Blocking primer and use thereof

Abstract

[Problem] To provide a novel means for improving the accuracy and the output of next generation sequencing (NGS) by using a longer 18S rDNA region than in the prior art as the subject of analysis and increasing the proportion of infectious eukaryotic 18S rDNA in the 18S rDNA used for the analysis. [Solution] Provided is a blocking primer for suppressing the amplification of mammalian 18S rDNA during the amplification of eukaryotic 18S rDNA. Also provided is a method for amplifying non-mammalian eukaryotic 18S rDNA, said method comprising a step in which a universal primer set is used to carry out, in the presence of the blocking primer, a nucleic acid amplification reaction in which a nucleic acid sample that includes mammal-derived DNA and non-mammalian eukaryotic organism-derived DNA is used as a template. Further provided is a method for analyzing non-mammalian eukaryotic 18S rDNA, said method comprising a step in which the nucleotide sequence of an amplicon that is obtained by the nucleic acid amplification reaction is analysed.

Description

Blocking primer and its use

[0001] The present invention provides a blocking primer for suppressing the amplification of mammalian 18S rDNA in the amplification of eukaryotic 18S rDNA, a kit containing the blocking primer, and a method for amplifying and analyzing non-mammalian eukaryotic 18S rDNA using the same.

[0002] In recent years, the increasing international movement of people and goods due to globalization has led to a serious problem of parasite transmission to areas outside of traditional endemic regions. Therefore, current parasite testing needs to target a wider range of parasites than before, but developing individual testing methods for each target parasite is inefficient both in terms of time and cost.

[0003] Next-generation sequencing (NGS) is used for the comprehensive analysis of infectious eukaryotes, such as parasites, based on the sequence similarity of the 18S rRNA gene (hereinafter also called 18S rDNA) region, as it can decode a large number of nucleotide sequences at once. In particular, when performing NGS analysis on DNA derived from clinical samples, attempts are being made to enrich the 18S rDNA of infectious eukaryotes in order to reduce the influence of host DNA, which is present in large quantities in clinical samples.

[0004] For example, Non-Patent Document 1 describes the amplification of the 18S rDNA V9 region from human placental DNA in the presence of blocking primers that suppress the amplification of mammalian 18S rDNA, and the detection of pathogenic eukaryotes such as malaria parasites and Toxoplasma gondii by performing NGS analysis. Non-Patent Document 2 describes the amplification of the 18S rDNA V3 region from host-derived DNA treated with restriction enzymes that digest 18S rDNA at cleavage sites present only in the host sequence, and the detection of various pathogenic eukaryotes by performing NGS analysis. Non-Patent Document 3 describes the amplification of the 18S rDNA V9 region or V4-V5 region using a previously reported primer set without suppressing the amplification of 18S rDNA from host-derived DNA, and the subsequent NGS analysis, noting that it is difficult to identify the species of organism.

[0005] NGS (Next Generation Sequencing) presents challenges such as the need for expensive equipment, the time-consuming nature of the analysis, and the requirement for high accuracy and high output to comprehensively analyze infectious eukaryotes. In recent years, the development of portable sequencers has gradually resolved the issues of cost and time, but there is still room for improvement in terms of accuracy and output.

[0006] Lager et al., Microbiome. 2018 Sep 1;6(1):151. doi: 10.1186 / s40168-018-0529-x.Fraherty et al.. Microbiome. 2018 Sep 17;6(1):164. doi: 10.1186 / s40168-018-0540-2.Kounosu et al., Sci Rep. 2019 Oct 31;9(1):15789. doi: 10.1038 / s41598-019-52422-z.

[0007] This invention provides a novel method for improving the accuracy and output of NGS analysis of 18S rDNA regions using nucleic acid samples containing mammalian DNA and non-mammalian eukaryotic DNA. This is achieved by targeting longer 18S rDNA regions than in conventional methods and by increasing the proportion of infectious eukaryotic 18S rDNA in the 18S rDNA used for analysis.

[0008] The inventors have found an oligonucleotide that can function as a blocking primer for the amplification of mammalian 18S rDNA in the amplification of eukaryotic 18S rDNA.

