Method for increasing production of heme-containing globin (HCG) recombinant protein through co-culture of recombinant strains

Abstract

The present invention is for providing an increase in the production of a recombinant HCG protein through co-culture of recombinant strains. The objective of the present invention is to provide a co-culture system for decomposing lactose into sugar sources (glucose and galactose) required for the growth and protein expression of yeast and Bacillus strains by using the lactose decomposition ability of the Bacillus strain, thereby providing a method for effectively increasing the production of a plant recombinant heme-containing globin protein through co-culture between a recombinant strain expressing a globin protein and a recombinant strain expressing heme.

Description

Enhanced production method of HCG (HEME CONTAINING GLOBIN) recombinant protein through co-culture of recombinant strains

[0001] The present invention aims to provide a method for producing myoglobin bound to porphyrin obtained from strains cultured in this manner, by co-culturing a recombinant strain that produces porphyrin and a recombinant strain that produces globin protein using a symbiotic co-culture system.

[0002]

[0003] Various studies are currently underway to address social issues related to the continuously increasing demand for meat and to replace traditional livestock-based meat production methods. Plant-based meat substitutes and cultured meat are solutions to these problems and are being developed based on advanced scientific technology and consumer preferences, and the related market is growing rapidly.

[0004] Among the key factors in plant-based meat substitutes, the biggest challenge is to sensorially and nutritionally replicate meat. To resolve the off-flavor issue of soybeans—a representative material used for producing plant-based meat substitutes—and to mimic the product's red color and blood taste, leghemoglobin derived from leguminous root nodules—which has a structure similar to animal myoglobin—is being utilized in production. However, extraction methods for plant-derived leghemoglobin suffer from low yields, high unit costs, and difficulties in mass production.

[0005] In addition, common meat is characterized by its red color and bloody taste, which is due to the myoglobin present in muscle tissue. In this myoglobin structure, the heme located at the center plays an important role in giving it the above characteristics.

[0006] The heme mentioned above is a type of porphyrin, and porphyrin is a representative tetradentate chelate found frequently in living organisms, consisting of four linked pyrrole rings. This structure is called a porphin, and its derivatives are called porphyrins. In plants, porphyrins are produced in the form of chlorophyll and play an important role in life activities, and are also called "the pigments of life."

[0007] The heme mentioned above is a precursor of hemoglobin and has a porphyrin ring complexed with ferrous iron and protoporphyrin IX. In the human body, heme plays an important role in transporting oxygen and regulating intracellular pH, and due to its high absorption rate, it is used as an iron supplement. Various forms of porphyrin compounds exist in nature, and recently, they have been gaining attention as high-value compounds, serving as industrial materials such as electrical conductors, pharmaceutical compounds, catalysts, and food ingredients.

[0008] Furthermore, heme can react with nitric oxide (NO) to form a nitrosil-heme complex; during this process, the electronic structure of heme changes, resulting in a red color. Since this reaction is similar to the process in which sodium nitrite, traditionally used in meat processing, reacts with myoglobin to form nitroso-myoglobin, it can effectively mimic the color of meat products. This can serve as an alternative to fundamentally resolve the problem of sodium nitrite reacting with amines in processed meat products to generate nitrosamines, which are carcinogenic substances. Therefore, to summarize, while heme enables the mimicry of red color and blood flavor, it oxidizes easily and raises concerns regarding cytotoxicity. Consequently, the production of myoglobin containing heme complements the drawbacks of heme and holds high utility value as a food ingredient.

[0009] Therefore, if non-animal heme can be produced in an eco-friendly and sustainable manner by mass-producing these heme components through fermentation using microbial metabolic pathways, it could be utilized not only as an additive required for plant-based meat substitutes but also as a material for pharmaceutical and industrial applications.

[0010]

[0011] The present invention aims to provide an enhanced method for producing HCG (heme-containing globin) recombinant protein through co-culture of recombinant strains.

[0012] The present invention aims to replace existing meat production methods and, furthermore, to obtain industrial materials such as electrical conductors, pharmaceutical compounds, catalysts, and food materials as compounds through recombinant strains.

[0013] The present invention is to produce a myoglobin protein in a heme-bound form using yeast that has advantages in the overexpression of plant-derived proteins.

[0014] The present invention is an invention for the stable supply of heme in the food, pharmaceutical, and biotechnology industries. Existing methods of supplying heme through animal tissues, plant roots, and microbial fermentation extracts present limitations in production efficiency, process stability, and sustainability due to ethical issues and high production costs. Therefore, the present invention aims to overcome these limitations and provide a stable supply through genetically modified heme-producing strains and methods for providing them.

[0015]

[0016] In order to solve the aforementioned problem, the present invention aims to provide a method for increasing the production of recombinant HCG protein through co-culture by selecting a recombinant strain.

[0017] As one embodiment of the invention, the present invention may provide a recombinant Bacillus strain that produces heme.

[0018] As an embodiment of the invention, the present invention aims to provide a strain that increases heme productivity by regulating genes related to heme porphyrin biosynthesis of a Bacillus sp. strain, and a method for producing the same.

[0019] As one embodiment of the invention, the Bacillus strain used in the present invention is a Bacillus megeterium strain.

[0020] As one embodiment of the invention, the present invention relates to a more stable form of the hemA gene, which is a gene expressing the heme biosynthesis-related enzyme 'glutamyl-tRNA reductase' in a wild-type Bacillus strain. KK This is an invention to replace the +3 and +4 positions of the hemA gene with KK (Lysine-Lysine / AAA-AAA).

[0021] As one embodiment of the invention, the present invention relates to the hemA KK This invention utilizes a cumate-induced expression system to regulate gene expression.

[0022] As one embodiment of the invention, the present invention may use a recombinant yeast strain to increase the production of recombinant HCG protein.

