Composition for preventing, improving, or treating muscle tissue and mitochondrial injury as side effect of mRNA vaccination

Abstract

The present invention relates to: a pharmaceutical composition for preventing or treating muscle tissue and mitochondrial injury as a side effect of mRNA vaccination, the composition comprising an ApoE inhibitor as an active ingredient; and a health functional food composition for preventing or improving muscle tissue and mitochondrial injury as a side effect of mRNA vaccination, the composition comprising an ApoE inhibitor as an active ingredient. Specifically, it was found that muscle fiber damage following mRNA vaccination is reduced, the increase in inflammatory cytokine expression is alleviated, and significant deterioration in muscle strength does not appear under ApoE deficiency or ApoE inhibition conditions and a Western-style diet (WD). In addition, an indicator group including Gbp5, Irmg1, Il18, Myd88, and Casp1 as genes that are differentially expressed before and after mRNA vaccination in ApoE+ / + and ApoE− / − mice was derived, and is proposed as being useful for screening substances having preventive / therapeutic (pharmaceutical) and preventive / ameliorative (health functional food) activities related to mRNA vaccine-induced muscle tissue and mitochondrial injury.

Description

Composition for the prevention, improvement, or treatment of muscle tissue and mitochondrial damage caused by mRNA vaccination

[0001] The present invention relates to a composition for improving, preventing, or treating muscle tissue and mitochondrial damage induced by mRNA vaccination, comprising an ApoE inhibitor as an active ingredient. Furthermore, the present invention relates to a method for screening substances to be used to improve, prevent, or treat muscle tissue and mitochondrial damage induced by mRNA vaccination using an ApoE-deficient animal model.

[0002] mRNA vaccines are emerging as an innovative platform in modern immunology, providing rapid and flexible solutions for infectious diseases. The success of the Pfizer-BioNTech and Moderna vaccines during the COVID-19 pandemic demonstrated the potential of mRNA technology to provide effective and scalable protection. These vaccines deliver synthetic mRNA encapsulated in lipid nanoparticles (LNPs), which are known to induce a potent immune response by instructing host cells to produce viral antigens; however, concerns regarding muscle-related side effects have also been reported. Adverse effects include inflammation at the injection site (redness, swelling, itching) and, in some cases, localized muscle pain and myositis. These adverse reactions often manifest as muscle pain, reduced exercise tolerance, and elevated serum creatine kinase levels, and adverse reactions associated with significant muscle tissue damage following vaccination have been reported.

[0003] mRNA vaccines initiate antigen expression in muscle cells after intramuscular injection and have the potential to cause local inflammation. While mRNA and LNPs generally degrade within a short period, residual mRNA and antigen proteins remain in immune cells within muscle tissue, potentially prolonging immune activation. These residual mRNA fragments and antigen proteins can directly affect muscle cells, disrupting cellular function and contributing to muscle impairment. Compared to other tissues, this local immune response and direct cellular impact can exacerbate muscle tissue damage, particularly in individuals susceptible to inflammatory conditions.

[0004] With the widespread use of mRNA vaccines, it is becoming increasingly important to understand how underlying health conditions can affect the efficacy of these vaccines, particularly in individuals with metabolic diseases. Hyperlipidemia, characterized by chronically high lipid levels, inhibits muscle regeneration, disrupts immune homeostasis, and heightens underlying inflammation, making it highly likely that tissue damage will be exacerbated after vaccination. Indeed, inflammation and muscle tissue damage at the mRNA vaccine injection site have been confirmed in patients with chronic hyperlipidemia.

[0005] Meanwhile, apolipoprotein E (ApoE) is known as a mediator of the intersection between lipid metabolism and immune regulation. ApoE deficiency (ApoE- / -) is associated with mitochondrial dysfunction and inflammatory responses; when ApoE is deficient, mitochondrial damage occurs, and the expression levels of inflammatory cytokine genes increase. In a low-density lipoprotein receptor (LDLR) and ApoE double knockout hyperlipidemia mouse model, increased motor capacity and skeletal muscle mass were observed in the mice.

[0006] Mitochondria are central to muscle energy metabolism, and impaired function can amplify inflammatory responses such as IL-1β / IL-18 through reduced ATP production, mtDNA release, and activation of inflammatory complexes (inflammasome; e.g., NLRP3-caspase-1 pathway). Since this disruption of the mitochondrial-inflammatory axis may coincide with muscle tissue damage patterns observed after mRNA vaccination, a group of indicators encompassing immune pathways (e.g., NOD-like receptor pathway), oxidative phosphorylation (OXPHOS) / electron transport chain (ETC) pathways, and membrane lipid (cardiolipin) metabolic pathways serves as a reasonable starting point for damage monitoring and candidate screening.

[0007] As prior art for the present invention, Su-Hyun Kim (Seoul National University Graduate School, 2023) conducted a study on the association between a high-fat, high-cholesterol diet and visceral fat gene expression in ApoE- / - mice, noting that the expression levels of inflammatory cytokine genes increased due to a high-fat diet in ApoE- / - mice and that this is mainly related to mitochondrial function and inflammatory response, but does not mention the association with mRNA vaccination or content related to muscle damage; Tomczyk et al. (International Journal of Molecular Sciences 22.22, 2021) conducted a study on the association between muscle strength enhancement and increased fatty acid oxidation capacity in hyperlipidemia mice, and confirmed an increase in motor ability and skeletal muscle strength in mice in an ApoE and low-density lipoprotein receptor double knockout hyperlipidemia mouse model, but does not mention muscle damage induced by mRNA vaccination; and Symou et al. (Immunologic Research 71.4, 2023) disclose that myositis occurs due to mRNA vaccination. However, it does not disclose the association between ApoE protein deficiency or hyperlipidemia and vaccination.

[0008] Accordingly, the inventors of the present invention ApoE + / + and ApoE - / - In mouse and monkey models, muscle fiber damage, elevated CK levels, and increased inflammatory responses were observed following mRNA vaccination, along with a decline in mitochondrial function. It was confirmed that ApoE deficiency and the intake of a Western diet (WD) can influence the magnitude and pattern of these responses. From these results, it was determined that ApoE dysfunction may modulate the mRNA vaccine-induced muscle tissue damage response; based on this, the applicability of a composition containing an ApoE inhibitor as an active ingredient is proposed. Furthermore, ApoE - / - The present invention was completed by confirming that drugs capable of improving, preventing, or treating muscle tissue and mitochondrial damage induced by mRNA vaccines can be screened using mice.

[0009] The present invention relates to a pharmaceutical composition for the prevention or treatment of muscle tissue and mitochondrial damage induced by mRNA vaccination, comprising an ApoE inhibitor as an active ingredient. Furthermore, the present invention relates to a health functional food composition for the improvement and prevention of muscle tissue and mitochondrial damage induced by mRNA vaccination, comprising an ApoE inhibitor as an active ingredient. Additionally, the present invention relates to a method for screening substances effective in improving, preventing, or treating muscle tissue and mitochondrial damage induced by mRNA vaccination using an ApoE-deficient animal model.

[0010] In order to achieve the above objective,

[0011] The present invention aims to provide a pharmaceutical composition for the prevention or treatment of muscle tissue and mitochondrial damage induced by mRNA vaccination, comprising an ApoE inhibitor as an active ingredient.

[0012] The present invention aims to provide a health functional food composition for improving and preventing muscle tissue and mitochondrial damage induced by mRNA vaccination, comprising an ApoE inhibitor as an active ingredient.

[0013] The present invention aims to provide a method for screening substances effective in improving, preventing, or treating muscle tissue and mitochondrial damage caused by mRNA vaccination.

[0014] A composition comprising an ApoE inhibitor of the present invention as an active ingredient can be usefully utilized to improve, prevent, or treat muscle and mitochondrial damage caused by mRNA vaccination, as it reduces functional and structural damage to muscle fibers and mitochondria induced by mRNA vaccination, lowers the increased expression levels of inflammatory cytokines, and alleviates muscle weakness.

[0015] In addition, through the screening method using an ApoE-deficient animal model according to the present invention, substances exhibiting activity to treat, alleviate, or improve side effects of muscle tissue and mitochondrial damage induced by mRNA vaccination can be effectively screened.

[0016] Figure 1 is a schematic diagram showing the process of intramuscular administration of an mRNA vaccine to macaque monkeys and mice fed a standard feed or a Western-style diet.

[0017] Figure 2 shows the results of confirming antigen expression using SARS-CoV-2 spike antibodies in the quadriceps of an animal model injected with an mRNA vaccine.

[0018] Figure 3 is a graph showing the damaged muscle fibers in the quadriceps of an animal model injected with an mRNA vaccine, normalized with respect to the total number of muscle fibers.

[0019] Figure 4 is a graph showing the observed blood vessels in the quadriceps of an animal model injected with an mRNA vaccine, normalized and displayed as a graph.

[0020] Figure 5 shows the expression levels of S100A9 and Il1β in the quadriceps of monkey and mouse models injected with mRNA vaccine, using ARFGAP2 and Gapdh as internal controls.

[0021] Figure 6 shows the expression levels of Ccl7, Trim63, and Myog in the quadriceps of a mouse model injected with an mRNA vaccine, using Gapdh as an internal control.

