Composition for preventing and treating hepatocellular carcinoma, using tussilagone compound extracted from domestic native plant

The tussilagon compound from Ganoderma lucidum activates p38 MAPK signaling to induce autophagy and apoptosis, addressing the challenges of hepatocellular carcinoma by inhibiting cell proliferation and tumor formation, offering a promising therapeutic and preventive approach for HCC.

WO2026155390A1PCT designated stage Publication Date: 2026-07-23NAMBU UNIV IND COOPERATION GRP
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
NAMBU UNIV IND COOPERATION GRP
Filing Date
2025-12-11
Publication Date
2026-07-23

AI Technical Summary

Technical Problem

Hepatocellular carcinoma (HCC) has a poor prognosis due to difficulty in early detection and limited treatment options, especially in advanced stages, with high mortality rates and limited cure potential, necessitating the development of effective preventive and therapeutic agents.

Method used

A pharmaceutical composition comprising a tussilagon compound isolated from Ganoderma lucidum, specifically 14-acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]notonipetranone (Tussilagone), which activates p38 MAPK signaling to induce autophagy and apoptosis in liver cancer cells, and can be used alone or in combination with existing treatments.

Benefits of technology

The tussilagon compound effectively inhibits hepatocellular carcinoma cell proliferation, reduces tumor formation, and induces apoptosis and autophagy, providing a potential therapeutic and preventive strategy for HCC.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure KR2025021354_23072026_PF_FP_ABST
    Figure KR2025021354_23072026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for treating hepatocellular carcinoma, the composition comprising a tussilagone compound isolated from a tussilago farfara L. extract. The composition which is treating hepatocellular carcinoma and comprises a tussilagone compound isolated from a tussilago farfara L. extract according to the present invention can be used alone or in combination with existing treatment methods, and in particular, can be effectively used in the development of a p38 MAPK pathway regulator for targeted treatments and cancer treatments for patients with p38 MAPK pathway regulation disorders.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for the prevention and treatment of anticancer effects in hepatocellular carcinoma using tussilagon compounds extracted from native Korean plants

[0001] The present invention relates to a composition for treating hepatocellular carcinoma comprising a tussilagon compound isolated from an extract of *Ganoderma lucidum*.

[0002]

[0003] Liver cancer, consisting of hepatocellular carcinoma (HCC) and intrahepatic cholangiocarcinoma (iCCA), is one of the fastest-growing cancer markets globally. Among these, HCC, which originates from hepatocytes, accounts for 80–90% of all liver cancers. Since lifestyle patterns involving excessive alcohol consumption and vulnerability to stress are known to increase the risk of developing HCC, it is receiving particular attention as a major health risk factor in Korea. HCC is a malignant tumor that develops in the liver, with hepatitis B and C, as well as cirrhosis, acting as major risk factors. Although HCC is a common type of cancer, it is known to have a poor prognosis because treatment is difficult in advanced stages. The five-year survival rate for HCC patients is less than 20%, and the prognosis is severe, with approximately 60% of patients who undergo liver resection experiencing recurrence within five years. Furthermore, early detection is often difficult due to the liver's characteristics, which are often referred to as the "silent organ" because early symptoms are almost non-existent. Furthermore, when cancer has spread to multiple sites or metastasized to other organs, treatments with a potential for a cure, such as surgery or liver transplantation, are applicable to only about 30% of patients. According to the U.S. National Cancer Institute's SEER (Surveillance, Epidemiology, and End Results) program, it is estimated that approximately 41,210 new cases of hepatocellular carcinoma and intrahepatic cholangiocarcinoma will be diagnosed in the United States in 2023, with about 29,380 deaths attributed to the disease; the five-year survival rate in the U.S. remains at only 21.6%. South Korea has a higher incidence rate of hepatocellular carcinoma compared to developed countries, with approximately 12,000 new patients diagnosed annually, making it the second leading cause of cancer-related death. As the incidence and metastasis rates of hepatocellular carcinoma increase, the importance of early diagnosis and the development of treatments is being highlighted.

