Gene edited maize with altered stature
By introducing heterologous expression-enhancing elements into the DVL1 gene of maize using CRISPR/Cas systems, the method effectively regulates plant height, addressing the limitations of existing methods and enhancing agronomic performance and yield.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- INARI AGRICULTURE TECHNOLOGY INC
- Filing Date
- 2026-01-15
- Publication Date
- 2026-07-23
AI Technical Summary
Existing methods for reducing plant height in maize often result in severe reductions that are not commercially useful, as most genes involved in plant height regulation are positive regulators, and complete or near-complete loss-of-function mutations lead to undesirable outcomes.
Introduction of a heterologous expression-enhancing element, such as a transcription or translational enhancer, into the DVL1 gene of maize to increase or decrease plant height by modifying the endogenous DVL1 gene or inserting a transgene with these elements, using CRISPR/Cas systems to introduce amorphic or hypomorphic alleles, thereby regulating plant height effectively.
Achieves controlled alterations in plant height, ranging from 5% to 50% increase or decrease, improving agronomic performance and yield by optimizing DVL1 gene expression levels.
Smart Images

Figure US2026011453_23072026_PF_FP_ABST
Abstract
Description
Docket No. P15033WO00TITLE: GENE EDITED MAIZE WITH ALTERED STATURECROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This international patent application claims benefit of U.S. Provisional Patent Application Serial No.: 63 / 746,736, filed January 17, 2025, which is incorporated herein by reference in its entirety.INCORPORATION OF SEQUENCE LISTING
[0002] The instant application contains a sequence listing, which has been submitted in XML file format by electronic submission and is hereby incorporated by reference in its entirety. The XML file, created on January 14, 2026, is named P15033WO00.xml and is 172,652 bytes in size. Also incorporated herein by reference in its entirety is the sequence listing named “P15033US00.XML” which was filed in U.S. Provisional Patent Application Serial No.: 63 / 746,73 on January 17, 2025, and which is 172,304 bytes (measured in MS-Windows®) in size.BACKGROUND
[0003] Plant height is to a large extent determined by stem elongation which is regulated by different factors for example by plant hormones such as gibberellic acid. Reduced plant height is a useful commercial trait linked to improved performance, agronomical practices and overall yield.
[0004] A number of genes have been described to be involved in plant height such as Brevis plantl (BV1), brachytic2 (BR2), compact plant2 (ct2) and others. As most of these genes are positive regulators of plant growth, complete or near complete loss-of-function mutations in such genes typically results in severe reductions of plant height which are less useful.
[0005] Ellis et al., 1987, EMBO J. (6): 11:3203-3208, disclose a 16 base pair bacterial octopine synthase gene enhancer element that could increase expression of exogenous genes in maize and tobacco protoplasts in transient expression assays. PCT Patent Application WO 2018 / 140899 discloses insertion of expression-enhancing elements with homology to the bacterial octopine synthase gene enhancer element in the promoter region of a maize Lc gene in a maize protoplast genome to increase expression of that gene.SUMMARY
[0006] Disclosed herein are maize plants comprising (i) a modified endogenous DVL1 gene wherein a heterologous expression enhancing element is located in the modified gene and whereinDocket No. P15033WO00the unmodified endogenous DVL1 gene comprises the DNA molecule of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof; or (ii) a transgene comprising a heterologous expression enhancing element which is operably linked to a gene encoding a DVL1 protein of SEQ ID NO: 6 or an allelic variant thereof wherein expression of the DVL1 protein is increased in comparison to a control maize plant lacking the transgene.
[0007] Also disclosed are biological samples comprising a detectable amount of a DNA molecule comprising a heterologous transcription enhancer, a heterologous intron, and / or heterologous translational enhancing element located in a DNA fragment of a modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
[0008] Maize plant chromosomes are also disclosed. In certain embodiments, the maize plant chromosomes comprise (i) a modified endogenous DVL1 gene wherein a heterologous expression enhancing element is located in the modified gene and wherein the unmodified endogenous DVL1 gene comprises the DNA molecule of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the heterologous expression enhancing element is a transcription enhancer comprising SEQ ID NO: 10 and the insertion is located: (i) about 174 to about 134 base pairs or about 154 base pairs 5’ to the transcription start site (TSS) of the endogenous DVL1 gene or TSS of the transgene encoding the DVL1 protein; (ii) about 275 to about 235 base pairs or about 255 base pairs 5’ to the TSS of the DVL1 gene or TSS of the transgene encoding the DVL1 protein; or (iii) in a double stranded break introduced in the endogenous DVL1 gene promoter with a Cast 2 nuclease and a Casl2 guide RNA comprising a spacer encoded by SEQ ID NO: 123 or 127; or optionally wherein the modified endogenous DVL1 gene comprises the enhancer insertion set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 136, SEQ ID NO: 137, or an allelic variant thereof; or (ii) a transgene comprising a heterologous expression enhancing element which is operably linked to a gene encoding a DVL1 protein of SEQ ID NO: 6 or an allelic variant thereof wherein expression of the DVL1 protein is increased in comparison to a control maize plant lacking the transgene.
