Chimeric fc receptor and use thereof

Abstract

Provided are a chimeric Fc receptor and a use thereof. A fusion protein, i.e., a chimeric Fc receptor, is designed and constructed by selecting an extracellular region of a natural Fc receptor protein, and selecting a suitable hinge region, transmembrane region and intracellular stimulatory signaling domain. The chimeric Fc receptor is also expressed on the surface of immune cells, especially on the surface of NK cells and T cells, by using a virus packaging and integration method, and the universality and targeting specificity of the immune cells can be regulated, so that the function of killing target cells is significantly enhanced.

Description

Chimeric Fc receptors and their applications

[0001] Cross-references to related applications

[0002] This application is based on and claims priority to Chinese Patent Application No. 202510053399.8, filed on January 14, 2025, the entire contents of which are hereby incorporated herein by reference. Technical Field

[0003] This invention belongs to the fields of cell biology and immunology, specifically relating to chimeric Fc receptors and their applications. Background Technology

[0004] As a representative of adoptive immunotherapy, CAR-T cells have achieved remarkable results in cancer treatment. However, CAR-T cells have significant drawbacks: they are highly customized and lack versatility, typically only usable for the patient's own body. Therefore, breakthroughs in versatility and other aspects are still needed for CAR-T cells. In contrast, NK cells have a wider range of applications (they can be used for allogeneic therapy), and their surface expresses multiple receptors, which can be divided into two main categories based on function: activating receptors and inhibitory receptors. The function of NK cells can be precisely regulated through the interaction of these receptors and ligands, thus leading to numerous CAR-NK studies and reports. However, the CAR molecule limits the versatility of NK cells and may not fully realize their potential to kill tumor cells.

[0005] NK cells primarily combat tumor cells through three mechanisms, among which FcR-dependent ADCC (antibody-dependent cell-mediated cytotoxicity) is a crucial mechanism for killing tumor cells. In humans, the IgG FcR family (FcγR) consists of six receptors: FcγRI / CD64, FcγRIIa / CD32a, FcγRIIb / CD32b, FcγRIIc / CD32c, FcγRIIIa / CD16a, and FcγRIIIb / CD16b. However, only CD16a is primarily responsible for triggering NK cell-mediated ADCC. FcγR expression levels are high in monocytes and macrophages; however, FcγR is rarely found in lymphocytes, especially on the surface of T cells where it is almost non-existent. On NK cells, only the activating receptor FcγRIIIa / CD16a is expressed. NK cells express CD16a, which has a very weak ability to bind to antibodies. Moreover, the production cells used in antibody manufacturing are generally Chinese hamster ovary (CHO) cell lines. The special glycosylation (such as trehalose) in the Fc region of the antibodies produced by these cells further weakens their ability to bind to CD16a, thus limiting the ADCC effect exerted by NK cells. Summary of the Invention

[0006] To address the aforementioned problems in the existing technology, this invention provides a chimeric Fc receptor that can be expressed on the surface of immune cells through viral transfection or other methods. After antibodies or other cytokines fused with the Fc fragment bind to the chimeric Fc receptor on the surface of immune cells, they can promote the activation of immune cells (NK cells, T cells, etc.) and kill target cells expressing antigens.

[0007] To address the problems of the existing technology, the technical solution adopted by the present invention is as follows:

[0008] A chimeric Fc receptor, the chimeric Fc receptor comprising an extracellular region, a hinge region, a transmembrane region and an intracellular stimulatory signaling region connected sequentially from the amino terminus to the carboxyl terminus, wherein the extracellular region is an Fc receptor binding domain;

[0009] The structure of the intracellular stimulation signal region is as follows:

[0010] 1) One or more costimulatory regions are connected sequentially.

[0011] Or, 2) One or more costimulation domains and stimulus signal domains are connected sequentially;

[0012] The co-stimulatory domain is selected from the co-stimulatory domains of at least one of the following proteins: CD2, CD244, 4-1BB, CD28, BAFF-R, TACI, DAP10, DAP12; the stimulation signal domain is CD3Z(YXXQ) or CD3Q.

[0013] In some specific embodiments, the intracellular stimulation signal region sequence of the Fc receptor is a single co-stimulatory domain.

[0014] In some specific embodiments, the intracellular stimulation signal region sequence of the Fc receptor consists of two co-stimulatory domains connected sequentially.

[0015] In some specific embodiments, the intracellular stimulation signal region sequence of the Fc receptor consists of three co-stimulatory domains connected sequentially.

[0016] In some embodiments,

[0017] The specific sequence of the Fc receptor binding domain is one of SEQ ID NO.3 to 5;

[0018] The hinge region is selected from the hinge region of one of the following proteins: CD64, CD8α;

[0019] The transmembrane region is selected from the transmembrane region of one of the following proteins: CD64, CD8α, CD2, DAP10, NKG2D.

[0020] In some embodiments,

[0021] The intracellular stimulation signal region sequence of the Fc receptor consists of 1-3 co-stimulatory domains and a stimulation signal domain connected in sequence, wherein the co-stimulatory domains are selected from the co-stimulatory domains of at least one of the following proteins: BAFF-R, TACI, DAP10, and DAP12.

[0022] In some embodiments,

[0023] The intracellular stimulation signal region sequence of the Fc receptor consists of 1-3 co-stimulatory domains and a stimulation signal domain connected in sequence, wherein the co-stimulatory domains are selected from the co-stimulatory domains of at least one of the following proteins: BAFF-R, DAP10, and DAP12.

[0024] In some specific embodiments, the intracellular stimulation signal region sequence of the Fc receptor consists of a co-stimulatory domain and a stimulation signal domain connected in sequence.