[0004] Tussilago farfara L. is a perennial herbaceous plant belonging to the Asteraceae family. In traditional Korean medicine, its flower buds are called Gwandonghwa and are known to strengthen lung function and relieve coughs and phlegm. It is known to contain sterols, flavonoids, and tannin compounds (Kim Chang-min et al., *Comprehensive Dictionary of Chinese Medicine* Vol. 1, pp. 439–44, Jeongdam, 1997). In traditional Korean medicine, Tussilago farfara is characterized by its antitussive and expectorant properties due to its lung-moistening effect. It is particularly known to be effective for coughs caused by lung deficiency accompanied by blood in the phlegm, as well as for pulmonary tuberculosis and lung abscesses (*moistening the lungs and lowering qi*). Furthermore, it is widely applied for coughs, asthma, and upper respiratory infections caused by external pathogens, and helps to release stagnant qi to promote smooth skin. It has been reported that a decoction of the flowers has expectorant and anti-coughing effects in experimental animals, and that polysaccharides contained in the flowers have anti-inflammatory effects. Although the flowers are known to be used as a cough and expectorant and anti-inflammatory agent for bronchial asthma, laryngitis, bronchiectasis, pneumonia, bronchitis, gastrointestinal catarrh, inflammation of the kidneys and urethra, and fever, the inhibitory effect of tussilagone, a type of sesquiterpene isolated from the flowers, on hepatocellular carcinoma has not yet been reported.

[0005]

[0006] While studying the efficacy of a tusilagon compound isolated from *Ganoderma lucidum* against hepatocellular carcinoma, the inventors confirmed that the tusilagon compound activates p38 MAPK signaling and induces autophagy and apoptosis in liver cancer cells, thereby completing the present invention.

[0007] Therefore, the objective of the present invention is to provide a pharmaceutical composition for the prevention and treatment of hepatocellular carcinoma comprising a tussilagon compound isolated from an extract of *Ganoderma lucidum* as an active ingredient.

[0008] Another objective of the present invention is to provide a health functional food for the prevention or improvement of hepatocellular carcinoma comprising a tussilagon compound isolated from an extract of *Ganoderma lucidum* as an active ingredient.

[0009] Another objective of the present invention is to provide an adjuvant therapeutic agent for hepatocellular carcinoma comprising a tussilagon compound isolated from an extract of *Ganoderma lucidum* as an active ingredient.

[0010]

[0011] To achieve the above objective, the present invention provides a pharmaceutical composition for the prevention or treatment of hepatocellular carcinoma comprising, as an active ingredient, 14-acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]notonipetranone of the following structural formula 1 that activates p38 MAPK (14-Acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]-notonipetranone; Tusilagone), or a pharmaceutically acceptable salt thereof.

[0012] (Structural Formula 1)

[0013]

[0014]

[0015] To achieve the above other objective, the present invention comprises 14-acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]notonipetranone of Structural Formula 1 (Tussilagone) that activates p38 MAPK, or a pharmaceutically acceptable salt thereof; The present invention provides a pharmaceutical composition for the prevention or treatment of hepatocellular carcinoma comprising, as an active ingredient, a combination of one or more anticancer agents selected from sorafenib, lenvatinib, regorafenib, cabozantinib, ramucirumab, pembrolizumab, nivolumab, atezolizumab, bevacizumab, durvalumab, tremelimumab, and ipilimumab.

[0016] To achieve the above additional objective, the present invention provides a health functional food for the prevention or improvement of hepatocellular carcinoma comprising, as an active ingredient, 14-acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]notonipetranone of the above structural formula 1, which activates p38 MAPK (14-Acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]-notonipetranone; Tusilagone), or a pharmaceutically acceptable salt thereof.

[0017]

[0018] A composition for treating hepatocellular carcinoma comprising a tusilagon compound isolated from a Tushilagon extract according to the present invention can be used alone or in combination with existing treatments, and can be particularly useful for the development of p38 MAPK pathway modulators for targeted therapy and cancer treatment for patients with p38 MAPK pathway dysregulation.

[0019]

[0020] Figure 1 shows the effect of tusilagon on the proliferation of HepG2 cells.

[0021] Figure 2 shows the effect of tusilagon on tumor formation in HepG2 cells.

