Allosteric modulators for extrasynaptic GABA-a receptors

The development of selective allosteric modulators for extrasynaptic GABA-A receptors addresses the need for targeted modulation of GABA-A subtypes, improving therapeutic efficacy in neurological disorders by selectively inhibiting or activating these receptors.

WO2026154086A1PCT designated stage Publication Date: 2026-07-23UNIVERSITY OF COPENHAGEN
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
UNIVERSITY OF COPENHAGEN
Filing Date
2026-01-15
Publication Date
2026-07-23

AI Technical Summary

Technical Problem

There is a need for selective inhibitors and modulators of extrasynaptic GABA-A receptors, particularly for conditions like absence epilepsy, where elevated tonic current is dysregulated, and existing positive allosteric modulators lack selectivity and druggability for brain-targeted compounds.

Method used

Development of negative and positive allosteric modulators (NAMs and PAMs) targeting c Pib-containing extrasynaptic GABA-A receptors, which exhibit selective modulation of different GABA-A subtypes, improving BBB permeability and pharmacological profiles for neurological disorders.

Benefits of technology

These modulators provide selective inhibition or activation of GABA-A receptors, addressing dysregulated tonic inhibition in neurological conditions, enhancing therapeutic efficacy and safety for brain-targeted treatments.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure IMGF000001_0001
    Figure IMGF000001_0001
  • Figure IMGF000003_0001
    Figure IMGF000003_0001
  • Figure IMGF000004_0001
    Figure IMGF000004_0001
Patent Text Reader

Abstract

The present disclosure relates to allosteric modulators for extrasynaptic GABA-A receptors and their use in therapy.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] P7022PC00

[0002] Allosteric modulators for extrasynaptic GABA-A receptors

[0003] Technical field

[0004] The present disclosure relates to allosteric modulators for extrasynaptic GABA-A receptors and their use in therapy.

[0005] Background

[0006] The main inhibitory neurotransmitter system in the brain, the y-aminobutyric acid (GABA) system, with its predominant GABA type A receptor (GABAAR) system is a target for several molecules, including benzodiazepines, neurosteroids, barbiturates, propofol, volatile anaesthetics, and putatively ethanol. Their actions lead to anxiolytic, sedative, memory-modifying, anticonvulsant, and hypnotic effects. GABAA assemble as heteropentameric complexes from a variety of subunits (ai-6, P1-3, Y1-3, 6, £, 9, TT, and P1-3). There are two different forms of inhibition mediated by GABAAR. The subunit compositions differ with different synaptic localizations as well as with the types of inhibition mediated. Synaptic receptors, typically composed of two a, two p, and one y subunit, lead to phasic inhibition, whereas tonic inhibition is mediated mostly by peri- and extrasynaptic b-containing receptors. These receptors are characterized by their enhanced GABA sensitivities and reduced desensitization properties and can be regarded as prototypic extrasynaptic receptors at ambient GABA concentrations.

[0007] Extrasynaptic GABAAR containing the 5 subunit are found in the cerebellum, thalamus, olfactory bulb, cortex, and hippocampus, where the 5 subunit is frequently codistributed with a4 and a6 subunits. The GABAAR subtypes aef^ / sb are expressed at high levels exclusively by mature cerebellar granule neurons. In forebrain areas, for example, in thalamic relay cells, the neostriatum, the dentate gyrus, and some layers of the cortex, 5 subunits are combined with a4 and P2 / 3 subunits. In hippocampal interneurons, tonic inhibition seems to be also conveyed via aipb receptors. The major fraction of non-b- containing receptors that are found in areas other than synapses may be constituted by a5Py2-type receptors in the hippocampus. a4pib receptors are reported to be expressed in the hippocampus and also in the periaqueductal

[0008] grey matter throughout the female oestrous cycle where it may serve an important physiological role (Griffiths 2005, Mangan 2005).

[0009] It has been estimated that tonic current in hippocampal neurons is responsible for 60-

[0010]

[0011] P7022PC00

[0012] important input for regulation of the neuronal membrane potential. In several brain conditions such as epilepsy and stroke, tonic inhibition is dysregulated, thus making 5 subunit-containing GABAARS potential targets for improved therapy. However, no selective inhibitors for this target have been reported to date. Specifically, in absence seizures, it is of interest to inhibit GABA transmission as this type of epilepsy is characterised by enhanced GABA signalling specifically in thalamo-cortical neurons. Elevated tonic current is also seen in human succinate semialdehyde dehydrogenase (SSADH; ALDH5A1) deficiency (Drasbek et al. 2008).

[0013] Several positive allosteric modulators (PAMs) of GABAAR have been developed which find potential use in increasing the activity of GABAA receptors, thus having sedative and / or anxiolytic properties. Recently, a neurosteroid-derived PAM was approved for the treatment of postpartum depression. However, in diseases and disorders such as absence epilepsy, the opposite effect is desired, and accordingly, the provision of a negative allosteric modulator (NAM) of GABAA receptors would be beneficial. However, there is also still a need for more PAMs of extrasynaptic GABAAR in order to improve chances of identifying effective and clinically safe compounds. Furthermore, there is still a need to improve druggability compared to existing compounds having PAM activity, especially for compounds intended to exert their effect in the brain.

[0014] Furthermore, as different GABAA receptor subtypes are expressed to different extents in various brain regions and in different disorders, achieving selectivity for some GABAA receptor subtypes over others is especially desirable

[0015] Summary

[0016] Disclosed herein are the first reported negative allosteric modulators (NAMs) of c Pib-containing extrasynaptic GABAA receptors, exemplified by inhibition of the c Pib subtype. Such compounds may find use in therapy, such as in the treatment of neurological diseases and disorders.

[0017] Disclosed herein are positive allosteric modulators (PAMs) of c pb-containing extrasynaptic GABAA receptors, exemplified by positive modulation of several c ps subtypes. Such compounds may find use in therapy, such as in the treatment of neurological diseases and disorders. Some of these compounds exhibit improved BBB permeability over known GABAA PAMS.P7022PC00

[0018] Disclosed herein are modulators of c pb-containing extrasynaptic GABAA receptors which exhibit NAM activity on the c Pib subtype, but PAM activity on the a4p2<5 and c sG subtypes. The different GABAA subtypes are expressed to different extents in different brain regions, and may also be expressed to different extents between different disorders. Such compounds thus exhibit a unique pharmacological profile not seen before, and they may find use in the treatment of neurological diseases and disorders where simultaneous activation and inhibition of different GABAA subtypes, e.g., in different brain regions.

[0019] One aspect of the disclosure provides for a compound of formula (I):

[0020] (Rl)n" E J / >-4

[0021] ZYR3

[0022] X

[0023] R2formula (I),

[0024] wherein:

[0025] R1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-6alkynyl, Ci-ealkoxy, Ci-eacyl, Cs-wcycloalkyl, Ce-waryl, Ce-warylCi-ealkyl, C2-loheterocyclyl, C2- heteroaryl, C2- heteroarylCi-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-ealkynyl, Ci-ealkoxy, and Ci-eacyl;

[0026] R2is selected from Ci-ealkyl, C2-ealkenyl, C2-ealkynyl, Ci-ealkoxy, Cs-wcycloalkyl, Ce- aryl, Ce- arylCi-ealkyl, C2-wheterocyclyl, C2-wheteroaryl, C2- heteroarylCi-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, C1-6alkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce-warylamino, Ce-wdiarylamino, and Ce-waryloxy;

[0027] R3is hydrogen or Ci-ealkyl,

[0028]

[0029] P7022PC00

[0030]

[0031] R6is selected from Ci-4alkyl, C2-4alkenyl, C2-4alkynyl, Ci-4alkoxy, Ce- aryl, Ce- arylCi-4alkyl, C2- heterocyclyl, C2- heteroaryl, C2- heteroarylCi-6alkyl, fluoro, chloro, bromo, and iodo,

[0032] R7is hydrogen or Ci-ealkyl,

[0033] n is 0, 1, 2, 3, or 4,

[0034] p is 0, 1, or 2,

[0035] X is CO, SO2, or a bond,

[0036] Y is N or CH,

[0037] or a pharmaceutically acceptable salt thereof.

[0038] One aspect of the disclosure provides for a pharmaceutical composition comprising the compound of the disclosure.

[0039] One aspect of the disclosure provides for the compound of the disclosure or the pharmaceutical composition of the disclosure for use in medicine.

[0040] One aspect of the disclosure provides for the compound of the disclosure or the pharmaceutical composition of the disclosure for use in the treatment of a neurological disease or disorder.

[0041] One aspect of the disclosure provides for a method of treating a neurological disease or disorder, said method comprising administering the compound of the disclosure or the pharmaceutical composition of the disclosure to a subject in need thereof.

[0042] One aspect of the disclosure provides for a method of inhibiting the GABAA receptor in a subject in need thereof, said method comprising administering the compound of the disclosure or the pharmaceutical composition of the disclosure to the subject.

[0043] One aspect of the disclosure provides for a method of activating the GABAA receptor in a subject in need thereof, said method comprising administering the compound of the disclosure or the pharmaceutical composition of the disclosure to the subject.

[0044] One aspect of the disclosure provides for a method of activating the GABAA receptorP7022PC00

[0045] □4 26 and / or 04036 subtypes while inhibiting the GABAA receptor O40I6 subtype in a subject in need thereof, said method comprising administering the compound of the disclosure or the pharmaceutical composition of the disclosure to the subject.

[0046] One aspect of the present disclosure provides for a use of the compound of the disclosure for the manufacture of a medicant for the treatment of a neurological disease or disorder.

[0047] Description of Drawings

[0048] FIG 1: A) Results of the primary screening of each analogue at 10 pM coapplied with GABA 1 pM at O40ib GABAA S using whole-cell patch-clamp electrophysiology. Data are shown as pooled data from 2-3 cells given as mean ± SEM and normalized to GABAmax. SM-20 is compound 3j. B and D) Representative current traces for DS2, compound 30, 3.16 / 3c, 3.21 / 3s, and 3.18 / 3e coapplied with GABA 1 pM. C) Concentration-response curves of the modulation of GABA EC20 by 3.16 / 3c and 3.21 / 3s at O40ib GABAARS in the FMP assay. Data are shown as pooled curves normalized to GABAmax given as mean ± SEM (n =3-5 with three technical replicates). Collected EC50 values ± SEM and Hill slopes are given in table 1. D) Time constants, T, for currents induced by GABA 1 pM with or without 10 pM 3.18 / 3e (NNJ-95-2) are determined by fitting to a monoexponential function. Data are shown as box plots (boxes, 25 to 75%; whiskers, minimum and maximum; lines, median) for 8 cells.

[0049] Statistical analysis was performed using unpaired t-test, p=0.0027.

[0050] FIG 2: A) Representative whole-cell patch-clamp electrophysiology current traces for GABA 1 pM (10 pM for y2-containing GABAARS) before and after 10 s application of 3.18 / 3e (NNJ-95-2) at O40ib, Q40IY2, Q402Y2, and QI02Y2 GABAARS. B) 3.18 / 3e (NNJ-95-2) concentration-dependently inhibits the current induced by GABA 1 pM (corresponding to GABA EC20) at O40ib GABAARS with an IC50 of 8.87 pM (n = 6) with a Hill slope of -1.57. Data are shown as pooled data from 6 cells given as means ± SEM and normalized to the GABA 1 pM control. C) At cu0iY2, Q402Y2, and QI02Y2 GABAAR subtypes, 3.18 / 3e (NNJ-95-2) (1, 3, 10 pM) does not significantly inhibit the current amplitude of GABA 1 pM. Currents were normalized to the maximum GABA current and presented as %l / lmax ± SEM from minimum two independent transfections (n = 5-6). Statistical analyses were performed using two-sided Welch’s / test compared with GABA 1 pM control current and adjusted for multiple testing using the original FDRP7022PC00

[0051] method of Benjamini and Hochberg with a discovery rate of 0.05.

[0052] FIG 3: A) Single representative GABA concentration-response curves for c Pib wildtype (WT), O4(T300I) I5, and O4 I5(L260V) GABAARS (means ± SD, three technical replicates) using the FMP assay. B) Bar diagram of pooled pECso values determined in the FMP assay (means with 95% confidence intervals (Cl), each point representing an independent replicate (n = 3-9), and C) bar diagram of maximum amplitude induced by 100 pM GABA fora4p15 WT, a4(T300l)Pi5, and a4p15(L260V) GABAARS in whole-cell patch-clamp electrophysiology (means ± SD n = 6). Statistical analyses were performed using one-way ANOVA with post hoc Dunnett’s test. D) 3.18 / 3e (NNJ-95-2) reduces GABA control current amplitudes of O4(T300I) I5, and O4 I5(L260V) GABAARS. Currents were normalized to the maximum GABA current and presented as %l / lmax ± SEM from minimum three independent transfections (n = 5-12). Statistical analyses were performed using two-sided Welch’s t test compared with GABA 1 pM control current and adjusted for multiple testing using the original FDR method of Benjamini and Hochberg with a discovery rate of 0.05. E) Representative whole-cell patch-clamp electrophysiology current traces for GABA 1 pM before and after 10 s application of 3.18 / 3e (NNJ-95-2) at O4(T300l)Pib, and O4Pib(L260V) GABAARS.

[0053] FIG 4: Testing of IP-6, IP-11, IP-12, IP-21, IP-22, IP-26 and IP-27 at a4Pib using wholecell patch-clamp electrophysiology. A) Currents of GABA 1 pM co-applied with IP-6 or IP-12 10 pM were normalized to GABA 1 pM control current, and C) Currents of GABA 1 pM before and after 10 s application of IP-6, IP-11, IP-12, IP-21, IP-22, IP-26 or IP-27 10 pM. Currents were normalized to the maximum GABA current (%l / lmax). Data are shown as box plots (boxes, 25 to 75%; whiskers, minimum and maximum; lines, median). B-D) Representative whole-cell patch-clamp electrophysiology current traces of B) GABA 1 pM co-applied with IP-6 or IP-12 10 pM, or D) GABA 1 pM before and after 10 s application of IP-6, IP-11, IP-12, IP-21, IP-22, IP-26 or IP-2710 pM.

[0054] FIG 5: Reagents and conditions: (i) KCN, BiCh, EtOH / H2O, 80°C, 7% (providing 2a); (ii) tert-butyl isocyanide, NH4CI, toluene, 110°C, 25-80% (providing 1b-1o); (iii) for 1o: 2-thienylboronic acid, Na2CO3, Pd(PPh3)4, 1:2 H2O / DME, 90°C, 76%; (iv) for 1c-p: 5M HBr (aq), 100°C, 34- 99%; (v) for 1b: (a) 33 wt.% HBr solution in acetic acid, 35°C and b) 1M HCI (aq), rt, 33%; (vi) for 1e: triisopropyl silane, TFA, H2O, rt, 45%; (vii) respective acyl chloride (for 2a-m and 2o-q: 4-chlorobenzoyl chloride. For 2n: 4-P7022PC00

[0055] chlorobenzoyl chloride, acetyl chloride and 1 -adamantanecarbonyl chloride), toluene (dry), pyridine (dry), rt, 3-71%; (viii) for2n: HBTU, TEA, DCM, rtto 55°C, 12%; (ix) for 3f: 1:1 MeOH / 1,4-dioxane, NaOMe, 60°C, 2%; (x) for3t: THF, 5M NaOH (aq), rt, 39%. Compound 3n correspond to the compound 30 from literature (Rostrup et al. 2021).

[0056] FIG 6: Whole-cell patch-clamp electrophysiology current traces for GABA 1 pM before and after 10 s co-application of A) 3.18 / 3e (NNJ-95-2) and B) IP-27 at recombinant c PsG GABAAR expressed in HEK293 cells showing PAM effects. Data are shown as pooled data and presented as %l / lmax ± SEM from minimum two independent transfections and at least n = 4. C) Current traces for GABA 1 pM with co-application of analogues DS2, NNJ-95, IP-6, IP-26, IA-83 and IA-95 at recombinant c PaG and D) DS2, NNJ-95 and IA-83 a CUP26 GABAAR expressed in HEK293 cells. Data are shown as pooled data and presented as %l / lmax ± SEM from minimum two independent transfections and at least n = 2.

[0057] Detailed description

[0058] Definitions

[0059] As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly states otherwise.

[0060] A dashed line indicates the attachment point of a chemical moiety.

[0061] As used herein, the term ‘cycloalkyl’ refers to a saturated or unsaturated nonaromatic hydrocarbon mono-or multi-ring system having e.g. 3 to 10 carbon atoms. Suitable cycloalkyls include, but are not limited to cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, cyclopentenyl, cyclohexenyl, cycloheptenyl, cycloheptynyl, adamantyl, norbonyl, cubanyl, bicyclo[2.2.2]octanyl, bicyclo[1.1.1]pentyl, spiro[3.3]heptanyl, and the like.

[0062] The term “treatment”, as used herein, refers to the combating of a disease or disorder. “Treatment” or “treating,” as used herein, includes any desirable effect on the symptoms or pathology of a disease or condition as described herein, and may include even minimal changes or improvements in one or more measurable markers of the disease or condition being treated. “Treatment” or “treating” does not necessarily indicate complete eradication or cure of the disease or condition, or associatedP7022PC00

[0063] symptoms thereof.

[0064] Compounds of the disclosure

[0065] One embodiment of the disclosure provides for a compound of formula (I):

[0066]

[0067] formula (I),

[0068] wherein:

[0069] R1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-6alkynyl, Ci-ealkoxy, Ci-eacyl, Cs-wcycloalkyl, Ce- aryl, Ce- arylCi-ealkyl, C2- wheterocyclyl, C2-wheteroaryl, C2- heteroarylCi-ealkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, C1-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-ealkynyl, Ci-ealkoxy, and Ci-eacyl;

[0070] R2is selected from Ci-ealkyl, C2-ealkenyl, C2-ealkynyl, Ci-ealkoxy, Cs-wcycloalkyl, Ce- waryl, Ce-warylCi-ealkyl, C2-wheterocyclyl, C2-wheteroaryl, C2-wheteroarylCi-ealkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, C1-6alkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCiwacyl, Ce-waryl, Ce-warylamino, Ce-wdiarylamino, and Ce-waryloxy;

[0071] R3is hydrogen or Ci-ealkyl,

[0072]

[0073] R6is selected from Ci-4alkyl, C2-4alkenyl, C2-4alkynyl, Ci-4alkoxy, Ce-waryl, Ce-warylCi-4alkyl, C2- heterocyclyl, C2- heteroaryl, C2- heteroarylCi-6alkyl, fluoro, chloro, bromo, and iodo,

[0074] R7is hydrogen or Ci-ealkyl,P7022PC00

[0075] n is 0, 1, 2, 3, or 4,

[0076] p is 0, 1, or 2,

[0077] X is CO, SO2, or a bond,

[0078] Y is N or CH,

[0079] or a pharmaceutically acceptable salt thereof.

[0080] In one embodiment of the disclosure, Y is N. In one embodiment of the disclosure, the compound has the structure of formula (II):

[0081] X

[0082]

[0083] R2formula (II).

[0084] In one embodiment of the disclosure, n is 0, 1, or 2.

[0085] In one embodiment of the disclosure, the compound is selected from formulae (lla)- (Hd):

[0086] x

[0087] R2formula (Ila),

[0088] X

[0089] R2formula (lib),

[0090]

[0091]

[0092] R2formula (lid).P7022PC00

[0093] In one embodiment of the disclosure, the compound is selected from formulae (lle)-(llj):

[0094] x

[0095] R2formula (He),

[0096] x

[0097] R2formula (Ilf),

[0098] , N

[0099] / >— R

[0100] R2formula (I Ig),

[0101] /

[0102] X

[0103] r2formula (llh),

[0104] x

[0105] R2formula (Hi),

[0106] x

[0107]

[0108] R2formula (I Ij).

[0109]

[0110] orP7022PC00

[0111] In one embodiment of the present disclosure, R4is hydrogen,

[0112]

[0113]

[0114] In one embodiment of the present disclosure R4is selected from hydrogen,

[0115]

[0116]

[0117] In one embodiment of the present disclosure, R4is selected from hydrogen, -11, s IPhN-^ / S> s^z S^CIS-^Z s^z1--U.-’U,,-< J,-< I

[0118]

[0119] In one embodiment of the disclosure,

[0120]

[0121] Rais

[0122] In one embodiment of the disclosure, the compound has the structure of formula (III):

[0123]

[0124] formula (III).

[0125] In one embodiment of the disclosure, the compound is selected from formulae (llla)-P7022PC00

[0126] (Hid):

[0127] R1R7

[0128] , NR3

[0129] X

[0130] R2formula (Illa),

[0131] R7

[0132] X

[0133]

[0134] r2formula (Hid).

[0135] In one embodiment of the disclosure, the compound is selected from formulae (llle)-(Hlj):

[0136] X

[0137] R2formula (I lie),

[0138] x

[0139]

[0140] R2formula (lllf),P7022PC00

[0141]

[0142] R7

[0143] X

[0144] R2formula (lllh),

[0145] R7

[0146] X

[0147] R2formula (Illi),

[0148] R7

[0149] X

[0150]

[0151] R2formula (II Ij).

[0152] In one embodiment of the disclosure, X is CO. In one embodiment of the disclosure, the compound is of formula (IV):

[0153] o

[0154]

[0155] R2formula (IV).

[0156] In one embodiment of the disclosure, the compound is selected from formulae (IVa)-(IVd):

[0157] R1

[0158] NR3

[0159] 0=^

[0160]

[0161] R2formula (IVa),P7022PC00

[0162]

[0163] In one embodiment of the disclosure, the compound is selected from formulae (IVe)-(IVj):

[0164] R1

[0165] O- R2formula (IVe),

[0166] R1

[0167] R1J5Q-R4

[0168] NR3

[0169]

[0170] R2formula (IVf),

[0171] R1

[0172] 0=^

[0173]

[0174] R2formula (I Vg),P7022PC00

[0175] 4

[0176] formula (IVh),

[0177]

[0178] In one embodiment of the disclosure, the compound is of formula (V):

[0179]

[0180] In one embodiment of the disclosure, the compound is selected from formulae (Va)-(Vd):

[0181] formula (Va),

[0182]

[0183] R- formula (Vb),P7022PC00

[0184] formula (Vc),

[0185] R7

[0186] formula (Vd).

[0187] In one embodiment of the disclosure, the compound is selected from formulae (Ve)-(Vj):

[0188] R2formula (Ve),

[0189]

[0190] R2formula (Vf),

[0191] R2formula (Vg),

[0192] R7

[0193]

[0194] r2formula (Vh),P7022PC00

[0195] R7

[0196] R2formula (Vi),

[0197] R7

[0198]

[0199] R2formula (Vj).

[0200] In one embodiment of the disclosure, the compound has the structure of formula (VI):

[0201]

[0202] wherein R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-6alkenyl, haloC2-ealkenyl, Ci-ealkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce- diarylamino, and C6-10aryloxy, and wherein m is 0, 1, 2, or 3.

[0203] In one embodiment of the disclosure, the compound is selected from formulae (Vla)-(Vld):

[0204] R1

[0205] NR3

[0206] X

[0207] z / ^r(R5)m

[0208]

[0209] formula (Via),P7022PC00

[0210] n,

[0211] X

[0212] formula (VI b),

[0213]

[0214] In one embodiment of the disclosure, the compound is selected from formulae (Vie)- (Vlj):

[0215]

[0216] formula (Vlf),P7022PC00

[0217]

[0218] In one embodiment of the disclosure, the compound has the structure of formula (VII):

[0219]

[0220] wherein:

[0221] R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, Ci-ealkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, C1-P7022PC00

[0222] eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce- diarylamino, and C6-10aryloxy, and wherein m is 0, 1, 2, or 3.

[0223] In one embodiment of the disclosure, the compound is selected from formulae (IVa)-(IVd):

[0224] R7

[0225]

[0226] formula (Vlld).

[0227] In one embodiment of the disclosure, the compound is selected from formulae (Vlle)-(Vllj):P7022PC00

[0228] formula (VIIh),

[0229]

[0230] formula (VIIi),P7022PC00

[0231]

[0232] In one embodiment of the present disclosure, the compound has the structure of formula (VIII):

[0233] o

[0234]

[0235] formula (VIII),

[0236] wherein R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-6alkenyl, haloC2-ealkenyl, Ci-ealkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce- diarylamino, and C6-10aryloxy, and wherein m is 0, 1, 2, or 3.

[0237] In one embodiment of the present disclosure, the compound is selected from formulae (VIIIa)-(VIIId):

[0238]

[0239] formula (VIIIb),P7022PC00

[0240]

[0241] In one embodiment of the present disclosure, the compound is selected from formulae (VIIIe)-(VIIIj):

[0242] formula (VIIIe),

[0243]

[0244] formula (VIIIf),

[0245]

[0246] formula (VIIIg),P7022PC00

[0247] formula (VIIIh),

[0248]

[0249] formula (VIIIj).

[0250] In one embodiment of the disclosure, m is 0 or 1.

[0251] In one embodiment of the disclosure, p is 0, 1, or 2, preferably 1 or 2.

[0252] In one embodiment of the disclosure, R4is selected from

[0253]

[0254]

[0255] In one embodiment of the disclosure, R4is selected from

[0256]

[0257] P7022PC00

[0258]

[0259] In one embodiment of the disclosure, R2is 4-chlorophenyl.

[0260] C(R5)m

[0261]

[0262] , adamantyl such as 1-adamantyl or 2-adamantyl, cubanyl, bicyclo[2.2.2]octanyl such as bicyclo[2.2.2]octan-1-yl or bicyclo[2.2.2]octan-2-yl, norbornyl such as norborn-1-yl, norborn-2-yl, or norborn-7-yl, bicyclo[1.1.1]pentyl, or spiro[3.3]heptanyl, any one of which may optionally be substituted,

[0263] wherein R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-6alkenyl, haloC2-ealkenyl, Ci-ealkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce- diarylamino, and C6-10aryloxy, and wherein m is 0, 1, 2, or 3.

[0264] In one embodiment of the disclosure, R2is an optionally substituted adamantyl group, such as an optionally substituted adamant-1 -yl group or an optionally substituted adamant-2-yl group.

[0265] In one embodiment of the disclosure, halo is selected from fluoro, chloro, bromo, iodo, including combinations thereof.

[0266] In one embodiment of the disclosure, C1-6alkyl is selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, sec-pentyl, tert-pentyl, neopentyl, and linear or branched hexyl.

[0267] In one embodiment of the disclosure, R3is selected from hydrogen, methyl, and ethyl.

[0268] In one embodiment of the disclosure, R3is hydrogen.

[0269] In one embodiment of the disclosure, R7is selected from hydrogen, methyl, ethyl, n-P7022PC00

[0270] propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, sec-pentyl, tert-pentyl, neopentyl, and linear or branched hexyl.

[0271] In one embodiment of the disclosure, R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

[0272] In one embodiment of the disclosure, R1is selected from methyl, ethyl, F, Cl, Br, I, thien-2-yl, and thien-3-yl.

[0273] In one embodiment of the disclosure:

[0274] R3is hydrogen,

[0275] n is 0, 1, or 2,

[0276] X is O, and

[0277] Y is N.

[0278] In one embodiment of the disclosure,

[0279] R3is hydrogen,

[0280] R7is hydrogen, methyl, ethyl, n-propyl, or isopropyl,

[0281] n is 0, 1, or 2,

[0282] X is CO, and

[0283] Y is N.

[0284] In one embodiment of the disclosure, the compound has a structure selected from R7

[0285] formula (II) and (lla)-(llj), preferably (lie),

[0286]

[0287] R4is or v— y, and R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

[0288] In one embodiment of the disclosure, the compound has a structure selected from formula (III) and (llla)-(lllj), preferably (I He), and wherein R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

[0289] In one embodiment of the disclosure, the compound has a structure selected fromP7022PC00

[0290] formula (IV) and (IVa)-(IVj), preferably (

[0291]

[0292] IVc), R4is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

[0293] In one embodiment of the disclosure, the compound has a structure selected from formula (V) and (Va)-(Vj), preferably (Vc), and wherein R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

[0294] In one embodiment of the disclosure, the compound has a structure selected from R7

[0295] / =>(R7)P formula (VI) and (Vla)-(Vlj), preferably (V

[0296]

[0297] ic), R4is or, and R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

[0298] In one embodiment of the disclosure, the compound has a structure selected from formula (VII) and (Vlla)-(Vllj), preferably (Vile), and wherein R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

[0299] In one embodiment of the disclosure, the compound has a structure selected from R7

[0300] / = '(R7)P formula (VIII) and (VIIIa-VIIIj), preferably (Ville), R4is

[0301]

[0302] or v—, and R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

[0303] In one embodiment of the disclosure, the compound has the structure of formula (Vic), wherein:

[0304] R1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-6alkynyl, Ci-ealkoxy, Ci-eacyl, Cs- cycloalkyl, Ce- aryl, Ce- arylCi-ealkyl, C2-loheterocyclyl, C2- heteroaryl, C2- heteroarylCi-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, C1-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-ealkynyl, Ci-ealkoxy, and Cieacyl,P7022PC00

[0305] R3is H,

[0306] R7

[0307]

[0308] R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl,

[0309] R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, Ci-ealkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce-warylamino, Ce-wdiarylamino, and Ce-waryloxy, and m is 0 or 1.

[0310] In one embodiment of the disclosure, the compound has the structure of formula (Vile), wherein:

[0311] R1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-6alkynyl, Ci-ealkoxy, Ci-eacyl, Cs-wcycloalkyl, Ce-waryl, Ce-warylCi-ealkyl, C2-loheterocyclyl, C2- heteroaryl, C2- heteroarylCi-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-ealkynyl, Ci-ealkoxy, and Ci-eacyl,

[0312] R3is H,

[0313] R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl,

[0314] R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, Ci-ealkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce-wdiarylamino, and C6-10aryloxy, and m is 0 or 1.

[0315] In one embodiment of the disclosure, the compound has the structure of formula (Vic), wherein:

[0316] R1is selected from methyl, ethyl, F, Cl, Br, I, thien-2-yl, and thien-3-yl,

[0317] R3is H,P7022PC00

[0318] R7

[0319]

[0320] R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl,

[0321] R5is selected from fluoro, chloro, bromo, iodo, C1-6alkoxy, and C6-10aryloxy, and m is 0 or 1.

[0322] In one embodiment of the disclosure, the compound has the structure of formula (Vile), wherein:

[0323] R1is selected from methyl, ethyl, F, Cl, Br, I, thien-2-yl, and thien-3-yl,

[0324] R3is H,

[0325] R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl,

[0326] R5is selected from fluoro, chloro, bromo, iodo, Ci-ealkoxy, and C6-10aryloxy, and m is 0 or 1.

[0327] In one embodiment of the disclosure, the compound has a structure selected from formula (II) and (lla)-(llj), preferably (He), and wherein R4is selected from hydrogen,

[0328]

[0329] In one embodiment of the disclosure, the compound has a structure selected from formula (IV) and (IVa)-(IVj), preferably (IVc), and wherein R4is selected from

[0330] hydrogen,

[0331]

[0332] In one embodiment of the disclosure, the compound has a structure selected from formula (VI) and (Vla)-(Vlj), preferably (Vic), and wherein R4is selected from hydrogen,P7022PC00

[0333]

[0334] In one embodiment of the disclosure, the compound has the structure of formula (He), wherein

[0335] R1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-6alkynyl, Ci-ealkoxy, Ci-eacyl, Cs- cycloalkyl, Ce- aryl, Ce-warylCi-ealkyl, C2-loheterocyclyl, C2- heteroaryl, C2- heteroarylCi-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-ealkynyl, Ci-ealkoxy, and Ci-eacyl,

[0336] R3is H,

[0337]

[0338] R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, C1-6alkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce-wdiarylamino, and C6-10aryloxy, and m is 0 or 1.

[0339] In one embodiment of the disclosure, the compound has the structure of formula (He), wherein

[0340] R1is selected from methyl, ethyl, F, Cl, Br, I, thien-2-yl, and thien-3-yl,

[0341] R3is H,

[0342]

[0343] P7022PC00

[0344]

[0345] R5is selected from fluoro, chloro, bromo, iodo, C1-6alkoxy, and C6-10aryloxy, and m is 0 or 1.

[0346] In one embodiment of the disclosure, the compound has the structure of formula (IVc), wherein

[0347] R1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-6alkynyl, Ci-ealkoxy, Ci-eacyl, Cs-wcycloalkyl, Ce-waryl, Ce-warylCi-ealkyl, C2-loheterocyclyl, C2- heteroaryl, C2- heteroarylCi-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-ealkynyl, Ci-ealkoxy, and Ci-eacyl,

[0348] R3is H,

[0349] R4is selected from the group of hydrogen,

[0350]

[0351] , \-"N,,

[0352]

[0353] R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, C1-6alkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce-wdiarylamino, and C6-10aryloxy, and m is 0 or 1.

[0354] In one embodiment of the disclosure, the compound has the structure of formula (IVc), wherein

[0355] R1is selected from methyl, ethyl, F, Cl, Br, I, thien-2-yl, and thien-3-yl,

[0356] R3is H,P7022PC00

[0357]

[0358] R5is selected from fluoro, chloro, bromo, iodo, C1-6alkoxy, and C6-10aryloxy, and m is 0 or 1.

[0359] In one embodiment of the disclosure, the compound has the structure of formula (VI He), wherein

[0360] R1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-6alkynyl, Ci-ealkoxy, Ci-eacyl, Cs-wcycloalkyl, Ce-waryl, Ce-warylCi-ealkyl, C2-loheterocyclyl, C2- heteroaryl, C2- heteroarylCi-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2-ealkenyl, C2-ealkynyl, Ci-ealkoxy, and Ci-eacyl,

[0361] R3is H,

[0362]

[0363] R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, C1-6alkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce-wdiarylamino, and C6-10aryloxy, and m is 0 or 1.