[0009] This disclosure provides the following inventions: Item 1. (a) the nucleotide sequence shown in Sequence ID No. 1, (b) a nucleotide sequence in which 1 to 35 nucleotides are deleted from the 3' end of sequence (a), (c) a nucleotide sequence having at least 90% sequence identity with sequence (a) or (b), or (d) a blocking primer comprising a nucleotide sequence in which 1 to 10 nucleotides in the range from the 5' end to the 3' end of any of sequences (a) to (c) are replaced with nucleotides having universal bases, wherein the blocking primer has a modification at the 3' end that inhibits extension by DNA polymerase, and a nucleic acid amplification reaction is performed using a nucleic acid sample containing mammalian DNA and non-mammalian eukaryotic DNA as a template, using universal primer F566 consisting of the nucleotide sequence shown in Sequence ID No. 3 and universal primer 1774R consisting of the nucleotide sequence shown in Sequence ID No. 4, or (e) the nucleotide sequence shown in Sequence ID No. 2, (f) a nucleotide sequence in which 1 to 20 nucleotides are deleted from the 3' end of sequence (e) A method for amplifying non-mammalian eukaryotic 18S rDNA, comprising the step of performing a nucleic acid amplification reaction using a nucleic acid sample containing mammalian DNA and non-mammalian eukaryotic DNA as a template, in the presence of a blocking primer comprising a nucleotide sequence having at least 90% sequence identity with sequence (e) or (f), or (h) a nucleotide sequence in which 1 to 10 nucleotides located in the range from the 4th to the 3' end of any of sequences (e) to (g) are replaced with nucleotides having a universal base, and the blocking primer having a modification at the 3' end that inhibits extension by DNA polymerase, using a universal primer HsF661 comprising the nucleotide sequence shown in SEQ ID NO: 5 and a universal primer 1774R comprising the nucleotide sequence shown in SEQ ID NO: 4. Item 2. The method according to Item 1, wherein in sequence (d), 2 to 8 consecutive nucleotides are replaced with nucleotides having a universal base.Item 3. The method according to item 1 or 2, wherein the substitution of nucleotides with universal bases in sequence (d) is located in the range from the 20th to the 3' end from the 5' end. Item 4. The method according to item 1 or 2, wherein the total length of sequence (d) is 37 nucleotides or more, and the substitution of nucleotides with universal bases in sequence (d) is located in the range from the 20th to the 37th position from the 5' end. Item 5. The method according to item 1, wherein in sequence (h), 2 to 8 consecutive nucleotides are substituted with nucleotides having universal bases. Item 6. The method according to item 1, wherein the total length of sequence (h) is 25 nucleotides or more, and the substitution of nucleotides in sequence (h) is located in the range from the 20th to the 25th position from the 5' end.Item 7. Universal bases include deoxyinosine, inosine, 7-deaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'-OMeinosine, 2'-Finosine, deoxy3-nitropyrrole, 3-nitropyrrole, 2'-OMe3-nitropyrrole, 2'-F3-nitropyrrole, 1-(2'-deoxy-β-D-ribofuranosyl)-3-nitropyrrole, deoxy5-nitropyrrole Lu, 5-nitroindole, 2'-OMe5-nitroindole, 2'-F5-nitroindole, deoxy4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy4-aminobenzimidazole, 4-aminobenzimidazole, deoxynebularin, 2'-Fnebularin, 2'-F4-nitrobenzimidazole, PNA-5-introindole, PNA-nebularin, PN The method according to any one of claims 1 to 6, selected from the group consisting of A-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, morpholino-5-nitroindole, morpholino-nebularin, morpholino-inosine, morpholino-4-nitrobenzimidazole, morpholino-3-nitropyrrole, phosphoramidate-5-nitroindole, phosphoramidate-nebularin, phosphoramidate-inosine, phosphoramidate-4-nitrobenzimidazole, phosphoramidate-3-nitropyrrole, 2'-O-methoxyethylinosine, 2'-O-methoxyethylnebularin, 2'-O-methoxyethyl 5-nitroindole, 2'-O-methoxyethyl 4-nitrobenzimidazole, and 2'-O-methoxyethyl 3-nitropyrrole. Claim 8. The method according to any one of claims 1 to 6, wherein the universal base is selected from the group consisting of deoxyinosine, inosine, 1-(2'-deoxy-β-D-ribofuranosyl)-3-nitropyrrole and 5-nitroindole. Claim 9. The method according to claim 1, wherein the blocking primer consists of the nucleotide sequence shown in any of SEQ ID NOs: 1, 2, 7-9 and 12-20. Claim 10. The method according to claim 1, wherein the blocking primer consists of the nucleotide sequence shown in SEQ ID NO: 21.11. The method according to any one of items 1 to 10, wherein the modification that inhibits DNA polymerase elongation is selected from the group consisting of phosphorylation, addition of an alkyl linker, addition of a polyethylene glycol linker, introduction of a dideoxynucleotide, and introduction of an inverted nucleotide. 12. The method according to any one of items 1 to 11, wherein the blocking primer further comprises a chemically modified nucleotide. 13. The method according to any one of items 1 to 12, wherein at least one of the universal primers has an overhang sequence added for adding an adapter sequence for next-generation sequencing. 14. The method according to any one of items 1 to 13, wherein in the nucleic acid amplification reaction, in addition to the blocking primer, a peptide nucleic acid consisting of the sequence shown in SEQ ID NO: 6 is present. 15. The method according to any one of items 1 to 14, wherein the non-mammalian eukaryote uses a mammal as its host. 16. The method according to any one of items 1 to 15, wherein the nucleic acid sample is prepared from a sample taken from a mammal. 17. A method for analyzing 18S rDNA of a non-mammalian eukaryote, comprising the steps of performing a nucleic acid amplification reaction as defined in any one of items 1 to 16, and analyzing the nucleotide sequence of an amplicon obtained by the nucleic acid amplification reaction. Item 18. A blocking primer comprising: (a) the nucleotide sequence shown in Sequence ID No. 1; (b) a nucleotide sequence in which 1 to 35 nucleotides are deleted from the 3' end of sequence (a); (c) a nucleotide sequence having at least 90% sequence identity with sequence (a) or (b); or (d) a nucleotide sequence in which 1 to 10 nucleotides in the range from the 5th to the 3' end of any of sequences (a) to (c) are replaced with nucleotides having universal bases, wherein the blocking primer has a modification at the 3' end that inhibits elongation by DNA polymerase. Item 19. A kit for amplifying non-mammalian eukaryotic 18S rDNA, comprising the blocking primer described in item 18, universal primer F566 consisting of the nucleotide sequence shown in SEQ ID NO: 3, and universal primer 1774R consisting of the nucleotide sequence shown in SEQ ID NO: 4.Item 20. A blocking primer comprising (e) the nucleotide sequence shown in Sequence ID No. 2, (f) a nucleotide sequence in which 1 to 20 nucleotides are deleted from the 3' end of sequence (e), (g) a nucleotide sequence having at least 90% sequence identity with sequence (e) or (f), or (h) a nucleotide sequence in which 1 to 10 nucleotides in the range from the 4th nucleotide from the 5' end to the 3' end of any of sequences (e) to (g) are replaced with nucleotides having universal bases, wherein the blocking primer has a modification at the 3' end that inhibits extension by DNA polymerase. Item 21. A kit for amplifying non-mammalian eukaryotic 18S rDNA comprising the blocking primer according to Item 20, a universal primer HsF661 comprising the nucleotide sequence shown in Sequence ID No. 5, and a universal primer 1774R comprising the nucleotide sequence shown in Sequence ID No. 4. Item 22. The kit according to Item 19 or 21, further comprising a peptide nucleic acid comprising the sequence shown in Sequence ID No. 6.

[0010] According to the present invention, it is possible to amplify long non-mammalian eukaryotic 18S rDNA of 1 kbp or more while suppressing the amplification of mammalian 18S rDNA. This makes it possible to efficiently enrich non-mammalian eukaryotic 18S rDNA in nucleic acid amplification reactions using nucleic acid samples containing nucleic acids derived from a host mammal and nucleic acids derived from a non-mammalian eukaryote.

[0011] Figure 1 shows the electrophoresis image of 18S rDNA amplification products obtained by PCR using universal primers F566 and 1774R and blocking primer MBR(0)prototype, with nucleic acid samples prepared from healthy whole blood samples mixed with Trypanosoma brucei as templates. Figure 2 shows the electrophoresis image of 18S rDNA amplification products obtained by PCR using universal primers F566 and 1774R and each blocking primer that does not contain deoxyinosine, with nucleic acid samples prepared from healthy whole blood samples mixed with T. brucei as templates. Figure 3 shows the electrophoresis image of 18S rDNA amplification products obtained by PCR using universal primers F566 and 1774R and each blocking primer that contains deoxyinosine, with nucleic acid samples prepared from healthy whole blood samples mixed with T. brucei as templates. Figure 4 shows T. Figure 5 shows electrophoretic images of 18S rDNA amplification products obtained by PCR using universal primers F566 and 1774R and blocking primers containing deoxyinosine, with nucleic acid samples prepared from healthy human whole blood samples mixed with T. brucei as templates. Figure 5 shows a graph representing the ratio of human sequences to T. brucei sequences for the 18S rDNA amplification products shown in the electrophoretic images of Figure 3. The left and right graphs use whole blood samples from different donors. Figure 6 shows a graph representing the ratio of identified species for 18S rDNA amplification products obtained by PCR using universal primers F566 and 1774R, blocking primer MBR(0)prototype, and PNA_Mammal_Block, with nucleic acid samples prepared from bovine whole blood samples mixed with parasitic infections as templates. Species with 10 or fewer reads are labeled "others". Figure 7 shows a graph representing the proportion of identified species in the V9 and V4-9 regions of 18S rDNA amplification products obtained by PCR using universal primers F566 and 1774R, blocking primer MBR(0)prototype, and PNA_Mammal_Block, with nucleic acid samples prepared from bovine whole blood samples mixed with parasites as templates. Species with 10 or fewer reads were labeled "others".Figure 8 shows electrophoretic images of 18S rDNA amplification products obtained by PCR (center) using universal primers F566 and 1774R and blocking primer MBR(0)prototype, and by PCR (right) using universal primers HsF661 and 1774R and blocking primer BP-2, using nucleic acid samples prepared from whole blood samples of healthy individuals mixed with T. brucei as templates. Figure 9 shows T. Figure 9A shows electrophoretic images of 18S rDNA amplification products obtained by PCR using universal primers F566 and 1774R and blocking primers MBR(0)prototype and PNA_Mammal_Block, with nucleic acid samples prepared from healthy whole blood samples mixed with T. brucei (Figure 9A), Plasmodium falciparum (Figure 9B), or Babesia bovis (Figure 9C) as templates. A graph showing the proportion of identified species for each amplification product is also shown. In the electrophoresis in Figure 9A, lanes 1 and 7 represent amplification products from controls without template addition, while lanes 2-6 and 8-12 represent amplification products from healthy whole blood nucleic acid samples mixed with 0, 10, 100, 1000, and 10000 T. brucei cells / mL. The amplification products in lanes 1-6 were obtained without the addition of either blocking primer. In the electrophoresis in Figures 9B and 9C, lane 0 shows the amplification products from the control without template addition, while lanes 1-6 show 0, 4000, 20000, and 10. ５ , 5 x 10 ５ and 1.5 × 10 ６ This corresponds to amplification products from nucleic acid samples derived from healthy human whole blood mixed with P. falciparum or B. bovis at a concentration of 1 / mL. Figure 10 shows a graph representing the proportion of identified organisms in 18S rDNA amplification products obtained by PCR using universal primers F566 and 1774R, blocking primer MBR(0)prototype, and PNA_Mammal_Block, with nucleic acid samples prepared from dog blood samples mixed with parasites as templates.