[0022] Figure 3 shows the effect of tusilagon on the apoptosis-related pathway of HepG2 cells.

[0023] Figure 4 shows the effect of tusilagon on autophagy markers in HepG2 cells.

[0024] Figure 5 shows the efficacy of tusilagon in the NOD-SCID mouse CDX model.

[0025] Figure 6 shows the visual and quantitative evaluation of tumor size in a CDX model treated with tusilagon.

[0026] Figure 7 shows the results of in vivo Western blot analysis of major signaling pathways in tumor tissue of the tusilagon-treated group.

[0027] Figure 8 shows the effect of tusilagon on the expression of proteins related to autophagy and apoptosis in tumor tissue.

[0028] Figure 9 shows an overview of the basic mechanism of autophagic apoptosis of HepG2 cells by tusilagon according to the present invention.

[0029]

[0030] The present invention provides a pharmaceutical composition for the prevention or treatment of hepatocellular carcinoma comprising, as an active ingredient, 14-acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]notonipetranone of the following structural formula 1 that activates p38 MAPK (14-Acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]-notonipetranone; Tusilagone), or a pharmaceutically acceptable salt thereof.

[0031] (Structural Formula 1)

[0032]

[0033] The compounds of the present invention can be prepared into pharmaceutically acceptable salts and solvates according to methods conventional in the art.

[0034] As a pharmaceutically acceptable salt of the present invention, an acid addition salt formed by a free acid is useful.

[0035] Acid addition salts are prepared by conventional methods, for example, by dissolving a compound in an excess amount of aqueous acid solution and precipitating the salt using a water-miscible organic solvent such as methanol, ethanol, acetone, or acetonitrile. An equal molar amount of the compound and an acid or alcohol (e.g., glycol monomethyl ether) in water may be heated and then the mixture may be dried by evaporation or the precipitated salt may be filtered by suction.

[0036] At this time, organic acids and inorganic acids may be used as free acids. Inorganic acids may include hydrochloric acid, phosphoric acid, sulfuric acid, nitric acid, tartaric acid, etc., and organic acids may include methanesulfonic acid, p-toluenesulfonic acid, acetic acid, trifluoroacetic acid, citric acid, maleic acid, succinic acid, oxalic acid, benzoic acid, tartaric acid, fumaric acid, manderic acid, propionic acid, citric acid, lactic acid, glycolic acid, gluconic acid, galacturonic acid, glutamic acid, glutaric acid, glucuronic acid, aspartic acid, ascorbic acid, carboxylic acid, vanillic acid, and hydroiodic acid, etc.

[0037] In addition, pharmaceutically acceptable metal salts can be produced using a base. Alkali metal or alkaline earth metal salts are obtained, for example, by dissolving a compound in an excess amount of alkali metal hydroxide or alkaline earth metal hydroxide solution, filtering the undissolved compound salt, and then evaporating and drying the filtrate. In this case, it is particularly pharmaceutically suitable to produce sodium, potassium, or calcium salts as metal salts, and the corresponding silver salt is obtained by reacting the alkali metal or alkaline earth metal salt with a suitable silver salt (e.g., silver nitrate).

[0038] Pharmaceutically acceptable salts of the compounds of the present invention comprise salts of acidic or basic groups that may be present in the compounds of the present invention, unless otherwise indicated. For example, pharmaceutically acceptable salts include sodium, calcium, and potassium salts of hydroxyl groups, and other pharmaceutically acceptable salts of amino groups include hydrobromide, sulfate, hydrogen sulfate, phosphate, hydrogen phosphate, dihydrogen phosphate, acetate, succinate, citrate, tartrate, lactate, mandelate, methanesulfonate (mesylate), and p-toluenesulfonate (tosylate) salts, which may be prepared through methods or processes for preparing salts known in the art.

[0039] The compounds of the present invention can be prepared by chemically synthesizing or commercially available by means of separation methods and purification methods that are well known in the art, such as separating from a silica gel column and a purification method that involves repeating purification processes, or by chemically synthesizing.

