Respiratory syncytial virus antigenic polypeptide, nucleic acid and vaccine, and use thereof
By introducing mutations and GS linkers at specific sites in the RSV F protein, combined with mRNA technology, the problem of insufficient immunogenicity of RSV vaccines was solved, resulting in a more efficient immune response and protein expression, and improving the protective effect against RSV.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- SHENZHEN RHEGEN BIOTECHNOLOGY CO LTD
- Filing Date
- 2026-01-14
- Publication Date
- 2026-07-23
AI Technical Summary
Current RSV vaccines lack effective antigen design, making it difficult to increase the neutralizing antibody titer of the prefusion state (F protein), resulting in insufficient immunogenicity and difficulty in effectively preventing respiratory syncytial virus infection, especially in the case of immunocompromised individuals and the elderly.
By introducing mutations at specific amino acid positions in the RSV F protein, such as K176P, L160P, T174P, N175P, L181P, N183P, G184P, Q210P, S211P, C212P, and S213P, and introducing the GS linker at positions 104-144, the pre-fusion state (F protein) is stabilized. Combined with mRNA technology, the coding sequence is optimized to enhance immunogenicity and protein expression levels.
It significantly improved the immunogenicity and protein expression level of the pre-fusion state F protein, enhanced the immune response to RSV, and improved the protective effect of the vaccine.
Smart Images

Figure PCTCN2026072490-FTAPPB-I100001 
Figure PCTCN2026072490-FTAPPB-I100002 
Figure PCTCN2026072490-FTAPPB-I100003
Abstract
Description
Respiratory syncytial virus antigenic peptides, nucleic acids, vaccines, and their applications Technical Field
[0001] This invention relates to a respiratory syncytial virus antigenic polypeptide, nucleic acid, and vaccine, and their applications. Background Technology
[0002] Respiratory syncytial virus (RSV) is a single-stranded, negative-sense RNA virus that encodes 11 proteins. Based on antigenic drift of the G protein, RSV can be divided into two subtypes, A and B. The F protein sequence of RSV is relatively conserved, but it undergoes splicing and fusion conformational changes during infection of host cells.
[0003] Human respiratory syncytial virus (hRSV) can cause diseases affecting the upper respiratory tract, trachea, bronchi, bronchioles, alveoli, pleura, and pleural cavity, as well as the respiratory nerves and muscles. RSV can be transmitted through respiratory droplets or contaminated objects, and can spread to the lower respiratory tract via the nasopharynx or upper respiratory tract mucosa, inducing low respiratory tract infection (LRTI). RSV infection initially presents with flu-like symptoms such as runny nose, loss of appetite, cough, sneezing, fever, wheezing, and a feeling of fullness; these symptoms usually appear in stages.
[0004] RSV is the most common cause of bronchiolitis and pneumonia in children under 1 year old. In a minority of infants infected with RSV, symptoms may include irritability, reduced activity, and difficulty breathing. If it leads to a more severe infection, it can develop into bronchiolitis, inflammation of the small airways in the lungs, pneumonia, and lung infections. Symptoms are more severe and can even be fatal in immunocompromised individuals, the elderly, those with lung disease, and those with heart failure. Individuals infected with RSV may experience difficulty breathing or dehydration; in severe cases, additional oxygen or intubation and mechanical ventilation may be required. If the condition continues to worsen, it can lead to chronic obstructive pulmonary disease (COPD) and serious complications affecting the respiratory and other systems, including pneumonia, sleep apnea, respiratory failure, and heart failure, which can develop into a serious and fatal condition within a year.
[0005] The most significant reason for the lack of RSV vaccine products on the market for decades is the absence of effective antigen design. Long-term research has shown that the RSV surface F glycoprotein exhibits the highest conservation across different strains and elicits high neutralizing antibody titers. A 2013 study by the National Institutes of Health (NIH) revealed that the metastable F protein undergoes conformational changes before and after fusion, and importantly, the site exhibits the highest antibody affinity. and site V only exist in the pre-F conformation of F protein. The research team of NIH achieved the purpose of stabilizing pre-F by introducing cysteine to form disulfide bonds at positions 155 and 290, and the purpose of stabilization was also achieved by replacing the antibody binding site with long-chain hydrophobic amino acids. The team finally obtained the optimal pre-F antigen Ds-CaV1 by combining multiple position substitutions. In 2016, the NIH team continued to optimize the structure and sequence on the basis of the existing one, introduced GS linker at positions 104-144 to eliminate the allosteric effect of pep27 and fusion peptide, and introduced cysteine at positions 149 and 458 to achieve the stability of F protein trimer, thereby further improving the immunogenicity of the antigen. The clinical results of the protein vaccine based on these mutations showed a good protection rate, but there is still a lot of room for improvement according to the data. The application of mRNA technology is likely to improve the immunogenicity of the antigen at the technical level.
[0006] CN10847235A discloses an RSV antigenic polypeptide, which is based on the work of NIH (GS linker + two groups of cysteine + two cavity fillers) and retains the transmembrane region. The secretory protein is transformed into a membrane protein, and better clinical results are obtained, which shows that the transmembrane protein and the C-terminal of F protein help to improve the immunogenicity of the antigen. In addition, the clinical results also show the unique high immunogenicity of mRNA technology.
[0007] The results of years of research show that it is difficult to identify new mutation sites that can maintain pre-F, making it difficult to improve the pre-F neutralizing antibody titer from the antigen angle. SUMMARY
[0008] One object of the present application is to provide a respiratory syncytial virus (RSV) antigenic polypeptide, which can improve the pre-F immunogenicity and / or help to improve the protein expression level.
[0009] Another object of the present application is to provide the use of the respiratory syncytial virus antigenic polypeptide.
[0010] Another object of the present application is to provide a respiratory syncytial virus vaccine.
[0011] Another object of the present application is to provide the use of the respiratory syncytial virus vaccine.
[0012] In one aspect, the present application provides a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof, wherein the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof has one or more mutation sites of the following amino acid residues compared to the amino acid sequence of wild-type Pre-F protein of respiratory syncytial virus:
[0013] positions 174-176, 181-184, 210-213, 160-161.
[0014] According to a specific embodiment of the present application, the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide of the present application refers to a fragment of partial amino acid sequence derived from the respiratory syncytial virus antigenic polypeptide and capable of causing an immune response against RSV. That is, the immunogenic fragment has a truncated amino acid sequence compared to the respiratory syncytial virus antigenic polypeptide of the present application. Preferably, the immunogenic fragment has the same mutation sites as the respiratory syncytial virus antigenic polypeptide of the present application. Preferably, the immunogenic fragment has an amino acid sequence derived from at least positions 100-300 of the respiratory syncytial virus antigenic polypeptide of the present application. Further preferably, the immunogenic fragment has an amino acid sequence derived from at least positions 50-400, further preferably at least positions 26-470, at least positions 26-510, at least positions 25-470, at least positions 25-510, at least positions 24-470, at least positions 24-510, at least positions 23-470, at least positions 23-510, at least positions 22-470, at least positions 22-510, or at least positions 1-470 of the respiratory syncytial virus antigenic polypeptide of the present application.
[0015] In the present application, the positions of the mutation sites are numbered based on the amino acid sequence of wild-type Pre-F protein of respiratory syncytial virus, unless otherwise specified. According to a specific embodiment of the present application, the wild-type Pre-F protein of respiratory syncytial virus is wild-type A strain or B strain Pre-F protein of respiratory syncytial virus. The respiratory syncytial virus antigenic polypeptide of the present application or the immunogenic fragment thereof is a derived sequence obtained after the mutation based on the amino acid sequence of wild-type A strain or B strain Pre-F protein of respiratory syncytial virus. The wild-type Pre-F protein of respiratory syncytial virus is wild-type A strain Pre-F protein of respiratory syncytial virus, and the amino acid sequence is shown in SEQ ID No. 1. The wild-type Pre-F protein of respiratory syncytial virus is wild-type B strain Pre-F protein of respiratory syncytial virus, and the amino acid sequence is shown in SEQ ID No. 32.
[0016] According to a specific embodiment of the application, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the application, the mutation site is selected from one or more of K176, L160, T174, N175, L181, N183, G184, Q210, S211, C212, S213, R213.
[0017] According to a specific embodiment of the application, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the application, the mutation site is a mutation to proline.
[0018] According to a specific embodiment of the application, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the application, the mutation site is selected from one or more of K176P, L160P, T174P, N175P, L181P, N183P, G184P, Q210P, S211P, C212P, S213P.
[0019] According to a specific embodiment of the application, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the application, the mutation site comprises one or more of K176, L160, L181, Q210, S211, R213.
[0020] According to a specific embodiment of the application, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the application, the mutation site is selected from one or more of K176P, L160P, T174P, N175P, L181P, N183P, G184P, Q210P, S211P, C212P, S213P, R213P.
[0021] According to a specific embodiment of the application, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the application, the mutation site is selected from one or more of K176P, L160P, L181P, N183P, G184P, Q210P, S211P, C212P, R213P.
[0022] According to a specific embodiment of the application, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the application, the mutation site comprises K176P.
[0023] According to a specific embodiment of the application, in the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the application, the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof further comprises the following mutations compared to the amino acid sequence of the wild-type Pre-F protein of respiratory syncytial virus:
[0024] the amino acid residues 104-144 are replaced with a GS linker; and / or
[0025] one or more mutation sites selected from P102A, L373R, I379V, M447V.