[0364] In one embodiment of the disclosure, the compound has the structure of formula (VI He), whereinP7022PC00

[0365] R1is selected from methyl, ethyl, F, Cl, Br, I, thien-2-yl, and thien-3-yl,

[0366] R3is H,

[0367]

[0368] R5is selected from fluoro, chloro, bromo, iodo, Ci-ealkoxy, and C6-10aryloxy, and m is 0 or 1.

[0369] In one embodiment of the disclosure, the compound has the structure of formula (VI He), wherein

[0370] R1is selected from methyl, Br, and thien-2-yl,

[0371] R3is H,

[0372]

[0373] R2is selected from 4-chlorophenyl, 3-(methyloxycarbonyl)phenyl, 3-hydroxyphenyl, methyl, and 1-adamantyl.

[0374] In one embodiment of the disclosure, the compound has a structure selected from:

[0375]

[0376]

[0377]

[0378] The compound of the disclosure may have different or same activity on the GABAA receptor subtypes. In one embodiment of the present disclosure, said compound is a positive allosteric modulator of the GABAA receptor. In one embodiment of the present disclosure, said compound is a negative allosteric modulator of the GABAA receptor. In one embodiment of the present disclosure, said compound is a positive allosteric modulator of the GABAA receptor O40I6 subtype. In one embodiment of the present disclosure, said compound is a positive allosteric modulator of the GABAA receptor 04026 subtype. In one embodiment of the present disclosure, said compound is a positive allosteric modulator of the GABAA receptor 04036 subtype. In one embodiment of the present disclosure, said compound is a positive modulator of the GABAA receptor O40ib, 04026, and 04036 subtypes. In one embodiment of the present disclosure, said compound is a negative allosteric modulator of the GABAA receptor O40ib subtype and a positive allosteric modulator of the 04026 and / or the 04036 GABAA receptor subtype.P7022PC00

[0379] Some compounds of the disclosure were found to permeate the blood-brain-barrier, which is paramount for the successful treatment of many CNS disorders. Permeation is in part due to the compounds having specific lipophilicities. The lipophilicity can be assessed using the logP value of the compounds. The logP value can generally be measured from the partition between e.g water and octanol. Blood-brain-barrier penetration can also be measured as the distribution between brain and plasma after systemic administration to mice. In one embodiment of the present disclosure, the logP value is measured as the partition between water and octanol. In one embodiment the logP value is calculated. The calculation methods may be Crippen’s method, the Ghose-Crippen method, the Wildman-Crippen method, or the XLogP method. In one embodiment, the compound of the disclosure has a logP value in the range of 2.8 to 3.9, such as 2.9 to 3.8, such as 3.0 to 3.7, such as 3.1 to 3.6.

[0380] In one embodiment, the compound is not any one of:

[0381] / V-[2-(2-Thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0382] / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0383] 4-Methyl- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0384] / V-[6-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0385] 2-Methyl- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0386] / V-[8-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0387] 3-Methyl- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0388] 4-Hydroxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0389] 4-Methyl- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Methyl- / V-[6-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 3,5-Dimethyl- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0390] 3-Methyl- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Methoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0391] 4-Methyl- / V-[8-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[2-(2-Thienyl)imidazo[1,2-a]pyridin-3-yl]-2-naphthalenecarboxamide, / V-[2-(2-Thienyl)imidazo[1,2-a]pyridin-3-yl]-1 -naphthalenecarboxamide, 2-lodo- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0392] 4-lodo- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0393] 4-Chloro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0394] / V-(2,6-Di-2-thienylimidazo[1,2-a]pyridin-3-yl)benzamide,P7022PC00

[0395] 2-Bromo- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0396] 4-Bromo- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0397] 3.4-Dimethyl- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0398] 2-Fluoro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0399] 2-Methoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0400] 2-Chloro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0401] 3-lodo- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0402] 3-Methoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0403] / V-[6-Bromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0404] 3-Fluoro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0405] 3-Bromo- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0406] 3-Chloro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0407] / V-[6-Chloro-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0408] 4-(1,1-Dimethylethyl)- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 2-[[[2-(2-Thienyl)imidazo[1,2-a]pyridin-3-yl]amino]carbonyl]benzoic acid, 3.4-Dimethyl- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Chloro- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Methoxy- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Fluoro- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Chloro- / V-[6-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Phenyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0409] 4-Methoxy- / V-[6-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 2-Ethoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0410] 4-Chloro- / V-[8-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Chloro-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-methylbenzamide, 4-Methoxy- / V-[8-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Chloro- / V-[2-(5-methyl-2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 2-Ethoxy- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Nitro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0411] / V-[7-Bromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-chlorobenzamide, 4-Chloro- / V-[6-iodo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 2,6-Difluoro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0412] 4-Chloro- / V-[6-chloro-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Bromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-chlorobenzamide, 4-Chloro- / V-[6-fluoro-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,P7022PC00

[0413] 4-Butoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0414] / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-nitrobenzamide,

[0415] 3-Nitro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0416] / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0417] / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-3-nitrobenzamide,

[0418] 5-Bromo-2-chloro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Bromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-methoxybenzamide, / V-[6-Chloro-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-methoxybenzamide, / V-[2-(2-Thienyl)imidazo[1,2-a]pyridin-3-yl]-1,3-benzodioxole-5-carboxamide, 4-(Acetyloxy)- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0419] 2.4-Dimethoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0420] 3.4-Dimethoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0421] 2.3-Dimethoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0422] 4-(Phenylmethoxy)- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Chloro- / V-[6-methoxy-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 3.4-Dichloro- / V-[8-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 2.4-Dichloro- / V-[8-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-1,3-benzodioxole-5-carboxamide,

[0423] 4-Methyl-3-nitro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0424] / V-[6-Bromo-8-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-chlorobenzamide,

[0425] / V-[2-(2-Thienyl)imidazo[1,2-a]pyridin-3-yl]-3-(trifluoromethyl)benzamide, 3.5-Dinitro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0426] / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-hydroxybenzamide, 4-[[(1-Oxo-2-propen-1-yl)amino]methyl]- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0427] 4-Chloro- / V-[6,8-dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-fluorobenzamide, 2-Chloro-4,5-difluoro- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0428] 4-Chloro- / V-[6-(1-methylethoxy)-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0429] / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-3- (trifluoromethyl)benzamide,P7022PC00

[0430] 3.4.5-Triethoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0431] / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-methoxybenzamide, 4-Butoxy- / V-[6-chloro-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Bromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-butoxybenzamide, 4-Chloro-3-nitro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 3.4.5-Triethoxy- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Chloro- / V-[2-(2-thienyl)-6-(trifluoromethyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0432] / V-[6-Bromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-phenoxybenzamide, 4-Chloro- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-3-nitrobenzamide, Ethyl 3-[(4-chlorobenzoyl)amino]-2-(2-thienyl)imidazo[1,2-a]pyridine-6-carboxylate,

[0433] 8-Chloro-2,3-dihydro- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-1,4-benzodioxin-6-carboxamide,

[0434] 4-Butoxy- / V-[6,8-dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Chloro- / V-[8-(phenylmethoxy)-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,

[0435] / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-(2-fluoroethoxy)benzamide,

[0436] / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-(4-fluorobutoxy)benzamide,

[0437] / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-(3-fluoropropoxy)benzamide,

[0438] / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-3-(1-pyrrolidinylsulfonyl)benzamide,

[0439] N-(2-(thiophen-2-yl)imidazo[1,2-a]pyridin-3-yl)-2-naphthamide,

[0440] / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-(4-morpholinylsulfonyl)benzamide,

[0441] / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-3-(4-morpholinylsulfonyl)benzamide,

[0442] 4-Methoxy- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-3-(1-pyrrolidinylsulfonyl)benzamide, and

[0443] / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-[[(1,1-dimethylethyl)diphenylsilyl]oxy]benzamide.P7022PC00

[0444] Pharmaceutical compositions and therapy

[0445] One embodiment of the disclosure provides for a pharmaceutical composition comprising the compound of the disclosure.

[0446] One embodiment of the disclosure provides for the compound of the disclosure or the pharmaceutical composition of the disclosure for use in medicine.

[0447] One embodiment of the disclosure provides for the compound of the disclosure or the pharmaceutical composition of the disclosure for use in the treatment of a neurological disease or disorder.

[0448] In one embodiment of the disclosure, the neurological disease or disorder is ameliorated by inhibition of the GABAA receptor, such as the extrasynaptic GABAA receptor.

[0449] In one embodiment of the disclosure, the neurological disease or disorder is ameliorated by stimulation of the GABAA receptor, such as the extrasynaptic GABAA receptor.

[0450] In one embodiment of the disclosure, the neurological disease or disorder is selected from epilepsy, seizures, cognitive impairment, and brain injury. In one embodiment of the disclosure, the epilepsy is absence epilepsy.

[0451] In one embodiment of the disclosure, the brain injury is acute brain injury or chronic brain injury.

[0452] In one embodiment of the present disclosure, the neurological disease or disorder is Alzheimer’s disease or a similar condition with cognitive decline.

[0453] In one embodiment of the disclosure, the brain injury is stroke, such as ischemic stroke.

[0454] In one embodiment of the present disclosure, the neurological disease or disorder is selected from anxiety disorders, panic disorders, agoraphobia, animal and other phobias including social phobias, obsessive-compulsive disorder, stress disorders, andP7022PC00

[0455] generalized or substance-induced anxiety disorder; neuroses; convulsions; migraine; depressive or bipolar disorders, for example single-episode or recurrent major depressive disorder, post-partum depression, dysthymic disorder, bipolar I and bipolar II manic disorders, and cyclothymic disorder, psychotic disorders including schizophrenia, epilepsy, Parkinson's disease and Huntington's disease; neurodegeneration arising from cerebral ischemia attention deficit hyperactivity disorder; burette's syndrome; speech disorders, including stuttering; disorders of circadian rhythm, e.g. in subjects suffering from the effects of jet lag or shiftwork pain and nociception; emesis, including acute, delayed and anticipatory emesis, in particular emesis induced by chemotherapy or radiation, as well as motion sickness, and postoperative nausea and vomiting; eating disorders including anorexia nervosa and bulimia nervosa; premenstrual syndrome; muscle spasm or spasticity, e.g. in paraplegic patients; hearing disorders, including tinnitus and age-related hearing impairment, presbycusis and hyperacusis; urinary incontinence; the effects of substance abuse or dependency, including alcohol withdrawal; cognition disorders, for example in subjects suffering from dementing conditions such as Alzheimer's disease; sleep disorders such as insomnia, vestibular disorders such as Meniere's disease, benign paroxsysmal positional vertigo (BPPV), endolymphatic hydrops and mal de debarquement syndrome; attention deficit / hyperactivity disorder; intention tremor; and restless leg syndrome. In one embodiment, the sleep disorder is insomnia, such as primary or secondary insomnia. In one embodiment, the secondary insomnia is associated with or due to another condition, such as a neurodevelopmental disorder, a neurological disease, a neurodegenerative disease, a neuropsychiatric disease, a cardiometabolic disorder, an immune-related disturbance, and an age-related sleep disturbance.

[0456] In one embodiment of the disclosure, the neurological disease or disorder is succinic semialdehyde dehydrogenase (SSADH) deficiency.

[0457] One embodiment of the disclosure provides for a method of treating a neurological disease or disorder, said method comprising administering the compound of the disclosure or the pharmaceutical composition of the disclosure to a subject in need thereof.

[0458] One embodiment of the disclosure provides for a method of inhibiting the GABAAP7022PC00

[0459] receptor in a subject in need thereof, said method comprising administering the compound of the disclosure or the pharmaceutical composition of the disclosure to the subject.

[0460] One embodiment of the present disclosure provides for a method of activating the GABAA receptor in a subject in need thereof, said method comprising administering the compound of the disclosure or the pharmaceutical composition of the disclosure to the subject.

[0461] One embodiment of the present disclosure provides for a method of activating the GABAA receptor α4β2δ and / or α4β3δ subtypes while inhibiting the GABAA receptor α4β1δ subtype in a subject in need thereof, said method comprising administering the compound of the disclosure or the pharmaceutical composition of the disclosure to the subject.

[0462] In one embodiment of the disclosure, the GABAA receptor is extrasynaptic.

[0463] One embodiment of the present disclosure provides for a use of the compound of the disclosure for the manufacture of a medicant for the treatment of a neurological disease or disorder.

[0464] Examples

[0465] Example 1: synthesis of compounds

[0466] General materials and methods

[0467] All chemicals and solvents were obtained from commercial suppliers and used without further purification. Anhydrous solvents were obtained using an in-house solvent purification system kept under argon or dried over molecular sieves (3 A, Sigma-Aldrich) for at least 2 days prior to use. Thin-Layer Chromatography (TLC) was carried out using Merck silica gel 60 F254 plates and the compounds were visualized by UV (254 nm). The eluent system is specified in the experimental section with the Rf value given for guidance. Microwave (MW) reactions were performed with the Biotage Initiator instrument in sealed 0.5-2 mL, 2-5 mL or 10-20 mL reaction vials. Automated Flash Column Chromatography was carried out on a Combi Flash NextGen 300+. For normal phase (NP) and reverse phase (RP) chromatography, RediSep NP Silver (40-60 micron) / Gold (20-40 micron) Silica columns and RediSep Silver (40-60 micron) / GoldP7022PC00

[0468] (20-40 micron) C18 columns were utilized, respectively. For NP chromatography, the specific eluent system is specified in the experimental section, whereas the eluent system of RP chromatography consisted of eluent A (95:5:0.1 H2O / ACN / TFA) and B (95:5:0.1 ACN / H2O / TFA). Analytical High-performance Liquid Chromatography (anal. HPLC) was performed on an UltiMate HPLC system consisting of an LPG-3400A pump (1 mL / min), a WPS-300SL autosampler, and a DAD-3000D diode array detector using a Gemini-NX C18 column (4.6x250 mm, 3 pm, 110A). Data were acquired and processed using the Chromeleon Software v. 6.80. Samples were diluted in 1.0 mL of 1:1 H2O / ACN or 1:1:1 DMF / H2O / ACN (in cases in which the solubility of the compounds was found to be insufficient) with injection of 2-10 pL via autosampler. The eluents A (100:0.1 H2O / TFA) and B (90:10:0.1 ACN / H2O / TFA) were used with a 0-100%B linear gradient elution, 20 min. HPLC purity >95% unless otherwise stated. Preparative High-performance Liquid Chromatography (prep. HPLC) was carried out on an UltiMate HPLC system consisting of an LPG-3400BX pump (20 mL / min), a Rheodyne 9725i injector, a 10 mL loop and a MWD 3000SD detector. The fractions were collected manually. Data were acquired and processed using the Chromeleon Software v. 6.80. The eluent A (100:0.1 H2O / TFA) and B (90:10:0.1 ACN / H2O / TFA) were used with an isocratic elution specified in the experimental section. Nuclear Magnetic Resonance (NMR) Spectroscopy (1H,13C,19F, COSY, HSQC, HMBC and ROESY) was acquired using a 400 MHz Bruker Avance III which had a 5 mm broad band probe at 400.09 MHz or a Bruker Avance 600 MHz spectrometer equipped with a 5-mm cryogenically cooled13C / 1H DCH probe. Proton spectra were acquired at 400.09 MHz or 599.78 MHz, carbon spectra at 100.60 MHz or 150.82 MHz and fluorine spectra at 376.45 MHz. The samples were dissolved in Acetone-cfe, Chloroform-d, Methanol-ck or DMSO-d6 and analyzed at 300K. Chemical shifts are reported in ppm relative to the respective solvent peak that was used as an internal standard. Liquid Chromatography-Mass Spectrometry (LC-MS) was performed on an Agilent 6130 Mass Spectrometer instrument using electron spray ionization (ESI) coupled to an Agilent 1200 HPLC system (ESI-LCMS) with a C18 reverse phase column (Zorbax Eclipse XBD-C18, 4.6 mm x 50 mm), autosampler and diode array detector, using a linear gradient of the binary solvent system of buffer A (95:5:0.1 H2O / ACN / Formic acid) to buffer B (100:0.1 ACN / Formic acid) with a flow rate of 1 mL / min.

[0469] Method A: General procedure for Groebke-Blackburn-Bienayme (GBB) synthesis of N-(tert-butyl)-imidazo[ 1,2-a]-pyridin-3-amine derivatives.P7022PC00

[0470] The aldehyde (1 equiv) was dissolved in toluene (10-120 mL), after which NH4CI (1 equiv), tert-butyl isocyanide (1.2 equiv) and the 2-amino-pyridine (1 equiv) were added. The reaction mixture was heated to reflux and monitored by TLC and / or LC-MS. Upon completion, the reaction mixture was cooled down to room temperature and 2M aqueous NaOH (1 mL) was added to quench the reaction. The reaction was stirred for additional 30 min, after which the crude product was obtained and purified as specified.

[0471] Method B: General procedure for tert-butyl deprotection of the N-(tert-butyl)-imidazo[ 1,2-a]-pyridin-3-amine derivatives.

[0472] The tert-butyl protected imidazo[1,2-a]pyridin-3-amine was suspended in 5M aqueous HBr (10-150 mL). Unless otherwise specified, the reaction mixture was heated to 100°C and monitored by LC-MS. Upon completion, the reaction mixture was cooled to 0° and the pH was adjusted to pH ~ 12-14 using 35% NaOH in aqueous solution. The crude product was obtained and purified (when needed) as specified.

[0473] Method C: General procedure for the acylation of imidazo[1,2-a]pyridin-3-amine derivatives.

[0474] In a flame-dried flask, the imidazo[1,2-a]pyridin-3-amine (1 equiv) was suspended in dry toluene (3-10 mL) and dry pyridine (1 mL). The flask was fitted with a rubber septum, purged with nitrogen and the acyl chloride (1.2-1.4 equiv) was added through the septum. The reaction mixture was stirred at room temperature and monitored by LC-MS and / or TLC. The crude product was obtained and purified as specified.

[0475] Compound and synthetic pathways overview

[0476] Figure 5 shows an overview of the synthetic pathways to obtain the compounds disclosed herein. Reagents and conditions: (i) KCN, BiCh, EtOH / H2O, 80°C, 7% (providing 2a); (ii) tert-butyl isocyanide, NH4CI, toluene, 110°C, 25-80% (providing 1b-1o); (iii) for 1o: 2-thienylboronic acid, Na2CO3, Pd(PPh3)4, 1:2 H2O / DME, 90°C, 76%; (iv) for 1c-p: 5M HBr (aq), 100°C, 34- 99%; (v) for 1b: (a) 33 wt.% HBr solution in acetic acid, 35°C and b) 1M HCI (aq), rt, 33%; (vi) for 1e: triisopropyl silane, TFA, H2O, rt, 45%; (vii) respective acyl chloride (for2a-m and 2o-q: 4-chlorobenzoyl chloride. For 2n: 4-chlorobenzoyl chloride, acetyl chloride and 1 -adamantanecarbonyl chloride), toluene (dry), pyridine (dry), rt, 3-71%; (viii) for2n: HBTU, TEA, DCM, rt to 55°C, 12%; (ix) for 3f: 1:1 MeOH / 1,4-dioxane, NaOMe, 60°C, 2%; (x) for3t: THF, 5M NaOH (aq), rt, 39%. Compound 3n correspond to the compound 30 from literature (Rostrup et al.P7022PC00

[0477] 2021). The table below shows the substituent pattern corresponding to each derivative. By way of example, the compound 3.14 / 2a has structure of 2 shown in Figure 5 with the substituents indicated in row a in the table below; both ‘3.14’ and ‘a’ indicate the substituent pattern.

[0478] Derivative Ri R2 R3 a (3.14) H CH34-CI-Ph

[0479] b (3.15) CH34-CI-Ph

[0480] c (3.16) CH34-CI-Ph / H d (3.17) ^YN„> CH34-CI-Ph

[0481] e (3.18) CH34-CI-Ph Tos f (3.19) CH34-CI-Ph

[0482] g (4.19) X ) CH34-CI-Ph

[0483] h (4.20) ^j> CH34-CI-Ph

[0484] i (4.21) FAXCH34-CI-Ph

[0485] j (SM-20)CH34-CI-Ph

[0486] k (4.23)CH34-CI-Ph

[0487] I (4.24) XX"CH34-CI-Ph m (4.25) Hj CH34-CI-Ph

[0488] n (NNJ-65-1) XjCH34-CI-Ph

[0489] 0 (4.22)Br4-CI-Ph

[0490] P (4.27) Xl} 4-CI-Ph

[0491]

[0492] P7022PC00

[0493] \ q (4.29) CH34-CI-PhS(-Bu r(3.20) CH3CH3

[0494] s (3.21) CH31-adamantyl

[0495] t (3.22) CH33-OOCH3-Ph

[0496] u (3.23)CH34-CI-Ph

[0497] v (3.24) CH33-OH-Ph

[0498]

[0499] N-(tert-butyl)-6-methyl-2-(oxazol-4-yl)imidazo[1,2-a]pyridin-3-amine (3.2 / 1 b) Obtained from oxazol-5-carboxaldehyde (448 mg, 4.62 mmol), NH4CI (247 mg, 4.62 mmol), tert-butyl isocyanide (630 pL, 5.55 mmol) and 2-amino-5-methyl-pyridine (500 mg, 4.62 mmol) according to Method A. The mixture was refluxed overnight. The product was directly filtered from toluene to give brown crystalline solid (300 mg, 25% yield). Rt(HPLC) = 10.46 min (>95% pure).1H NMR (600 MHz, DMSO-d6) 58.48 (d, J = 1.0 Hz, 1H), 8.45 (d, J= 1.0 Hz, 1H), 8.20 -8.08 (m, 1H), 7.34 (d, J= 9.1 Hz, 1H), 7.04 (dd, J= 9.1, 1.7 Hz, 1H), 4.38 (s, 1H), 2.30 (s, 3H), 1.08 (s, 9H).13C NMR (151 MHz, DMSO-d6) 5151.93, 140.49, 135.83, 135.65, 129.50, 127.15, 125.23, 121.40, 120.39, 116.03, 56.18, 29.67, 17.75. ESI-MS (m / z) calculated [M + H]+for CI5HI8N4O = 271.16, found = 271.2.

[0500] N-(tert-butyl)-6-methyl-2-(thiazol-5-yl)imidazo[1,2-a]pyridin-3-amine (3.3 / 1 c) Obtained from thiazole-5-carboxaldehyde (401 pL, 4.62 mmol), NH4CI (247 mg, 4.62 mmol), tert-butyl isocyanide (628 pL, 5.55 mmol) and 2-amino-5-methylpyridine (500 mg, 4.62 mmol) according to Method A. The reaction mixture was refluxed overnight, after which additional tert-butyl isocyanide (0.4 eq.) was added and the reaction mixture was stirred for another day. After addition and stirring with 2M aqueous NaOH, a precipitate formed which was collected by filtration and washed with small amounts of toluene. The light orange solid was used in the subsequent reaction without further purification (1.06 g, 80% yield). Rf= 0.050 (1:1 EtOAc / heptane).1H NMR (600 MHz, Methanol-d4) 58.97 (d, J= 0.7 Hz, 1H), 8.43 (d, J= 0.7 Hz, 1H), 8.19- 8.15 (m, 1H), 7.37 (dd, J= 9.2, 1.0 Hz, 1H), 7.18 (dd, J= 9.2, 1.7 Hz, 1H), 2.36 (s, 3H), 1.15 (s, 9H).

[0501] 13C NMR (151 MHz, Methanol-d4) 5154.69, 143.00, 141.42, 133.97, 132.44, 130.18,P7022PC00

[0502] 126.00, 123.50, 123.09, 116.62, 57.31, 30.84, 18.22. ESI-MS (m / z) calculated [M + H]+for CI5HI8N4S = 287.13, found = 287.1.

[0503] N-(tert-butyl)-2-( 1H-imidazol-5-yl)-6-methylimidazo[ 1,2-a]pyridin-3-amine (3.4 / 1 d) Obtained from 5-imidazolecarboxaldehyde (1.17 g, 9.25 mmol), NH4CI (495 mg, 9.25 mmol), tert-butyl isocyanide (1.26 mL, 11.1 mmol) and 2-amino-5-methylpyridine (1.00 g, 9.25 mmol) according to Method A. The reaction mixture was refluxed overnight and upon stirring with 2M aqueous NaOH, H2O was added, and the aqueous layer was extracted with EtOAc (x3). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo to give a brown-pink solid. The crude product was recrystallized from H2O / ACN (10:3) to yield the product as a pink solid (930 mg, 39% yield). Rf= 0.25 (9:1 DCM / MeOH + 1% TEA).1H NMR (600 MHz, Chloroform-d) 58.06 - 8.03 (m, 1H), 7.67 (s, 1H), 7.60 (s, 1H), 7.41 (d, J= 9.1 Hz, 1H), 7.02 (dd, J= 9.1, 1.9 Hz, 1H), 2.35 (s, 3H), 1.18 (s, 9H).13C NMR (151 MHz, Chloroform-d) 5 140.91, 135.15, 131.46, 131.02, 128.41, 124.30, 121.86, 121.80, 119.99, 115.77, 57.27, 30.62, 18.74. ESI-MS (m / z) calculated [M + H]+for Ci5Hi9N5= 270.17, found 270.2.

[0504] N-(tert-butyl)-6-methyl-2-( 1 -methyl- 1 H-pyrrol-2-yl)imidazo[ 1, 2-a]pyridin-3-amine (3.5 / 1 e)

[0505] Obtained from 1-methylpyrrole-2-carboxaldehyde (497 pL, 4.62 mmol), NH4CI (247 mg, 4.62 mmol), tert-butyl isocyanide (628 pL, 5.55 mmol) and 2-amino-5-methylpyridine (500 mg, 4.62 mmol) according to Method A. The reaction mixture was refluxed overnight, after which additional tert-butyl isocyanide (0.3 eq.) and 2-amino-5-methylpyridine (0.2 eq.) were added and the reaction mixture was stirred for another day. Upon addition and stirring with 2M aqueous NaOH, the reaction mixture was reduced in vacuo and the crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane). The product was an off-white and fluffy solid (989 mg, 76% yield). Rf= 0.25 (1:1 EtOAc / heptane).1H NMR (400 MHz, Methanol-d4) 58.19 - 8.13 (m, 1H), 7.34 (dd, J= 9.1, 1.0 Hz, 1H), 7.13 (dd, J= 9.1, 1.8 Hz, 1H), 6.77 (dd, J = 2.7, 1.8 Hz, 1H), 6.29 (dd, J= 3.6, 1.8 Hz, 1H), 6.11 (dd, J= 3.6, 2.7 Hz, 1H), 3.70 (s, 3H), 2.36 (d, J= 1.2 Hz, 3H), 0.95 (s, 9H).13C NMR (101 MHz, Methanol-d4) 5 142.04, 133.67, 129.07, 127.72, 127.01, 124.12, 122.87, 122.67, 116.42, 111.27, 108.47, 55.99, 35.11, 30.18, 18.26. ESI-MS (m / z) calculated [M + H]+for C17H22N4 = 283.19, found = 283.2.P7022PC00

[0506] N-(tert-butyl)-6-methyl-2-( 1 -tosyl- 1 H-pyrrole-2)imidazo[ 1, 2-a]pyridin-3-amine (3.6 / 1 f) Obtained from 1-Tosyl-1H-pyrrole-2-carbaldehyde (1.15 g, 4.62 mmol), NH4CI (247 mg, 4.62 mmol), tert-butyl isocyanide (630 pL, 5.55 mmol) and 2-amino-5-methyl-pyridine (500 mg, 4.62 mmol) according to Method A. The reaction mixture was refluxed overnight and upon stirring with 2M aqueous NaOH, the reaction mixture was reduced in vacuo and the crude product was triturated with Et20 and one drop of MeOH to yield the product as a white crystalline solid (1.40 g, 72% yield). 1H NMR (600 MHz, DMSO-d6) 58.18- 8.12 (m, 1H), 7.94- 7.85 (m, 2H), 7.48 (dd, J= 3.4, 1.7 Hz, 1H), 7.42 -7.37 (m, 2H), 7.34 (dd, J= 9.1, 1.0 Hz, 1H), 7.07 (dd, J= 9.1, 1.7 Hz, 1H), 6.51 (dd, J= 3.4, 1.7 Hz, 1H), 6.38 (t, J= 3.4 Hz, 1H), 4.03 (s, 1H), 2.39 (s, 3H), 2.33 (d, J= 1.2 Hz, 3H), 0.93 (s, 9H). 13C NMR (151 MHz, DMSO-c / 6) 5144.78, 139.37, 135.74, 130.74, 129.45, 128.96, 127.87, 126.90, 126.20, 123.36, 121.08, 120.54, 116.39, 116.19, 111.91, 54.60, 29.45, 21.06, 17.81. ESI-MS (m / z) calculated [M + H]+ for C23H26N4O2S = 423.18, found = 423.2.

[0507] N-(tert-butyl)-6-methyl-2-phenylimidazo[1,2-a]pyridin-3-amine (4.2 / 1 g)

[0508] Obtained from benzaldehyde (472 pL, 4.62 mmol), NH4CI (247 mg, 4.62 mmol), tertbutyl isocyanide (628 pL, 5.55 mmol) and 2-amino-5-methylpyridine (500 mg, 4.62 mmol) according to Method A. The reaction mixture was refluxed overnight and upon stirring with 2M aqueous NaOH, a white precipitate formed which was collected by filtration and washed with H2O. The filtride was resuspended in EtOAc and extracted with H2O, after which the organic layer was reduced in vacuo to yield a white and fluffy product that was used in the subsequent reaction without further purification (1.10 g, 85% yield). Rf= 0.33 (1:1 EtOAc / heptane).1H NMR (600 MHz, Methanol-d4) 58.20 -8.18 (m, 1H), 7.95-7.92 (m, 2H), 7.44-7.40 (m, 2H), 7.37 (d, J= 9.1 Hz, 1H), 7.33-7.30 (m, 1H), 7.14 (dd, J= 9.1, 1.7 Hz, 1H), 2.37 (s, 3H), 1.00 (s, 9H).13C NMR (151 MHz, Methanol-d4) 5142.29, 140.07, 136.43, 129.52, 129.23, 129.22, 128.48, 125.42, 122.86, 122.82, 116.49, 56.89, 30.59, 18.27. ESI-MS (m / z) calculated [M + H]+for C18H21N3 = 280.18, found 280.2.

[0509] N-(tert-butyl)-6-methyl-2-(3-methylthiophen-2-yl)imidazo[1,2-a]pyridin-3-amine (4.3 / 1 h) Obtained from 3-methylthiophene-2-carbaldehyde (299 pL, 2.77 mmol), NH4CI (148 mg, 2.77 mmol), tert-butyl isocyanide (377 pL, 3.33 mmol) and 2-amino-5-methylpyridine (300 mg, 2.77 mmol) according to Method A. The reaction mixture wasP7022PC00

[0510] refluxed for 22 h and upon stirring with 2M aqueous NaOH, H2O was added, and the aqueous layer was extracted with EtOAc (x3). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to give a brown solid. The crude product was dissolved in 3 mL EtOH and upon addition of H2O, a precipitate formed which was collected by filtration. The resulting pink solid was used in the subsequent reaction without further purification (380 mg, 46% yield). Rf = 0.51 (1:1 EtOAc / heptane).1H NMR (600 MHz, DMSO-d6) 68.23 (s, 1H), 7.46 (d, J= 5.0 Hz, 1H), 7.42 (d, J= 9.1 Hz, 1H), 7.15 (d, J= 9.1 Hz, 1H), 6.94 (d, J= 5.0 Hz, 1H), 4.26 (s, 1H), 2.35 (s, 3H), 2.33 (s, 3H), 0.95 (s, 9H).13C NMR (151 MHz, DMSO-d6) 6 139.53, 136.71, 135.11, 135.03, 130.19, 128.09, 125.24, 124.50, 121.57, 121.07, 115.37, 55.39, 29.72, 17.83, 15.26. ESI-MS (m / z) calculated [M + H]+for C17H21N3S = 300.15, found 300.2.

[0511] N-(tert-butyl)-6-methyl-2-(4-methylthiophen-2-yl)imidazo[1!2-a]pyridin-3-amine (4.4 / 1 i) Obtained from 4-methylthiophene-2-carbaldehyde (251 mg, 1.99 mmol), NH4CI (106 mg, 1.99 mmol), tert-butyl isocyanide (270 pL, 2.39 mmol) and 2-amino-5-methylpyridine (215 mg, 1.99 mmol) according to Method A. The reaction mixture was refluxed overnight, after which additional tert-butyl isocyanide (0.2 eq.) and 2-amino-5-methylpyridine (0.2 eq.) were added and the reaction mixture was stirred for another day. After addition and stirring with 2M aqueous NaOH, a precipitate formed which was collected by filtration and washed with H2O. The filtride was a faint pink and fluffy solid that was used in the subsequent reaction without further purification (415 mg, 70% yield). Rf= 0.45 (1:1 EtOAc / heptane).1H NMR (600 MHz, Methanol-d4) 68.15 - 8.12 (m, 1H), 7.46 (s, 1H), 7.32 (dd, J= 9.1, 1.0 Hz, 1H), 7.12 (dd, J= 9.1, 1.8 Hz, 1H), 6.97 (s, 1H), 2.35 (s, 3H), 2.29 (s, 3H), 1.14 (s, 9H).13C NMR (151 MHz, Methanol-d4) 6 142.35, 138.87, 137.93, 135.58, 129.40, 128.93, 124.72, 122.94, 122.90, 121.60, 116.32, 57.26, 30.80, 18.23, 15.72. ESI-MS (m / z) calculated [M + H]+for Ci7H2iN3S = 300.15, found 300.2.