[0040] In addition, the present invention relates to 14-acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]notonipetranone of the above-mentioned structural formula 1 (Tussilagone), or a pharmaceutically acceptable salt thereof, which activates p38 MAPK; The present invention provides a pharmaceutical composition for the prevention or treatment of hepatocellular carcinoma comprising, as an active ingredient, a combination of one or more anticancer agents selected from sorafenib, lenvatinib, regorafenib, cabozantinib, ramucirumab, pembrolizumab, nivolumab, atezolizumab, bevacizumab, durvalumab, tremelimumab, and ipilimumab.

[0041] The composition of the present invention comprises the compound in an amount of 0.01 to 99% by weight relative to the total weight of the composition.

[0042] However, the composition described above is not necessarily limited thereto and may vary depending on the patient's condition and the type and degree of progression of the disease.

[0043] A composition comprising the compound of the present invention may further include a suitable carrier, excipient, and diluent commonly used in the manufacture of pharmaceutical compositions.

[0044] A composition comprising a compound according to the present invention may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, external formulations, suppositories, and sterile injectable solutions according to conventional methods, and carriers, excipients, and diluents that may be included therein include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methylcellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, magnesium stearate, and mineral oil. When formulating, the product is prepared using diluents or excipients such as commonly used fillers, fillers, binders, wetting agents, disintegrants, and surfactants. Solid dosage forms for oral administration include tablets, pills, powders, granules, and capsules, and these solid dosage forms are prepared by mixing at least one excipient with the above compound, such as cotton, starch, calcium carbonate, sucrose or lactose, or gelatin. In addition to simple excipients, lubricants such as magnesium styrate and talc are also used. Liquid dosage forms for oral administration include suspensions, liquids, emulsions, and syrups, and may contain various excipients, such as wetting agents, sweeteners, flavoring agents, and preservatives, in addition to commonly used simple diluents like water and liquid paraffin. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. As non-aqueous solvents and suspensions, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As bases for suppositories, Witepsol, Macrogol, Tween 61, cacao oil, laurin oil, glycerogelatin, etc. may be used.

[0045] The preferred dosage of the compound of the present invention varies depending on the patient's condition and body weight, the severity of the disease, the form of the drug, the route of administration, and the duration, but can be appropriately selected by those skilled in the art. However, for a desirable effect, it is preferable to administer the compound at a dose of 0.01 mg / kg to 10 g / kg per day, preferably 1 mg / kg to 1 g / kg. The administration may be performed once a day or divided into several doses. Therefore, the above dosage does not limit the scope of the present invention in any way.

[0046] The composition of the present invention may be administered to mammals such as rats, mice, livestock, and humans by various routes. Any mode of administration is expected, for example, by oral and rectal or intravenous methods.

[0047] In addition, the present invention provides a health functional food for the prevention or improvement of hepatocellular carcinoma comprising, as an active ingredient, 14-acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]notonipetranone of the structural formula 1 that activates p38 MAPK (14-Acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]-notonipetranone; Tusilagone), or a pharmaceutically acceptable salt thereof.

[0048] "Health functional food" as defined herein means food manufactured and processed using raw materials or ingredients having functional properties useful to the human body pursuant to Article 6727 of the Health Functional Foods Act, and "functional properties" means consuming for the purpose of obtaining useful effects for health purposes, such as regulating nutrients or physiological actions on the structure and function of the human body.

[0049] The health functional food for the prevention and improvement of cancer according to the present invention comprises the compound in an amount of 0.01 to 95%, preferably 1 to 80% by weight, based on the total weight of the composition.

[0050] Furthermore, the composition of the present invention may be a health food intended for the prevention and improvement of hepatocellular carcinoma.

[0051] In addition, for the purpose of preventing and improving cancer, it can be manufactured and processed into pharmaceutical dosage forms such as powders, granules, tablets, capsules, pills, suspensions, emulsions, and syrups, or into health functional foods in the form of tea bags, infused teas, and health drinks.