[0023] As an embodiment of the invention, in order to increase the production of recombinant HCG protein, a recombinant Bacillus strain that produces heme and a recombinant yeast strain may be co-cultured, and specifically, the co-culture may utilize a symbiotic co-culture system.

[0024] More specifically, the present invention aims to produce a myoglobin protein in a heme-bound form by developing an interdependent symbiotic co-culture system of two strains using a recombinant Bacillus strain that produces heme at a high concentration and a recombinant S. cerevisiae strain that produces a globin protein capable of binding heme.

[0025]

[0026] The technology for producing recombinant HCG protein using a symbiotic co-culture system according to the present invention can be utilized for the production of materials based on microbial precision fermentation, diversification of the use of recombinant strains for food materials, etc.

[0027] In the case of general co-culture, it is a method of confirming signal transduction and interactions between cells by culturing different cells together. However, in the case of the symbiotic co-culture of the present invention, it is a method of mutually utilizing metabolites between strains. When only initial metabolites are administered, the byproducts generated through the metabolic pathways of each strain are utilized as metabolites between the strains to grow and proliferate, thereby enabling continuous production of specific metabolites.

[0028]

[0029] Figure 1 is a schematic diagram of the pFBEL1023, plasmid map.

[0030] Figure 2 is a schematic diagram of the fabrication of the pFBEL1023 plasmid.

[0031] Figure 3 is a photograph showing the electrophoresis of the gene used to construct the pFBEL1023 plasmid and its size.

[0032] Figure 4 shows the hemA of the pFBEL1023 plasmid-transformed strain. KK This is a photograph showing the electrophoresis of the PCR product and its size to confirm gene introduction.

[0033] Figure 5 is a picture of the pFBEL1024 plasmid map.

[0034] Figure 6 is an electrophoretic image of the gene used to construct the pFBEL1024 plasmid.

[0035] Figure 7 shows Bm-hemA KK This is an electrophoresis image of the PCR result confirming the removal of the cobA gene in the Ter-ΔcobA strain.

[0036] Figure 8 shows Bm-WT, Bm-hemA KK , Bm-hemA KK Ter strain and Bm-hemA KK Cell growth (OD) of Ter-ΔcobA strain 600 This is a comparison graph.

[0037] Figure 9 is a chromatogram of the standard substance analysis of coproporphyrinogen III heme.

[0038] Fig. 10 shows Bm-wt, Bm-hemA KK This is a chromatogram of the 12-hour culture analysis of the strain.

[0039] Fig. 11 shows Bm-hemA KK This is a chromatogram of the 12-hour culture analysis of the Ter-ΔcobA strain.

[0040] Figure 12 shows Bm-wt and Bm-hemA after 12 hours of culture. KK , Bm-hemA KK -Ter, Bm-hemA KK This is the result of the quantitative analysis of total heme content in the culture medium of the Ter-ΔcobA strain.

[0041] Figure 13 shows Bm-wt and Bm-hemA after 12 hours of culture. KK , Bm-hemA KK -Ter, Bm-hemA KK This is the result of the quantitative analysis of the total coproporphyrinogen III content in the culture medium of the Ter-ΔcobA strain.

[0042] Figure 14 shows the results of confirming the growth of Bacillus strains and the decrease in lactose concentration depending on the presence or absence of a nitrogen source.

[0043] Figure 15 shows the results of confirming lactose degradation by β-galactosidase and the resulting growth of recombinant S. cerevisiae and globin protein induction expression.

[0044] Figures 16 to 18 show the results of confirming the co-culture conditions of recombinant Bacillus strains and S. cerevisiae strains using SC medium.

[0045] Figure 19 shows the results of confirming the expression of recombinant globin protein through co-culture of recombinant Bacillus strains and S. cerevisiae strains using SC medium.

[0046] Figure 20 shows the results of confirming culture characteristics by differentiating wild-type Bacillus strains and recombinant Bacillus strains in symbiotic co-culture using SC medium.

[0047] Figure 21 is the result of confirming the color change of the culture medium and purified protein according to the culture characteristics of Figure 19.

[0048] Figure 22 is a comparison of absorbance between animal hemoglobin and recombinant globin produced by co-culture with wild-type Bacillus strains to verify whether the recombinant globin protein produced in symbiotic co-culture using recombinant Bacillus strains was produced in the form of a holoprotein.

[0049]

[0050] The present invention aims to provide a method for producing recombinant heme-containing globin (HCG) protein with increased production yield through co-culture of recombinant strains.

[0051] The present invention aims to provide a method for producing recombinant heme-containing globin (HCG) protein comprising the step of co-culturing a Bacillus strain and a yeast strain.

[0052] The present invention aims to provide a recombinant Bacillus sp. strain with increased productivity of heme porphyrin.

[0053] As an embodiment of the invention, the recombinant strain may be a recombinant strain of the genus Bacillus (Bacillus sp.), and the recombinant strain of the genus Bacillus may be one or more recombinant strains selected from the group consisting of Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus licheniformis, Bacillus pumilus, Bacillus megaterium, Bacillus clausii, Bacillus polymyxa, Bacillus coagulans, and Bacillus sphaericus; more specifically, it may be one or more recombinant strains selected from the group consisting of Bacillus subtilis and Bacillus megaterium strains, and even more specifically, recombinant Bacillus megaterium It could be a strain.

[0054] In one embodiment of the invention, the heme porphyrin is a metal porphyrin complex composed of a central metal ion and a porphyrin ring structure, and may be one or more selected from the group consisting of Heme A, Heme B, Heme C, Heme D, Heme O, Heme S, and Heme L, and specifically may be one or more selected from the group consisting of Heme B, Heme C, and Heme O.