[0512] N-(tert-butyl)-6-methyl-2-(5-methylthiophen-2-yl)imidazo[1,2-a]pyridin-3-amine (SM-20 / 1j)

[0513] Obtained from 5-methylthiophene-2-carbaldehyde (499 pL, 4.62 mmol), NH4CI (247 mg, 4.62 mmol), tert-butyl isocyanide (628 pL, 5.55 mmol) and 2-amino-5-methylpyridine (500 mg, 4.62 mmol) according to Method A. The reaction mixture was refluxed overnight and upon stirring with 2M aqueous NaOH, a precipitate formedP7022PC00

[0514] which was collected by filtration and washed with H2O. The filtride was triturated with a 1:1 mixture of H2O / CAN to yield an off-white and fluffy solid (785 mg, 57% yield). Rf = 0.38 (1:1 EtOAc / Heptane).1H NMR (400 MHz, Acetone-cfe) 68.14 (d, J= 1.8 Hz, 1H), 7.49 (d, J= 3.5 Hz, 1H), 7.26 (d, J= 9.1 Hz, 1H), 7.01 (dd, J= 9.1, 1.8 Hz, 1H), 6.77 -6.70 (m, 1H), 3.90 (s, 1H), 2.48 (s, 3H), 2.32 (s, 3H), 1.19 (s, 9H).13C NMR (101 MHz, Acetone-cfe) 6 141.67, 139.39, 137.68, 136.10, 127.53, 126.23, 125.33, 123.19, 122.38, 121.28, 117.02, 57.10, 30.84, 18.26, 15.20. ESI-MS (m / z) calculated [M + H]+for C17H21N3S = 300.15, found = 300.2.

[0515] N-(tert-butyl)-2-(5-chlorothiophen-2-yl)-6-methylimidazo[1!2-a]pyridin-3-amine (4.6 / 1 k) Obtained from 5-chloro-2-thiophenecarboxaldehyde (296 pL, 2.77 mmol), NH4CI (148 mg, 2.77 mmol), tert-butyl isocyanide (377 pL, 3.33 mmol) and 2-amino-5-methylpyridine (300 mg, 2.77 mmol) according to Method A. The reaction mixture was refluxed overnight, after which additional tert-butyl isocyanide (0.3 eq.) and 2-amino-5-methylpyridine (0.2 eq.) were added and the reaction mixture was stirred for another day. Upon addition and stirring with 2M aqueous NaOH, a precipitate formed which was collected by filtration and washed with H2O. The filtride was an off-white and fluffy solid that was used in the subsequent reaction without further purification (798 mg, 90% yield). Rf= 0.65 (1:1 EtOAc / heptane).1H NMR (400 MHz, Methanol-d4) 68.16 -8.10 (m, 1H), 7.46 (d, J = 3.9 Hz, 1H), 7.33 (d, J = 9.1 Hz, 1H), 7.15 (dd, J = 9.1, 1.8 Hz, 1H), 6.95 (d, J = 3.9 Hz, 1H), 2.35 (s, 3H), 1.16 (s, 9H).13C NMR (101 MHz, Methanol-d4) 5 142.61, 137.43, 134.77, 130.35, 129.83, 127.51, 125.85, 124.96, 123.22, 122.99, 116.45, 57.32, 30.85, 18.21. ESI-MS (m / z) calculated [M + H]+for CI6HI8CIN3S = 320.10, found = 320.1 and [M + H + 2]+322.1.

[0516] N-(tert-butyl)-2-(5-ethylthiophen-2-yl)-6-methylimidazo[1,2-a]pyridin-3-amine (4.7 / 11) Obtained from 5-ethyl-2-thiophenecarboxaldehyde (579 pL, 4.62 mmol), NH4CI (247 mg, 4.62 mmol), tert-butyl isocyanide (628 pL, 5.55 mmol) and 2-amino-5-methylpyridine (500 mg, 4.62 mmol) according to Method A. The reaction mixture was refluxed overnight, after which additional tert-butyl isocyanide (0.3 eq.) was added and the reaction mixture was stirred for another day. After addition and stirring with 2M aqueous NaOH, a precipitate formed which was collected by filtration and washed with H2O. The filtride was an off-white solid that was used in the subsequent reaction without further purification (1.18 g, 82% yield). Rf = 0.44 (1:1 EtOAc / heptane).1H NMR (600 MHz, Methanol-d4) 58.15 - 8.11 (m, 1H), 7.42 (d, J= 3.6 Hz, 1H), 7.31 (dd, J =P7022PC00

[0517] 9.1, 1.0 Hz, 1H), 7.11 (dd, J= 9.1, 1.7 Hz, 1H), 6.79 (dt, J= 3.6, 1.1 Hz, 1H), 2.88 (qd, J= 7.5, 1.1 Hz, 2H), 2.34 (s, 3H), 1.34 (t, J= 7.5 Hz, 3H), 1.14 (s, 9H).13C NMR (151 MHz, Methanol-d4) 6 148.57, 142.31, 135.72, 135.51, 129.29, 126.53, 124.66, 124.47, 122.86, 116.24, 57.20, 30.80, 24.32, 18.23, 16.53. ESI-MS (m / z) calculated [M + H]+for C18H23N3S = 314.17, found = 314.2.

[0518] 2-(5-benzylthiophen-2-yl)-N-(tert-butyl)-6-methylimidazo[1!2-a]pyridin-3-amine (4.8 / 1 m) Obtained from 5-benzylthiophene-2-carbaldehyde (56.1 mg, 0.277 mmol), NH4CI (14.8 mg, 0.277 mmol), tert-butyl isocyanide (37.7 pL, 0.333 mmol) and 2-amino-5-methylpyridine (30.0 mg, 0.277 mmol) according to Method A. The reaction mixture was refluxed overnight, after which additional tert-butyl isocyanide (0.3 eq.) and 2-amino-5-methylpyridine (0.3 eq.) were added and the reaction mixture was stirred for another day. After addition and stirring with 2M aqueous NaOH, the reaction mixture was reduced in vacuo and the resulting brown solid was triturated with Et20 to yield the product as an orange solid (99.2 mg, 95% yield). Rf = 0.49 (1:1 EtOAc / heptane).1H NMR (400 MHz, DMSO-d6) 58.13 - 8.07 (m, 1H), 7.55 (d, J= 3.6 Hz, 1H), 7.36 - 7.26 (m, 6H), 7.01 (dd, J= 9.2, 1.7 Hz, 1H), 6.82 (d, J= 3.6 Hz, 1H), 4.52 (s, 1H), 4.13 (s, 2H), 2.28 (s, 3H), 1.09 (s, 9H).13C NMR (101 MHz, DMSO-d6) 5 142.78, 140.54, 140.05, 136.83, 134.04, 128.41, 128.39, 126.93, 126.25, 125.29, 124.12, 122.46, 121.44, 120.09, 115.67, 56.02, 35.32, 30.17, 17.76. ESI-MS (m / z) calculated [M + H]+for C23H25N3S = 376.18, found = 376.1.

[0519] N-(tert-butyl)-6-methyl-2-(thiophen-2-yl)imidazo[1,2-a]pyridin-3-amine (3.7 / 1 n) Obtained from 2-thiophenecarboxaldehyde (1.10 mL, 12.0 mmol), NH4CI (640 mg, 12.0 mmol), tert-butyl isocyanide (1.63 mL, 14.4 mmol) and 2-amino-5-methylpyridine (1.30 g, 12.0 mmol) according to Method A. The reaction mixture was refluxed for 24 h and upon stirring with 2M aqueous NaOH, H2O was added, and the aqueous layer was extracted with EtOAc (x4). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo. The crude product was recrystallized from H2O / ACN (10:3) to yield the product as a pink crystalline solid (2.66 g, 78% yield). Rf= 0.35 (1:1 EtOAc / heptane).1H NMR (600 MHz, Chloroform-d) 57.97 (s, 1H), 7.59 (d, J= 3.5, 1H), 7.46 (d, J= 9.1 Hz, 1H), 7.30 (d, J= 5.0 Hz, 1H), 7.09 (t, J= 3.5 Hz, 1H), 7.00 (d, J= 9.1 Hz, 1H), 3.08 (s, 1H), 2.33 (s, 3H), 1.19 (s, 9H).13C NMR (151 MHz, Chloroform-d) 5 141.2, 137.5, 134.4, 127.9, 127.4, 125.0, 124.9, 122.8, 121.4, 121.3, 116.5, 56.8, 30.7, 18.6. ESI-MS (m / z) calculated [M + H]+for C16H19N3S =P7022PC00

[0520] 286.14, found = 286.1. The analytical data is in accordance with literature.

[0521] 6-bromo-N-(tert-butyl)-2-(5-methylthiophen-2-yl)imidazo[ 1, 2-a]pyridin-3-amine (4.5 / 1 o) Obtained from 5-methylthiophene-2-carbaldehyde (312 pL, 2.89 mmol), NH4CI (155 mg, 2.89 mmol), tert-butyl isocyanide (392 pL, 3.47 mmol) and 2-amino-5-bromopyridine (500 mg, 2.89 mmol) according to Method A. The reaction mixture was stirred overnight, after which additional tert-butyl isocyanide (0.4 eq.) was added and the reaction mixture was stirred for 3 more days. Upon stirring with 2M aqueous NaOH, H2O was added, and the aqueous layer was extracted with EtOAc (x3). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to give a brown solid. The crude product was triturated with ACN to yield the product as an off-white solid (785 mg, 75% yield). Rf = 0.58 (1:1 EtOAc / heptane).1H NMR (600 MHz, Methanol-d4) 58.48 (dd, J = 1.9, 0.9 Hz, 1 H), 7.45 (d, J = 3.5 Hz, 1 H), 7.36 (dd, J = 9.4, 0.9 Hz, 1 H), 7.32 (dd, J = 9.4, 1.9 Hz, 1 H), 6.79 - 6.75 (m, 1 H), 2.51 (s, 3H), 1.14 (s, 9H).13C NMR (151 MHz, Methanol-d4) 5 141.62, 141.60, 136.85, 135.17, 129.38, 127.32, 126.66, 125.40, 125.04, 117.81, 107.53, 57.39, 30.79, 15.16. ESI-MS (m / z) calculated [M + H]+for Ci6Hi8BrN3S = 364.05, found 364.1 and [M + H + 2]+366.1.

[0522] N-(tert-butyl)-2-(5-methylthiophen-2-yl)-6-(thiophen-2-yl)imidazo[1,2-a]pyridin-3-amine (4.5a / 1p)

[0523] 4.5 / 1 o (500 mg, 1.37 mmol, 1 eq.) was suspended in a 2:1 mixture of di methoxyethane (6 mL) and H2O (3 mL). The 2-thienylboronic acid (211 mg, 1.65 mmol, 1.2 eq.), Na2CC>3 (291 mg, 2.75 mmol, 2 eq.) and Pd(PPh3)4 (159 mg, 0.137 mmol, 0.1 eq.) were added, after which the flask was fitted with a rubber septum and purged with nitrogen. The reaction mixture was heated to 90°C and monitored by LC-MS. Upon completion, the reaction mixture was cooled to room temperature, diluted with H2O, filtered through celite and extracted with DCM (x3). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to yield a light grey solid (381 mg, 76% yield). Rf= 0.50 (1:1 EtOAc / heptane).1H NMR (600 MHz, Methanol-d4) 5 8.58 - 8.55 (m, 1 H), 7.57 (dd, J = 9.3, 1.8 Hz, 1 H), 7.49 - 7.40 (m, 4H), 7.14 (dd, J = 5.1, 3.6 Hz, 1H), 6.80 -6.76 (m, 1H), 2.52 (s, 3H), 1.19 (s, 9H).13C NMR (151 MHz, Methanol-d4) 5 142.41, 141.33, 141.28, 136.61, 135.53, 129.36, 127.03, 126.60, 126.22, 125.74, 125.14, 125.09, 121.57, 121.00, 117.05, 57.32, 30.92, 15.17. ESI-MS (m / z) calculated [M + H]+for C20H21N3S2 = 368.12, found = 368.1.P7022PC00

[0524] 6-methylimidazo[ 1,2-a]pyridin-3-amine (3.1 / 2a)

[0525] BiCh (200 mg, 0.634 mmol, 1 eq.) was added to a solution of formaldehyde (37% in H2O, 0.480 mL, 6.39 mmol, 10.1 eq.) in EtOH (10 mL) to form a white suspension, which was stirred at room temperature for 20 min. 2-amino-5-methylpyridine (697 mg, 6.44 mmol, 10.2 eq.) was then added and the reaction mixture was refluxed for 1.5 h, after which KCN (810 mg, 12.4 mmol, 19.6 eq.) and H2O (10 mL) was added. The heating continued for 3.5 h and upon LC-MS control, the reaction was quenched with 1M aqueous NaOH (6 mL) and filtered. The filtrate was extracted with EtOAc (x3), and the organic layers were combined, washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo. The crude product was subjected to automated flash column chromatography (NP) using a gradient elution (DCM / MeOH). The product was a faint brown oil that crystallized over time, and it was immediately used in the subsequent reaction (63.7 mg crude). Rf= 0.32 (9:1 DCM / MeOH).1H NMR (600 MHz, Methanol-d4) 57.90 - 7.85 (m, 1H), 7.30 (dd, J= 9.2, 1.0 Hz, 1H), 7.01 (dd, J= 9.2, 1.7 Hz, 1H), 6.94 (s, 1H), 2.34 (d, J= 1.2 Hz, 3H).13C NMR (151 MHz, Methanol-d4) 5 141.34, 130.53, 127.12, 122.76, 120.88, 118.96, 116.72, 18.22. ESI-MS (m / z) calculated [M + H]+for C8H9N3= 148.09, found = 148.1.

[0526] 6-methyl-2-(oxazol-5-yl)imidazo[1,2-a]pyridin-3-amine (3.8 / 2b)

[0527] In a flame-dried flask, 3.2 / 1 b (200 mg, 0.740 mmol) was suspended in a HBr solution 33 wt.% in acetic acid (10 mL). The reaction mixture was heated to 35°C and monitored by LC-MS. After 2 h, the reaction mixture was cooled to room temperature and the pH was adjusted to pH ~ 12-14 using 35% NaOH in aqueous solution (under cooling in an ice bath). The alkaline aqueous layer was extracted with EtOAc (x4). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to yield an orange solid. 1M aqueous HCI (2 mL) was added to the solid and the reaction mixture was left at room temperature for 3 days, upon which the pH was adjusted to pH ~ 12-14 using 1M aqueous NaOH. The precipitate was collected by filtration and washed with H2O. The resulting dark orange solid was used in the subsequent reaction without further purification (52.0 mg crude). ESI-MS (m / z) calculated [M + H]+for CnH N4O = 215.05, found = 215.1.

[0528] 6-methyl-2-(thiazol-5-yl)imidazo[ 1, 2-a ]pyridin-3-amine (3.9 / 2c)

[0529] Obtained from 3.3 / 1c (1.06 g, 3.69 mmol) according to Method B. The reaction mixtureP7022PC00

[0530] was stirred for 8 h. The alkaline aqueous layer was extracted with EtOAc (x3). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to yield a brown-red solid that was used in the subsequent reaction without further purification (412 mg, 48% yield). Rf = 0.69 (9:1 DCM / MeOH + 1% TEA).

[0531] 1H NMR (600 MHz, Methanol-d4) 68.92 (d, J= 0.7 Hz, 1H), 8.32 (d, J= 0.7 Hz, 1H), 8.01 - 7.97 (m, 1H), 7.31 (dd, J= 9.2, 1.0 Hz, 1H), 7.09 (dd, J= 9.2, 1.7 Hz, 1H), 2.35 (s, 3H).13C NMR (151 MHz, Methanol-d4) 6 153.47, 141.30, 139.14, 134.31, 128.71, 127.02, 123.65, 123.43, 121.29, 116.40, 18.25. ESI-MS (m / z) calculated [M + H]+for CIIH N4S = 231.07, found = 231.1.

[0532] 2-(1 H-imidazol-5-yl)-6-methylimidazo[1,2-a]pyridin-3-amine (3.10 / 2d)

[0533] Obtained from 3.4 / 1 d (260 mg, 0.965 mmol) according to Method B. The reaction mixture was stirred at 90°C for 2 h. The alkaline aqueous layer was extracted with EtOAc (x4). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to yield a dark green. The crude product was dissolved in 5 mL EtOH and upon addition of H2O, a precipitate formed which was collected by filtration. The resulting green solid was used in the subsequent reaction without further purification (161 mg, 78% yield). Rf = 0.075 (9:1 DCM / MeOH + 1% TEA).1H NMR (600 MHz, DMSO-d6) 6 12.14 (br s, 1H), 7.84 (s, 1H), 7.72 (s, 1H), 7.34 (s, 1H), 7.24 (d, J= 9.1 Hz, 1H), 6.83 (d, J= 9.1 Hz, 1H), 5.49 (br s, 2H), 2.27 (s, 3H).

[0534] 13C NMR (151 MHz, DMSO-d6) 6 137.76, 137.41, 135.05, 126.78, 123.49, 121.26, 119.46, 119.20, 115.41, 110.93, 17.89. ESI-MS (m / z) calculated [M + H]+for C11H11N5 = 214.11, found = 214.1.

[0535] 6-methyl-2-(1-methyl-1H-pyrrol-2-yl)imidazo[1,2-a]pyridin-3-amine (3.11 / 2e) 3.5 / 1e (200 mg, 0.708 mmol, 1 eq.) was suspended in H2O (0.5 mL) and triisopropyl silane (0.5 mL) and the solution was stirred for 5 min. Trifluoroacetic acid (9 mL) was then added, after which the reaction mixture was stirred for 2.5 h. Upon completion monitored by LC-MS, the dark brown reaction mixture was reduced in vacuo and the crude product was purified by automated flash column chromatography (RP) using a gradient elution. The product was a yellow solid (71.4 mg, 45% yield). Rf = 0.49 (9.5:0.5 DCM / MeOH + 1% TEA).1H NMR (400 MHz, Methanol-d4) 58.39 - 8.33 (m, 1H), 7.72 (dd, J= 9.2, 1.6 Hz, 1H), 7.66 (dd, J= 9.2, 1.0 Hz, 1H), 6.96 (dd, J= 2.8, 1.7 Hz, 1H), 6.46 (dd, J= 3.7, 1.7 Hz, 1H), 6.26 (dd, J= 3.7, 2.8 Hz, 1H), 3.68 (s, 3H), 2.51 (d, J= 1.2 Hz, 3H).13C NMR (101 MHz, Methanol-d4) 5 135.74, 135.37, 130.44,P7022PC00

[0536] 128.17, 126.77, 123.05, 119.50, 113.89, 111.80, 111.52, 109.78, 34.91, 18.14. ESI-MS (m / z) calculated [M + H]+forCi3Hi4N4= 227.13, found = 227.1.

[0537] 6-Methyl-2-(1-tosyl-1H-pyrrole-2)imidazo[1,2-a]pyridin-3-amine (3.12 / 2f)

[0538] Obtained from 3.6 / 1f (600 mg, 1.42 mmol) according to Method B. The reaction mixture was stirred at 65°C for 1 h and the temperature was then slowly increased to 110°C over 7 h. The alkaline aqueous layer was extracted with EtOAc (x3). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to yield a white crystalline solid that was used in the subsequent reaction without further purification (505 mg, 97% yield).1H NMR (600 MHz, DMSO-d6) 57.92 (s, 1H), 7.81 (d, J= 8.4 Hz, 2H), 7.48 (m, 1H), 7.36 (d, J= 8.1 Hz, 2H), 7.26 (d, J= 9.2 Hz, 1H), 6.90 (dd, J= 9.2 Hz, 1.5 Hz, 1H), 6.40 (t, J =3.4 Hz, 1H), 6.35-6.33 (m, 1H), 4.78 (s, 2H), 2.37 (s, 3H), 2.29 (s, 3H).13C NMR (151 MHz, DMSO-d6) 5 144.6, 136.9, 135.8, 129.4, 128.8, 128.5, 127.7, 124.4, 124.4, 123.4, 119.81, 119.75, 118.6, 116.2, 116.0, 120.0, 21.1, 17.9. ESI-MS (m / z) calculated [M + H]+for CI9HI8N4O2S = 367.12, found = 367.3.

[0539] 6-methyl-2-phenylimidazo[ 1, 2-a ]pyridin-3-amine (4.10 / 2g)

[0540] Obtained from 4.2 / 1g (1.09 g, 3.89 mmol) according to Method B. The reaction mixture was stirred for 5 h. Upon pH adjustment, a precipitate formed which was collected by filtration and washed with H2O. The filtride was a faint yellow solid that was used in the subsequent reaction without further purification (860 mg, 99% yield). Rf = 0.58 (9.5:0.5 DCM / MeOH + 1% TEA).1H NMR (600 MHz, Methanol-d4) 58.47-8.43 (m, 1H), 7.87- 7.82 (m, 2H), 7.74 (dd, J = 9.2, 1.6 Hz, 1 H), 7.70 (dd, J = 9.2, 1.0 Hz, 1 H), 7.62 - 7.56 (m, 2H), 7.52 -7.45 (m, 1H), 2.52 (s, 3H).13C NMR (151 MHz, Methanol-d4) 5136.26, 135.68, 130.47, 130.23, 128.86, 128.44, 128.32, 128.04, 123.24, 120.11, 111.88, 18.18. ESI-MS (m / z) calculated [M + H]+for CI4HI3N3= 224.12, found 224.2.

[0541] 6-methyl-2-(3-methylthiophen-2-yl)imidazo[ 1,2-a]pyridin-3-amine (4.11 / 2h) Obtained from 4.3 / 1 h (380 mg, 1.27 mmol) according to Method B. The reaction mixture was stirred for 2.5 h. The alkaline aqueous layer was extracted with EtOAc (x3). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to yield a green oil. The crude product was redissolved in EtOH and reduced in vacuo to yield a yellow-green solid that was used in the subsequent reaction without further purification (103 mg, 34% yield). Rf = 0.67 (9.5:0.5P7022PC00

[0542] DCM / MeOH + 1% TEA).1H NMR (600 MHz, DMSO-d6) 67.97-7.92 (m, 1H), 7.42 (d, J= 5.1 Hz, 1H), 7.30 (d, J= 9.2 Hz, 1H), 6.94 (d, J= 5.1 Hz, 1H), 6.92 (dd, J= 9.2, 1.7 Hz, 1H), 4.83 (s, 2H), 2.34 (s, 3H), 2.28 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 137.92, 133.53, 131.04, 130.52, 126.35, 124.76, 124.10, 122.98, 119.88, 119.82, 115.89, 17.90, 15.11. ESI-MS (m / z) calculated [M + H]+forCi3Hi3N3S = 244.09, found = 244.2.

[0543] 6-methyl-2-(4-methylthiophen-2-yl)imidazo[ 1, 2-a]pyridin-3-amine (4.12 / 2i) Obtained from 4.4 / 1 i (407 mg, 1.36 mmol) according to Method B. The reaction mixture was stirred for 5 h. Upon pH adjustment, a precipitate formed which was collected by filtration and washed with H2O. The filtride was a light grey solid that was used in the subsequent reaction without further purification (322 mg, 97% yield). Rf = 0.88 (9.5:0.5 DCM / MeOH + 1% TEA).1H NMR (600 MHz, Methanol-d4) 58.45-8.40 (m, 1H), 7.74 (dd, J= 9.2, 1.6 Hz, 1H), 7.66 (dd, J= 9.2, 1.0 Hz, 1H), 7.44 (s, 1H), 7.25 (s, 1H), 2.51 (s, 3H), 2.35 (s, 3H).13C NMR (151 MHz, Methanol-d4) 5140.14, 136.15, 135.96, 129.79, 129.25, 128.52, 127.40, 124.09, 123.36, 117.00, 111.65, 18.15, 15.51. ESI-MS (m / z) calculated [M + H]+for CI3HI3N3S = 244.09, found 244.2.

[0544] 6-methyl-2-(5-methylthiophen-2-yl)imidazo[ 1, 2-a]pyridin-3-amine (SM-20 / 2j) Obtained from NNJ-67-1 / 1j (670 mg, 2.24 mmol) according to Method B. The reaction mixture was stirred for 5 h. Upon pH adjustment, a precipitate formed which was collected by filtration and washed with H2O. The filtride was a strong yellow solid that was used in the subsequent reaction without further purification (498 mg, 92% yield). Rf = 0.30 (2:1 EtOAc / Heptane).1H NMR (600 MHz, Methanol-d4) 58.33 - 8.29 (m, 1H), 7.56 (d, J= 1.3 Hz, 2H), 7.37 (d, J= 3.6 Hz, 1H), 6.88 (dq, J= 3.6, 1.1 Hz, 1H), 2.55 (d, J= 1.1 Hz, 3H), 2.46 (d, J= 1.2 Hz, 3H).13C NMR (151 MHz, Methanol-d4) 5 142.92, 137.26, 133.79, 129.43, 127.30, 127.07, 126.95, 126.38, 122.76, 120.05, 112.71, 18.18, 15.13. ESI-MS (m / z) calculated [M + H]+for CI3HI3N3S = 244.09, found = 244.1.

[0545] 2-(5-chlorothiophen-2-yl)-6-methylimidazo[ 1, 2-a]pyridin-3-amine (4.14 / 2k) Obtained from 4.6 / 1 k (785 mg, 2.45 mmol) according to Method B. The reaction mixture was stirred for 8 h. Upon pH adjustment, a precipitate formed which was collected by filtration and washed with H2O. The filtride was a dark green solid containing the desired product together with the dechlorinated product (7% accordingP7022PC00

[0546] to1H NMR integration). The crude product was used in the subsequent reaction without further purification (603 mg crude). Rf= 0.78 (9:1 DCM / MeOH + 1% TEA).1H NMR (600 MHz, DMSO-d6) 68.45 - 8.43 (m, 1H), 7.60 (d, J= 9.1 Hz, 1H), 7.50 - 7.46 (m, 2H), 7.22 (d, J= 4.0 Hz, 1H), 5.71 (br s, 2H), 2.37 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 135.30, 132.08, 130.73, 128.27, 127.56, 126.42, 124.41, 124.27, 121.68, 115.57, 112.21, 17.71. ESI-MS (m / z) calculated [M + H]+for C12H10CIN3S = 264.04, found = 264.0 and [M + H + 2]+266.0.

[0547] 2-(5-ethylthiophen-2-yl)-6-methylimidazo[ 1,2-a]pyridin-3-amine (4.15 / 21)

[0548] Obtained from 4.7 / 11 (1.10 g, 3.51 mmol) according to Method B. The reaction mixture was stirred for 4 h. Upon pH adjustment, a precipitate formed which was collected by filtration and washed with H2O. The filtride was a yellow solid that was used in the subsequent reaction without further purification (730 mg, 81% yield). Rf = 0.54 (9.5:0.5 DCM / MeOH + 1% TEA).1H NMR (400 MHz, Methanol-d4) 67.92 - 7.87 (m, 1H), 7.29 (d, J= 3.6 Hz, 1H), 7.26 (dd, J= 9.2, 1.0 Hz, 1H), 7.00 (dd, J= 9.2, 1.8 Hz, 1H), 6.79 (dt, J= 3.6, 1.1 Hz, 1H), 2.86 (qd, J= 7.5, 1.1 Hz, 2H), 2.31 (s, 3H), 1.33 (t, J= 7.5 Hz, 3H).13C NMR (101 MHz, Methanol-d4) 6 147.46, 140.63, 135.65, 127.82, 127.18, 125.08, 125.01, 124.22, 122.96, 120.98, 115.97, 24.30, 18.25, 16.53. ESI-MS (m / z) calculated [M + H]+for CI4HI5N3S = 258.11, found = 258.1.

[0549] 2-(5-benzylthiophen-2-yl)-6-methylimidazo[ 1, 2-a]pyridin-3-amine (4.16 / 2m) Obtained from 4.8 / 1 m (99.2 mg, 0.264 mmol) according to Method B. The reaction mixture was stirred for 3 h. Upon pH adjustment, a precipitate formed which was collected by filtration and washed with H2O. The filtride was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane) to yield the product as a faint orange solid (60.6 mg, 77% yield). Rf = 0.32 (1:1 EtOAc / Heptane).1H NMR (600 MHz, Methanol-d4) 57.96 - 7.92 (m, 1 H), 7.33 (d, J = 3.6 Hz, 1 H), 7.31 -7.27 (m, 5H), 7.24 - 7.18 (m, 1H), 7.04 (dd, J= 9.2, 1.7 Hz, 1H), 6.84 (dt, J= 3.6, 1.0 Hz, 1H), 4.17 (d, J= 1.0 Hz, 2H), 2.34 (d, J= 1.2 Hz, 3H).13C NMR (151 MHz, Methanol-d4) 5 144.58, 142.01, 140.72, 137.01, 129.65, 129.53, 127.87, 127.47, 127.04, 126.78, 125.29, 124.17, 123.01, 121.03, 116.09, 37.03, 18.25. ESI-MS (m / z) calculated [M + H]+for Ci9Hi7N3S = 320.12, found = 320.1.

[0550] 6-methyl-2-(thiophen-2-yl)imidazo[ 1, 2-a ]pyridin-3-amine (3.13 / 2n)

[0551] Obtained from 3.7 / 1 n (508 mg, 1.78 mmol) according to Method B. The reactionP7022PC00

[0552] mixture was stirred for 3 h. The alkaline aqueous layer was extracted with EtOAc (x3). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to yield a green solid that was used in the subsequent reaction without further purification (312 mg, 76% yield). Rf = 0.30 (2:1 EtOAc / heptane).1H NMR (600 MHz, DMSO-d6) 68.02 - 7.99 (m, 1H), 7.52 (dd, J= 3.6, 1.1 Hz, 1H), 7.37 (dd, J= 5.0, 1.1 Hz, 1H), 7.28 (d, J= 9.1 Hz, 1H), 7.10 (dd, J= 5.0, 3.6 Hz, 1H), 6.90 (dd, J= 9.1, 1.8 Hz, 1H), 5.17 (s, 2H), 2.27 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 138.93, 137.73, 127.75, 125.17, 124.99, 123.41, 123.35, 121.60, 120.04, 119.78, 115.68, 17.90. ESI-MS (m / z) calculated [M + H]+forCi2HnN3S = 230.07, found 230.1. The analytical data is in accordance with literature.

[0553] 6-bromo-2-(5-methylthiophen-2-yl)imidazo[ 1, 2-a]pyridin-3-amine (4.13 / 2o) Obtained from 4.5 / 1 o (730 mg, 2.00 mmol) according to Method B. The reaction mixture was stirred for 7 h. Upon pH adjustment, a precipitate formed which was collected by filtration and washed with H2O. The filtride was a dark yellow solid that was used in the subsequent reaction without further purification (555 mg, 90% yield). Rf = 0.70 (9.5:0.5 DCM / MeOH + 1% TEA).1H NMR (600 MHz, Methanol-d4) 68.37- 8.34 (m, 1H), 7.34 - 7.29 (m, 2H), 7.22 (dd, J= 9.5, 1.9 Hz, 1H), 6.81 -6.77 (m, 1H), 2.51 (s, 3H).13C NMR (151 MHz, Methanol-d4) 6 140.42, 139.75, 135.47, 127.98, 127.50, 127.01, 125.99, 124.95, 123.67, 117.48, 107.50, 15.14. ESI-MS (m / z) calculated [M + H]+for Ci2H BrN3S = 307.99, found = 308.2 and [M + H + 2]+310.2.

[0554] 2-(5-methylthiophen-2-yl)-6-(thiophen-2-yl)imidazo[1,2-a]pyridin-3-amine (4.18 / 2p) Obtained from 4.5a / 1p (350 mg, 0.952 mmol) according to Method B. The reaction mixture was stirred for 5 h. Upon pH adjustment, a precipitate formed which was collected by filtration and washed with H2O. The filtride was a dark green solid that was used in the subsequent reaction without further purification (277 mg, 93% yield). Rf = 0.67 (9.5:0.5 DCM / MeOH + 1% TEA).1H NMR (600 MHz, Methanol-d4) 58.42 (dd, J = 1.8, 1.0 Hz, 1 H), 7.47 (dd, J = 9.3, 1.8 Hz, 1 H), 7.44 - 7.40 (m, 3H), 7.32 (d, J = 3.5 Hz, 1H), 7.13 (dd, J= 5.1, 3.6 Hz, 1H), 6.79 (dq, J= 3.5, 1.1 Hz, 1H), 2.51 (d, J= 1.1 Hz, 3H).13C NMR (151 MHz, Methanol-d4) 5 141.53, 140.64, 140.09, 135.81, 129.22, 127.76, 126.95, 126.10, 126.00, 125.02, 124.67, 124.21, 121.72, 119.23, 116.78, 15.14. ESI-MS (m / z) calculated [M + H]+for CI6HI3N3S = 312.06, found = 312.1.

[0555] 2-(4-(tert-butyl)-1-methyl-1H-pyrrol-2-yl)-6-methylimidazo[1,2-a]pyridin-3-amineP7022PC00

[0556] (3.11a / 2q)

[0557] Obtained from 3.5 / 1e (100 mg, 0.354 mmol) according to Method B. The reaction mixture was stirred overnight. Upon pH adjustment, a precipitate formed which was collected by filtration and washed with H2O. The filtride was purified by automated flash column chromatography (NP) using a gradient elution (DCM / MeOH) to yield the product as a green solid (45 mg, 56% yield). Rf = 0.47 (95:5 DCM / MeOH).1H NMR (400 MHz, Methanol-d4) 57.97 - 7.93 (m, 1H), 7.34 (dd, J= 9.2, 1.1 Hz, 1H), 7.11 (dd, J = 9.2, 1.5 Hz, 1 H), 6.60 (d, J = 2.0 Hz, 1 H), 6.24 (d, J = 2.0 Hz, 1 H), 3.63 (s, 3H), 2.37 (d, J= 1.1 Hz, 3H), 1.26 (s, 9H).13C NMR (101 MHz, Methanol-d4) 5 139.49, 136.23, 128.27, 126.14, 125.52, 123.57, 122.01, 121.20, 120.19, 115.61, 108.68, 34.92, 32.35, 31.45, 18.26. ESI-MS (m / z) calculated [M + H]+for Ci7H22N4= 283.19, found = 283.2.