[0026] According to some embodiments of the present application, the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof of the present application has 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% identity to the amino acid sequence of the wild-type Pre-F protein of respiratory syncytial virus A strain or B strain, except for the mutations described above.
[0027] According to some embodiments of the present application, the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof of the present application has 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% identity to the amino acid sequence of the wild-type Pre-F protein of respiratory syncytial virus A strain or B strain, except for the mutations described above.
[0028] According to some embodiments of the present application, the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof of the present application has 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% identity to the amino acid sequence of the wild-type Pre-F protein of respiratory syncytial virus A strain or B strain, except for the mutations described above.
[0029] According to some embodiments of the present application, the amino acid sequence of the respiratory syncytial virus antigenic polypeptide or the immunogenic fragment thereof of the present application has 90% or more, 95% or more, 96% or more, 97% or more, 98% or more, 99% or more, or 100% identity to the amino acid sequence of the wild-type Pre-F protein of respiratory syncytial virus A strain or B strain, except for the mutations described above.
[0030] According to some embodiments of the present application, the amino acid sequence of the respiratory syncytial virus antigenic polypeptide according to the present application is as set forth in SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12 or SEQ ID No. 30. The immunogenic fragment according to the present application has an amino acid sequence derived from at least positions 50-400, further preferably at least positions 26-470, at least positions 26-510, at least positions 22-470, at least positions 22-510 or at least positions 1-470 of these polypeptides. More preferably, the amino acid sequence of the immunogenic fragment is set forth in positions 26-470, positions 26-510, positions 25-470, positions 25-510, positions 24-470, positions 24-510, positions 23-470, positions 23-510, positions 22-470 or positions 22-510 of the amino acid sequence set forth in SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12 or SEQ ID No. 30.
[0031] In another aspect, the present application also provides a polynucleotide encoding the amino acid sequence of the respiratory syncytial virus antigenic polypeptide according to the present application or an immunogenic fragment thereof.
[0032] According to some embodiments of the present application, the polynucleotide according to the present application is DNA or RNA. The RNA can be mRNA or self-replicating RNA, etc.
[0033] According to some embodiments of the present application, the sequence of the polynucleotide encoding the respiratory syncytial virus antigenic polypeptide according to the present application is as set forth in SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24, SEQ ID No. 28, SEQ ID No. 29 or SEQ ID No. 31.
[0034] According to some specific embodiments of the present invention, the polynucleotide sequence encoding the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide is a fragment derived from the sequences shown in SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24, SEQ ID No. 28, SEQ ID No. 29, or SEQ ID No. 31. That is, the polynucleotide encoding the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide has a truncated nucleotide sequence compared to the polynucleotide encoding the respiratory syncytial virus antigenic polypeptide of the present invention.
[0035] On the other hand, the present invention also provides the use of the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment or the polynucleotide in the preparation of a medicament for treating respiratory syncytial virus infection.
[0036] On the other hand, the present invention also provides the use of the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment or the polynucleotide in the preparation of a respiratory syncytial virus vaccine.
[0037] On the other hand, the present invention also provides a composition of a respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof, comprising: a respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof obtained by performing the aforementioned mutations on the amino acid sequence of the Pre-F protein of wild-type A strain of respiratory syncytial virus, and a respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof obtained by performing the aforementioned mutations on the amino acid sequence of the Pre-F protein of wild-type B strain of respiratory syncytial virus.
[0038] On the other hand, the present invention also provides a nucleotide composition encoding the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention, comprising: nucleotides encoding the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention obtained by performing the aforementioned mutations on the amino acid sequence of the Pre-F protein of wild-type A strain of respiratory syncytial virus, and nucleotides encoding the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof of the present invention obtained by performing the aforementioned mutations on the amino acid sequence of the Pre-F protein of wild-type B strain of respiratory syncytial virus.
[0039] On the other hand, the present invention also provides a pharmaceutical composition comprising:
[0040] One or more of the respiratory syncytial virus antigenic polypeptides or immunogenic fragments thereof of the present invention; and / or
[0041] One or more of the polynucleotides mentioned above in this invention.
[0042] On the other hand, the present invention also provides a respiratory syncytial virus vaccine, comprising:
[0043] At least one mRNA having an open reading frame encoding an antigenic polypeptide of the respiratory syncytial virus or an immunogenic fragment thereof as described in this invention, and
[0044] Pharmaceutically acceptable carrier.
[0045] The respiratory syncytial virus vaccine containing mRNA of the present invention is an mRNA vaccine.
[0046] According to some specific embodiments of the present invention, the respiratory syncytial virus vaccine of the present invention has one or more of the following features:
[0047] The open reading frame is codon-optimized; preferably, the codon optimization is as shown in SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24, SEQ ID No. 28, SEQ ID No. 29 or SEQ ID No. 31; and / or
[0048] The open reading frame further comprises a sequence encoding a signal peptide linked to an RSV antigenic polypeptide or its immunogenic fragment; preferably, the amino acid sequence of the signal peptide is as shown in positions 1-21, 1-22, 1-23, 1-24, or 1-25 of SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12, or SEQ ID No. 30; and / or
[0049] The open reading frame further comprises a sequence encoding a transmembrane region linked to an RSV antigenic polypeptide or its immunogenic fragment; preferably, the amino acid sequence of the transmembrane region is as shown at positions 471-510 of SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12 or SEQ ID No. 30; and / or
[0050] The at least one mRNA comprises at least one chemical modification; preferably, the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methylpseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methylpseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, and 2′-O-methyluridine; preferably, at least 80%, at least 90%, or 100% of the uracil in the open reading frame has a chemical modification; and / or
[0051] The at least one mRNA contains at least one 5′ cap structure; and / or
[0052] The at least one mRNA contains a 3′ polyA tail; and / or
[0053] The vaccine is formulated in nanoparticles; preferably, the nanoparticles have an average diameter of 50 nm to 200 nm; preferably, the nanoparticles are lipid nanoparticles; preferably, the lipid nanoparticles comprise cationic lipids, PEG-modified lipids, sterols, and non-cationic lipids; preferably, the cationic lipids are ionizable cationic lipids, the non-cationic lipids are neutral lipids, and the sterols are cholesterol.
[0054] In some specific embodiments of the present invention, the vaccine of the present invention comprises an mRNA molecule as described above, said mRNA molecule encoding a single type of respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof as described above. Specifically, said mRNA molecule may be an mRNA molecule encoding a mutant polypeptide (e.g., based on the amino acid sequence of the Pre-F protein of wild-type A strain of respiratory syncytial virus) or an immunogenic fragment thereof, or an mRNA molecule encoding a mutant polypeptide () based on the amino acid sequence of the Pre-F protein of wild-type B strain of respiratory syncytial virus or an immunogenic fragment thereof. Preferably, the active mRNA molecules of the mRNA vaccine consist of the same mRNA molecules. More preferably, said mRNA molecule has an open reading frame encoding the amino acid sequence shown in SEQ ID No. 5 or SEQ ID No. 30.
[0055] In some specific embodiments of the present invention, the vaccine of the present invention comprises at least two mRNA molecules, each mRNA molecule having an open reading frame encoding an antigenic polypeptide of the respiratory syncytial virus (RSV) or an immunogenic fragment thereof as described in the present invention. Preferably, the at least two mRNA molecules encode at least two RSV antigenic polypeptides or immunogenic fragments thereof as described above. More preferably, of the at least two mRNA molecules, at least one mRNA molecule encodes a polypeptide or immunogenic fragment thereof based on a mutation in the amino acid sequence of the RSV wild-type A strain Pre-F protein, and at least another mRNA molecule encodes a polypeptide or immunogenic fragment thereof based on a mutation in the amino acid sequence of the RSV wild-type B strain Pre-F protein. Preferably, the amino acid sequence of the polypeptide based on the mutation in the amino acid sequence of the RSV wild-type A strain Pre-F protein is shown in SEQ ID No. 5, and the amino acid sequence of the polypeptide based on the mutation in the amino acid sequence of the RSV wild-type B strain Pre-F protein is shown in SEQ ID No. 30.
[0056] In some specific embodiments of the present invention, the vaccine of the present invention comprises two mRNA molecules, wherein one mRNA molecule encodes a polypeptide or immunogenic fragment thereof that has a mutation in the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain A, and the other mRNA molecule encodes a polypeptide or immunogenic fragment thereof that has a mutation in the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain B. Preferably, the amino acid sequence of the polypeptide that has a mutation in the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain A is as shown in SEQ ID No. 5, and the amino acid sequence of the polypeptide that has a mutation in the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain B is as shown in SEQ ID No. 30. In some preferred embodiments of the present invention, the mRNA molecule comprises an mRNA molecule encoding the amino acid sequence shown in SEQ ID No. 5 and an mRNA molecule encoding the amino acid sequence shown in SEQ ID No. 30. More preferably, the mRNA molecule comprises an mRNA molecule with an open reading frame such as the sequence shown in SEQ ID No. 17, SEQ ID No. 28 or SEQ ID No. 29 and an mRNA molecule with an open reading frame such as the sequence shown in SEQ ID No. 31.