[0022] Figure 7 shows the measurement of creatine kinase activity in the plasma of a monkey model injected with an mRNA vaccine (n=2 for saline, n=4 for the mRNA vaccine group).

[0023] Figure 8 shows the grip strength of mice measured following mRNA vaccination.

[0024] Figure 9 is a Venn diagram showing differentially expressed genes (DEGs) in a mouse model fed a regular diet (Mus musculuson Regular chow diet, RMM), a mouse model fed a Western diet (Mus musculuson Western diet, WMM), and a monkey model fed a regular diet (Macaca fascicularison Regular chow diet, RMF).

[0025] Figure 10 shows the results of principal component analysis (PCA) on differentially expressed genes (DEGs) that changed compared to the control group after mRNA vaccine injection in a mouse model fed a regular chow diet (Mus musculus on Regular chow diet, RMM), a mouse model fed a Western diet (Mus musculus on Western diet, WMM), and a monkey model fed a regular chow diet (Macaca fascicularis on Regular chow diet, RMF).

[0026] Figure 11 shows the immune-related pathways, mitochondria-related pathways, cardiomyopathy-related pathways, and metabolic pathways resulting from KEGG pathway enrichment analysis in a mouse model fed a regular chow diet (Mus musculuson Regular chow diet, RMM), a mouse model fed a Western diet (Mus musculuson Western diet, WMM), and a monkey model fed a regular chow diet (Macaca fascicularison Regular chow diet, RMF).

[0027] Figure 12 is a heatmap showing fold changes of differentially expressed genes associated with mitochondrial complex IV, showing consistent downregulation of these genes after vaccination in a mouse model fed a regular diet (Mus musculuson Regular chow diet, RMM), a mouse model fed a Western diet (Mus musculuson Western diet, WMM), and a monkey model fed a regular diet (Macaca fascicularison Regular chow diet, RMF).

[0028] Figure 13 shows that the expression of mitochondrial respiratory chain complex IV (electron transport chain, ETC) related genes in the injection site muscle is generally reduced after mRNA vaccination.

[0029] Figure 14 shows the disruption of the cardiolipin synthesis pathway and the compensatory increase in expression of the pathway from glycerol-3-phosphate to phosphatidylglycerophosphate (PGP) along with the decrease in expression of PTPMT1 and CRLS1.

[0030] Figure 15 is a diagram showing changes in the ultrastructure confirmed by transmission electron microscopy (TEM), showing Z-line disruption, myofibril arrangement disorder and cristae disruption in the longitudinal section, and expanded intermyofibril (IMF) mitochondria, as well as irregular myofibril arrangement and mitochondrial hypertrophy in the transverse section.

[0031] Figure 16 is a quantitative comparison of the ratio of abnormal intermyofibrillar and subcapsulated (SS) mitochondria, showing that after inoculation, abnormal intermyofibrillar mitochondria significantly increased while subcapsulated mitochondria were relatively preserved.

[0032] Figure 17 shows a decrease in mitochondrial enzyme activity at the injection site through a decrease in the intensity of succinate dehydrogenase (SDH, mitochondrial complex II) histochemical staining.

[0033] Figure 18 shows that the mitochondrial DNA copy number at the vaccine injection site in the RMM and WMM populations significantly decreased after vaccination.

[0034] Figure 19 is a figure showing the consistency of common differential expression genes and expression directions confirmed through comparison with denervation muscle transcriptome data.

[0035] Figure 20 is a schematic diagram showing the process of administering mRNA vaccines to ApoE+ / + and ApoE- / - mice after feeding them a normal diet and a Western diet.

[0036] Figure 21 shows the results of confirming antigen expression using SARS-CoV-2 spike antibodies to evaluate antigen expression after mRNA vaccination in the quadriceps of mouse models fed a normal diet and a Western diet, respectively, in ApoE+ / + and ApoE- / - mice.

[0037] Figure 22 is a graph showing the damaged muscle fibers in the quadriceps of a mouse model fed a normal diet and a Western diet to ApoE+ / + and ApoE- / - mice, respectively, and normalized to the total number of muscle fibers.

[0038] Figure 23 is a graph showing the observed blood vessels in the quadriceps femoris of mouse models fed a normal diet and a Western diet, respectively, in ApoE+ / + and ApoE- / - mice, and the normalized blood vessel area.

[0039] Figure 24 shows the results of evaluating the expression of Gapdh and normalized Igf2 and Myh7 by extracting mRNA from mouse model muscle tissues fed ApoE+ / + and ApoE- / - mice, respectively, with a standard diet and a Western diet.

[0040] Figure 25 shows the expression levels of S100a9, Il1β, and Ccl7 in the quadriceps femoris of mouse models fed a normal diet and a Western diet, respectively, in ApoE+ / + and ApoE- / - mice, using Gapdh as an internal control.

[0041] Figure 26 shows the grip strength of mouse models fed a normal diet and a Western diet, respectively, to ApoE+ / + and ApoE- / - mice.

[0042] Figure 27 shows the principal component analysis results of differentially expressed genes in ApoE+ / + and ApoE- / - mice fed a Western diet (WD) and a Regular Chow Diet (RCD).

[0043] Figure 28 is a box plot comparing the normalized expression distribution of differentially expressed genes (DEGs) related to the electron transport chain (ETC) and groups of genes related to immunity and apoptosis before and after vaccination, focusing on ApoE- / - mice under Western diet (WD) conditions.

[0044] Figure 29 summarizes changes in DEG expression by representative signaling pathways, such as chemokines, TNF-α, NF-κB, caspase signaling, and oxidative phosphorylation (OXPHOS) complex, showing that in ApoE- / -, the amplitude of immune pathway induction is small and OXPHOS down-down is mitigated.

[0045] Figure 30 shows the results of confirming the gene expression levels of the five genes selected as the most differentially expressed genes after mRNA vaccination in ApoE+ / + and ApoE- / - mice fed a Western diet, respectively, in the quadriceps of mouse models fed a Western diet and a standard diet.

[0046] Figure 31 shows the results of observing apoptotic cells by evaluating quadriceps muscle sections of mouse models fed a standard diet and a Western diet, respectively, in ApoE+ / + and ApoE- / - mice.

[0047] Figure 32 shows the results of a comparative analysis showing that deneurogenesis-related transcriptomic changes after vaccination are significantly attenuated in ApoE- / - compared to ApoE+ / +.

[0048] Figure 33 is a figure showing the change in mitochondrial DNA copy number according to genotype and dietary conditions.

[0049] Figure 34 shows the results of measuring mRNA expression of Il1β, Il6, Tnf-α, Ccl2, and Myh7 in the hearts of mouse models fed standard and Western diets, respectively, to ApoE+ / + and ApoE- / - mice using qRT-PCR. The expression was normalized to the expression of the reference gene, Gapdh.

[0050] Figure 35 shows the results of confirming the gene expression levels of the five genes selected as having the most differential expression after mRNA vaccination in ApoE+ / + and ApoE- / - mice fed a Western diet, respectively, in the heart of a mouse model fed a normal diet and a Western diet.

[0051] Figure 36 is a schematic diagram comparing the process of muscle tissue damage side effects occurring in the untreated group and the group with ApoE inhibition, high cholesterol, and high fat levels during mRNA vaccination.

[0052] The present invention will be described in detail below.

[0053] The present invention provides a pharmaceutical composition for the prevention or treatment of damage to muscle tissue and mitochondria caused by mRNA vaccination, comprising an ApoE inhibitor as an active ingredient.

[0054] In the present invention, the ApoE inhibitor may be an ApoE expression inhibitor or an ApoE activity inhibitor.

[0055] In the present invention, the ApoE inhibitor may be one or more selected from the group consisting of siRNA (short interfering RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme, or antisense oligonucleotide that binds complementarily to the ApoE gene described in SEQ ID NO. 37; or a compound, peptide, peptide analog (mimetics), aptamer, and antibody or antigen-binding fragment of an antibody that specifically binds to the ApoE protein described in SEQ ID NO. 38.

[0056] In the present invention, the ApoE activity inhibitor may be a synthetic or natural compound capable of reducing or inhibiting the activity of ApoE proteins.

[0057] The composition according to the present invention can suppress or reduce changes in the expression of (i) NOD-like receptor signaling pathway and innate immunity / inflammation-related marker genes (e.g., Gbp5, Irgm1, Il18, Myd88, Casp1, S100a9, Il6, Ccl2, Ccl12, Gsdmd, etc.) and (ii) mitochondrial electron transport chain (OXPHOS / ETC)-related genes (e.g., ND1, Cox7a1, Uqcr11, Atp5k, Sdhb, etc.) after mRNA vaccination compared to before vaccination. The changes in gene expression according to the present invention can be determined by measuring the expression levels of mRNA, which is the transcriptional product of the gene, or proteins, which are the translational products.

[0058] Methods for measuring the mRNA expression level may use RT-PCR (Reverse transcription polymerase chain reaction), Competitive RT-PCR, Real-time RT-PCR, RNase protection assay (RPA), Northern blotting, and DNA chips, but are not limited thereto.

[0059] Changes in the expression and / or activity of the protein of the present invention can be determined by quantifying the concentration (amount) of the said protein or measuring its activity.