[0025] In some specific embodiments, the intracellular stimulation signal region sequence of the Fc receptor consists of two co-stimulatory domains and a stimulation signal domain connected sequentially.

[0026] In some specific embodiments, the intracellular stimulation signal region sequence of the Fc receptor consists of three co-stimulatory domains and a stimulation signal domain connected sequentially. In some embodiments,

[0027] The amino acid sequence of the chimeric Fc receptor is one of those in SEQ ID NO.19-66.

[0028] An isolated nucleic acid molecule encoding the chimeric Fc receptor described in any of the above.

[0029] A carrier comprising the isolated nucleic acid molecules.

[0030] The vector is selected from one or more of DNA, RNA, and plasmids.

[0031] Optionally, the plasmid is a viral vector.

[0032] Optionally, the viral vector is a lentiviral vector or an adenovirus vector.

[0033] A cell containing the nucleic acid molecule or the carrier.

[0034] The cells mentioned are T cells, NK cells, monocytes, macrophages, and dendritic cells.

[0035] The T cells are cytotoxic T cells, tumor-infiltrating T cells, or regulatory T cells.

[0036] The NK cells mentioned therein are NK-92 cells, genetically modified NK-92 cells, autologous NK cells, or NK cells formed by induced culture of PBMCs.

[0037] A method for expressing a chimeric Fc receptor on cells, employing a viral transduction method, wherein the cells are optionally NK cells or T cells, and the viral transduction method is performed once or multiple times.

[0038] A pharmaceutical composition or kit comprising one or more of the following:

[0039] i) Chimeric Fc receptors as described in any of the above;

[0040] ii) Nucleic acid molecules as described above;

[0041] iii) The carrier as described in any of the above; and

[0042] iv) Cells as described in any of the above descriptions;

[0043] In addition, pharmaceutically acceptable diluents or excipients.

[0044] The beneficial effects of this application are:

[0045] This application mimics the Fc receptor conformation of innate immune cells to construct a chimeric Fc-region receptor (CFR), which can be efficiently displayed on the surface of immune cells. Immune cells expressing CFR can bind to the Fc fragments of various antibodies or Fc fusion proteins, enabling multi-targeting and enhanced function. For example, experiments in this application show that incubating NK cells expressing CFR with antibodies that can bind to tumor antigens significantly improves the killing effect on tumor cells compared to NK cells expressing CFR or wild-type NK cells incubated only with isotype antibodies. This demonstrates that the targeting ability of non-specific immune NK cells, after binding to antibodies by expressing the CFR provided in this application, can enhance the tumor-killing function of NK cells. This application also demonstrates that the constructed CFR can exert antibody-mediated cytotoxic effects when displayed on T cells. This invention can also regulate the versatility and targeting of CFR-expressing immune cells by adjusting the type of antibody or other cytokines fused with the Fc fragment, allowing for more flexible and effective killing of various target cells, such as various tumor cells expressing different antigens. Attached Figure Description

[0046] Figure 1 shows a structural comparison of natural NK cells, CAR-T / NK cells, and antibody-anchored CRF-NK / T cells.

[0047] Figure 2A shows the detection results of NK cells expressing VT055 killing NCI-N87 cells;

[0048] Figure 2B shows the detection results of NK cells expressing VT056 killing NCI-N87 cells;

[0049] Figure 2C shows the detection results of NK cells expressing VT060 killing NCI-N87 cells;

[0050] Figure 2D shows the detection results of NK cells expressing VT067 killing NCI-N87 cells;

[0051] Figure 2E shows the detection results of NK cells expressing VT068 killing NCI-N87 cells;

[0052] Figure 2F shows the detection results of NK cells expressing VT069 killing NCI-N87 cells;

[0053] Figure 2G shows the detection results of NK cells expressing VT071 killing NCI-N87 cells;

[0054] Figure 2H shows the detection results of NK cells expressing VT072 killing NCI-N87 cells;

[0055] Figure 3A shows the detection results of three groups of killing Raji cells: no T cells, T cells, and CFR-T cells expressing VT060 but without CD20 antibody.

[0056] Figure 3B shows the detection results of killing Raji cells in two groups: T cells with CD20 antibody and CFR-T cells expressing VT060 with CD20 antibody.

[0057] Figure 4 shows the results of CFR-NK cells killing Raji cells mediated by gene editing and CFR expression gene insertion. Detailed Implementation

[0058] The "range" disclosed in this application is defined by a lower limit and an upper limit. A given range is defined by selecting a lower limit and an upper limit, which define the boundaries of a particular range. Ranges defined in this way can include or exclude endpoints and can be arbitrarily combined; that is, any lower limit can be combined with any upper limit to form a range. For example, if ranges of 60-120 and 80-110 are listed for a specific parameter, it is expected that ranges of 60-110 and 80-120 are also included. Furthermore, if minimum range values ​​of 1 and 2 are listed, and if maximum range values ​​of 3, 4, and 5 are listed, then the following ranges are all expected: 1-3, 1-4, 1-5, 2-3, 2-4, and 2-5. In this application, unless otherwise stated, the numerical range "ab" represents a shortened representation of any combination of real numbers between a and b, where a and b are real numbers. For example, the numerical range "0-5" indicates that all real numbers between "0-5" have been listed in this article; "0-5" is simply a shortened representation of these numerical combinations. Furthermore, when a parameter is stated as an integer ≥2, it is equivalent to disclosing that the parameter is, for example, an integer such as 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, etc.

[0059] Unless otherwise specified, all embodiments and optional embodiments of this application may be combined to form new technical solutions.