[0057] According to a specific embodiment of the present invention, when the mRNA vaccine of the present invention includes two or more mRNA molecules, the proportion of each mRNA molecule can be any ratio, for example, each can be 1-5 parts by weight, preferably 1-2 parts by weight, and more preferably equal proportions.
[0058] According to a specific embodiment of the present invention, in the mRNA vaccine of the present invention, the ratio of the mRNA molecule encoding a mutant polypeptide or its immunogenic fragment based on the amino acid sequence of the Pre-F protein of wild-type A strain of respiratory syncytial virus to the mRNA molecule encoding a mutant polypeptide or its immunogenic fragment based on the amino acid sequence of the Pre-F protein of wild-type B strain of respiratory syncytial virus can be any ratio, for example, it can be (1-5):(1-5), preferably (1-2):(1-2), and more preferably 1:1.
[0059] On the other hand, the present invention also provides an immunization method comprising administering an effective amount of the vaccine of the present invention to an individual in need.
[0060] According to a specific embodiment of the present invention, the vaccine of the present invention is a single-dose, double-dose, or triple-dose immunization vaccine. For double-dose or triple-dose immunization vaccines, the interval between each two doses can be two weeks, three weeks, or four weeks.
[0061] According to a specific embodiment of the present invention, the single dose of the vaccine of the present invention is 2.5 μg to 20 μg based on the total mRNA, for example, 2.5 μg / dose, 5 μg / dose, 20 μg / dose, 15 μg / dose, or 20 μg / dose.
[0062] According to a specific embodiment of the present invention, the vaccine of the present invention is administered via intramuscular injection.
[0063] Experiments of this invention show that the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment of the present invention having the mutation site, and the polynucleotide encoding the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment of the present invention having the mutation site, can enhance pre-F immunogenicity and / or contribute to the enhancement of protein expression levels. Attached Figure Description
[0064] Figure 1 shows the quantitative data of RSV F protein expression levels in each group in Example 1. The data unit in the figure is ng / 100 μL.
[0065] Figure 2 shows the quantitative statistical analysis of RSV F protein expression levels in each group in Example 1. Data units in the figure: ng / 100μL.
[0066] Figure 3 shows the immunoblotting results of different coding sequence proteins of F-VP6 detected by D25 in Example 1.
[0067] Figure 4 shows the immunoblotting results of different coding sequences of F-VP6 proteins detected by motaz in Example 1.
[0068] Figure 5 shows the antibody titer statistics of mice 14 days after immunization in Example 2.
[0069] Figure 6 shows the antibody titer statistics of mice 28 days after immunization in Example 2.
[0070] Figure 7 shows the statistics of neutralizing antibody titers in mice 28 days after immunization in Example 3.
[0071] Figure 8 shows the results of RSV-A2 neutralizing antibody titer detection in Example 4.
[0072] Figure 9 shows the results of RSV-B neutralizing antibody titer detection in Example 4.
[0073] Figure 10 shows the results of viral load detection in the lungs after challenge in Example 4.
[0074] Figure 11 shows the lung assessment score results in Example 4.
[0075] Figures 12A and 12B show the neutralizing antibody titers induced by different doses of RSV A and RSV B antigens in RSV A and RSV B viral strains.
[0076] Figures 13A and 13B show the neutralizing antibody titers induced by 5 μg RSV A antigen and different doses of RSV B antigen against RSV A and RSV B strains.
[0077] Figures 14A and 14B show the titers of neutralizing antibodies against RSV A2 and RSV B strains in the serum of BALB / c mice after immunization with different doses.
[0078] Figures 15A and 15B show the serum neutralizing antibody titers against RSV A2 and RSV B strains after immunizing BALB / c mice with different procedures.
[0079] Figure 16 shows the viral load in the right lung of a cotton rat after infection with RSV strain A2.
[0080] Figures 17A and 17B show the level of neutralizing antibodies against RSV type A2 strain in the serum of cotton rats.
[0081] Figures 18A and 18B show the neutralizing antibody titers against RSV type B BA9 strain in rat serum.
[0082] Figures 19A to 19E show the expression levels of cytokines in the lungs of cotton rats on day 4 after viral challenge.
[0083] Figure 20 shows the pathological scores of lung tissue in cotton rats on day 4 after viral challenge. Detailed Implementation
[0084] To provide a clearer understanding of the technical features, objectives, and beneficial effects of this invention, the technical solution of this invention is described in detail below, but this should not be construed as limiting the scope of implementation of this invention. Experimental methods in the embodiments that do not specify specific conditions should be performed according to conventional conditions in the relevant field or according to the conditions recommended in the instrument manufacturer's instructions.
[0085] This invention provides 12 RSV F allosteres based on wild-type (WT) RSV F, each allosteric having one of the following mutation sites: L160P, E161P, T174P, N175P, K176P, L181P, N183P, G184P, Q210P, S211P, C212P, and S213P. Furthermore, each allosteric variant incorporates the P102A, 373R, I379V, and M447V mutation sites, and replaces amino acid residues 104-144 of the wild-type RSV F with a GS linker. The amino acid and encoding nucleotide sequences of the wild-type and allosteric RSV F are shown in Table 1.
[0086] Table 1
[0087] Example 1
[0088] In this embodiment, the expression level of pre-fusion RSV F glycoprotein (D25, Mota) on the cell surface was detected by double-antibody sandwich enzyme-linked immunosorbent assay using a specific antibody against it, and the effect of each RSV F allosteric variant on the expression level of RSV pre-F was investigated.
[0089] 1. mRNA transfection of cells
[0090] 293T cells were transfected with 4 μg of mRNA containing different sequences (SEQ ID No. 13-SEQ ID No. 24) (each mRNA was prepared according to standard techniques in its respective field). The cells were cultured in 6-well plates, with approximately two million cells per well. Culture was terminated after 24 hours, and intracellular proteins were collected for total protein quantification.
[0091] 2. Enzyme-linked immunosorbent assay (ELISA) to determine antigen expression levels.
[0092] ① Antibody coating of ELISA plates: Remove the aliquoted antibody protein (Mota) from the refrigerator and dilute it to 2 μg / mL with Coating Buffer (Research Grade Motavizumab, DVV02803). Add 100 μL of the sample to each well of a 96-well plate (Greiner, 655061), cap the plate, and incubate overnight at 2-8℃. Remove the coated 96-well plate, pour off the coating buffer, and remove excess solution to ensure no residue remains in the wells. Wash the plate with 1× Washing Buffer diluted with ultrapure water, 300 μL per well, repeating 3 times. After firmly patting dry any remaining liquid on absorbent paper, add 300 μL of blocking buffer per well, then seal with a sealing film and incubate at 37℃ for 2 hours.
[0093] ② Add the sample to be tested: First, dilute the protein stock solution (cell lysis buffer) from step 1 to 1-2 μg / μL before performing the antigen test. Especially for samples with unknown protein expression, previous studies recommended using a serial dilution method. The serial dilution factors for the samples were set to 40, 80, 160, 320, 640, 1280, and 2560 times. Remove the sealed 96-well plate, wash it, and remove any remaining liquid. Add 100 μl of sample diluent to the blank wells, and add 100 μl of standard or test sample to the remaining wells (be careful to avoid air bubbles; add the sample to the bottom of the well, avoiding contact with the well walls; the sample should be loaded onto one plate within 10 minutes). Cover the plate with a membrane and incubate at 37℃ for 2 hours. To ensure the validity of the experimental results, please use a fresh standard solution for each experiment.
[0094] ③ Add detection antibody: Remove the blocked 96-well plate, pour off the coating solution, clean up any residual liquid, and wash 5 times. Dilute the detection antibody Anti-HRSV-A F / Fusion glycoprotein F0 Antibody(D25)(RVV02809)-Bioti (concentration 0.79mg / ml) at a ratio of 1:2000. Add 100μL of the diluted antibody to each well of the 96-well plate, seal the plate with a sealing film, and incubate at 37°C in the dark for 1 hour.
[0095] ④ Add substrate solution: Remove the 96-well plate after adding the detection antibody, pour off the coating solution, and clean off any residual liquid 5 times. Dilute HRP-conjugated Streptavidin (SA00001-0) at a ratio of 1:10000, add 100 μL of the diluted HRP-conjugated Streptavidin to each well of the 96-well plate, seal the plate with a sealing membrane, and incubate at 37°C in the dark for 30 min.
[0096] ⑤ Color development and OD value detection: Turn off the indoor light source, remove the 96-well plate after incubating the secondary antibody, and discard the primary antibody liquid to wash 5 times. Take out the disposable sample container and place it in a light-proof box. Pour the TMB solution into the sample container, and add 100 μL of TMB to each well using a multi-channel pipette. Incubate in the dark for 20 minutes (do not exceed 25 minutes). At this time, positive samples will turn blue. The sample addition time and waiting time for each plate must be recorded to prevent experimental errors. After the color development time is up, add 100 μL of Stop Solution to each well using a multi-channel pipette. At this time, the sample will first turn yellow. Measure its absorbance at 450 nm. After adding the Stop Solution to each plate, please read the plate within two minutes, otherwise the absorbance of the blank wells will increase and the absorbance of the sample wells will decrease. The microplate reader program should be set to absorbance at 450 nm and low-speed shaking for 5 seconds.
[0097] The results of RSV F glycoprotein detection on the cell surface before fusion are shown in Figures 1 and 2. The results indicate that each RSV F allosteric variant of the present invention contributes to the increase of RSV pre-F expression.