[0558] 4-chloro-N-(6-methylimidazo[ 1,2-a]pyridin-3-yl)benzamide (3.14 / 3a)

[0559] Obtained from 3.1 / 2a (63.7 mg, 0.433 mmol) and 4-chlorobenzoyl chloride (77.7 pL, 0.606 mmol, 1.4 eq.) according to Method C. The reaction mixture was stirred for 4 days, after which additional 4-chlorobenzoyl chloride (0.2 eq.) was added and the mixture was stirred for another day. The crude product was obtained by adding 1 mL of H2O to the reaction mixture, which was subsequently stirred for 30 min and then dissolved in additional H2O. The aqueous layer was extracted with EtOAc (x3), after which the organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to give a brown crude that was purified by automated flash column chromatography (NP) using a gradient elution (DCM / MeOH). The final product was a white solid (87.5 mg, 71% yield). Rf = 0.31 (95:5 DCM / MeOH). Rt(HPLC) = 10.16 min (>99% pure). Reported as a TFA salt:1H NMR (600 MHz, DMSO-d6) 5 10.98 (s, 1H), 8.54 - 8.51 (m, 1H), 8.13 (s, 1H), 8.12 - 8.09 (m, 2H), 7.86 (dd, J = 9.2, 0.9 Hz, 1 H), 7.75 (dd, J = 9.2, 1.6 Hz, 1 H), 7.72 - 7.67 (m, 2H), 2.42 (d, J = 1.3 Hz, 3H).13C NMR (151 MHz, DMSO-d6) 5 165.61, 157.85 (q,2JFC = 31.52 Hz), 137.49, 137.35, 134.35, 131.25, 130.17, 128.69, 125.94, 123.22, 121.11, 119.27, 116.99 (q,1JFC = 298.58 Hz), 112.82, 17.39. ESI-MS (m / z) calculated [M + H]+for C15H12CIN3O = 286.07, found = 286.1 and [M + H + 2]+288.1.

[0560] 4-chloro-N-(6-methyl-2-(oxazol-5-yl)imidazo[1,2-a]pyridin-3-yl)benzamide (3.15 / 3b) Obtained from 3.8 / 2b (50.0 mg crude, 0.233 mmol) and 4-chlorobenzoyl chloride (35.9 pL, 0.280 mmol, 1.2 eq.) according to Method C. The reaction mixture was stirred forP7022PC00

[0561] 28 h, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. A precipitate was formed and removed by filtration. The filtrate was reduced in vacuo to give an orange-brown crude that was purified by prep. HPLC (isocratic elution with 25% of eluent B: Rt~ 8.5-11.5 min). The product was a faint yellow solid (9.50 mg, 12% yield). Rf= 0.41 (7:3 EtOAc / heptane). Rt(HPLC) = 10.98 min (>99% pure).

[0562] Reported as a TFA salt:1H NMR (600 MHz, DMSO-d6) 6 10.84 (s, 1H), 8.59 (d, J= 1.0 Hz, 1H), 8.57 (d, J= 1.0 Hz, 1H), 8.31 (s, 1H), 8.17 - 8.11 (m, 2H), 7.74 - 7.67 (m, 3H), 7.57 (d, J= 9.1 Hz, 1H), 2.38 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 165.77, 158.02 (q,2JFC = 34.7 Hz), 153.04, 139.04, 137.71, 137.29, 132.55, 131.63, 130.99, 130.24, 128.60, 126.45, 124.64, 122.46, 116.43, 116.28 (q,1JFc = 294.4 Hz), 113.94, 17.44.19F NMR (376 MHz, DMSO-d6) 6 -74.26. ESI-MS (m / z) calculated [M + H]+for C18H13CIN4O2 = 353.08, found = 353.1 and [M + H + 2]+355.1.

[0563] 4-chloro-N-(6-methyl-2-(thiazol-5-yl)imidazo[ 1, 2-a ]pyridin-3-yl)benzamide (3.16 / 3c) Obtained from 3.9 / 2c (400 mg, 1.74 mmol) and 4-chlorobenzoyl chloride (312 pL, 2.43 mmol, 1.4 eq.) according to Method C. The reaction mixture was stirred overnight, after which additional 4-chlorobenzoyl chloride (0.4 eq.) was added and the reaction mixture was stirred another day. The crude product was obtained by adding 1 mL of H2O to the reaction mixture, which was subsequently stirred for 30 min and the solvent reduced in vacuo. The brown solid was redissolved in EtOAc and extracted with 2M aqueous NaOH (x3). The organic layer was washed with brine, dried over anhydrous Na2SO4and reduced in vacuo, after which the crude product was purified by automated flash column chromatography (RP) using a gradient elution. The final product was a white solid (94.4 mg, 15% yield). Rf= 0.10 (3:1 EtOAc / heptane). Rt(HPLC) = 11.39 min (>99% pure).1H NMR (600 MHz, DMSO-d6) 6 10.72 (s, 1H), 9.06 (d, J= 0.7 Hz, 1H), 8.20 (d, J= 0.7 Hz, 1H), 8.19 - 8.13 (m, 2H), 8.07- 8.03 (m, 1H), 7.74 - 7.69 (m, 2H), 7.55 (dd, J= 9.2, 1.0 Hz, 1H), 7.24 (dd, J= 9.2, 1.7 Hz, 1H), 2.31 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 165.71, 153.76, 141.59, 139.58, 137.34, 131.72, 131.49, 131.44, 130.04, 128.90, 128.77, 122.19, 121.35, 116.19, 114.99, 17.52. ESI-MS (m / z) calculated [M + H]+for C18H13ClN4OS = 369.06, found = 369.1 and [M + H + 2]+371.1.

[0564] N-(2-(1H-imidazol-5-yl)-6-methylimidazo[1,2-a]pyridin-3-yl)-4-chlorobenzamide (3.1713d)

[0565] Obtained from 3.10 / 2d (121 mg, 0.567 mmol) and 4-chlorobenzoyl chloride (87.3 pL, 0.681 mmol, 1.2 eq.) according to Method C. The reaction mixture was stirred for 3P7022PC00

[0566] days, after which additional 4-chlorobenzoyl chloride (0.3 eq.) was added and the reaction mixture was stirred for another day. The crude product was obtained by adding 3 mL of H2O to the reaction mixture, which was subsequently stirred for 30 min and the precipitate was collected by filtration. The filtride was dissolved in DMF and upon addition of H2O, a yellow precipitate formed which was collected by filtration. The solid was triturated with acetone to yield the final product as a yellow crystalline solid (15.6 mg, 8% yield). Rf= 0.65 (9:1 DCM / MeOH). Rt(HPLC) = 11.74 min (>95% pure).

[0567] 1H NMR (600 MHz, Methanol-d4) δ 8.02 - 7.96 (m, 2H), 7.87 (s, 1H), 7.74 (s, 1H), 7.52 - 7.46 (m, 2H), 7.45 (s, 1 H), 7.29 (d, J = 9.2 Hz, 1 H), 7.02 (d, J = 9.2 Hz, 1 H), 2.35 (s, 3H).13C NMR (151 MHz, Methanol-d4) 6 167.61, 140.50, 140.33, 136.60, 132.11, 130.09, 129.88, 127.26, 123.36, 122.84, 120.66, 116.01, 18.25. ESI-MS (m / z) calculated [M + H]+for C18H14ClN5O = 352.10, found = 352.1 and [M + H + 2]+354.1.

[0568] 4-chloro-N-(6-methyl-2-(1-methyl-1H-pyrrol-2-yl)imidazo[1,2-a]pyridin-3-yl)benzamide (3.18 / 3e)

[0569] Obtained from 3.11 / 2e (71.0 mg, 0.314 mmol) and 4-chlorobenzoyl chloride (56.3 pL, 0.439 mmol, 1.4 equiv) according to Method C. The reaction mixture was stirred for 2 h, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. A precipitate was formed and removed by filtration. The filtrate was reduced in vacuo to give a crude product that was purified by prep. HPLC (isocratic elution with 35% of eluent B: Rt~ 6.0 min). The product was a white and fluffy solid (18.4 mg, 16% yield). Rf = 0.49 (7:3 EtOAc / heptane). Rt(HPLC) = 11.17 min (>95% pure). Reported as a TFA salt:1H NMR (600 MHz, DMSO-d6) 6 10.81 (s, 1H), 8.33 (s, 1H), 8.12 - 8.06 (m, 2H), 7.76 (d, J= 9.1 Hz, 1H), 7.71 - 7.66 (m, 2H), 7.60 (d, J= 9.1 Hz, 1H), 6.97 (t, J= 2.2 Hz, 1H), 6.43 (dd, J= 3.7, 1.8 Hz, 1H), 6.12 (dd, J= 3.7, 2.6 Hz, 1H), 3.78 (s, 3H), 2.39 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 166.05, 158.00 (q,2JFC = 34.72 Hz), 138.20, 137.40, 132.50, 131.23, 131.07, 130.04, 128.66, 125.79, 124.86, 122.42, 120.71, 116.13, 116.10 (q,1JFc = 294.43 Hz), 113.50, 111.41, 108.07, 35.12, 17.37.19F NMR (376 MHz, DMSO-d6) 6 -74.28. ESI-MS (m / z) calculated [M + H]+for C20H17ClN4O = 365.12, found = 365.1 and [M + H + 2]+367.1.

[0570] 4-chloro-N-(6-methyl-2-(1-tosyl-1H-pyrrol-2-yl)imidazo[1,2-a]pyridin-3-yl)benzamide (3.19 / 3f)

[0571] Obtained from 3.12 / 2f (250 mg, 0.682 mmol) and 4-chlorobenzoyl chloride (105.0 pL, 0.819 mmol, 1.2 equiv) according to Method C. The reaction mixture was stirred forP7022PC00

[0572] overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. EtOAc was added and the suspension was extracted with 2M aqueous NaOH (x3). The organic layer was washed with brine, dried over anhydrous Na2SO4and reduced in vacuo, upon which the crude was triturated with Et20 to yield the product as a white solid (211 mg, 62% yield). Rf = 0.47 (7:3 EtOAc / heptane). Rt(HPLC) = 9.10 min (>96% pure).1H NMR (600 MHz, DMSO-d6) 6 10.44 (s, 1H), 8.07 -8.00 (m, 4H), 7.96 (s, 1 H), 7.65 (d, J = 8.5 Hz, 2H), 7.53 - 7.48 (m, 2H), 7.42 (d, J = 8.0 Hz, 2H), 7.22 (d, J= 9.2 Hz, 1H), 6.41 -6.37 (m, 1H), 6.35 (t, J= 3.4 Hz, 1H), 2.38 (s, 3H), 2.32 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 165.78, 144.74, 140.38, 137.09, 135.97, 131.74, 131.08, 129.99, 129.47, 128.60, 128.07, 127.97, 127.13, 124.36, 121.65, 121.28, 116.90, 116.48, 116.18, 112.04, 21.10, 17.59. ESI-MS (m / z) calculated [M + H]+for C26H21CIN4O3S = 505.11, found = 505.1 and [M + H + 2]+507.1.

[0573] 4-chloro-N-(6-methyl-2-phenylimidazo[ 1,2-a]pyridin-3-yl)benzamide (4.19 / 3g) Obtained from 4.10 / 2g (300 mg, 1.34 mmol) and 4-chlorobenzoyl chloride (207 pL, 1.61 mmol, 1.2 equiv) according to Method C. The reaction mixture was stirred overnight, after which additional 4-chlorobenzoyl chloride (0.1 equiv) was added and the reaction mixture was stirred for 5 h. The crude product was obtained by adding 1 mL of H2O to the reaction mixture, which was subsequently stirred for 30 min and the precipitate was collected by filtration. The filtride was suspended in EtOAc, after which it was extracted with 2M aqueous NaOH (x3). The organic layer was washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo, upon which the crude was triturated with a 1:1 mixture of H2O / ACN, followed by a trituration with Et20. The final product was a white and fluffy solid (126 mg, 26% yield). Rf = 0.49 (7:3 EtOAc / heptane). Rt(HPLC) = 12.33 min (>99% pure).1H NMR (600 MHz, DMSO-d6) 6 10.70 (s, 1H), 8.17 - 8.11 (m, 2H), 7.98- 7.92 (m, 3H), 7.72 - 7.67 (m, 2H), 7.55 (dd, J = 9.2, 1.0 Hz, 1 H), 7.42 (t, J = 7.8 Hz, 2H), 7.33 - 7.28 (m, 1 H), 7.20 (dd, J = 9.2, 1.7 Hz, 1H), 2.31 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 165.67, 141.19, 137.70, 137.22, 133.69, 131.80, 129.98, 128.74, 128.52, 128.20, 127.55, 126.49, 121.63, 121.09, 116.37, 114.88, 17.56. ESI-MS (m / z) calculated [M + H]+for C21H16CIN3O = 362.11, found = 362.1 and [M + H + 2]+364.1.

[0574] 4-chloro-N-(6-methyl-2-(3-methylthiophen-2-yl)imidazo[1,2-a]pyridin-3-yl)benzamide (4.20 / 3h)

[0575] Obtained from 4.11 / 2h (91.0 mg, 0.374 mmol) and 4-chlorobenzoyl chloride (57.5 pL,P7022PC00

[0576] 0.449 mmol, 1.2 equiv) according to Method C. The reaction mixture was stirred for 4 h, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. A precipitate was formed and removed by filtration. The filtrate was reduced in vacuo to give a green crude that was triturated with EtOAc, followed by a trituration with Et20 to give a white solid as the final product (5.4 mg, 4% yield). Rf = 0.60 (1:1 EtOAc / heptane). Rt(HPLC) = 12.34 min (>96% pure).1H NMR (600 MHz, DMSO-d6) 6 10.58 (s, 1H), 8.13 - 8.10 (m, 2H), 7.95- 7.91 (m, 1H), 7.69- 7.66 (m, 2H), 7.54 (dd, J = 9.1, 1.0 Hz, 1H), 7.43 (d, J= 5.1 Hz, 1H), 7.20 (dd, J= 9.1, 1.7 Hz, 1H), 6.94 (d, J = 5.1 Hz, 1H), 2.45 (s, 3H), 2.30 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 165.80, 141.10, 137.13, 135.36, 134.46, 131.91, 130.94, 129.96, 128.86, 128.68, 128.13, 125.04, 121.67, 121.11, 116.19, 114.93, 17.54, 15.37. ESI-MS (m / z) calculated [M + H]+for C20H16CIN3OS = 382.08, found = 382.1 and [M + H + 2]+384.1.

[0577] 4-chloro-N-(6-methyl-2-(4-methylthiophen-2-yl)imidazo[1,2-a]pyridin-3-yl)benzamide (4.21 / 3i)

[0578] Obtained from 4.12 / 2i (321 mg, 1.32 mmol) and 4-chlorobenzoyl chloride (203 pL, 1.58 mmol, 1.2 equiv) according to Method C. The reaction mixture was stirred overnight, after which additional 4-chlorobenzoyl chloride (0.1 equiv) was added and the reaction mixture was stirred for 5 h. The crude product was obtained by adding 1 mL of H2O to the reaction mixture, which was subsequently stirred for 30 min and the precipitate was collected by filtration. The filtride was suspended in EtOAc, after which it was extracted with 2M aqueous NaOH (x3). The organic layer was washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo, upon which the crude was triturated with a 1:1 mixture of H2O / ACN to yield the final product as a faint pink solid (222 mg, 44% yield). Rf= 0.56 (1:1 EtOAc / heptane). Rt(HPLC) = 12.76 min (>98% pure).1H NMR (600 MHz, DMSO-d6) 6 10.63 (s, 1H), 8.18 - 8.12 (m, 2H), 7.97 - 7.93 (m, 1H), 7.73 -7.68 (m, 2H), 7.50 (dd, J= 9.2, 1.0 Hz, 1H), 7.27 (d, J= 1.6 Hz, 1H), 7.19 (dd, J= 9.2, 1.7 Hz, 1H), 7.11 - 7.07 (m, 1H), 2.29 (s, 3H), 2.19 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 165.63, 141.15, 137.49, 137.20, 136.15, 134.03, 131.89, 130.00, 128.74, 128.34, 126.25, 121.72, 121.11, 116.02, 113.73, 17.52, 15.45. ESI-MS (m / z) calculated [M + H]+for C20H16CIN3OS = 382.08, found = 382.1 and [M + H + 2]+384.1.

[0579] 4-chloro-N-(6-methyl-2-(5-methylthiophen-2-yl)imidazo[1,2-a]pyridin-3-yl)benzamide (SM-20 / 3j)

[0580] Obtained from NNJ-70-1 / 2j (480 mg, 1.97 mmol) and 4-chlorobenzoyl chloride (354 pL,P7022PC00

[0581] 2.76 mmol, 1.4 equiv) according to Method C. The reaction mixture was stirred for 3 days, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. A precipitate formed which was collected by filtration, redissolved in EtOAc and extracted with 2M aqueous NaOH (x3). The organic layer was washed with brine, dried over Na2SO4and reduced in vacuo to give a strong yellow solid. The crude product was purified by automated flash column chromatography (NP) using a gradient elution (DCM / MeOH) to yield the final product as a yellow solid (390 mg, 52% yield). Rf = 0.16 (99:1 DCM / MeOH). Rt(HPLC) = 12.81 min (>99% pure).1H NMR (600 MHz, DMSO-d6) 6 10.62 (s, 1H), 8.19 - 8.13 (m, 2H), 7.95 (dd, J= 1.8, 1.0 Hz, 1H), 7.73 - 7.67 (m, 2H), 7.50 (dd, J= 9.2, 1.0 Hz, 1H), 7.25 (d, J= 3.5 Hz, 1H), 7.18 (dd, J= 9.2, 1.8 Hz, 1H), 6.81 -6.77 (m, 1H), 2.44 (d, J= 1.3 Hz, 3H), 2.29 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 165.61, 141.15, 139.25, 137.24, 134.20, 134.08, 131.84, 130.00, 128.75, 128.24, 126.09, 124.12, 121.67, 121.05, 115.95, 113.38, 17.53, 14.95. ESI-MS (m / z) calculated [M + H]+for C20H16ClN3OS = 382.08, found = 382.1 and [M + H + 2]+384.1.

[0582] 4-chloro-N-(2-(5-chlorothiophen-2-yl)-6-methylimidazo[1,2-a]pyridin-3-yl)benzamide (4.2313k)

[0583] Obtained from 4.14 / 2k (360 mg, 1.37 mmol) and 4-chlorobenzoyl chloride (245 pL, 1.91 mmol, 1.4 equiv) according to Method C. The reaction mixture was stirred overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. A precipitate formed which was collected by filtration and resuspended in EtOAc. The organic layer was extracted with 2M aqueous NaOH (x3), after which it was washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo. The crude product was purified by automated flash column chromatography (RP) using a gradient elution. The final product was a faint yellow solid (45.7 mg, 8% yield). Rf= 0.3 (1:1 EtOAc / Heptane). Rt(HPLC) = 13.65 min (>97% pure).1H NMR (600 MHz, DMSO-d6) 6 10.68 (s, 1H), 8.18 - 8.12 (m, 2H), 8.03 - 7.99 (m, 1H), 7.73 -7.68 (m, 2H), 7.52 (dd, J= 9.2, 1.0 Hz, 1H), 7.25 (d, J= 4.0 Hz, 1H), 7.22 (dd, J= 9.2, 1.7 Hz, 1H), 7.12 (d, J= 4.0 Hz, 1H), 2.30 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 165.57, 141.26, 137.33, 135.73, 132.85, 131.65, 130.01, 128.80, 128.76, 127.75, 127.71, 123.53, 122.10, 121.25, 116.08, 114.05, 17.50. ESI-MS (m / z) calculated [M + H]+for C19H13CI2N3OS = 402.02, found = 402.0, [M + H + 2]+404.0 and [M + H + 4]+406.0.

[0584] 4-chloro-N-(2-(5-ethylthiophen-2-yl)-6-methylimidazo[1,2-a]pyridin-3-yl)benzamideP7022PC00

[0585] (4.24 / 31)

[0586] Obtained from 4.15 / 21 (100 mg, 0.389 mmol) and 4-chlorobenzoyl chloride (69.7 pL, 0.544 mmol, 1.4 equiv) according to Method C. The reaction mixture was stirred overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. A precipitate formed which was collected by filtration, redissolved in EtOAc and extracted with 2M aqueous NaOH (x3). The organic layer was washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo to give a faint yellow solid. The crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane) to yield the final product as a faint yellow solid (73.9 mg, 48% yield). Rf= 0.33 (1:1 EtOAc / heptane). Rt(HPLC) = 13.58 min (>98% pure).1H NMR (400 MHz, DMSO-d6) 5 10.62 (s, 1H), 8.19 - 8.11 (m, 2H), 7.95 (d, J= 1.7 Hz, 1H), 7.75 - 7.66 (m, 2H), 7.49 (d, J= 9.1 Hz, 1H), 7.25 (d, J= 3.6 Hz, 1H), 7.18 (dd, J = 9.1, 1.7 Hz, 1H), 6.82 (d, J= 3.6 Hz, 1H), 2.79 (q, J= 7.5 Hz, 2H), 2.29 (s, 3H), 1.23 (t, J= 7.5 Hz, 3H).13C NMR (101 MHz, DMSO-d6) 5 165.63, 146.75, 141.14, 137.21, 134.19, 133.73, 131.87, 129.99, 128.75, 128.23, 124.32, 123.93, 121.67, 121.06, 115.95, 113.43, 22.73, 17.53, 15.88. ESI-MS (m / z) calculated [M + H]+for C21H18CIN3OS = 396.09, found = 396.1 and [M + H + 2]+398.1.

[0587] N-(2-(5-benzylthiophen-2-yl)-6-methylimidazo[1,2-a]pyridin-3-yl)-4-chlorobenzamide (4.25 / 3m)

[0588] Obtained from 4.16 / 2m (50.0 mg, 0.157 mmol) and 4-chlorobenzoyl chloride (28.1 pL, 0.219 mmol, 1.4 equiv) according to Method C. The reaction mixture was stirred overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. The reaction mixture was then reduced in vacuo and resuspended in EtOAc. The organic layer was extracted with 2M aqueous NaOH (x3), after which it was washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo. The crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane) to yield the final product as a faint purple solid (41.3 mg, 58% yield). Rf= 0.45 (1:1 EtOAc / heptane). Rt(HPLC) = 14.20 min (>97% pure).1H NMR (600 MHz, DMSO-d6) 5 10.94 (s, 1H), 8.51 (s, 1H), 8.12 - 8.06 (m, 2H), 7.82 (d, J= 9.1 Hz, 1H), 7.76 (d, J= 9.1 Hz, 1H), 7.74 - 7.70 (m, 2H), 7.59 (d, J= 3.7 Hz, 1H), 7.32 -7.18 (m, 5H), 7.04 (d, J= 3.7 Hz, 1H), 4.19 (s, 2H), 2.40 (s, 3H).13C NMR (151 MHz, DMSO-d6) 5 166.33, 148.42, 139.82, 137.67, 137.11, 135.39, 131.17, 130.23, 128.97, 128.78, 128.57, 128.51, 127.91, 127.05, 126.87, 126.60, 126.28, 123.11, 114.85, 112.13, 35.10, 17.35. ESI-MS (m / z) calculated [M + H]+for C26H20CIN3OS = 458.11,P7022PC00

[0589] found = 458.1 and [M + H + 2]+460.1.

[0590] 4-chloro-N-(6-methyl-2-(thiophen-2-yl)imidazo[1,2-a]pyridin-3-yl)benzamide (NNJ-65-1 / 3n)

[0591] Obtained from NNJ-34-2 / 2n (200 mg, 0.872 mmol) and 4-chlorobenzoyl chloride (157 pL, 1.22 mmol, 1.4 equiv) according to Method C. The reaction mixture was stirred for 3 days, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. A precipitate formed which was collected by filtration. The crude product was triturated with Et20, followed by a trituration with acetone to give an off-white solid as the final product (120 mg, 38% yield). Rf = 0.20 (2:1 EtOAc / Heptane). Rt(HPLC) = 12.18 min (>99% pure).1H NMR (600 MHz, DMSO-d6) 5 10.67 (s, 1H), 8.18 - 8.12 (m, 2H), 7.99 - 7.96 (m, 1 H), 7.72 - 7.67 (m, 2H), 7.54 - 7.49 (m, 2H), 7.45 (dd, J = 3.6, 1.2 Hz, 1H), 7.20 (dd, J= 9.2, 1.7 Hz, 1H), 7.11 (dd, J= 5.0, 3.6 Hz, 1H), 2.30 (s, 3H).

[0592] 13C NMR (151 MHz, DMSO-d6) 5 165.77, 141.27, 137.31, 136.42, 134.02, 131.86, 130.06, 128.80, 128.52, 127.85, 125.93, 124.16, 121.91, 121.18, 116.08, 113.84, 17.58. ESI-MS (m / z) calculated [M + H]+for C19H14CIN3OS = 368.06, found = 368.1 and [M + H + 2]+370.0. The analytical data is in accordance with literature.

[0593] N-(6-bromo-2-(5-methylthiophen-2-yl)imidazo[1,2-a]pyridin-3-yl)-4-chlorobenzamide (4.22 / 30)

[0594] Obtained from 4.13 / 2o (130 mg, 0.422 mmol) and 4-chlorobenzoyl chloride (64.9 pL, 0.506 mmol, 1.2 equiv) according to Method C. The reaction mixture was stirred overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. A precipitate formed which was collected by filtration and redissolved in EtOAc. The organic layer was extracted with 2M aqueous NaOH (x3), after which it was washed with brine, dried over anhydrous Na2SO4and reduced in vacuo. The crude product was triturated with a 1:1 mixture of H2O / ACN to yield the final product as a faint yellow solid (84.4 mg, 45% yield). Rf= 0.71 (7:3 EtOAc / heptane). Rt(HPLC) = 13.70 min (>99% pure).1H NMR (600 MHz, DMSO-d6) 5 10.67 (s, 1H), 8.59- 8.56 (m, 1H), 8.17 - 8.11 (m, 2H), 7.72 - 7.67 (m, 2H), 7.58 (dd, J= 9.5, 1.0 Hz, 1H), 7.44 (dd, J = 9.5, 1.9 Hz, 1H), 7.28 (d, J= 3.6 Hz, 1H), 6.83 -6.79 (m, 1H), 2.44 (s, 3H).13C NMR (151 MHz, DMSO-d6) 5 165.67, 140.54, 140.00, 137.17, 135.06, 133.27, 131.83, 130.12, 128.63, 128.26, 126.25, 124.84, 123.94, 117.58, 114.29, 106.33, 14.96. ESIMS (m / z) calculated [M + H]+for C19H13BrClN3OS = 445.97, found = 446.0, [M + H + 2]+448.0 and [M + H + 4]+450.0.P7022PC00

[0595] 4-chloro-N-(2-(5-methylthiophen-2-yl)-6-(thiophen-2-yl)imidazo[1,2-a]pyridin-3-yl)benzamide (4.27 / 3p)

[0596] Obtained from 4.18 / 2p (270 mg, 0.867 mmol) and 4-chlorobenzoyl chloride (156 pL, 1.21 mmol, 1.4 equiv) according to Method C. The reaction mixture was stirred for 3 days, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. A precipitate formed which was collected by filtration, redissolved in EtOAc and extracted with 2M aqueous NaOH (x3). The organic layer was washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo to give a yellow solid. The crude product was triturated with Et20 to yield the final product as a faint yellow solid (118 mg, 30% yield). Rf= 0.69 (7:3 EtOAc / heptane). Rt(HPLC) = 14.24 min (>99% pure).1H NMR (600 MHz, DMSO-d6) 5 10.70 (s, 1H), 8.36 (dd, J= 1.8, 1.0 Hz, 1H), 8.20- 8.14 (m, 2H), 7.73 - 7.69 (m, 2H), 7.67 (dd, J = 9.3, 1.0 Hz, 1 H), 7.63 (dd, J = 9.3, 1.8 Hz, 1 H), 7.60 - 7.57 (m, 2H), 7.29 (d, J= 3.5 Hz, 1H), 7.15 (dd, J= 5.1, 3.6 Hz, 1H), 6.83 -6.79 (m, 1H), 2.45 (d, J= 1.2 Hz, 3H).13C NMR (151 MHz, DMSO-d6) 5 165.71, 141.25, 139.76, 139.20, 137.26, 134.98, 133.64, 131.89, 130.09, 128.76, 128.48, 126.23, 125.99, 124.84, 124.66, 124.63, 119.88, 119.02, 116.93, 114.38, 14.98. ESI-MS (m / z) calculated [M + H]+for C23H16CIN3OS2 = 450.05, found = 450.1 and [M + H + 2]+452.1.

[0597] N-(2-(4-(tert-butyl)- 1 -methyl- 1H-pyrrol-2-yl)-6-methylimidazo[ 1, 2-a]pyridin-3-yl)-4-chlorobenzamide (4.29 / 3q)

[0598] Obtained from 3.11a / 2q (45.0 mg, 0.159 mmol) and 4-chlorobenzoyl chloride (28.6 pL, 0.223 mmol, 1.4 equiv) according to Method C. The reaction mixture was stirred overnight, after which additional 4-chlorobenzoyl chloride (0.5 equiv) was added and the reaction mixture was stirred for another day. Upon addition of 1 mL H2O and stirring for 30 min, the reaction mixture was then reduced in vacuo and resuspended in EtOAc. The organic layer was extracted with 2M aqueous NaOH (x3), after which it was washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo. The crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane) to yield the final product as a faint pink solid (29.2 mg, 44% yield). Rf= 0.5 (1:1 EtOAc / heptane). Rt(HPLC) = 14.00 min (>99% pure).1H NMR (600 MHz, DMSO-d6) 5 10.51 (s, 1H), 8.01 - 7.97 (m, 2H), 7.90- 7.87 (m, 1H), 7.61 - 7.56 (m, 2H), 7.51 (d, J= 9.2 Hz, 1H), 7.25 (dd, J= 9.2, 1.6 Hz, 1H), 6.59 (d, J= 2.0 Hz, 1H), 6.24 (d, J = 2.0 Hz, 1H), 3.71 (s, 3H), 2.26 (s, 3H), 1.07 (s, 9H).13C NMR (151 MHz, DMSO-d6) 5 167.67, 141.27, 138.20, 134.93, 132.94, 132.38, 130.49, 129.95,P7022PC00

[0599] 129.52, 123.95, 123.59, 121.64, 120.82, 116.02, 115.53, 108.51, 35.88, 32.28, 30.73, 18.26. ESI-MS (m / z) calculated [M + H]+for C24H25CIN4O = 421.18, found = 421.2 and [M + H + 2]+423.2.

[0600] N-(6-methyl-2-(thiophen-2-yl)imidazo[1,2-a]pyridin-3-yl)acetamide (3.20 / 3r) Obtained from 3.13 / 2n (100 mg, 0.436 mmol) and acetyl chloride (37.2 pL, 0.523 mmol, 1.2 equiv) according to Method C. The reaction mixture was stirred for 1 h, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. A precipitate was collected by filtration and washed with H2O to yield the final product as a white solid. (59.7 mg, 51% yield). Rf = 0.35 (4:1 EtOAc / heptane). Rt(HPLC) = 6.32 min (>99% pure).1H NMR (600 MHz, DMSO-d6) 5 10.34 (s, 1H), 8.16 (s, 1H), 7.71 -7.67 (m, 2H), 7.65 (d, J= 9.1 Hz, 1H), 7.48 (d, J= 9.1 Hz, 1H), 7.21 (t, J= 5.1 Hz, 1H), 2.37 (s, 3H), 2.26 (s, 3H).13C NMR (151 MHz, DMSO-d6) 5 170.75, 138.90, 131.89, 129.82, 128.07, 127.98, 127.69, 126.08, 124.17, 122.07, 114.90, 113.95, 22.74, 17.52. ESI-MS (m / z) calculated [M + H]+for C14H13N3OS = 272.09, found = 272.3.

[0601] N-(6-methyl-2-(thiophen-2-yl)imidazo[1,2-a]pyridin-3-yl)adamantane-1 -carboxamide (3.213s)

[0602] Obtained from 3.13 / 2n (150 mg, 0.654 mmol) and 1 -adamantanecarbonyl chloride (182 mg, 0.916 mmol, 1.2 equiv) according to Method C. The reaction mixture was stirred overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. EtOAc was added and the suspension was extracted with 2M aqueous NaOH (x3). The organic layer was washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo. The crude product was purified by automated flash column chromatography (RP) using a gradient elution. The final product was an off-white solid (7.60 mg, 3% yield). Rf = 0.28 (2:3 EtOAc / heptane). Rt(HPLC) = 13.29 min (>97% pure).1H NMR (600 MHz, Methanol-d4) 57.58 - 7.53 (m, 2H), 7.48 - 7.42 (m, 2H), 7.25 (dd, J= 9.2, 1.6 Hz, 1H), 7.13 (t, J= 4.3 Hz, 1H), 2.36 (s, 3H), 2.18 -2.13 (m, 9H), 1.91 - 1.84 (m, 6H).13C NMR (151 MHz, Methanol-d4) 5 181.45, 143.44, 136.45, 135.66, 130.47, 128.45, 126.84, 126.13, 124.30, 121.61, 116.68, 115.36, 42.66, 40.22, 37.55, 29.69, 18.20. ESI-MS (m / z) calculated [M + H]+for C23H25N3OS = 392.18, found = 392.2.

[0603] 3-((6-methyl-2-(thiophen-2-yl)imidazo[1,2-a]pyridin-3-yl)carbamoyl)phenyl acetate

[0604] (3.22 / 3t)P7022PC00

[0605] 3.13 / 2n (207 mg, 0.903 mmol, 1.0 equiv) and 3-acetoxybenzoic acid (163 mg, 0.903 mmol, 1.0 equiv) were dissolved in dry DCM (15 mL), after which HBTU (325 mg, 0.858 mmol, 0.95 equiv) and dry TEA (377 pL, 2.71 mmol, 3.0 equiv) were added. The reaction mixture was stirred at room temperature overnight. Upon TLC and LC-MS control, the reaction was first heated to 45°C overnight, then increased again to 55°C for an additional night and eventually refluxed for 12 more hours. The reaction was then cooled down to room temperature, reduced in vacuo, diluted with H2O and extracted with EtOAc (x3). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to yield a black crude that was used without any further purification (42.3 mg crude). Rf = 0.35 (7:3 EtOAc / Heptane). ESIMS (m / z) calculated [M + H]+for C21H17N3O3S = 392.11, found = 392.1.