[0060] Methods for measuring changes in protein expression and / or activity include, but are not limited to, Western blot, ELISA (enzyme-linked immunosorbent assay), radioimmunoassay (RIA), radioimmunodiffusion, Ouchterlony immunodiffusion, rocket immunoelectrophoresis, tissue immunostaining, immunoprecipitation assay, complement fixation assay, FACS, and protein chips.

[0061] The phrase "inhibits or reduces change" used in the present invention means that the change in the indicator gene group / protein group after vaccination is substantially non-existent or limited to within 5 times, 4 times, 3 times, 2 times, or 1.5 times compared to before mRNA vaccination.

[0062] The composition according to the present invention can inhibit or reduce damage to muscle tissue and mitochondria induced after mRNA vaccination.

[0063] When formulated into a pharmaceutical composition of the present invention, it may include a carrier, diluent, excipient, or a combination of two or more thereof that are commonly used in pharmaceutical compositions. Pharmaceutically acceptable carriers are not particularly limited as long as they are suitable for delivering the composition in vivo.

[0064] The pharmaceutical composition of the present invention can be formulated as an oral preparation or a parenteral preparation.

[0065] The composition of the present invention may include the active ingredient in an effective amount capable of preventing or treating damage to muscle tissue and mitochondria induced by mRNA vaccines, depending on the specific use, formulation, product form, etc., and the typical effective amount will be determined within the range of 0.001% by weight to 15% by weight based on the total weight of the composition. Here, "effective amount" refers to the amount of the active ingredient included in the composition of the present invention that, when administered to mammals, preferably humans, the subjects of application, for a period of administration recommended by medical professionals, can produce intended medical and pharmacological effects, such as the treatment, alleviation, or improvement of side effects of muscle tissue damage induced by mRNA vaccines. Such an effective amount may be determined experimentally within the ordinary capacity of a person skilled in the art.

[0066] The present invention provides a health functional food composition for preventing or improving damage to muscle tissue and mitochondria induced by mRNA vaccination, comprising an ApoE inhibitor as an active ingredient.

[0067] The term "health functional food" in this specification refers to a product manufactured using raw materials or ingredients that have functions useful to the human body or nutrients that are easily deficient in daily meals, and the form and type of the health functional food are not particularly limited. Specifically, the health functional food may be in the form of tablets, capsules, powders, granules, liquids, and pills.

[0068] The present invention relates to a screening method for an effective substance having preventive, corrective, or therapeutic activity against damage to muscle tissue and mitochondria induced by mRNA vaccination, wherein

[0069] 1) ApoE - / - Step to prepare the mouse;

[0070] 2) A step of feeding prepared mice a diet containing cholesterol and fat for 6 to 10 weeks after treating them with the candidate substance;

[0071] 3) Step of inoculating mice with mRNA vaccine;

[0072] 4) a step of measuring the expression levels and / or activities of mRNA or proteins for (i) the group of marker genes related to NOD-like receptor signaling and innate immunity / inflammation and (ii) the group of marker genes related to mitochondria ETC / OXPHOS in mouse muscles before and after administration of the mRNA vaccine; and

[0073] 5) A step of determining the candidate substance as an effective substance when the above measurement value of Step 4) is compared with the vaccine-alone control group, if (i) the increase in expression of the innate immunity / inflammation marker gene group in the candidate substance treatment group is smaller than the increase in the vaccine-alone control group, or (ii) the decrease in expression of the mitochondrial electron transport chain marker gene group is smaller than the decrease in the vaccine-alone control group;

[0074] A screening method including

[0075] In the present invention, the cholesterol content in step 2) may be 0.05 to 0.5 weight%, preferably 0.1 to 0.3 weight%, relative to the total weight.

[0076] In the present invention, the fat content in step 2) may be 35 to 45 weight%, preferably 37 to 42 weight%, relative to the total weight.

[0077] In the present invention, in step 3), the mRNA vaccine may be administered twice at 2-week intervals, but is not limited thereto.

[0078] According to a specific embodiment of the present invention, to determine the effect of mRNA vaccination on damage to muscle tissue and mitochondria, a SARS-CoV-2 mRNA vaccine was intramuscularly injected into monkeys three times at 14-day intervals. Mice were vaccinated twice at 2-week intervals, with the injections targeting the quadriceps femoris muscle (Fig. 1). Immunohistochemical analysis using anti-SARS-CoV-2 spike protein antibodies confirmed the presence of SARS-CoV-2 spike proteins in the muscle tissues of all groups: RMF (monkey / RCD), RMM (mouse / RCD), and WMM (mouse / WD) (Fig. 2). After vaccination, observation of muscle tissues using hematoxylin and eosin (H&E) staining revealed significant skeletal muscle damage (Fig. 3). In particular, it was confirmed that angiogenesis around muscle fibers, which is essential for the delivery of nutrients required for muscle regeneration, remained unchanged (Fig. 4). Inflammatory genes S100A9 and IL1β, which are key to the regulation of inflammation, were upregulated after vaccination (Fig. 5). In addition, the expression of muscle tissue damage markers Ccl7, Trim63, and Myog was significantly increased in both the RMM and WMM groups (Fig. 6), and serum creatine kinase (CK) activity, a major indicator of muscle tissue damage, was found to increase by more than 1.5-fold in the RMF group (Fig. 7). Compared to the control group that received saline solution under both dietary conditions after the second vaccination, muscle grip strength was significantly reduced in the vaccinated group (Fig. 8).

[0079] Based on the results regarding localized muscle tissue damage induced by mRNA vaccination, differentially expressed genes (DEGs) were analyzed before and after vaccination to further confirm the extensive effects of mRNA vaccination on muscle tissue. As a result, 887 differentially expressed genes common to all three groups—RMF, RMM, and WMM—were identified (Fig. 9), and distinct expression patterns were observed in all three groups before and after vaccination (Fig. 10). Pathway enrichment analysis of the three groups highlighted two major categories: immune-related pathways and mitochondrial-related pathways (Fig. 11). In particular, the expression of the complex IV-related gene group involved in mitochondrial oxidative phosphorylation was consistently reduced (Fig. 12).

[0080] In addition, a detailed examination of mitochondrial function and ultrastructure at the injection site revealed an overall decrease in genes related to respiratory complex IV and a decline in key cardiolipin synthesis genes (PTPMT1, CRLS1) (Figs. 13-14). Z-line decay, IMF mitochondrial swelling, and cristae decay were observed in TEM, while SS mitochondria were relatively preserved (Figs. 15-16). Furthermore, decreased SDH activity and reduced mtDNA copy number supported the functional decline (Figs. 17-18).

[0081] Subsequently, in comparison with denervation transcripts, directional alignment with 33 common DEGs including COL8A1, LGALS3, FOS, MYOG, LDB3, ACTN2, CKM, ENO3, FHL1, MYBPC2, MYH1 / 2 / 4 was confirmed, confirming that the vaccine-induced response partially converges with the denervation axis (Fig. 19).

[0082] To investigate the effects of ApoE deficiency and Western diet (WD) intake on muscle tissue damage following mRNA vaccination, ApoE+ / + and ApoE- / - mice were vaccinated with mRNA vaccines in groups fed a normal diet and a Western diet (Fig. 20), and the expression of the mRNA vaccine omicron antigen at the injection site was confirmed (Fig. 21). Unlike ApoE- / - mice fed a Western diet, a significant increase in the number of damaged muscle fibers was observed in the mRNA-vaccinated ApoE+ / + and ApoE- / - mice in the normal diet group and in the ApoE+ / + mice fed a Western diet (Fig. 22). No significant changes in the vascular area within the muscle tissue were observed under any conditions, indicating that a stable nutrient supply is maintained during muscle regeneration (Fig. 23). The expression of Myh7 and Igf2 increased in other groups after mRNA inoculation, but significantly decreased or showed no significant change in ApoE- / - mice fed a Western diet (Fig. 24).

[0083] In addition, it was confirmed that the degree of cytokine elevation induced by mRNA vaccination was significantly lower, particularly in ApoE- / - mice fed a Western diet (Fig. 25). The results of mouse grip strength evaluation showed a similar trend, with ApoE- / - mice fed a Western diet showing no significant decrease in grip strength even after vaccination (Fig. 26). These results suggest that ApoE deficiency alleviates muscle tissue damage and regulates the inflammatory response after mRNA vaccination, particularly under Western diet feeding conditions.

[0084] Based on the results regarding reduced muscle tissue damage and changes in inflammatory responses in ApoE- / - mice, 1,262 differentially expressed genes were analyzed between ApoE+ / + and ApoE- / - mice under both standard and Western diet conditions to further confirm the effects of ApoE deficiency. Principal component analysis (PCA) of differentially expressed genes revealed distinct expression patterns between ApoE- / - and ApoE+ / + mice fed the Western diet, whereas these differences were not observed in mice fed the standard diet (Fig. 27). In ApoE- / - mice fed the Western diet, downregulated genes were found to be primarily associated with mitochondrial function, whereas upregulated genes were found to be associated with immune responses.