[0060] Unless otherwise specified, all technical features and optional technical features of this application may be combined to form new technical solutions.

[0061] Unless otherwise specified, all steps in this application may be performed sequentially or randomly, preferably sequentially. For example, the method includes steps (a) and (b), indicating that the method may include steps (a) and (b) performed sequentially, or it may include steps (b) and (a) performed sequentially. For example, the mention that the method may also include step (c) indicates that step (c) may be added to the method in any order. For example, the method may include steps (a), (b), and (c), or it may include steps (a), (c), and (b), or it may include steps (c), (a), and (b), etc.

[0062] Unless otherwise specified, the terms used in this application have the common meanings as commonly understood by those skilled in the art.

[0063] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to limit this disclosure. When used herein, the singular forms “a,” “an,” and “the” are also intended to include the plural forms unless the context clearly indicates otherwise. It should also be understood that the terms “comprise” and / or “comprising,” when used in this specification, identify the presence of the stated features, integers, steps, operations, elements, and / or components, but do not exclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups. When used herein, the term “and / or” includes any and all combinations of the associated listed items.

[0064] This invention provides a chimeric Fc-region receptor (CFR) that can be expressed on the surface of immune cells through viral transfection or gene editing. When antibodies or other cytokines fused with the Fc fragment bind to the chimeric Fc receptor on the surface of immune cells, they can activate immune cells (NK cells, T cells, etc.) and kill target cells expressing antigens.

[0065] As shown in Figure 1, the chimeric Fc receptor provided in this application is constructed with reference to the chimeric antigen receptor (CAR). It consists of an extracellular region, a hinge region, a transmembrane region, and an intracellular stimulation signal region connected in sequence. The intracellular stimulation signal region is mainly composed of a co-stimulatory domain or a co-stimulatory domain connected to a stimulation signal domain.

[0066] Extracellular region: The extracellular region refers to the Fc receptor-binding domain, which can bind to the Fc segment of the antibody. Optionally, the extracellular region can be selected from the Fc receptor-binding domain or its variants of any protein such as CD64, antiCD19 scFv, CD16a, db_CD64, FCGR1A (CD64a), FCGR1B (CD64b), FCG2A (CD32a), FCG2B (CD32b), FCG3A (CD16a), FCG3B (CD16b).

[0067] Hinge region: Located between the extracellular region and the transmembrane region, the hinge region provides sufficient flexibility for the CFR to ensure that the external recognition domain can effectively bind to the antigen without affecting the function of the CFR cell. Optionally, the hinge region may be a hinge region of one of the following proteins: CD64, CD8α, CD7, CD32, CD16a, db_CD64, FCGR1A (CD64a), FCGR1B (CD64b), FCG2A (CD32a), FCG2B (CD32b), FCG3A (CD16a), or FCG3B (CD16b).

[0068] Transmembrane region: Located in the cell membrane portion of the CFR, it anchors the CFR to the cell membrane of immune cells and interacts with other cell signaling molecules. Optionally, the transmembrane region can be any transmembrane region of proteins such as CD8α, CD8α, CD7, CD64, CD16a, CD244, CD28, CD8α, NKG2D, TCRα chain, TCRβ chain, TCRγ chain, TCRδ chain, CD3ζ subunit, CD3ε subunit, CD3γ subunit, CD3δ subunit, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD28, CD37, CD64, CD80, CD86, CD134, CD137, and CD154.

[0069] Intracellular stimulatory signaling region (CFR): This region includes at least one co-stimulatory domain, with or without a stimulatory signaling domain. When an antibody anchored to the CFR binds to an antigen, or a cytokine anchored to the CFR binds to a ligand, the co-stimulatory domain, or the co-stimulatory domain combined with the stimulatory signaling domain, activates the cell and initiates a series of signal transduction pathways, ultimately leading to cell activation and the release of cytotoxins to eliminate cancer cells. Optionally, the co-stimulatory domain can be selected from any one or more co-stimulatory domains of proteins such as 4-1BB, CD28, CD2, BAFF-R, TACI, DAP10, DAP12, CD3z, TLR2, TLR1, CD27, OX40, DAP10, OX40, 2B4, CD81, CD2, CD5, CD30, CD40, HVEM, and ICOS. Optionally, the stimulation signal domain can be selected from CD3ζ, CD3Z(YXXQ) or CD3Q. CD3Z(YXXQ) is a variation of CD3ζ, and its sequence is shown in SEQ ID NO:2. CD3Q is another variation of CD3ζ, and its sequence is shown in SEQ ID NO:67. The amino acid sequence structures of CD3Z(YXXQ) and CD3Q are obtained with reference to existing articles and patents (Kagoya Y, Tanaka S, Guo T, et al. A novel chimeric antigen receptor containing a JAK-STAT signaling domain mediates superior antitumor effects. Nat Med. 2018; 24(3):352-359. doi:10.1038 / nm.4478, WO2023081901A1).

[0070] In particular, the applicant has discovered that when the Fc receptor binding domain consists of 1-3 co-stimulatory domains and a stimulatory signal domain connected in sequence, and the co-stimulatory domains are selected from the co-stimulatory domains of at least one of the following proteins: BAFF-R, TACI, DAP10, DAP12, the immune cells exhibiting chimeric Fc receptors show the strongest targeted killing effect after binding with tumor antigen antibodies, achieving the best effect on different tumor cells expressing multiple antigens.