[0055] In one embodiment of the invention, the porphyrin may be one or more porphyrins selected from the group consisting of uroporphyrinogen I / III (UPG I / III), coproporphyrinogen I / III (CPG I / III), protoporphyrin IX, deuteroporphyrin, mesoporphyrin, and hemin; more specifically, it may be one or more porphyrins selected from the group consisting of uroporphyrinogen III (UPG III), coproporphyrinogen III (CPG III), and protoporphyrin IX; more specifically, it is uroporphyrinogen III.

[0056] As an embodiment of the invention, the recombinant Bacillus strain (Bacillus sp.) with increased productivity of heme porphyrin comprises: a CymR gene expression cassette containing SEQ ID NO. 1; and a hemA containing SEQ ID NO. 2. kk It comprises a plasmid containing a gene expression cassette. More specifically, the hemA KKThe gene expression cassette may include a promoter; and the rnnB1 T1 terminator of SEQ ID NO. 2, and the CymR gene expression cassette may include a promoter; and the T7Te terminator of SEQ ID NO. 1.

[0057] As one embodiment of the invention, the present invention may further include a plasmid for removing the gene of 7 in a recombinant Bacillus strain (Bacillus sp.) with increased productivity of heme porphyrin.

[0058] As one embodiment of the invention, the recombinant Bacillus strain with increased heme productivity may be one in which the heme biosynthesis competitive metabolic pathway enzyme Uroporphyrinogen-III C-methyltransferase has been removed.

[0059] The above-mentioned Uroporphyrinogen-III C-methyltransferase is an enzyme involved in the synthesis of cyclicidin derivatives by transferring methyl groups within Bacillus strains, and the strain is Vitamin B 12 It is an enzyme that plays an important role in the biosynthetic pathway of (cobalamin). In the heme synthesis pathway, when C-methyltransferase acts, vitamin B 12 ...is generated. Therefore, the present invention is intended to further maximize the production of heme by removing the corresponding enzyme and inhibiting the competitive biosynthetic pathway.

[0060] As one embodiment of the invention, the Uroporphyrinogen-III C-methyltransferase may include a cobA gene, specifically, the Uroporphyrinogen-III C-methyltransferase of the Bacillus megaterium strain may be composed of a cobA gene, and more specifically, the Uroporphyrinogen-III C-methyltransferase of the Bacillus megaterium strain may be composed of the cobA gene sequence of SEQ ID NO. 7.

[0061] As one embodiment of the invention, in order to remove Uroporphyrinogen-III C-methyltransferase of the recombinant Bacillus strain, a plasmid that recognizes the downstream nucleotide sequence of the cobA gene of SEQ ID NO. 5 and the upstream nucleotide sequence of the cobA gene of SEQ ID NO. 6 and removes the cobA gene of SEQ ID NO. 7 may be inserted into the recombinant strain.

[0062] As one embodiment of the invention, in the present invention, the heme content in the culture medium of a wild-type Bacillus megaterium strain may be 1.5 to 3 mg / L in 12 hours, specifically 1.7 to 2.5 mg / L, and more specifically 1.8 mg / L.

[0063] As one embodiment of the invention, in the present invention, hemA KK The heme content in the culture medium of the Bacillus megaterium strain may be 3 to 9 mg / L in 12 hours, specifically 4.0 to 8 mg / L, and more specifically 6.7 mg / L.

[0064] As an embodiment of the invention, as an embodiment of the invention, in the present invention, hemA KK-The heme content in the culture medium of the Bacillus megaterium strain may be 3 to 9 mg / L in 12 hours, specifically 4.0 to 8 mg / L, and more specifically 6.9 mg / L.

[0065] As an embodiment of the invention, as an embodiment of the invention, in the present invention, hemA KK The heme content in the culture medium of the Ter-ΔcobA Bacillus megaterium strain may be 5 to 10 mg / L in 12 hours, specifically 6 to 9 mg / L, and more specifically 8.5 mg / L.

[0066]

[0067] As one embodiment of the invention, in the present invention, coproporphyrinogen III may not be produced in the culture medium of a wild-type Bacillus megaterium strain.

[0068] As one embodiment of the invention, in the present invention, hemA KK The coproporphyrinogen III content in the culture medium of the Bacillus megaterium strain may be 1 to 5 mg / L in 12 hours, specifically 2 to 4 mg / L, and more specifically 2.3 mg / L.

[0069] As an embodiment of the invention, as an embodiment of the invention, in the present invention, hemA KK The coproporphyrinogen III content in the culture medium of the Bacillus megaterium strain may be 1 to 5 mg / L in 12 hours, specifically 2 to 4 mg / L, and more specifically 2.5 mg / L.

[0070] As an embodiment of the invention, as an embodiment of the invention, in the present invention, hemAKK The coproporphyrinogen III content in the culture medium of the Ter- ΔcobA Bacillus megaterium strain may be 2 to 8 mg / L in 12 hours, specifically 3 to 6 mg / L, and more specifically 4.3 mg / L.

[0071]

[0072]

[0073] As an embodiment of the invention, the present invention aims to provide a method for producing a recombinant Bacillus sp. strain with increased productivity of heme porphyrin, comprising the following steps.

[0074] (1) CymR gene expression cassette containing sequence number 1 and hemA containing sequence number 2 KK A step of introducing a plasmid containing a gene expression cassette into a Bacillus strain;

[0075] (2) hemA through the expression of the introduced plasmid KK A step that induces gene expression.

[0076] As one embodiment of the invention, the method for producing a recombinant Bacillus strain (Bacillus sp.) with increased heme porphyrin productivity may further include the following steps.

[0077] (a) a step of introducing a plasmid containing genes of SEQ ID NO. 5 and SEQ ID NO. 6 to remove the enzyme expression gene of Uroporphyrinogen-III C-methyltransferase SEQ ID NO. 7 into the above-mentioned Bacillus strain;

[0078] (b) A step of removing the Uroporphyrinogen-III C-methyltransferase enzyme expression gene through the above plasmid.