[0085] To verify these results, changes in gene expression were analyzed across four comparison groups: ApoE+ / + mice before and after vaccination, ApoE+ / + versus ApoE- / - mice before and after vaccination, ApoE- / - mice before and after vaccination, and ApoE+ / + versus ApoE- / - mice after vaccination. Genes with significant changes (P < 0.01) were selected and grouped by pathway (Fig. 28). Meanwhile, a summary analysis of representative signaling pathways under WD (Western diet) conditions revealed that the induction amplitude of the chemokine, TNF-α, NF-κB, and caspase pathways was consistently smaller in ApoE- / - compared to ApoE+ / +, and the downregulation of mitochondrial OXPHOS (electron transport chain) complex genes showed a tendency to be attenuated (Fig. 29).

[0086] In addition, after mRNA vaccination of ApoE+ / + and ApoE- / - mice fed a Western diet, the top 5 differentially expressed genes based on statistical criteria (e.g., Gbp5, Irgm1, Il18, Myd88, Casp1) derived from the comparison were selected as a representative panel, and their expression levels were confirmed via qRT-PCR. While the expression of the aforementioned genes increased in both ApoE- / - and ApoE+ / + mice under standard feed conditions after mRNA vaccination, the degree of increase in the expression of these genes was lower in ApoE- / - mice fed a Western diet (Fig. 30). When examining differences in the expression of apoptosis-related genes in muscle tissue at the injection site using TUNEL staining, TUNEL-positive cells increased in the muscle tissue of ApoE+ / + mice after vaccination, whereas fewer TUNEL-positive cells were observed in the muscle tissue of ApoE- / - mice fed a Western diet (Fig. 31).

[0087] These results indicate that mRNA vaccination induces significant changes in immunity and mitochondrial gene expression in ApoE+ / + mice, but these changes are attenuated in ApoE- / - mice under Western diet feeding conditions, and confirmed that the five genes mentioned above can be used to screen for substances or treatments to alleviate side effects of mRNA vaccine-induced muscle tissue damage.

[0088] Cross-matches were confirmed between the injection site scRNA-seq public data (GSE239574) and the NOD-like receptor and ETC gene groups (Tables 2 and 3). Comparative transcriptome analysis revealed significantly fewer deneurogenesis-related transcriptome changes after vaccination in ApoE- / - mice compared to ApoE+ / + mice (Fig. 32). Additionally, mitochondrial DNA copy number measurements showed a significant decrease in ApoE+ / + mice after vaccination, whereas there was no change in ApoE- / - mice under Western diet conditions (Fig. 33).

[0089] Meanwhile, in the heart, the tissue-specific response was insensitive, so Il1β, Il6, Ccl2, and Myh7 showed a slight and inexplicable increase in the standard diet or a decreasing trend in the WD diet, and qRT-PCR of Gbp5, Irgm1, Il18, Myd88, and Casp1 did not reproduce a distinct increase in muscle (Figs. 34-35). Thus, the present invention confirmed that ApoE deficiency under a Western diet (WD) can regulate the inflammatory response and effectively alleviate muscle tissue damage induced by mRNA vaccines.

[0090] The present invention will be explained in detail below through examples.

[0091] However, the following examples are merely specific illustrations of the present invention in one aspect, and the present invention is not limited to the following examples.

[0092] Materials and Methods

[0093] 1. Manufacturing of experimental mRNA vaccine

[0094] The antigen was designed using a DNA sequence encoding the spike protein of the SARS-CoV-2 omicron variant. mRNA vaccine plasmids were produced by inserting antigen DNA into various cloning sites on the mRNA platform using restriction enzymes (PacI and ClaI). After linearizing the mRNA vaccine template using NotI, mRNA was produced using the EZ T7 High Yield In vitro Transcription Kit (Enzynomics, Daejeon, South Korea) according to the manufacturer's protocol. Capping was performed using SC101 (STPharm, Siheung, Korea), and UTP was replaced with N1-methyl-pseudouridine (Trilink, San Diego, California, USA). Total mRNA was precipitated using lithium chloride and purified using cellulose.

[0095] 2. Preparation of Experimental Animals and Animal Experiment Procedures

[0096] Cynomorgus macaques (Macaca fascicularis) aged 4–5 years were purchased from ORIENT GENIA (Seongnam, Gyeonggi-do, South Korea). The animals were housed under controlled conditions (20–28°C, 50–70% humidity, 12-hour light-dark cycle) at the Non-Human Primate Research Center of Seoul National University Hospital. The animals were fed Teklad Global 20% Protein Primate Diet (Inotiv, Cat #: 2050c, West Lafayette, IN, USA) and fresh fruit. All animal experiment procedures were approved by the Institutional Animal Care and Use Committee of Seoul National University Hospital (Approval No. 23-0029). The animals were injected intramuscularly (left upper brachialis muscle) with either the SARS-CoV-2 mRNA vaccine (mRNA dose, 800 μg / individual) or physiological saline as a control. The vaccination schedule included administering a primary immunization followed by two booster doses at two-week intervals. Euthanize the animal 2 days after the final immunization, collect tissue from the injection site (left upper brachii muscle), especially visible lesions, and then fix with formalin or RNAlater TM 1cm for (Invitrogen, Cat #: AM7021, Waltham, MA, USA) 3 It was cut to size.

[0097] Female ApoE tm1UncWild-type C57BL / 6J mice were purchased from Jackson Laboratory (Bar Harbor, ME, USA). All mice were housed in a controlled environment and maintained in a temperature-controlled room (22°C) with a 12-hour day / night cycle throughout the experiment. To establish the Western Diet (WD), 6-week-old mice were fed cholesterol (0.2% of total feed weight) and fat (42% of total feed weight) (Cat #: DY-88137, Doo Yeol Biotech, Seoul, Korea). Additionally, 6-week-old mice were fed a standard diet for 10 weeks. All experimental procedures were approved by the Institutional Animal Care and Use Committee (IACUC) and performed in accordance with the relevant guidelines (Approval No.: LCDI-2022-0070).

[0098] 3. Vaccination

[0099] Mice fed a Western diet or a standard diet were intramuscularly injected with either the SARS-CoV-2 mRNA vaccine or physiological saline as a control. The vaccination schedule involved a first immunization at 14 weeks of age, followed by a booster vaccination at 16 weeks of age. Mice were euthanized 48 hours (2 days) after immunization, and tissue and blood samples were collected for further analysis.

[0100] 4.1 Analysis and Visualization of Differentially Expressed Genes (DEGs)

[0101] For mice fed a Western-style diet (WMM), genes that calculated as 0 in any of the 20 samples were excluded, leaving 14,243 genes for analysis out of 40,879. For mice fed a standard diet (RMM), this filtering resulted in 14,349 genes out of 40,879. For monkeys fed a standard diet (RMF), 15,665 genes out of 28,832 were analyzed after filtering from 6 samples. The Wald test was performed using DESeq2 v1.40.1, which identifies DEGs by applying a Generalized Linear Model to each gene and obtaining p-values. Genes with an absolute value of log2FoldChange ≥ 1 and a p-value < 0.01 were identified as DEGs, and the second group was used as a control group for comparison with the first group. The groups were defined as follows: ApoE before vaccination + / + , ApoE after vaccination + / + , ApoE before vaccination - / - , ApoE after vaccination - / - Mouse. The regularized log(rlog) transformation method minimized sample differences for genes with low expression levels by converting coefficient data to a log2 scale and normalizing them using library size factors. To standardize comparisons between various genes or conditions, a statistical value defined as log2FoldChange divided by the standard error (lfcSE) was used.

[0102] Principal Component Analysis (PCA) was performed using the R package Factoextra v1.0.7 to provide a data overview, focusing on the intersections (887 genes) or unions (1,125 genes) of DEGs in the samples being compared. Hierarchical clustering heatmaps were generated using rlog transformed values ​​to visualize gene expression in all samples for WMM, RMM, and RMF. The heatmaps utilized 887 crossover DEGs and z-score normalization to adjust for large differences in expression between genes, and WMM, RMM, and RMF were normalized separately to account for species differences. Hierarchical clustering of the x-axis (genes) was performed using Euclidean distance and complete linkage, and dendrograms were added. Box plots were generated to display the distribution of normalized gene expression values ​​for each gene across the entire group. Additionally, the rlog-normalized expression of gene groups belonging to the electron transport chain (ETC) and immune and apoptotic pathways (e.g., chemokine signaling, TNF, NF-κB, caspase) was compared 'before and after vaccination' and 'among the three groups WMM, RMM, and RMF,' respectively. The comparison results were visualized as box plots, and the median was indicated on each graph.

[0103] 4.2 Comparative Analysis of Denervation-Related Genes and Open Single-Cell RNA Sequencing (scRNA-seq) Data

[0104] To evaluate expression changes associated with nerve block, a total of 66 marker genes that showed significant changes under denervation conditions in mouse muscle tissue were collected. Selection was based on fold change and p-value criteria reported in each study, or only genes annotated as differentially expressed genes were included; the baseline criteria applied were absolute log2FoldChange ≥ 1 and p < 0.01. For some datasets, the Wilcoxon rank-sum test (min.pct = 0.25, logfc.threshold = 0.25) was performed in parallel to suit a single-cell-specific workflow. Denervation-related differentially expressed genes were identified by comparing pre- and post-vaccination expression of the WMM, RMM, and RMF groups using these 66 genes.