[0071] The chimeric Fc-region receptor (CFR) provided in this application is composed of modules listed in Table 1 in tandem, and lentiviral vectors (VT) with different protein structures were constructed for testing. The protein components expressed by the tested vectors are listed in Table 2 (VT019~VT072). The lentiviruses (VSV-G envelope proteins) expressing the nucleic acids of each CFR amino acid sequence in the sequence listing were synthesized, packaged, concentrated, and filled by Suzhou Boteng Biopharmaceutical Co., Ltd.

[0072] Table 1 Module Sequence List

[0073] Table 2 Structural Combination Methods

[0074] The main instruments, equipment, and reagents used in the embodiments of this invention are shown in Tables 3 and 4 below:

[0075] Table 3 Instruments and Equipment

[0076] Table 4 Reagents

[0077] Example 1: Display capability of CFR protein on NK cells (NK92 cells)

[0078] Viruses with a titer of 3E7TU / mL or higher (based on data from Jurkat cells) were selected and transfected into NK92 cells to verify the display ability of CFR proteins on NK cells. Transduction conditions were as follows: NK92 cells were seeded in 96-well plates at 2E5 cells per well (91% viability), 20-fold of virus (MOI=20) was added, and the cells were incubated at 37°C for approximately 5 hours. After centrifugation at 180g for 5 minutes, the medium was replaced to 1 ml, and the cells were seeded into one well of a 24-well plate. Six days after transfection (D6), the extracellular CD64 structure was detected as a marker of normal structural display to quantitatively determine the expression ability of each CFR vector. The results are shown in Table 5.

[0079] Table 5. Results of D6 Positive Rate Detection

[0080] Example 2: CFR-NK92 anchored to Ocrelizumab antibody to construct a CD20-targeting CAR-NK drug to kill Raji cells.

[0081] Flow cytometry was used to detect CAR-NK-mediated cytotoxicity. Two E4 GFP+-positive Raji cells were seeded into each well of a 96-well plate and suspended in 100 μL of culture medium. CFR-NK92 cells expressing CFR were treated with an antibody at a concentration of 2 μg / ml containing Ocrelizumab to construct a CD20-targeting CAR-NK drug. An antibody isotype control of IgG1 isotype at a concentration of 2 μg / ml containing IgG1 isotype served as a non-antibody-mediated killing control. NK92 cells transfected with the corresponding vector virus were cultured for 4 hours at an effector-to-target ratio (E:T = 4:1) relative to Raji cells. The cell suspension was stained with PI dye to indicate apoptotic cells, and the GFP+PI+% ratio was calculated as an indicator of killing efficacy. NK92 cells not transfected with the CFR vector were treated with either an IgG1 isotype control or Ocrelizumab antibody as a baseline NK92 killing control. Untreated Raji cells served as a baseline apoptosis control (NC, Raji only). The results are shown in Table 6 below:

[0082] Table 6. Results of lethality detection

[0083] The results showed that CFR-NK92 cells exhibiting VT026, VT027, VT028, VT029, VT030, VT031, VT034, VT040, VT041, and VT042, when anchored with Ocrelizumab antibody to construct a CD20-targeting CAR-NK drug, significantly killed Raji cells. The killing efficacy of each CAR-NK drug group (final killing efficiency 67–78%) was significantly higher than that of Raji tumor cells under basal apoptosis (Raji only), with a relative basal killing gain of 29–40%. The killing efficacy of each CAR-NK drug group was significantly better than that of the CFR-NK92-anchored IgG isotype control (IgG1 isotype control), indicating that CAR-NK targeting is specific. The CAR-NK drug killing effect of each group was significantly better than that of NK92 without CFR vector added with IgG1 isotype control drug (killing addition of 22%) or control added with Ocrelizumab antibody (killing addition of 26%), indicating that NK killing is mediated by CFR.

[0084] Example 3: Repeated transduction can increase the display of CFR protein on NK cells (NK92 cells).

[0085] Based on the killing results, this application further optimized the CFR protein conformation and constructed VT026, VT043, and VT055–VT072 vectors to package the virus for further testing of its efficacy.

[0086] Plasmid vectors VT026, VT043, and VT055–VT072 were constructed and packaged with viruses. After transfection into Jurkat cells to determine the titer, NK92 cells were transfected to verify the display ability of CFR proteins on NK cells. Transduction conditions were as follows: NK92 cells were seeded in 96-well plates at 2E5 cells per well (91% viability), and 20-fold of virus (MOI = 20) was added. The cells were incubated at 37°C for approximately 5 hours, centrifuged at 180g for 5 minutes, and the medium was replaced to 1 ml, which was then seeded into one well of a 24-well plate. Seven days after transduction (D7), the extracellular CD64 structure was detected as a marker of normal structural display to quantitatively determine the expression ability of each CFR vector. Seven days after transduction, the CFR-NK cell pools corresponding to the five viruses (VT026, VT043, VT058, VT061, and VT064) with lower positive rates were transduced again under the same conditions, as shown in Table 7.

[0087] Table 7 Positive Rate Detection Results

[0088] The results showed that the positive rate was increased in all tests 4 days after the second transduction (D11).

[0089] Example 4: Demonstrating the use of an optimized CFR-NK92-anchored Ocrelizumab antibody to construct a CD20-targeting CAR-NK drug to kill Raji cells.

