTA explorer FPLC. The purification process used Buffer A (50mM Tris-HCl, pH 7.5) and Buffer B (50mM Tris-HCl, pH 7.5, 1.0M NaCl). Specifically, the RESOURCE Q column was equilibrated with 10 CV of Buffer A (50mM Tris-HCl, pH 7.5), then loaded with the sample. The column was then washed with 10 CV of Buffer A, followed by gradient elution (1 mL / min, 30 min, 0-100% Buffer B) to separate and collect fractions containing DAR1 and DAR2 CD36 antibody-Glyco-Mono-siRNA conjugates (hereinafter referred to as aCD36-Glyco-Mono-siSOD1 DAR1 and aCD36-Glyco-Mono-siSOD1DAR2). The fractions were concentrated by ultrafiltration (30 kDa MWCO Amicon) and buffer exchanged with pH 7.4 PBS (10 CV exchange volume).
[0446] 3.2.1.3 Preparation of bivalent small nucleic acid AOC (aCD36-Glyco-Di-siRNA conjugate)
[0447] (1) Synthesis of DBCO-C7-Di-siRNA
[0448] The synthesis method of Di-siRNA-C7-NH2 is described in 3.1.1.
[0449] Di-siRNA consists of two siRNAs linked by a spacer. In this experiment, the spacer was three deoxythymidine nucleotides (dTdTdT).
[0450] 1.0 equivalent of Di-siRNA-C7-NH2 was dissolved in pH 7.4 PBS, and 10 equivalents of DBCO-NHS ester (14 mM, acetonitrile) were added. The mixture was reacted overnight at 25°C. After the reaction was completed, it was concentrated by rotary evaporation and then buffered with pure water (3 kDa MWCO Amicon). The concentration was determined by NanoDrop. The obtained DBCO-C7-Di-siRNA product can be directly used for the next step of antibody conjugation (see reaction 3 below).
[0451] (2) Antibody glycosylation site-directed conjugation
[0452] 1.5 equivalents of DBCO-C7-Di-siRNA were added to the antibody carrying the azide-active linker, mixed thoroughly, and then coupled using a rotary mixer at 37°C for 3 hours. The degree of coupling reaction was monitored by analytical AEX-HPLC. After the coupling reaction was completed, the mixture was separated and purified.
[0453] (3) Product purification
[0454] The crude product mixture from the coupling reaction was purified using anion exchange chromatography (RESOURCE Q) via AKTA explorer FPLC. The purification process employed Buffer A (50 mM Tris-HCl, pH 7.5) and Buffer B (50 mM Tris-HCl, pH 7.5, 1.0 M NaCl). Specifically, the RESOURCE Q column was equilibrated with 10 CV of Buffer A (50 mM Tris-HCl, pH 7.5), followed by sample loading, washing with 10 CV of Buffer A, and gradient elution (1 mL / min, 30 min, 0-100% Buffer B) to separate and collect fractions containing the aCD36-Glyco-Di-siRNA conjugates of DAR1 and DAR2. These fractions were then concentrated by ultrafiltration (30 kDa MWCO Amicon) and buffer-exchanged with pH 7.4 PBS (10 CV exchange volume).
[0455] 3.2.2 Experimental Results
[0456] The results (Figures 15-21) show that the antibody-glycosylated site-directed siRNA conjugation process of this embodiment can complete the preparation of CD36 antibody-Glyco-siRNA conjugates (hereinafter referred to as: aCD36-Glyco-siSOD1). Simultaneously, by controlling and optimizing the antibody and small nucleic acid feed ratio, site-directed conjugation of disaccharidated antibodies can be achieved to prepare CD36 antibody-Glyco-siRNA conjugates of DAR1 or DAR2 (hereinafter referred to as: aCD36-Glyco-Di-siSOD1 DAR1 and aCD36-Glyco-Di-siSOD1 DAR2), with an overall yield >70%.
[0457] 3.3 Preparation of aCD36-Cys-ASO conjugates by non-site-specific coupling of cysteine
[0458] 3.3.1 Experimental Procedure
[0459] 3.3.1.1 Synthesis of SMCC-C7-ASO
[0460] ASO-C7-NH2 was synthesized according to a standard oligonucleotide solid-phase synthesis protocol. The ASO sequence is shown in Table 6.
[0461] All ASOs were synthesized on a solid-phase synthesizer using standard phosphoramide chemistry and purified by HPLC. All ASOs contained a C7-NH2 conjugate linker at the 3' or 5' end of their chains.
[0462] 1.0 equivalent of ASO-C7-NH2 was dissolved in pH 7.4 PBS, and 10 equivalents of SMCC (14 mM, acetonitrile) were added. The mixture was reacted overnight at 25°C. After the reaction was completed, it was concentrated by rotary evaporation and then buffered with pure water (3 kDa MWCO Amicon). The concentration was determined by NanoDrop. The resulting SMCC-C7-ASO product (reaction 4 below) can be directly used for the next step of antibody conjugation.
[0463] Table 6 ASO Sequence List Note: SOD1-ASO targets the SOD1 gene, and mSOD1-ASO is a modified SOD1-ASO. (eN) indicates that nucleotide N is modified with 2'-methoxyethyl (2'-MOE), and N is selected from A, T, C, U, and G; (Ns)(N') indicates that there is a phosphate thioester modification between the two nucleotides N and N', and N and N' are selected from A, T, C, U, and G, respectively. For example, (Us)(G) indicates that the phosphodiester bond between U and G is modified with phosphate thioester; (dN) indicates that nucleotide N is modified with 2'-deoxyribose, and N is selected from A, T, C, U, and G. The ASO sequence used in this experiment is mSOD1-ASO.
[0464] 3.3.1.2 Synthesis of aCD36-Cys-ASO conjugate coupled with antibody cysteine
[0465] (1) Reduce the interchain disulfide bonds of the antibody with TCEP.
[0466] The antibody was buffer-exchanged using 25 mM borate buffer (pH 8) to achieve a concentration of 5–10 mg / mL.
[0467] Add 4 equivalents of TCEP aqueous solution to the solution, mix well, place on a rotary mixer, and react at room temperature for 3 hours to reduce the disulfide bonds between antibody chains.
[0468] (2) Antibody conjugation
[0469] To the mixture obtained after the reduction reaction, add 3 equivalents of SMCC-C7-ASO, mix immediately and thoroughly, and place on a rotary mixer for coupling. React at room temperature for 1 hour. Monitor the degree of coupling reaction by analyzing the reaction mixture using analytical AEX-HPLC. After the coupling reaction is complete, add 5 equivalents of L-cysteine aqueous solution to quench the reaction. Quench the reaction at room temperature for 20 minutes to remove unreacted SMCC-C7-ASO.
[0470] (3) Product purification
[0471] The crude product mixture from the coupling reaction was purified using anion exchange chromatography (RESOURCE Q) via AKTA explorer FPLC. The purification process employed Buffer A (50 mM Tris-HCl, pH 7.5) and Buffer B (50 mM Tris-HCl, pH 7.5, 1.0 M NaCl). Specifically, the RESOURCE Q column was equilibrated with 10 CV of Buffer A (50 mM Tris-HCl, pH 7.5), followed by sample loading, washing with 10 CV of Buffer A, and gradient elution (1 mL / min, 30 min, 0-100% Buffer B) to separate and collect fractions containing the aCD36-Cys-ASO conjugates of DAR1 and DAR2. These fractions were then concentrated by ultrafiltration (30 kDa MWCO Amicon) and buffer-exchanged with pH 7.4 PBS (10 CV exchange volume).
[0472] 3.3.2 Experimental Results
[0473] Analysis of aCD36-Cys-ASO conjugates. The characterization and purity of the separated aCD36-Cys-ASO conjugates were evaluated by analytical HPLC using anion exchange chromatography and SEC methods (Figures 22-24).
[0474] The results (Figures 22-24) show that CD36 antibody-Cys-ASO conjugates (hereinafter referred to as aCD36-Cys-ASO) can be successfully prepared by the above-mentioned antibody-cysteine conjugate method. Furthermore, by controlling and optimizing the feed ratio, CD36 antibody-Cys-ASO conjugates with DAR1 or DAR2 as the main products (hereinafter referred to as aCD36-Cys-ASO DAR1 and aCD36-Cys-ASO DAR2) can be prepared, and stable yields can be achieved between batches.
[0475] 3.4 Preparation of aCD36-Glyco-ASO conjugates by site-directed glycosyl coupling method
[0476] 3.4.1 Experimental Procedure
[0477] For antibody glycosyl azidation modification, refer to 3.2.1.1.
[0478] (1) Synthesis of DBCO-C7-ASO
[0479] ASO-C7-NH2 was synthesized according to the standard oligonucleotide solid-phase synthesis protocol, as described in section 3.3.1.1. The ASO sequence is shown in Table 6.
[0480] 1.0 equivalent of ASO-C7-NH2 was dissolved in pH 7.4 PBS, and 10 equivalents of DBCO-NHS ester (14 mM, acetonitrile) were added. The mixture was reacted overnight at 25°C. After the reaction was completed, it was concentrated by rotary evaporation and then buffered with pure water (3 kDa MWCO Amicon). The concentration was determined by NanoDrop. The resulting DBCO-C7-ASO product (reaction 5 below) can be directly used for the next step of antibody conjugation.
[0481] (2) Synthesis of aCD36-Glyco-ASO conjugate by site-directed coupling of antibody glycosyl groups
[0482] Three equivalents of DBCO-C7-Mono-ASO were added to the antibody carrying the azide-active linker, mixed thoroughly, and then coupled using a rotary mixer at 37°C for 3 hours. The degree of coupling reaction was monitored by analytical AEX-HPLC. After the coupling reaction was completed, the mixture was separated and purified.