[0098] Based on the aforementioned RSV F variant expression verification results, F-VP6 exhibits the best expression level and stability. Therefore, this embodiment further optimized the sequence of this mutant (optimized sequences are shown in SEQ ID No. 28 and SEQ ID No. 29, respectively) to demonstrate that different coding sequences all have good expression levels. The cell culture and protein extraction experiments were performed as above, and the protein immunoblotting experiment is as follows:
[0099] (1) The prepared protein samples were sequentially spotted into 4%-20% protein gels, electrophoresed at 80V for 30 min, and then electrophoresed at 120V for 55 min.
[0100] (2) Transfer: Label membranes 1 to 8 in sequence. When transferring two membranes at the same time, use 25V, 2.5A, for 12min.
[0101] (3) Sealing: Wash the NC membrane with pure water for 10 min, then transfer the membrane to a petri dish, add 15 mL of 5% skim milk and seal at room temperature for 1 h;
[0102] (4) Primary antibody incubation: For membranes 1, 2, 3, and 4, the D25 monoclonal antibody was diluted 1:3000 in 5 ml of 5% skim milk and incubated at 4°C for 15 hours using a roller mixer. For membranes 5, 6, 7, and 8, the MOTA monoclonal antibody was diluted 1:3000 in 5 ml of 5% skim milk and incubated at 4°C for 15 hours using a roller mixer.
[0103] (5) Primary antibody elution: After the primary antibody incubation is completed, remove the primary antibody solution, place the membrane in TBST and shake and wash it 3 times on a shaker for 15 min each time;
[0104] (6) Secondary antibody incubation: All membranes 1-8 were incubated with human secondary antibody: HRP-conjugated Affinipure Goat Anti-human IgG (H+L) was diluted 1:1000 into 5 mL of 5% skim milk according to the instructions and incubated at room temperature for 1 h in a roller mixer;
[0105] (7) Secondary antibody elution: After the secondary antibody incubation is completed, remove the secondary antibody solution, place the membrane in TBST and shake and wash it 3 times on a shaker for 15 minutes each time. After elution, immerse the membrane in TBST solution.
[0106] (8) Development: Prepare the developing solution (thermo), mix 4000 μL of developing solution A and 4000 μL of developing solution B for later use; place the membrane of each B sample (intracellular sample) in the imaging instrument tray, add 500 μL of developing solution to the surface, and expose for 40 seconds.
[0107] The results are shown in Figures 3 and 4. They demonstrate that different optimized sequences can all express F-VP6 protein normally, and D25 and mota antibody tests show clear signals at the correct positions. Therefore, it can be inferred that F-VP6 has a good pre-F structure.
[0108] Example 2
[0109] This embodiment uses F-VP6 from Example 1 as an example to investigate the in vivo immunogenicity (mouse binding antibody) of the RSV F variant of the present invention in mice.
[0110] 1. Methods and Grouping
[0111] The in vitro synthesis of the mRNA used in the experiment was performed according to standard procedures in the relevant field. In this embodiment, the target mRNA molecule of F-VP6, in addition to the coding sequence (SEQ ID No. 17), also includes a 5' UTR (GGAGATAAGAGAGAAAAGAAGAGTAAGAAGAAATATAAGAGCCGCCACC, SEQ ID No. 25) and a 3' UTR (GCTGCCTTCTGCGGGGCTTGCCTTCTGGCCATGCCCTTCTTCTCTCCCTTG CACCTGTACCTCTTGGTCTTTGAATAAAGCCTGAGTAGGAAG, SEQ ID No. 26), a 5' CAP of Cap2-6 (structure shown in Formula I), a 3' polyA tail (AAA ...
[0112] The target mRNA of F-VP6 was encapsulated in T19-5 LNPs (the composition and molar ratio of T19-5 LNPs were: T19 (structure as shown in Formula II), 48%; DSPC, 16%; DMG-PEG2000, 1.5%; CHOL, 34.5%), with a particle size of approximately 100 nm, and injected intramuscularly (IM) into eight-week-old BALB / c mice (n=10 per group). The mRNA was administered at two-week intervals, with a single injection dose of 5 μg, and serum was collected weekly. Serum binding antibody titers against D14 and D28 pre-F glycoproteins were determined by ELISA.
[0113] The pre-fusion F-specific IgG titer was measured two weeks after a single administration (i.e., 14 days after mouse immunization) and two weeks after two administrations (i.e., 28 days after mouse immunization).
[0114] 2. The specific experimental procedure is as follows:
[0115] ① Sample dilution
[0116] Blood was collected from the marginal eye of mice, and the supernatant was collected by high-speed centrifugation, with a minimum volume of 50 μL. Serum (primary antibody) was diluted: the sample was diluted to gradients of 4000x, 40000x, 400000x, 4000000x, 8000000x, 20000000x, and 40000000x. The serum dilution method can refer to the following steps: The control serum (CK) was diluted to three gradients of 40x, 400x, and 4000x. The liquid addition procedure was the same as for the serum. Note that a control should be included in each 96-well plate.
[0117] ② Enzyme-linked immunosorbent assay
[0118] Remove the aliquoted pre-F protein from the refrigerator and dilute it to 2 μg / mL with Coating Buffer. Add 100 μL of the HRSV(A) Fusion glycoprotein F0, His Tag (RSF-V52H7) to each well of a 96-well plate (Greiner, 655061). Cap the plate and incubate overnight at 2-8°C. Remove the coated 96-well plate, pour off the coating buffer, and remove any excess solution to ensure no residue remains in the wells. Wash the plate with 300 μL of 1× Washing Buffer diluted with ultrapure water, repeating 3 times. After firmly patting dry on absorbent paper, add 300 μL of blocking buffer to each well, then seal with a sealing membrane and incubate at 37°C for 2 hours.
[0119] Remove the coated 96-well plate, pour off the coating solution, and ensure no residue remains in the wells. Wash the plate with 1× Washing Buffer diluted with ultrapure water, 300 μL per well, repeating the wash 3 times. After removing any residual liquid, add 300 μL of Blocking Diluent per well, then seal the plate with a sealing membrane and incubate at 4°C for 2 hours.
[0120] Pour off the coating solution and clean up any residual liquid; add the diluted test serum sample and control group serum sample, take three times for each sample, 100 μL each time, and make three parallel replicates. Note that a blank control and CK should be set up for each plate.
[0121] Dilute Goat pab to Ms IgG (HRP) with Dilution buffer at a ratio of 1:10000 (the dilution factor should be determined according to the instructions), and vortex to mix. Remove the 96-well plate after primary antibody incubation, discard the primary antibody liquid, and clean the remaining liquid until no residue remains in the wells. Wash the plate 5 times with a plate washer to remove any remaining liquid; add 100 μL of the diluted antibody to each well of the 96-well plate, seal with sealing film, and incubate at room temperature in the dark for 1 hour.
[0122] Turn off the indoor lights, remove the 96-well plate after incubating the secondary antibody, and rinse 5 times by discarding the primary antibody solution. Place the disposable sample container in a light-proof box, pour the TMB solution into the sample container, and add 100 μL of TMB to each well using a multi-channel pipette. Incubate in the dark for 20 minutes (do not exceed 25 minutes). At this time, positive samples will turn blue. Record the addition time and waiting time for each plate to prevent experimental errors. After the incubation time is up, add 100 μL of Stop Solution to each well using a multi-channel pipette. The sample will initially turn yellow. Measure the absorbance at 450 nm. Read the plate within two minutes after adding the Stop Solution; otherwise, the absorbance of the blank wells will increase and the absorbance of the sample wells will decrease. Set the microplate reader program to absorbance at 450 nm and low-speed shaking for 5 seconds.
[0123] The antibody titer detection results are shown in Figures 5 and 6, indicating that the F-VP6 of the present invention can induce a high pre-F binding antibody titer.
[0124] Example 3
[0125] This embodiment provides the detection of neutralizing antibodies in samples from mice immunized 28 days after immunization in Example 2 to measure the level of RSV-A2 neutralizing antibodies in the serum of immunized mice.
[0126] The main experimental procedure was to inactivate the sample by incubating it at 56°C for 30 minutes, and then use the Plaque Reduction Neutralization Test (PRNT) to detect the neutralizing titer of the respiratory syncytial virus in the serum.
[0127] RSV A2 strain (or RSV A2 strain with RFP fluorescent tag) was diluted to approximately 80 plaque units (PFU) per inoculation dose. Equal volumes of serially diluted serum were added, and the mixture was incubated at 37°C for 60 minutes. Each dilution was then inoculated into two wells of a 24-well plate containing pre-converted cells (0.2 mL per well). The plates were incubated at 37°C for 2 hours to allow adsorption. The inoculation solution was then discarded, and the plates were incubated with pre-warmed medium containing 0.8% methylcellulose at 37°C for 72 hours. The number of plaques formed per well was counted using an antibody immunopilot assay (or fluorescent plaque assay), and the neutralizing titer of the serum that reduced plaques by 50% was calculated.
[0128] The results of the neutralizing antibody titer test are shown in Figure 7. Combining Figures 6 and 7, it can be seen that although the antibody binding rate of the mouse samples 28 days after immunization was not significantly different from that of the control WT group, reaching saturation levels, the F-VP6 antigen value involved in this invention was slightly higher than that of the WT control. It is noteworthy that the results in Figure 7 show that the F-VP6 antigen designed in this invention can induce a higher level of neutralizing antibody titer compared to the wild type.