[0012] [Definitions] The following descriptions may be based on representative embodiments or specific examples, but the present invention is not limited to such embodiments or specific examples. In this specification, numerical ranges represented using "~" or "-" mean ranges that include the numbers at both ends as the upper and lower limits, respectively, unless otherwise specified. The upper and lower limits of each numerical range exemplified in this specification can be combined in any way.

[0013] In this disclosure, the term "nucleic acid" refers to an oligomer or polymer composed of nucleotides as monomers, and can be used interchangeably with the terms "oligonucleotide" and "polynucleotide." Examples of nucleic acids include deoxyribonucleic acid (DNA), ribonucleic acid (RNA), and chimeric nucleic acids that contain both deoxyribonucleotides and ribonucleotides as constituent units.

[0014] The terms "region" and "part" in relation to nucleic acids are interchangeable and both refer to a single nucleotide or a sequence of nucleotides contained within a nucleic acid.

[0015] Sequence identity with respect to nucleotide sequences means the percentage of matching nucleotides in the target nucleotide sequence relative to the total length of the reference nucleotide sequence (where the total length includes gaps) after optimal alignment calculated using an algorithm known in the art. The algorithm may preferably consider the introduction of gaps into one or both sequences for optimal alignment. Identity can be calculated, for example, by aligning two nucleotide sequences using NCBI BLAST (National Center for Biotechnology Information Basic Local Alignment Search Tool) with general settings (e.g., E-value = 10; gaps allowed; filtering = ON; match score = 1; mismatch score = -3, etc.).

[0016] 18S rDNA is the DNA that encodes 18S rRNA in eukaryotes. Because 18S rDNA exists in hundreds to thousands of copies within a genome, it can be easily amplified by nucleic acid amplification reactions such as PCR. In this disclosure, 18S rDNA encompasses a partial sequence of 18S rDNA.

[0017] 18S rRNA possesses both highly conserved regions and variable regions (V1-V9 regions) that differ across species. By amplifying the 18S rDNA region corresponding to the variable region of 18S rRNA, analyzing its nucleotide sequence, and comparing it with existing sequence databases, eukaryotic species can be identified. By using NGS for nucleotide sequence analysis of the 18S rDNA region, comprehensive analysis of eukaryotes contained in a sample (metabarcoding analysis) becomes possible.

[0018] A blocking primer is a single-stranded oligonucleotide that has the ability to selectively suppress the amplification of a specific nucleotide sequence in nucleic acid amplification reactions such as PCR, and is used together with an amplification primer set. Blocking primers can selectively suppress the amplification of a specific nucleotide sequence by inhibiting the annealing of the amplification primer to a template nucleic acid containing the specific nucleotide sequence to be suppressed, and / or by inhibiting the extension reaction from the amplification primer. Selective suppression here means reducing the ratio of the amount of amplification product from the specific nucleotide sequence to be suppressed to the total amount of amplification product by at least 1%, preferably at least 2%, and more preferably at least 4%.

[0019] A universal base is a base that has the ability to pair with four types of bases that are naturally occurring DNA bases: adenine, thymine, guanine, and cytosine. Preferably, a universal base has a weaker ability to form hydrogen bonds with other bases than the base that it naturally pairs with.

[0020] [Blocking Primers] This disclosure provides blocking primers (hereinafter also referred to as Blocking Primer 1) comprising: (a) the nucleotide sequence shown in Sequence ID No. 1; (b) a nucleotide sequence in which 1 to 40 nucleotides are deleted from the 3' end of sequence (a); (c) a nucleotide sequence having at least 80% sequence identity with sequence (a) or (b); or (d) a nucleotide sequence in which 1 to 10 nucleotides in any of sequences (a) to (c), in the range from the 5' end to the 3' end, are replaced with nucleotides having a universal base.

[0021] Blocking primer 1 consists of any of the above sequences (a) to (d). Sequence (a) is the nucleotide sequence shown in Sequence ID No. 1. Sequence (b) is a nucleotide sequence obtained by deleting 1 to 5 nucleotides, 1 to 10 nucleotides, 1 to 15 nucleotides, 1 to 20 nucleotides, 1 to 25 nucleotides, 1 to 30 nucleotides, 1 to 35 nucleotides, or 1 to 40 nucleotides from the 3' end of the nucleotide sequence shown in Sequence ID No. 1, preferably 1 to 5 nucleotides, 1 to 10 nucleotides, 1 to 15 nucleotides, 1 to 20 nucleotides, 1 to 25 nucleotides, 1 to 30 nucleotides, or 1 to 35 nucleotides from the 3' end. An example of sequence (b) is the nucleotide sequence shown in any of Sequence ID Nos. 7 to 9.

[0022] Sequence (c) is a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, and even more preferably at least 98% sequence identity with the nucleotide sequence of sequence (a) or (b).

[0023] Sequence (d) is a nucleotide sequence in which 1 to 10, preferably 1 to 8, and more preferably 1 to 6 nucleotides in any of sequences (a) to (c) are replaced with nucleotides having a universal base (hereinafter referred to as universal nucleotides). In other words, sequence (d) corresponds to a universal nucleotide substitution of sequences (a) to (c).

[0024] If sequence (d) is substituted with multiple universal nucleotides, the substitutions may be discontinuous or continuous. A discontinuous substitution means that at least two nucleotides that are not adjacent to each other are substituted, while a continuous substitution means that at least two nucleotides that are adjacent to each other are substituted. In sequence (d), all universal nucleotides may be not adjacent to each other, at least two universal nucleotides may be adjacent to each other and the remaining universal nucleotides may be not adjacent to each other, or all universal nucleotides may be adjacent to each other.

[0025] For example, in sequence (d), 1 to 10 nucleotides, preferably 1 to 8, more preferably 1 to 6 nucleotides, may be discontinuously substituted with universal nucleotides, in which case all universal nucleotides are not adjacent to each other. Alternatively, for example, in sequence (d), 2 to 10 nucleotides, preferably 2 to 8, more preferably 2 to 6 nucleotides, may be continuously substituted with universal nucleotides, in which case sequence (d) may include discontinuous substitutions of universal nucleotides in addition to continuous substitutions of universal nucleotides, as long as the total number of universal nucleotides does not exceed 10.

[0026] The position of the substitution in the universal nucleotide in sequence (d) is not restricted as long as it is within the range from the 5th to the 3' end from the 5' end. When the total length of sequence (d) is 37 nucleotides or more, the position of the substitution may be, for example, within the range from the 5th to the 37th position from the 5' end. When the total length of sequence (d) is 32 nucleotides or more, the position may be, for example, within the range from the 5th to the 32nd position from the 5' end.

[0027] The location of the universal nucleotide substitution in sequence (d) is preferably within the range of 10 to 37 from the 5' end, or, if the total length of sequence (d) is less than 37 nucleotides, preferably within the range of 10 to 3' from the 5' end.

[0028] The location of the universal nucleotide substitution in sequence (d) is more preferably within the range of 15 to 37 from the 5' end, or, if the total length of sequence (d) is less than 37 nucleotides, more preferably within the range of 15 to 3' from the 5' end.

[0029] The location of the universal nucleotide substitution in sequence (d) is more preferably within the range of 20 to 37 from the 5' end, or, if the total length of sequence (d) is less than 37 nucleotides, more preferably within the range of 20 to 3' from the 5' end.

[0030] The position of the universal nucleotide substitution in sequence (d) is more preferably within the range of 26 to 31 from the 5' end. In this case, sequence (d) has a total length of 31 nucleotides or more and is continuously substituted with 1 to 6 universal nucleotides.

[0031] An example of sequence (d) is the nucleotide sequence shown in any of sequence numbers 12 to 20.