[0483] (3) Product purification
[0484] The crude product mixture from the coupling reaction was purified using anion exchange chromatography (RESOURCE Q) via AKTA explorer FPLC. The purification process employed Buffer A (50 mM Tris-HCl, pH 7.5) and Buffer B (50 mM Tris-HCl, pH 7.5, 1.0 M NaCl). Specifically, the RESOURCE Q column was equilibrated with 10 CV of Buffer A (50 mM Tris-HCl, pH 7.5), followed by sample loading, washing with 10 CV of Buffer A, and gradient elution (1 mL / min, 30 min, 0-100% Buffer B) to separate and collect fractions containing the CD36 antibody-Glyco-ASO conjugates of DAR1 and DAR2. These fractions were then concentrated by ultrafiltration (30 kDa MWCO Amicon) and buffer-exchanged with pH 7.4 PBS (10 CV exchange volume).
[0485] 3.4.2 Experimental Results
[0486] The results (Figures 25-27) demonstrate that the antibody-glycosylated site-directed ASO conjugation process disclosed in this paper can complete the preparation of AOC (hereinafter referred to as: aCD36-Glyco-ASO). Simultaneously, by controlling and optimizing the ratio of antibody to small nucleic acid, site-directed conjugation of disaccharidated antibodies can be achieved to prepare CD36 antibody-Glyco-ASO conjugates of DAR1 or DAR2 (hereinafter referred to as: aCD36-Glyco-ASO DAR1 and aCD36-Glyco-ASO DAR2).
[0487] 3.5 Backbone / structural protein-coupled nucleic acid molecules
[0488] 3.5.1 Experimental Procedure
[0489] Take a certain amount of the FN3 structural protein prepared above, add 1.2 equivalents of SMCC adapter small nucleic acid, couple at room temperature for 1 h, perform Q column purification to remove unreacted small nucleic acid and FN3 structural protein, and collect the coupling product.
[0490] 3.6scFv protein-coupled nucleic acid molecules
[0491] 3.6.1 Experimental Procedure
[0492] Take a certain amount of the scFv protein prepared above, add 2 equivalents of TCEP and reduce at room temperature for 3 hours, add 1.2 equivalents of SMCC adapter small nucleic acid, couple at room temperature for 1 hour, perform Q column purification to remove unreacted small nucleic acid and scFv protein, and collect the coupling product (hereinafter referred to as: scFv-Cys-siSOD1).
[0493] 3.7 Fab protein-coupled nucleic acid molecules
[0494] 3.7.1 Experimental Procedure
[0495] Take a certain amount of the Fab protein prepared above, add 2 equivalents of TCEP and reduce at room temperature for 3 hours, add 1.2 equivalents of SMCC adapter small nucleic acid, couple at room temperature for 1 hour, perform Q column purification to remove unreacted small nucleic acid and Fab protein, and collect the coupling product (hereinafter referred to as: Fab-Cys-siSOD1).
[0496] 3.8 HcAb conjugated nucleic acid molecules
[0497] 3.8.1 Experimental Procedure
[0498] Take a certain amount of the HcAb prepared above, add 4 equivalents of TCEP and reduce at room temperature for 3 hours, add 1.2 equivalents of SMCC adapter small nucleic acid, couple at room temperature for 1 hour, perform Q column purification to remove unreacted small nucleic acid and HcAb, and collect the coupling product (hereinafter referred to as: HcAb-Cys-siSOD1).
[0499] 3.9 Polypeptide (linear peptide) coupled with nucleic acid molecules
[0500] 3.9.1 Experimental Procedure
[0501] A certain amount of peptide sample, modified with azide groups, was weighed into a centrifuge tube. Based on the calculation results, 0.1 eq of DBCO-siRNA aqueous solution was added to the peptide sample. After addition, the mixture was immediately stirred evenly and placed on a rotary mixer at 37°C for 2 h. After the reaction, AEX-HPLC was performed to determine the coupling effect. Unreacted peptides were removed using a RESOURCE Q column, and the peptide fraction coupled with siRNA was separated. The solution was ultrafiltered to PBS, and the coupling product (hereinafter referred to as: Peptide-Glyco-siSOD1) was collected.
[0502] Polypeptide chain sequence: SEQ ID NO:48(N3), sequence modification: C-terminal azido group modification.
[0503] Example 4: Verification of the intracellularization effect of ligand-nucleic acid conjugates
[0504] To verify that the aforementioned ligand-coupled nucleic acid drug targeting CD36 can bind to cell membrane surface antigens and be internalized into cells, this experiment observed the process of the AOC being internalized into SW48 cells (cells with high expression of CD36 antigen on their surface).
[0505] 4.1 Experimental Materials
[0506] The experimental materials used in this experiment are shown in Table 7.
[0507] Table 7 Experimental Materials
[0508] 4.2 Experimental Procedure
[0509] (1) Grouping
[0510] Group A was transfected with siCD36 (siRNA targeting CD36) for 48 hours before being administered AOC; Group B was treated with the same number of cells as Group A, and AOC was administered 48 hours later. The siRNA sequence of siCD36 is shown in Table 8.
[0511] Table 8 siCD36 Sequence List Note: The naked siCD36 sequence targets the CD36 gene. siCD36 is a modified siRNA sequence. (dN) indicates that nucleotide N has a 2' deoxyribose modification, and N is selected from A, T, C, U, and G.
[0512] (2) Dilution of siRNA
[0513] Dilute the siRNA to 5 μM with H2O, and then dilute it 25 times to 200 mM with Opti-medium.
[0514] (3) Preparation of transfection reagent
[0515] Prepare the transfection reagent at a ratio of 6 μL RNAiMAX to 100 μL Opti-medium.
[0516] (4) Digestion of SW48 cells
[0517] Centrifuge at 1000g for 5 minutes, resuspend in antibiotic-free medium to the required concentration, and inoculate at 80,000 cells / well.
[0518] (5) Mix the Opti-medium diluted transfection reagent and siRNA at a ratio of 1:1, mix well by pipetting, and incubate at room temperature for 5 min.
[0519] (6) Before cell seeding, add 50 μL of culture medium to the center of a 6-well plate and attach the slide to the bottom of the 6-well plate.
[0520] (7) For Group A, add 200 μL of the nucleic acid solution prepared in step 4 to a 6-well plate, then add the cell suspension prepared in step 3, 1800 μL / well, with a final siRNA concentration of 10 nM. Incubate horizontally in a CO2 incubator. For Group B, simply add the cell suspension.
[0521] (8) Administration
[0522] After 48 hours, the aCD36-Cys-siSOD1-Cy3 DAR1 (Cy3 is a fluorescent molecule used to detect siSOD1) concentration was diluted to 1 μM, and 400 μL was added to the culture supernatant. The drug administration time points were 0.5 h, 4 h, and 24 h.
[0523] (9) Fixed
[0524] Immunostaining fixative was used to fix the stain at room temperature in the dark for 10 minutes, followed by washing with PBS 3 times.
[0525] (10) Permeation
[0526] Add 1000 μL of immunostaining permeabilization buffer to each well and permeabilize at room temperature in the dark for 30 min.
[0527] (11) Closed
[0528] Add 1000 μL of blocking solution per well, seal at room temperature in the dark for 1 h, and then discard the blocking solution.
[0529] (12) Primary antibody incubation
[0530] Anti-LAMP1 antibody was diluted 1:200 with primary antibody dilution buffer, 500 μL / well, incubated overnight at 4°C in the dark, and then washed with washing buffer.
[0531] (13) Secondary antibody incubation
[0532] Goat anti-rabbit 488 secondary antibody and goat anti-human 647 secondary antibody were diluted 1:200 with secondary antibody dilution buffer and then mixed to the working concentration. The mixture was 500 μL / well and incubated at room temperature in the dark for 2 hours, followed by washing with washing buffer.
[0533] (14) Stain nuclei with DAPI, 500 μL / well, incubate for 10 min, and wash twice with PBS.
[0534] (15) Add 200 μL of anti-fluorescence quenching mounting solution to the glass slide and cover it with the cell-covered slide.
[0535] (16) Cells were imaged using a Leica TCS SP8 laser confocal microscope. Images were acquired and processed using 405, 488, 561 and 633 nm lasers.
[0536] 4.3 Experimental Results
[0537] Figure 28A shows that with prolonged free uptake time, the expression of Cy3-labeled siSOD1 increased, indicating that the ligand-nucleic acid conjugate can gradually enter the lysosomes of SW48 cells through internalization. Furthermore, the co-localization of AOC and lysosomes suggests that after the AOC containing the CD36-targeting antibody enters the lysosome, the antibody degrades, and the small nucleic acid escapes from the lysosome into the cytoplasm to exert its therapeutic effect.
[0538] Figure 28B shows that AOC can enter lysosomes.
[0539] Figures 28C and D show that the expression of CD36 antigen on the surface of SW48 cells decreased after transfection with siCD36.
[0540] Figures 28E and F show that when CD36 on the cell surface is knocked down by siCD36, the expression of siSOD1, a Cy3 fluorescent molecule co-localized with lysosomes, decreases, which means that the internalization of AOC containing CD36-targeting ligands is inhibited.
[0541] The above results indicate that the internalization of CD36-targeting ligand-nucleic acid conjugates into cells is mediated by the binding of CD36-targeting ligands to CD36 on the cell surface.
[0542] Example 5: Targeting Validation of Ligand-Nucleic Acid Conjugates
[0543] 5.1 Validation of fluorescence distribution results in cardiac tissue
[0544] To verify the targeting ability of the CD36-targeting ligand-nucleic acid conjugate prepared above in the heart of animals, the distribution of the drug in various tissues of mice was observed after the conjugate was administered in this experiment.