[0090] Flow cytometry was used to detect CAR-NK-mediated cytotoxicity. Two E4 GFP+-positive Raji cells were seeded into each well of a 96-well plate and suspended in 100 μL of culture medium. To construct a CD20-targeting CAR-NK drug, 2 μg / ml of Ocrelizumab antibody was added to each group of CFR-NK92 cells expressing CFR. An antibody isotype control of 2 μg / ml of IgG1 isotype was used as a non-antibody-mediated killing control for each group of CFR-NK92 cells. Raji cells were labeled with CFSE dye. NK92 cells transfected with the corresponding vector virus were cultured at an effector-to-target ratio of E:T = 4:1 relative to Raji cells for 4 hours. The cell suspension was then stained with PI dye to indicate apoptotic cells, and the CFSE+PI+% ratio was calculated as an indicator of killing efficacy. NK92 cells not transfected with the CFR vector were treated with either the IgG1 isotype control drug or Ocrelizumab antibody as a baseline control for NK92 killing. Raji cells supplemented with the corresponding antibody served as a baseline apoptosis control (Raji). The cell killing mediated by the Ocrelizumab antibody was subtracted from the cell killing mediated by the IgG1 isotype control, and this was used as the "increased cell killing" data reflecting the enhanced efficacy of CFR. The data are shown in Table 8 below:

[0091] Table 8. Results of Lethality Detection

[0092] The results showed that CFR-NK92 cells exhibiting VT026, VT043, VT055, VT056, VT057, VT058, VT059, VT060, VT061, VT064, VT065, VT067, VT068, VT069, VT070, VT071, and VT072, when anchored with Ocrelizumab antibody to construct CAR-NK drugs targeting the CD20 antigen, significantly killed Raji cells expressing the CD20 antigen. The killing effects of each CAR-NK drug were significantly higher than those of the control group and the tumor cell baseline signal. All CAR-NK drugs showed significantly better killing effects than the CFR-NK92-anchored IgG isotype control drug (IgG), with the killing increase ranging from 8.40% to 22.61%, indicating that CAR-NK targeting is specific and NK cell killing is mediated by CFR.

[0093] Example 5: Demonstrates the use of an optimized CFR-NK92-anchored Daratumumab antibody to construct a CD38-targeting CAR-NK drug to kill Raji cells.

[0094] Flow cytometry was used to detect CAR-NK-mediated cytotoxicity. Two E4 GFP+-positive Raji cells were seeded into each well of a 96-well plate and suspended in 100 μL of culture medium. CFR-NK92 cells expressing CFR were supplemented with 2 μg / ml of daratumumab antibody to construct a CD38-targeting CAR-NK drug. An isotype control of IgG1 isotype at 2 μg / ml served as a non-antibody-mediated killing control. Raji cells were labeled with CFSE dye. NK92 cells transfected with the corresponding vector virus were cultured at an effector-to-target ratio of E:T = 4:1 relative to Raji cells for 4 hours. The cell suspension was then stained with PI dye to indicate apoptotic cells, and the CFSE+PI+% ratio was calculated as an indicator of killing efficacy. NK92 cells not transfected with the CFR vector were supplemented with either the IgG1 isotype control drug or daratumumab antibody as a baseline NK92 killing control. Raji cells supplemented with the corresponding antibody served as a baseline apoptosis control (Raji). The cell killing mediated by Daratumumab antibody was subtracted from the cell killing mediated by the IgG1 isotype control, and this was used as the "increased cell killing" data reflecting the enhanced efficacy of CFR. The data are shown in Table 9 below:

[0095] Table 9. Results of Lethality Detection

[0096] The results showed that CFR-NK92 cells exhibiting VT026, VT043, VT055, VT056, VT057, VT058, VT059, VT060, VT061, VT064, VT065, VT067, VT068, VT069, VT070, VT071, and VT072, when anchored with Daratumab antibody to construct CAR-NK drugs targeting the CD38 antigen, significantly killed Raji cells expressing the CD38 antigen. The killing effects of each CAR-NK drug were significantly higher than those of the control group and the tumor cell baseline signal. All CAR-NK drugs showed significantly better killing effects than the CFR-NK92-anchored IgG isotype control drug (IgG), with the killing increase ranging from 1.91% to 10.25%, indicating that CAR-NK targeting is specific and NK cell killing is mediated by CFR.

[0097] Example 6: CFR protein was displayed on PBMC-derived primary NK cells to construct CFR-NK cells, and the Ocrelizumab antibody was anchored to construct a CD20-targeting CAR-NK drug to kill Raji cells.

[0098] NK cells derived from PBMCs were transfected to verify the display ability of CFR protein on primary NK cells and its enhanced drug efficacy. The procedure was as follows: Human peripheral blood mononuclear cells (PBMCs) were isolated from apheresis blood of two donors (Donor1 and Donor2), sorted for CD56+ positivity using CD56 magnetic beads, and then activated using an NK activation kit. Four days after activation, the sorted and activated NK cells were seeded in 96-well plates at 2E5 cells per well (80% viability). A 20-fold increase in viral load (MOI = 20) was added, and the plates were incubated at 37°C for approximately 5 hours. After centrifugation at 180g for 5 minutes, the medium was replaced with 1 ml, and the cells were seeded into one well of a 24-well plate. Seven days after transfection, CAR-NK-mediated cytotoxicity was detected using flow cytometry.