[0032] The disclosure also provides a blocking primer (hereinafter referred to as Blocking Primer 2) comprising: (e) the nucleotide sequence shown in Sequence ID No. 2; (f) a nucleotide sequence in which 1 to 20 nucleotides are deleted from the 3' end of sequence (e); (g) a nucleotide sequence having at least 80% sequence identity with sequence (e) or (f); or (h) a nucleotide sequence in which 1 to 10 nucleotides located in the range from the 4th nucleotide from the 5' end to the 3' end of any of sequences (e) to (g) are replaced with universal nucleotides.

[0033] The blocking primer 2 consists of any one of the nucleotide sequences of the above sequences (e) to (h). The sequence (e) is the nucleotide sequence shown in SEQ ID NO: 2. The sequence (f) is a nucleotide sequence in which 1 to 5 nucleotides, 1 to 10 nucleotides, 1 to 15 nucleotides, or 1 to 20 nucleotides, preferably 1 to 5 nucleotides, 1 to 10 nucleotides, or 1 to 15 nucleotides, are deleted from the 3'-terminal side of the nucleotide sequence shown in SEQ ID NO: 2.

[0034] The sequence (g) is a nucleotide sequence having at least 80%, preferably at least 85%, more preferably at least 90%, still more preferably at least 95%, and even more preferably at least 98% sequence identity with the nucleotide sequence of the sequence (e) or (f).

[0035] [[ID=,6]]The sequence (h) is a nucleotide sequence in which 1 to 10, preferably 1 to 8, more preferably 1 to 6 nucleotides are replaced with universal nucleotides in any one of the sequences (e) to (g). That is, the sequence (h) corresponds to a universal nucleotide substitution product of the sequences (e) to (g).

[0036] When the sequence (h) is replaced with a plurality of universal nucleotides, the replacement may be discontinuous or continuous. In the sequence (h), all the universal nucleotides may exist without being adjacent to each other, at least two universal nucleotides may exist adjacent to each other, and the remaining universal nucleotides may exist without being adjacent to each other, or all the universal nucleotides may exist adjacent to each other.

[0037] For example, in the sequence (h), 1 to 10 nucleotides, preferably 1 to 8 nucleotides, more preferably 1 to 6 nucleotides may be discontinuously substituted with universal nucleotides, and at this time, all the universal nucleotides are not adjacent to each other. Also, for example, in the sequence (h), 2 to 10 nucleotides, preferably 2 to 8 nucleotides, more preferably 2 to 6 nucleotides may be continuously substituted with universal nucleotides, and at this time, the sequence (h) may include discontinuous substitution with universal nucleotides in addition to the continuous substitution with universal nucleotides, as long as the total number of universal nucleotides does not exceed 10.

[0038] There is no limitation on the position of substitution with universal nucleotides in the sequence (h) as long as it is within the range from the 4th position from the 5'-end side to the 3'-end. When the full length of the sequence (h) is 25 nucleotides or more, for example, the position of substitution is within the range from the 4th position from the 5'-end side to the 25th position, preferably within the range from the 10th position from the 5'-end side to the 25th position, more preferably within the range from the 15th position from the 5'-end side to the 25th position, and even more preferably within the range from the 20th position from the 5'-end side to the 25th position. When the full length of the sequence (h) is 25 nucleotides or more and the position of substitution is within the range from the 20th position from the 5'-end side to the 25th position, the sequence (h) is substituted with 1 to 6 universal nucleotides. Examples of the sequence (h) include the nucleotide sequence shown in SEQ ID NO: 21.

[0039] Examples of universal bases that can be used in this disclosure include deoxyinosine, inosine, 7-deaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'-OMeinosine, 2'-Finosine, deoxy3-nitropyrrole, 3-nitropyrrole, 2'-OMe3-nitropyrrole, 2'-F3-nitropyrrole, 1-(2'-deoxy-β-D-ribofuranosyl)-3-nitropyrrole, deoxy5-nitropyrrole, 5-nitroindole, 2'-OMe5-nitroindole, 2'-F5-nitroindole, deoxy4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy4-aminobenzimidazole, 4-aminobenzimidazole, deoxynebularine, 2'-Fnebularine, 2'-F4-nitrobenzimidazole, and PNA-5-I Examples include nitroindole, PNA-nebulaline, PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, morpholino-5-nitroindole, morpholino-nebulaline, morpholino-inosine, morpholino-4-nitrobenzimidazole, morpholino-3-nitropyrrole, phosphoramidate-5-nitroindole, phosphoramidate-nebulaline, phosphoramidate-inosine, phosphoramidate-4-nitrobenzimidazole, phosphoramidate-3-nitropyrrole, 2'-O-methoxyethylinosine, 2'-O-methoxyethylnebulaline, 2'-O-methoxyethyl 5-nitroindole, 2'-O-methoxyethyl 4-nitrobenzimidazole, and 2'-O-methoxyethyl 3-nitropyrrole.

[0040] The universal base can preferably be selected from the group consisting of deoxyinosine, inosine, 1-(2'-deoxy-β-D-ribofuranosyl)-3-nitropyrrole, and 5-nitroindole.

[0041] [Modification of Blocking Primers] Blocking primers 1 and 2 have a modification at their 3'-ends that inhibits extension by DNA polymerase. The modification at the 3'-ends of blocking primers 1 and 2 that inhibits extension by DNA polymerase may be any modification known to those skilled in the art as a modification that inhibits extension by DNA polymerase. For example, it can be selected from the group consisting of phosphorylation, addition of an alkyl linker (such as a C2 spacer, C3 spacer, C4 spacer, C6 spacer, C9 spacer, C12 spacer, etc.), addition of a polyethylene glycol linker (such as spacer 9 (triethylene glycol), spacer 18 (hexaethylene glycol), etc.), introduction of a dideoxynucleotide, and introduction of an inverted nucleotide (a nucleotide having a structure in which the 3'-5' is inverted compared to the natural deoxyribonucleotide).

[0042] Blocking primers 1 and 2 may further contain chemically modified nucleotides in addition to natural deoxyribonucleotides (adenine, thymine, guanine, and cytosine) and the above-mentioned universal nucleotides. Examples of chemically modified nucleotides include nucleotides in which the phosphate group (phosphate) is replaced with a chemically modified phosphate group such as phosphorothioate (PS), methylphosphonate, phosphorodithioate, etc.; nucleotides having a cross-linked structure in the sugar moiety [for example, LNA (Locked Nucleic Acid) in which the oxygen atom at the 2'-position and the carbon atom at the 4'-position are cross-linked via a methylene group, ENA cross-linked via an ethylene group, ２ OCH ２ - cross-linked BNA (Bridged Nucleic Acid) via ＣＯＣ ,-NR-CH[[ID=IO]] ２ [[ID=II]]- (R is a methyl or hydrogen atom) cross-linked BNA ＮＣ ,-CH(OCH ３ )- cross-linked cMOE,-CH(CH ３Examples include cEt crosslinked via )-, AmNA crosslinked via amide, and scpBNA crosslinked via methylene with cyclopropane formed at the 6' position; nucleotides in which a methyl group or cationic functional group is introduced at the 5th position of the pyrimidine base; and nucleotides in which the carbonyl group at the 2nd position of the pyrimidine base is replaced with a thiocarbonyl group.

[0043] [Further Blocking Primers] This disclosure further provides nucleic acid analogs of blocking primers 1 and 2, for example, peptide nucleic acid blocking primers 1 and 2 in which the sugar-phosphate backbone of each of blocking primers 1 and 2 is replaced with an N-(2-aminoethyl)glycine backbone. Peptide nucleic acid blocking primers 1 and 2 may be substituted with peptide nucleic acid monomers having universal bases, the number of which can be 1 to 10, and their positions can be determined by replacing the positions of the universal nucleotides in blocking primers 1 and 2 with the 5' end at the N-terminus and the 3' end at the C-terminus. Since peptide nucleic acid blocking primers 1 and 2 are not subject to extension by DNA polymerase, C-terminal modification is not required.