[0545] 5.1.1 Experimental Procedure
[0546] Six- to eight-week-old wild-type male mice (ICR) were selected, with three mice in each group. On day 0, different doses of aCD36-Cys-siSOD1-Cy5 (Cy5 is a fluorescent molecule used to detect the distribution of AOC drugs) were injected via the tail vein. The CD36 antibody sequence was YJ117E, and the injection doses were 0.5, 1, 2, and 3 mg / kg, respectively. The control group mice were given an equal volume of PBS mediator. In vivo drug distribution in mice was detected using the AniView multimodal animal in vivo imaging system at 1, 3, 6, and 24 hours after drug administration. After 24 hours, the mice were euthanized, and tissue samples were collected from various parts of the body, including the heart, liver, spleen, kidney, gastrocnemius muscle, triceps brachii muscle, brown adipose tissue (BAT), epididymal adipose tissue (eWAT), and subcutaneous adipose tissue (iWAT), and drug distribution was analyzed.
[0547] 5.1.2 Experimental Results
[0548] As shown in Figures 29-31, aCD36-Cys-siSOD1-Cy5 is mainly concentrated in the cardiac region. Meanwhile, the fluorescence intensity shows a dose- and time-dependent change in AOC drug, indicating that the AOC drug can be effectively delivered to cardiac tissue.
[0549] 5.2 Verification of cardiac tissue section results
[0550] To verify whether the targeting of cardiac tissue in the above experiments was brought about by ligands targeting CD36, this experiment compared the signal intensity of fluorescently labeled AOC drug (aCD36-Cys-siSOD1), siRNA drug (siSOD1), and CD36 antibody (CD36mAb) in cardiac tissue.
[0551] 5.2.1 Experimental Procedure
[0552] Six wild-type male mice (C57BL / 6) aged 6-8 weeks were selected, with six mice in each group. On day 0, mice were injected via tail vein with AOC drug (aCD36-Cys-siSOD1), siRNA drug (siSOD1), and CD36 antibody (CD36 mAb). The CD36 antibody sequence was YJ117E. The injection dose was 6 mg / kg. Control mice were given an equal volume of PBS as a carrier. On day 7 (D7) after drug administration, the mice were euthanized, and heart tissue samples were collected for section staining analysis. The secondary antibody was analyzed using Alexa Fluor. TM 647-labeled Goat anti-Human IgG (H+L) secondary antibody.
[0553] 5.2.2 Experimental Results
[0554] The cardiac tissue section results (Figure 32) showed no obvious signal staining in the PBS group and the siSOD1 group; however, in the CD36 mAb group, significant red fluorescence signals were observed in the myocardial cell membrane and peripheral tissues, as well as in the vascular endothelial cells; and in the aCD36-Cys-siSOD1 group, significant red fluorescence signals were observed in the myocardial cell membrane and peripheral tissues, as well as in the vascular endothelial cells. These results indicate that the targeting effect of the ligand-nucleic acid conjugate prepared in this application on cardiac tissue is achieved by the CD36 targeting ligand in the conjugate.
[0555] 5.3 Validation of Molecular Biological Results on Cardiac Tissue Distribution
[0556] 5.3.1 Experimental Procedure
[0557] 5.3.1.1 Administration
[0558] Six- to eight-week-old wild-type male mice (C57BL / 6) were selected, with three mice in each group. On day 0, mice were injected via tail vein with aCD36-Cys-siSOD1 (CD36 antibody sequence ONA) at a dose of 6 mg / kg. Control mice were given an equal volume of PBS. Heart tissue samples were collected from mice at 0 h, 7 h, 1 day (D1), 3 days (D3), 7 days (D7), 14 days (D14), and 28 days (D28) after drug administration.
[0559] 4.3.1.2 RNA Extraction and Analysis
[0560] Small RNAs were extracted using the miRNeasy Mini Kit (QIAGEN), and the total extracted RNA was analyzed by stem-loop method cDNA one-strand synthesis and stem-loop method real-time PCR (SL-qPCR) using the miRNA 1st Strand cDNA Synthesis Kit (by stem-loop) (Novozymes) and the miRNA Universal SYBR qPCR Master Mix Kit (Novozymes).
[0561] 5.3.2 Experimental Results
[0562] As shown in Figure 33, absolute quantification of siSOD1 in heart tissue samples revealed a gradual decrease in siSOD1 levels within the mouse heart. This result indicates that the aforementioned AOC drug entered the heart tissue, reaching peak tissue storage at 7 hours, and was subsequently degraded / cleared from the heart as expected, while almost no AOC drug was found in the liver and kidneys.
[0563] 5.4 Targeting Validation of Cardiomyocytes
[0564] To verify the cell types targeted by the aforementioned ligand-nucleic acid conjugate in cardiac tissue, and to verify the distribution of the CD36-targeting ligand and siRNA in the heart (tissue), hematoxylin-eosin staining (HE staining), fluorescence in situ hybridization (FISH), immunofluorescence (IF), and immunohistochemical staining (IHC, DAB staining) were performed.
[0565] 5.4.1 Experimental Procedure
[0566] Six- to eight-week-old wild-type male mice (C57BL / 6) were selected, with three mice in each group. On day 0, mice were injected via tail vein with aCD36-Cys-siSOD1 DAR2 (AOC administration group). siSOD1 was FISH-labeled, and the CD36 antibody sequence was ONA. The injection dose was 6 mg / kg. Control mice received an equal volume of PBS. Seven days after administration, mice were euthanized, and heart tissue samples were collected for HE, FISH, IF, and IHC assays. The secondary antibody for IF was prepared using Alexa Fluor. TM The 647-labeled hIgG1 secondary antibody was used to specifically bind to the CD36 antigen.
[0567] FISH-siRNA: [siRNA sequence (5'-3')AS single strand: UUUAGAGUGAGGAUUAAAAUGAG].
[0568] 5.4.2 Experimental Results
[0569] As shown in Figures 34-35, the delivery of siRNA targeting the SOD1 protein differs among different cell types in the mouse heart. In cardiomyocytes, siRNA is positive, while in fibroblasts, endothelial cells, and immune cells, siRNA levels are low or no significant signal is detected, resulting in a negative signal.
[0570] As shown in Figure 36, the FISH fluorescence hybridization results showed that the PBS group was negative for green fluorescence, while the AOC group showed brighter green fluorescence, indicating that siRNA was present at this location. The IF results showed that the PBS group did not show fluorescence, while the AOC group showed red fluorescence indicating that the antibody in the drug sample was specifically bound. The Merge results showed that both the target siRNA and the drug antibody were present in the cells, and that the target siRNA and the drug antibody were co-localized.
[0571] In pathological IHC experiments, the brown portion in cells represents SOD1 protein, with darker colors indicating higher levels of SOD1 protein. As shown in Figure 37, the PBS group showed strong positive expression of SOD1 protein in the cytoplasm, while the AOC-treated group showed significantly less brown portion, indicating a significant decrease in SOD1 protein expression in the cytoplasm.
[0572] The above results demonstrate that the ligand-nucleic acid conjugate can effectively deliver nucleic acid molecules to cardiomyocytes in heart tissue and effectively knock down the expression of the target SOD1 protein.
[0573] 5.5 Single-cell sequencing analysis of knockdown effects of different cell types in cardiac tissue
[0574] The heart contains various cell types, such as endothelial cells, fibroblasts, macrophages, granulocytes, monocytes, natural killer cells, and cardiomyocytes. To verify that the aforementioned AOC drug targets cardiomyocytes, rather than other cells in the heart tissue, this experiment performed single-cell sequencing on different cells in the heart tissue. Due to the large size of cardiomyocytes, single-cell sequencing has certain limitations. This experiment indirectly demonstrates that the aforementioned AOC drug targets and exerts its effects on cardiomyocytes by performing single-cell sequencing on other cells in the heart tissue.
[0575] 5.5.1 Experimental Procedure
[0576] (1) Drug administration and RNA extraction
[0577] Six- to eight-week-old wild-type male mice (C57BL / 6, purchased from Spefair) and obese male mice (OB / OB, purchased from Huafukang), three mice in each group, were selected. On day 0, mice were injected intravenously with aCD36-Cys-siSOD1 DAR1 (CD36 antibody sequence YJ117E) at a dose of 6 mg / kg. Control mice received an equal volume of PBS. Heart tissue samples were collected on day 7 post-administration. Each heart tissue sample was divided into two parts. One part was used for tissue mRNA quantification analysis. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed using reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit. The other part was used for single-cell sequencing.
[0578] (2) Single-cell sequencing
[0579] 1. Tissue dissociation and preparation of single-cell suspensions
[0580] The obtained tissue was cut into 0.5mm pieces. 3 Small pieces were washed with PBS. Dissociation buffer was added, and the mixture was reacted in a 37°C water bath with shaker for 20 min. Dissociation was terminated by adding 10% fetal bovine serum. After pipetting and filtering, the precipitate was collected by centrifugation. The precipitate was resuspended in PBS, treated with erythrocyte lysis buffer, centrifuged, and then treated with reagents to remove dead cells. After washing, a suspension was prepared. The cell activity was assessed at >85%, with a cell concentration of 700-1200 cells / μL.
[0581] 2. Library construction and sequencing
[0582] Cell capture (capturing 10,000 target cells), cDNA amplification, and library construction were performed according to the official library construction kit (10X Genomics GEM-X Universal 3' Gene Expression v4). After library construction, sequencing was performed using the Illumina NovaSeq X plus sequencing platform (paired-end multiplexing run, 150bp), requiring 100GB of data.
[0583] 3. Bioinformatics Sequence Analysis
[0584] Statistical analysis of data quality was performed on the raw sequencing data of each sample.