[0079] As one embodiment of the invention, the present invention may provide a recombinant Bacillus strain with increased productivity of heme porphyrin produced by the above manufacturing method.

[0080]

[0081] As an embodiment of the invention, the strain may be a recombinant yeast strain, and the recombinant yeast strain may be composed of one or more recombinant yeast strains selected from the group consisting of Pichia pastoris (Komataella pastoris), Saccharomyces cerevisiae, Yarrowia lipolytica, Wickerhamomyces anomalus, Kluyveromyces lactis, and Xanthophyllomyces dendrorhous, specifically, it may be composed of one or more recombinant yeast strains selected from the group consisting of Pichia pastoris and Saccharomyces cerevisiae, and more specifically, it may be a recombinant Saccharomyces cerevisiae strain.

[0082] As an embodiment of the invention, the co-culture may be a co-culture of a recombinant Bacillus strain and a recombinant yeast, specifically a symbiotic co-culture, wherein the symbiotic co-culture increases the growth and proliferation of both strains through the production of mutually complementary substances of the strains cultured together, and furthermore, is a method that can produce the final compound they intend to produce immediately without an additional synthesis process.

[0083] Furthermore, the above symbiotic co-culture is a method of mutually utilizing metabolites among strains. When only initial metabolites are administered, the byproducts generated through the metabolic pathways of each strain are mutually utilized as metabolites among the strains to grow and proliferate, thereby enabling continuous production of specific metabolites.

[0084] As an embodiment of the invention, the present invention may provide a method for increasing the production of recombinant HCG protein comprising the following steps.

[0085] (1) Step of producing a recombinant Bacillus strain;

[0086] (2) Step of producing a recombinant yeast strain;

[0087] (3) a step of co-culturing the recombinant Bacillus strain produced in step (1) and the recombinant yeast strain produced in step (2); and

[0088] (4) A step of purifying recombinant HCG protein from the co-cultured strains of step (3) above.

[0089] As one embodiment of the invention, the recombinant Bacillus strain of step (1) may grow through the supply of a nitrogen source, and specifically, may increase the concentration of glucose and galactose through the supply of a nitrogen source. More specifically, the recombinant Bacillus strain may increase the concentration of glucose and galactose through the supply of a nitrogen source, and furthermore, may produce heme.

[0090] In one embodiment of the invention, the recombinant yeast strain of step (2) is grown through the supply of glucose and galactose, and specifically, the concentration of globin may be increased through the supply of glucose and galactose.

[0091] As one embodiment of the invention, the co-culture of the recombinant Bacillus strain and the recombinant yeast strain in step (3) may be a symbiotic co-culture.

[0092] As one embodiment of the invention, the medium of the co-culture of the recombinant Bacillus strain and the recombinant yeast strain in step (3) may further include a nitrogen source.

[0093] The above symbiotic co-culture is a mutually complementary co-culture between strains in which the metabolites of each strain are used as the basic metabolites of other strains, and through this, the desired final metabolite can be obtained without additional processes.

[0094] As an embodiment of the invention, through the co-culture of step (3) above, the recombinant Bacillus strain may secrete β-galactosidase enzyme to provide glucose and galactose, which are glycogens essential for the growth and protein expression of yeast through the breakdown of lactose, and the recombinant yeast may express golbine protein using porphyrin provided by the recombinant Bacillus strain.

[0095] As one embodiment of the invention, the co-culture of step (3) may be performed for 12 to 120 hours, specifically for 24 to 96 hours, and more specifically for 48 to 72 hours.

[0096] As one embodiment of the invention, the Bacillus strain and yeast strain used in the symbiotic co-culture may be co-cultured in a ratio of 0.5:1 to 10, specifically in a ratio of 0.5:2, 0.5:4, or 0.5:10, and more specifically, as the amount of yeast strain increases, the production of protein may increase.

[0097] As one embodiment of the invention, the recombinant HCG protein produced by the above method may have an absorbance similar to that of heme. The absorbance of the recombinant HCG protein may be observed to be high at 300 to 700 nm, specifically at 350 to 600 nm, and more specifically at 400 to 580 nm.

[0098]

[0099] As one embodiment of the invention, the present invention aims to provide a composition for HCG production comprising a strain of the genus Bacillus, a yeast strain, and a co-culture medium.

[0100] As one embodiment of the invention, the present invention aims to provide a kit comprising the above-mentioned composition for HCG production.

[0101] As one embodiment of the invention, the composition for producing HCG may be included in a medical composition.

[0102]

[0103] The present invention may provide a food composition comprising a recombinant HCG protein produced using the above method.

[0104] In addition, the present invention provides a meat substitute flavor composition comprising the above-mentioned HCG protein.

[0105] In addition, the present invention provides a method for producing an alternative meat flavor composition comprising the method for producing the above-mentioned HCG protein.

[0106] In addition, the present invention provides a method for producing a natural colorant composition for meat processing products, comprising the method for producing the above-mentioned HCG protein.

[0107]

[0108] The present invention may utilize a recombinant HCG protein produced using the above method as a food additive. In one embodiment, the recombinant HCG protein may be used as a food additive or a cell culture food ingredient for enhancing the flavor, enhancing aroma, realizing blood taste, realizing meat color, and changing color before and after cooking of plant-based meat substitutes.

[0109] As an embodiment of the invention, the food composition may include food-grade acceptable food additives in addition to the active ingredient. The food additive refers to a component that can be added to food as an auxiliary component, and any food additive known in the industry that is added to the preparation of food of each formulation may be used without limitation. In the present invention, any food additive that assists in the anti-inflammatory effect of the food composition without significantly altering the properties of the food composition may be used without limitation.