[0044] Blocking primers 1 and 2, and their nucleic acid analogs (hereinafter collectively referred to as the blocking primers of this disclosure), can be artificially synthesized using genetic engineering or chemical synthesis techniques. Methods for genetic engineering, chemical synthesis, synthesis of chemically modified nucleotides, and synthesis of nucleic acids containing them are well known to those skilled in the art.

[0045] The blocking primers of this disclosure can be used to suppress the amplification of mammalian 18S rDNA in the amplification of eukaryotic 18S rDNA.

[0046] [Method for Amplifying Non-Mammalian Eukaryotic 18S rDNA] This disclosure provides a method for amplifying non-mammalian eukaryotic 18S rDNA, comprising the steps of: performing a nucleic acid amplification reaction using a nucleic acid sample containing mammalian DNA and non-mammalian eukaryotic DNA as a template, in the presence of blocking primer 1 or its nucleic acid analog (e.g., peptide nucleic acid blocking primer 1), using universal primer F566 (SEQ ID NO: 3) and universal primer 1774R (SEQ ID NO: 4); or performing a nucleic acid amplification reaction using a nucleic acid sample containing mammalian DNA and non-mammalian eukaryotic DNA as a template, in the presence of blocking primer 2 or its nucleic acid analog (e.g., peptide nucleic acid blocking primer 2), using universal primer HsF661 (SEQ ID NO: 5) and universal primer 1774R.

[0047] The nucleic acid sample used as a template for the nucleic acid amplification reaction is a sample containing mammalian DNA and non-mammalian eukaryotic DNA. The nucleic acid sample may be the sample itself collected from mammalian individuals coexisting with non-mammalian eukaryotes, for example, from mammalian individuals infected with, or suspected of being infected with, non-mammalian eukaryotes, or it may be a sample that has been pre-treated by grinding, homogenizing, centrifugation, or concentration. Preferably, the nucleic acid sample is prepared by concentrating DNA from a sample collected from a mammalian individual coexisting with a non-mammalian eukaryote, for example, by DNA extraction. Samples collected from mammalian individuals may be, for example, body fluids (e.g., blood, lymph, saliva, nasal secretions, tears, gastrointestinal mucus, bone marrow fluid, urine, semen, peritoneal fluid, etc.), feces, tissue sections, puncture fluid, pus, etc.

[0048] Mammals include humans and non-human mammals. Examples of non-human mammals include primates such as chimpanzees and rhesus monkeys, domesticated animals such as pigs, cattle, goats, horses, and sheep, companion animals such as dogs and cats, and rodents such as mice, rats, hamsters, and guinea pigs.

[0049] Non-mammalian eukaryotes are eukaryotes that are not mammals, i.e., eukaryotes other than humans and non-human mammals. Since non-mammalian eukaryotes can use mammals as hosts, specimens taken from mammalian individuals may contain both mammalian-derived DNA and non-mammalian eukaryote-derived DNA. Examples of non-mammalian eukaryotes in this disclosure include protozoa, helminths, and fungi.

[0050] Examples of protozoa include rhizopods (e.g., Entamoeba histolytica, Acanthamoeba spp., Naegleria fowleri), flagellates (e.g., Trypanosoma spp., Giardia duodenalis, Trichomonas vaginalis, Leishmania spp.), sporozoans (e.g., Plasmodium sp., Babesia spp., Hepatozoon spp., Cryptosporidium spp., Sarcocystis fayeri, Toxoplasma gondii), and hairy worms (e.g., Balantidium largeis). Examples include *Blastocystis coli* and *Blastocystis hominis*.

[0051] Examples of helminths include nematodes (such as roundworms like human roundworm (Ascaris lumbricoides), pig roundworm (Ascaris suis), dog roundworm (Ascaris canis), and cat roundworm (Ascaris cati); Anisakis spp.; pinworms (Enterobius vermicularis); round nematodes such as Ancylostoma duodenale, American hookworm (Nacator americanus), and Angiostrongylus cantonensis; rod-shaped nematodes such as Strongyloides stercoralis; Gnatostoma spinigerum, Gnatostoma hispidum, Gnatostoma doloresi, and Gnatostoma japonica) Nipponicum), Oriental eye worm (Thelazia callipaida), Anisakiae nematodes such as Crassicauda giliakiana, Wuchereria bancforti, Dirofilaria immitis; whipworms (Trichuris trichiura); Trichinella spiralis), trematodes (e.g., Plagioorchis such as Clonochis sinensis, Metagonimus yokogawai, Paragonimus westermani, Paragonimus miyazakii; Echinostoma hortense, Fasciola hepatica, Fasciola gigantica, etc.);Folding trematodes such as Schistosoma japnonica, Schistosoma mansoni, Schistosoma haematobium, and Gigantobilharzia sturniae), tapeworms (e.g., Diphyllobothrium nihonkaiense, Diphyllobothrium latum, Diplogonoporiasis grandis, Spirometra erinaceieuropaei, and other pseudophyllae; Taenia saginata, Taenia solium, Echinococcus multilocularis, and Echinococcus granulosus) Examples include cyclofolia (such as Granulosus), acanthocephalans, and nematodes.

[0052] Examples of fungi include yeast-like fungi (e.g., Candida sp., Cryptococcus sp.), filamentous fungi (e.g., Aspergillus sp., Fusarium sp.), and biphasic fungi (e.g., Coccidioides sp., Histoplasma sp.).

[0053] Universal primers F566 and 1774R are primer sets capable of amplifying the 18S rDNA region corresponding to the V4-V9 region of 18S rRNA, while universal primers HsF661 and 1774R are primer sets capable of amplifying the 18S rDNA region corresponding to a part of the V4 region and the V5-V9 region of 18S rRNA. The nucleotide sequence of universal primer 1774R (SEQ ID NO: 4) has variations in which the 4th nucleotide from the 5' end is A or G, the 6th nucleotide is A or C, and the 7th nucleotide is A or T. Universal primer 1774R may be a single oligonucleotide or a mixture of multiple oligonucleotides, as long as it consists of any of these variation sequences. Universal primer 1774R is, for example, a degenerate oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 4. Furthermore, the nucleotide sequence of universal primer HsF661 (SEQ ID NO: 5) has variations in which the 3rd, 14th, and 15th nucleotides from the 5' end are C or T, the 4th nucleotide is A, G, or T, the 11th nucleotide is A or G, and the 12th nucleotide is A, C, or G. Universal primer HsF661 may be a single oligonucleotide or a mixture of multiple oligonucleotides, as long as it consists of any of these variation sequences. Universal primer HsF661 is, for example, a degenerate oligonucleotide consisting of the nucleotide sequence shown in SEQ ID NO: 5.

[0054] By using the set of universal primers described above and the corresponding blocking primers of this disclosure, a nucleic acid amplification reaction (e.g., PCR) can be performed using DNA in a nucleic acid sample as a template, thereby selectively suppressing the amplification of mammalian 18S rDNA while amplifying non-mammalian eukaryotic 18S rDNA. Blocking primer 1 has four nucleotides at its 5' end that overlap with the 3' end of universal primer 1774R, and blocking primer 2 has three nucleotides at its 5' end that overlap with the 3' end of universal primer HsF661. Although not bound by theory, it is thought that the blocking primers of this disclosure inhibit the annealing of the universal primers by hybridizing the binding sites of universal primers 1774R and HsF661, respectively, with the mammalian-specific region adjacent to their 3' end on the 18S rDNA, and that the extension reaction from the blocking primers is inhibited by the modification at the 3' end that inhibits extension by DNA polymerase.

[0055] Universal primers may have an overhang sequence for attaching an adapter sequence for NGS. The adapter sequence for NGS is a sequence that is attached to the nucleotide sequence to be analyzed for NGS analysis. The adapter sequence for NGS can be appropriately configured depending on the NGS platform used, and may include, for example, an index sequence (also called an index or barcode sequence), a support binding sequence, a sequence primer binding sequence, a motor protein binding sequence, etc. The overhang sequence has a nucleotide sequence that is complementary to the terminal portion of the adapter sequence, or to the terminal portion of the complementary sequence of the adapter sequence.