[0052] The health functional beverage composition of the present invention contains the above-mentioned compound as an essential component in the indicated proportions, with no particular restrictions on other components, and may contain various flavoring agents or natural carbohydrates as additional components, as in conventional beverages. Examples of the above-mentioned natural carbohydrates include monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, etc.; and polysaccharides, e.g., dextrin, cyclodextrin, etc., as well as conventional sugars and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As flavoring agents other than those mentioned above, natural flavoring agents (thaumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.) and synthetic flavoring agents (saccharin, aspartame, etc.) may be advantageously used. The proportion of the above-mentioned natural carbohydrate is generally about 1 to 20 g, preferably about 5 to 12 g, per 100 ml of the composition of the present invention.

[0053] In addition to the above, the composition of the present invention may contain various nutritional agents, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc.

[0054] In addition, the compositions of the present invention may contain fruit pulp for the production of natural fruit juices, fruit juice beverages, and vegetable beverages. These ingredients may be used independently or in combination. Although the proportion of these additives is not particularly important, it is generally selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the composition of the present invention.

[0055] In addition, the compound of the present invention may be added to food or beverage for the purpose of preventing a target disease. At this time, the amount of the compound in the food or beverage may be added in an amount of 0.01 to 15 weight% of the total weight of the food, and the health beverage composition may be added in a ratio of 0.02 to 5g, preferably 0.3 to 1g, based on 100ml.

[0056] The present invention will be explained in more detail below through examples. These examples are merely for the purpose of explaining the present invention more specifically, and it will be obvious to those skilled in the art that the scope of the present invention is not limited to these examples.

[0057]

[0058] Example 1. Preparation of Tussilago farfara extract and isolation of tussilagone

[0059] Dried Tussilago farfara buds were ground into a powder and extracted under reflux of 80% methanol (1:5 w / v, 3×) for 3 hours, after which the aqueous-methanol mixed extract was evaporated under reduced pressure at 60°C. Subsequently, 81 g of the methanol extract was dissolved in water and fractionated with an equal volume of petroleum ether (PE) (60–90°C, 3×). The solvent was evaporated, and the residue was freeze-dried to obtain 8.10 g of the petroleum ether fraction, which was then subjected to HSCCC separation. The crude sample and the extract fraction were analyzed by HPLC using an SB-C18 column (4.6 mm × 150 mm, 5 μm) at 25°C. Methanol:water (85:15, v / v) was used as the mobile phase. The flow rate was 1.0 mL / min, and the sample injection volume was 20 μL. Tusilagon was monitored at 220 nm using a diode array detector (DAD). Commercially available standard tusilagon (98%) was used as the standard solution to prepare the calibration curve. The calibration curve was Y = 28,221X + 112.63 (r² = 0.9993). Y represents the peak area of ​​tusilagon, and X represents the tusilagon content (mg / mL). The chemical structure and purity of the isolated tusilagon were confirmed according to the methods of the literature.

[0060]

[0061] Example 2. HepG2 cell culture and the effect of tusilagon on HepG2 cell proliferation

[0062] Human liver cancer cell line HepG2 cells were cultured in RPMI-1640 medium and normal hepatocyte cell line Chang cells were cultured in DMEM, after which 1% (v / v) penicillin-streptomycin (Gibco BRL, Gaithersburg, MD, USA) and 10% fetal bovine serum were added and cultured. The MTT reagent 3-[4,5-dimethylthiazole-2-yl]-2,5-diphenyltetrazolium bromide and other reagents used for cell activity analysis were purchased from Sigma-Aldrich (St. Louis, MO, USA).

[0063] An MTT assay was performed to determine the effect of tusilagon on the proliferation of human liver cancer cell line HepG2 cells. HepG2 cells were placed in a 48-well plate at a rate of 5 × 10⁶ per well. 3 After inoculating with cell density, the Tusilagon obtained in Example 1 was treated at concentrations of 10, 25, and 50 μM for 24, 48, and 72 hours, respectively, and the proliferation pattern of HepG2 cells was confirmed. As a result, it was confirmed that treatment with Tusilagon inhibited the proliferation of HepG2 cells in a concentration and time-dependent manner (Fig. 1).