[0606] 4-chloro-N-(6-methyl-2-( 1 H-pyrrol-2-yl)imidazo[ 1,2-a]pyridin-3-yi)benzamide (3.23 / 3u) In a flame-dried flask, 3.19 / 3f (100 mg, 0.198 mmol, 1 equiv) was suspended in a 1:1 mixture of MeOH and 1,4-dioxane. The flask was sealed and purged with nitrogen, after which sodium methoxide (113 pL, 1.98 mmol, 10 equiv) was added (reaction mixture turned immediately orange). The reaction mixture was stirred at 60°C overnight and upon completion monitored by TLC and LC-MS, the reaction mixture was cooled to room temperature. H2O was added and the reaction mixture was extracted with EtOAc (x3). The organic layer was washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo to give a black solid. The crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane) to yield the final product as an off-white solid (1.51 mg, 2% yield). Rf = 0.33 (7:3 EtOAc / heptane). Rt(HPLC) = 12.14 min (>98% pure).1H NMR (600 MHz, DMSO-d6) 6 11.30 - 11.27 (m, 1H), 10.54 (s, 1H), 8.18- 8.12 (m, 2H), 7.92 - 7.88 (m, 1H), 7.71 -7.64 (m, 2H), 7.46 (dd, J= 9.1, 1.0 Hz, 1H), 7.15 (dd, J= 9.1, 1.7 Hz, 1H), 6.78 (td, J = 2.6, 1.5 Hz, 1H), 6.33 (ddd, J= 3.7, 2.4, 1.5 Hz, 1H), 6.10-6.05 (m, 1H), 2.30 (s, 3H).

[0607] 13C NMR (151 MHz, DMSO-d6) 6 165.93, 141.50, 137.56, 134.08, 132.48, 130.43, 129.17, 127.96, 125.43, 121.67, 121.48, 119.18, 116.03, 112.99, 109.18, 106.84, 18.04. ESI-MS (m / z) calculated [M + H]+for C19H15CIN4O = 351.10, found = 351.1 and [M + H + 2]+353.1.

[0608] 3-hydroxy-N-(6-methyl-2-(thiophen-2-yl)imidazo[1,2-a]pyridin-3-yl)benzamide (3.24 / 3v) 3.22 / 3t (42.3 mg crude, 0.108 mmol) was dissolved in THF (3 mL), after which 5M aqueous NaOH (3 mL) was added to the solution. The biphasic mixture was vigorouslyP7022PC00

[0609] stirred at room temperature and the reaction was monitored by LC-MS. After 3 h, THF was removed in vacuo and the residue was diluted with H2O (10 mL). The pH of the solution was adjusted to pH 7 using 3M aqueous HCI. The precipitate formed was collected by filtration and it was triturated with Et20 to yield the final product as a faint orange solid (14.7 mg, 39% yield). Rf= 0.34 (9.5:0.5 DCM / MeOH + 1% TEA). Rt(HPLC) = 9.99 min (>97% pure).1H NMR (600 MHz, DMSO-d6) 6 10.47 (s, 1H), 9.83 (s, 1 H), 7.90 (s, 1 H), 7.59 (d, J = 7.9 Hz, 1 H), 7.53 - 7.49 (m, 3H), 7.44 (s, 1 H), 7.40 (t, J= 7.9 Hz, 1H), 7.19 (d, J= 9.2 Hz, 1H), 7.11 (t, J= 4.3 Hz, 1H), 7.06 (d, J= 7.9 Hz, 1H), 2.30 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 166.65, 157.56, 141.15, 136.56, 134.42, 133.97, 129.70, 128.34, 127.76, 125.80, 123.98, 121.78, 120.98, 119.26, 118.55, 116.06, 114.94, 114.16, 17.55. ESI-MS (m / z) calculated [M + H]+for C19H15N3O2S = 350.10, found = 350.1.

[0610] 2-phenyl- 1-(thiophen-2-yl)ethan- 1-one (3.25 / 8)

[0611] In a flame-dried flask, aluminium chloride (862 mg, 6.45 mmol, 1 equiv) was dissolved in dry DCM (10 mL) and the flask was fitted with a rubber septum and purged with nitrogen. After cooling to 0°C and to a well-stirred solution, phenylacetyl chloride (1.00 g, 6.45 mmol, 1 equiv) as a dry DCM solution (5 mL) was added dropwise - reaction mixture turned orange during the addition. This was followed by a dropwise addition of thiophene (1.09 g, 12.9 mmol, 2 equiv) as a dry DCM solution (5 mL). The reaction mixture was stirred at room temperature for 1 h and upon completion monitored by TLC / LC-MS, the reaction mixture was poured carefully to a stirring mixture of ice (80 g) and concentrated HCI (2 mL). The acidic aqueous layer was extracted with EtOAc (x3). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to yield a light green solid (1.13 g, 86% yield). Rf = 0.58 (3:7 EtOAc / heptane).1H NMR (600 MHz, DMSO-d6) 68.12 (dd, J= 3.7, 1.2 Hz, 1H), 8.02 (dd, J = 4.9, 1.2 Hz, 1 H), 7.35 - 7.28 (m, 4H), 7.27 (dd, J = 4.9, 3.7 Hz, 1 H), 7.26 -7.22 (m, 1H), 4.30 (s, 2H).13C NMR (151 MHz, DMSO-d6) 6 190.70, 143.51, 135.30, 134.91, 134.08, 129.55, 128.80, 128.35, 126.62, 45.04. ESI-MS (m / z) calculated [M + H]+for C12H10OS = 203.05, found = 203.1.

[0612] 2-phenyl-1-(thiophen-2-yl)ethan-1-one O-methyl oxime (3.26a / 9)

[0613] To a solution of 3.25 / 8 (250 mg, 1.24 mmol, 1 equiv) in EtOH (20 mL), methoxylamine hydrochloride (155 mg, 1.85 mmol, 1.5 equiv) and dry pyridine (149 pL, 1.85 mmol, 1.5 equiv) were added. The flask was purged with nitrogen, after which the reactionP7022PC00

[0614] mixture was heated to 60°C and monitored by TLC and LC-MS. After 4 h, the reaction mixture had turned orange and it was cooled to room temperature and the solvent reduced in vacuo. The residue was redissolved in EtOAc and extracted with H2O (x3). The organic layer was then washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to yield a faint orange oil that was used in the subsequent reaction without further purification. This step afforded the oxime product (295 mg crude) as a mix of isomers (1H N MR integration ratio 3:2). Rf = 0.78 (1:1 EtOAc / Heptane).

[0615] 2-phenyl-1-(thiophen-2-yl)ethan-1 -amine (3.26b / 10)

[0616] 3.26a / 9 (295 mg crude, 1.24 mmol, 1 equiv) was taken up in dry THF (4 mL) and transferred to a flame-dried flask purged with nitrogen. 1M solution of borane in THF (5 mL, 5 mmol, 4 equiv) was added and the reaction mixture was stirred at 50°C overnight. Upon TLC and LC-MS control, the reaction mixture was cooled to room temperature and carefully quenched by a dropwise addition of 6M aqueous HCI (until a white suspension was observed). After stirring for 10 min, the reaction mixture was adjusted to pH > 10 by addition of 5M aqueous NaOH. The resulting yellow solution was extracted with EtOAc (x3). The organic layers were combined, washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo to yield a yellow oil (203 mg, 81% yield). Due to lack of stability, the product was immediately used in the subsequent reaction. Rf= 0.28 (2:3 EtOAc / heptane + 5% TEA).1H NMR (600 MHz, Chloroform-d) 5 7.34 -7.28 (m, 2H), 7.27-7.23 (m, 1H), 7.23-7.18 (m, 3H), 6.95 (dd, J = 5.0, 3.5 Hz, 1H), 6.92 -6.91 (m, 1H), 4.49 (dd, J= 8.7, 5.1 Hz, 1H), 3.15 (dd, J= 13.4, 5.1 Hz, 1H), 2.91 (dd, J= 13.4, 8.7 Hz, 1H).13C NMR (151 MHz, Chloroform-d) 5137.71, 129.52, 129.49, 128.68, 126.93, 126.91, 124.57, 124.54, 53.39, 45.64. ESI-MS (m / z) calculated [M + H]+for elimination product C12H10S = 187.06, found = 187.1.

[0617] 4-chloro-N-(2-phenyl- 1-(thiophen-2-yl)ethyl) benzamide (3.27 / 11 )

[0618] Obtained from 3.26b / 10 (203 mg, 0.999 mmol) and 4-chlorobenzoyl chloride (179 pL, 1.40 mmol, 1.4 equiv) according to Method C. The reaction mixture was stirred overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. A precipitate was formed and removed by filtration. The filtrate was reduced in vacuo and the solid was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane), followed by a trituration with Et20 to yield the final product as a white solid (9.10 mg, 3% yield). Rf = 0.33 (1:9 EtOAc / heptane). Rt(HPLC) = 17.15 min (>99% pure).1H NMR (600 MHz,P7022PC00

[0619] Methanol-d4) 67.70 - 7.64 (m, 2H), 7.46 - 7.40 (m, 2H), 7.30 - 7.27 (m, 3H), 7.27 -7.23 (m, 2H), 7.20-7.13 (m, 1H), 7.05 (dt, J= 3.5, 1.1 Hz, 1H), 6.96 (dd, J= 5.1, 3.5 Hz, 1H), 5.66 (ddd, J= 9.5, 6.1, 0.9 Hz, 1H), 3.36 (dd, J= 13.8, 6.1 Hz, 1H), 3.26 (dd, J = 13.8, 9.5 Hz, 1H).13C NMR (151 MHz, Methanol-d4) 6168.45, 147.14, 139.39, 138.64, 134.41, 130.29, 130.05, 129.64, 129.36, 127.70, 127.61, 125.49, 125.18, 52.23, 43.27. ESI-MS (m / z) calculated [M + H]+for C19H16ClNOS = 342.07, found = 342.1 and [M + H + 2]+344.1.

[0620] 5-bromo-1,2-dimethyl-4-nitro-1 H-imidazole (3.28A / 12a) and 4-bromo-1,2-dimethyl-5-nitro- 1 H-imidazole (3.28B / 12b)

[0621] 5-bromo-2-methyl-4-nitro-1 / - / -imidazole (2.00 g, 9.71 mmol, 1 equiv) was dissolved in 1.5M aqueous NaOH (9.73 mL, 14.6 mmol, 1.5 equiv). The yellow reaction mixture was heated to 55°C, upon which dimethyl sulphate (1.38 mL, 14.6 mmol, 1.5 equiv) was added dropwise. The reaction mixture was heated to 60°C, stirred overnight and monitored by LC-MS. Additional dimethyl sulphate was added (0.2 equiv) and the reaction mixture was stirred for 1 h, upon which the mixture was cooled to room temperature and quenched with 5M aqueous NaOH (10 mL). A precipitate formed which was collected by filtration and washed with H2O. The crude product was a mix of isomers that were separated by automated flash column chromatography (RP) using a gradient elution. The reaction afforded two white solids: isomer A (1.14 g, 53% yield) and B (773 mg, 36% yield). Isomer A: Rf= 0.47 (EtOAc).1H NMR (600 MHz, Methanol-d4) 53.67 (s, 3H), 2.47 (s, 3H).13C NMR (151 MHz, Methanol-d4) 5147.45, 144.52, 107.58, 33.45, 13.72. ESI-MS (m / z) calculated [M + H]+for C5H6BrN3O2 = 219.97, found = 220.0. Isomer B: Rf= 0.63 (EtOAc).1H NMR (600 MHz, Methanol-d4) 5 3.89 (s, 3H), 2.45 (s, 3H).13C NMR (151 MHz, Methanol-d4) 5150.91, 137.22, 119.19, 35.07, 13.65. ESI-MS (m / z) calculated [M + H]+for C5H6BrN3O2 = 219.97, found = 220.0.

[0622] 1,2-dimethyl-4-nitro-5-(thiophen-2-yl)-1 H-imidazole (3.29A / 13a)

[0623] In a flame-dried MW vial, 3.28A / 12a (300 mg, 1.36 mmol, 1 equiv) was dissolved in degassed dimethoxyethane (9 mL), after which Pd(PPh3)4(53.6 mg, 0.0464 mmol, 0.034 equiv) was added. The reaction mixture was stirred under nitrogen at room temperature for 1 h. A solution of 2-thienyl boronic acid (180 mg, 1.40 mmol, 1.03 equiv) in absolute EtOH (3 mL) and 1M aqueous K2CO3(6 mL) was then added to the vial. The reaction mixture was subjected to microwave irradiation for 3 h at 75°C andP7022PC00

[0624] monitored by LC-MS. The reaction mixture was reduced in vacuo and redissolved in DCM, upon which the organic layer was extracted with H2O (x3), washed with brine, dried over anhydrous Na2SO4and reduced in vacuo. The crude green oil was purified by automated flash column chromatography (RP) using a gradient elution. The final product was an off-white solid (161 mg, 53% yield). Rf = 0.38 (EtOAc).1H NMR (400 MHz, Chloroform-d) 57.60 (dd, J= 5.0, 1.2 Hz, 1H), 7.25-7.15 (m, 2H), 3.47 (s, 3H), 2.49 (s, 3H).13C NMR (151 MHz, Chloroform-d) 5144.70, 144.23, 131.50, 129.73, 127.63, 126.35, 125.59, 32.12, 13.80. ESI-MS (m / z) calculated [M + H]+for C9H9N3O2S = 224.05, found = 224.1.

[0625] 1.2-dimethyl-5-nitro-4-(thiophen-2-yl)-1 H-imidazole (3.29B / 13b)

[0626] In a flame-dried MW vial, 3.28B / 12b (150 mg, 0.682 mmol, 1 equiv) was dissolved in degassed dimethoxyethane (4.5 mL), after which Pd(PPh3)4 (26.8 mg, 0.0232 mmol, 0.034 equiv) was added. The reaction mixture was stirred under nitrogen at room temperature for 1 h. A solution of 2-thienyl boronic acid (89.9 mg, 0.702 mmol, 1.03 equiv) in absolute EtOH (1.5 mL) and 1M aqueous K2CO3 (3 mL) was then added to the vial. The reaction mixture was subjected to microwave irradiation for 3 h at 75°C and monitored by LC-MS. The reaction mixture was reduced in vacuo and redissolved in DCM, upon which the organic layer was extracted with H2O (x3), washed with brine, dried over anhydrous Na2SO4and reduced in vacuo. The crude green oil was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane) to yield the final product as yellow solid (55.0 mg, 36% yield). Rf = 0.46 (7:3 EtOAc / heptane).1H NMR (400 MHz, Chloroform-d) 58.17 (dd, J= 3.8, 1.2 Hz, 1H), 7.50 (dd, J= 5.1, 1.2 Hz, 1H), 7.15 (dd, J= 5.1, 3.8 Hz, 1H), 3.90 (s, 3H), 2.51 (s, 3H).13C NMR (101 MHz, Chloroform-d) 5148.94, 138.15, 134.36, 133.36, 130.76, 129.68, 128.02, 34.44, 14.26. ESI-MS (m / z) calculated [M + H]+for C9H9N3O2S = 224.05, found = 224.1.

[0627] 1,2-dimethyl-5-(thiophen-2-yl)-1H-imidazol-4-amine (3.30A / 14a)

[0628] 3.29A / 13a (150 mg, 0.672 mmol, 1 equiv) was dissolved in MeOH (11 mL), after which SnCh (637 mg, 3.36 mmol, 5 equiv) was added. The faint yellow reaction mixture was heated to 65°C and stirred overnight. Upon LC-MS control, the reaction mixture was cooled to room temperature, reduced in vacuo and redissolved in a small amount of EtOAc. The pH of the solution was adjusted to pH = 7 using 5M aqueous NaOH and the reaction mixture was stirred for 2 h at room temperature. Additional EtOAc wasP7022PC00

[0629] added, and the solution was filtered through celite. The organic filtrate was then extracted with H2O (x3), washed with brine, dried over anhydrous Na2SO4and reduced in vacuo to yield the product as a brown solid that was used in the subsequent reaction without further purification (121 mg, 93% yield). Rf = 0.42 (9.5:0.5 DCM / MeOH + 1% TEA).1H NMR (400 MHz, Chloroform-d) 57.38 - 7.30 (m, 1H), 7.14 - 7.06 (m, 1H), 6.99 - 6.93 (m, 1H), 3.46 (s, 3H), 2.34 (s, 3H).13C NMR (101 MHz, Chloroform-d) 5 142.92, 141.81, 131.89, 127.67, 126.27, 125.41, 105.85, 31.45, 13.39. ESI-MS (m / z) calculated [M + H]+for C9H11N3S = 194.07, found = 194.1.

[0630] 1,2-dimethyl-4-(thiophen-2-yl)-1 H-imidazol-5-amine (3.30B / 14b)

[0631] 3.29B / 13b (45.0 mg, 0.202 mmol, 1 equiv) was dissolved in MeOH (4.5 mL), after which SnCh (191 mg, 1.01 mmol, 5 equiv) was added. The yellow reaction mixture was heated to 65°C and stirred overnight. Upon LC-MS control, the reaction mixture was cooled to room temperature, reduced in vacuo and redissolved in a small amount of EtOAc. The pH of the solution was adjusted to pH = 7 using 5M aqueous NaOH and the reaction mixture was stirred for 2 h at room temperature. Additional EtOAc was added, and the solution was filtered through celite. The organic filtrate was then extracted with H2O (x3), washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo to yield the product as a brown solid that was used in the subsequent reaction without further purification (22.0 mg, 56% yield). Rf = 0.61 (9:1 DCM / MeOH + 1% TEA).

[0632] 1H NMR (600 MHz, Chloroform-d) 57.18 (dd, J= 3.5, 1.2 Hz, 1H), 7.12 (dd, J= 5.1, 1.2 Hz, 1H), 7.02 (dd, J= 5.1, 3.5 Hz, 1H), 3.36 (s, 3H), 2.31 (s, 3H).13C NMR (151 MHz, Chloroform-d) 5 139.98, 138.20, 129.83, 127.48, 121.79, 120.54, 120.48, 29.03, 13.50. ESI-MS (m / z) calculated [M + H]+for C9H11N3S = 194.07, found = 194.1.

[0633] 4-chloro-N-(1,2-dimethyl-5-(thiophen-2-yl)-1H-imidazol-4-yl)benzamide (3.31A / 15a) Obtained from 3.30A / 14a (120 mg, 0.621 mmol) and 4-chlorobenzoyl chloride (111 pL, 0.869 mmol, 1.4 equiv) according to Method C. The reaction mixture was stirred overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. The reaction mixture was then reduced in vacuo and resuspended in EtOAc. The organic layer was extracted with 2M aqueous NaOH (x3), after which it was washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo. The crude product was purified by automated flash column chromatography (NP) using a gradient elution (DCM / MeOH) to yield the final product as a faint yellow solid (40.2 mg, 20% yield). Rf= 0.22 (7:3 EtOAc / heptane). Rt(HPLC) = 11.13 min (>99% pure).1H NMRP7022PC00

[0634] (600 MHz, DMSO-d6) 69.93 (br s, 1H), 7.92 (d, J= 8.1 Hz, 2H), 7.58 - 7.52 (m, 3H), 7.18 (d, J= 3.6 Hz, 1H), 7.11 (dd, J= 5.1, 3.6 Hz, 1H), 3.58 (s, 3H), 2.36 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 165.59, 142.92, 136.18, 133.27, 132.23, 130.08, 129.53, 128.38, 127.28, 126.38, 126.19, 119.65, 31.67, 13.15. ESI-MS (m / z) calculated [M + H]+for C16H14ClN3OS = 332.06, found = 332.1 and [M + H + 2]+334.1.

[0635] 4-chloro-N-(1,2-dimethyl-4-(thiophen-2-yl)-1H-imidazol-5-yl)benzamide (3.31B / 15b) Obtained from 3.30B / 14b (22.0 mg, 0.114 mmol) and 4-chlorobenzoyl chloride (20.4 pL, 0.159 mmol, 1.4 equiv) according to Method C. The reaction mixture was stirred overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. The reaction mixture was then reduced in vacuo and resuspended in EtOAc. The organic layer was extracted with 2M aqueous NaOH (x3), after which it was washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo. The crude product was purified by automated flash column chromatography (RP) using a gradient elution to yield the final product as an off-white solid (21.2 mg, 56% yield). Rf = 0.20 (7:3 EtOAc / heptane). Rt(HPLC) = 11.34 min (>98% pure).1H NMR (600 MHz, DMSO-d6) 6 10.30 (s, 1H), 8.10 - 8.04 (m, 2H), 7.69 - 7.63 (m, 2H), 7.30 (dd, J= 5.1, 1.2 Hz, 1H), 7.13 (dd, J= 3.6, 1.2 Hz, 1H), 6.99 (dd, J= 5.1, 3.6 Hz, 1H), 3.34 (s, 3H), 2.34 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6 165.96, 142.68, 137.37, 137.13, 131.92, 129.76, 128.78, 127.90, 127.34, 123.23, 121.21, 120.76, 29.40, 13.24. ESI-MS (m / z) calculated [M + H]+for C16H14CIN3OS = 332.06, found = 332.1 and [M + H + 2]+334.1.

[0636] 4-(tert-butyl)- 1 -methyl- 1 H-pyrrole-2-carbaldehyde (SMI-3)

[0637] In a flame-dried flask, dry DCM (35 mL) was cooled to 0°C using an ice bath.

[0638] Aluminum chloride (2.93 g, 22.0 mmol, 2 eq.) was added and pulverized using a pestle, upon which the flask was fitted with a rubber septum and purged with argon. To the well-stirred suspension, 1-methylpyrrole-2-carboxaldehyde (1.18 mL, 11.0 mmol, 1 eq.) and 2-chloro-2-methylpropane (2.40 mL, 22.0 mmol, 2 eq.) were added dropwise through the septum. The reaction mixture was stirred for 2 hours and monitored by TLC. The solvent was then removed by nitrogen flow and the crude was subjected to automated flash column chromatography (NP) using a gradient elution (DCM / heptane). The product was an oil (1.14 g, 64% yield). Rf = 0.86 (1:1 EtOAc / heptane).1H NMR (600 MHz, Chloroform-d) 59.38 (s, 1 H), 6.88 (d, J = 2.0 Hz, 1 H), 6.84 - 6.80 (m, 1 H), 3.91 (s, 3H), 1.25 (s, 9H).13C NMR (151 MHz, Chloroform-d) 5 179.90, 137.63, 130.95, 130.55, 122.89, 36.55, 31.62, 30.58. ESI-MS (m / z) calculated [M + H]+for C10H15NO =P7022PC00

[0639] 166.12, found = 166.1.

[0640] N-(tert-butyl)-2-(4-(tert-butyl)- 1 -methyl- 1H-pyrrol-2-yl)-6-methylimidazo[ 1, 2-a]pyridin-3-amine (SMI-8)

[0641] Obtained from SMI-3 (764 mg, 4.62 mmol), NH4CI (247 mg, 4.62 mmol), tert-butyl isocyanide (628 μL, 5.55 mmol) and 2-amino-5-methylpyridine (500 mg, 4.62 mmol) according to Method A. Upon addition and stirring with 2M aqueous NaOH, the reaction mixture was reduced in vacuo and the crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane). The product was an off-white solid (1.02 g, 78% yield).1H NMR (400 MHz, Methanol-^) 58.15 (m, 1H), 7.33 (d, J= 9.2 Hz, 1H), 7.12 (dd, J= 9.2, 1.9 Hz, 1H), 6.55 (d, J= 2.0 Hz, 1H), 6.27 (d, J = 2.0 Hz, 1 H), 3.64 (s, 3H), 2.36 (s, 3H), 1.25 (s, 9H), 0.96 (s, 9H).13C NMR (101 MHz, Methanol-d4) 5141.95, 136.03, 134.03, 128.95, 127.27, 126.83, 122.82, 122.61, 119.36, 116.38, 109.28, 55.94, 34.96, 32.37, 31.44, 30.26, 18.26. ESI-MS (m / z) calculated [M + H]+for C21H30N4 = 339.25, found = 339.3.

[0642] 2-(4-(tert-butyl)-1-methyl-1H-pyrrol-2-yl)-6-methylimidazo[1,2-a]pyridin-3-amine (SMI-9 or 3.11a / 2q)

[0643] SMI-8 (184 mg, 0.544 mmol, 1 eq.) was suspended in H2O (0.5 mL) and triisopropyl silane (0.5 mL) and the solution was stirred for 5 min. Trifluoroacetic acid (9 mL) was then added, after which the reaction mixture was stirred for 6 h. Upon completion monitored by LC-MS, the reaction mixture was reduced in vacuo and the crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane + 2.5% TEA). The product was a yellowish solid (145 mg, 95% yield). Rf= 0.35 (1:1 EtOAc / heptane + 2.5% TEA).1H NMR (400 MHz, Methanol-d4) 57.89 (m, 1H), 7.31 (d, J= 9.2 Hz, 1H), 7.03 (dd, J= 9.2, 1.6 Hz, 1H), 6.58 (d, J= 2.0 Hz, 1H), 6.22 (d, J = 2.0 Hz, 1H), 3.63 (s, 3H), 2.36 (s, 3H), 1.26 (s, 9H).13C NMR (101 MHz, Methanol-d4) 5140.20, 136.06, 127.78, 127.09, 126.62, 123.73, 122.81, 120.89, 119.83, 116.32, 108.20, 34.93, 32.37, 31.44, 18.27. ESI-MS (m / z) calculated [M + H]+for C17H22N4 = 283.19, found = 283.2.

[0644] N-(2-(4-(tert-butyl)- 1 -methyl- 1H-pyrrol-2-yl)-6-methylimidazo[ 1, 2-a]pyridin-3-yl)-4-chlorobenzamide (NNJ-96-2 or SMI-10 or4.29 / 3q)

[0645] Obtained from SMI-9 (50.0 mg, 0.177 mmol) and 4-chlorobenzoyl chloride (31.8 μL, 0.248 mmol, 1.4 eq.) according to Method C. The reaction mixture was stirredP7022PC00

[0646] overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. The reaction mixture was then reduced in vacuo and resuspended in EtOAc. The organic layer was extracted with 2M aqueous NaOH (x3), after which it was washed with brine, dried over anhydrous Na2SO4and reduced in vacuo. The crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane) to yield the final product as an off-white solid (38.1 mg, 51% yield). Rf= 0.48 (1:1 EtOAc / heptane). Rt(HPLC) = 13.98 min (>99% pure).1H NMR (600 MHz, DMSO-d6) 6 10.49 (s, 1H), 8.11 - 8.08 (m, 2H), 7.91 (m, 1H), 7.68 - 7.65 (m, 2H), 7.50 (d, J= 9.2 Hz, 1H), 7.14 (dd, J= 9.2, 1.8 Hz, 1H), 6.60 (d, J= 2.0 Hz, 1H), 6.29 (d, J = 2.0 Hz, 1H), 3.86 (s, 3H), 2.30 (s, 3H), 1.13 (s, 9H).13C NMR (151 MHz, DMSO-d6) 6 166.4, 141.2, 137.4, 134.1, 133.9, 132.9, 130.3, 129.1, 127.8, 125.1, 121.7, 121.5, 119.9, 116.5, 115.46, 107.5, 35.9, 32.1, 30.5, 18.1. ESI-MS (m / z) calculated [M + H]+for C24H25CIN4O = 421.18, found = 421.2 and [M + H + 2]+423.2.

[0647] 1 -ethyl- 1 H-pyrrole-2-carbaldehyde (IP-1 )

[0648] A solution of 1 / 7-pyrrole-2-carbaldehyde (520 mg, 5.47 mmol, 1 eq.) in 11.5 mL DMF was added dropwise to a suspension of NaH (284 mg, 7.11 mmol, 1.3 eq.). The solution was cooled to 0 °C and then bromoethane (735 pL, 9.84 mmol, 1.8 eq.) was added dropwise and the reaction mixture was stirred for 2 hours at 70 °C. Upon completion, the reaction mixture was cooled to rt, diluted with aqueous CaCh and extracted with EtOAc (x3). The combined organic layers were dried over anhydrous MgSO4 and reduced in vacuo. The white solid was used in the subsequent reaction without further purification (557 mg, 83% yield).1H NMR (400 MHz, Chloroform-d) 5 9.54 (s, 1 H), 7.00 - 6.95 (m, 1 H), 6.93 (dd, J = 4.0, 1.7 Hz, 1 H), 6.22 (dd, J = 4.0, 2.5 Hz, 1H), 4.36 (q, J = 7.2 Hz, 2H), 1.39 (t, J = 7.2 Hz, 3H).13C NMR (101 MHz, Chloroform-d) 5 179.03, 131.04, 130.28, 124.60, 109.42, 43.88, 16.54. ESI / MS (m / z) calculated [M + H]+for C7H9NO = 124.08, found 124.1.

[0649] N-(tert-butyl)-2-( 1 -ethyl- 1H-pyrrol-2-yl)-6-methylimidazo[ 1, 2-a]pyridine-3-amine (IP-2) Obtained from IP-1 (100 mg, 0.812 mmol), NH4CI (43.4 mg, 0.812 mmol), tert-butyl isocyanide (220 pL, 1.95 mmol) and 2-amino-5-methylpyridine (176 mg, 1.62 mmol) according to Method A. The reaction mixture was refluxed for 2 days. After addition and stirring with 2M aqueous NaOH, the reaction mixture was reduced in vacuo and the crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane). The product was an off-white and fluffy solid (90.0P7022PC00

[0650] mg, 37% yield).1H NMR (400 MHz, Methanol-d4) 68.22 - 8.17 (m, 1H), 7.37 (d, J= 9.0 Hz, 1H), 7.16 (dd, J= 9.0, 1.9 Hz, 1H), 6.91 - 6.85 (m, 1H), 6.36 -6.29 (m, 1H), 6.17 (t, J = 3.2 Hz, 1 H), 4.20 (q, J = 7.3 Hz, 2H), 2.40 (s, 3H), 1.36 - 1.27 (q, J = 7.3 Hz, 3H), 1.01 (s, 9H).13C NMR (101 MHz, Methanol-d4) 6 144.60, 136.37, 131.56, 129.46, 129.37, 125.38, 125.20, 124.62, 118.95, 113.87, 111.19, 58.61, 45.66, 32.80, 20.79, 19.57. ESI / MS (m / z) calculated [M + H]+for C18H24N4= 297.21, found 297.3.

[0651] 2-( 1 -ethyl- 1H-pyrrol-2-yl)-6-methylimidazo[ 1, 2-a]pyridine-3-amine (IP-4)

[0652] IP-2 (200 mg, 0.672 mmol, 1 eq.) was suspended in H2O (0.5 mL) and triisopropyl silane (0.5 mL) and the solution was stirred for 5 min. Trifluoroacetic acid (9 mL) was then added, after which the reaction mixture was stirred for 3 h. Upon completion monitored by LC-MS, the dark orange crude was reduced in vacuo and purified by automated flash column chromatography (RP) using a gradient elution. The product was a yellow solid (60.0 mg, 37% yield).1H NMR (400 MHz, Methanol-d4) 58.41 - 8.36 (m, 1H), 7.75 (dd, J= 9.2, 1.5 Hz, 1H), 7.68 (dd, J= 9.2, 1.0 Hz, 1H), 7.10 - 7.05 (m, 1H), 6.51 -6.44 (m, 1H), 6.36 -6.28 (m, 1H), 4.02 (q, J= 7.3 Hz, 2H), 2.54 (s, 3H), 1.31 (t, J= 7.3 Hz, 3H). ESI / MS (m / z) calculated [M + H]+for C14H16N4= 241.14, found 241.1.

[0653] 4-chloro-N-(2-( 1 -ethyl- 1H-pyrrol-2-yl)-6-methylimidazo[ 1, 2-a]pyridine-3-yl)benzamide (IP-6)

[0654] Obtained from IP-4 (60.0 mg, 0.250 mmol) and 4-chlorobenzoyl chloride (45.0 pL, 0.350 mmol) according to Method C. The reaction mixture was stirred for 3 hours, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. EtOAc was added and the organic layer was extracted with H2O, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo. The crude was purified by automated flash column chromatography (NP) using a gradient solution (EtOAc / heptane). The final product was a slightly pink solid (17.0 mg, 18% yield). Rf = 0.38 (1:1 EtOAc / heptane). Rt(HPLC) = 12.32 min (>99% pure).1H NMR (400 MHz, DMSO-d6) 6 10.50 (s, 1H), 8.15- 8.07 (m, 2H), 7.93 (s, 1H), 7.71 - 7.63 (m, 2H), 7.52 (d, J= 9.2 Hz, 1H), 7.17 (dd, J= 9.2, 1.7 Hz, 1H), 6.92 - 6.86 (m, 1H), 6.33 -6.27 (m, 1H), 6.06 -6.00 (m, 1H), 4.45 (q, J= 7.1 Hz, 2H), 2.31 (s, 3H), 1.29 (t, J= 7.1 Hz, 3H).

[0655] 13C NMR (101 MHz, DMSO-d6) 6 166.12, 141.31, 137.56, 133.99, 132.36, 130.42, 129.15, 128.02, 124.61, 122.89, 121.93, 121.40, 116.58, 115.12, 109.52, 108.04, 42.74, 18.03, 17.62. ESI / MS (m / z) calculated [M + H]+for C21H19ClN4O = 379.13, foundP7022PC00

[0656] 379.1 and [M + H + 2]+381.1.