[0105] To compare the expression patterns of NOD-like receptor signaling and mitochondrial electron transport chain genes with existing reports, single-cell RNA sequencing (scRNA-seq) datasets derived from vaccinated mice (muscle tissue, lymph nodes, and peripheral blood) registered in public databases were obtained and profiled. The scRNA-seq data were processed using sequencing analysis software to generate count tables, and then the gene expression of all cells within each sample was averaged. Genes with differential expression were identified using the same criteria as the RNA-seq in this study (absolute log2FoldChange ≥ 1, p < 0.01). The count data were log2 scaled using rlog transformation and normalized by a library size factor. The Wald statistic (stat = log2FoldChange / lfcSE) was used for comparisons between genes and conditions.

[0106] 5. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR)

[0107] For RNA isolation, quadriceps femoris tissue and the heart were lysed with Lysis Reagent (QIAGEN, Hilden, Germany) and homogenized using TissueLyser II (QIAGEN). RNA was extracted using the RNeasy Mini Kit or Midi kit (QIAGEN) according to the manufacturer's protocol. Complementary DNA (cDNA) was synthesized using the TOPscript™ RT DryMIX kit (Enzynomics, Daejeon, Republic of Korea). qRT-PCR was performed on a CFX384 C1000 Thermal Cycler (Bio-Rad) using the TOPreal™ qPCR2ХPreMIX (SYBR Green with high ROX) kit (Enzynomics). The primer sequences used are listed in Table 1.

[0108] 종GeneForward (5' - 3')Reverse ( 3' - 5')원숭이 (Macaca fascicularis)ARFGAP2GCGTCCATCTGAGCTTCATCCATCATTGGCTGTGCATCCAS100A9CCGGAGGGAATTCAAACAGCGTTAGCCTCGCCATCAGCATIL1βGACGTCGATGGCCCTAAACAGAAGCCCTCGTTGTAGTGCT마우스(Mus musculus)Casp1ACAAGGCACGGGACCTATGTCCCAGTCAGTCCTGGAAATGCcl7GCTGCTTTCAGCATCCAAGTGCCAGGGACACCGACTACTGGapdh (muscle)TCCCACTCTTCCACCTTCGACAGGAAATGAGCTTGACAAAGTTGGapdh(heart)ATCAACGACCCCTTCATTGACCCCAGTAGACTCCACGACATACTCAGCGbp5CAGACCTATTTGAACGCCAAAGATGCCTTGATTCTATCAGCCTCTIl18GACTCTTGCGTCAACTTCAAGGCAGGCTGTCTTTTGTCAACGAIl1βGACGTCGATGGCCCTAAACAGAAGCCCTCGTTGTAGTGCTIL6TACCACTTCACAAGTCGGAGGCCTGCAAGTGCATCATCGTTGTTCIgf2CGCTTCAGTTTGTCTGTTCGAGGTAGACACGTCCCTCTCGIrgm1TGCTCCACTACTCCCCAACATGCTCCTACTGACCTCAGGTAACCcl2ACCTGGATCGGAACCAAATGCCTTAGGGCAGATGCAGTTTTAAMyh7ACCAGGCCCTTTGACCTCAAGAAATCTTGTCGAACTTGGGTGGGTTCTMyd88TCATGTTCTCCATACCCTTGGTAAACTGCGAGTGGGGTCAGS100a9ACCACCATCATCGACACCTTCAAAGGTTGCCAACTGTGCTTCTnf-αTTGACCTCAGCGCTGAGTTGCCTGTAGCCCACGTCGTAGCND1CTAGCAGAAACAAACCGGGCCCGGCTGCGTATTCTACGTTHK2GCCAGCCTCTCCTGATTTTAGTGTGGGAACACAAAAGACCTCTTCTGG

[0109] ARFGAP2; ARF GTPase activating protein 2, Casp1; caspase 1, Ccl7; CC motif chemokine ligand 7, Gapdh; glyceraldehyde-3-phosphate dehydrogenase, Gbp5; guanylate binding protein 5, Il18; interleukin 18, Il1β; interleukin 1 beta, Il6; interleukin 6, Igf2; insulin-like growth factor 2, Irgm1; immunity-related GTPase family M member 1, Ccl2; CC motif chemokine ligand 2, Myh7; myosin heavy chain 7, Myd88; myeloid differentiation primary response gene 88, S100a9; S100 calcium binding protein A9, Tnf-α; tumor necrosis factor alpha, ND1; NADH dehydrogenase subunit 1, HK2; hexokinase 2.6. Quantification of mitochondrial DNA copy number

[0110] Mitochondrial copy number (mtDNA copy number) was quantified via qPCR, and the relative abundance of the mitochondrial gene NADH dehydrogenase subunit 1 (ND1) and the nuclear gene hexokinase 2 (HK2) was measured. Total DNA was extracted from quadriceps femoris tissue. Reactions were performed under standard cycling conditions using a SYBR Green-based qPCR premix kit (see Table 1 for primer sequences). The relative mtDNA copy number was calculated using the 2^-ΔCt (relative quantification) method, where ΔCt = Ct(ND1) - Ct(HK2). Data were analyzed in triplicate and expressed as the mean (standard deviation).

[0111] 7. Histological analysis

[0112] 7.1 H&E and Immunohistochemistry (IHC) Analysis

[0113] Muscle tissue from the vaccine injection site was fixed with 10% neutral formaldehyde, and the tissue samples were embedded in paraffin and stained with hematoxylin and eosin (H&E). To analyze damaged areas of the muscle, the stained areas were captured using a Motic EasyScan Digital Slide Scanner (Motic Hong Kong Ltd., Hong Kong, China), and at least 5–10 images were taken of random regions with a central nucleus. Damaged fibers were evaluated according to the following criteria: pale cytoplasm, fibers with small diameter, angular fibers, central nuclei, invasive fibers, and the number of damaged fibers expressed as a percentage of the total number of fibers. In these images, the cross-sectional area of ​​regenerated muscle fibers with a central nucleus (CSA) was measured using ImageJ software. For the SARS-CoV-2 spike immunohistochemical staining of muscle tissue, Dako Retrieval Solution (pH 6.0, S2369, Dako, Santa Clara, CA, USA) was used for antigen recovery. Dako Protein Block Serum-Free (X0909; Dako) was used for 1 hour to block non-specific binding. Subsequently, anti-SARS-CoV / SARS-CoV-2 (COVID-19) spike antibody (1:200; GTX632604, GeneTex, Irvine, CA, USA) was incubated at 4°C for 24 hours. Antigen visualization was performed using the Dako Envision Detection System Peroxidase / DAB+ (K5007). Slides were counterstained with hematoxylin for nuclear staining, dehydrated, and mounted. Images were captured using a Motic Easyscan Digital Slide Scanner (Motic Hong Kong, Ltd.).

[0114] 7.2 Succinate Dehydrogenase (SDH) Histochemical Staining

[0115] To evaluate mitochondrial oxidase activity, 10 μm thick frozen sections of the quadriceps femoris muscle were prepared and processed as follows. The sections were incubated in SDH reaction buffer at 37°C for 2 hours; the reaction buffer contained 0.2 M phosphate buffer (pH 7.4), 1.0 mg / mL nitro blue tetrazolium (NBT), and 0.1 M sodium succinate. After the reaction, the slides were fixed in 10% formalin for 15 minutes, washed with distilled water, dehydrated with stepwise ethanol, and mounted. Images of the stained sections were acquired using a digital slide scanner. Quantification of SDH-positive muscle fibers was performed using image analysis software, and a fixation intensity threshold of 158 was applied to define the positive region.

[0116] 8. Measuring mouse grip strength

[0117] Grip strength was evaluated using a grip strength meter (Seitech, Seoul, Korea). Each mouse grasped a horizontal bar connected to a force gauge that recorded the maximum pulling force applied by the forelimbs before releasing the grip. After securing both forelimbs to the bar and confirming a stable grip, the force gauge was reset. Then, the mouse was pulled slightly backward with its tail to elicit a strong response against the bar. The gauge recorded the maximum force generated during the response. The maximum grip strength of each mouse was measured at least four times to ensure accuracy and consistency. The recorded grip strength values ​​were normalized to body weight for comparative analysis.

[0118] 9. Transmission Electron Microscopy (TEM) and Quantification of Mitochondrial Subtypes

[0119] After intramuscular injection of the mRNA vaccine or control buffer, quadriceps femoris tissue was harvested 2 days after the second vaccination. The tissue was immediately fixed overnight at 4°C in a mixed fixative of 2% glutaraldehyde and 2% paraformaldehyde dissolved in 0.1 M phosphate buffer (pH 7.4). Subsequently, post-fixation was performed with 1% osmium tetroxide for 2 hours, followed by dehydration through a stepwise ethanol treatment process and embedding in Poly / Bed 812 resin. Ultrathin sections approximately 80 nm thick were prepared using an ultramicrotome and stained with uranyl acetate and lead citrate. Images were acquired using a transmission electron microscope at 100 kV, and digital micrographs were captured using a side-mounted camera.

[0120] Mitochondrial quantification was performed on longitudinal sections. Based on anatomical location, mitochondria were classified into intermyofibrillar (IMF) mitochondria, located between muscle fibers, and subsarcolemmal (SS) mitochondria, located just below the cell membrane. Abnormal mitochondria were defined as those exhibiting morphological abnormalities, such as edema or cristae collapse. At least 10 randomly selected fields of view were analyzed for each sample under blinded conditions, and mitochondria were manually classified as normal or abnormal. The number and proportion of each subtype were quantified using image analysis software.