[0585] 5.5.2 Results Analysis
[0586] RT-qPCR analysis was performed according to the analytical method in 1.2.
[0587] 5.5.3 Experimental Results
[0588] As shown in Figure 38 (Figure 38A shows C57BL / 6 wild-type male mice; Figure 38B shows OB / OB obese male mice), aCD36-Cys-siSOD1 DAR1 can effectively knock down Sod1 mRNA in the heart.
[0589] As shown in Figure 39 (Figure 39A shows C57BL / 6 wild-type male mice; Figure 39B shows OB / OB obese male mice), single-cell sequencing results showed that aCD36-Cys-siSOD1 DAR1 had no significant effect on fibroblasts, macrophages, endothelial cells, etc. in the heart.
[0590] The results showed that aCD36-Cys-siSOD1 DAR1 effectively knocked down Sod1 mRNA in the heart, while single-cell sequencing results showed that aCD36-Cys-siSOD1 DAR1 had no significant knockdown effect on Sod1 mRNA in fibroblasts, macrophages, endothelial cells, and other cell types in the heart. Furthermore, based on the proportion of cardiomyocytes in the heart and the expression proportion of CD36 in different cell types of cardiac tissue (as shown in Figure 40), it can be concluded that the effective knockdown of Sod1 mRNA in the heart is mainly caused by the effective knockdown of Sod1 mRNA in cardiomyocytes, thus verifying that the ligand-nucleic acid conjugate prepared in this application primarily targets cardiomyocytes.
[0591] 5.6 Validation of targeting at the mRNA level and validation of its knockdown effect
[0592] To verify that the ligand-nucleic acid conjugate prepared above can continuously knock down Sod1 mRNA in cardiomyocytes at the mRNA level, and that the knockdown effect is dose- and time-dependent, while there is no knockdown effect in other tissues, this experiment detected the content of Sod1 mRNA in different tissues by applying different concentrations of aCD36-Cys-siSOD1 DAR2.
[0593] 5.6.1 Experimental Procedure
[0594] Six wild-type male mice (C57BL / 6) aged 6-8 weeks were selected, with six mice in each group. On day 0, mice were injected via tail vein with aCD36-Cys-siSOD1 DAR2 (CD36 antibody sequence ONA). The injection doses were 0.3 mg / kg, 1 mg / kg, 3 mg / kg, and 6 mg / kg, respectively. The control group mice were given an equal volume of PBS. Heart and kidney tissue samples were collected from mice on days 7 (D7), 14 (D14), 28 (D28), 50 (D50), and 70 (D70) after drug administration. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0595] 5.6.2 Results Analysis
[0596] RT-qPCR analysis was performed according to the analytical method in 1.2.
[0597] 5.6.3 Experimental Results
[0598] As shown in Figures 41-43, the results showed that aCD36-Cys-siSOD1 DAR2 knocked down the Sod1 mRNA level in cardiac tissue in a dose- and time-dependent manner, with no significant effect on the liver and kidneys.
[0599] The above experimental results collectively demonstrate that the ligand-nucleic acid conjugate in this application can deliver nucleic acid molecules to heart tissue, mainly to cardiomyocytes in heart tissue, and achieve target gene knockdown by binding to CD36 expressed on the surface of cardiomyocytes.
[0600] Example 6: Validation of delivery efficiency and persistence of ligand-nucleic acid conjugates
[0601] 6.1 Validation of delivery efficiency of ligand-nucleic acid conjugates
[0602] Currently, the mature delivery platform in the field of small nucleic acids is L96, which delivers to the liver and has high nucleic acid delivery efficiency. To verify the delivery efficiency of the ligand-nucleic acid conjugate prepared in this application, the effects of L96 in delivering siSOD1 to the liver and the ligand targeting CD36 in delivering siSOD1 to the heart were compared.
[0603] 6.1.1 Experimental Procedure
[0604] Wild-type male mice (C57BL / 6) aged 6-8 weeks were selected, with 4 mice in each group. On day 0, L96-siSOD1 (structure shown in the figure below) and aCD36-Cys-siSOD1 (CD36 antibody sequence ONA) were injected via tail vein at a dose of 6 mg / kg. Control mice were given an equal volume of PBS. Heart and liver tissue samples were collected from mice on days 7 (D7), 14 (D14), 28 (D28), and 49 (D49) after drug administration. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0605] 6.1.2 Results Analysis
[0606] RT-qPCR analysis was performed according to the analytical method in 1.2.
[0607] 6.1.3 Experimental Results
[0608] As shown in Figure 44, the ligand delivery of siSOD1 targeting CD36 has a good knockdown effect in cardiac tissue. Its knockdown effect in cardiac tissue is comparable to that of L96 delivery of siSOD1 to the liver, which proves that CD36 in this application has tissue / cell specificity and is a ligand binding target with high delivery efficiency.
[0609] 6.2 Validation of the persistence of ligand-nucleic acid conjugate delivery
[0610] 6.2.1 Experimental Procedure
[0611] Six- to eight-week-old wild-type male mice (ICR) were selected, with three mice in each group. On day 0, mice were injected via tail vein with Naked-siSOD1-Cy5 (Naked), L96-siSOD1-Cy5 (L96), and aCD36-Cys-siSOD1-Cy5 (AOC), respectively. The CD36 antibody sequence was YJ117E. The injection dose was 2 mg / kg. The control group mice were given an equal volume of PBS as a carrier. In vivo drug distribution in mice was detected using the AniView multimodal animal in vivo imaging system at 1, 3, 6, and 24 hours after drug administration.
[0612] 6.2.2 Experimental Results
[0613] As shown in Figure 45, after administration, Naked-siSOD1-Cy5 was distributed throughout the body, L96-siSOD1-Cy5 was mainly distributed in the liver region, and aCD36-Cys-siSOD1-Cy5 was mainly concentrated in the heart. Furthermore, the fluorescence intensity of each group of drugs decreased over time, and aCD36-Cys-siSOD1-Cy5 had a longer retention time.
[0614] The above results indicate that the CD36-targeting ligand prepared in this application has comparable delivery efficiency and better delivery persistence to L96, a common delivery ligand in the field of nucleic acids.
[0615] Example 7: Comparison of delivery effects of conjugates containing CD36-targeting ligands and conjugates containing TfR1-targeting ligands
[0616] To compare the effects of CD36 and hTfR1 as delivery targets, this experiment conjugated two antibodies that specifically bind to CD36 and hTfR1 with siRNA molecules (siRNA targeting SOD1), and detected the inhibition efficiency of the SOD1 gene in cardiac tissue.
[0617] 7.1 Experimental Procedure
[0618] Six- to eight-week-old male hTfR1 transgenic mice, purchased from Biocytogen, were selected. Two mice were used in each group. On day 0, hTfR1-Glyco-siSOD1 and aCD36-Glyco-siSOD1 (CD36 antibody sequence YJ117E) were injected via tail vein at a dose of 6 mg / kg. Control mice were given an equal volume of PBS mediator. On day 14 (D14), tissue samples from the heart, gastrocnemius, triceps, liver, and kidney were collected. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0619] 7.2 Results Analysis
[0620] RT-qPCR analysis was performed according to the analytical method in 1.2.
[0621] 7.3 Experimental Results
[0622] As shown in Figure 46, in the heart, aCD36-Glyco-siSOD1 has a higher inhibitory efficiency than hTfR1-Glyco-siSOD1. The experimental results indicate that CD36 is a more efficient target for delivering siRNA to cardiomyocytes / cardiac tissue.
[0623] Example 8: In vivo activity verification of ligand-nucleic acid conjugate targeting cardiomyocytes
[0624] 8.1 Validation of the in vivo targeting activity of ligand-siRNA conjugates in cardiomyocytes
[0625] To verify the in vivo therapeutic effects of the different ligand-nucleic acid conjugates prepared above, this embodiment was designed. This embodiment tested the knockdown effects of different conjugation methods of siRNA and CD36 antibody (cysteine non-site conjugation and glycosylation site conjugation), different doses of ligand-nucleic acid conjugates, different DAR values (DAR1 and DAR2), and monovalent or divalent ligand-nucleic acid conjugates on target gene mRNA.
[0626] 8.1.1 Experimental Procedure
[0627] Six wild-type male mice (C57BL / 6) aged 6-8 weeks were selected, with six mice in each group. On day 0, mice were injected via tail vein with aCD36-Cys-siSOD1 DAR1, aCD36-Cys-siSOD1 DAR2, aCD36-Glyco-Mono-siSOD1 DAR1, aCD36-Glyco-Mono-siSOD1 DAR2, aCD36-Glyco-Di-siSOD1 DAR1, and aCD36-Glyco-Di-siSOD1 DAR2, all with the CD36 antibody sequence ONA. The injection doses were 0.3, 1, 3, and 6 mg / kg, respectively. The control group mice were given an equal volume of PBS mediator. Heart, liver, and kidney tissue samples were collected from mice on days 7 (D7), 14 (D14), and 28 (D28) after drug administration. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0628] 8.1.2 Results Analysis
[0629] RT-qPCR analysis was performed according to the analytical method in 1.2.
[0630] 8.1.3 Experimental Results
[0631] (1) Results of CD36 antibody-cysteine non-site-specific conjugation siRNA dose-dependent conjugation
[0632] Figure 47 shows the results of aCD36-Cys-siSOD1 DAR2 inhibiting Sod1 mRNA expression on day 14. The results indicate that aCD36-Cys-siSOD1 DAR2 can significantly inhibit Sod1 mRNA expression in a dose-dependent manner, with a cardiac knockdown efficiency of up to 80% after administration of 6 mg / kg.