[0009] Also provided are maize plant cells comprising at least one mutation in the DVL1 gene of SEQ ID NO: 1, 120, or 122, wherein the at least one mutation comprises an amorphic or hypom orphic allele of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
[0010] Also disclosed are plants or plant parts of an elite maize plant, cultivar, or variety with decreased height and / or internode length comprising at least one mutation comprising an amorphic or hypom orphic allele in the endogenous DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, wherein the decreased height and / or internode length is in comparison to a wildtype or control maize plant lacking the at least one mutation.Docket No. P15033WO00
[0011] Biological samples comprising a nucleic acid containing at least one mutation in the maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, wherein the at least one mutation comprises an amorphic or hypomorphic allele of the DVL1 gene of SEQ ID NO: 1, 120, or 122 are also provided.
[0012] Also provided are guide RNA molecules comprising a spacer RNA molecule which targets the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the spacer RNA molecule comprises the RNA encoded by SEQ ID NO: 139-194 or 195. In some embodiments, the spacer RNA molecule comprises the RNA encoded by SEQ ID NO: 139, 141, 142, 145, 147, 149, 150, 193, 194, or 195.
[0013] Also disclosed are methods for decreasing height and / or internode length in a maize plant, comprising introducing at least one mutation comprising an amorphic or hypomorphic allele in the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof of a maize plant cell.BRIEF DESCRIPTION OF THE DRAWINGS
[0014] FIGS. 1A-E show the Zm00001ebl36340 wild-type (WT) Sequence from 3000bp upstream of the gene’s 5’ untranslated region (5’ UTR) up to and including the entire coding region of the gene (SEQ ID NO: 1). A guide RNA (SEQ ID NO: 123) is denoted with a directional arrow under the sequence labeled with the SEQ ID NO. The enhancer insertion site is denoted with a triangle. The coding region (SEQ ID NO: 5), 5’UTR (SEQ ID NO: 3), and 3’UTR (SEQ ID NO: 4) are also noted.
[0015] FIGS. 2A-E show a mutated Zm00001ebl36340 sequence from 3000bp upstream of the gene’s 5’ untranslated region (5’ UTR) up to and including the entire coding region of the gene (SEQ ID NO: 8). The enhancer insertion (SEQ ID NO: 10) is denoted with a black line under the sequence. The coding region (SEQ ID NO: 5, 5’UTR (SEQ ID NO: 3), and 3’UTR (SEQ ID NO: 4) are also noted.
[0016] FIGS. 3A-B show the wild-type DVL1 gene of SEQ ID NO: 7 which encompasses the 5’ untranslated region (SEQ ID NO: 3), protein coding region, and 3’ untranslated regions (SEQ ID NO: 4). The guide RNA target sites are indicated for select spacer RNA molecules encoded by SEQ ID NO: 139, 142, 147, 150, and 193 according to some embodiments of the disclosure. Cut sites are indicated by a vertical line on each guide target site.Docket No. P15033WO00DETAILED DESCRIPTION
[0017] The phrase “allelic variant” as used herein refers to a polynucleotide or polypeptide sequence variant that occurs in a particular gene at particular locus in a different strain, variety, or isolate of a given organism.
[0018] As used herein, the phrase “amorphic allele” refers to an allele of a gene having no gene activity in comparison to the wild-type allele of the gene. Amorphic alleles are also known as null alleles.
[0019] The term "and / or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as "A and / or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and / or" as used in a phrase such as "A, B, and / or C" is intended to encompass each of the following embodiments: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).
[0020] As used herein, the phrase “biological sample” refers to either intact or non-intact (e.g., milled maize seed or maize plant tissue, chopped maize plant tissue, lyophilized tissue) maize plant tissue. It may also be an extract comprising intact or non-intact seed or maize plant tissue. The biological sample can comprise flour, meal, syrup, oil, starch, and cereals manufactured in whole or in part to contain maize plant products or by-products. In certain embodiments, the biological sample is “non-regenerable” (i.e., incapable of being regenerated into a maize plant or maize plant part).
[0021] As used herein, the terms “correspond,” “corresponding,” and the like, when used in the context of an nucleotide position, mutation, and / or substitution in any given polynucleotide (e.g, an allelic variant of SEQ ID NO: 1) with respect to the reference polynucleotide sequence (e.g, SEQ ID NO: 1) all refer to the position of the polynucleotide residue in the given sequence that has identity to the residue in the reference nucleotide sequence when the given polynucleotide is aligned to the reference polynucleotide sequence using a pairwise alignment algorithm (e.g., CLUSTAL O 1.2.4 with default parameters).