[0129] Example 4: In vivo immunogenicity study (cotton rats)
[0130] Immunogenicity of F-VP6 was evaluated in rats. The purpose of this study was to evaluate the immunogenicity, efficacy, and safety of F-VP6 as an antigen in a rat model, and to assess the likelihood of enhanced respiratory disease (ERD) at the proposed dose, including viral load and lung pathology evaluation after challenge.
[0131] F-VP6 mRNA (same as in Example 2) was formulated in lipid nanoparticles, the lipid nanoparticles being the same as the T19-5LNP in Example 2. Formaldehyde-treated RSV virus (groups) and unimmunized / unchallenged groups served as controls. Female rats (6-8 weeks old) were divided into 5 groups of 10 each, including low-dose and high-dose groups. Immunization was performed according to the timelines shown in Table 2. Groups 1 and 2 were the low-dose and high-dose LNP-mRNA (F-VP6) groups, respectively; Group 3 was the formaldehyde-treated RSV virus group (FI-RSV); and Groups 4 and 5 were the unimmunized / unchallenged groups, respectively. Blood was collected on day 56 for neutralizing antibody titer identification, and mice were challenged intranasally with 5 log10 RSV A2. Animals were sacrificed on day 61, and lung tissue was collected for viral load determination and pathological evaluation.
[0132] Table 2
[0133] For evaluation, the neutralizing antibody detection method was the same as in Example 3. For lung pathology and viral load evaluation, sample extraction included transferring sections of the right lung (4 lobes) into MACS tissue homogenizer tubes, tightening the caps, and proceeding to the next step. 2 mL of DPBS was added to the tissue homogenizer tubes. The tubes were then placed in a MACS tissue homogenizer and homogenized using the RNA-01-01 program. The homogenizer tubes were centrifuged at 1000g for 5 min to remove foam and tissue residue. The residue was then transferred to a biosafety cabinet, and the homogenate was stored at -80°C.
[0134] The results of the rat evaluation experiment are shown in Figures 8-11. The results showed that both 10 μg and 20 μg F-VP6 inoculation induced neutralizing antibodies against RSV A and RSV B strains. After challenge, the viral load in the lungs of immunized rats was significantly lower than that of unimmunized rats, and the rate of weight loss was also slower in the immunized group, with reduced lung damage. The vaccine efficacy was evaluated based on clinical symptoms, weight changes, neutralizing antibody titers, lung tissue pathological changes, and viral load. The following conclusions can be drawn: In the rat model, vaccination with 10 μg / rat and 20 μg / rat can induce neutralizing antibodies against RSV A / B strains and provide protection against infection with RSV A / B strains.
[0135] Example 5: Immunogenicity Study of Different Antigen Combinations
[0136] In this embodiment, the mRNA used encodes a mutant polypeptide or its immunogenic fragment based on the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain A, namely F-VP6 (amino acid sequence SEQ ID No. 5, nucleotide sequence SEQ ID No. 17) in Example 1, which is named RSV-A in this embodiment. The mRNA used encodes a mutant polypeptide or its immunogenic fragment based on the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain B, which is named RSV-B, and its sequence corresponds to F-VP6-6 (amino acid sequence SEQ ID No. 30, nucleotide sequence SEQ ID No. 31) in Table 1. The vaccine containing the two mRNA molecules (RSV-A and RSV-B) is named RSV-A+B or RSV-A:B, or a two-mRNA combination vaccine. The modification of each mRNA is the same as in Example 1.
[0137] SPF-grade female BALB / c mice were used, and the immunization schedule was two injections 14 days apart, administered intramuscularly. Each mouse received a different dose. The recombinant protein vaccines AREXVY (GlaxoSmithKline) and ABRYSVO (Pfizer) were used as controls to investigate the effect of different immunization doses on immunization efficacy. The primary assay was to measure the titers of neutralizing antibodies against RSV A2 and RSV B strains in serum two weeks after the last immunization. Information regarding immunization doses and schedules is shown in Table 3.
[0138] Table 3. Overview of Experimental Design
[0139] BALB / c mice were immunized with two combined mRNA vaccines of respiratory syncytial virus (RSV) at different doses, 14 days apart. BALB / c mice were also immunized with two combined AREXVY and ABRYSVO recombinant protein vaccines at a dose of 12 μg / mouse (1 / 10HD), 14 days apart. Blood samples were collected 14 days after the second immunization (D28) to detect RSV A2 and RSV B virus neutralizing antibody titers. The study investigated the immunization effects of different doses and ratios of the two combined mRNA vaccines of RSV to provide data support and a reasonable and scientific theoretical basis for the clinically intended dosage.
[0140] Referring to Figure 12A, 14 days after the second immunization, the geometric mean titers of neutralizing antibodies against RSV A virus in the serum of mice in the RSV-A (2.5 μg), RSV-A (5 μg), and RSV-A (10 μg) groups were 941 (95% CI: 570, 1555), 2578 (95% CI: 1162, 5718), and 2576 (95% CI: 1624, 4085), respectively; the geometric mean titers of neutralizing antibodies against RSV A virus in the serum of mice in the RSV-B (2.5 μg), RSV-B (5 μg), and RSV-B (10 μg) groups were 339 (95% CI: 168, 683), 389 (95% CI: 267, 567), and 804 (95% CI: 508, 1272), respectively. The geometric mean titers of neutralizing antibodies against RSV A in the serum of mice in the A:B (2.5μg:2.5μg) group, RSV A:B (5μg:5μg) group, and RSV A:B (10μg:10μg) group were 1185 (95% CI: 499, 2816), 2670 (95% CI: 1922, 3708), and 4750 (95% CI: 2931, 7700), respectively. The geometric mean titer of neutralizing antibodies against RSV A in the serum of mice in the GSK-AREXVY group was 1163 (95% CI: 536, 2523). Fourteen days after the second dose of the Pfizer-ABRYSVO recombinant protein vaccine, most mice did not develop neutralizing antibodies against RSV A.The geometric mean titer of RSV-A virus neutralizing antibody in the serum of mice in the RSV-A (2.5 μg) group was not significantly different from that in the RSV-B (2.5 μg:2.5 μg) group (Mann-Whitney test P value: 0.3095). The geometric mean titer of RSV-A virus neutralizing antibody in the serum of mice in the RSV-A (5 μg) group was not significantly different from that in the RSV-B (5 μg:5 μg) group (Mann-Whitney test P value: 0.9372). The geometric mean titer of RSV-A virus neutralizing antibody in the serum of mice in the RSV-A (10 μg) group was significantly lower than that in the RSV-B (10 μg:10 μg) group (Mann-Whitney test P value: 0.0043). The geometric mean titer of RSV-A virus neutralizing antibody in the serum of mice in the RSV-B (2.5 μg:2.5 μg) group was significantly lower than that in the RSV-B (2.5 μg:2.5 μg) group. There was no significant difference between the RSV A:B (5μg:5μg) group and the GSK-AREXVY group (Mann-Whitney test P values: 0.1320, 0.9372), but the RSV A:B (10μg:10μg) group had significantly lower levels than the RSV A:B (10μg:10μg) group (Mann-Whitney test P value: 0.0022). The geometric mean titer of RSV A virus neutralizing antibody in the serum of the RSV A:B (5μg:5μg) group was significantly lower than that in the RSV A:B (10μg:10μg) group (Mann-Whitney test P value: 0.0260), but significantly higher than that in the GSK-AREXVY group (Mann-Whitney test P value: 0.0411). The geometric mean titer of RSV A virus neutralizing antibody in the serum of the RSV A:B (10μg:10μg) group was significantly higher than that in the GSK-AREXVY group (Mann-Whitney test P value: 0.0411). P-value: 0.0087.