[0633] (2) Time-dependent results of CD36 antibody-cysteine non-site-specific conjugation of siRNA
[0634] Figure 48 shows that aCD36-Cys-siSOD1 DAR2 significantly and persistently inhibited Sod1 mRNA expression at a dose of 6 mg / kg, exhibiting a clear time-dependent effect, with a knockdown efficiency of over 80% at 28 days.
[0635] (3) Specificity results of CD36 antibody-cysteine non-site-specific conjugation to siRNA
[0636] Figures 49-50 show the results of aCD36-Cys-siSOD1 DAR2 inhibiting Sod1 mRNA expression on days 14 and 28, respectively. The results indicate that different doses of aCD36-Cys-siSOD1 DAR2 showed significantly higher knockdown efficiency in the heart than in the liver and kidney, exhibiting obvious tissue specificity.
[0637] (4) Results of in vivo dose-dependent conjugation of CD36 antibody-glycosylated siRNA
[0638] Figure 51 shows the results of aCD36-Glyco-Mono-siSOD1 DAR2 inhibiting Sod1 mRNA expression on day 14. The results indicate that aCD36-Glyco-Mono-siSOD1 DAR2 can significantly inhibit Sod1 mRNA expression in a dose-dependent manner, with a cardiac knockdown efficiency of up to 95% at a dose of 6 mg / kg.
[0639] (5) Time-dependent results of CD36 antibody glycosylation site-directed conjugation with siRNA
[0640] Figure 52 shows that aCD36-Glyco-Mono-siSOD1 DAR2 can significantly and persistently inhibit Sod1 mRNA expression at a dose of 6 mg / kg, exhibiting a clear time-dependent effect, with a knockdown efficiency of over 90% at 28 days.
[0641] (6) Results of in vivo specificity of CD36 antibody glycosyl site-directed conjugation siRNA
[0642] Figure 53 shows the results of aCD36-Glyco-Mono-siSOD1 DAR2 inhibiting Sod1 mRNA expression on day 14. The results indicate that different doses of aCD36-Glyco-Mono-siSOD1 DAR2 have significantly higher knockdown efficiency in the heart than in the liver and kidney, showing obvious tissue specificity.
[0643] (7) Knockdown activity results of AOC with different DAR values (DAR1 and DAR2)
[0644] Figure 54 shows that non-site-coupled siRNA with cysteine can effectively knock down Sod1 mRNA expression in cardiac tissue at different DAR values.
[0645] The results in Figures 55-56 show that site-directed glycosylation of siRNA with different DAR values, regardless of whether it is coupled with monovalent or bivalent siRNA, can effectively knock down Sod1 mRNA expression in cardiac tissue.
[0646] The above results indicate that CD36 antibody-conjugated siRNA, using different doses, different conjugation methods (cysteine non-site conjugation and glycosylation site conjugation), different DAR values (DAR1 and DAR2), and monovalent or bivalent AOC, all have good knockdown effects on the target gene SOD1 mRNA.
[0647] 8.2 Validation of the in vivo cardiomyocyte-targeting activity of the ligand-ASO conjugate
[0648] This embodiment tested the knockdown effect of AOC on the target gene SOD1 mRNA at different doses using different conjugation methods (cysteine non-site conjugation and glycosylation site conjugation) of ASO and CD36 antibodies.
[0649] 8.2.1 Experimental Procedure
[0650] Six- to eight-week-old humanized SOD1 transgenic mice were selected, with six mice in each group. On day 0, mice were injected via tail vein with aCD36-Cys-ASO and aCD36-Glyco-ASO. The CD36 antibody sequence was ONA, and the ASO sequence was mSOD1-ASO. The injection doses were 0.3, 1, 3, and 6 mg / kg, respectively. The control group mice were given an equal volume of PBS. On days 7 (D7), 14 (D14), and 28 (D28) after drug administration, tissue samples from the heart, liver, and kidneys were collected. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0651] 8.2.2 Results Analysis
[0652] RT-qPCR analysis was performed according to the analytical method in 1.2.
[0653] 8.2.3 Experimental Results
[0654] (1) Results of in vivo activity of CD36 antibody-cysteine non-site-specific conjugation with ASO
[0655] Figure 57 shows that, 14 days after administration, CD36 antibody-cysteine non-site-specific conjugation with ASO can significantly inhibit SOD1 mRNA expression in cardiac tissue.
[0656] (2) Results of CD36 antibody-cysteine non-site-specific conjugation with ASO in a dose-dependent manner
[0657] Figure 58 shows that CD36 antibody cysteine non-site-specific conjugation with ASO can significantly inhibit SOD1 mRNA expression in a dose-dependent manner, with a cardiac knockdown efficiency of up to 75% at a dose of 6 mg / kg.
[0658] (3) Results of CD36 antibody-cysteine non-site-specific conjugation with ASO
[0659] Figure 59 shows that the knockdown efficiency of different doses of aCD36-Cys-ASO in the heart was significantly higher than that in the liver and kidney, exhibiting obvious tissue specificity.
[0660] (4) Results of in vivo activity of CD36 antibody glycosyl site-directed conjugation to ASO
[0661] Figure 60 shows that site-directed glycosylation of ASO can significantly inhibit SOD1 mRNA expression in cardiac tissue.
[0662] (5) In vivo dose-dependent results of CD36 antibody glycosyl site-directed conjugation with ASO
[0663] Figure 61 shows that CD36 antibody glycosyl site-directed conjugation with ASO can significantly inhibit SOD1 mRNA expression in a dose-dependent manner, with a cardiac knockdown efficiency of up to 90% at a dose of 6 mg / kg.
[0664] (6) Specificity results of CD36 antibody glycosyl site-directed conjugation to ASO body
[0665] Figure 62 shows that the knockdown efficiency of different doses of aCD36-Glyco-ASO in the heart was significantly higher than that in the liver and kidneys, exhibiting obvious tissue specificity.
[0666] The above results indicate that CD36-targeting antibody conjugated with ASO, using different conjugation methods (cysteine non-site conjugation and glycosylation site conjugation), has a good knockdown effect on the target gene SOD1 mRNA.
[0667] The above experimental results collectively demonstrate that the anti-CD36 antibody of this application, when conjugated with different types of nucleic acid molecules (siRNA or ASO) or nucleic acid molecules with different DAR values (DAR1 or DAR2), and when different conjugation methods are used between the antibody and the nucleic acid molecules, can achieve good nucleic acid delivery in cardiac tissue / cardiomyocytes and has a good knockdown effect on the target genes of nucleic acid molecules.
[0668] Example 9: Validation of the effect of the ligand-nucleic acid conjugate
[0669] 9.1 Experimental Procedure
[0670] 9.1.1 Validation of the efficacy of CD36 antibody-conjugated siRNA
[0671] Wild-type male mice (C57BL / 6) aged 6-8 weeks were selected, with four mice in each group. On day 0, mice were injected via tail vein with different antibody strains and different conjugation techniques for AOC drugs. The antibody strains were YJ117E and ONA, and the small nucleic acid drug was siRNA (as shown in Table 9). The injection dose was 6 mg / kg, and the control group mice were given an equal volume of PBS mediator. On day 7 (D7) and day 14 (D14) after drug administration, tissue samples from various parts of the mice, including heart, gastrocnemius muscle, triceps brachii muscle, liver, and kidney, were collected. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0672] 9.1.2 Validation of the efficacy of CD36 antibody-conjugated ASO
[0673] Six- to eight-week-old humanized SOD1 transgenic mice were selected, with four mice in each group. On day 0, mice were injected via tail vein with different antibody strains and AOC drugs conjugated using different conjugation techniques. The antibody strains were YJ117E and ONA, and the small nucleic acid drug was ASO (as shown in Table 9). The injection dose was 12 mg / kg for all mice, while the control group was given an equal volume of PBS. On day 7 (D7) and day 14 (D14) after drug administration, tissue samples were collected from the mice, including heart, gastrocnemius muscle, triceps brachii muscle, liver, and kidney tissue samples. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0674] Table 9. Drug names of the two antibody strains
[0675] 9.2 Results Analysis
[0676] RT-qPCR analysis was performed according to the analytical method in 1.2.
[0677] 9.3 Experimental Results
[0678] (1) Validation of the effect of AOC conjugated with different CD36 antibody strains on cardiomyocyte targeted delivery
[0679] As shown in Figure 63, regardless of whether the YJ117E antibody strain or the ONA antibody strain is used, effective knockdown of the target gene can be achieved in the heart after conjugation with small nucleic acids, verifying the feasibility of conjugating different antibody strains and further demonstrating the effectiveness of CD36 target targeting cardiomyocytes.
[0680] (2) Comparative verification of the activity of AOCs with different coupling methods for targeted delivery to cardiomyocytes
[0681] As shown in Figure 64, the ONA antibody strain was conjugated with small nucleic acids using Cys and Glyco, respectively. Both conjugation methods could effectively knock down the target gene in cardiac tissue, verifying the feasibility of different conjugation methods and further demonstrating the effectiveness of CD36 target targeting cardiomyocytes.
[0682] (3) Validation of the activity of AOCs with different linkers for targeted delivery to cardiomyocytes
[0683] As shown in Figure 65, the ONA antibody strain was linked to nucleic acid molecules using both the non-breakable linker and the breakable linker (breakable at SS) shown in the figure below. Both coupling methods can effectively knock down the target gene in cardiac tissue, verifying the feasibility of changing different linkers and further demonstrating the effectiveness of CD36 target targeting myocardium.
[0684] (4) Activity verification of coupling with different DAR values
[0685] As shown in Figure 66, the YJ117E antibody strain, through Cys-coupled siSOD1, and the ONA antibody strain, through Cys-coupled siSOD1, can effectively knock down the target gene in cardiac tissue when the DAR value is 1 or 2.