[0657] 1 -propyl- 1 H-pyrrole-2-carbaldehyde (IP-8)

[0658] A solution of 1 H-pyrrole-2-carbaldehyde (300 mg, 3.15 mmol, 1 eq.) in DMF (6.525 mL) was added dropwise to a suspension of NaH (164 mg, 4.10 mmol, 1.3 eq.). The solution was cooled to 0 °C and then bromoethane (5.17 pL, 5.68 mmol, 1.8 eq.) was added dropwise and the reaction mixture was stirred for 2 hours at 70 °C. Upon completion, the reaction mixture was cooled to rt, diluted with aqueous CaCh and extracted with EtOAc (x3). The combined organic layers were dried over anhydrous MgSC>4 and reduced in vacuo. The white solid was used in the subsequent reaction without further purification (238.0 mg, 55% yield).1H NMR (400 MHz, Chloroform-d) 5 9.53 (s, 1 H), 6.95 - 6.91 (m, 2H), 6.21 (dd, J = 4.0, 2.4 Hz, 1 H), 4.30 - 4.25 (m, 2H), 1.78 (h, J= 7.4 Hz, 2H), 0.90 (t, J= 7.4 Hz, 3H).13C NMR (101 MHz, Chloroform-d) 5 179.26, 131.39, 131.29, 124.75, 109.38, 50.66, 24.57, 10.94. ESI / MS (m / z) calculated [M + H]+for C8H11NO = 138.09, found 138.1.

[0659] N-(tert-butyl)-2-( 1 -propyl- 1 H-pyrrol-2-yl)imidazo[ 1, 2-a]pyridin-3-amine (IP-9) Obtained from IP-8 (230 mg, 1.68 mmol), NH4CI (135 mg, 2.51 mmol), tert-butyl isocyanide (455 pL, 4.02 mmol) and 2-amino-5-methylpyridine (363 mg, 3.35mmol) according to Method A. The reaction mixture was refluxed for 2 days. After addition and stirring with 2M aqueous NaOH, the reaction mixture was reduced in vacuo and the crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane). The product was an off white and fluffy solid (300 mg, 58% yield).1H NMR (400 MHz, Methanol-d4) 68.22 -8.17 (m, 1H), 7.38 (d, J= 9.2 Hz, 1H), 7.17 (dd, J= 9.2, 1.8 Hz, 1H), 6.85 (dd, J= 2.8, 1.8 Hz, 1H), 6.36 (dd, J= 3.6, 1.8 Hz, 1 H), 6.16 (dd, J = 3.6, 2.8 Hz, 1 H), 4.20 - 4.11 (m, 2H), 2.41 (s, 3H), 1.69 (h, J = 7.4 Hz, 2H), 1.02 (s, 9H), 0.85 (t, J= 7.4 Hz, 3H). ESI / MS (m / z) calculated [M + H]+for C19H26N4= 311.22, found 311.2.

[0660] 6-methyl-2-( 1 -propyl- 1 H-pyrrol-2-yl)imidazo[ 1, 2-a]pyridin-3-amine (IP-10)

[0661] IP-9 (300 mg, 0.966 mmol, 1 eq.) was suspended in H2O (697 pL, 38.7 mmol) and triisopropyl silane (1.78 mL, 8.70 mmol) and the solution was stirred for 5 min.

[0662] Trifluoroacetic acid (12.3 mL) was then added, after which the reaction mixture was stirred for 3h. Upon completion monitored by LC-MS, the dark orange crude was purified by automated flash column chromatography (RP) using a gradient elution. TheP7022PC00

[0663] product was a yellow solid (70.1 mg, 28% yield).1H NMR (600 MHz, Methanol-^) 6 8.40 - 8.36 (m, 1 H), 7.75 (dd, J = 9.2, 1.6 Hz, 1 H), 7.68 (dd, J = 9.2, 1.0 Hz, 1 H), 7.05 (dd, J= 2.8, 1.7 Hz, 1H), 6.47 (dd, J= 3.7, 1.7 Hz, 1H), 6.31 (dd, J= 3.7, 2.8 Hz, 1H), 3.99 - 3.94 (m, 2H), 2.57 - 2.52 (m, 3H), 1.65 (h, J = 7.4 Hz, 2H), 0.79 (t, J = 7.4 Hz, 3H).13C NMR (151 MHz, Methanol-d4) 6 134.26, 133.99, 129.29, 126.79, 124.24, 121.65, 117.25, 112.81, 110.41, 109.76, 108.41, 49.03, 24.32, 16.74, 9.90. ESI / MS (m / z) calculated [M + H]+for CisHi8N4= 255.16, found 255.2.

[0664] 4-chloro-N-(6-methyl-2-( 1 -propyl- 1 H-pyrrol-2-yl)imidazo[ 1, 2-a]pyridin-3-yl)benzamide (IP-12)

[0665] Obtained from IP-10 (65 mg, 0.25 mmol) and 4-chlorobenzoyl chloride (46 pL, 0.36 mmol) according to Method C. The reaction mixture was stirred for 3 hours, after which 1mL of H2O was added and the mixture was subsequently stirred for 30 min. EtOAc was added and the organic layer was extracted with H2O, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo. The crude was purified by automated flash column chromatography (NP) using a gradient solution (EtOAc / heptane). The final product was a slightly pink solid (83.0 mg, 83% yield). Rf = 0.38 (1:1 EtOAc / heptane). Rt (HPLC) = 10.87 min (>98% pure).1H NMR (600 MHz, DMSO-d6) 5 10.73 (s, 1H), 8.29 - 8.18 (m, 1H), 8.10 - 8.08 (m, 2H), 7.72 - 7.66 (m, 3H), 7.55 - 7.47 (m, 1H), 7.00 - 6.97 (m, 1H), 6.43 -6.39 (m, 1H), 6.11 (m, 1H), 4.20 - 4.14 (m, 2H), 2.37 (s, 3H), 1.61 (h, J= 7.4 Hz, 2H), 0.73 (t, J= 7.4 Hz, 3H). ESI / MS (m / z) calculated [M + H]+for C22H2ICIN4O = 393.15, found 393.2 and [M + H + 2]+395.2.

[0666] 4-methoxy-N-(6-methyl-2-(1-methyl-1H-pyrrol-2-yl)imidazo[1,2-a]pyridin-3-yl)benzamide (IP-11)

[0667] Obtained from 3.11 / 2e (50.0 mg, 0.220 mmol) and 4-methoxybenzoyl chloride (42.1 pL, 0.311 mmol, 1.4 eq.) according to Method C. The reaction mixture was stirred for 1 h, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. The reaction mixture was diluted with water and extracted with EtOAc (x3). The combined organic layers were washed with brine, dried over anhydrous Na2SO4and reduced in vacuo. The crude was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane). The product was an off-white solid (15.2 mg, 19% yield). Rf= 0.31 (2:3 EtOAc / heptane). Rt(HPLC) = 10.97 min (>98% pure).1H NMR (600 MHz, DMSO-d6) 5 10.25 (s, 1H), 8.09- 8.04 (m, 2H), 7.86- 7.83 (m, 1H), 7.51 (dd, J= 9.1, 1.0 Hz, 1H), 7.15 (dd, J= 9.1, 1.7 Hz, 1H), 7.13- 7.07 (m,P7022PC00

[0668] 2H), 6.83 -6.79 (m, 1H), 6.31 (dd, J= 3.7, 1.8 Hz, 1H), 6.00 (dd, J= 3.7, 2.6 Hz, 1H), 3.93 (s, 3H), 3.86 (s, 3H), 2.29 (s, 3H). ESI / MS (m / z) calculated [M + H]+for ESI / MS (m / z) calculated [M + H]+for C21H20N4O = 361.17, found 361.3.

[0669] N-(6-methyl-2-(1-methyl-1H-pyrrol-2-yl)imidazo[1!2-a]pyridin-3-yl)benzamide (IP-21) Obtained from 3.11 / 2e (154 mg, 0.678 mmol) and benzoyl chloride (110 pL, 0.949 mmol, 1.4 eq.) according to Method C. The reaction mixture was stirred for 2.5 h, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. The reaction mixture was diluted with water and extracted with EtOAc (x3). The combined organic layers were washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo. The crude was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane). The product was a white solid (45.3 mg, 20% yield). Rt(HPLC) = 9.32 min (>95% pure).1H NMR (600 MHz, DMSO) 5 10.72 (s, 1 H), 8.29 (s, 1 H), 8.08 (d, J = 7.8 Hz, 2H), 7.75 (d, J = 9.2 Hz, 1 H), 7.71 - 7.65 (m, 1H), 7.62 - 7.57 (m, 3H), 6.97 (s, 1H), 6.44 (m, 1H), 6.13 (m, 1H), 3.80 (s, 3H), 2.39 (s, 3H).13C NMR (151 MHz, DMSO-d6) 5 167.03, 138.30, 132.55, 132.50, 128.60, 128.13, 125.73, 124.82, 122.33, 121.08, 120.89, 117.42, 116.37, 113.65, 111.38, 108.07, 35.19, 17.43. ESI / MS (m / z) calculated [M + H]+for C2oHi8N40 = 331.16, found 331.3.

[0670] N-(6-methyl-2-(1-methyl-1H-pyrrol-2-yl)imidazo[1,2-a]pyridin-3-yl)adamantane-1-carboxamide (IP-22)

[0671] Obtained from 3.11 / 2e (154 mg, 0.678 mmol) and 1 -adamantanecarbonyl chloride (188 mg, 0.949 mmol, 1.4 eq.) according to Method C. The reaction mixture was stirred overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. The reaction mixture was diluted with water and extracted with EtOAc (x3). The combined organic layers were washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo. The crude was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane). The product was an off-white solid (55.2 mg, 21% yield). Rt(HPLC) = 13.11 min (>95% pure).1H NMR (600 MHz, DMSO-d6) 59.51 (s, 1 H), 7.63 - 7.51 (m, 2H), 7.30 - 7.21 (m, 1 H), 6.88 - 6.84 (m, 1H), 6.32 (dd, J= 3.7, 1.8 Hz, 1H), 6.11 -6.06 (m, 1H), 3.88 (s, 3H), 2.34 (s, 3H), 2.07 - 1.99 (m, 9H), 1.78 - 1.69 (m, 6H). ESI / MS (m / z) calculated [M + H]+for C24H28N4O = 389.23, found 389.3.P7022PC00

[0672] N-(6-bromo-2-(1-methyl-1H-pyrrol-2-yl)imidazo[1,2-a]pyridin-3-yl)-4-chlorobenzamide (IP-26)

[0673] Obtained from IP-18 (50.0 mg, 0.171 mmol) and 4-chlorobenzoyl chloride (30.6 pL, 0.239 mmol, 1.4 eq.) according to Method C. The reaction mixture was stirred overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. The reaction mixture was diluted with water and extracted with EtOAc (x3). The combined organic layers were washed with brine, dried over anhydrous Na2SO4 and reduced in vacuo. The crude was purified by automated flash column chromatography (RP) using a gradient elution. The product was a white solid (30.8 mg, 42% yield). Rt(HPLC) = 12.52 min (>99% pure).1H NMR (600 MHz, DMSO-d6) 6 10.58 (s, 1H), 8.53 (dd, J= 1.9, 0.9 Hz, 1H), 8.12 - 8.07 (m, 2H), 7.69 - 7.64 (m, 2H), 7.60 (dd, J = 9.4, 0.9 Hz, 1 H), 7.42 (dd, J = 9.4, 1.9 Hz, 1 H), 6.88 - 6.84 (m, 1 H), 6.36 (dd, J= 3.7, 1.8 Hz, 1H), 6.03 (dd, J= 3.7, 2.6 Hz, 1H), 3.94 (s, 3H).13C NMR (151 MHz, DMSO-d6) 5 166.23, 140.68, 137.57, 134.87, 132.33, 130.54, 129.07, 128.11, 125.28, 124.82, 124.25, 118.18, 116.00, 110.16, 108.03, 106.72, 36.34.

[0674] ESI / MS (m / z) calculated [M + H]+for Ci9Hi4BrCIN4O = 429.01, found = 429.0, [M + H + 2]+431.0 and [M + H + 4]+433.0.

[0675] 6-bromo-2-(1-methyl-1H-pyrrol-2-yl)imidazo[1,2-a]pyridin-3-amine (IP-18)

[0676] IP-17 (200 mg, 0.576 mmol, 1 eq.) was suspended in H2O (0.5 mL) and triisopropyl silane (1 mL) and the solution was stirred for 5 min. Trifluoroacetic acid (8 mL) was then added, after which the reaction mixture was stirred for 2.5 h. Upon completion monitored by LC-MS, the crude was directly purified by automated flash column chromatography (RP) using a gradient elution. The product was a yellow solid (45.7 mg, 27% yield).1H NMR (600 MHz, Methanol-d4) 58.81 - 8.78 (m, 1H), 7.88 (dd, J = 9.5, 1.7 Hz, 1 H), 7.69 (d, J = 9.5 Hz, 1 H), 6.99 - 6.95 (m, 1 H), 6.48 (dd, J = 3.7, 1.7 Hz, 1H), 6.31 -6.24 (m, 1H), 3.69 (s, 3H).13C NMR (151 MHz, Methanol-d4) 5 134.04, 133.35, 129.58, 125.56, 124.21, 118.03, 112.61, 112.26, 111.14, 110.17, 108.47, 33.55. ESI / MS (m / z) calculated [M + H]+for Ci2HnBrN4= 291.02, found = 291.0 and [M + H + 2]+293.0.

[0677] 6-bromo-N-(tert-butyl)-2-(1-methyl-1H-pyrrol-2-yl)imidazo[1,2-a]pyridin-3-amine (IP-17) Obtained from 1-methylpyrrole-2-carboxaldehyde (492 pL, 4.58 mmol), NH4CI (245 mg, 4.58 mmol), tert-butyl isocyanide (622 mL, 5.50 mmol) and 2-amino-5-bromopyridine (793 mg, 4.58 mmol) according to Method A. The reaction mixture was refluxedP7022PC00

[0678] overnight, after which additional tert-butyl isocyanide (0.3 eq.) and 2-amino-5-bromopyridine (0.3 eq.) were added and the reaction mixture was stirred for another day. Upon addition and stirring with 2M aqueous NaOH, the reaction mixture was reduced in vacuo and the crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane). The product was a white solid (1.42 g, 89% yield).1H NMR (600 MHz, Methanol-d4) 68.52 (dd, J= 1.9, 0.9 Hz, 1H), 7.40 (dd, J= 9.4, 0.9 Hz, 1H), 7.35 (dd, J= 9.4, 1.9 Hz, 1H), 6.80 (dd, J= 2.7, 1.7 Hz, 1H), 6.35 (dd, J= 3.6, 1.7 Hz, 1H), 6.13 (dd, J= 3.6, 2.7 Hz, 1H), 3.73 (s, 3H), 0.97 (s, 9H).13C NMR (151 MHz, Methanol-d4) 6141.31, 134.98, 129.17, 127.59, 127.09, 125.23, 124.57, 118.02, 111.75, 108.61, 107.63, 56.15, 35.19, 30.19. ESI / MS (m / z) calculated [M + H]+for Ci6Hi9BrN4= 347.09, found = 347.2 and [M + H + 2]+349.2.

[0679] 4-chloro-N-(2-( 1 -methyl- 1 H-pyrrol-2-yl)imidazo[ 1, 2-a]pyridin-3-yl)benzamide (IP-27) Obtained from IP-20 (200 mg, 0.938 mmol) and 4-chlorobenzoyl chloride (168 pL, 1.31 mmol, 1.4 eq.) according to Method C. The reaction mixture was stirred overnight, after which 1 mL of H2O was added and the mixture was subsequently stirred for 30 min. The reaction mixture was diluted with water and extracted with EtOAc (x3). The combined organic layers were washed with brine, dried over anhydrous Na2SO4and reduced in vacuo. The crude was purified by automated flash column chromatography (RP) using a gradient elution. The product was a white solid (33.0 mg, 10% yield). Rt(HPLC) = 11.39 min (>98% pure).1H NMR (600 MHz, DMSO-d6) 6 10.56 (s, 1H), 8.12 - 8.06 (m, 3H), 7.69-7.64 (m, 2H), 7.61 (dt, J= 9.1, 1.1 Hz, 1H), 7.31 (ddd, J= 9.1, 6.7, 1.3 Hz, 1H), 6.94 (td, = 6.7, 1.1 Hz, 1H), 6.84 (dd, J= 2.6, 1.8 Hz, 1H), 6.34 (dd, J= 3.7, 1.8 Hz, 1H), 6.03 (dd, J= 3.7, 2.6 Hz, 1H), 3.94 (s, 3H).13C NMR (151 MHz, DMSO-d6) 6165.66, 141.72, 137.12, 133.53, 131.80, 129.88, 128.71, 124.82, 124.68, 124.41, 123.64, 116.61, 114.90, 112.10, 109.30, 107.44, 35.77. ESI / MS (m / z) calculated [M + H]+for CI9HI5CIN4O = 351.10, found = 351.1 and [M + H + 2]+353.1.

[0680] 2-( 1-methyl-1H-pyrrol-2-yl)imidazo[ 1,2-a]pyridin-3-amine (IP-20)

[0681] IP-19 (500 mg, 1.86 mmol, 1 eq.) was suspended in H2O (1.5 mL) and triisopropyl silane (3.5 mL) and the solution was stirred for 5 min. Trifluoroacetic acid (24 mL) was then added, after which the reaction mixture was stirred for 3h. Upon completion monitored by LC-MS, the brown crude was directly purified by automated flash column chromatography (RP) using a gradient elution. The product was a brown solid (210 mg,P7022PC00

[0682] 53% yield).1H NMR (600 MHz, Methanol-d4) 68.56 (dt, J = 6.9, 1.1 Hz, 1H), 7.84 (ddd, J= 9.1, 7.0, 1.1 Hz, 1H), 7.76 (dt, J= 9.1, 1.1 Hz, 1H), 7.46 (td, = 6.9, 1.1 Hz, 1H), 6.97 (dd, J= 2.7, 1.7 Hz, 1H), 6.49 (dd, J= 3.7, 1.7 Hz, 1H), 6.27 (dd, J= 3.7, 2.7 Hz, 1H), 3.69 (s, 3H).13C NMR (151 MHz, Methanol-d4) 6 136.89, 132.66, 130.79, 128.36, 126.87, 125.46, 119.38, 117.39, 114.01, 112.52, 109.84, 34.93. ESI / MS (m / z) calculated [M + H]+for CI2HI2N4= 213.11, found 213.2.

[0683] N-(tert-butyl)-2-(1 -methyl-1 H-pyrrol-2-yl)imidazo[1,2-a]pyridin-3-amine (IP-19) Obtained from 1-methylpyrrole-2-carboxaldehyde (492 pL, 4.58 mmol), NH4CI (245 mg, 4.58 mmol), tert-butyl isocyanide (622 pL, 5.50 mmol) and 2-aminopyridine (431 mg, 4.58 mmol) according to Method A. The reaction mixture was refluxed overnight. After addition and stirring with 2M aqueous NaOH, the reaction mixture was reduced in vacuo and the crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane). The product was an off-white solid (872 mg, 71% yield).1H NMR (600 MHz, Methanol-d4) 58.40 (dt, J= 6.9, 1.2 Hz, 1H), 7.44 (dt, J= 9.0, 1.1 Hz, 1H), 7.26 (ddd, J= 9.0, 6.7, 1.3 Hz, 1H), 6.92 (td, J= 6.8, 1.2 Hz, 1H), 6.78 (dd, J= 2.7, 1.8 Hz, 1H), 6.32 (dd, J= 3.6, 1.8 Hz, 1H), 6.12 (dd, J= 3.6, 2.7 Hz, 1H), 3.72 (s, 3H), 0.96 (s, 9H).13C NMR (151 MHz, Methanol-d4) 5 142.99, 133.80, 127.56, 127.26, 126.11, 125.17, 124.26, 116.97, 112.88, 111.42, 108.51, 56.01, 35.13, 30.17. ESI / MS (m / z) calculated [M + H]+for CI6H20N4= 269.18, found 269.3.

[0684] N-(tert-butyl)-6-methyl-2-(m-tolyl)imidazo[ 1, 2-a]pyridin-3-amine (IA-79)

[0685] Obtained from 3-methylbenzaldehyde (545 pL, 4.62 mmol), NH4CI (247 mg, 4.62 mmol), tert-butyl isocyanide (1.05 mL, 9.24 mmol) and 5-methylpyridin-2-amine (999 mg, 9.24 mmol) according to Method A. The reaction mixture was refluxed overnight and subsequent addition of 1M aqueous HCI and stirring for 20 minutes occurred. 2M aqueous NaOH was added carefully to the mixture until it reached basic pH. The mixture was dissolved in watertoluene and the aqueous phase was extracted with toluene (x3). The combined organic layers were dried over anhydrous Na2SO4and reduced in vacuo and the crude product was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane). The product was a pale pink solid (1.32 g, 97% yield).1H NMR (400 MHz, Methanol-d4) 58.17 (m, 1H), 7.78 (m, 1H), 7.74 - 7.68 (m, 1H), 7.36 (dd, J= 9.1, 1.0 Hz, 1H), 7.29 (t, J= 7.6 Hz, 1H), 7.16 - 7.10 (m, 2H), 2.40 (s, 3H), 2.36 (d, J= 1.2 Hz, 3H), 0.99 (s, 9H).13C NMR (101 MHz, Methanol-d4) 5 142.20, 140.49, 140.13, 138.87, 136.26, 130.08, 129.13,P7022PC00

[0686] 126.63, 125.35, 122.80, 122.77, 116.43, 56.87, 30.63, 21.52, 18.27. ESI / MS (m / z) calculated [M + H]+for C19H23N3 = 294.20, found = 294.2

[0687] 6-methyl-2-(m-tolyl)imidazo[ 1,2-a]pyridin-3-amine (IA-81)

[0688] IA-79 (1.30 g, 4.43 mmol, 1 eq.) was suspended in 5M aqueous HBr (20mL). The reaction mixture was stirred under reflux conditions for 4 hours. Upon completion monitored by LC-MS and slow addition of 5M aqueous NaOH solution until pH 13-14, precipitation occurred and the product was obtained by filtration. The product was a yellow solid (1.03 g, 98% yield).1H NMR (400 MHz, Methanol-d4) 57.92 (s, 1H), 7.71 (s, 1H), 7.66 (d, J= 7.8 Hz, 1H), 7.29 (m, 2H), 7.08 (d, J= 7.5 Hz, 1H), 7.00 (d, J= 9.2 Hz, 1H), 2.39 (s, 3H), 2.32 (s, 3H).13C NMR (101 MHz, Methanol-d4) 5 140.65, 139.24, 135.59, 130.70, 129.49, 128.68, 128.49, 127.59, 126.31, 125.19, 122.83, 120.98, 116.30, 21.61, 18.30. ESI / MS (m / z) calculated [M + H]+for Ci4Hi5N3= 238.13, found 238.2.

[0689] 4-chloro-N-(6-methyl-2-(m-tolyl)imidazo[1,2-a]pyridin-3-yl)benzamide (IA-83) Obtained from IA-81 (400 mg, 1.69 mmol) and 4-chlorobenzoyl chloride (303 pL, 2.36 mmol) according to Method C. The reaction mixture was stirred for 5 hours, after which 2 mL of H2O was added and the mixture was subsequently stirred for 30 min. EtOAc was added and the organic layer was extracted with H2O, washed with brine, dried over anhydrous Na2SO4and reduced in vacuo. The crude was purified by automated flash column chromatography (RP) using a gradient elution (H2O: MeCN: TFA 95:5:1 I H2O: MeCN: TFA 5:95:1). The final product was a white solid (144 mg, 23% yield). Rf = 0.72 (EtOAc). Rt(HPLC) = 12.84 min (>99% pure).

[0690] 1H NMR (600 MHz, DMSO-d6) 5 11.01 (s, 1H), 8.43 (s, 1H), 8.15- 8.12 (m, 2H), 7.82 (d, J= 9.1 Hz, 1H), 7.74 (m, 1H), 7.73- 7.70 (m, 2H), 7.69 - 7.66 (m, 2H), 7.41 (t, J = 7.7 Hz, 1H), 7.28 (d, J= 7.5 Hz, 1H), 2.40 (s, 3H), 2.35 (s, 3H).13C NMR (151 MHz, DMSO-d6) 5 166.67, 158.64 (q,2JFC = 33.77 Hz), 138.80, 138.65, 138.07, 134.12, 133.16, 131.77, 130.62, 130.53, 129.50, 129.28, 129.10, 128.07, 126.00, 124.58, 123.14, 116.99 (q,1JFc = 295.22 Hz), 116.53, 113.82, 21.53, 17.92.19F NMR (376 MHz, DMSO-c / 6) 5 -74.19. ESI / MS (m / z) calculated [M + H]+for C22H18CIN3O = 376.12, found 376.1.

[0691] N-(tert-butyl)-6-methyl-2-( 1 -methyl- 1 H-pyrrol-2-yl)imidazo[ 1, 2-a]pyridin-3-amine (IA-90) Obtained from 1-methyl-1H-pyrrole-2-carbaldehyde (984 pL, 9.16 mmol), NH4CI (490P7022PC00

[0692] mg, 9.16 mmol), tert-butyl isocyanide (2.07 mL, 18.3 mmol, 2eq.) and 5-methylpyridin-2-amine (1.98 g, 18.3 mmol) according to Method A. The reaction mixture was refluxed overnight and the reaction mixture was reduced in vacuo. The crude mixture was purified by automated flash column chromatography (NP) using a gradient elution (EtOAc / heptane). The product was a white solid (2.28 g, 88% yield).1H NMR (400 MHz, Methanol-d4) 57.79 - 7.74 (m, 1H), 6.95 (d, J= 9.1 Hz, 1H), 6.73 (dd, J= 9.1, 1.8 Hz, 1H), 6.37 (dd, J= 2.7, 1.8 Hz, 1H), 5.89 (dd, J= 3.6, 1.7 Hz, 1H), 5.71 (dd, J = 3.6, 2.7 Hz, 1H), 3.31 (s, 3H), 1.96 (d, J= 1.2 Hz, 3H), 0.56 (s, 9H).13C NMR (101 MHz, Methanol-d4) 5 142.03, 133.67, 129.06, 127.72, 127.00, 124.12, 122.86, 122.67, 116.42, 111.27, 108.47, 55.99, 35.11, 30.18, 18.26. ESI / MS (m / z) calculated [M + H]+for C17H22N4 = 283.19, found = 283.3

[0693] 6-methyl-2-(1-methyl-1H-pyrrol-2-yl)imidazo[1,2-a]pyridin-3-amine (IA-91)

[0694] IA-91 (1500 mg, 5.312 mmol, 1 eq.) was suspended in H2O (4 mL) and triisopropyl silane (9.8 mL) and the solution was stirred for 5 min. Trifluoroacetic acid (68 mL) was then added, after which the reaction mixture was stirred for 3 h. Upon completion monitored by LC-MS, the crude was directly purified by automated flash column chromatography (RP) using a gradient elution (H2O: MeCN: TFA 95:5:1 / H2O: MeCN: TFA 5:95:1). The product was a pale green solid (508 mg, 42% yield).1H NMR (400 MHz, Methanol-d4) 58.36 (m, 1 H), 7.71 (dd, J = 9.3, 1.5 Hz, 1 H), 7.66 (d, J = 9.3 Hz, 1 H), 6.98 - 6.92 (m, 1 H), 6.46 (dd, J = 3.7, 1.7 Hz, 1 H), 6.25 (dd, J = 3.7, 2.7 Hz, 1 H), 3.68 (s, 3H), 2.51 (d, J= 1.2 Hz, 3H).13C NMR (101 MHz, Methanol-d4) 5 135.79, 135.27, 130.41, 128.11, 126.74, 123.03, 119.59, 113.85, 111.86, 111.65, 109.77, 34.92, 18.14. ESI / MS (m / z) calculated [M + H]+for C13H14N4 = 227.13, found = 227.3.

[0695] N-(6-methyl-2-(1-methyl-1H-pyrrol-2-yl)imidazo[1,2-a]pyridin-3-yl)spiro[3.3]heptane-2-carboxamide (IA-95)

[0696] To obtain the corresponding acyl chloride, spiro[3.3]heptane-2-carboxylic acid (130 mg, 0.928 mmol) and oxalyl chloride (99pL, 1.1 mmol) were added together with dry toluene in a microwave vial equipped with a magnetic stirrer under dry inert conditions and stirred for 2 h in room temperature. Upon completion of acyl chloride formation, the reaction mixture was purged with nitrogen until dryness and IA-91 (150mg, 0.663mmol), anhydrous pyridine (1.61mL, 19.9mmol) and anhydrous toluene (3mL) were added. The reaction mixture was stirred overnight, after which 2 mL of H2O was added and the mixture was subsequently stirred for 30 min. EtOAc was added and theP7022PC00

[0697] organic layer was extracted with H2O, washed with aqueous 1M NaOH solution, dried over anhydrous Na2SO4and reduced in vacuo. The crude was purified by automated flash column chromatography (RP) using a gradient elution (H2O: MeCN: TFA 95:5:1 1 H2O: MeCN: TFA 5:95:1) and additionally preparative HPLC (RP). The final product was a white solid (73 mg, 32% yield). Rf = 0.69 (EtOAc). Rt(HPLC) = 11.79 min (>98% pure).1H NMR (600 MHz, Methanol-d4) b 8.23 - 8.18 (m, 1H), 7.88 (dd, J= 9.1, 1.6 Hz, 1H), 7.80 (d, J= 9.1 Hz, 1H), 7.02 -6.97 (m, 1H), 6.49 (dd, J= 3.8, 1.7 Hz, 1H), 6.30 - 6.21 (m, 1H), 3.69 (s, 3H), 3.29 (m, 1H), 2.51 (s, 3H), 2.35-2.27 (m, 4H), 2.12 (t, J= 7.5 Hz, 2H), 1.95 (t, J= 7.5 Hz, 2H), 1.88 - 1.81 (m, 2H).13C NMR (151 MHz, Methanol-cM) 5 178.99, 138.30, 137.61, 129.47, 128.05, 125.42, 124.43, 119.26, 118.62, 114.89, 112.50, 110.06, 41.34, 38.72, 36.06, 35.42, 35.17, 35.16, 18.02, 16.95. ESI / MS (m / z) calculated [M + H]+for C21H24N4O = 349.20, found 349.3.

[0698] Example 2: pharmacology

[0699] Cell culturing and transient transfection

[0700] Cells were maintained and transfected as previously described (Falk-Petersen et al. 2021; Falk-Petersen et al. 2017, Falk-Petersen et al. 2020). In brief, HEK293 cells were maintained in DM EM containing GlutaMAX-l, supplemented with 10% FBS and 1% penicillin-streptomycin and incubated at 37 °C and a humidity of 5% CO2. To ensure incorporation of the GABAAR b-subunit, a previously validated HEK293 Flp-ln™ cell line stably expressing the human b-subunit (referred to as b-HEK) (Falk-Petersen et al.

[0701] 2017) was used, while y2-containing GABAAR subtypes were expressed in a background HEK293 Flp-ln™ cell line stably expressing the G-protein coupled peptide receptor NPBWR2 (referred to as HEK background). 200 pg / mL hygromycin B was used for positive selection for all stable cell lines.

[0702] To express recombinant GABAARS, plasmids containing human 01 / 4-, P1 / 2- and Y2-subunit cDNA were transiently transfected into b-HEK or HEK background cells. Cells used for whole-cell patch-clamp recordings were co-transfected with green fluorescent protein (GFP) in order to identify successfully transfected cells, cu- and Pi-subunits were transfected into b-HEK cells in a 1:1 ratio for FMP and 0.5:1:1 (GFP:a4: Pi) for whole-cell patch-clamp recordings. HEK background cells were transfected with 01 / 4-, P1 / 2- and Y2-subunits in a 1:1:2 ratio for the FMP assay and 0.5:1:1:2 (GFP:ai / 4: Pi / 2:y2) ratio for whole-cell patch-clamp recordings. Transfections were performed using Polyfect (Qiagen) according to the manufacturer’s protocol except for using half the volume of transfection reagent for each transfection.P7022PC00

[0703] Plasmids and Mutant Constructs

[0704] The plasmids used for transient expression of GABAA receptors have been described previously (Falk-Petersen et al. 2017, Falk-Petersen et al. 2020). The WT human cu-and Pi-subunits were subcloned into the plINIV vector (Addgene, Cambridge, MA), the human ai-, P2- and y2-subunits were subcloned into the pcDNA3.1 / Zeo vector, and the human b-subunit into the pcDNA5 / FRT vector (Invitrogen, Paisley, UK) using the b-construct described previously (Falk-Petersen et al. 2017). Plasmids carrying mutations were generated and sequence-verified by GenScript (Piscataway, NJ). The numbering of the mutants refers to the sequences with the signal peptide included.

[0705] Generation of Stable Cell Line

[0706] The b(L260V) mutation was established as a stable HEK293 Flp-ln cell line (Invitrogen) as previously described for the b-HEK (Falk-Petersen et al. 2021; Falk-Petersen et al.

[0707] 2017). The stable cell line was generated using the pcDNA / FRTA / 5-His TOPO TA Expression kit (Invitrogen) performed according to the manufacturer’s protocol, except for using 25 ml Polyfect and 4 mg DNA for transfection in a 10-cm culture dish.