[0110] As an embodiment of the invention, the food composition may be, for example, various types of food, beverages, chewing gum, tea, vitamin complexes, health functional foods, etc. Additionally, in the present invention, food includes, but is not limited to, special nutritional foods (e.g., infant formula, baby food, etc.), processed meat products, fish products, tofu products, jelly products, noodles (e.g., ramen, noodles, etc.), health supplements, seasoning foods (e.g., soy sauce, soybean paste, red pepper paste, mixed sauce, etc.), sauces, confectionery products (e.g., snacks), dairy products (e.g., fermented milk, cheese, etc.), other processed foods, kimchi, pickled foods (various types of kimchi, pickled vegetables, etc.), beverages (e.g., fruit and vegetable beverages, soy milk, fermented beverages, etc.), and natural seasonings (e.g., ramen soup mix).

[0111] Examples of food additives include various nutritional supplements, vitamins, minerals (electrolytes), flavoring agents such as synthetic and natural flavoring agents, coloring agents and fillers, pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, and carbonating agents used in carbonated beverages.

[0112] The above food composition may be used as a functional health food. The above health food refers to a food manufactured and processed in the form of tablets, capsules, powders, granules, liquids, pills, etc., using raw materials or ingredients that have functional properties useful to the human body. Here, functional properties mean obtaining effects useful for health purposes, such as regulating nutrients or physiological actions on the structure and function of the human body.

[0113] In addition, the above food composition can be used as an additive to various foods. Foods to which this food composition can be added may include meat, sausage, bread, chocolate, candy, snacks, confectionery, pizza, ramen, other noodles, chewing gum, dairy products including ice cream, various soups, beverages, tea, drinks, alcoholic beverages, and vitamin complexes, without any limitation on the type of food.

[0114]

[0115] As one embodiment of the invention, the present invention may provide a substitute meat comprising a recombinant HCG protein produced using the above method and a method for producing the same. As one specific embodiment of the invention, the substitute meat comprising the recombinant HCG protein may contain various flavoring agents or natural carbohydrates, etc., as additional ingredients, such as in a food composition.

[0116] Examples of the natural carbohydrates described above include monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, etc.; and polysaccharides, such as conventional sugars like dextrin, cyclodextrin, etc.; and sugar alcohols such as xylitol, rubitol, erythritol, etc. The flavoring agent described above may comprise one or more carbohydrates selected from the group consisting of natural flavoring agents (thaumatin), stevia extracts (e.g., rebaudioside A, glycyrrhizin, etc.), and synthetic flavoring agents (saccharin, aspartame, etc.).

[0117] The above-mentioned substitute meat may contain conventional food additives, and unless otherwise specified, its suitability as a food additive shall be determined in accordance with the specifications and standards for the relevant item, based on the general provisions and general test methods of the Food Additives Codex approved by the Korea Food and Drug Administration.

[0118] The above food additives may be chemically synthesized compounds such as ketones, glycine, calcium citrate, nicotinic acid, and cinnamon acid; natural additives such as persimmon dye, licorice extract, crystalline cellulose, sorghum dye, and guar gum; or mixed preparations such as L-sodium glutamate preparations, alkaline noodle additives, preservative preparations, and tar dye preparations. A mixture mixed with excipients, binders, disintegrants, and other additives may be granulated by a conventional method, and then compressed by adding a lubricant, etc., or the mixture may be compressed directly. Additionally, the above-mentioned tablet-form health functional food may contain a binder, etc., as necessary.

[0119] The present invention may provide a cell culture serum for producing cultured meat containing a recombinant HCG protein produced using the above method, and an additive included in an alternative medium material using the same.

[0120]

[0121] One or more specific examples are described in more detail below through embodiments. However, these embodiments are intended to illustrate one or more specific examples and the scope of the present invention is not limited to these embodiments.

[0122]

[0123] Example 1: Construction of a plasmid for hemAKK gene expression using a novel cumate-induced expression system introduced into the Bacillus strain genome

[0124] In this embodiment, the cumate-induced expression system of a Bacillus (Bacillus sp.) strain and hemA KKThis explains the process of constructing a plasmid to introduce a gene cassette containing genes into the genome.

[0125]

[0126] 1-1. Method for producing a Bacillus megaterium strain (hereinafter Bm) with increased heme porphyrin production.

[0127] Escherichia coli (Escherichia coli TOP10) strain was used for the cloning of the plasmid for the B. megaterium strain (hereinafter Bm strain). hemA using a Cumate-induced expression system. KK The NEB Gibson Assembly Kit was utilized to construct the plasmid for gene expression, and the pFBEL1023 plasmid was ultimately constructed (Fig. 1). To this end, a gene containing KK (Lysine-Lysine / AAA-AAA) at the +3 and +4 positions of the hemA gene present in the Bm strain genome was constructed via PCR into the pCT5-bac2.0 plasmid, and this gene was then introduced to produce pCT5-bac2.0-hemA KK A Bm plasmid was constructed. Based on this, the CymR expression cassette, a cumate-induced expression system, was prepared to include both a promoter and a terminator, and hemA KK The entire cassette was obtained by PCR amplification, including terminators on both ends to ensure that both the promoter and terminator of the Bm gene expression cassette were included. The T7Te terminator was used after CymR, and the rnnB1 T1 terminator was used after the hemAKK gene, as shown in Table 1.

[0128] Using the obtained PCR amplification product, cloning was performed according to the Gibson assembly protocol to construct the pFBEL1023 plasmid (Fig. 2). The electrophoresis results of the PCR amplification product are shown in Fig. 3.

[0129] NameSequenceSeq NOT7Te Terminator sequenceGGCTCACCTTCGGGTGGGCCTTTCTGCG1rnnB T1 terminator sequenceCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTC2

[0130]

[0131]

[0132] Example 2: Introduction and verification of plasmid for cassette insertion of hemAKK gene expression in Bacillus strains

[0133] Cumate-induced expression system and hemA KK The pFBEL1023 plasmid, constructed to introduce a gene-containing cassette into the genome, was transformed into the wild-type Bm strain, and the pFBEL1079 plasmid was transformed into the wild-type Bs strain. Colony PCR of the Bm strain was performed using hemA KK Ter-Bm Check primer F, hemA KK hemA resulting from the introduction of a plasmid using the Ter-Bm Check primer R. KK As a result of confirming the introduction of the gene, as shown in Fig. 4, the transformed strains in lanes 1 through 6 were hemA KK A gene cumate-induced expression cassette was introduced, and a PCR amplification product of approximately 2,600 bp was confirmed.