[0686] (5) Activity verification of conjugated monovalent or bivalent siRNA
[0687] As shown in Figure 67, the ONA antibody strain, conjugated with either monovalent or bivalent siSOD1 via Glyco, demonstrated effective knockdown of the target gene in cardiac tissue with both monovalent and bivalent siSOD1 at a DAR value of 1 or 2. This validated the feasibility of using different DAR values and multivalent nucleic acid molecules, further illustrating the effectiveness of CD36 targeting cardiac tissue.
[0688] (6) Activity verification of ASO coupling
[0689] As shown in Figure 68, the YJ117E antibody strain and the ONA antibody strain were coupled with a nucleic acid molecule via Cys. When the nucleic acid molecule was ASO, the target gene could be effectively knocked down in the heart tissue, verifying the feasibility of changing different nucleic acid molecules and further demonstrating the effectiveness of CD36 targeting the heart tissue.
[0690] Example 10: In vivo efficacy verification of ligand-nucleic acid conjugates in a pig model
[0691] 10.1 Experimental Materials
[0692] 10.1.1 Laboratory Animals
[0693] The experimental animals used in Example 10 are shown in Table 10.
[0694] Table 10 Experimental animals in Example 10
[0695] 10.1.2 Experimental Apparatus
[0696] The experimental instruments used in Example 10 are shown in Table 11.
[0697] Table 11 Experimental apparatus in Example 10
[0698] 10.1.3 Experimental Reagents and Consumables
[0699] The experimental reagents and consumables used in Example 10 are shown in Table 12.
[0700] Table 12 Experimental reagents and consumables for Example 10
[0701] 10.2 Experimental Procedure
[0702] This experiment consisted of two groups of four male animals: a blank control group and a drug-treated experimental group, each with two animals. On day 0, the experimental group was administered aCD36-Glyco-siSOD1 DAR2 via intravenous injection. The CD36 antibody sequence was YJ117E, and the injection dose was 6 mg / kg. The control group received an equal volume of PBS. On day 24 (D24), porcine heart, liver, and kidney tissues were dissected and collected. Total RNA was extracted from each tissue using the Trizol method, and the expression of Sod1 mRNA in the tissues was detected using reverse transcription and RT-qPCR analysis with the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0703] 10.3 Results Analysis
[0704] RT-qPCR analysis was performed according to the analytical method in 1.2.
[0705] 10.4 Experimental Results
[0706] As shown in Figure 79, in Bama pigs, aCD36-Glyco-siSOD1 DAR2 can specifically target the heart to deliver siRNA, achieving effective knockdown of target gene mRNA.
[0707] Example 11: In vivo efficacy verification of ligand delivery of nucleic acid molecules targeting different sites.
[0708] To verify that the targeted delivery of the CD36-targeting ligand to cardiomyocytes is unaffected by nucleic acid molecules targeting genes, this experiment was designed. The PPIB gene encodes a protein of cyclophilin B, a member of the cyclophilin family, and is expressed in various tissues. In this experiment, ONA antibodies were used to conjugate siRNAs targeting the PPIB gene (aCD36-Cys-siPPIB DAR1 and aCD36-Cys-siPPIB DAR2) to detect the expression of PPIB mRNA in cardiac tissue.
[0709] 11.1 Experimental Procedure
[0710] Wild-type male mice (C57BL / 6) aged 6-8 weeks were selected, with four mice in each group. On day 0, mice were injected via tail vein with AOC drugs targeting the PPIB gene, namely aCD36-Cys-siPPIB DAR1 and aCD36-Cys-siPPIB DAR2 (CD36 sequence is ONA), at a dose of 6 mg / kg. Control mice were given an equal volume of PBS. On day 7 post-administration, heart tissue samples were collected from the mice. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0711] 11.2 Results Analysis
[0712] RT-qPCR analysis was performed according to the analytical method in 1.2.
[0713] 11.3 Experimental Results
[0714] As shown in Figure 69, both aCD36-Cys-siPPIB DAR1 and aCD36-Cys-siPPIB DAR2 can effectively reduce the level of Ppib mRNA in cardiac tissue. This result indicates that the CD36 antibody-mediated homing and endocytosis mechanism is universal, and changing the conjugated nucleic acid molecules can still achieve efficient delivery to cardiomyocytes and effective inhibition of target gene expression.
[0715] Example 12: In vivo efficacy verification of ligand delivery of nucleic acid molecules targeting multiple different sites.
[0716] To verify whether CD36 antibody conjugated with multiple siRNAs targeting different sites still possesses an effective gene expression knockdown effect, this experiment conjugated the YJ117E antibody with two siRNAs: siSOD1 (siRNA targeting the SOD1 gene) and siPPIB (siRNA targeting the PPIB gene). Different conjugation sequences for the two siRNAs (YJ117E-Glyco-siSOD1-siPPIB and YJ117E-Glyco-siPPIB-siSOD1) were provided, and the mRNA levels of the two target genes, SOD1 and PPIB, in cardiac tissue were detected.
[0717] 12.1 Experimental Procedure
[0718] Six wild-type male mice (C57BL / 6) aged 6-8 weeks were selected, with six mice in each group. On day 0, mice were injected via tail vein with aCD36-Glyco-siSOD1, aCD36-Glyco-siPPIB, aCD36-Glyco-siSOD1-siPPIB, and aCD36-Glyco-siPPIB-siSOD1, as well as a mixture of aCD36-Glyco-siSOD1 and aCD36-Glyco-siPPIB (as shown in Figure 70). The CD36 antibody sequence was YJ117E. The injection dose was 6 mg / kg. Control mice were given an equal volume of PBS. On day 14 after drug administration, heart tissue samples were collected from the mice. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0719] 12.2 Results Analysis
[0720] RT-qPCR analysis was performed according to the analytical method in 1.2.
[0721] 12.3 Experimental Results
[0722] As shown in Figure 71, AOC can deliver two different siRNAs simultaneously to cardiac tissue / cardiomyocytes, knocking down the target gene mRNA, regardless of the coupling order of the two siRNAs.
[0723] The results showed that AOC carrying two siRNAs could still be efficiently taken up by cardiomyocytes, and there was no significant competition or interference between the two siRNAs. The technical platform for ligand-conjugated nucleic acid molecules targeting CD36 prepared in this application has the potential to solve the problem of synergistic knockdown of dual-target / multi-target genes.
[0724] Example 13: AOC safety verification of ligand-nucleic acid conjugates
[0725] 13.1 Transcriptome Sequencing Validation
[0726] To ensure the basic safety of the aforementioned AOC drugs, this experiment compared the number of differentially expressed genes between the treated mice and the control mice.
[0727] 13.1.1 Experimental Procedure
[0728] Six- to eight-week-old wild-type male mice (C57BL / 6) were selected, with three mice in each group. On day 0, CD36 antibody (CD36 mAb) and aCD36-Cys-siSOD1 (AOC) were injected via tail vein at doses of 7.5 mg / kg and 30 mg / kg, respectively. The control group mice were given an equal volume of PBS. Mice were sacrificed on days 3 and 7 post-administration, and heart tissue samples were collected and sent to a third-party company for transcriptome analysis to identify differentially expressed genes.
[0729] 13.1.2 Experimental Results
[0730] As shown in Figure 72, the number of differentially expressed genes was relatively small after drug administration. These results indicate that the AOC drug causes minimal perturbation to the overall transcriptome of cardiomyocytes and has good safety profile.
[0731] 13.2 In vivo safety verification of CD36-targeted ligand-nucleic acid conjugates
[0732] To ensure the basic safety of the aforementioned AOC drugs, routine blood tests were performed on mice after administration.
[0733] 13.2.1 Experimental Procedure
[0734] Wild-type male mice (C57BL / 6) aged 6-8 weeks were selected, with 3 mice in each group. On day 0, mice were injected via tail vein with aCD36-Cys-siSOD1 DAR2 (CD36 antibody sequence ONA) at doses of 0.3, 3, and 6 mg / kg, respectively. Control mice received an equal volume of PBS as a carrier. On day 7 post-administration, mice were anesthetized with 5% isoflurane and immediately sacrificed. Blood samples (1.5-2.0 mL) were collected from the mice for routine blood testing. Routine blood testing was performed using a Mindray (BC-5000Vet) fully automated veterinary blood cell analyzer.
[0735] 13.2.2 Experimental Results
[0736] As shown in Figures 73-74 and Table 13, after 7 days of administration of different doses of aCD36-Cys-siSOD1 DAR2, except for the percentage of monocytes (MON) in the blood of a few mice which was lower than the normal reference range, all other indicators were within the normal reference range, and there was no significant difference between the administration group and the PBS group, indicating that aCD36-Cys-siSOD1 has no significant toxicity.
[0737] Table 13. Routine blood test results 7 days after drug administration
[0738] The above experimental results collectively demonstrate that the AOC drug containing CD36-targeting ligand prepared in this application has no significant toxicity and possesses good safety.
[0739] Example 14: In vivo activity verification of ligand delivery of nucleic acid molecules targeting different sites
[0740] 14.1 Validation of AOC activity targeting the PLN gene in vivo
[0741] The PLN gene encodes a phosphatase in the sarcoplasmic reticulum, which inhibits sarcoplasmic reticulum calcium-ATPase, keeping it in a non-phosphorylated state. The phosphatase is a major substrate for cyclic adenosine monophosphate (cAMP)-dependent protein kinase. When phosphorylated, its inhibitory effect is weakened, thereby activating the calcium pump to take up calcium ions from the cytoplasm, reducing cytoplasmic calcium concentration and accelerating muscle relaxation. Various mutations in the PLN gene are associated with dilated cardiomyopathy (DCM) and hypertrophic cardiomyopathy. It has been reported that ASO compounds targeting PLN can prevent PLN protein aggregation and improve cardiac dysfunction. This experiment assessed the in vivo activity of AOCs targeting the PLN gene by detecting PLN RNA levels.