[0099] The assay procedure was as follows: 2E4 Raji cells labeled with CFSE dye were seeded into each well of a 96-well plate and suspended in 100 μL of culture medium. Ocrelizumab antibody at a concentration of 2 μg / ml was added to each CFR-NK cell group expressing CFR to construct a CD20-targeting CAR-NK drug. NK cells transfected with the corresponding vector virus were cultured for 4 hours at an effector-to-target ratio (E:T) of 4:1 relative to Raji cells. The cell suspension was then stained with PI dye to indicate apoptotic cells, and the CFSE+PI+% ratio was calculated as an indicator of cytotoxicity. NK cells without CFR vector transduction, with or without Ocrelizumab antibody, served as a baseline control for NK cell killing. Raji cells served as a baseline apoptosis control (Raji only). The cell killing mediated by Ocrelizumab antibody in the CFR-NK sample group minus the cell killing mediated by Ocrelizumab antibody in the untransfected NK cells was calculated as the "enhanced cytotoxicity" data reflecting the enhanced efficacy of CFR. The data are shown in Tables 10 and 11 below:

[0100] Table 10. Results of lethality detection

[0101] Table 11 Results of the kill rate test

[0102] The results showed that primary NK cells from Donor1 cells displaying VT055, VT056, VT060, and VT072, and primary NK cells from Donor2 cells displaying VT055, VT056, and VT060, when anchored with Ocrelizumab antibody to construct CAR-NK drugs targeting the CD20 antigen, significantly killed Raji cells expressing the CD20 antigen. The killing effects of the CAR-NK drugs in each group were significantly higher than those in the control group and the baseline signal of tumor cells, with the increase in killing ranging from 3.57% to 18.17%.

[0103] Example 7: Demonstrating the use of an optimized CFR-NK92-anchored Atezolizumab antibody to construct a CAR-NK drug targeting PD-L1 to kill Raji cells.

[0104] Flow cytometry was used to detect CAR-NK-mediated cytotoxicity. Two E4 GFP+-positive Raji cells were seeded into each well of a 96-well plate and suspended in 100 μL of culture medium. Atezolizumab antibody at a concentration of 2 μg / ml was added to each group of CFR-NK92 cells expressing CFR to construct a CAR-NK drug targeting PD-L1. An antibody isotype control of IgG1 isotype at a concentration of 2 μg / ml was used as a non-antibody-mediated killing control for each group of CFR-NK92 cells. Raji cells were labeled with CFSE dye. CFR-NK92 cells transfected with the corresponding vector virus were cultured at an effector-to-target ratio of E:T = 4:1 relative to Raji cells for 4 hours. The cell suspension was stained with PI dye to indicate apoptotic cells, and the CFSE+PI+% ratio was calculated as an indicator of killing effect. Untransfected NK92 cells were treated with either IgG1 isotype control drug or Atezolizumab antibody as a baseline control for NK92 killing. Raji cells supplemented with the corresponding antibody served as a baseline apoptosis control (Raji). The cell killing mediated by the Atezolizumab antibody was subtracted from the cell killing mediated by the IgG1 isotype control, and this was used as the "increased cell killing" data reflecting the enhanced efficacy of CFR. The data are shown in Table 12 below:

[0105] Table 12 Results of Lethality Detection

[0106] The results showed that CFR-NK92 cells displaying VT026, VT055, VT056, VT060, VT071, and VT072, when anchored with Atezolizumab antibody to construct CAR-NK drugs targeting the CD38 antigen, significantly killed Raji cells expressing the CD38 antigen. The killing effect of each group of CAR-NK drugs was significantly higher than that of the control group and the background signal of tumor cells. The CAR-NK drugs constructed from CFR-NK92 cells displaying VT055, VT056, VT060, VT071, and VT072 cells after anchoring with Atezolizumab showed significantly better killing effects than the CFR-NK92 cells anchored with the IgG isotype control drug (IgG), with the killing increase ranging from 3.26% to 11.35%, indicating that CAR-NK targeting is specific and NK killing is mediated by CFR.

[0107] Example 8: CFR-NK92-anchored Zolbetuximab antibody to construct a CAR-NK drug targeting Claudin18.2 to kill NCI-N87 cells (gastric cancer cells) expressing Claudin18.2 antigen.

[0108] CAR-NK-mediated cytotoxicity was detected using real-time label-free RTCA. Culture medium was added to an E-Plate assay plate, and background impedance was measured. Log-phase NCI-N87 cells expressing Claudin18.2 antigen were collected and counted. The cell suspension concentration was adjusted, and 1E5 NCI-N87 cells expressing Claudin18.2 antigen were added to the E-Plate assay plate. The plate was incubated at room temperature in a clean bench for 30 min. The E-Plate assay plate with added cells was then placed on the assay table (which was pre-placed in an incubator) for real-time dynamic cell proliferation detection. After overnight detection, CFR-NK92 was anchored to Zolbetuximab antibody to construct a CAR-NK drug targeting Claudin18.2. The prepared drug was added to each well, and real-time dynamic detection continued to obtain the CAR-NK-mediated cell killing effect curve.

[0109] As shown in Figures 2A to 2H, the results indicate that CFR-NK92 cells (VT055, VT056, VT060, VT067, VT068, VT069, VT071, and VT072) anchored with Zolbetuximab antibody to construct a CAR-NK drug targeting the Claudin18.2 antigen significantly killed NCI-N87 cells expressing the Claudin18.2 antigen. The killing effect of each CAR-NK drug (final killing efficiency >80%) was significantly higher than the tumor cell background signal (Tumor only). The killing effect of each CAR-NK drug was significantly better than that of the CFR-NK92-anchored IgG isotype control drug (IgG), indicating that CAR-NK targeting is specific. The killing effect of each CAR-NK drug was significantly better than that of the NK92-anchored IgG isotype control drug (NC) without CFR vector transfection, indicating that NK killing is mediated by CFR.

[0110] Example 9: Demonstration of CFR protein on T cells (Jurkat cells)

[0111] After purification, the viruses expressing each CFR vector were transduced into 100 μL of 2E5 Jurkat cells in gradient volumes ranging from 0.05 μL to 1.33 μL. The extracellular CD64 structure was detected as a marker of normal structural display to quantitatively determine the expression capacity of each CFR vector. Results with a CD64 positivity rate of 2%-20% (controlling MOI < 1) were included in the quantification calculation. The results are shown in Table 13.