[0141] Referring to Figure 12B, 14 days after the second immunization, the geometric mean titers of neutralizing antibodies against RSV B virus in the serum of mice in the RSV-A (2.5 μg), RSV-A (5 μg), and RSV-A (10 μg) groups were 152 (95% CI: 97,240), 273 (95% CI: 155,481), and 268 (95% CI: 158,455), respectively; the geometric mean titers of neutralizing antibodies against RSV B virus in the serum of mice in the RSV-B (2.5 μg), RSV-B (5 μg), and RSV-B (10 μg) groups were 1011 (95% CI: 431,2372), 1043 (95% CI: 826,1318), and 2728 (95% CI: 1193,6233), respectively. The geometric mean titers of neutralizing antibodies against RSV B virus in the serum of mice in the A:B (2.5μg:2.5μg) group, RSV A:B (5μg:5μg) group, and RSV A:B (10μg:10μg) group were 589 (95% CI: 401, 866), 1216 (95% CI: 646, 2289), and 1780 (95% CI: 1031, 3074), respectively. The geometric mean titer of neutralizing antibodies against RSV B virus in the serum of mice in the AREXVY group was 90 (95% CI: 37, 221). Fourteen days after the second dose of Pfizer-ABRYSVO recombinant protein vaccine, most mice did not develop neutralizing antibodies against RSV B virus.The geometric mean titer of RSV-A (2.5 μg) neutralizing antibody against RSV B virus in mouse serum was significantly lower than that in the RSV A:B (2.5 μg:2.5 μg) group (Mann-Whitney test, P: 0.0022). The geometric mean titer of RSV-A (5 μg) neutralizing antibody against RSV B virus in mouse serum was significantly lower than that in the RSV A:B (5 μg:5 μg) group (Mann-Whitney test, P: 0.0022). The geometric mean titer of RSV-A (10 μg) neutralizing antibody against RSV B virus in mouse serum was significantly lower than that in the RSV A:B (10 μg:10 μg) group (Mann-Whitney test, P: 0.0022). The geometric mean titer of RSV A:B (2.5 μg:2.5 μg) neutralizing antibody against RSV B virus in mouse serum was significantly lower than that in the RSV A:B (5 μg:5 μg) group and the RSV A:B (5 μg:5 μg) group. The geometric mean titer of RSV B virus neutralizing antibody in the serum of mice in the RSV A:B (10μg:10μg) group was significantly higher than that in the GSK-AREXVY group (Mann-Whitney test P value: 0.0022) than that in the GSK-AREXVY group (Mann-Whitney test P value: 0.0022). There was no significant difference between the RSV A:B (5μg:5μg) group and the RSV A:B (10μg:10μg) group (Mann-Whitney test P value: 0.2403), but the RSV A:B (5μg:5μg) group was significantly higher than that in the GSK-AREXVY group (Mann-Whitney test P value: 0.0022). The geometric mean titer of RSV B virus neutralizing antibody in the serum of mice in the RSV A:B (10μg:10μg) group was significantly higher than that in the GSK-AREXVY group (Mann-Whitney test P value: 0.0022). This indicates that the co-encapsulation of RSV A antigen and RSV B antigen mRNA does not interfere with each other, and both are superior to marketed recombinant protein vaccines.
[0142] In this embodiment, 5 μg of RSV A antigen mRNA and different amounts of RSV B antigen mRNA were mixed for an immunization experiment to compare the intensity of the immune response.
[0143] Referring to Figure 13A, the geometric mean titer of neutralizing antibody against RSV A virus in the serum of mice in the RSV A:B (5μg:2.5μg) group was 1866 (95% CI: 1268, 2744), and the geometric mean titer of neutralizing antibody against RSV A virus in the serum of mice in the RSV A:B (5μg:10μg) group was 2726 (95% CI: 1982, 3748). The geometric mean titer of RSV A virus neutralizing antibody in the serum of mice in the RSV A:B (5μg:2.5μg) group was not significantly different from that in the RSV-A (5μg), RSV A:B (5μg:5μg), RSV A:B (5μg:10μg), and GSK-AREXVY groups (Mann-Whitney test P values: 0.6991, 0.1320, 0.0649, 0.1797, respectively). The geometric mean titer of RSV A virus neutralizing antibody in the serum of mice in the RSV A:B (5μg:5μg) group was not significantly different from that in the RSV-A (5μg) and RSV A:B (5μg:10μg) groups (Mann-Whitney test P values: 0.9372, >0.9999), but was significantly higher than that in the GSK-AREXVY group (Mann-Whitney test P values: 0.9372, >0.9999). P value: 0.0411), the geometric mean titer of RSV A virus neutralizing antibody in the serum of mice in the RSV A:B (5μg:10μg) group was not significantly different from that in the GSK-AREXVY group (Mann-Whitney test P value: 0.0649).
[0144] Referring to Figure 13B, the geometric mean titer of neutralizing antibody against RSV B virus in the serum of mice in the RSV A:B (5μg:2.5μg) group was 674 (95% CI: 377, 1206), and the geometric mean titer of neutralizing antibody against RSV B virus in the serum of mice in the RSV A:B (5μg:10μg) group was 2855 (95% CI: 1804, 4519). The geometric mean titer of RSV B virus neutralizing antibody in the serum of mice in the RSV A:B (5μg:2.5μg) group was not significantly different from that in the RSV-B (2.5μg) group and the RSV A:B (5μg:5μg) group (Mann-Whitney test P values: 0.4848, 0.1797, respectively), but was significantly higher than that in the GSK-AREXVY group (Mann-Whitney test P value: 0.0022) and lower than that in the RSV A:B (5μg:10μg) group (Mann-Whitney test P value: 0.0411). Similarly, the geometric mean titer of RSV B virus neutralizing antibody in the serum of mice in the RSV A:B (5μg:5μg) group was not significantly different from that in the RSV-B (5μg) group (Mann-Whitney test P value: 0.8182), but was significantly higher than that in the GSK-AREXVY group (Mann-Whitney test P value: 0.8182). The titer of neutralizing antibody against RSV B virus in the serum of mice in the RSV A:B (5μg:10μg) group was significantly lower than that in the RSV A:B (5μg:10μg) group (Mann-Whitney test, P value: 0.0411). The geometric mean titer of neutralizing antibody against RSV B virus in the serum of mice in the RSV A:B (5μg:10μg) group was significantly higher than that in mice in the GSK-AREXVY group (Mann-Whitney test, P value: 0.0022).
[0145] Considering the neutralizing antibody levels of both RSV A and RSV B virus strains, a 1:1 ratio of RSV A antigen mRNA to RSV B antigen mRNA yielded the best results.
[0146] SPF-grade female BALB / c mice were immunized with RSV-A+B (5+5 μg / mouse) via intramuscular injection, using two-dose regimens with a 14-day interval and three-dose regimens with a 14-day interval. The recombinant protein vaccines AREXVY (GlaxoSmithKline) and ABRYSVO (Pfizer) were used as controls. The titers of neutralizing antibodies against RSV A2 and RSV B strains in serum were measured 14 days after the last immunization. Grouping, immunization dosage, and procedures are shown in Table 4.
[0147] Table 4. Overview of Experimental Design
[0148] Referring to Figure 14A, the geometric mean titer of neutralizing antibodies against RSV A2 in mouse serum 14 days after a single dose of RSV-A+B (5+5 μg / mouse) was 1200 (95% CI: 581, 2479). With a 14-day interval between two doses, the geometric mean titer of neutralizing antibodies against RSV A2 in mouse serum 14 days after the second dose was 2670 (95% CI: 1922, 3708). With a 14-day interval between three doses, the geometric mean titer of neutralizing antibodies against RSV A2 in mouse serum 14 days after the second dose was 2942 (95% CI: 1787, 4844). The geometric mean titer of neutralizing antibodies against RSV A2 in the GSK-AREXVY group was 1163 (95% CI: 536, 2523). Fourteen days after the second dose of the Pfizer-ABRYSVO recombinant protein vaccine, most mice did not develop neutralizing antibodies against RSV A2. There was no significant difference in the titer of neutralizing antibodies against RSV A2 in mouse serum after a single immunization compared to after two immunizations (Mann-Whitney test, P: 0.0649), but it was significantly lower than that after three immunizations (Mann-Whitney test, P: 0.0260). There was no significant difference in the titer of neutralizing antibodies against RSV A2 in mouse serum after two immunizations compared to after three immunizations (Mann-Whitney test, P: 0.6991).
[0149] Referring to Figure 14B, the geometric mean titer of neutralizing antibodies against RSV B in mouse serum 14 days after a single dose of RSV-A+B (5+5 μg / mouse) was 635 (95% CI: 376, 1073). After a 14-day interval between two doses, the geometric mean titer of neutralizing antibodies against RSV B in mouse serum 14 days after the second dose was 1216 (95% CI: 646, 2289). After a 14-day interval between three doses, the geometric mean titer of neutralizing antibodies against RSV B in mouse serum 14 days after the second dose was 3970 (95% CI: 2404, 6555). The geometric mean titer of neutralizing antibodies against RSV B in the GSK-AREXVY group was 90 (95% CI: 37, 221). Most mice did not develop neutralizing antibodies against RSV B 14 days after the second dose of the Pfizer-ABRYSVO recombinant protein vaccine. There was no significant difference in the titer of neutralizing antibodies against RSV B in mouse serum after a single immunization and after two immunizations (Mann-Whitney test P value: 0.1320), but it was significantly lower than that after three immunizations (Mann-Whitney test P value: 0.0022). The titer of neutralizing antibodies against RSV B in mouse serum after two immunizations was significantly lower than that after three immunizations (Mann-Whitney test P value: 0.0087).
[0150] SPF-grade female BALB / c mice were immunized with RSV-A+B (5+5 μg / mouse) via intramuscular injection at intervals of 14, 21, and 28 days. The recombinant protein vaccines AREXVY (GlaxoSmithKline) and ABRYSVO (Pfizer) were used as controls. The titers of neutralizing antibodies against RSV A2 and RSV B strains in serum were measured 14 days after the last immunization. Grouping, immunization dosage, and procedures are shown in Table 5.
[0151] Table 5. Overview of Experimental Design
[0152] Referring to Figure 15A, for mice immunized with RSV-A+B (5+5 μg / mouse) at a 14-day interval between two doses, the geometric mean titer of neutralizing antibodies against RSV A2 in mouse serum 14 days after the second dose was 2670 (95% CI: 1922, 3708). At a 21-day interval, the geometric mean titer of neutralizing antibodies against RSV A2 in mouse serum 14 days after the second dose was 5938 (95% CI: 4253, 8289). At a 28-day interval, the geometric mean titer of neutralizing antibodies against RSV A2 in mouse serum 14 days after the second dose was 2585 (95% CI: 1249, 5352). The geometric mean titer of neutralizing antibodies against RSV A2 in the GSK-AREXVY group was 1163 (95% CI: 536, 2523). Fourteen days after the second dose of the Pfizer-ABRYSVO recombinant protein vaccine, most mice did not develop neutralizing antibodies against RSV A2 virus.