[0742] 14.1.1 Experimental Procedure
[0743] (1) Preparation of AOC targeting the PLN gene
[0744] AOC targeting the PLN gene was prepared using the antibody glycosylation site-directed coupling process described in Example 3. The siRNA sequence targeting the PLN gene is shown in Table 14.
[0745] Table 14. siRNA sequence listing targeting PLN Note: YG-PLN-1 targets the PLN gene, and siPLN-1 is a modified YG-PLN-1. (Ns)(N') indicates that there is a thiophosphate modification between the two nucleotides N and N', where N and N' are selected from A, T, C, U, and G, respectively. For example, (Us)(G) indicates that the phosphodiester bond between U and G is modified with thiophosphate; (mN) indicates that nucleotide N has a 2'-O-methyl modification, where N is selected from A, T, C, U, and G; (fN) indicates that nucleotide N has a fluorinated modification, where N is selected from A, T, C, U, and G; (vpN) indicates that nucleotide N has a 5'-vinyl phosphate modification at the 5'-OH, where N is selected from A, T, C, U, and G. For example, (vpmNs)(N') indicates that nucleotide N has both a 5'-vinyl phosphate modification and a 2'-O-methyl modification, and the phosphodiester bond between nucleotides N and N' has a thiophosphate modification.
[0746] (2) In vivo activity verification
[0747] Six- to eight-week-old wild-type male mice (C57BL / 6) were purchased from Spiefol (Beijing) Biotechnology Co., Ltd., with three mice in each group. On day 0, mice were injected intravenously via tail vein with aCD36-Cys-siPLN-1DAR1 (CD36 antibody sequence ONA) at doses of 1 mg / kg, 6 mg / kg, and 10 mg / kg. Control mice received an equal volume of Saline. Heart tissue samples were collected on days 14 and 28 post-administration. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0748] (3) In vivo activity verification
[0749] Twelve male cynomolgus macaques were selected and the experiment was conducted by Junke Zhengyuan (Guangxi) Biomedical Technology Co., Ltd. After acclimatization, they were randomly divided into 6 groups of 2 monkeys each according to their body weight. Each group received a single subcutaneous administration of an AOC drug targeting PLN at doses of 3 mg / kg and 6 mg / kg, respectively. Heart tissue was collected from the monkeys on days 7 (D7), 14 (D14), and 21 (D21) after administration. The tissue was divided into two parts. One part was used for PLN mRNA expression detection. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit. The other part of the tissue was used for Western blotting.
[0750] 14.1.2 Experimental Results
[0751] (1) In vivo activity verification
[0752] As shown in Figure 75, CD36 antibody conjugated with PLN siRNA effectively inhibited PLn mRNA expression in mouse cardiomyocytes in a dose-dependent manner. These results indicate that PLN siRNA, through conjugation with CD36 antibody, can inhibit PLN gene expression in cardiomyocytes, demonstrating therapeutic potential.
[0753] (2) In vivo activity verification
[0754] The AOC disclosed herein exhibits good activity in cynomolgus monkeys, significantly and persistently reducing PLN mRNA and protein expression levels. This indicates that the AOC drug of this invention can target cardiomyocytes and effectively inhibit PLN gene expression in cardiomyocytes.
[0755] 14.2 Validation of AOC activity targeting the NPPA gene in vivo
[0756] NPPA plays a crucial role in regulating vascular tone and sodium balance. This gene encodes atrial natriuretic peptide (ANP) precursors, hormones released by cardiomyocytes in the atria, and sometimes by cardiomyocytes in the ventricles during volume expansion and potential increases in ventricular wall stress. In patients with heart failure, increased ventricular filling pressure leading to enhanced traction and increased secretion of neurohormones (e.g., norepinephrine and angiotensin) stimulates ventricular myocytes to secrete ANP, resulting in increased release. This experiment indirectly demonstrates the in vivo activity of AOC by detecting NPPA mRNA expression in cardiomyocytes.
[0757] 14.2.1 Experimental Procedure
[0758] (1) Preparation of AOC targeting the NPPA gene
[0759] AOC targeting the NPPA gene was prepared using the antibody glycosylation site-directed coupling process described in Example 3. The siRNA sequence targeting the NPPA gene is shown in Table 15.
[0760] Table 15. siRNA sequence listing targeting NPPA Note: siNPPA-X is YG-NPPA-X with modifications (X is 1-5). (Ns)(N') indicates that there is a thiophosphate modification between the two nucleotides N and N', where N and N' are selected from A, T, C, U, and G, respectively. For example, (Us)(G) indicates that the phosphodiester bond between U and G is modified with a thiophosphate; (mN) indicates that nucleotide N has a 2'-O-methyl modification, where N is selected from A, T, C, U, and G; (fN) indicates that nucleotide N has a fluorinated modification, where N is selected from A, T, C, U, and G; (vpN) indicates that nucleotide N has a 5'-vinyl phosphate modification on the 5'-OH, where N is selected from A, T, C, U, and G. For example, (vpmNs)(N') indicates that nucleotide N has both a 5'-vinyl phosphate modification and a 2'-O-methyl modification, and the phosphodiester bond between nucleotides N and N' has a thiophosphate modification.
[0761] (2) In vivo activity verification
[0762] Six wild-type male mice (C57BL / 6) aged 6-8 weeks were selected, with six mice in each group. On day 0, mice were injected via tail vein with aCD36-Cys-siNPPA-1, aCD36-Cys-siNPPA-2, aCD36-Cys-siNPPA-3, aCD36-Cys-siNPPA-4, and aCD36-Cys-siNPPA-5, all containing the CD36 antibody sequence ONA, at a dose of 3 mg / kg. The control group received an equal volume of PBS. On day 25 post-drug administration, heart tissue samples were collected from the mice. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0763] 14.2.2 Results Analysis
[0764] RT-qPCR analysis was performed according to the analytical method in 1.2.
[0765] 14.2.3 Experimental Results
[0766] As shown in Figure 76, CD36 antibody conjugated with NPPA siRNA can target cardiomyocytes and effectively inhibit Nppa mRNA expression in cardiomyocytes. The results indicate that NPPA siRNA, through conjugation with CD36 antibody, can inhibit NPPA gene expression in cardiomyocytes, demonstrating therapeutic potential.
[0767] Example 15: In vivo activity verification of nucleic acid molecules delivered by different types of ligands
[0768] This embodiment was designed to verify the effectiveness of different ligand types in delivering nucleic acid molecules.
[0769] 15.1 In vivo activity validation of linear peptide, Fab, scFv, and HcAb-conjugated nucleic acid molecules
[0770] 15.1.1 Experimental Procedure
[0771] (1) Preparation of AOC of linear peptide-coupled nucleic acid molecules
[0772] An AOC (Analogous Orthogonal Component) targeting CD36 and coupled with a nucleic acid molecule, abbreviated as Peptide-Glyco-siSOD1, was prepared using the antibody-glycosylation site-directed coupling process described in Example 3. The siRNA sequence targeting the SOD1 gene is shown in Table 5, and the amino acid sequence of the linear peptide is shown in SEQ ID NO:48.
[0773] (2) Preparation of AOCs for Fab-coupled nucleic acid molecules
[0774] An AOC targeting CD36 and conjugated to SOD1 nucleic acid molecules, abbreviated as Fab-Cys-siSOD1, was prepared using the antibody-cysteine non-site conjugation process described in Example 2. The siRNA sequence targeting the SOD1 gene is shown in Table 5. The sequence of the Fab light chain is shown in SEQ ID NO:28, and the sequence of the heavy chain is shown in SEQ ID NO:44.
[0775] (3) Preparation of AOC of scFv-coupled nucleic acid molecules
[0776] An AOC (analytical compound) targeting CD36 and conjugated to SOD1 nucleic acid molecules, abbreviated as scFv-Cys-siSOD1, was prepared using the antibody-cysteine non-site conjugation process described in Example 2. The siRNA sequence targeting the SOD1 gene is shown in Table 5, and the scFv sequence is shown in SEQ ID NO:46.
[0777] (4) Preparation of AOC of HcAb-coupled nucleic acid molecules
[0778] An AOC (Antibody-Cys-siSOD1) targeting CD36 and conjugated with SOD1 nucleic acid molecules was prepared using the non-site conjugation process of antibody cysteine in Example 2. The siRNA sequence targeting the SOD1 gene is shown in Table 5, and the full-length sequence of HcAb is shown in SEQ ID NO:43.
[0779] (5) In vivo activity verification
[0780] Six- to eight-week-old male mice (C57BL / 6), six mice in each group, were injected via tail vein on day 0 with Peptide-Glyco-siSOD1, Fab-Cys-siSOD1, scFv-Cys-siSOD1, HcAb-Cys-siSOD1, and aCD36-Cys-siSOD1 (CD36 antibody sequence YJ117E). The injection dose was 12 mg / kg. Control mice were given an equal volume of PBS. On day 14 (D14) after drug administration, mouse heart tissue samples were collected. Total RNA was extracted using the Trizol method, and the extracted total RNA was analyzed by reverse transcription and RT-qPCR using the FlysisAmp Cells-to-CT 1-Step SYBR Green Kit.
[0781] 15.1.2 Results Analysis
[0782] RT-qPCR analysis was performed according to the analytical method in 1.2.
[0783] 15.1.3 Experimental Results
[0784] As shown in Figure 77, Peptide-Glyco-siSOD1, Fab-Cys-siSOD1, scFv-Cys-siSOD1, and HcAb-Cys-siSOD1 can all deliver siRNA to heart tissue and have good knockdown effects, comparable to the knockdown effect of aCD36-Cys-siSOD1.