[0022] As used herein, the terms “Cpfl” and “Casl2a” are used interchangeably to refer to the same RNA dependent DNA endonuclease (RdDe).
[0023] As used herein, the phrases “endogenous promoter,” “endogenous gene,” “endogenous plant transcription unit” and the like refer to the native form of a promoter, gene, or plant transcription unit in its natural location in the organism or in the genome of an organism.
[0024] As used herein, the term “exemplary” refers to an example, an instance, or an illustration, and does not indicate a preferred embodiment unless otherwise stated.Docket No. P15033WO00
[0025] The term “heterologous” as used herein with regards to a DNA molecule, nucleotides, or polynucleotides inserted into a plant genome refer to any DNA molecule, nucleotide, or polynucleotide that is synthetic or that has been removed from its native location and that has been inserted into a new genomic location.
[0026] As used herein, the phrase “hypomorphic allele” refers to an allele of a gene with less gene activity than a wild-type allele but more gene activity than an amorphic allele.
[0027] As used herein, the terms “include,” “includes,” and “including” are to be construed as at least having the features to which they refer while not excluding any additional unspecified features.
[0028] As used herein, the term “isomorphic allele” refers to an allele of a gene having wildtype gene activity.
[0029] As used herein, the term “introduced” means providing a nucleic acid (e.g., expression construct) or protein into a cell. Introduced includes reference to the incorporation of a nucleic acid into a eukaryotic or prokaryotic cell where the nucleic acid may be incorporated into the genome of the cell and includes reference to the transient provision of a nucleic acid or protein to the cell. Introduced includes reference to stable or transient transformation methods. Thus, “introduced” in the context of inserting a nucleic acid fragment (e.g, a recombinant DNA construct / expression construct) into a cell, means “transfection” or “transformation” or “transduction” and includes reference to the incorporation of a nucleic acid fragment into a eukaryotic or prokaryotic cell where the nucleic acid fragment may be incorporated into the genome of the cell (e.g, nuclear chromosome, plasmid, plastid, chloroplast, or mitochondrial DNA), converted into an autonomous replicon, or transiently expressed (e.g., transfected mRNA).
[0030] As used herein, a “loss-of-function allele” can include an amorphic allele or a hypomorphic allele of a gene.
[0031] As used herein, a “non-natural” or “non-naturally occurring” mutation refers to a mutation in a gene which is generated via human intervention or descended from the mutation generated via human intervention. Non-limiting examples of human intervention which can be used to generate a non-naturally occurring mutation include mutagenesis (e.g., chemical mutagenesis, ionizing radiation mutagenesis), mutagenesis followed by DNA sequence-based screening and selection (TILLING), and targeted genetic modifications (e.g., CRISPR-based methods, TALEN-based methods, zinc finger-based methods).
[0032] As used herein, the phrase "operably linked" refers to a juxtaposition wherein the components so described are in a relationship permitting them to function in their intendedDocket No. P15033WO00manner. For instance, a promoter is operably linked to a coding sequence if the promoter affects its transcription or expression. In another non-limiting example, an “expression enhancing element” (e.g., a transcription enhancer element) is operably linked to a promoter if the expression increasing element increases activity of the promoter (e.g., as measured by promoter-driven accumulation of a transcript or protein encoded by the transcript). In certain embodiments provided herein, a heterologous “expression enhancing element” (e.g., a transcription enhancer element) is operably linked to an endogenous plant promoter (e.g., a maize DVL1 gene promoter associated with the endogenous maize gene) which is located in a plant chromosome.
[0033] As used herein, the term “plant” includes a whole plant and any descendant, cell, tissue, or part of a plant. The term “plant parts” include any part(s) of a plant, including, for example and without limitation: seed (including mature seed and immature seed); a plant cutting; a plant cell; a plant cell culture; or a plant organ (e.g., pollen, embryos, flowers, fruits, shoots, leaves, roots, stems, and explants). A plant tissue or plant organ may be a seed, protoplast, callus, or any other group of plant cells that is organized into a structural or functional unit. A plant cell or tissue culture may be capable of regenerating a plant having the physiological and morphological characteristics of the plant from which the cell or tissue was obtained, and of regenerating a plant having substantially the same genotype as the plant. Regenerable cells in a plant cell or tissue culture may be embryos, protoplasts, meristematic cells, callus, pollen, leaves, anthers, roots, root tips, flowers, or stalks. In contrast, some plant cells are not capable of being regenerated to produce plants and are referred to herein as “non-regenerable” plant cells.
[0034] As used herein, the phrase “transcription start site” or term “(TSS)” refers to the nucleotide corresponding to the 5’ end of the 5’ untranslated sequence of the sense strand of the gene.