[0064] To investigate the cytotoxicity of tusilagon, the effect of tusilagon on the activity of Chang cells, a normal hepatocyte cell line, was examined using an MTT assay. 5 × 10⁶ cells were placed per well in a 48-well plate. 3 When Chang cells inoculated at cell densities were treated with tusilagon at concentrations of 10, 25, and 50 μM for 72 hours, no significant difference was observed in any of the tusilagon treatment groups compared to the control group, confirming that treatment with tusilagon does not affect the activity of normal hepatocytes.

[0065]

[0066] Example 3. Effect of Tusilagon on HepG2 Tumor Formation

[0067] The effect of tusilagon on tumorigenesis in HepG2 cells was investigated through a colony formation assay. Adhering HepG2 cells were treated with tusilagon at concentrations of 0, 10, and 25 μM for 72 hours, respectively, followed by two washes with phosphate-buffered saline (PBS) to remove residual medium and dead cells. Adhering cells were fixed with 4% paraformaldehyde for 15 minutes to preserve cell morphology, and colonies were visualized by staining with 0.5% crystal violet for 15 minutes. Cells were gently washed with PBS to remove excess staining, and images were obtained using an inverted microscope (Olympus). As a result, the number of colonies decreased in a concentration-dependent manner with tusilagon (Fig. 2), suggesting that treatment with tusilagon reduces the potential for tumorigenesis.

[0068]

[0069] Example 4. Effects of Tusilagon on the HepG2 Apoptosis-Related Pathway

[0070] To investigate the apoptosis-induced pathway by tusilagon, a transient infection and antioxidant response factor (ARE) promoter-luciferase (LUC) assay was performed. HepG2 cells were plated in 24-well plates at a rate of 3 × 10⁶ per well. 5Cells were inoculated at a certain density and cultured overnight. Subsequently, cells were infected with the pRL-SV40 plasmid (Promega, Madison, WI, USA) and ARE-promoter-luciferase using Lipofectamine® 2000 reagent (Invitrogen, Carlsbad, CA, USA). Infection efficiency was evaluated by normalizing the firefly luciferase activity expressed by the ARE promoter to the corresponding renilla luciferase activity. Infected HepG2 cells were pretreated with specific inhibitors of JNK (SP600125), MEK (PD98059), and p38 (SB203580) for 30 minutes, followed by treatment with tusilagon at concentrations of 0, 10, 20, and 30 μM, and relative luciferase activity was expressed as a change in scale relative to the control group. As a result, the ARE-luc activity of the p38 inhibitor SB203580-treated group was significantly reduced (Fig. 3A).

[0071] The expression of apoptosis-related markers following tusilagon treatment was confirmed by Western blot. HepG2 cells were treated with tusilagon at concentrations of 0, 10, 20, and 30 μM, washed with PBS, and lysed with radioimmunoprecipitation assay (RIPA) buffer to extract proteins. Equal amounts of protein from each sample were loaded onto a sodium dodecyl sulfate-polyacrylamide gel (SDS-PAGE), separated by electrophoresis, and transferred to an Immune-Blot™ polyvinylidene difluoride (PVDF) membrane (Bio-Rad Laboratories, Hercules, CA, USA) via electrophoresis. The membrane was blocked and incubated overnight with a specific primary antibody, followed by incubation with a secondary antibody conjugated with rhizome peroxidase (HRP). Immunoblot signals were visualized using an enhanced chemiluminescence (ECL) system (Pierce Biotechnology, Rockford, IL, USA) and captured using an ImageQuant™ LAS 4000 biomolecular imager (GE Healthcare Life Sciences, Waukesha, WI, USA). Data were analyzed using Multi Gauge 3.0 software (Fujifilm Life Science, Tokyo, Japan). Antibodies against phospho-p38 (p-p38), total p38 (t-p38), and Nrf-2 were purchased from Cell Signaling Technology (Beverly, MA, USA), while lamin B antibodies and secondary antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). Western blot results confirmed that the expression of p-p38 and Nrf-2 increased in a dose-dependent manner with tusilagon (Figures 3B and 3C).