[0134] NameSequenceSeq NO.hemA KK Ter-Bm Check primer FGTATAATTATAGCACGAGCTGG3hemA KKTer-Bm Check primer RGCTGTTTGCAAAACCCACAC4

[0135]

[0136] Example 3: Construction of a plasmid for the removal of a competitive metabolic pathway gene in heme porphyrin biosynthesis

[0137] In this example, a plasmid was constructed to remove the gene for Europorphyrinogen-III C-methyltransferase (hereinafter, Uroporphyrinogen-III C-methyltransferase), an enzyme of the competitive metabolic pathway for heme biosynthesis in Bacillus strains. The enzyme 'Uroporphyrinogen-III C-methyltransferase' is known as the cobA gene in the Bm strain, and the process of constructing a plasmid to remove this gene is described. Escherichia coli (Escherichia coli TOP10) strain was used for cloning the plasmid. The NEB Gibson Assembly Kit was utilized to construct plasmids for gene removal in each strain, and the pFBEL1024 plasmid was finally constructed (Fig. 5). To this end, the upstream and downstream sequences of the cobA gene present in the Bm strain genome, each 1,000 bp, were identified using B. megaterium genome sequence information registered in NCBI, which are shown in Table 3, and the corresponding sequences were amplified via PCR.

[0138] The amplified upstream and downstream fragments were assembled using the pHBintN plasmid and Gibson Assembly, configured to induce homologous recombination. The electrophoresis results of the corresponding PCR products are shown in Figure 6.

[0139]

[0140]

[0141] Example 4: Introduction and Confirmation of Plasmid for Removal of Gene for Competitive Metabolic Pathway in Heme Porphyrin Biosynthesis of Bacillus Strains

[0142] The constructed pFBEL1024 vector is Bm-hemA KK Ter strain (control group, hemA KK The gene-introduced Bm strain was transformed.

[0143]

[0144] Bm-hemA by colony PCR using ΔcobA Check primer F and ΔcobA Check primer R KK As a result of confirming the removal of the cobA gene due to the introduction of the plasmid into the Ter strain, the control group in lane 1 showed the presence of the cobA gene, with a PCR amplification product of approximately 1,300 bp, while the transformed strains in lanes 2 through 7 showed the removal of the cobA gene, with an amplification product of approximately 550 bp. This indicates that the cobA gene was successfully removed from the genome using the pFBEL1024 plasmid (Fig. 7).

[0145] The primer sequences used are shown in Table 4.

[0146] NameSequenceSeq NO.ΔcobA Check primer FATGGCAGCTGTTAATAACAG8ΔcobA Check primer RTTTTGGAAGTATACGTGGAGT9

[0147]

[0148] Example 5: Confirmation of cell growth of a recombinant Bacillus strain modified to enhance heme porphyrin biosynthesis

[0149] 5-1. How to check

[0150] Recombinant Bacillus strains improved to enhance heme biosynthesis (hemA KKBm (Bm-hemA) with an expression cassette inserted and the enzyme 'Uroporphyrinogen-III C-methyltransferase' expression gene removed KK To verify the cell growth rate of Ter-ΔcobA), hemA KK The strain with the inserted expression cassette was compared to the control (Bm-hemA KK It was used as the Ter strain, and the strain was cultured under identical conditions. 250 mL of 2XYT medium was used for culture, and the initial inoculation OD 600 d was set to 0.1, and cultured at 30℃ and 200 rpm. The OD of the two strains 600 When the g reached 0.3–0.4, cumate was added to the medium to a concentration of 50 μM to induce heme production. Both strains were cultured for 48 hours after induction, and OD was measured at 12-hour intervals. 600 Analyzed.

[0151] 5-2. Results

[0152] Bm-hemA KK Ter strain and Bm-hemA KK The Ter-ΔcobA strain exhibited rapid growth corresponding to the exponential phase up to 12 hours of initial culture, and showed a growth stasis corresponding to the stationary phase from 12 hours to 36 hours. Subsequently, from the 36-hour mark, it was confirmed to be a death phase where growth decreased as the OD600 value decreased (Fig. 8).

[0153]

[0154] Example 6: Analysis of culture products of a recombinant Bacillus strain modified to enhance heme porphyrin biosynthesis

[0155] 6-1. Experimental Method

[0156] The culture product was analyzed using the culture medium after 12 hours of culture performed in Example 5. Heme and coproporphyrinogen III were analyzed among the culture products, and the methods for extracting heme from cells and analyzing heme are as follows. To quantify heme and its precursor, coproporphyrinogen III, intracellular and culture medium samples were analyzed separately. For the analysis of intracellular porphyrin, 1 mL of cultured cells was centrifuged at 13,000 rpm for 2 minutes to remove the supernatant, and then 1 mL of acidic acetonitrile buffer (acetonitrile:1.7 M HCl in an 8:2 ratio) was added. Subsequently, the mixture was stirred for 30 seconds and centrifuged at 13,000 rpm for 2 minutes. The obtained supernatant was mixed with saturated magnesium sulfate buffer in a 2:1 ratio and centrifuged at 13,000 rpm for 30 seconds to obtain the final extract. The analysis of porphyrins in the culture medium was performed using the supernatant of the cell culture medium directly without any pretreatment process.