[0121] <Experimental Example 1> Confirmation of the Effects of mRNA Vaccination on Muscles

[0122] To determine the effects of mRNA vaccination on muscle, the SARS-CoV-2 mRNA vaccine was intramuscularly injected into monkeys three times at 14-day intervals. Mice were vaccinated twice at 2-week intervals, with the injections targeting the quadriceps femoris (Fig. 1). Muscle tissue was collected 48 hours after the final vaccination.

[0123] Monkeys were fed a Regular Chow Diet (RCD), and mice were divided into two groups: one group was fed the RCD and the other the Western Diet (WD) for 8 weeks to compare and evaluate the vaccination response under different dietary conditions. The group assignments were as follows: monkeys fed RCD (RMF), mice fed RCD (RMM), and mice fed WD (WMM).

[0124] <Experimental Example 1-1> Confirmation of Local Effects of mRNA Vaccination on Muscle Tissue at the Injection Site

[0125] Immunohistochemical analysis using anti-SARS-CoV-2 spike protein antibodies confirmed the presence of SARS-CoV-2 spike protein in the muscle tissues of all groups, RMF, RMM, and WMM (Fig. 2).

[0126] After vaccination, muscle tissue was observed using hematoxylin and eosin (H&E) staining, revealing morphological changes including fibrous degeneration, reduced diameter, pale cytoplasm, angular fibrous shape, central nucleus, and cell infiltration, confirming significant skeletal muscle damage (Fig. 3). In particular, it was confirmed that angiogenesis around muscle fibers, essential for the delivery of nutrients required for muscle regeneration, remained unchanged (Fig. 4). Inflammatory genes S100A9 and IL1β, which are key to inflammation regulation, were upregulated after vaccination (Fig. 5). Furthermore, the expression of muscle tissue damage markers Ccl7 and Trim63, and the muscle differentiation marker Myog, was significantly increased in both the RMM and WMM groups (Fig. 6), and serum creatine kinase (CK) activity, a major indicator of muscle tissue damage, was found to have increased by more than 1.5-fold in the RMM group (Fig. 7). Compared to the control group, which received saline solution in both dietary conditions after the second vaccination, the muscle grip strength in the vaccinated group decreased significantly (Fig. 8).

[0127] These results indicate that the mRNA vaccine consistently induces muscle tissue damage in all groups regardless of diet, showing distinct muscle fiber degeneration, increased creatine kinase levels, and decreased grip strength.

[0128] <Experimental Example 1-2> Confirmation of the Widespread Effects of mRNA Vaccination on Muscle Tissue

[0129] Based on the results regarding localized muscle tissue damage induced by mRNA vaccination in <Experimental Example 1-1> above, differentially expressed genes (DEGs) before and after vaccination were analyzed to further confirm the extensive effects of mRNA vaccination on muscle tissue.

[0130] 887 differentially expressed genes common to all three groups—RMF, RMM, and WMM—were identified (Fig. 9), and distinct expression patterns were observed in all three groups before and after vaccination (Fig. 10). Pathway enrichment analysis of the three groups highlighted two major categories: immune-related pathways and mitochondria-related pathways. This simultaneously suggested an increase in immune response and changes in gene expression related to mitochondrial activity following vaccination (Fig. 11). Analysis of changes in gene expression within the mitochondrial complex revealed that the expression of these genes was consistently downregulated in all groups following mRNA vaccination; in particular, the expression of Complex IV, which is involved in mitochondrial oxidative phosphorylation, was significantly reduced (Fig. 12).

[0131] Therefore, it was confirmed that mRNA vaccination initiates an immune response, impairs mitochondrial function to exert extensive effects on muscle tissue, and causes significant changes in gene expression that regulates energy production and apoptosis.

[0132] <Experimental Example 2> Mitochondrial damage caused by mRNA vaccine at the injection site

[0133] Based on the decrease in gene expression related to mitochondrial function observed in <Experimental Example 1-2>, changes in the expression of genes related to the mitochondrial respiratory complex were further analyzed. After mRNA vaccination, the expression of genes related to the mitochondrial respiratory complex IV in the muscle at the injection site generally decreased (Fig. 13). In addition, the decreased expression of PTPMT1 and CRLS1, which are essential for cardiolipin synthesis, indicated damage to mitochondrial membrane integrity (Fig. 14). Conversely, the metabolic pathway leading from glycerol-3-phosphate to phosphatidyl-glycerophosphate (PGP) showed increased expression, which may be a compensatory response to the decrease in cardiolipin (Fig. 14).

[0134] Transmission electron microscopy (TEM) observations revealed Z-line disruption and disorder in myofibril arrangement in the longitudinal section, along with numerous expanded intermyofibril (IMF) mitochondria accompanied by cristae disruption. In the transverse section, irregular myofibril arrangement and significant mitochondrial hypertrophy were also observed, demonstrating extensive ultrastructural damage (Fig. 15). In particular, while the expansion and cristae disruption of IMF mitochondria increased significantly after inoculation, submyofibril (SS) mitochondria remained relatively preserved, indicating differential damage with spatial heterogeneity (Fig. 16). This pattern of differential damage was confirmed to reflect the functional differences between IMF mitochondria, which are important for contractile function, and SS mitochondria, which are responsible for membrane-related functions. Furthermore, the simultaneous occurrence of selective damage to IMF mitochondria and Z-line disruption indicates that structural disruption and bioenergetic metabolic damage are closely linked.

[0135] In addition, the succinate dehydrogenase (SDH) staining intensity was significantly reduced at the inoculation site, confirming a decrease in mitochondrial enzyme activity (Fig. 17), and the mitochondrial DNA copy number (mtDNA copy number) was also significantly reduced in the RMM and WMM populations, consistent with the results observed in TEM (Fig. 18).

[0136] Therefore, it was confirmed that mRNA vaccination induces mitochondrial dysfunction characterized by selective damage to IMF mitochondria, reduced enzyme activity, and loss of mtDNA content in the muscle at the injection site.

[0137] <Experimental Example 3> Transcriptomic Similarity Between mRNA Vaccine-Induced Muscle Tissue Damage and Denervation

[0138] We examined whether tissue damage caused by mRNA vaccination is mechanistically similar to the deneurvation response. First, the Z-line disruption and decreased structural protein expression observed in the vaccinated group were similar to phenomena reported in deneurvated muscle. Accordingly, a comparative analysis was performed with the transcriptome dataset of deneurvated muscle, and a total of 33 common differentially expressed genes (DEGs) were identified, including extracellular matrix-related genes COL8A1 and LGALS3, muscle and nerve differentiation-related genes FOS and MYOG, and cytoskeletal structure-related genes LDB3, ACTN2, CKM, ENO3, FHL1, MYBPC2, MYH1, MYH4, and MYH2. Their expression directions were also largely consistent (Fig. 19). These results support the fact that the transcriptome response induced by mRNA vaccination partially converges with the deneurvation response.

[0139] <Experimental Example 4> Confirmation of the effect on muscle tissue damage after mRNA vaccination in an ApoE- / - mouse model under a Western diet

[0140] To determine the effects of ApoE deficiency and Western diet (WD) intake on muscle tissue damage after mRNA vaccination, 6-week-old ApoE+ / + and ApoE- / - mice were divided into RCD or WD subgroups, respectively, and the diets were maintained for 8 weeks. Quadriceps femoris muscle tissue from the injection site was collected and analyzed 48 hours after the second mRNA vaccine dose (Fig. 20). Immunohistochemical analysis using anti-SARS-CoV-2 spike protein antibodies confirmed the expression of the mRNA vaccine omecro antigen at the injection site, as the presence of SARS-CoV-2 spike protein in muscle tissue of all groups was confirmed (Fig. 21).

[0141] When the ratio of damaged muscle fibers to total muscle fibers in ApoE+ / + mice was examined, it was found that the ratio of damaged muscle fibers increased after mRNA vaccination in the group fed a normal diet and in ApoE+ / + mice fed a Western diet (Fig. 22). In particular, unlike ApoE- / - mice fed a Western diet following mRNA vaccination, a significant increase in the number of damaged muscle fibers was observed in the normal diet group of ApoE+ / + and ApoE- / - mice, as well as in the mRNA-vaccinated group of ApoE+ / + mice fed a Western diet (Fig. 22). No significant changes in the vascular area within the muscle tissue were observed under any conditions, indicating that a stable supply of nutrients is maintained during muscle regeneration (Fig. 23). When the expression of muscle differentiation markers Myh7 and Igf2, which are related to muscle damage and regeneration, was measured, the expression levels were similar to the trends observed in muscle fiber damage. Both markers were upregulated in ApoE+ / + and ApoE- / - mice under normal feed conditions, indicating that muscle regeneration is being activated by mRNA vaccination. The expression of Myh7 and Igf2 increased in the other groups after mRNA vaccination, but significantly decreased or showed no significant change in ApoE- / - mice fed a Western diet (Fig. 24).