[0072] A Caspase-3 assay was performed to determine the effect of tusilagon on HepG2 apoptosis. Each cell treated with tusilagon at concentrations of 10, 20, and 30 μM for 72 hours was washed with cold PBS, lysis buffer was added, and the cells were transferred to tubes. The resulting cell lysates were adjusted to a protein concentration of approximately 3 mg / mL. Caspase activity was evaluated using two types of Caspase-3 activity assay kits from Cell Signaling Technology according to the manufacturer's protocol. Fluorescence was measured using an excitation wavelength of 380 nm and an emission wavelength of 460 nm, and the results were expressed in Relative Fluorescence Units (RFU) to quantitatively represent the Caspase activity of the samples. As a result, in each treatment group treated with tusilagon at concentrations of 10, 20, and 30 μM for 72 hours, the activity of Caspase-3 increased in a dose-dependent manner with tusilagon, suggesting that tusilagon induces HepG2 apoptosis (Fig. 3D).

[0073]

[0074] Example 5. Effect of Tusilagon on HepG2 Cell Autophagy Markers

[0075] After treating HepG2 cells with 5, 10, 15, and 20 μM tusilagon for 6 hours, Western blot was performed as described above to analyze the expression of the autophagy markers Beclin-1 and LC3-II. Beclin-1 and LC3-II antibodies were purchased from Abcam (Cambridge, MA, USA). Tusilagon treatment increased the expression of Beclin-1 and LC3-II in a dose- and time-dependent manner, indicating that autophagy was induced (Fig. 4A).

[0076] The expression levels of Beclin-1 mRNA in Tusilagon-treated HepG2 cells were analyzed by qPCR. Total RNA was extracted from HepG2 cells treated with 0, 1, 5, 10, and 20 μM Tusilagon for 6 hours using Trizol reagent (Cellconic) and reverse transcribed into complementary DNA (cDNA) using Maxime™ RT PreMix Kits (oligo dT15 primers) (iNtRON). qRT-PCR was performed on a 7500 Real-Time PCR Detection System (Bio Molecular Systems) using the reverse transcribed cDNA, Luna® Universal qPCR Master Mix Kits (NEB), and Beclin-1 primers (Forward: GGCTGAGAGACTGGATCAGG (SEQ No. 1); Reverse: CTGCGTCTGGGCATAACG (SEQ No. 2)). The amplification protocol consisted of 45 cycles of initial denaturation at 95°C for 5 minutes, followed by denaturation at 95°C for 10 seconds and annealing at 60°C for 30 seconds. As a result, tusilagon was found to significantly increase Beclin-1 mRNA levels in a concentration-dependent manner (Fig. 4B).

[0077]

[0078] Example 6. Tumor-inhibitory efficacy of tusilagon in NOD-SCID mouse CDX model

[0079] Non-obese diabetic / severe combined immunodeficiency (NOD-SCID) mice were purchased from Central Laboratory Animals (Seoul, South Korea) and reared under controlled environmental conditions, including a temperature range of 21–24°C. All animal experiments were conducted in accordance with the guidelines of the Asan Medical Center Animal Care and Use Committee (IACUC), and the research protocol was approved by the IACUC (Approval No. 2022-12-078).

[0080] 2×10 per mouse 6A cell line-derived xenograft (CDX) model was constructed in NOD-SCID mice by transplanting HepG2 cells. Once the CDX model was established, tumor cells were transplanted into other NOD-SCID mice to induce tumor growth. When the tumor volume reached approximately 100 mm³, the mice were randomly assigned to three groups and orally administered 5 mM, 10 mM, or the same amount of PBS daily for 14 days. The dimensions of each tumor, including the major axis (D) and minor axis (d), were measured daily using digital calipers, and the volume (Tv) of each tumor was calculated using the formula Tv = 0.5 × D × d². After 14 days, the mice were sacrificed, and the tumors were excised and weighed (Fig. 5A). No significant change in the average body weight of the experimental animals was observed during the treatment period. In the Tusilagon-treated groups, tumor volume decreased in a concentration-dependent manner compared to the control group, suggesting that Tusilagon inhibited tumor growth in vivo (Fig. 5B). The tumor size of the tusilagon-treated group was smaller compared to the control group (Fig. 6A), and the tumor weight was also found to decrease with the dosage of tusilagon (Fig. 6B).