[0157] The concentrations of heme and its precursor, coproporphyrinogen III, were measured using an Agilent 1100 HPLC system from Agilent Technologies (Santa Clara, CA, USA) and a SUPELCOSIL™ LC-18-DB column (250 × 4.6 mm, Supelco Inc., PA, USA). Solvent A (methanol:acetonitrile = 10:90, v / v) and Solvent B (water with 0.5% (v / v) trifluoroacetic acid (TFA) added) were used as the mobile phases. The analysis was conducted under conditions where Solvent A was increased linearly from 20% to 95% at a flow rate of 1.0 mL / min for 40 minutes. The column temperature was maintained at 40°C, and detection was performed by measuring absorbance at a wavelength of 400 nm. The results of the standard substance analysis chromatogram confirmed that the retention time of coproporphyrinogen III was in the 13-minute range and the retention time of heme was in the 23-minute range (Fig. 9).

[0158]

[0159] 6-2. Chromatogram Results

[0160] Bm-hemA KK Ter strain and Bm-hemA KK Coproporphyrinogen III and heme present in the culture medium of the Ter-ΔcobA strain were analyzed for the intracellular cell extract and extracellular culture supernatant (Figs. 10, 11). As a result, Bm-hemA KK Ter strain and Bm-hemA KK Peaks of both heme and coproporphyrinogen III were detected inside the cells of all Ter-ΔcobA strains, but coproporphyrinogen III was detected at a concentration below the limit of quantification, making quantification impossible. In the culture medium, only coproporphyrinogen III was detected, and heme was not detected.

[0161]

[0162] 6-3. Results of measuring heme porphyrin content in culture medium

[0163] Bm-wt, Bm-hemA KK , Bm-hemA KK Ter, Bm-hemA KK The levels of heme and coproporphyrinogen III present in the culture medium of the Ter-ΔcobA strain were quantitatively analyzed according to incubation time (Figures 12, 13). The total heme content in the culture medium of the Bm-wt strain was confirmed to be 1.8 mg / L at 12 hours. Bm-hemA KK The total heme content in the culture medium of the strain was confirmed to be 6.7 mg / L at 12 hours. Bm-hemA KK The total heme content in the culture medium of the Ter strain was confirmed to be 6.9 mg / L at 12 hours. Bm-hemA KK The total heme content in the culture medium of the Ter-ΔcobA strain was confirmed to be 8.5 mg / L at 12 hours (Figure 12).

[0164] Coproporphyrinogen III was not detected in the culture medium of the Bm-wt strain. Bm-hemA KK The total coproporphyrinogen III content in the culture medium of the strain was confirmed to be 2.3 mg / L at 12 hours. Bm-hemA KK The total coproporphyrinogen III content in the culture medium of the Ter strain was confirmed to be 2.5 mg / L at 12 hours. Bm-hemA KK The total coproporphyrinogen III content in the culture medium of the Ter-ΔcobA strain was confirmed to be 4.3 mg / L at 12 hours (Figure 13). Through this, Bm-hemA KK It was confirmed that the heme and coproporphyrinogen III content in the culture medium of the Ter-ΔcobA strain was higher than that of other strains.

[0165]

[0166] Example 7. Confirmation of growth conditions for Bacillus strains by supplying a nitrogen source

[0167] To establish a Symbiotic co-culture system, experiments were conducted using the following methods.

[0168] The nitrogen source supply is Bm-hemA, one of the Bacillus strains produced above. KK We confirmed the effect on the growth of the Ter strain and intended to utilize it in a symbiotic co-culture system.

[0169] The strain used is a Bacillus megaterium strain (Bm-hemA KK The medium used was Yeast nitrogen base medium (YNB medium) with 10 g / L of lactose added. Yeast extract was added at a concentration of 1% to supply a nitrogen source.

[0170] As a result, under culture conditions where no nitrogen source was supplied, the body mass of Bacillus strains did not increase, and the lactose concentration did not decrease. Under conditions where a nitrogen source was supplied, an increase in the body mass of Bacillus strains, a decrease in lactose concentration, and an increase in galactose concentration were observed (Fig. 14). Therefore, it was determined that the addition of a nitrogen source is essential in a symbiotic co-culture system and helps the growth of Bacillus strains.

[0171]

[0172] Example 8. Confirmation of globin protein induction expression in recombinant S. cerevisiae by lactose degradation

[0173] The recombinant S. cerevisiae strain is a strain that expresses globin protein equipped with a galactose induction expression system. In addition, the Bacillus strain of Example 1 is a strain that produces β-galactosidase, and it was confirmed through Example 1 that it decomposes lactose into glucose and galactose using β-galactosidase. Therefore, a design was made to use the lactose degradation products produced by the Bacillus strain as a glycogen and inducer in a symbiotic co-culture system, and this was verified.

[0174] Example 2 aimed to determine whether galactose produced by the breakdown of lactose added to the medium by the β-galactosidase enzyme could be applied to a globin protein induction expression system of a recombinant S. cerevisiae strain.

[0175] The experiment was conducted as follows. The strain used was a recombinant S. cerevisiae strain, and 20 g / L of lactose was added to YP medium (10 g / L yeast extract, 20 g / L peptone, 20 g / L glucose). The lactose in the medium was decomposed by adding the β-galactosidase enzyme.

[0176] As a result, it was confirmed that under culture conditions without the addition of β-galactosidase, recombinant S. cerevisiae grew, but the induction of recombinant HCG (Heme-containing globin) protein did not occur. Under culture conditions with the addition of β-galactosidase, the growth of recombinant S. cerevisiae strains was confirmed, and the induction of recombinant protein occurred, resulting in the expression of globin protein (Fig. 15). Therefore, it was determined that lactose degradation by Bacillus strains in a symbiotic co-culture system could aid in yeast growth and protein induction.

[0177]

[0178] Example 9. Exploration of symbiotic co-culture system conditions

[0179] Through the preceding results, the feasibility of utilizing the elements necessary for establishing a symbiotic co-culture system was confirmed. To establish the system, conditions were explored using recombinant Bacillus strains and S. cerevisiae strains.