[0142] In addition, inflammatory cytokines S100a9, Il1β, and Ccl7 increased in both ApoE+ / + and ApoE- / - mice after mRNA vaccination (Fig. 25). However, it was confirmed that the degree of cytokine elevation induced by mRNA vaccination was significantly lower in ApoE- / - mice fed a Western diet (Fig. 25). The results of mouse grip strength evaluation showed a similar trend; grip strength decreased in ApoE+ / + mice after vaccination regardless of diet, and ApoE- / - mice fed a standard diet also showed a similar decrease. On the other hand, grip strength in ApoE- / - mice fed a Western diet did not significantly decrease even after vaccination (Fig. 26). These results suggest that ApoE deficiency alleviates muscle tissue damage and regulates the inflammatory response after mRNA vaccination, particularly under Western diet feeding conditions.

[0143] Based on the results regarding reduced muscle tissue damage and changes in inflammatory responses in ApoE- / - mice, 1,262 differentially expressed genes were analyzed between ApoE+ / + and ApoE- / - mice under both standard and Western diet conditions to further confirm the effects of ApoE deficiency. Principal component analysis (PCA) of differentially expressed genes revealed distinct expression patterns between ApoE- / - and ApoE+ / + mice fed the Western diet, whereas these differences were not observed in mice fed the standard diet (Fig. 27). In ApoE- / - mice fed the Western diet, downregulated genes were found to be primarily associated with mitochondrial function, whereas upregulated genes were found to be associated with immune responses.

[0144] To further characterize changes in immune and mitochondrial activity pathways under Western diet feeding conditions, gene expression distributions were analyzed in four comparison groups: (1) comparison of ApoE+ / + mice before and after vaccination, (2) comparison of ApoE+ / + vs. ApoE- / - mice before vaccination, (3) comparison of ApoE- / - mice before and after vaccination, and (4) comparison of changes in gene expression between ApoE+ / + vs. ApoE- / - mice after vaccination. Genes showing significant changes (P < 0.01) in each comparison were selected and grouped by pathway (Fig. 28). As a result, the pattern of gene expression changes following vaccination was found to be attenuated in ApoE- / - mice under Western diet (WD) conditions compared to ApoE+ / + mice. For mitochondrial electron transport chain (ETC) related genes, the decrease in gene expression after mRNA vaccination was smaller in ApoE- / - mice. Conversely, for genes related to immune response and apoptosis pathways whose expression increased after mRNA vaccine injection, the increase was smaller in ApoE- / - mice (Fig. 28). Analysis by representative signaling pathways revealed that vaccination activated immune-related pathways such as chemokines, tumor necrosis factor-α (TNF-α), NF-κB, and Caspase signaling pathways in both genotypes, but the increase in expression of these genes was consistently lower in ApoE- / - mice. For genes related to the mitochondrial OXPHOS complex, a significant decrease in expression was observed after vaccination in ApoE+ / + mice fed WD, whereas only a relatively moderate level of downregulation was observed in ApoE- / - mice (Fig. 29).

[0145] In addition, Gbp5, Irgm1, Il18, Myd88, and Casp1 were selected as representative examples of the most differentially expressed genes after mRNA vaccination in ApoE+ / + and ApoE- / - mice fed a Western diet, and their expression levels were confirmed via qRT-PCR. While the expression of the above genes increased in ApoE- / - and ApoE+ / + mice under standard feed conditions after mRNA vaccination, the increase in expression of the above genes was lower in ApoE- / - mice fed a Western diet (Fig. 30).

[0146] To experimentally verify changes in the expression of genes associated with apoptosis, TUNEL staining was performed on muscle tissue at the injection site. As a result, TUNEL-positive cells increased in the muscle tissue of ApoE+ / + mice after vaccination, whereas fewer TUNEL-positive cells were observed in the muscle tissue of ApoE- / - mice under Western diet feeding conditions (Fig. 31).

[0147] These results indicate that mRNA vaccination induces significant changes in gene expression related to immunity and mitochondrial function in ApoE+ / + mice, but these changes are attenuated in ApoE- / - mice under Western diet feeding conditions. Additionally, it was confirmed that the five genes mentioned above—Gbp5, Irgm1, Il18, Myd88, and Casp1—can be used to screen for substances or therapeutic agents to alleviate side effects of mRNA vaccine-induced muscle tissue damage.

[0148] Meanwhile, the transcriptome pattern observed in ApoE+ / + mice showed high similarity to recently reported single-cell transcriptome data of the vaccine injection site (GSE239574) (Tables 2 and 3).

[0149] Expression of differentially expressed genes (DEGs) in NOD-like receptor signaling pathways overlapping with the public dataset GSE239574 ChangeGene_SymbolThis_studyGSE239574Ccl129.35626481.28499186Ccl28.68870750.06401388Irgm26.3110122.41961552Gbp26.7064794 2.5119833Irgm16.21196361.85906421Gbp56.4569152.56731332Gbp36.39575192.28687364Gbp75.99610262.58547876Il66.0931204-0 .78714953Irf76.26207023.91682986Oas1g5.68260374.69581313Mefv5.75270610.55054525Oas1a5.41637633.79514883Cxcl14.62737 45-1.31667961Ifi2044.38814361.41131026Casp44.60101530.71596479Nlrp122.48914130.14533821Oas1b3.9281567NATrpv23.328426 0.08226662Pstpip14.15220691.1077262Sting13.7992222NAIl183.54855360.73759693Trpm23.5277239-0.1505358Ikbke3.24556561. 08349683Oas23.08058634.6222176Cyba3.1222641-0.03491028Aim22.70079520.86659656Prkcd2.65814580.30121557Naip22.84586290 .33056201Card93.0562563-0.91584337Gpsm32.66520050.36472613Nod22.97312670.48459128Gsdmd2.73190580.47625754Nlrp1a2.76 191222.36843819Nod12.32576860.69552243Plcb21.96475590.54189659Ripk21.69215470.15663741Naip61.67897010.24854571Tbk11.19050980.95339751Rnasel1.79822161.01238718Naip51.7626347-0.19566451Plcb11.5111547-1.15268366Nlrc41.70125530.10138895Nlrp1b1.57447951.11477888Casr-0.9449046NAMfn1-1.1523945-0.42498493Map1lc3a-1.3249195-1.59961116.

[0150] Differentially expressed genes (DEGs) in the mitochondrial electron transport chain that overlap with the public dataset GSE239574 Gene_SymbolThis_studyGSE239574Cox150.68612130.836610451ND6-0.9758515NANdufs1-0.9202085-0.072567683Ttc19-0.9011791-0.705234208Atp5b-0.9258798-0.352432096Atp5a1-0.9910696-0.250387232Uqcrc1-1.0208864-0.296073736Dmac2-0.94883140.44 4461686Ndufaf1-0.97088350.03194066Ndufv1-1.0221418-0.566193643Uqcrc2-1.1085854-0.252056039Atp5g3-1.1346757-0.345473009 Ndufab1-1.1142952-0.180991265Lyrm7-1.124152-0.021564637Nubpl-1.2477358-0.122705296Ndufaf4-0.9624530.002833335Ecsit-1.09 24001-0.19925194Ndufa9-1.2446253-0.261080411Atp5d-1.1476006-0.399153325Ndufa8-1.2590306-0.558061129Uqcrfs1-1.3812486-0 .399338964Cyc1-1.4582571-0.391576522Cox5a-1.3985978-0.284874062Sdhd-1.4264591-0.166339546Sdhaf1-1.040392-0.273633988Uq cc3-1.1259331-0.190600272CYTB-1.1310548NANdufaf3-0.7502474-0.222054937Cox17-0.96659460.035717432Atp5g2-1.445802-0.0609 17272Cox16-1.4826865-0.153852594Pet100-1.36601070.137595181ATP8-1.3624314NACox14-1.3947707-0.250920856Coa6-1.3492953-0.077650056ND1-1.5135161NASdhaf3-1.5124552-0.347954829COX1-1.564 7918NANdufs3-1.4618346-0.206835692NANdufs7-1.4305927-0.424154776 Atp5pb-1.5268271NACox4i1-1.5552002-0.392573021Atp5c1-1.6056417-0.302613125Ndufa11-1.5961987-0.336168826Sdhaf4-1.4323294-0.41 6816899Atp5h-1.5290384-0.381397763Ndufb7-1.5217255-0.296442689Ndufs8-1.5613788-0.201742092Ndufs4-1.5642756-0.144984455Ndufb3-1.631671-0.412478422Cox5b-1.589757-0.165038513Ndufc2-1.6880588-0.470595259Ndufb10-1.6015473-0.556267433Ndufaf6-1.750717-0.1 37017125Atp5o-1.7687705-0.294996224Ndufb6-1.7592415-0.426273328Sdhb-1.8498347-0.348764208Ndufa12-1.8038296-0.271282094Cox6b1-1.719599-0.310830152Ndufs5-1.6720756-0.463137131Uqcrq-1.7101388-0.237861873Uqcrb-1.9718259-0.633399235Atp5g1-2.0631913-0.29 8894933Ndufb5-2.0963976-0.351905114Ndufaf5-2.088548-0.326547335Ndufb9-2.0927709-0.464815492Ndufc1-2.1705367-0.542889587Ndufv2-1.8648816-0.357439559Ndufv3-1.9291854-0.435076405Atp5e-1.8779846-0.357825694Ndufb8-2.0223466-0.521028625Uqcr11-2.0382141-0.653658507Atp5k-2.0702007-0.235145493Ndufb2-1.9584152-0.632929952Ndufa5-1.9966318-0.579551405Ndufs6-1.8890665-0.338483889Ndufa13-1.9430555-0.439711113Uqcc2-1.8967643-0.624904908Ndufb1 1-1.9847203-0.419373473Uqcr10-1.9493419-0.505796321Cox7b-1.9572527-0.212457503Cox7c-1.9711775-0.297362105Uqcrh-1.9958721-0.359623176Ndufa4-2.0819515-0.351453062Ndufb4-2.0434515-0.544 789848Atp5mpl-2.1084523-0.368939417Cox6c-2.0191485-0.528196793Atp5l-2.0087369-0.503405109Ndufa2-2.0531176-0.352345681Ndufa6-2.0879006-0.335505193Atp5j2-2.1339304-0.36223319Ndufa3-1.7 960318-0.097098796COX2-1.7838058NAATP6-1.7189635NACox20-1.8557664-0.339380084Ndufb1-1.9691936NACOX3-2.3027704NAAtp5md-2.2387459-0.291344489Cox7a1-2.551529-1.152111673ND3-2.6199258NA.