[0056] In the nucleic acid amplification reaction, in addition to the blocking primer of this disclosure, a peptide nucleic acid consisting of the sequence shown in SEQ ID NO: 6 may be present. By combining the blocking primer of this disclosure with the peptide nucleic acid of SEQ ID NO: 6, selective suppression of mammalian 18S rDNA amplification and amplification of non-mammalian eukaryotic 18S rDNA can be performed more effectively.

[0057] The conditions for nucleic acid amplification reactions, such as the composition of the reaction solution (e.g., the type and concentration of enzyme used, primer concentration, template DNA concentration, concentration of each nucleotide substrate, buffer composition, etc.) and the reaction conditions (e.g., the number of cycles for thermal denaturation, annealing, and extension, and temperature, etc.), can be appropriately set considering various factors that are normally taken into account when carrying out nucleic acid amplification reactions, such as the type of enzyme used and the Tm value of the primers. Nucleic acid amplification reactions are performed in vitro.

[0058] The blocking primers of this disclosure can reduce the ratio of the amount of mammalian 18S rDNA amplification product to the total amount of amplification product by, for example, at least 1%, at least 2%, at least 4%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99%.

[0059] [Method for analyzing 18S rDNA of non-mammalian eukaryotes] This disclosure provides a method for analyzing 18S rDNA of non-mammalian eukaryotes, which includes, in addition to the step of performing the nucleic acid amplification reaction described above, the step of analyzing the nucleotide sequence of the amplicon obtained by the nucleic acid amplification reaction.

[0060] The nucleotide sequence analysis of amplicons obtained by nucleic acid amplification reactions can be performed using sequencing techniques known to those skilled in the art. Nucleotide sequence analysis is preferably performed by NGS. The amplicons can be subjected to NGS analysis after being treated with processes such as ligation to add adapter sequences for NGS.

[0061] Furthermore, amplicons with NGS adapter sequences can also be prepared by the 2-step tailored PCR method. In the 2-step tailored PCR method, a 1st PCR is performed using a universal primer with an overhang sequence attached, and then a 2nd PCR is performed using a set of 2nd PCR primers that hybridize with the full length of the overhang sequence or a 5' end portion thereof, with the amplification product of the 1st PCR as a template. The nucleotide sequences of the 2nd PCR primers can be appropriately designed so as to hybridize with the full length of the overhang sequence or a 5' end portion thereof, and so as to amplify the amplicon with the NGS adapter sequence attached.

[0062] By performing nucleic acid amplification reactions using nucleic acid samples from mammalian individuals infected or parasitized by non-mammalian eukaryotes as templates, analyzing the non-mammalian eukaryotic 18S rDNA contained in the amplicons, and comparing the nucleotide sequence information with known sequence databases, it is possible to comprehensively analyze non-mammalian eukaryotes that infect or parasitize mammals.

[0063] In particular, the blocking primers of this disclosure can amplify long non-mammalian eukaryotic 18S rDNA of 1 kbp or more while suppressing the amplification of the host mammalian 18S rDNA. Therefore, by using the blocking primers of this disclosure, comprehensive analysis of non-mammalian eukaryotes can be performed with high output due to the high proportion of non-mammalian eukaryotic 18S rDNA in the entire amplicon, and with high accuracy because the effects of some sequencing errors can be reduced for species analysis based on long 18S rDNA nucleotide sequences.

[0064] [Kit] This disclosure provides a kit for amplifying non-mammalian eukaryotic 18S rDNA, comprising the blocking primer 1 or its nucleic acid analog (e.g., peptide nucleic acid blocking primer 1), universal primer F566 (SEQ ID NO: 3), and universal primer 1774R (SEQ ID NO: 4). This disclosure also provides a kit for amplifying non-mammalian eukaryotic 18S rDNA, comprising blocking primer 2 or its nucleic acid analog (e.g., peptide nucleic acid blocking primer 2), universal primer HsF661 (SEQ ID NO: 5), and universal primer 1774R.

[0065] The kit may further include peptide nucleic acid (SEQ ID NO: 6). The kit may further include the above-mentioned 2nd PCR primer set, PCR reaction reagents (dNTPs, enzymes, buffers, pH adjusters, stabilizers, etc.), DNA extraction reagents, solid support, reaction vessel, instruction manual, etc.

[0066] The present invention will be described in more detail by the following examples, but the present invention is not limited thereto.

[0067] [Materials and Methods] • Nucleic acid sample: 1 × 10⁶ per 1 mL of whole blood from a healthy person ７ Samples were prepared by mixing Trypanosoma brucei with the above sample, and a series of samples (simulated sample series) were prepared by serially diluting the above sample 10-fold with whole blood of a healthy person. Genomic DNA was extracted from 200 μL of each simulated sample series using QuickGene DNA whole blood kit S (DB-S), and the purified DNA eluted into 200 μL was used as a nucleic acid sample for PCR. In addition, 4 × 10¹⁶ DNA was extracted from 1 mL of whole blood of a healthy person. ３ ~1.5 x 10 ６ Sample rows were prepared by mixing one sample of Plasmodium falciparum or Babesia bovis. Genomic DNA was extracted in the same manner as described above, and the purified DNA was used as a nucleic acid sample for PCR.

[0068] For three cattle samples and two dog samples known to be infected with parasites, DNA extracted from whole blood was used as nucleic acid samples for PCR. Of the cattle samples, cattle 1 and cattle 3 were confirmed to be positive for Theileria mutans and T. velifera, respectively, by conventional PCR testing.

[0069] - Primers The following oligoDNAs were used as universal primers for amplifying the 18S rDNA region. Note that 1774R and HsF661 used in the examples are degenerate oligoDNAs. 1774R is a mixture theoretically containing equal amounts of oligoDNA where R is A or G, M is A or C, and W is A or T. HsF661 is a mixture theoretically containing equal amounts of oligoDNA where each Y is C or T, D is A, G, or T, R is A or G, and V is A, C, or G.

[0070] The following oligoDNAs were tested as blocking primers for the blocking primers universal primers F566 and 1774R. All oligoDNAs in Table 2 have their 3' ends modified with a C3 spacer.

[0071] Furthermore, BP-2 (TTGGATCTTTGGGGAGCGGGGCIIIIIITCCGCCGCGAGGGCGAGCCA; SEQ ID NO: 21) was tested as a blocking primer for the universal primers HsF661 and 1774R. BP-2 has a C3 spacer at its 3' end. The sequence shown in SEQ ID NO: 21 is the sequence shown in SEQ ID NO: 2 (TTGGATCTTTGGGGAGCGGGGGGCGGGCGCTCCGCCGCGAGGGAGCCA) in which the 20th to 25th bases from the 5' end are all replaced with deoxyinosine.

[0072] PNA_Mammal_Block (CCCCGCCCTTGCCTC; SEQ ID NO: 6), a peptide nucleic acid, was tested as an alternative blocking primer to the peptide nucleic acid universal primers F566 and 1774R.

[0073] • PCR reaction solution composition: Ampdirect ＴＭ 2x Buffer (Shimadzu Corporation) 7.5 μL KAPA taq Extra (5 U / μL) 0.075 μL Forward Universal Primer [5 μM] 0.9 μL (Final concentration 0.3 μM) Reverse Universal Primer [5 μM] 0.9 μL (Final concentration 0.3 μM) Blocking Primer [20 μM] 1.5 μL (Final concentration 2.0 μM) Nucleic Acid Sample 1.5 μL Add water to make a total volume of 15 μL Reaction conditions 1 (basic conditions): Initial denaturation 95°C 3 min, temperature cycle x 35 (98°C 20 sec, 63°C 15 sec, 55°C 15 sec, 72°C 1 min 30 sec), final extended reaction (72°C 1 min 30 sec) Reaction conditions 2 (when using PNA_Mammal_Block): Initial denaturation 95°C 3 minutes, temperature cycle x 35 (98°C 20 sec, 75°C 15 sec, 63°C 15 sec, 55°C 15 sec, 72°C 1 minute 30 sec), final extension reaction (72°C 1 minute 30 sec)

[0074] Electrophoresis of PCR products: PCR products were separated by electrophoresis on a 1.2% agarose gel, and the DNA was stained with bromide bromide for visualization. In the case of PCR using universal primers F566 and 1774R, human 18S rDNA amplification products were observed at 1.2 kb, T. brucei 18S rDNA amplification products at around 1.6 kb, P. falcipalum 18S rDNA amplification products at around 1.5 kb, and B. bovis 18S rDNA amplification products at around 1.2 kb.