[0785] The above results indicate that regardless of whether the ligand type targeting CD36 is a linear peptide, Fab, scFv, or HcAb, it can achieve targeting of cardiomyocytes / cardiac tissue and knockdown of the target gene.
Claims
1. A nucleic acid conjugate for cardiomyocyte delivery, comprising: a ligand targeting CD36 and a nucleic acid molecule.
2. The nucleic acid conjugate of claim 1, wherein the ligand is a polypeptide, nucleic acid, or nucleic acid analog.
3. The nucleic acid conjugate as described in any one of claims 1 or 2, wherein the ligand is a nucleic acid and / or a nucleic acid analog, preferably an aptamer.
4. The nucleic acid conjugate as described in claim 2, wherein the ligand is a skeletal protein.
5. The nucleic acid conjugate as described in claim 2, wherein the ligand is an antibody or an antigen-binding fragment thereof.
6. The nucleic acid conjugate as described in claim 5, wherein the antibody or its antigen-binding fragment is a monovalent antibody or its antigen-binding fragment, or a multivalent antibody or its antigen-binding fragment.
7. The nucleic acid conjugate as described in any one of claims 5 or 6, wherein the antibody or its antigen-binding fragment is a monospecific antibody or its antigen-binding fragment, or a multispecific antibody or its antigen-binding fragment.
8. The nucleic acid conjugate according to any one of claims 5-7, wherein the antibody or its antigen-binding fragment is a monoclonal antibody or its antigen-binding fragment, or a polyclonal antibody or its antigen-binding fragment.
9. The nucleic acid conjugate according to any one of claims 5-8, wherein the antibody or its antigen-binding fragment is selected from conventional antibodies, Fab, Fab', F(ab')2, single-chain variable fragments (scFv), microantibodies, and single-domain antibodies (sdAb).
10. The nucleic acid conjugate of claim 9, wherein the sdAb is selected from camel-derived VHH, shark-derived VNAR, human-derived VH, human-derived VL, mouse-derived VH, and mouse-derived VL.
11. The nucleic acid conjugate of claim 9, wherein the antibody is an IgG monoclonal antibody.
12. The nucleic acid conjugate according to any one of claims 5-11, wherein the antibody or antigen-binding fragment thereof is a humanized antibody or antigen-binding fragment thereof.
13. The nucleic acid conjugate according to any one of claims 1-12, wherein the nucleic acid molecule is linked to a ligand targeting CD36 via a linker, wherein the linker is a breakable linker or a non-breakable linker.
14. The nucleic acid conjugate of claim 13, wherein the unbreakable linker is selected from maleimide hexanoyl (MCC), m-maleimide benzoyl (MB), 4-((4-(cyanoethynyl)benzoyl)oxy)(CB) or bismaleimide (BisMal).
15. The nucleic acid conjugate of claim 13, wherein the cleavable linker is selected from N-succinimide-4-(2-pyridyldithio)valerate, N-succinimide-4-(2-pyridyldithio)-2,2-dimethylbutyrate, valine-citrulline (VC) linker, 3-(2-pyridyldithio)propionate (PDP) or methyl-(2-pyridyldithio)toluene (MPT).
16. The nucleic acid conjugate according to any one of claims 1-15, wherein the coupling between the CD36-targeting ligand and the nucleic acid molecule is site-directed coupling or non-site-directed coupling.
17. The nucleic acid conjugate according to any one of claims 1-16, wherein the CD36-targeting ligand and the nucleic acid molecule are coupled via Glyco or Cys coupling.
18. The nucleic acid conjugate according to any one of claims 1-17, wherein the CD36-targeting ligand and nucleic acid molecule are coupled via Glyco site-directed coupling, Cys site-directed coupling, or Cys non-site-directed coupling.
19. The nucleic acid conjugate according to any one of claims 1-18, wherein the DAR value of the nucleic acid conjugate is 1-4, preferably 2.
20. The nucleic acid conjugate according to any one of claims 1-19, wherein the nucleic acid molecule is a monovalent nucleic acid molecule or a polyvalent nucleic acid molecule.
21. The nucleic acid conjugate according to any one of claims 1-20, wherein the nucleic acid molecule is a single-specific nucleic acid molecule or a multi-specific nucleic acid molecule.
22. The nucleic acid conjugate according to any one of claims 1-21, wherein the target gene targeted by the nucleic acid molecule is selected from the phosphatase receptor protein (PLN) and / or natriuretic peptide precursor A (NPPA) gene.
23. The nucleic acid conjugate according to any one of claims 1-22, wherein the nucleic acid molecule is an oligonucleotide.
24. The nucleic acid conjugate according to any one of claims 1-23, wherein the nucleic acid molecule is selected from siRNA (small interfering RNA), saRNA (small activating RNA), miRNA (microRNA), ASO (antisense oligonucleotide), shRNA (short hairpin RNA), aptamers, sgRNA (single guide RNA), and tinyRNA.
25. The nucleic acid conjugate according to any one of claims 1-24, wherein the nucleic acid molecule is selected from siRNA and ASO.
26. The nucleic acid conjugate according to any one of claims 1-25, wherein the nucleic acid molecule comprises at least one modification.
27. The nucleic acid conjugate of claim 26, wherein the modification is phosphate modification, ribose modification and / or base modification.
28. The nucleic acid conjugate according to any one of claims 26 or 27, wherein the modification is selected from one or more of the following: phosphate thioester (PS) modification, 2'O-methyl (2'OMe) modification, 2'fluoro (2'F) modification, 2'methoxyethyl (2'MOE) modification, 2'deoxyribose modification, and 5'-vinyl phosphate modification (VP).
29. A pharmaceutical composition comprising a therapeutically effective amount of the nucleic acid conjugate as described in any one of claims 1-28 and a pharmaceutically acceptable excipient.
30. The pharmaceutical composition of claim 29, wherein the pharmaceutical composition treats the disease by targeting cardiomyocytes.
31. The pharmaceutical composition of any one of claims 29 or 30, wherein the disease is associated with or caused by abnormal expression of myocardial cell genes.
32. The pharmaceutical composition of any one of claims 30 or 31, wherein the disease includes cardiomyopathy, rare heart disease, myocardial ischemia-reperfusion injury, heart failure, coronary artery disease, myocardial infarction, myocarditis, atherosclerosis, arrhythmia, intermittent hypoxia-related myocardial injury, cardiac ion channel-related diseases, hypertensive heart disease, atrial fibrillation, myocardial hypertrophy and fibrosis, acute coronary syndrome, hereditary glycogen storage disease, PRKAG2 cardiac syndrome, and idiopathic ventricular fibrillation (IVF).
33. The pharmaceutical composition of claim 32, wherein the cardiomyopathy includes dilated cardiomyopathy, hypertrophic cardiomyopathy, restrictive cardiomyopathy, hypoxic-ischemic cardiomyopathy, valvular cardiomyopathy, hypertensive cardiomyopathy, metabolic cardiomyopathy, endocrine cardiomyopathy, alcoholic cardiomyopathy, perinatal cardiomyopathy, drug-induced cardiomyopathy, hereditary cardiomyopathy, Keshan disease, arrhythmogenic cardiomyopathy, and arrhythmogenic right ventricular cardiomyopathy-like phenotype.
34. The pharmaceutical composition of claim 32, wherein the heart failure includes new-onset heart failure, acute heart failure, chronic heart failure, acute decompensated heart failure, left heart failure, right heart failure, dual heart failure, systolic dysfunction heart failure, diastolic dysfunction heart failure, systolic and diastolic dysfunction heart failure, high-output heart failure, and restrictive-filling heart failure.
35. The pharmaceutical composition of claim 32, wherein the myocardial infarction includes primary acute myocardial infarction, secondary acute myocardial infarction, PCI-related myocardial infarction, and coronary artery bypass graft-related acute myocardial infarction.
36. The pharmaceutical composition of claim 32, wherein the arrhythmia includes tachycardia, bradycardia, and irregular heart rate.
37. The pharmaceutical composition of claim 32, wherein the coronary artery disease includes asymptomatic myocardial ischemia, angina pectoris, myocardial infarction, and ischemic cardiomyopathy.
38. The pharmaceutical composition of claim 32, wherein the rare cardiac disease includes Brugada syndrome, left ventricular noncompaction (LVNSC), idiopathic pulmonary hypertension (IPAH), and transthyretin amyloid cardiomyopathy.
39. The pharmaceutical composition of claim 32, wherein the cardiac ion channel-related diseases include long QT syndrome, short QT syndrome, BrS syndrome, and catecholamine-sensitive polymorphic ventricular tachycardia (CPVT).
40. The pharmaceutical composition of claim 36, wherein the tachycardia includes sinus tachycardia, atrial tachycardia, atrial flutter, junctional tachycardia, atrial flutter, supraventricular tachycardia, and ventricular tachycardia.
41. The pharmaceutical composition of claim 36, wherein the bradycardia includes sinus arrest, sinus bradycardia, and atrioventricular block.
42. The pharmaceutical composition of claim 36, wherein the arrhythmia includes types of arrhythmias such as premature atrial contractions, atrial fibrillation, sick sinus syndrome, junctional premature beats, premature ventricular contractions, and ventricular fibrillation.
43. The pharmaceutical composition of claim 37, wherein the angina type includes exertional angina, spontaneous angina, and mixed angina.
44. Use of a CD36-targeting ligand in the preparation of a drug targeting cardiomyocytes.
45. Use of a CD36-targeting ligand in the preparation of conjugates targeting cardiomyocytes.
46. Use of a CD36-targeting nucleic acid conjugate in the preparation of a drug targeting cardiomyocytes.
47. A nucleic acid conjugate comprising a CD36-targeting ligand and a nucleic acid molecule, said ligand binding to a CD36 receptor on cardiomyocytes.