[0081]

[0082] Example 7. In vivo Western blot analysis of major signaling pathways in tumor tissue of the tussilagon-treated group

[0083] Factors of major signaling pathways in the tumor tissues of the tusilagon-treated group of Example 6 were analyzed by Western blot using the method described above, with β-actin as the loading control. Antibodies against phospho-AMPK (p-AMPK) and total AMPK (t-AMPK) were purchased from Cell Signaling Technology (Beverly, MA, USA), and antibodies against phospho-mTOR (p-mTOR) and β-actin were purchased from Santa Cruz Biotechnology (Santa Cruz, CA, USA). In the tusilagon-treated groups (T5-1, T5-2, T10-1, and T10-2), the expression level of HO-1 was significantly increased compared to the control group (Fig. 7A), and the expression level of p-AMPK was also increased compared to the control group (Fig. 7B). On the other hand, the expression of p-mTOR was lower in the tusilagon-treated groups than in the control group (Fig. 7C).

[0084]

[0085] Example 8. Effect of Tusilagon on the Expression of Autophagy and Apoptosis-Related Proteins in Tumor Tissue

[0086] The expression of autophagy-related proteins in tumor tissues was investigated by Western blot in the 5 mM and 10 mM tusilagon-treated groups and the control group. Beclin-1 and LC3B antibodies were purchased from Abcam (Cambridge, MA, USA). The expression of both the autophagy proteins LC3B and Beclin-1 was significantly increased in the 10 mM tusilagon-treated groups compared to the control group, indicating that treatment with tusilagon induced autophagy (Figures 8A and 8B).

[0087] In addition, the expression of apoptosis-related markers Caspase-3 and Caspase-9 was confirmed by Western blot in the 5 mM and 10 mM tusilagon-treated groups and the control group. Antibodies against cleaved caspase-3 (c-casp3) and cleaved caspase-9 (c-casp9) were purchased from Cell Signaling Technology (Beverly, MA, USA). Compared to the control group, the expression of cleaved Caspase-3 and Caspase-9 increased in the tusilagon-treated groups, indicating that apoptosis was induced by tusilagon treatment (Fig. 8C).

[0088] The mechanism of Tusilagon's induction of autophagy and apoptosis in HepG2 cells, confirmed through the above results, is illustrated in Fig. 9. Tusilagon activates p38 MAPK, thereby inducing an increase in HO-1 expression. Additionally, Tusilagon enhances the phosphorylation of AMPK, consequently inhibiting mTOR activity; this series of processes induces autophagy and apoptosis. Treatment with Tusilagon activates Caspase-3 and Caspase-9, promoting apoptosis, while the induction of autophagy leads to increased expression of LC3B and Beclin-1. The present invention suggests that Tusilagon exerts an antitumor effect against hepatocellular carcinoma through the activation of both autophagy and apoptosis.

Claims

1. A pharmaceutical composition for the prevention or treatment of hepatocellular carcinoma comprising, as an active ingredient, 14-Acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]notonipetranone of the following structural formula 1 that activates p38 MAPK (Tussilagone), or a pharmaceutically acceptable salt thereof. (Structural Formula 1) 2. p38 14-acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]notonipetranone of the above structural formula 1 that activates MAPK (14-Acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]-notonipetranone; Tusilagone), or a pharmaceutically acceptable salt thereof and; A pharmaceutical composition for the prevention or treatment of hepatocellular carcinoma comprising, as an active ingredient, a combination of one or more anticancer agents selected from sorafenib, lenvatinib, regorafenib, cabozantinib, ramucirumab, pembrolizumab, nivolumab, atezolizumab, bevacizumab, durvalumab, tremelimumab, and ipilimumab.

3. A method for the prevention or treatment of hepatocellular carcinoma comprising the step of administering a pharmaceutical composition according to either claim 1 or 2 to an individual in need thereof. 4.p38 A health functional food for the prevention or improvement of hepatocellular carcinoma comprising, as an active ingredient, 14-acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]notonipetranone of the above structural formula 1 that activates MAPK (14-Acetoxy-7β-[3'-ethyl-cis-crotonoyloxy]-notonipetranone; Tusilagone), or a pharmaceutically acceptable salt thereof.