[0708] Fluorometric Imaging Plate Reader (FLIPR) Membrane Potential (FMP) assay The FMP assay was performed as previously described with a few modifications (Falk-Petersen et al. 2017). In brief, cells were plated (50,000 cells / well in DMEM) into black poly-D-lysine-coated 96-well clear bottom plates 16-20 hrs post transfection. The following day, media was aspirated, and cells were washed in 100 pL / well assay buffer (HBSS supplemented with 20 mM HEPES, adjusted to pH 7.4 and freshly supplemented with 2 mM CaCh and 0.5 mM MgCh) followed by addition of 100 pL / well of FMP blue dye (0.5 mg / mL) diluted in assay buffer. Cell plates were shielded for light and incubated for 30 mins at 37 °C, 5% CO2. Meanwhile, ligand solutions were prepared as 4x desired concentrations in assay buffer containing GABA (EC10-20 for positive allosteric modulators and EC70-80 for negative allosteric modulators) and added to a ligand plate, which was placed in the preheated (37 °C) FLEXstation3 plate reader (Molecular Devices, Crawley, UK) for 10-15 mins prior to plate reading. The cell plate was read using an emission wavelength of 560 nm and an excitation wavelength of 530 nm, detecting the response as changes in fluorescent signal given in fluorescence units (ARFU) given as the difference between the average of baseline signal (~30 s recording) subtracted the peak response after compound addition (33 pL). All rawP7022PC00

[0709] traces were manually inspected for obvious artifacts after compound addition. Unless otherwise mentioned in the text or figure legends, experiments were performed in at least three independent experiments each using three technical replicates.

[0710] Concentration-response curves obtained in the FMP assay were fitted using the four-parameter concentration-response model:

[0711] top — bottom

[0712] Response = bottom -I - 777 — — — 7-7; — r

[0713]

[0714] 1 + 10((ioS£C50-W)'«H) EC50 values describe the concentration resulting in the half-maximal response (halfway between top and bottom). The ‘bottom’ and ‘top’ denote the upper and lower nonconstrained plateau of the curve, respectively, ‘[A]’ is the logarithmic concentration of ligand, and nn is the Hill coefficient. In order to compensate for variation in the assay window between experiments, data were normalized to either a saturating concentration of GABA or the GABA response used for modulation. pEC50 values of mutated receptors were compared and analyzed statistically by one-way ANOVA followed by Dunnett’s multiple comparison test with significance level set at p<0.05.

[0715] Whole-cell patch-clamp electrophysiology

[0716] b-HEK or HEK background cells transiently expressing human GABAA receptors and GFP were seeded in 35 mm Petri dishes the day before experiment. On the day of the experiment, cell media was exchanged for extracellular solution (ABSS containing (in mM): NaCI 140, KOI 3.5, Na2HPO41.25, MgSO42, CaCI22, glucose 10, and HEPES 10; pH 7.35) at room temperature (20-24 °C) before placing at the stage of an Axiovert 10 microscope (Zeiss, Germany). The cells were viewed at 200x magnification and cells containing GFP were visualized with UV light from an HBO 50 lamp (Zeiss, Germany). The cells were approached with micropipettes of 1.2-3.5 MQ resistance manufactured from 1.5-mm OD glass (World Precision Instruments, Sarasota, FL) on a microelectrode puller, model PP-830 (Narishige, Tokyo, Japan) containing an intracellular solution (containing (in mM): KCI 140, MgCI21, CaCI21, EGTA 10, MgATP 2, and HEPES 10; pH 7.3). Recordings were made from cells in the whole-cell configuration using the standard patch-clamp technique in voltage mode and an EPC-9 amplifier (HEKA, Lambrecht, Germany). The clamping potential was -60 mv, and series resistance was 70% compensated. Whole-cell currents were recorded using Pulse and PulseFit software (version 8.80; HEKA) and current traces were visualized using IgorPro (version 6.2.2.2; Wavemetrics, Lake Oswego, OR). Ligand solutions were prepared in ABSS and were applied using two VC3-8xP pressurized application systems feeding into a 16-barreled perfusion pipette (ALA Scientific Instruments Inc.,P7022PC00

[0717] Farmingdale, NY). Between compound applications, pure ABSS was applied to quickly remove the compounds from the cell and to allow the cells to recover for 1 minute before the next ligand application. For screening experiments, compounds were tested at one concentration of 10 pM coapplied with 1 pM GABA corresponding to GABA EC30 for a4Pid GABAARS. Compounds were applied for 5-10 s until plateau was reached. For compound characterization, 3.18 / 3e was pre-applied for 10 s before 5 s GABA EC30. All currents were normalized to the maximum GABA current induced by 100 pM GABA and given as %l / lmax- All curve-fitting results were carefully inspected visually. Cells with rundown of >50% of GABA control were excluded from the analysis.

[0718] For the antagonist concentration-response relationship, the equation:

[0719] j _ lmax

[0720]

[0721] ~ 1 + 10(((O.9 / C'50-IXI)-«H)

[0722] was fitted to the experimental data, where T is the membrane current, ‘A’ is the logarithm of the NAM concentration, ‘lmax’ is the maximum current that the reference agonist can induce, ‘IC50’ is the antagonist concentration inhibiting 50% of lmax, and ‘nn is the Hill coefficient.

[0723] Current relaxations were fitted to a monoexponential equation using a Simplex optimization algorithm (PulseFit; HEKA, Lambrecht, Germany).

[0724] z x / -1\

[0725] I(t) = IQ+ 11 exp — + I2exp —

[0726]

[0727] 'T1 ' 'T2 '

[0728] With T denoting the currents at a time ‘t’ and ‘TI’ and ‘T2’ the time constants. An unpaired t-test was used to compare time constants for GABA with and without NAM present. A two-sided Welch’s t test was used for comparing GABA control response with NAM response, correcting for multiple comparison using the original FDR method of Benjamini and Hochberg with a discovery rate of 0.05. Both adjusted and unadjusted P values are reported. Data analysis and statistics were performed in GraphPad Prism (version 10.0.2; GraphPad, San Diego, CA).

[0729] Functional Characterization at a4 / 3i6

[0730] The novel compounds were subjected to functional characterization at c Pib GABAARS using whole-cell patch-clamp electrophysiology. The compounds were screened in a single concentration of 10 pM coapplied with 1 pM GABA (corresponding to GABA EC30) (Figure 1A and 1B). DS2 and compound 30 were applied as reference compounds and to ensure functional incorporation of the b-subunit. In the primary screening, eight of the compounds (3.15 / 3b, 3.16 / 3c, 3.21 / 3s, 4.19 / 3g, 4.21 / 3S, 4.23 / 3k, 4.24 / 3I, SM-20 / 3j) showed positive modulatory activity, while no compoundsP7022PC00

[0731] were able to significantly reduce the current amplitude compared to GABA control. Compounds 3.16 / 3c, and 3.21 / 3s were able to potentiate the GABA response to a similar extent (>100% of GABAmax) as reference compounds, DS2 and compound 30. To characterize the potency of the compounds showing prominent positive modulatory activity more rapidly, the high-throughput fluorescence-based fluorometric imaging plate reader (FLIPR) membrane potential (FMP) assay was used. The FMP assay has previously been validated using the same HEK293 Flp-ln cell line stably expressing the human b-subunit resulting in high sensitivity and reproducibility (Falk-Petersen et al.

[0732] 2021, Falk-Petersen et al. 2017). ECso values were determined to 4.66 pM for 3.16 / 3c and 0.93 pM for3.21 / 3s at c Pib GABAARS (Figure 1C, Table 7). Thus, 3.21 / 3s is equipotent to DS2 while 3.16 / 3c is approximately five times less potent but showing higher apparent efficacy in the FMP assay. However, the FMP assay is not suitable for determining efficacy of agonists and modulators in an accurate manner (Falk-Petersen etal. 2017a).

[0733] Table 1. PAM activity of 3.16 / 3c, 3.21 / 3s, and reference compounds, DS2 and compound 30, at c Pib GABAARS determined in the FMP assay. ECso values and Hill slopes are determined from concentration-response curves and given as means. GABA concentrations used to induce EC20 response were a4pib: 0.04 pM, and aip2y2: 1.5 pM.

[0734] cuPib

[0735] Compound ECso (pM) pECso ± SEM nH ± SEM n DS2a0.98 6.01 ± 0.08 1.37 ± 0.16 4 Compound 30b0.16 6.79 ± 0.08 1.93 ± 0.18 4 3.16 / 3c 4.66 5.33 ± 0.06 1.55 ± 0.12 5 3.2173s 0.93 6.03 ± 0.06 1.01 ± 0.03 3 □ lP2Y2

[0736] Compound EC50(pM) pECso ± SEM nH ± SEM n 3.1673c 9.30 5.03 ± 0.07 2.67 ± 0.33 4 3.2173s 10.2 5.00 ± 0.01 1.85 ± 0.08 2

[0737]

[0738] aFrom Falk-Petersen et al. 2021.bFrom Rostrup et al. 2021.

[0739] By visual inspection of the current traces, only one compound, 3.18 / 3e, showed negative modulation of the GABA response by apparent accelerated current fade rate (Figure 1D). This was further investigated by fitting the current fade phase (from theP7022PC00

[0740] initial peak amplitude) of the current traces induced by GABA 1 pM with or without 3.18 / 3e to a monoexponential function. Comparing the time constants, T, of GABA 1 pM with and without 3.18 / 3e showed that 3.18 / 3e significantly accelerates the rate of current fade compared to the GABA control current (p=0.0027, unpaired t-test). Further investigation revealed that 10 s pre-application of 3.18 reduced the maximum current amplitude of the subsequent GABA current trace in a concentration-dependent manner with an IC50 value of 8.87 pM (n = 6) with a Hill slope of -1.57 at c Pib GABAARS (Figure 2A and 2B). Due to unspecific interactions of 3.18 / 3e with the fluorescent FMP dye and the d-HEK cell line, the FMP assay was not used for characterization of 3.18 / 3e.

[0741] Pharmacology - Subunit Selectivity

[0742] To assess potential b-subunit selectivity, 3.18 / 3e was tested in concentrations 1, 3, and 10 pM at c P-ib, Q4PIY2, C<4P2Y2, and QIP2Y2 GABAARS using whole-cell patch-clamp electrophysiology (Figure 4A). Unlike for the extrasynaptic c Pib GABAAR subtype, 10 s pre-application of 3.18 / 3e did not cause a statistically significant reduction of the subsequent GABA current amplitude at any of the Y2-subunit containing GABAARS tested (Figure 4C, p>0.05, two-sided Welch’s t test adjusted for multiple testing using the original FDR method of Benjamini and Hochberg, discovery rate of 0.05). This indicates a clear functional preference of 3.18 / 3e for the b-subunit.

[0743] Recently, several gain-of-function (GOF) patient variants of the 04- and b-subunit have been identified in patients suffering from neurodevelopmental disorders and generalized epilepsy (Ahring et al. 2022; Ahring et al. 2022a; Vogel et al. 2022). To explore the clinical potential of this novel b-subunit preferring NAM, two recently identified GOF variants, O4(T300l)Pib, and O4Pib(L260 ), were constructed and expressed in HEK cell lines to form tertiary c Pib GABAARS. GABA concentrationresponse curves were generated for c Pib WT, O4(T300l)Pib, and O4Pib(L260 ) using the FMP assay (Figure 3A). Supporting their previously identified GOF traits, GABA pECso values for both variants were significantly higher compared to c Pib WT (p<0.0001, one-way ANOVA, post hoc Dunnett’s test) (Figure 3B and Table 2).

[0744] Furthermore, the maximum current amplitude induced by GABA 100 pM in whole-cell patch-clamp electrophysiology were also increased for both GOF variants but only significantly for a4b1d(L260V) (p=0.0005, one-way ANOVA, post hoc Dunnett’s test) (Figure 3. C). As for the c Pib WT receptors, 3.18 / 3e was able to reduce the currentP7022PC00

[0745] amplitude of the subsequent GABA 1 pM trace in a concentration-dependent manner compared to the GABA control current for both GOF variants. (O4(T300l)Pib: p=0.0260 (10 pM), p=0.0064 (30 pM). a4Pib(L260V): p=0.0188(3 pM), p=0.0020 (10 pM) compared to pure GABA (0 pM) using two-sided Welch’s t test adjusted for multiple testing using the original FDR method of Benjamini and Hochberg, discovery rate of 0.05) (Figure 3D and 3E). The ability of 3.18 / 3e to reduce the increased GABA currents caused by the GOF mutations O4(T300l) and b(L260V) underlines the clinical potential a b-subunit preferring NAM to dampen and hopefully normalize the overactive tonic GABAergic neurotransmission evident in several neurological disorders.

[0746] Table 2. GABA ECso values and Hill slopes at c Pib WT, O4(T300l)Pib, and O4Pib(L260V) GABAA S determined in the FMP assay. ECso values and Hill slopes are determined from concentration-response curves and given as means. Statistical analysis was performed using one-way ANOVA with post hoc Dunnett’s test comparing pECso values for each variant to WT.

[0747] Subtype EC50 (pM) (pEC50 ± SEM) nH ± SEM n P cuPib WT 0.120 6.92 ± 0.02 1.271 ± 0.03 9 - a4(T300l)Pib 0.011 7.96 ± 0.04 1.267 ± 0.02 3 <0.0001 a4Pib(L260V) 0.0147 7.83 ± 0.01 1.371 ± 0.29 3 <0.0001

[0748]

[0749] Compounds IP-6 and IP-12 were tested using whole-cell patch-clamp electrophysiology at C PIS-GABAARS. AS seen for 3.18 / 3e, co-application of 10 pM IP-6 with GABA alters the kinetics of the current trace shape to accelerating the rate of current fade compared to GABA control trace. This is also evident for IP-12 but to a smaller extent (Figure 4C). Pre-application (10 s) of IP-6, IP-11, IP-12, IP-21, IP-26, and IP-27 reduce the subsequent GABA current amplitude with IP-27 resulting in the most efficient reduction at 10 pM (Figure 4C and D).

[0750] When tested at related subtypes CUP2 / 3<5-GABAARS compounds 3.18 / 3e (NNJ-95) and 3.21 / 3s (IP-27) were found to exhibit PAM properties i.e. potentiate the GABA response when co-applied at >10 pM (Figure 6A and 6B). This surprising switch in activity between subtypes has not previously been observed for compounds of this type. Representative analogues IP-6, IP-26, IA-83, and IA-95 were also found to be PAMs at O4P2 / 35-GABAARS (Figure 6C and D), thereby confirming that this phenomenon is not limited to just a few compounds, but rather is characteristic of aP7022PC00

[0751] broader subset of the disclosed chemical series.

[0752] This finding is of particular significance because it demonstrates that the compounds of the present invention possess dual functional potential, enabling them to act either as NAMs or PAMs depending on the GABAA receptor subtype present in the target tissue. Such versatility provides a unique therapeutic advantage, as it allows modulation of inhibitory neurotransmission in a subtype-selective manner. Consequently, the disclosed compounds may be useful in the treatment or prevention of a wide range of neurological disorders which would benefit from either activation or inhibition of the GABAA receptor.

[0753] Considerations on biodistribution using systemic administration routes

[0754] When administering a drug via a systemic route, such as oral administration, it is critical that the active compound biodistributes to the tissue or organ where it is intended to exert its therapeutic effect. The compounds disclosed herein are in part designed for use in the treatment of neurological disorders, including disorders of the central nervous system (CNS) and, in particular, the brain. Accordingly, an essential prerequisite for clinical efficacy is that the compound is capable of permeating the blood-brain barrier (BBB), a highly selective physiological barrier that restricts the passage of most molecules from the systemic circulation into the brain parenchyma.

[0755] The known imidazopyridine compound DS2 has been reported to lack sufficient BBB permeability, which imposes severe limitations on its further development as a therapeutic agent for neurological diseases and disorders. In contrast, the present inventors have surprisingly found that representative compounds of the instant disclosure, specifically NNJ-95 and IP-27, exhibit the ability to cross the BBB, thereby providing a clear and significant advantage over DS2.

[0756] Without being bound by theory, it is believed that lipophilicity, commonly expressed as the partition coefficient (logP), plays a key role in determining BBB permeability. A compound must exhibit sufficient lipophilicity to traverse the lipid-rich environment of the BBB, while retaining adequate hydrophilicity to ensure solubility and avoid unfavourable pharmacokinetic properties. DS2 has a logP value of 4.06, whereas NNJ-95 and IP-27 have logP values of 3.53 and 3.20, respectively. In the art, it is generally asserted that optimal logP values for BBB penetration lie within the range ofP7022PC00

[0757] approximately 1.5 to 2.7. Surprisingly, the present inventors have demonstrated that imidazopyridine compounds with logP values outside this previously accepted range, specifically in the range of 2.8 to 3.9, such as 2.9 to 3.8, such as 3.0 to 3.7, such as 3.1 to 3.6, are still capable of permeating the BBB. While some compounds of the instant disclosure exhibits PAM activity similar to DS2, they can therefore be seen as an improvement over DS2 because their exhibit better druggability due to their optimised lipophilicity.

[0758] Conclusion

[0759] Disclosed herein are examples of negative and positive allosteric modulators at the b-GABAARS. Furthermore, the NAMs show functional selectivity for the extrasynaptic C PIS-GABAARS compared to y2-containing GABAARS. The ability of 3.18 / 3e to dampen the GOF traits of two 04- and b-subunit variants identified in children with severe neurological disorders, underlines the great clinical potential of a b-subunit selective NAM. Some of the tested compounds show NAM activity on one GABAA receptor subtype, whereas they have PAM activity on others. Finally, some of the compounds were found to permeate the BBB, thus making them promising candidates as CNS disorder drugs.

[0760] Sequence overview

[0761] a4(T300l) - SEQ ID NO: 1 TCAATATTGGCCATTAGCCATATTATTCATTGGTTATATAGCATAAATCAATATTGG CTATTGGCCATTGCATACGTTGTATCTATATCATAATATGTACATTTATATTGGCTC ATGTCCAATATGACCGCCATGTTGGCATTGATTATTGACTAGTTATTAATAGTAATC AATTACGGGGTCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTA CGGTAAATGGCCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAA TAATGACGTATGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGG GTGGAGTATTTACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCC AAGTCCGCCCCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCC CAGTACATGACCTTACGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCAT CGCTATTACCATGGTGATGCGGTTTTGGCAGTACACCAATGGGCGTGGATAGCGG TTTGACTCACGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTT TTGGCACCAAAATCAACGGGACTTTCCAAAATGTCGTAACAACTGCGATCGCCCG CCCCGTTGACGCAAATGGGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCA GAGCTCGTTTAGTGAACCGTCAGATCACTAGAAGCTTTATTGCGGTAGTTTATCACP7022PC00

[0762] AGTTAAATTGCTAACGCAGTCAGTGCTTCTGACACAACAGTCTCGAACTTAAGCTG CAGTGACTCTCTTAAGGTAGCCTTGCAGAAGTTGGTCGTGAGGCACTGGGCAGGT AAGTATCAAGGTTACAAGACAGGTTTAAGGAGACCAATAGAAACTGGGCTTGTCG AGACAGAGAAGACTCTTGCGTTTCTGATAGGCACCTATTGGTCTTACTGACATCCA CTTTGCCTTTCTCTCCACAGGTGTCCACTCCCAGTTCAATTACAGCTCTTAAGGCT AGAGTACTTAATACGACTCACTATAGGCTAGCCTCGAGGTTTTTATTTTTAATTTTC TTTCAAATACTTCCACCATGAAGAAAAGTCCGGGTCTCTCTGACTACCTTTGGGCC TGGACCCTCTTTCTGAGCACATTGACTGGAAGAAGCTATGGTTTAAACGAATCCCC AGGACAGAACCAAAAGGAGGAGAAATTGTGCACAGAAAATTTCACCCGCATCCTG GACAGTTTGCTCGATGGTTATGACAACAGACTGCGTCCTGGATTTGGGGGTCCTG TTACAGAAGTGAAAACTGACATATATGTCACCAGCTTTGGACCTGTTTCTGATGTT GAAATGGAATACACAATGGATGTGTTCTTCAGGCAGACATGGATTGACAAAAGATT AAAATATGACGGCCCCATTGAAATTTTGAGATTGAACAATATGATGGTAACGAAAG TGTGGACCCCTGATACTTTCTTCAGGAATGGAAAGAAATCTGTCTCACATAATATG ACAGCTCCAAATAAGCTTTTTAGAATTATGAGAAATGGTACTATTTTATACACAATG AGACTCACCATAAGTGCGGAGTGTCCCATGAGATTGGTGGATTTTCCCATGGATG GTCATGCATGCCCTTTGAAATTCGGGAGTTATGCCTATCCAAAGAGTGAGATGATC TATACCTGGACAAAAGGTCCTGAGAAATCAGTTGAAGTTCCGAAGGAGTCTTCCA GCTTAGTTCAATATGATTTGATTGGGCAAACCGTATCAAGTGAAACCATCAAATCA ATTACGGGTGAATATATTGTTATGACGGTTTACTTCCACCTCAGACGGAAGATGGG TTATTTTATGATTCAGACCTATATTCCGTGCATTATGACAGTGATTCTTTCTCAAGT TTCATTTTGGATAAATAAAGAATCAGTTCCCGCTAGGACTGTATTTGGAATAACAAC TGTCCTCACCATGATCACACTAAGCATCAGTGCACGACATTCTTTGCCCAAAGTGT CCTATGCTACCGCCATGGACTGGTTCATAGCTGTCTGCTTTGCTTTTGTATTTTCG GCCCTTATCGAGTTTGCTGCTGTCAACTATTTCACCAATATTCAAATGGAAAAAGC CAAAAGGAAGACATCAAAGCCCCCTCAGGAAGTTCCCGCTGCTCCAGTGCAGAG AGAGAAGCATCCTGAAGCCCCTCTGCAGAATACAAATGCCAATTTGAACATGAGA AAAAGAACAAATGCTTTGGTTCACTCTGAATCTGATGTTGGCAACAGAACTGAGGT GGGAAACCATTCAAGCAAATCTTCCACAGTTGTTCAAGAATCTTCTAAAGGCACAC CTCGGTCTTACTTAGCTTCCAGTCCAAACCCATTCAGCCGTGCAAATGCAGCTGA AACCATATCTGCAGCAAGAGCACTTCCATCTGCTTCTCCTACTTCTATCCGAACTG GATATATGCCTCGAAAGGCTTCAGTTGGATCTGCTTCTACTCGGCACGTGTTTGG ATCAAGACTGCAGAGGATAAAGACCACAGTTAATACCATAGGGGCTACTGGGAAG TTGTCAGCTACTCCTCCTCCATCGGCTCCACCACCTTCTGGATCTGGCACAAGTA AAATAGACAAATATGCCCGTATTCTCTTTCCAGTCACATTTGGGGCATTTAACATGP7022PC00

[0763] CTTTATTGGGTTGTTTATTTATCTAACGACACTATGGAGAAATCAGAAAGTCTAATG TGAACGCGTGATCTGGTTACCACTAAACCAGCCTCAAGAACACCCGAATGGAGTC TCTAAGCTACATAATACCAACTTACACTTTACAAAATGTTGTCCCCCAAAATGTAGC CATTCGTATCTGCTCCTAATAAAAAGAAAGTTTCTTCACATTCTAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAACCCCCCCCCCCCCCCCCCCTGCAGCGGCCGCTTCC CTTTAGTGAGGGTTAATGCTTCGAGCAGACATGATAAGATACATTGATGAGTTTGG ACAAACCACAACTAGAATGCAGTGAAAAAAATGCTTTATTTGTGAAATTTGTGATG CTATTGCTTTATTTGTAACCATTATAAGCTGCAATAAACAAGTTAACAACAACAATT GCATTCATTTTATGTTTCAGGTTCAGGGGGAGATGTGGGAGGTTTTTTAAAGCAAG TAAAACCTCTACAAATGTGGTAAAATCCGATAAGGATCGATCCGGGCTGGCGTAA TAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTGCGCAGCCTGAATGG CGAATGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTAC GCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTT CTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGG GGGCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAAC TTGATTAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCG CCCTTTGACGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAA CAACACTCAACCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTT CGGCCTATTGGTTAAAAAATGAGCTGATTTAACAAAAATTTAACGCGAATTTTAACA AAATATTAACGCTTACAATTTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCG GTATTTCACACCGCATACGCGGATCTGCGCAGCACCATGGCCTGAAATAACCTCT GAAAGAGGAACTTGGTTAGGTACCTTCTGAGGCGGAAAGAACCAGCTGTGGAATG TGTGTCAGTTAGGGTGTGGAAAGTCCCCAGGCTCCCCAGCAGGCAGAAGTATGC AAAGCATGCATCTCAATTAGTCAGCAACCAGGTGTGGAAAGTCCCCAGGCTCCCC AGCAGGCAGAAGTATGCAAAGCATGCATCTCAATTAGTCAGCAACCATAGTCCCG CCCCTAACTCCGCCCATCCCGCCCCTAACTCCGCCCAGTTCCGCCCATTCTCCGC CCCATGGCTGACTAATTTTTTTTATTTATGCAGAGGCCGAGGCCGCCTCGGCCTC TGAGCTATTCCAGAAGTAGTGAGGAGGCTTTTTTGGAGGCCTAGGCTTTTGCAAA AAGCTTGATTCTTCTGACACAACAGTCTCGAACTTAAGGCTAGAGCCACCATGATT GAACAAGATGGATTGCACGCAGGTTCTCCGGCCGCTTGGGTGGAGAGGCTATTC GGCTATGACTGGGCACAACAGACAATCGGCTGCTCTGATGCCGCCGTGTTCCGG CTGTCAGCGCAGGGGCGCCCGGTTCTTTTTGTCAAGACCGACCTGTCCGGTGCC CTGAATGAACTGCAGGACGAGGCAGCGCGGCTATCGTGGCTGGCCACGACGGG CGTTCCTTGCGCAGCTGTGCTCGACGTTGTCACTGAAGCGGGAAGGGACTGGCT GCTATTGGGCGAAGTGCCGGGGCAGGATCTCCTGTCATCTCACCTTGCTCCTGCP7022PC00

[0764] CGAGAAAGTATCCATCATGGCTGATGCAATGCGGCGGCTGCATACGCTTGATCCG GCTACCTGCCCATTCGACCACCAAGCGAAACATCGCATCGAGCGAGCACGTACTC GGATGGAAGCCGGTCTTGTCGATCAGGATGATCTGGACGAAGAGCATCAGGGGC TCGCGCCAGCCGAACTGTTCGCCAGGCTCAAGGCGCGCATGCCCGACGGCGAG GATCTCGTCGTGACCCATGGCGATGCCTGCTTGCCGAATATCATGGTGGAAAATG GCCGCTTTTCTGGATTCATCGACTGTGGCCGGCTGGGTGTGGCGGACCGCTATC AGGACATAGCGTTGGCTACCCGTGATATTGCTGAAGAGCTTGGCGGCGAATGGG CTGACCGCTTCCTCGTGCTTTACGGTATCGCCGCTCCCGATTCGCAGCGCATCGC CTTCTATCGCCTTCTTGACGAGTTCTTCTGAGCGGGACTCTGGGGTTCGAAATGA CCGACCAAGCGACGCCCAACCTGCCATCACGATGGCCGCAATAAAATATCTTTAT TTTCATTACATCTGTGTGTTGGTTTTTTGTGTGAATCGATAGCGATAAGGATCCGC GTATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGCCAGCCCC GACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGGCAT CCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTC ACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTA TAGGTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGG AAATGTGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCC GCTCATGAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTA TGAGTATTCAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTC CTGTTTTTGCTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTG GGTGCACGAGTGGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGA GTTTTCGCCCCGAAGAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGT GGCGCGGTATTATCCCGTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATA CACTATTCTCAGAATGACTTGGTTGAGTACTCACCAGTCACAGAAAAGCATCTTAC GGATGGCATGACAGTAAGAGAATTATGCAGTGCTGCCATAACCATGAGTGATAAC ACTGCGGCCAACTTACTTCTGACAACGATCGGAGGACCGAAGGAGCTAACCGCTT TTTTGCACAACATGGGGGATCATGTAACTCGCCTTGATCGTTGGGAACCGGAGCT GAATGAAGCCATACCAAACGACGAGCGTGACACCACGATGCCTGTAGCAATGGC AACAACGTTGCGCAAACTATTAACTGGCGAACTACTTACTCTAGCTTCCCGGCAAC AATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGGACCACTTCTGCGCTCGGC CCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCCGGTGAGCGTGGGTCT CGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCCGTATCGTAGTTA TCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACAGATCGCTGA GATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTACTCATATA TACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGAAGATCCTP7022PC00

[0765] TTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTGAGCGT CAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGCGTA ATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGG ATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGAT ACCAAATACTGTTCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTG TAGCACCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAG TGGCGATAAGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAG GCGCAGCGGTCGGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCG AACGACCTACACCGAACTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACG CTTCCCGAAGGGAGAAAGGCGGACAGGTATCCGGTAAGCGGCAGGGTCGGAAC AGGAGAGCGCACGAGGGAGCTTCCAGGGGGAAACGCCTGGTATCTTTATAGTCC TGTCGGGTTTCGCCACCTCTGACTTGAGCGTCGATTTTTGTGATGCTCGTCAGGG GGGCGGAGCCTATGGAAAAACGCCAGCAACGCGGCCTTTTTACGGTTCCTGGCC TTTTGCTGGCCTTTTGCTCACATGGCTCGACAGATCT

[0766] 5(L260V) - SEQ ID NO: 2 ACGGATCGGGAGATCTCCCGATCCCCTATGGTGCACTCTCAGTACAATCTGCTCT GATGCCGCATAGTTAAGCCAGTATCTGCTCCCTGCTTGTGTGTTGGAGGTCGCTG AGTAGTGCGCGAGCAAAATTTAAGCTACAACAAGGCAAGGCTTGACCGACAATTG CATGAAGAATCTGCTTAGGGTTAGGCGTTTTGCGCTGCTTCGCGATGTACGGGCC AGATATACGCGTTGACATTGATTATTGACTAGTTATTAATAGTAATCAATTACGGGG TCATTAGTTCATAGCCCATATATGGAGTTCCGCGTTACATAACTTACGGTAAATGG CCCGCCTGGCTGACCGCCCAACGACCCCCGCCCATTGACGTCAATAATGACGTA TGTTCCCATAGTAACGCCAATAGGGACTTTCCATTGACGTCAATGGGTGGAGTATT TACGGTAAACTGCCCACTTGGCAGTACATCAAGTGTATCATATGCCAAGTACGCC CCCTATTGACGTCAATGACGGTAAATGGCCCGCCTGGCATTATGCCCAGTACATG ACCTTATGGGACTTTCCTACTTGGCAGTACATCTACGTATTAGTCATCGCTATTAC CATGGTGATGCGGTTTTGGCAGTACATCAATGGGCGTGGATAGCGGTTTGACTCA CGGGGATTTCCAAGTCTCCACCCCATTGACGTCAATGGGAGTTTGTTTTGGCACC AAAATCAACGGGACTTTCCAAAATGTCGTAACAACTCCGCCCCATTGACGCAAATG GGCGGTAGGCGTGTACGGTGGGAGGTCTATATAAGCAGAGCTCTCTGGCTAACT AGAGAACCCACTGCTTACTGGCTTATCGAAATTAATACGACTCACTATAGGGAGAC CCAAGCTGGCTAGCGTTTAAACTTAAGCTCGCCCTTGGgATGAAGAAAAGTCCGG GTCTCTCTGACTACCTTTGGGCCTGGACCCTCTTTCTGAGCACATTGACTGGAAG AAGCTATGGACAACCCTCATTACAAGATGAACAGAAGCTGATCAGCGAGGAGGACP7022PC00

[0767] CTGAATTCCGGATCCAACCTGGAGATCTCCTGGCTCCCCAACCTGGACGGGCTG ATAGCCGGCTACGCCCGCAACTTCCGGCCTGGCATCGGAGGCCCCCCCGTGAAT GTGGCCCTTGCCCTGGAGGTGGCCAGCATCGACCACATCTCAGAGGCCAACATG GAGTACACCATGACGGTGTTCCTGCACCAGAGCTGGCGGGACAGCAGGCTCTCC TACAACCACACCAACGAGACCCTGGGCCTGGACAGCCGCTTCGTGGACAAGCTG TGGCTGCCCGACACCTTCATCGTGAACGCCAAGTCGGCCTGGTTCCACGACGTG ACGGTGGAGAACAAGCTCATCCGGCTGCAGCCCGACGGCGTGATCCTGTACAGC ATCCGAATCACCTCCACTGTGGCCTGCGACATGGACCTGGCCAAATACCCCATGG ACGAGCAGGAGTGCATGCTGGACCTGGAGAGCTACGGTTACTCATCGGAGGACA TCGTCTACTACTGGTCGGAGAGCCAGGAGCACATCCACGGGCTGGACAAGCTGC AGCTGGCGCAGTTCACCATCACCAGCTACCGCTTCACCACGGAGCTGATGAACTT CAAGTCCGCTGGCCAGTTCCCACGGCTCAGCCTGCACTTCCACCTGCGGAGGAA CCGCGGCGTGTACATCATCCAATCCTACATGCCCTCCGTCGTGCTGGTCGCCATG TCCTGGGTCTCCTTCTGGATCAGCCAGGCGGCGGTGCCCGCCAGGGTGTCTCTA GGCATCACCACGGTGCTGACGATGACCACGCTCATGGTCAGTGCCCGCTCCTCC CTGCCACGGGCATCAGCCATCAAGGCACTGGACGTCTACTTCTGGATCTGCTATG TCTTCGTGTTTGCCGCCCTGGTGGAGTACGCCTTTGCTCATTTCAACGCCGACTA CAGGAAGAAGCAGAAGGCCAAGGTCAAGGTCTCCAGGCCGAGGGCAGAGATGG ACGTGAGGAACGCCATTGTCCTCTTCTCCCTCTCTGCTGCCGGCGTCACGCAGGA GCTGGCCATCTCCCGCCGGCAGCGCCGCGTCCCGGGGAACCTGATGGGCTCCT ACAGGTCGGTGGGGGTGGAGACAGGGGAGACGAAGAAGGAGGGGGCAGCCCG CTCAGGAGGCCAGGGGGGCATCCGTGCCCGGCTCAGGCCCATCGACGCAGACA CCATTGACATTTACGCCCGCGCTGTGTTCCCTGCGGCGTTTGCGGCCGTCAATGT CATCTACTGGGCGGCATACGCCATGTGAGCACAGGAAGGGCGAGCTTGGTACCG AGCTCGGATCCGAAGGTAAGCCTATCCCTAACCCTCTCCTCGGTCTCGATTCTAC GCGTACCGGTCATCATCACCATCACCATTGAGTTTAAACCCGCTGATCAGCCTCG ACTGTGCCTTCTAGTTGCCAGCCATCTGTTGTTTGCCCCTCCCCCGTGCCTTCCTT GACCCTGGAAGGTGCCACTCCCACTGTCCTTTCCTAATAAAATGAGGAAATTGCAT CGCATTGTCTGAGTAGGTGTCATTCTATTCTGGGGGGTGGGGTGGGGCAGGACA GCAAGGGGGAGGATTGGGAAGACAATAGCAGGCATGCTGGGGATGCGGTGGGC TCTATGGCTTCTGAGGCGGAAAGAACCAGCTGGGGCTCTAGGGGGTATCCCCAC GCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTACGCGCAGCGT GACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTTTCTTCCCTTCC TTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGGGTCCCTTT AGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGATTAGGGTP7022PC00

[0768] GATGGTTCACGTACCTAGAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTAT AGGAACTTCCTTGGCCAAAAAGCCTGAACTCACCGCGACGTCTGTCGAGAAGTTT CTGATCGAAAAGTTCGACAGCGTCTCCGACCTGATGCAGCTCTCGGAGGGCGAA GAATCTCGTGCTTTCAGCTTCGATGTAGGAGGGCGTGGATATGTCCTGCGGGTAA ATAGCTGCGCCGATGGTTTCTACAAAGATCGTTATGTTTATCGGCACTTTGCATCG GCCGCGCTCCCGATTCCGGAAGTGCTTGACATTGGGGAATTCAGCGAGAGCCTG ACCTATTGCATCTCCCGCCGTGCACAGGGTGTCACGTTGCAAGACCTGCCTGAAA CCGAACTGCCCGCTGTTCTGCAGCCGGTCGCGGAGGCCATGGATGCGATCGCTG CGGCCGATCTTAGCCAGACGAGCGGGTTCGGCCCATTCGGACCGCAAGGAATCG GTCAATACACTACATGGCGTGATTTCATATGCGCGATTGCTGATCCCCATGTGTAT CACTGGCAAACTGTGATGGACGACACCGTCAGTGCGTCCGTCGCGCAGGCTCTC GATGAGCTGATGCTTTGGGCCGAGGACTGCCCCGAAGTCCGGCACCTCGTGCAC GCGGATTTCGGCTCCAACAATGTCCTGACGGACAATGGCCGCATAACAGCGGTC ATTGACTGGAGCGAGGCGATGTTCGGGGATTCCCAATACGAGGTCGCCAACATCT TCTTCTGGAGGCCGTGGTTGGCTTGTATGGAGCAGCAGACGCGCTACTTCGAGC GGAGGCATCCGGAGCTTGCAGGATCGCCGCGGCTCCGGGCGTATATGCTCCGC ATTGGTCTTGACCAACTCTATCAGAGCTTGGTTGACGGCAATTTCGATGATGCAGC TTGGGCGCAGGGTCGATGCGACGCAATCGTCCGATCCGGAGCCGGGACTGTCG GGCGTACACAAATCGCCCGCAGAAGCGCGGCCGTCTGGACCGATGGCTGTGTAG AAGTACTCGCCGATAGTGGAAACCGACGCCCCAGCACTCGTCCGAGGGCAAAGG AATAGCACGTACTACGAGATTTCGATTCCACCGCCGCCTTCTATGAAAGGTTGGG CTTCGGAATCGTTTTCCGGGACGCCGGCTGGATGATCCTCCAGCGCGGGGATCT CATGCTGGAGTTCTTCGCCCACCCCAACTTGTTTATTGCAGCTTATAATGGTTACA AATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTA GTTGTGGTTTGTCCAAACTCATCAATGTATCTTATCATGTCTGTATACCGTCGACCT CTAGCTAGAGCTTGGCGTAATCATGGTCATAGCTGTTTCCTGTGTGAAATTGTTAT CCGCTCACAATTCCACACAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGG GTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTC CAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGCGGGG AGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGC GCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATAC GGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCA GCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTC CGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAAC CCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTP7022PC00

[0769] CTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGG AAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTC GTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGC GCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGC CACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTG CTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATT TGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCT TGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGC AGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGG TCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTATC AAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTTTTAAATCAATCTAA AGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACC TATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGT AGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATGATACC GCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGG AAGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCTCCATCCAGTCTATT AATTGTTGCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACG TTGTTGCCATTGCTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTC ATTCAGCTCCGGTTCCCAACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGC AAAAAAGCGGTTAGCTCCTTCGGTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCG CAGTGTTATCACTCATGGTTATGGCAGCACTGCATAATTCTCTTACTGTCATGCCA TCCGTAAGATGCTTTTCTGTGACTGGTGAGTACTCAACCAAGTCATTCTGAGAATA GTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAATACGGGATAATACCGC GCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTCTTCGGGGCGA AAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACTCGTGC ACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAA CAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAA TACTCATACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCAT GAGCGGATACATATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCA CATTTCCCCGAAAAGTGCCACCTGACGTC

[0770] References

[0771] Rostrup F, Falk-Petersen CB, Harpsoe K, Buchleithner S, Conforti I, Jung S, et al. Structural Determinants for the Mode of Action of Imidazopyridine DS2 at 5-Containing y-Aminobutyric Acid Type A Receptors. Journal of Medicinal Chemistry.P7022PC00

[0772] 2021;64(8):4730-43.

[0773] Falk-Petersen CB, Rostrup F, Loftier R, Buchleithner S, Harpsoe K, Gloriam DE, et al. Molecular Determinants Underlying Delta Selective Compound 2 Activity at 5-Containing GABAA Receptors. Mol Pharmacol. 2021;100(1):46-56.

[0774] Falk-Petersen CB, Sogaard R, Madsen KL, Klein AB, Frolund B, Wellendorph P. Development of a Robust Mammalian Cell-based Assay for Studying Recombinant a4pi / 3b GABAA Receptor Subtypes. Basic & Clinical Pharmacology & Toxicology. 2017; 121 (2): 119-29.

[0775] Falk-Petersen CB, TsonkovTM, Nielsen MS, Harpsoe K, Bundgaard C, Frolund B, et al. Discovery of a new class of orthosteric antagonists with nanomolar potency at extrasynaptic GABA(A) receptors. Sci Rep. 2020; 10(1): 10078.

[0776] Falk-Petersen CB, Sogaard R, Madsen KL, Klein AB, Frolund B, Wellendorph P.

[0777] Development of a Robust Mammalian Cell-based Assay for Studying Recombinant alpha4 beta1 / 3 delta GABAA Receptor Subtypes. Basic Clin Pharmacol Toxicol.

[0778] 2017; 121 (2): 119-29. (2017a)

[0779] Ahring PK, Liao VWY, Gardella E, Johannesen KM, Krey I, Selmer KK, et al. Gain-of-function variants in GABRD reveal a novel pathway for neurodevelopmental disorders and epilepsy. Brain. 2022; 145(4): 1299-309.

[0780] Ahring PK, Liao VWY, Lin S, Absalom NL, Chebib M, Moller RS. The de novo GABRA4 p. Thr300lle variant found in a patient with early-onset intractable epilepsy and neurodevelopmental abnormalities displays gain-of-function traits. Epilepsia.

[0781] 2022;63(9):2439-41. (2022a)

[0782] Vogel FD, Krenn M, Westphal DS, Graf E, Wagner M, Leiz S, et al. A de novo missense variant in GABRA4 alters receptor function in an epileptic and neurodevelopmental phenotype. Epilepsia. 2022;63(4):e35-e41.

[0783] Griffiths JL, LovickTA. GABAergic neurones in the rat periaqueductal grey matter express 04, Pi and 5 GABAA receptor subunits: plasticity ofP7022PC00

[0784] expression during the estrous cycle. Neuroscience. 2005;136:457-66.

[0785] Mangan PS, Sun C, Carpenter M, Goodkin HP, Sieghart W, Kapur J. Cultured hippocampal pyramidal neurons express two kinds of GABAA receptors. Mol Pharmacol. 2005;67:775-88.

[0786] Drasbek et al. J Inherit Metab Dis. 2008 Dec; 31(6): 662-668.

Claims

P7022PC00Claims1. A compound of formula (I):R2formula (I),wherein:R1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, C1-6alkylamino, C1-6dialkylamino, C1-6alkyl, C2-6alkenyl, C2-6alkynyl, C1-6alkoxy, C1-6acyl, C3-10cycloalkyl, C6-10aryl, C6-10arylC1-6alkyl, C2-10heterocyclyl, C2-10heteroaryl, C2-10heteroarylC1-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2- ealkenyl, C2-ealkynyl, Ci-ealkoxy, and Ci-eacyl;R2is selected from Ci-ealkyl, C2-ealkenyl, C2-ealkynyl, Ci-ealkoxy, Cs-wcycloalkyl, Ce- aryl, Ce-warylCi-ealkyl, C2- heterocyclyl, C2- heteroaryl, C2-wheteroarylCi- ealkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, C1-6alkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce- wdiarylamino, and Ce-waryloxy;R3is hydrogen or Ci-ealkyl,R6is selected from Ci-4alkyl, C2-4alkenyl, C2-4alkynyl, Ci-4alkoxy, Ce- aryl, Ce- warylCi-4alkyl, C2-wheterocyclyl, C2-wheteroaryl, C2-wheteroarylCi-ealkyl, fluoro, chloro, bromo, and iodo,R7is hydrogen or Ci-ealkyl,P7022PC00n is 0, 1, 2, 3, or 4,p is 0, 1, or 2,X is CO, SO2, or a bond,Y is N or CH,or a pharmaceutically acceptable salt thereof.

2. The compound according to claim 1, wherein the Y is N.

3. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (II):XR2formula (II).

4. The compound according to any one of the preceding claims, wherein n is 0, 1, or 2.

5. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (lla)-(lld):xR2formula (Ila),xR2formula (lib),XR2formula (He),P7022PC00R2formula (lid).

6. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (lle)-(llj):R1XR2formula (He),R1R2formula (I Ig),XR2formula (llh),R2formula (Hi),P7022PC00Xr2formula (I Ij).

7. The compound according to any one of the preceding claims, wherein R4is R78. The compound according to any one of the preceding claims, wherein R4ishydrogen,9. The compound according to any one of the preceding claims, wherein R4isselected from hydrogen,Ph10. The compound according to any one of the preceding claims, wherein R4is11. The compound according to any one of the preceding claims, wherein theP7022PC00compound has the structure of formula (III):formula (HI).

12. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (llla)-(llld):xR2formula (Illa),R7 / i xi r\XR2formula (I I lb),R7 / i xi r\XR2formula (I He),R7XR2formula (Hid).

13. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (llle)-(lllj):P7022PC00R7r2formula (Illi),formula (lllj).

14. The compound according to any one of the preceding claims, wherein X is CO.

15. The compound according to any one of the preceding claims, wherein theP7022PC00compound is of formula (IV):oR2formula (IV).

16. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (IVa)-(IVd):formula (IVa),17. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (IVe)-(IVj):R1Rt^skR4NR30=^R2formula (IVe),P7022PC0018. The compound according to any one of the preceding claims, wherein the compound is of formula (V):

19. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (Va)-(Vd):P7022PC00R2formula (Va),R7r2formula (Vb),R7R2formula (Vc),R7r2formula (Vd).

20. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (Ve)-(Vj):R2formula (Ve),R2formula (Vf),P7022PC00R7r2formula (Vh),R7R2formula (Vi),R7R2formula (Vj).

21. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (VI):wherein R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, Ci-ealkynyl, haloCi-ealkynyl, Ci- ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce-ioaryl, Ce- arylamino, Ce- wdiarylamino, and C6-10aryloxy, andwherein m is 0, 1, 2, or 3.P7022PC0022. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (Vla)-(Vld):

23. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (Vle)-(Vlj):formula (Vie),P7022PC0024. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (VII):P7022PC00-N N, NR3f ^r(R5)mformula (VII),wherein R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, Ci-ealkynyl, haloCi-ealkynyl, Ci- ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce-ioaryl, Ce- arylamino, Ce- wdiarylamino, and C6-10aryloxy, andwherein m is 0, 1, 2, or 3.

25. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (IVa)-(IVd):>3formula>3(R5)mformula>3formula (Vile),P7022PC00R1, NR3X^ssz formula (Vlld).

26. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (Vlle)-(Vllj):formula (Vllh),P7022PC0027. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (VIII):wherein R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, Ci-ealkynyl, haloCi-ealkynyl, Ci- ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce-ioaryl, Ce- arylamino, Ce- wdiarylamino, and C6-10aryloxy, andwherein m is 0, 1, 2, or 3.

28. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (VIIIa)-(VIIId):P7022PC0029. The compound according to any one of the preceding claims, wherein the compound is selected from formulae (VIIIe)-(VIIIj):formula (VIIIe),P7022PC00formula (VIIIf),formula (VIIIg),formula (VIIIh),formula (VIIIj).

30. The compound according to any one of the preceding claims, wherein m is 0 or 1.

31. The compound according to any one of the preceding claims, wherein p is 0, 1, or 2, preferably 1 or 2.P7022PC0032. The compound according to any one of the preceding claims, wherein R4is33. The compound according to any one of the preceding claims, wherein R4is34. The compound according to any one of the preceding claims, wherein R2is 4- chlorophenyl.

35. The compound according to any one of the preceding claims, wherein R2isC(R5)m, adamantyl such as 1-adamantyl or 2-adamantyl, cubanyl, bicyclo[2.2.2]octanyl such as bicyclo[2.2.2]octan-1-yl or bicyclo[2.2.2]octan-2-yl, bicyclo[1.1.1]pentyl, spiro[3.3]heptanyl, and norbornyl such as norborn-1-yl, norborn-2-yl or norborn-7-yl, any one of which may optionally be substituted,wherein R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi-ealkyl, C2-ealkenyl, haloC2-ealkenyl, Ci-ealkynyl, haloCi-ealkynyl, Ci- ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce-ioaryl, Ce- arylamino, Ce- wdiarylamino, and C6-10aryloxy, andwherein m is 0, 1, 2, or 3.

36. The compound according to any one of the preceding claims, wherein R2is an optionally substituted adamantyl group, such as an optionally substitutedP7022PC00adamant-1 -yl group or an optionally substituted adamant-2-yl group.

37. The compound according to any one of the preceding claims, wherein halo is selected from fluoro, chloro, bromo, iodo, including combinations thereof.

38. The compound according to any one of the preceding claims, wherein Ci-ealkyl is selected from methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, isopentyl, sec-pentyl, tert-pentyl, neopentyl, and linear or branched hexyl.

39. The compound according to any one of the preceding claims, wherein R3is selected from hydrogen, methyl, and ethyl.

40. The compound according to any one of the preceding claims, wherein R3is hydrogen.

41. The compound according to any one of the preceding claims, wherein R7is selected from hydrogen, methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, secbutyl, tert-butyl, n-pentyl, isopentyl, sec-pentyl, tert-pentyl, neopentyl, and linear or branched hexyl.

42. The compound according to any one of the preceding claims, wherein R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

43. The compound according to any one of the preceding claims, wherein R1is selected from methyl, ethyl, F, Cl, Br, I, thien-2-yl, and thien-3-yl.

44. The compound according to any one of the preceding claims, whereinR3is hydrogen,n is 0, 1, or 2,X is CO, andY is N.

45. The compound according to any one of the preceding claims, whereinR3is hydrogen,P7022PC00R7is hydrogen, methyl, ethyl, n-propyl, or isopropyl,n is 0, 1, or 2,X is CO, andY is N.

46. The compound according to any one of the preceding claims, wherein the compound has a structure selected from formula (II) and (lla)-(llj), preferably R7 / =>(R7)P(He), R4isor v— y, and R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

47. The compound according to any one of the preceding claims, wherein the compound has a structure selected from formula (III) and (llla)-(lllj), preferably (I I lc), and wherein R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

48. The compound according to any one of the preceding claims, wherein the compound has a structure selected from formula (IV) and (IVa)-(IVj), preferably R7 / N"lj _. / =Y(R7)P(IVc), R4is or, and R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

49. The compound according to any one of the preceding claims, wherein the compound has a structure selected from formula (V) and (Va)-(Vj), preferably (Vc), and wherein R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

50. The compound according to any one of the preceding claims, wherein the compound has a structure selected from formula (VI) and (Vla)-(Vlj), preferably R7 / N"lj _. / =Y(R7)P(Vic), R4is or, and R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.P7022PC0051. The compound according to any one of the preceding claims, wherein the compound has a structure selected from formula (VII) and (VI la)-(Vllj), preferably (Vile), and wherein R7is selected from hydrogen, methyl, ethyl, n- propyl, and isopropyl.

52. The compound according to any one of the preceding claims, wherein the compound has a structure selected from formula (VIII) and (VIIIa-VIIIj),R7N-^ / =>(R7)Ppreferably (VIIIe), R4isor — V, and R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl.

53. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (Vic), whereinR1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2- ealkenyl, C2-ealkynyl, Ci-ealkoxy, Ci-eacyl, Cs-wcycloalkyl, Ce- aryl, Ce-warylCi- ealkyl, C2- heterocyclyl, C2- heteroaryl, C2- heteroarylCi-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, C1-6alkylamino, C1-6dialkylamino, C1-6alkyl, C2-6alkenyl, C2-6alkynyl, C1-6alkoxy, and C1-6acyl,R3is H,R7R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl,R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi- ealkyl, C2-6alkenyl, haloC2-ealkenyl, C1-6alkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce-wdiarylamino, and Ce-waryloxy, andm is 0 or 1.P7022PC0054. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (Vile), whereinR1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2- ealkenyl, C2-ealkynyl, Ci-ealkoxy, Ci-eacyl, Cs-wcycloalkyl, Ce- aryl, Ce-warylCi- ealkyl, C2- heterocyclyl, C2- heteroaryl, C2- heteroarylCi-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, C1-6alkylamino, C1-6dialkylamino, C1-6alkyl, C2-6alkenyl, C2-6alkynyl, C1-6alkoxy, and C1-6acyl,R3is H,R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl,R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi- ealkyl, C2-6alkenyl, haloC2-ealkenyl, C1-6alkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce-wdiarylamino, and Ce-waryloxy, andm is 0 or 1.

55. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (Vic), whereinR1is selected from methyl, ethyl, F, Cl, Br, I, thien-2-yl, and thien-3-yl,R3is H,R7R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl,R5is selected from fluoro, chloro, bromo, iodo, C1-6alkoxy, and C6-10aryloxy, and m is 0 or 1.

56. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (Vile), whereinR1is selected from methyl, ethyl, F, Cl, Br, I, thien-2-yl, and thien-3-yl,R3is H,P7022PC00R7is selected from hydrogen, methyl, ethyl, n-propyl, and isopropyl,R5is selected from fluoro, chloro, bromo, iodo, Ci-ealkoxy, and C6-10aryloxy, and m is 0 or 1.

57. The compound according to any one of the preceding claims, wherein the compound has a structure selected from formula (II) and (lla)-(llj), preferably58. The compound according to any one of the preceding claims, wherein the compound has a structure selected from formula (IV) and (I Va)-(IVj), preferably59. The compound according to any one of the preceding claims, wherein the compound has a structure selected from formula (VI) and (Vla)-(Vlj), preferablyP7022PC0060. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (He), whereinR1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2- ealkenyl, C2-ealkynyl, Ci-ealkoxy, Ci-eacyl, Cs-wcycloalkyl, Ce- aryl, Ce-warylCi- ealkyl, C2- heterocyclyl, C2- heteroaryl, C2- heteroarylCi-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, C1-6alkylamino, C1-6dialkylamino, C1-6alkyl, C2-6alkenyl, C2-6alkynyl, C1-6alkoxy, and C1-6acyl,R3is H,R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi- ealkyl, C2-6alkenyl, haloC2-ealkenyl, C1-6alkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce-wdiarylamino, and Ce-waryloxy, andm is 0 or 1.

61. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (He), whereinR1is selected from methyl, ethyl, F, Cl, Br, I, thien-2-yl, and thien-3-yl,R3is H,P7022PC00PhR5is selected from fluoro, chloro, bromo, iodo, C1-6alkoxy, and C6-10aryloxy, and m is 0 or 1.

62. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (IVc), whereinR1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, C2- ealkenyl, C2-ealkynyl, Ci-ealkoxy, Ci-eacyl, Cs-wcycloalkyl, Ce- aryl, Ce-warylCi- ealkyl, C2- heterocyclyl, C2- heteroaryl, C2- heteroarylCi-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, C1-6alkylamino, C1-6dialkylamino, C1-6alkyl, C2-6alkenyl, C2-6alkynyl, C1-6alkoxy, and C1-6acyl,R3is H,o!?6)pX’pfl fl — (xil R4is selected from the group of hydrogen,,R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi- ealkyl, C2-6alkenyl, haloC2-ealkenyl, C1-6alkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce-warylamino, Ce-wdiarylamino, and Ce-waryloxy, andm is 0 or 1.

63. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (IVc), whereinR1is selected from methyl, ethyl, F, Cl, Br, I, thien-2-yl, and thien-3-yl,P7022PC00R3is H,PhR5is selected from fluoro, chloro, bromo, iodo, C1-6alkoxy, and C6-10aryloxy, and m is 0 or 1.

64. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (VIIIe), whereinR1is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, C1-6alkylamino, C1-6dialkylamino, C1-6alkyl, C2-6alkenyl, C2-6alkynyl, C1-6alkoxy, C1-6acyl, C3-10cycloalkyl, C6-10aryl, C6-10arylC1-6alkyl, C2-10heterocyclyl, C2-10heteroaryl, C2-10heteroarylC1-6alkyl, any of which may optionally be substituted by one, two, or three moieties independently selected from hydroxy, oxo, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, C1-6alkylamino, C1-6dialkylamino, C1-6alkyl, C2-6alkenyl, C2-6alkynyl, C1-6alkoxy, and C1-6acyl,R3is H,R5is selected from hydroxy, carboxy, carbamoyl, cyano, fluoro, chloro, bromo, iodo, mercapto, nitro, amino, Ci-ealkylamino, Ci-edialkylamino, Ci-ealkyl, haloCi- ealkyl, C2-6alkenyl, haloC2-ealkenyl, C1-6alkynyl, haloCi-ealkynyl, Ci-ealkoxy, haloCi-ealkoxy, Ci-eacyl, haloCi-eacyl, Ce- aryl, Ce- arylamino, Ce-wdiarylamino, and Ce-waryloxy, andm is 0 or 1.P7022PC0065. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (VIIIe), whereinR1is selected from methyl, ethyl, F, Cl, Br, I, thien-2-yl, and thien-3-yl,R3is H,PhR5is selected from fluoro, chloro, bromo, iodo, Ci-ealkoxy, and C6-10aryloxy, and m is 0 or 1.

66. The compound according to any one of the preceding claims, wherein the compound has the structure of formula (VIIIe), whereinR1is selected from methyl, Br, and thien-2-yl,R3is H,PhR2is selected from 4-chlorophenyl, 3-(methyloxycarbonyl)phenyl, 3- hydroxyphenyl, methyl, and 1-adamantyl.

67. The compound according to any one of the preceding claims, wherein the compound has a structure selected from:ı33P7022PC0068. The compound according to any one of the preceding claims, wherein the compound has a structure selected from:P7022PC00NHO69. The compound according to any one of the preceding claims, wherein said compound is a positive allosteric modulator of the GABAA receptor.

70. The compound according to any one of the preceding claims, wherein said compound is a negative allosteric modulator of the GABAA receptor.

71. The compound according to any one of the preceding claims, wherein said compound is a positive allosteric modulator of the GABAA receptor α4β1δ subtype.

72. The compound according to any one of the preceding claims, wherein said compound is a positive allosteric modulator of the GABAA receptor a4p2d subtype.

73. The compound according to any one of the preceding claims, wherein said compound is a positive allosteric modulator of the GABAA receptor α4β2δ subtype.

74. The compound according to any one of the preceding claims, wherein, said compound is a positive modulator of the GABAA receptor a4Pid, c Pad, and α4β3δ subtypes.

75. The compound according to any one of the preceding claims, wherein said compound is a negative allosteric modulator of the GABAA receptor a4Pid subtype and a positive allosteric modulator of the c Pad and / or the c Pad GABAA receptor subtype.P7022PC0076. The compound according to any one of the preceding claims, wherein said compound has a logP value in the range of 1.5 to 3.9, such as 1.5 to 3.8, such as 1.

5. to 3.7, such as 1.5 to 3.6.

77. The compound according to any one of the preceding claims, wherein said compound has a logP value in the range of 2.8 to 3.9, such as 2.9 to 3.8, such as 3.0 to 3.7, such as 3.1 to 3.6.

78. The compound according to any one of the preceding claims, wherein the compound is not any one of: / V-[2-(2-Thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-Methyl- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,2-Methyl- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[8-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,3-Methyl- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-Hydroxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-Methyl- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Methyl- / V-[6-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 3,5-Dimethyl- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,3-Methyl- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Methoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-Methyl- / V-[8-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[2-(2-Thienyl)imidazo[1,2-a]pyridin-3-yl]-2-naphthalenecarboxamide, / V-[2-(2-Thienyl)imidazo[1,2-a]pyridin-3-yl]-1 -naphthalenecarboxamide, 2-lodo- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-lodo- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-Chloro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-(2,6-Di-2-thienylimidazo[1,2-a]pyridin-3-yl)benzamide,2-Bromo- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-Bromo- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,3,4-Dimethyl- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,2-Fluoro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,2-Methoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,P7022PC002-Chloro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,3-lodo- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,3-Methoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Bromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,3-Fluoro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,3-Bromo- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,3-Chloro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Chloro-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-(1,1-Dimethylethyl)- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 2-[[[2-(2-Thienyl)imidazo[1,2-a]pyridin-3-yl]amino]carbonyl]benzoic acid, 3,4-Dimethyl- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Chloro- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Methoxy- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Fluoro- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Chloro- / V-[6-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Phenyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-Methoxy- / V-[6-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 2-Ethoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-Chloro- / V-[8-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Chloro-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-methylbenzamide, 4-Methoxy- / V-[8-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Chloro- / V-[2-(5-methyl-2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 2-Ethoxy- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Nitro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[7-Bromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-chlorobenzamide, 4-Chloro- / V-[6-iodo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 2,6-Difluoro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-Chloro- / V-[6-chloro-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Bromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-chlorobenzamide, 4-Chloro- / V-[6-fluoro-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Butoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-nitrobenzamide, 3-Nitro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-3-nitrobenzamide,P7022PC005-Bromo-2-chloro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Bromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-methoxybenzamide, / V-[6-Chloro-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-methoxybenzamide, / V-[2-(2-Thienyl)imidazo[1,2-a]pyridin-3-yl]-1,3-benzodioxole-5-carboxamide, 4-(Acetyloxy)- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,2.4-Dimethoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,3.4-Dimethoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,2.3-Dimethoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-(Phenylmethoxy)- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Chloro- / V-[6-methoxy-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 3.4-Dichloro- / V-[8-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 2.4-Dichloro- / V-[8-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-1,3-benzodioxole-5-carboxamide,4-Methyl-3-nitro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Bromo-8-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-chlorobenzamide, / V-[2-(2-Thienyl)imidazo[1,2-a]pyridin-3-yl]-3-(trifluoromethyl)benzamide, 3.5-Dinitro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-hydroxybenzamide, 4-[[(1-Oxo-2-propen-1-yl)amino]methyl]- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-Chloro- / V-[6,8-dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-fluorobenzamide, 2-Chloro-4,5-difluoro- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,4-Chloro- / V-[6-(1-methylethoxy)-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-3- (trifluoromethyl)benzamide,3.4.5-Triethoxy- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-methoxybenzamide, 4-Butoxy- / V-[6-chloro-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, / V-[6-Bromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-butoxybenzamide, 4-Chloro-3-nitro- / V-[2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide,P7022PC003,4,5-Triethoxy- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Chloro- / V-[2-(2-thienyl)-6-(trifluoromethyl)imidazo[1,2-a]pyridin-3- yl]benzamide, / V-[6-Bromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-phenoxybenzamide, 4-Chloro- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-3-nitrobenzamide, Ethyl 3-[(4-chlorobenzoyl)amino]-2-(2-thienyl)imidazo[1,2-a]pyridine-6- carboxylate,8-Chloro-2,3-dihydro- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-1,4- benzodioxin-6-carboxamide,4-Butoxy- / V-[6,8-dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]benzamide, 4-Chloro- / V-[8-(phenylmethoxy)-2-(2-thienyl)imidazo[1,2-a]pyridin-3- yl]benzamide, / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-(2- fluoroethoxy)benzamide, / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-(4- fluorobutoxy)benzamide, / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-(3- fluoropropoxy)benzamide, / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-3-(1- pyrrolidinylsulfonyl)benzamide,N-(2-(thiophen-2-yl)imidazo[1,2-a]pyridin-3-yl)-2-naphthamide, / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-(4- morpholinylsulfonyl)benzamide, / V-[7-Methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-3-(4- morpholinylsulfonyl)benzamide,4-Methoxy- / V-[7-methyl-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-3-(1- pyrrolidinylsulfonyl)benzamide, and / V-[6,8-Dibromo-2-(2-thienyl)imidazo[1,2-a]pyridin-3-yl]-4-[[(1,1- dimethylethyl)diphenylsilyl]oxy]benzamide.

79. A pharmaceutical composition comprising the compound according to any one of the preceding claims.

80. The compound or the pharmaceutical composition according to any one of the preceding claims for use in medicine.P7022PC0081. The compound or the pharmaceutical composition according to any one of the preceding claims for use in the treatment of a neurological disease or disorder.

82. The compound or the pharmaceutical composition for use according to any one of the preceding claims, wherein the neurological disease or disorder is ameliorated by inhibition of the GABAA receptor, such as the extrasynaptic GABAA receptor.

83. The compound or the pharmaceutical composition for use according to any one of the preceding claims, wherein the neurological disease or disorder is ameliorated by stimulation of the GABAA receptor, such as the extrasynaptic GABAA receptor.

84. The compound or the pharmaceutical composition for use according to any one of the preceding claims, wherein the neurological disease or disorder is selected from epilepsy, seizures, cognitive impairment, brain injury, and succinic semialdehyde dehydrogenase (SSADH) deficiency.

85. The compound or the pharmaceutical composition for use according to any one of the preceding claims, wherein the epilepsy is absence epilepsy.

86. The compound or the pharmaceutical composition for use according to any one of the preceding claims, wherein the brain injury is acute brain injury or chronic brain injury87. The compound or the pharmaceutical composition for use according to any one of the preceding claims, wherein the neurological disease or disorder is Alzheimer’s disease or a similar condition with cognitive decline.

88. The compound or the pharmaceutical composition for use according to any one of the preceding claims, wherein the brain injury is stroke, such as ischemic stroke.

89. The compound or the pharmaceutical composition for use according to any oneP7022PC00of the preceding claims, wherein the neurological disease or disorder is selected from anxiety disorders, panic disorders, agoraphobia, animal and other phobias including social phobias, obsessive-compulsive disorder, stress disorders, and generalized or substance-induced anxiety disorder; neuroses; convulsions; migraine; depressive or bipolar disorders, for example singleepisode or recurrent major depressive disorder, post-partum depression, dysthymic disorder, bipolar I and bipolar II manic disorders, and cyclothymic disorder, psychotic disorders including schizophrenia, epilepsy, Parkinson's disease and Huntington's disease; neurodegeneration arising from cerebral ischemia, attention deficit hyperactivity disorder; burette's syndrome; speech disorders, including stuttering; disorders of circadian rhythm, e.g. in subjects suffering from the effects of jet lag or shiftwork pain and nociception; emesis, including acute, delayed and anticipatory emesis, in particular emesis induced by chemotherapy or radiation, as well as motion sickness, and post-operative nausea and vomiting; eating disorders including anorexia nervosa and bulimia nervosa; premenstrual syndrome; muscle spasm or spasticity, e.g. in paraplegic patients; hearing disorders, including tinnitus and age-related hearing impairment, presbycusis and hyperacusis; urinary incontinence; the effects of substance abuse or dependency, including alcohol withdrawal; cognition disorders, for example in subjects suffering from dementing conditions such as Alzheimer's disease; sleep disorders such as insomnia, vestibular disorders such as Meniere's disease, benign paroxsysmal positional vertigo (BPPV), endolymphatic hydrops and mal de debarquement syndrome; attention deficit / hyperactivity disorder; intention tremor; and restless leg syndrome.

90. The compound or the pharmaceutical composition for use according to any one of the preceding claims, wherein the insomnia is primary insomnia or secondary insomnia.

91. The compound or the pharmaceutical composition for use according to any one of the preceding claims, wherein the secondary insomnia is associated with or due to another condition, such as a neurodevelopmental disorder, a neurological disease, a neurodegenerative disease, a neuropsychiatric disease, a cardiometabolic disorder, an immune-related disturbance, and an age-related sleep disturbance.P7022PC0092. A method of treating a neurological disease or disorder, said method comprising administering the compound or the pharmaceutical composition according to any one of the preceding claims to a subject in need thereof.

93. A method of inhibiting the GABAA receptor in a subject in need thereof, said method comprising administering the compound or the pharmaceutical composition according to any of the preceding claims to the subject.

94. A method of activating the GABAA receptor in a subject in need thereof, said method comprising administering the compound of the disclosure or the pharmaceutical composition of the disclosure to the subject.

95. A method of activating the GABAA receptor α4β2δ and / or α4β3δ subtypes while inhibiting the GABAA receptor α4β1δ subtype in a subject in need thereof, said method comprising administering the compound of the disclosure or the pharmaceutical composition of the disclosure to the subject.

96. The method according to any one of the preceding claims, wherein the GABAA receptor is extrasynaptic.

97. Use of a compound according to any one of the preceding claims for the manufacture of a medicant for the treatment of a neurological disease or disorder.