[0075] - Sequence analysis using portable NGS: PCR products were purified by mixing an equal volume of AMPre XP (Beckman Coulter) with the DNA solution. Following the protocol of the library preparation kit LSK-NBD114.96 (Oxford nanopore), barcodes were added to identify each product, and a sequence library was prepared. Sequence data was obtained from the obtained library using a portable next-generation sequencer with a MinION Mk1B sequencer, Flongle adapter, and Flongle flowcell (R10.4.1) (FLO-FLG114). The species of origin was determined for each obtained sequence data using NCBI blastn.

[0076] [Example 1] 10 in 1 mL of whole blood of a healthy person ７ A nucleic acid sample prepared from a sample series containing approximately 100 T. brucei cells was used as a template. PCR was performed under reaction condition 1 using universal primers F566 and 1774R and the blocking primer MBR(0)prototype to amplify 18S rDNA, which was then analyzed by electrophoresis. When PCR was performed without the blocking primer, detection of the T. brucei 18S rDNA amplification product was difficult unless more than 2000 T. brucei cells were present in 200 μL of whole blood. However, when PCR was performed with the MBR(0)prototype, the T. brucei 18S rDNA amplification product could be detected if more than 200 T. brucei cells were present in 200 μL of whole blood (Figure 1). brucei meets the detection limit of the gold standard microscopic examination, while 200 T. brucei cells in 200 μL of whole blood correspond to the detection limit of existing highly sensitive trypanosoma-specific PCR.

[0077] [Example 2] A nucleic acid sample prepared from a sample of 1000 T. brucei cells mixed with 1 mL of whole blood from a healthy person was used as a template. PCR was performed under reaction condition 1 using universal primers F566 and 1774R and the blocking primers in Table 2 to amplify 18S rDNA, which was then analyzed by electrophoresis. Deoxyinosine-free MBR_WT+20, MBR_WT+15, MBR_WT(0), and MBR_WT-15 inhibited the amplification of host human 18S rDNA (Figure 2). MBR+15bp, MBR+10bp, MBR+5bp, MBR(0) prototype, MBR-5bp, MBR-10bp, and MBR-15bp, in which the 26th to 31st bases from the 5' end were all replaced with deoxyinosine, also inhibited the amplification of human 18S rDNA (Figure 3). Furthermore, MBR_Left6I and MBR_Right6I, in which the position of the deoxyinosine in the MBR(0) prototype was shifted to the 5' and 3' ends, respectively, also inhibited the amplification of human 18S rDNA (Figure 4).

[0078] The relative abundance of human 18S rDNA and T. brucei 18S rDNA, as confirmed in the electrophoretic image in Figure 3, was estimated by sequence analysis using portable NGS. When blocking primers other than MBR-15bp were used, the ratio of reads identified as T. brucei to the total number of reads exceeded 4%, confirming good performance as blocking primers (Figure 5 left). Similar results were observed when the healthy donor was changed (Figure 5 right).

[0079] [Example 3] Using nucleic acid samples prepared from the blood of three cattle known to have mixed parasitic infections as templates, PCR was performed under reaction condition 2 using universal primers F566 and 1774R, blocking primer MBR(0)prototype, and PNA_Mammal_Block (final concentration 1.0 μM or 5.0 μM) to amplify 18S rDNA, and the species of origin was determined by sequence analysis and blastn. MBR(0)prototype inhibited the amplification of the host bovine 18S rDNA, thereby enabling the identification of multiple species of Theileria genus protozoa. The inhibition of bovine 18S rDNA amplification by MBR(0)prototype was enhanced by its use in combination with PNA_Mammal_Block (Figure 6).

[0080] [Example 4] Using the nucleic acid sample used in Example 3 as a template, PCR was performed under reaction condition 2 using universal primers F566 and 1774R, blocking primer MBR(0)prototype, and PNA_Mammal_Block (final concentration 5.0 μM) to amplify 18S rDNA, and the sequence was analyzed using portable NGS. From the obtained individual sequence data, the sequences with the universal primer sequences removed were extracted as the V4-9 region. Additionally, the sequence up to 1774R, which is sandwiched between the known 18S rDNA amplification primers 1391F (GTACACACCGCCCCGTC; SEQ ID NO: 22) and EukBr (TGATCCTTCTTGCAGGTTCAACCTAC; SEQ ID NO: 23) and overlaps with EukBr, was removed, and a region of approximately 100-150 bp was extracted as the V9 region. The origin of the organism was determined to be cattle using blastn. Sequences that were not determined to be of cattle origin were treated as candidate pathogen sequences, and species identification was performed using a simple Bayesian classifier based on the k-mer frequency, one of the metagenomic analysis methods. Specifically, using data from the SILVA database, which contains 18S rRNA sequences of eukaryotes, we performed species estimation using a simple Bayesian classifier implemented in the DADA2 package in R. Sequences that were not supported by the species of origin with a probability of 80% or higher were classified as unidentified. In species identification using the V9 region, many sequences were classified as unidentified (Figure 7, left column for each sample), whereas in species identification using the V4-9 regions, the species of origin could be identified for almost all sequences (Figure 7, right column for each sample).

[0081] [Example 5] Using nucleic acid samples prepared from a sample of 1000 T. brucei cells mixed in 1 mL of whole blood from a healthy person as a template, PCR was performed using universal primers F566 and 1774R and blocking primer MBR(0) protein, and PCR was also performed using universal primers HsF661 and 1774R and blocking primer BP-2, each under reaction condition 1 to amplify 18S rDNA, which was then analyzed by electrophoresis. Similar to MBR(0) protein, BP-2 inhibited the amplification of human 18S rDNA (Figure 8).

[0082] [Example 6] 1 × 10⁶ units added to 1 mL of whole blood from a healthy person. １ ~1 x 10 ４ A nucleic acid sample prepared from a sample series containing a mixture of T. brucei, or 4 × 10 in 1 mL of whole blood from a healthy person. ３ ~1.5 x 10 ６ Nucleic acid samples prepared from a sample series containing a mixture of P. falciparum or B. bovis were used as templates. PCR was performed under reaction condition 1 using universal primers F566 and 1774R and blocking primers MBR(0)prototype (final concentration 2 μM) and PNA_Mammal_Block (final concentration 5 μM) to amplify 18S rDNA, which was then analyzed by electrophoresis. Furthermore, the amplified products were subjected to sequence analysis using portable NGS, and the abundance ratio of human 18S rDNA to parasite 18S rDNA was compared based on the number of reads.

[0083] In nucleic acid samples containing a mixture of any of the parasites, increasing the amount of blocking primers resulted in a decrease in human 18S rDNA amplification products and an increase in parasitic 18S rDNA amplification products (Figure 9).

[0084] [Example 7] Using nucleic acid samples prepared from the blood of two dogs (B46, D1) with known mixed parasitic infections as templates, PCR was performed under reaction condition 2 using universal primers F566 and 1774R, blocking primers MBR(0)prototype (final concentration 2 μM), and PNA_Mammal_Block (final concentration 5 μM) to amplify 18S rDNA. The type of organism from which the sample originated was determined by sequence analysis and blastn. The combination of MBR(0)prototype and PNA_Mammal_Block inhibited the amplification of the host canine 18S rDNA, thereby enabling the identification of Babesia, Hepatozoon, Leishmania, and filaria immitis (Figure 10).