[0180] The experiment was conducted as follows. Cell inoculation of the recombinant Bacillus strain was set to an OD of 0.5, and cell inoculation of the recombinant S. cerevisiae strain was verified by increasing the OD to 2, 4, and 10. The medium used was a synthetic complete (SC) medium containing a minimal amount of free amino acids.

[0181] As a result, under the condition of inoculation with the recombinant S. cerevisiae strain at an OD of 2, the decrease in lactose and OD 600 An increase was confirmed. In addition, changes in the viable cell counts of recombinant Bacillus and S. cerevisiae strains were confirmed using CFU. This indicates that as the inoculation OD of the recombinant S. cerevisiae strain increased, OD 600Changes in CFU were observed, and in particular, under the condition of inoculation OD 10 of the recombinant S. cerevisiae strain, it was confirmed that lactose decreased by nearly half. Therefore, using the minimal medium SC medium, co-culture conditions were established in which the two strains grow interdependently with only the inoculation of the recombinant S. cerevisiae strain (Figs. 16 to 18).

[0182]

[0183] Example 10. Production and purification of recombinant globin protein in holoprotein form using a symbiotic co-culture system

[0184] Using the established symbiotic co-culture system, the production of plant-based recombinant globin protein was confirmed by co-culturing a heme-producing recombinant Bacillus strain and a globin-producing recombinant S. cerevisiae strain.

[0185] The experiment was conducted as follows. After co-culturing a recombinant Bacillus strain and a S. cerevisiae strain for 48 hours, the produced recombinant protein was purified using his-tag purification. Subsequently, the production of globin protein was confirmed by analyzing the purified product using SDS-PAGE. As a result, the expression of recombinant globin protein was confirmed (Fig. 19).

[0186]

[0187] Example 11. Comparison of recombinant globin proteins produced using a symbiotic co-culture system with wild-type Bacillus strains and recombinant Bacillus strains

[0188] The results of globin protein production were compared and verified by differentiating between wild-type Bacillus strains and heme-producing recombinant Bacillus strains using a Symbiotic co-culture system.

[0189] The experiment was conducted as follows. The established symbiotic co-culture conditions were used identically, with only the Bacillus strains used being varied. Culture was carried out for 72 hours, and protein purification was performed using the His-tag purification method.

[0190] As a result, in the co-culture using wild Bacillus strains, a decrease in lactose and an increase in OD were observed, but it was presumed that the produced globin protein was in the form of an apoprotein without heme binding (Fig. 20). On the other hand, in the co-culture using recombinant Bacillus strains that produce heme, it was confirmed that globin protein in the form of a holoprotein with heme binding was produced. In addition, it was confirmed that the culture medium and the purified protein turned red (Fig. 21).

[0191]

[0192] Example 12. Comparison of absorbance according to heme binding of animal hemoglobin and recombinant globin protein

[0193] To confirm whether the recombinant protein produced using symbiotic co-culture is a heme-bound holoprotein, the absorbance of the purified recombinant protein was analyzed to verify whether heme binding was present.

[0194] The experiment was conducted as follows. To analyze the absorbance of the purified recombinant protein, animal hemoglobin and recombinant globin protein produced by co-culture using wild-type Bacillus strains were used as controls. The animal hemoglobin protein was treated with acetone to extract hem and its absorbance was compared and analyzed, while the protein produced by co-culture was scanned and analyzed from 300 nm to 700 nm to determine if high absorbance was observed in the 400-580 nm range, which is the heme-specific absorption wavelength.

[0195] As a result, through comparative analysis of the absorbance of animal hemoglobin, differences in the 400-580 nm wavelength range depending on the presence or absence of heme were confirmed. Based on these results, comparative analysis of the absorbance of recombinant globin proteins produced by co-culture using wild-type Bacillus and heme-producing recombinant Bacillus strains revealed that the recombinant globin proteins produced by co-culture with heme-producing recombinant Bacillus strains showed a difference in peaks in the 400-580 nm wavelength range. Therefore, co-culture using heme-producing recombinant Bacillus strains was verified to successfully produce globin proteins in the form of holoproteins with bound heme (Fig. 22).

[0196]

[0197]

[0198] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

[0199]

[0200]

[0201]

[0202] The present invention aims to provide a method for producing plant-derived recombinant heme-containing globin protein bound to porphyrin obtained from strains cultured in this manner, by co-culturing a recombinant strain that produces porphyrin and a recombinant strain that produces globin protein using a symbiotic co-culture system. Through this, the invention aims to provide a method for effectively increasing the production of plant-derived recombinant heme-containing globin protein through co-culturing between a globin protein and a recombinant strain expressing heme.

[0203]

[0204] Attach electronic file

Claims

1. A method for producing recombinant heme-containing globin (HCG) protein comprising the step of co-culturing a Bacillus strain and a yeast strain.

2. In Claim 1, The above-mentioned Bacillus strain comprises a CymR gene expression cassette containing SEQ ID NO. 1; and a hemA containing SEQ ID NO.

2. KK A method for producing heme comprising a gene expression cassette.

3. In Claim 2, A method for producing heme, wherein the above-mentioned Bacillus strain further comprises a plasmid for deleting one or more genes selected from the group consisting of the genes of SEQ ID NO. 5 and SEQ ID NO.

6.

4. In Claim 1, A method for producing heme-binding protein, wherein the above co-culture is a symbiotic co-culture.

5. In Claim 1, A method in which the above-mentioned Bacillus strain and yeast strain are co-cultured in a weight ratio of 0.5:1 to 10.

6. A composition for HCG production comprising a Bacillus strain, a yeast strain, and a co-culture medium.

7. A food composition comprising a recombinant HCG protein produced through the method of Claim 1.

Images