[0151] In addition, comparative transcriptome analysis confirmed that deneurogenesis-related transcriptome changes after vaccination were significantly less in ApoE- / - mice compared to ApoE+ / + mice (Fig. 32). Finally, considering that mitochondrial function may play a central role in these transcriptome differences, the mitochondrial DNA copy number was measured. As a result, while significant changes were observed in ApoE+ / + mice after vaccination, there was no change in mitochondrial content in ApoE- / - mice under WD conditions (Fig. 33). Taken together, the range of gene expression change after vaccination was generally reduced in ApoE- / - mice under WD conditions, which supports the idea that ApoE deficiency mitigates injection site tissue damage by buffering the dynamic range of immune and mitochondrial-related transcriptional responses.

[0152] <Experimental Example 5> Confirmation of the effects on the heart after mRNA vaccination in an ApoE- / - mouse model under a Western diet

[0153] We confirmed whether the effects of mRNA vaccination on muscle tissue extend to other tissues, particularly the heart.

[0154] Analysis of the expression of genes related to inflammatory cytokines and macrophage activity showed that under standard feed conditions, mRNA expression of Il1β, Il6, Ccl2, and Myh7 in ApoE+ / + mice showed only a slight and insignificant increase, but under Western diet conditions, the expression of these markers decreased (Fig. 34).

[0155] In addition, the mRNA expression levels of five differentially expressed genes selected in <Experimental Example 2>—Gbp5, Irgm1, Il18, Myd88, and Casp1—were examined. As a result, in ApoE+ / + mice fed a standard diet, vaccination increased the expression of Gbp5, Irgm1, and Myd88, whereas in ApoE- / - mice, the expression decreased or no change was observed. On the other hand, under Western diet conditions, the changes in mRNA expression of the aforementioned genes were similar between ApoE+ / + and ApoE- / - mice (Fig. 35). These results confirmed that mRNA vaccination exhibits a completely different response pattern in the heart compared to muscle tissue, and that the gene expression profiles are also different. Since only mild and insignificant changes in inflammatory markers and mitochondrial function were detected in heart tissue, this indicates a tissue-specific response to mRNA vaccination.

[0156] Thus, the present invention confirmed that ApoE deficiency under a Western diet (WD) can effectively alleviate muscle tissue damage induced by mRNA vaccines by regulating the inflammatory response.

Claims

A pharmaceutical composition for the prevention or treatment of muscle tissue and mitochondrial damage induced by mRNA vaccination containing an ApoE inhibitor as an active ingredient. In paragraph 1, The above ApoE inhibitor is a pharmaceutical composition for the prevention or treatment of muscle tissue and mitochondrial damage induced by mRNA vaccination, wherein the ApoE inhibitor is an ApoE expression inhibitor or an ApoE activity inhibitor. In paragraph 2, The above ApoE inhibitor is a pharmaceutical composition comprising one or more selected from the group consisting of siRNA (short interfering RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme, or antisense oligonucleotide that binds complementarily to the ApoE gene described in SEQ ID NO. 37; or a compound, peptide, peptide analog (mimetics), aptamer, and antibody or antigen-binding fragment of an antibody that specifically binds to the ApoE protein described in SEQ ID NO.

38. In paragraph 1, The above composition is a pharmaceutical composition for the prevention or treatment of muscle tissue and mitochondrial damage induced by mRNA vaccination, characterized by inhibiting or reducing changes in the expression of (i) gene groups related to innate immunity / inflammation and / or (ii) gene groups related to the mitochondrial electron transport chain (OXPHOS / ETC) before and after mRNA vaccination. In paragraph 4, A pharmaceutical composition comprising (i) one or more of the innate immunity / inflammation or inflammasome signaling pathway marker genes including Gbp5, Irgm1, Il18, Myd88, Casp1, S100a9, Il6, Ccl2, Ccl12, Gsdmd, Il1β, Irf7, and Sting1, and (ii) one or more of the mitochondrial electron transport chain / oxidative phosphorylation marker genes including ND1, Cox7a1, Uqcr11, Atp5k, Sdhb, Ndufs1, Uqcrc1, and Atp5b. A health functional food composition for preventing or improving muscle tissue and mitochondrial damage induced by mRNA vaccination containing an ApoE inhibitor as an active ingredient. In paragraph 6, The above ApoE inhibitor is an ApoE expression inhibitor or an ApoE activity inhibitor, and is a health functional food composition for the prevention or improvement of muscle tissue and mitochondrial damage induced by mRNA vaccination. In paragraph 6, The above ApoE inhibitor is a health functional food composition comprising one or more selected from the group consisting of siRNA (short interfering RNA), shRNA (short hairpin RNA), miRNA (microRNA), ribozyme, or antisense oligonucleotide that binds complementarily to the ApoE gene described in SEQ ID NO. 37; or a compound, peptide, peptide analog (mimetics), aptamer, and antibody or antigen-binding fragment of an antibody that specifically binds to the ApoE protein described in SEQ ID NO.

38. In paragraph 6, The above composition is a health functional food composition for preventing or improving muscle tissue and mitochondrial damage induced by mRNA vaccination, characterized by inhibiting or reducing changes in the expression of (i) gene groups related to innate immunity / inflammation and / or (ii) gene groups related to the mitochondrial electron transport chain (OXPHOS / ETC) before and after mRNA vaccination. In Paragraph 9, A health functional food composition comprising (i) one or more of the innate immunity / inflammation or inflammasome signaling pathway marker genes including Gbp5, Irgm1, Il18, Myd88, Casp1, S100a9, Il6, Ccl2, Ccl12, Gsdmd, Il1β, Irf7, and Sting1, and (ii) one or more of the mitochondrial electron transport chain / oxidative phosphorylation marker genes including ND1, Cox7a1, Uqcr11, Atp5k, Sdhb, Ndufs1, Uqcrc1, and Atp5b. A screening method for effective substances having improving, preventing, or therapeutic activity against muscle tissue and mitochondrial damage induced by mRNA vaccination, 1) ApoE - / - Step to prepare the mouse; 2) A step of feeding prepared mice a diet containing cholesterol and fat for 6 to 10 weeks after treating them with the candidate substance; 3) Step of inoculating mice with mRNA vaccine; 4) a step of measuring the expression levels or activity of mRNA and / or proteins of (i) gene groups related to innate immunity / inflammation and / or (ii) gene groups related to the mitochondrial electron transport chain (OXPHOS / ETC) in mouse muscles before and after mRNA vaccination; and 5) A screening method comprising the step of determining the candidate substance as an effective substance when the above measurement value of step 4) is compared with a vaccine-only control group, wherein (i) the increase in expression of the innate immunity / inflammation indicator gene group of the candidate substance treatment group is smaller than the increase in the vaccine-only control group, or (ii) the decrease in expression of the mitochondrial electron transport chain indicator gene group is smaller than the decrease in the vaccine-only control group. In Paragraph 11, A screening method comprising (i) one or more of the innate immunity / inflammation or inflammasome signaling pathway marker genes including Gbp5, Irgm1, Il18, Myd88, Casp1, S100a9, Il6, Ccl2, Ccl12, Gsdmd, Il1β, Irf7, and Sting1, and (ii) one or more of the mitochondrial electron transport chain / oxidative phosphorylation marker genes including ND1, Cox7a1, Uqcr11, Atp5k, Sdhb, Ndufs1, Uqcrc1, and Atp5b. In Paragraph 11, A screening method for an effective substance having improving, preventing, or therapeutic activity against muscle tissue and mitochondrial damage induced by mRNA vaccination, characterized in that, in step 2) above, the cholesterol content is 0.1 to 0.3% by weight relative to the total weight of the feed and the fat content is 35 to 45% by weight relative to the total weight of the feed. A method for preventing or treating muscle tissue and mitochondrial damage caused by mRNA vaccination, characterized by including the step of administering an ApoE inhibitor to a subject. Use of ApoE inhibitors in the manufacture of medicines for the prevention or treatment of muscle tissue and mitochondrial damage induced by mRNA vaccination.

Images