Claims

1. A blocking primer comprising: (a) the nucleotide sequence shown in Sequence ID No. 1; (b) a nucleotide sequence from which 1 to 35 nucleotides have been deleted from the 3' end of sequence (a); (c) a nucleotide sequence having at least 90% sequence identity with sequence (a) or (b); or (d) a nucleotide sequence in which 1 to 10 nucleotides in the range from the 5th to the 3' end of any of sequences (a) to (c) are replaced with nucleotides having universal bases, wherein the blocking primer has a modification at the 3' end that inhibits extension by DNA polymerase, and a universal primer F566 consisting of the nucleotide sequence shown in Sequence ID No. 3 and a universal primer 1774R consisting of the nucleotide sequence shown in Sequence ID No. 4 are used to perform a nucleic acid amplification reaction using a nucleic acid sample containing mammalian DNA and non-mammalian eukaryotic DNA as a template, or (e) the nucleotide sequence shown in Sequence ID No. 2; (f) a nucleotide sequence from which 1 to 20 nucleotides have been deleted from the 3' end of sequence (e). A method for amplifying non-mammalian eukaryotic 18S rDNA, comprising the step of performing a nucleic acid amplification reaction using a nucleic acid sample containing mammalian DNA and non-mammalian eukaryotic DNA as a template, in the presence of a blocking primer comprising a nucleotide sequence having at least 90% sequence identity with sequence (e) or (f), or (h) a nucleotide sequence in which 1 to 10 nucleotides located in the range from the 4th to the 3' end of any of sequences (e) to (g) are replaced with nucleotides having a universal base, and the blocking primer having a modification at the 3' end that inhibits extension by DNA polymerase, using a universal primer HsF661 comprising the nucleotide sequence shown in Sequence ID No. 5 and a universal primer 1774R comprising the nucleotide sequence shown in Sequence ID No.

4.

2. The method according to claim 1, wherein in sequence (d), 2 to 8 consecutive nucleotides are replaced with nucleotides having universal bases.

3. The method according to claim 1, wherein the substitution of a nucleotide having a universal base in sequence (d) is located in the range from the 20th position to the 3' end from the 5' end.

4. The method according to claim 1, wherein the total length of sequence (d) is 37 nucleotides or more, and the substitution of nucleotides having a universal base in sequence (d) is located in the range of 20 to 37 from the 5' end.

5. The method according to claim 1, wherein in sequence (h), 2 to 8 consecutive nucleotides are replaced with nucleotides having universal bases.

6. The method according to claim 1, wherein the total length of sequence (h) is 25 nucleotides or more, and the nucleotide substitution in sequence (h) is located in the range from the 20th to the 25th position from the 5' end.

7. Universal bases include deoxyinosine, inosine, 7-deaza-2'-deoxyinosine, 2-aza-2'-deoxyinosine, 2'-OMeinosine, 2'-Finosine, deoxy3-nitropyrrole, 3-nitropyrrole, 2'-OMe3-nitropyrrole, 2'-F3-nitropyrrole, 1-(2'-deoxy-β-D-ribofuranosyl)-3-nitropyrrole, deoxy5-nitropyrrole Roll, 5-nitroindole, 2'-OMe5-nitroindole, 2'-F5-nitroindole, deoxy4-nitrobenzimidazole, 4-nitrobenzimidazole, deoxy4-aminobenzimidazole, 4-aminobenzimidazole, deoxynebularin, 2'-Fnebularin, 2'-F4-nitrobenzimidazole, PNA-5-introindole, PNA-nebularin The method according to claim 1, selected from the group consisting of , PNA-inosine, PNA-4-nitrobenzimidazole, PNA-3-nitropyrrole, morpholino-5-nitroindole, morpholino-nebularin, morpholino-inosine, morpholino-4-nitrobenzimidazole, morpholino-3-nitropyrrole, phosphoramidate-5-nitroindole, phosphoramidate-nebularin, phosphoramidate-inosine, phosphoramidate-4-nitrobenzimidazole, phosphoramidate-3-nitropyrrole, 2'-O-methoxyethylinosine, 2'-O-methoxyethylnebularin, 2'-O-methoxyethyl 5-nitroindole, 2'-O-methoxyethyl 4-nitrobenzimidazole, and 2'-O-methoxyethyl 3-nitropyrrole.

8. The method according to claim 1, wherein the universal base is selected from the group consisting of deoxyinosine, inosine, 1-(2'-deoxy-β-D-ribofuranosyl)-3-nitropyrrole, and 5-nitroindole.

9. The method according to claim 1, wherein the blocking primer comprises a nucleotide sequence shown in any of SEQ ID NOs: 1, 2, 7-9 and 12-20.

10. The method according to claim 1, wherein the blocking primer comprises the nucleotide sequence shown in SEQ ID NO:

21.

11. The method according to claim 1, wherein the modification that inhibits DNA polymerase elongation is selected from the group consisting of phosphorylation, addition of an alkyl linker, addition of a polyethylene glycol linker, introduction of a dideoxynucleotide, and introduction of an inverted nucleotide.

12. The method according to claim 1, wherein the blocking primer further comprises a chemically modified nucleotide.

13. The method according to claim 1, wherein at least one of the universal primers is provided with an overhang sequence for attaching an adapter sequence for next-generation sequencing.

14. The method according to claim 1, wherein, in the nucleic acid amplification reaction, a peptide nucleic acid consisting of the sequence shown in SEQ ID NO: 6 is present in addition to the blocking primer.

15. The method according to claim 1, wherein the non-mammalian eukaryote uses a mammal as its host.

16. The method according to claim 1, wherein the nucleic acid sample is prepared from a specimen taken from a mammal.

17. A method for analyzing 18S rDNA of a non-mammalian eukaryote, comprising the steps of performing a nucleic acid amplification reaction as defined in any one of claims 1 to 16, and analyzing the nucleotide sequence of an amplicon obtained by the nucleic acid amplification reaction.

18. A blocking primer comprising: (a) the nucleotide sequence shown in Sequence ID No. 1; (b) a nucleotide sequence in which 1 to 35 nucleotides are deleted from the 3' end of sequence (a); (c) a nucleotide sequence having at least 90% sequence identity with sequence (a) or (b); or (d) a nucleotide sequence in which 1 to 10 nucleotides in the range from the 5th to the 3' end of any of sequences (a) to (c) are replaced with nucleotides having a universal base, wherein the blocking primer has a modification at the 3' end that inhibits elongation by DNA polymerase.

19. A kit for amplifying non-mammalian eukaryotic 18S rDNA, comprising the blocking primer described in claim 18, universal primer F566 consisting of the nucleotide sequence shown in SEQ ID NO: 3, and universal primer 1774R consisting of the nucleotide sequence shown in SEQ ID NO:

4.

20. A blocking primer comprising: (e) the nucleotide sequence shown in Sequence ID No. 2; (f) a nucleotide sequence obtained by deleting 1 to 20 nucleotides from the 3' end of sequence (e); (g) a nucleotide sequence having at least 90% sequence identity with sequence (e) or (f); or (h) a nucleotide sequence in which 1 to 10 nucleotides located in the range from the 4th nucleotide from the 5' end to the 3' end of any of sequences (e) to (g) are replaced with nucleotides having universal bases, wherein the blocking primer has a modification at the 3' end that inhibits elongation by DNA polymerase.

21. A kit for amplifying non-mammalian eukaryotic 18S rDNA, comprising the blocking primer described in claim 20, a universal primer HsF661 consisting of the nucleotide sequence shown in SEQ ID NO: 5, and a universal primer 1774R consisting of the nucleotide sequence shown in SEQ ID NO:

4.

22. The kit according to claim 19 or 21, further comprising a peptide nucleic acid comprising the sequence shown in Sequence ID No. 6.

Images