[0153] Referring to Figure 15B, for mice immunized with RSV-A+B (5+5 μg / mouse) at a 14-day interval between two doses, the geometric mean titer of neutralizing antibodies against RSV B in mouse serum 14 days after the second dose was 1216 (95% CI: 646, 2289). At a 21-day interval, the geometric mean titer of neutralizing antibodies against RSV B in mouse serum 14 days after the second dose was 5342 (95% CI: 2996, 9526). At a 28-day interval, the geometric mean titer of neutralizing antibodies against RSV B in mouse serum 14 days after the second dose was 7157 (95% CI: 5045, 10154). The geometric mean titer of neutralizing antibodies against RSV B in the GSK-AREXVY group mice was 90 (95% CI: 37, 221). Fourteen days after the second dose of the Pfizer-ABRYSVO recombinant protein vaccine, the vast majority of mice did not develop neutralizing antibodies against RSV B virus.
[0154] There were significant differences in serum RSV A2 neutralizing antibody titers between doses of RSV-A+B (5+5μg / animal) 14 days after two doses and 21 days after two doses (Mann-Whitney test, P value: 0.0022); there were no significant differences in serum RSV A2 neutralizing antibody titers between doses of RSV-A+B (5+5μg / animal) 14 days after two doses and 28 days after two doses (Mann-Whitney test, P value: 0.4848); and there were significant differences in serum RSV A2 neutralizing antibody titers between doses of RSV-A+B (5+5μg / animal) 21 days after two doses and 28 days after two doses (Mann-Whitney test). P value: 0.0411); For the dose of RSV-A+B (5+5μg / animal), there were significant differences in serum RSV B neutralizing antibody titers between two doses administered 14 days apart and between two doses administered 21 days apart (Mann-Whitney test P value: 0.0087); For the dose of RSV-A+B (5+5μg / animal), there were significant differences in serum RSV B neutralizing antibody titers between two doses administered 14 days apart and between two doses administered 28 days apart (Mann-Whitney test P value: 0.0022); For the dose of RSV-A+B (5+5μg / animal), there were no significant differences in serum RSV B neutralizing antibody titers between two doses administered 21 days apart and between two doses administered 28 days apart (Mann-Whitney test P value: 0.3095).
[0155] Example 6: Protection against viral challenge in cotton rats using two mRNA combined vaccines
[0156] This study used a 7-week-old female cotton rat model, immunized with a combined respiratory syncytial virus (RSV) mRNA vaccine administered intramuscularly in the thigh on days 0 and 28. On day 56, the RSV A2 strain (RSV-A2) (1×10⁻⁶) was administered. 6 Animals were attacked with PFU / animal via nasal administration. Clinical symptoms, weight changes, viral load in lung tissue 4 days after challenge, pathological changes in lung tissue, and lung cytokine detection were assessed. Neutralizing antibody titers in mouse serum before challenge were also evaluated to assess the vaccine's protective effect against respiratory syncytial virus (RSV). Experimental group information is shown in Table 6, where the FI-RSV group received formaldehyde-inactivated RSV vaccine.
[0157] Table 6. Experimental Groups and Information Table
[0158] To determine the protective efficacy of the vaccine, RNA was extracted from the right lung of rats and homogenized to detect the expression level of the N gene of RSV type A2 strain. The experimental results are shown in Figure 16. On day 4 post-challenge, the viral load in the right lung of rats in the 10μg group was 1.51 × 10⁻⁶. 8 The viral load in the right lung of the 20μg group of mice was 1.57×10 copies / g. 8 The viral load in the right lung of the FI-RSV group mice was 8.24 × 10 copies / g. 9 The viral load in the right lung of the AREXVY-GSK group mice was 4.16 × 10 copies / g. 8 The viral load in the right lung of mice in the ABRYSVO-Pfizer group was 2.94 × 10 copies / g. 9 The viral load in the right lung of mice in the saline-challenged group was 1.08 × 10⁻⁶ copies / g. 11 copies / g.
[0159] Serum was collected from rats 14 days after the second immunization, and the level of neutralizing antibodies against RSV type A2 strain was detected by immunoplaque assay. The results are shown in Figures 17A and 17B.
[0160] The serum dilutions (defined as IC50 values) at which 10 μg and 20 μg rat serum achieved half-maximal inhibition (50% inhibitory concentration, IC50) against RSV type A A2 strain were 19625 (95% CI: 11960, 32203) and 25311 (95% CI: 19335, 33134), respectively. The IC50 value of FI-RSV group rat serum against RSV type A A2 strain was 719.8 (95% CI: 292.3, 1773), the IC50 value of AREXVY-GSK group rat serum against RSV type A A2 strain was 4441 (95% CI: 3025, 6520), and the IC50 value of ABRYSVO-Pfizer group rat serum against RSV type A A2 strain was [not specified in the original text]. The IC50 value of RSV strain A2 was 1485 (95% CI: 973.6, 2264). Neutralizing antibodies against RSV strain A2 were not detected in the serum of rats in both the saline-challenged and saline-unchallenged groups.
[0161] Converting the above antibody IC50 values to international standard units (IU / mL), the neutralizing antibody titers against RSV type A A2 strain in the serum of rats in the 10 μg and 20 μg groups were 49206 IU / mL (95% CI: 29987, 80743) and 63465 IU / mL (95% CI: 48480, 83080), respectively. The neutralizing antibody titer against RSV type A A2 strain in the serum of rats in the FI-RSV group was 1805 IU / mL (95% CI: 732.7, 4445), and the neutralizing antibody titer against RSV type A A2 strain in the serum of rats in the AREXVY-GSK group was 11136 IU / mL (95% CI: 7585, 16348). The neutralizing antibody titer against RSV type A A2 strain in the serum of rats in the ABRYSVO-Pfizer group was [not specified in the original text]. The neutralizing antibody titer for RSV strain A2 was 3722 IU / mL (95% CI: 2440, 5677). Neutralizing antibodies against RSV strain A2 were not detected in the serum of rats in both the saline-challenged and saline-unchallenged groups.
[0162] There was no significant difference in the neutralizing antibody titers against RSV type A2 strain in the 10μg and 20μg groups of rat serum (Mann-Whitney test, p = 0.3939), but both were significantly higher than those in the AREXVY-GSK group (Mann-Whitney test, p = 0.0022 and 0.0022, respectively).
[0163] Serum from rats was collected 14 days after the second immunization, and the level of neutralizing antibodies against RSV type B BA9 strain in the serum was detected by immunoplaque assay. The results are shown in Figures 18A and 18B.
[0164] The IC50 values of 10 μg and 20 μg rat serum against RSV type B BA9 strain were 4155 (95% CI: 2248, 7680) and 5347 (95% CI: 3263, 8763), respectively. The IC50 value of FI-RSV rat serum against RSV type B BA9 strain was 2.16 (95% CI: 0.30, 15.60). The IC50 value of AREXVY-GSK rat serum against RSV type B BA9 strain was 2121 (95% CI: 1516, 2968). The IC50 value of ABRYSVO-Pfizer rat serum against RSV type B BA9 strain was 1245 (95% CI: 636.1, 2436). No neutralizing antibodies against RSV type B BA9 strain were detected in the serum of rats in the saline-challenge group and the saline-non-challenge group.
[0165] Converting the above antibody IC50 values to international standard units (IU / mL), the neutralizing antibody titers of rat serum against RSV type B BA9 strain in the RSV-A+B-10μg group and RSV-A+B-20μg group were 10606 IU / mL (95% CI: 5737, 19606) and 13650 IU / mL (95% CI: 8330, 22369), respectively. The neutralizing antibody titer of rat serum against RSV type B BA9 strain in the AREXVY-GSK group was 5414 IU / mL (95% CI: 3869, 7576), and the neutralizing antibody titer of rat serum against RSV type B BA9 strain in the FI-RSV group was 2.52 IU / mL (95% CI: 0.23, 27.24). The neutralizing antibody titer of rat serum against RSV type B BA9 strain in the ABRYSVO-Pfizer group was [not specified in the original text]. The neutralizing antibody titer of RSV strain B BA9 was 3178 IU / mL (95% CI: 1624, 6219). Neutralizing antibodies against RSV strain B BA9 were not detected in the serum of rats in both the saline-challenge group and the saline-non-challenge group.
[0166] There was no significant difference in the neutralizing antibody titers against RSV type B BA9 in the 10μg and 20μg groups of rat serum (Mann-Whitney test, p = 0.3939), but both were significantly higher than those in the AREXVY-GSK group (Mann-Whitney test, p = 0.0260 and 0.0043, respectively).
[0167] Since VERD following RSV infection is associated with a Th2-biased immune response, this experiment evaluated the gene expression of cytokines in the lungs of rats on day 4 after challenge.
[0168] As shown in Figures 19A-19E, on day 4 after challenge with RSV-A+B vaccines (10 μg / rat and 20 μg / rat), the relative expression levels of Th2 cell-related cytokines (IL-4, IL-5, and IL-13) in the right lung of the rats did not show significant differences compared to the two marketed RSV recombinant protein vaccines, but were significantly lower than the FI-RSV vaccine; the relative expression level of IFN-γ was significantly lower than the two marketed RSV recombinant protein vaccines and the FI-RSV vaccine. These results indicate that the RSV-A+B vaccine can reduce the inflammatory response induced by RSV infection and attenuate VERD-related inflammatory responses in the lungs.