[0112] Table 13 Positive Rate Detection Results

[0113] The results showed that VT032, VT040, VT042, VT029, VT027, VT043, VT031, VT041, VT028, VT026, VT034, VT019, VT030, and VT021 were well expressed on T cells, with viral titers above 3E7. VT036, VT038, VT023, VT048, VT039, VT035, and VT044 were normally displayed, with viral titers between 1E7 and 3E7. VT037, VT033, VT047, VT022, VT020, VT024, and VT025 could be expressed, but the display effect was weak, with viral titers below 1E7. VT045 and VT046 were difficult to display on T cells, and no display signal was detected.

[0114] Example 10: Demonstrating the use of a CFR-T anchored Ocrelizumab antibody to construct a CD20-targeting CAR-T drug to kill Raji cells.

[0115] Virus purification of the CFR vector expressing VT060 was used to transfect 2E5 T cells (Jurkat cells) at MOI=20. Three days later, flow cytometry was used to detect the constructed CAR-T-mediated cytotoxicity. 2E4 GFP+ positive Raji cells were seeded into each well of a 96-well plate and suspended in 100 μL of culture medium. An antibody at a concentration of 2 μg / ml of Ocrelizumab was added to the VT060-expressing CFR-T cells to construct a CD20-targeting CAR-T drug. CFR-NK92 cells in each group were anchored with an antibody isotype control at a concentration of 2 μg / ml of IgG1 isotype as a non-antibody-mediated killing control. Raji cells were labeled with CFSE dye. CFR-T cells transfected with the corresponding vector virus were cultured for 4 hours at an effector-to-target ratio of E:T = 4:1 relative to Raji cells. The cell suspension was then stained with APC-Cy7 live / dead dye to indicate apoptotic cells. The percentage of CFSE + APC-Cy7 live / dead dye was calculated as an indicator of killing effect. Untransfected CFR vector T cells were treated with either IgG1 isotype control or Ocrelizumab antibody as a baseline control for NK92 killing. Raji cells supplemented with the corresponding antibody served as a baseline apoptosis control (Raji). The statistical data on Ocrelizumab antibody-mediated cell killing are shown in Figures 3A and 3B.

[0116] The results showed that CFR-T cells displaying VT060, anchored with Ocrelizumab antibody to construct a CAR-T drug targeting the CD20 antigen, significantly killed Raji cells expressing the CD20 antigen (29.64%). The killing effect of the CAR-T drug was significantly higher than that of the control group (9.32%–13.34%) and the baseline apoptosis signal of tumor cells (13.64%). This indicates that CAR-T targeting is specific, and NK cell killing is mediated by CFR.

[0117] Example 11: CRISPR-mediated CFR gene knock-in primary NK cell genome construction to create CFR-expressing NK cells

[0118] CRISPR-mediated CFR gene knock-in into primary NK cell genomes to construct CFR-expressing NK cells. The construction procedure was as follows: peripheral blood mononuclear cells (PBMCs) were isolated from a donor's blood sample, sorted for CD56+ positive cells using CD56 magnetic beads, and then activated using an NK activation kit. VT056 was selected as the test CFR gene. Four days after activation, the DNA template expressing the CFR gene (VT056) and the RNP complex expressing the CRISPR system were introduced into NK cells via electroporation. The electroporation parameters are shown in Table 14. Two insertion sites were selected for testing: the AAVS1 site targeted by sg22 (targeting sequence GTTAATGTGGCTCTGGTTCT (SEQ ID NO. 68)) and the DGKZ site targeted by sg036 (targeting sequence ACTCGCTGCACGGGGCCCCA (SEQ ID NO. 69)). Electroporated samples without a DNA template expressing the CFR gene were used as a control for detecting CRISPR editing efficiency; electroporated samples with only a DNA template expressing the CFR gene were used as a background control for random integration. After 3 and 7 days of electroporation, Sanger sequencing was performed using PCR amplicon sequencing to obtain sequencing results (.ab1 files). The success of gene editing was determined by comparing the presence and intensity of overlapping signal peaks near the gRNA editing site in the sequencing results. Using the online tool "TIDE" (shinyapps.datacurators.nl / tide), the .ab1 files of the Sanger sequencing were uploaded, allowing for quantitative analysis of the proportion of different editing types in the total amplicon based on Sanger sequencing peak levels, and simulating quantitative knockout efficiency (the proportion of insertion and deletion types in the total amplicon). After 7 and 14 days of electroporation, flow cytometry was used to detect the expression of the CD64 tag on the corresponding samples, testing the display level of CFR on primary NK cells. The results are shown in Table 15 below.

[0119] Table 14 Electro-rotation parameters

[0120] Table 15 Test Results

[0121] The results showed that the CRISPR system achieved editing efficiency of nearly 90% at both test sites on the NK genome. The CRISPR system mediated efficient knock-in of the CFR gene at two sites: the AAVS1 site targeted by sg22 and the DGKZ site targeted by sg036, resulting in normal expression of the CFR protein. The integration expression efficiency indicated by CD64+ positive NK cells was significantly higher than that of random DNA integration without the CRISPR system (0.01%). The integration efficiency of the CFR protein at both target sites was close to 10% after 7 and 14 days of electroporation (CD64+ positive NK cells).

[0122] Example 12: Gene editing-mediated CFR-NK cell anchoring with Ocrelizumab antibody to construct CD20-targeting CAR-NK drug to kill Raji cells.