[0169] On the 4th day after the viral challenge, animals from different groups were euthanized and tissue samples were collected. Inflammatory cell infiltration, edema, and damage in the left lung tissue were observed using hematoxylin and eosin (H&E) staining to assess the distribution of lung damage and to evaluate and score the degree of damage. The results are shown in Figure 20.
[0170] In the saline-challenge group, all experimental animals showed significant lung damage in the left lung after viral infection, with a median pathological score of 4.00 (3.50, 5.00). In the ABRYSVO-Pfizer group, the median pathological score of the left lung in mice was 1.50 (0.75, 2.00). In the RSV-A+B-10μg group, the median pathological score of the left lung in mice was 1.00 (1.00, 1.00). In the RSV-A+B-20μg group, the median pathological score of the left lung in mice was 1.00 (1.00, 1.00). In the FI-RSV group, the median pathological score of the left lung in mice was 1.00 (0.00, 1.25). In the AREXVY-GSK group, the median pathological score of the left lung in mice was 1.00 (0.75, 1.00). In the saline-unchallenge group, the median pathological score of the left lung was 1.00 (0.75, 1.00).
[0171] The above results show that in a rat RSV infection model, doses of 10 μg / rat and 20 μg / rat of RSV-A+B vaccine have a protective effect against respiratory syncytial virus type A A2 strain infection, reduce viral load in the rat lungs and alleviate lung damage, and can induce the production of neutralizing antibodies against type A A2 strain and type B BA9 strain, as well as attenuate the inflammatory response associated with vaccine-enhanced respiratory disease (VERD).
Claims
1. A respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof, wherein, The amino acid sequence of the respiratory syncytial virus antigenic polypeptide or its immunogenic fragment, compared to the amino acid sequence of the wild-type Pre-F protein of respiratory syncytial virus, has amino acid residues 104-144 replaced by GS linker, amino acid residue 102 replaced by A, amino acid residue 373 replaced by R, amino acid residue 379 replaced by V, amino acid residue 447 replaced by V, and has one or more mutation sites at the following amino acid residue positions: One or more of K176P, L160P, T174P, N175P, L181P, N183P, G184P, Q210P, S211P, C212P, S213P, and R213P.
2. The respiratory syncytial virus antigenic polypeptide or its immunogenic fragment according to claim 1, wherein, The mutation site is selected from one or more of K176P, L160P, L181P, N183P, G184P, Q210P, S211P, C212P, and R213P. Preferably, the mutation site includes K176P.
3. The respiratory syncytial virus antigenic polypeptide or its immunogenic fragment according to claim 1, wherein, Except for the mutation, the amino acid sequence of the respiratory syncytial virus antigenic polypeptide has 100% identity with the amino acid sequence of the Pre-F protein of wild-type A or B strains of respiratory syncytial virus. Preferably, the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain A is shown in SEQ ID No. 1, and the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain B is shown in SEQ ID No. 32; More preferably, the amino acid sequence of the respiratory syncytial virus antigenic polypeptide is as shown in SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 7, SEQ ID No. 8, SEQ ID No. 9, SEQ ID No. 10, SEQ ID No. 11, SEQ ID No. 12 or SEQ ID No.
30.
4. A polynucleotide encoding the amino acid sequence of the respiratory syncytial virus antigenic polypeptide of any one of claims 1-3 or an immunogenic fragment thereof.
5. The polynucleotide according to claim 4, wherein it is DNA or RNA; Preferably, the polynucleotide sequence encoding the respiratory syncytial virus antigenic polypeptide is as shown in SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24, SEQ ID No. 28, SEQ ID No. 29 or SEQ ID No. 31; Preferably, the polynucleotide sequence encoding the immunogenic fragment of the respiratory syncytial virus antigenic polypeptide is derived from the sequences shown in SEQ ID No. 14, SEQ ID No. 15, SEQ ID No. 16, SEQ ID No. 17, SEQ ID No. 18, SEQ ID No. 19, SEQ ID No. 20, SEQ ID No. 21, SEQ ID No. 22, SEQ ID No. 23, SEQ ID No. 24, SEQ ID No. 28, SEQ ID No. 29 or SEQ ID No.
31.
6. The use of the respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof as described in any one of claims 1-3, or the polynucleotide as described in claim 4 or 5, in the preparation of a medicament for treating respiratory syncytial virus infection or a respiratory syncytial virus vaccine.
7. A pharmaceutical composition comprising: One or more of the respiratory syncytial virus antigenic polypeptides or immunogenic fragments thereof as described in any one of claims 1-3; and / or One or more of the polynucleotides described in claim 4 or 5; Preferably, the pharmaceutical composition comprises: a respiratory syncytial virus antigenic polypeptide having the amino acid sequence shown in SEQ ID No. 5 or an immunogenic fragment thereof, and a respiratory syncytial virus antigenic polypeptide having the amino acid sequence shown in SEQ ID No. 30 or an immunogenic fragment thereof. Preferably, the pharmaceutical composition comprises: a nucleotide encoding the amino acid sequence shown in SEQ ID No. 5, and a nucleotide encoding the amino acid sequence shown in SEQ ID No.
30.
8. A respiratory syncytial virus vaccine comprising: At least one mRNA molecule having an open reading frame encoding an antigenic polypeptide of the respiratory syncytial virus as described in any one of claims 1-3 or an immunogenic fragment thereof, and Pharmaceutically acceptable carrier.
9. The vaccine according to claim 8, wherein it has one or more of the following characteristics: The open reading frame is codon-optimized; and / or The open reading frame also has a sequence encoding a signal peptide linked to a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof; and / or The open reading frame also has a sequence encoding a transmembrane region linked to a respiratory syncytial virus antigenic polypeptide or an immunogenic fragment thereof; and / or The at least one mRNA molecule comprises at least one chemical modification; preferably, the chemical modification is selected from the group consisting of: pseudouridine, N1-methylpseudouridine, N1-ethylpseudouridine, 2-thiouridine, 4′-thiouridine, 5-methylcytosine, 2-thio-1-methyl-1-deaza-pseudouridine, 2-thio-1-methylpseudouridine, 2-thio-5-aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy-pseudouridine, 4-thio-1-methylpseudouridine, 4-thio-pseudouridine, 5-aza-uridine, dihydropseudouridine, 5-methoxyuridine, and 2′-O-methyluridine; preferably, at least 80%, at least 90%, or 100% of the uracil in the open reading frame has a chemical modification; and / or The at least one mRNA molecule contains at least one 5′ cap structure; and / or The at least one mRNA molecule contains a 3′ polyA tail; and / or The vaccine is formulated in nanoparticles; preferably, the nanoparticles have an average diameter of 50 nm to 200 nm; preferably, the nanoparticles are lipid nanoparticles; preferably, the lipid nanoparticles comprise cationic lipids, PEG-modified lipids, sterols, and non-cationic lipids; preferably, the cationic lipids are ionizable cationic lipids, the non-cationic lipids are neutral lipids, and the sterols are cholesterol.
10. The vaccine according to claim 8 or 9, comprising an mRNA molecule encoding a single type of respiratory syncytial virus antigenic polypeptide or immunogenic fragment thereof as described in any one of claims 1-3; Preferably, the mRNA molecule has an open reading frame encoding the amino acid sequence shown in SEQ ID No. 5 or SEQ ID No.
30.
11. The vaccine according to claim 8 or 9, comprising at least two mRNA molecules, each of the at least two mRNA molecules having an open reading frame encoding an antigenic polypeptide of respiratory syncytial virus according to any one of claims 1-3 or an immunogenic fragment thereof, preferably encoding at least two antigenic polypeptides of respiratory syncytial virus according to any one of claims 1-3 or an immunogenic fragment thereof. Preferably, of the at least two mRNA molecules, at least one mRNA molecule encodes a polypeptide or immunogenic fragment thereof with a mutation in the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain A, and at least another mRNA molecule encodes a polypeptide or immunogenic fragment thereof with a mutation in the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain B.
12. The vaccine according to claim 11, wherein, The amino acid sequence of the mutant polypeptide based on the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain A is shown in SEQ ID No. 5, and the amino acid sequence of the mutant polypeptide based on the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain B is shown in SEQ ID No.
30. Preferably, the mRNA molecule includes an mRNA molecule encoding the amino acid sequence shown in SEQ ID No. 5 and an mRNA molecule encoding the amino acid sequence shown in SEQ ID No. 30; More preferably, the mRNA molecule includes an mRNA molecule with an open reading frame such as the sequence shown in SEQ ID No. 17, SEQ ID No. 28 or SEQ ID No. 29 and an mRNA molecule with an open reading frame such as the sequence shown in SEQ ID No.
31.
13. The vaccine according to claim 11 or 12, wherein, The ratio of mRNA encoding a mutant polypeptide or its immunogenic fragment based on the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain A to mRNA encoding a mutant polypeptide or its immunogenic fragment based on the amino acid sequence of the Pre-F protein of wild-type respiratory syncytial virus strain B is (1-5):(1-5), preferably (1-2):(1-2).