[0123] CAR-NK-mediated cytotoxicity was detected by flow cytometry. Two E4 GFP+-positive Raji cells were seeded into each well of a 96-well plate and suspended in 100 μL of culture medium. Gradient concentrations of Ocrelizumab antibody were added to CFR-NK cells expressing CFR (49 days after electroporation) to construct a CD20-targeting CAR-NK drug. Raji cells were labeled with CFSE dye. After 4 hours of culture with antibody-anchored CFR-NK cells mixed with Raji cells at an effector-to-target ratio of E:T = 1:1, the cell suspension was stained with PI dye to indicate apoptotic cells, and the CFSE+PI+% ratio was calculated as an indicator of killing effect. Groups containing CFR-NK and Raji cells, and Raji cells without antibody and effector cells, served as a baseline apoptosis control (Raji). Data are shown in Figure 4.

[0124] Figure 4 shows that, through gene editing and site-specific integration of CFR-NK cells displaying CFR(VT060), and anchoring gradient concentrations of Ocrelizumab antibody to construct CAR-NK drugs targeting the CD20 antigen, the ability of these drugs to kill Raji cells expressing the CD20 antigen was tested. The killing effect of each CAR-NK drug increased with increasing antibody concentration, and the antibody-dependent half-maximal killing concentration (EC50) was 106 ng / mL.

[0125] As can be seen from the above embodiments, when the Fc receptor binding domain consists of 1-3 co-stimulatory domains and a stimulatory signal domain connected in sequence, and the co-stimulatory domains are selected from the co-stimulatory domains of at least one of the following proteins: BAFF-R, TACI, DAP10, DAP12, the immune cells exhibiting chimeric Fc receptors show the strongest targeted killing effect after binding with tumor antigen antibodies, achieving the best effect on different tumor cells expressing multiple antigens.

[0126] Furthermore, it was found that when antibodies that can bind to tumor antigens are incubated with NK cells expressing CFR, the killing effect on tumor cells is significantly improved compared to NK cells expressing CFR or wild-type NK cells incubated only with isotype antibodies. This indicates that the targeting ability of non-specific immune NK cells can be enhanced by binding to antibodies after expressing the CFR provided in this application.

[0127] Moreover, the CFR constructed in this application can also exert antibody-mediated cytotoxic effects on the surface of T cells.

[0128] This invention can also regulate the versatility and targeting of immune cells expressing CFR by adjusting the type of antibody or other cytokines fused with the Fc fragment, thereby killing various target cells more flexibly and effectively, such as various tumor cells expressing different antigens.

Claims

1. A chimeric Fc receptor, wherein, The chimeric Fc receptor comprises, from the amino terminus to the carboxyl terminus, an extracellular region, a hinge region, a transmembrane region, and an intracellular stimulatory signal region, The extracellular region is an Fc receptor binding domain; The structure of the intracellular stimulatory signal region is: 1) one costimulatory domain or multiple costimulatory domains are sequentially connected, Or, 2) one costimulatory domain or multiple costimulatory domains and a stimulatory signal domain are sequentially connected; The costimulatory domain is selected from at least one costimulatory domain of the following proteins: CD2, CD244, 4-1BB, CD28, BAFF-R, TACI, DAP10, DAP12; The stimulatory signal domain is CD3Z (YXXQ) or CD3Q.

2. The chimeric Fc receptor of claim 1, wherein, The specific sequence of the Fc receptor binding domain is one of SEQ ID NO. 3-5; The hinge region is selected from the hinge region of one of the following proteins: CD64, CD8a; The transmembrane region is selected from the transmembrane region of one of the following proteins: CD64, CD8a, CD2, DAP10, NKG2D.

3. The chimeric Fc receptor of claim 2, wherein, The intracellular stimulatory signal region of the chimeric Fc receptor is that one costimulatory domain or multiple costimulatory domains and a stimulatory signal domain are sequentially connected, and the costimulatory domain is selected from at least one costimulatory domain of the following proteins: BAFF-R, TACI, DAP10, DAP12.

4. The chimeric Fc receptor of claim 2, wherein, The sequence of the chimeric Fc receptor is one of SEQ ID NO: 19-SEQ ID NO:

66.

5. A nucleic acid molecule, wherein, It encodes the chimeric Fc receptor of any one of claims 1 to 4.

6. A vector, wherein, It comprises the nucleic acid molecule of claim 5.

7. The vector of claim 6, wherein, It is selected from one or more of DNA, RNA, plasmid, Optionally, the plasmid is a viral vector, Optionally, the viral vector is a lentiviral vector or an adenoviral vector.

8. A cell, wherein, It comprises the nucleic acid molecule of claim 5 or the vector of claim 6 or 7, or its surface displays the chimeric Fc receptor of any one of claims 1-4.

9. The cell of claim 8, wherein, The cell is a T cell, an NK cell, a monocyte, a macrophage, a dendritic cell, Optionally, the T cell is a cytotoxic T cell, a tumor infiltrating T cell, or a regulatory T cell, Optionally, the NK cell is an NK-92 cell, a genetically modified NK-92 cell, an autologous NK cell, or an NK cell formed by inducing culture of PBMC.

10. A method of expressing the chimeric Fc receptor of any one of claims 1 to 4 on a cell, wherein, The method of viral transduction is used, and optionally, the cell is an NK cell or a T cell, and optionally, the method of viral transduction is used once or multiple times.

11. A pharmaceutical composition or kit, wherein, It comprises one or more selected from the following: i) the chimeric Fc receptor of any one of claims 1 to 4; ii) the nucleic acid molecule of claim 5; iii) the vector of claim 6 or 7; And iv) the cell of claim 8 to 9; and a pharmaceutically acceptable diluent or excipient.

Images