[0035] As used herein, the phrase “translational start site” or term “(TmslSS)” refers to the nucleotide corresponding to the adenine residue of the first nucleotide of the ATG translation initiation codon of the gene.
[0036] As used herein, the terms “unmodified DVL1 gene” and “DVL1 protein” respectively refer to either the gene of SEQ ID NO: 1, 120, 122, and allelic variants thereof or the protein of SEQ ID NO: 6 and allelic variants thereof.
[0037] To the extent to which any of the preceding definitions is inconsistent with definitions provided in any patent or non-patent reference incorporated herein by reference, any patent or non-patent reference cited herein, or in any patent or non-patent reference found elsewhere, it is understood that the preceding definition will be used herein.
[0038] Maize plants comprising a modified DEVIL 1 (DVL1) gene also known as ROTUNDIFOLIA-like 8 wherein a heterologous expression enhancing element is located in theDocket No. P15033WO00modified gene and provides for increased expression of a DVL1 gene product (e.g., a DVL1 protein or RNA transcript encoding the protein) are disclosed. Maize plants comprising a hypom orphic or amorphic DVL1 allele providing for decreased expression of a DVL1 gene product (e.g., a DVL1 protein or RNA transcript encoding the protein) are also disclosed An endogenous and unmodified DVL1 gene allele (SEQ ID NO: 1) is set forth in the “MaizeGDB” (maize genome database world wide web internet site “maizegdb.org”) under accession number Zm00001ebl36340 (based on maize genome assembly Zm-B73-REFERENCE-NAM-5.0) and encodes the DVL1 protein (SEQ ID NO: 6). DVL1 gene allele (SEQ ID NO: 120) is alternatively set forth in the “MaizeGDB” (maize genome database world wide web internet site “maizegdb.org”) under accession number Zm00001d041535 (based on maize genome assembly Zm-B73-REFERENCE-NAM-4.0).
[0039] Allelic variants of an endogenous DVL1 gene (SEQ ID NO: 1, 120, 122) include sequence variants of both non-coding regions e.g., promoter, 5’ UTR, and 3’ UTR set forth in SEQ ID NO: 1, 120, 122) and coding regions (regions of the genes encoding the proteins of SEQ ID NO: 6 or 138). Allelic variants of an endogenous DVL1 gene include variants which encode DVL1 proteins having at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 6 or 138. Allelic variants of an endogenous DVL1 gene also include variants having at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 1, 120, or 122. Allelic variants of a modified endogenous DVL1 gene also include variants having at least 95%, 96%, 98%, 99%, or 99.5% sequence identity to SEQ ID NO: 8 or 9.
[0040] In embodiments, the present disclosure provides for maize plant cells, plant parts including seed, plants, seed lots, and biological samples comprising an amorphic or hypomorphic allele of a DVL1 gene (i.e., comprising at least one mutation in the endogenous DVL1 gene). These maize plants and parts can be utilized for human food, livestock feed, as a raw material in industry, or as breeding material for development of other maize varieties.
[0041] In certain embodiments, guide RNAs comprising the spacers encoded by any one of SEQ ID NO: 139-194 or 195 are used in conjunction with suitable Cas nucleases to introduce amorphic or hypomorphic mutations into the DVL1 gene (e.g., an exon which contains an open reading frame (ORF) encoding a portion of the DVL1 protein). In some embodiments, the guide RNAs comprise the spacers encoded by any one of SEQ ID NO: 139, 141, 142, 145, 147, 149, 150, 193, 194, or 195. In some embodiments, distinct gRNAs can be used to introduce amorphic or hypomorphic mutations in the DVL1 gene or allelic variants thereof.
[0042] To obtain maize plants with altered stature and improved performance as both inbred parents and as a hybrids, it is desirable in certain embodiments to obtain an allelic series of maizeDocket No. P15033WO00plants comprising different modified DVL1 genes. In the allelic series, distinct expression levels of the different modified DVL1 genes are obtained to produce plants with distinct alterations in height. In some embodiments, the alteration in height is an increase in plant height ranging from about 5% or 10% to about 15%, 20%, 30%, or 50% in comparison to control plants lacking the modified DVL1 gene. In some embodiments, the alteration in height is a reduction in plant height ranging from about 5% or 10% to about 15%, 20%, 30%, or 50% in comparison to control plants lacking the modified DVL1 gene In certain contexts, maize plants having a given DVL1 gene results in higher increases or lower reductions in height (e.g., from about 5% to about 15% in comparison to control plants) are selected from the allelic series in order to obtain plants having a desired height increase or decrease. In certain contexts, maize plants having a given DVL1 gene with results in higher increases or lower reductions in height (e.g., from about 15% to about 20% or 30% in comparison to control plants) are selected from the allelic series in order to obtain plants having a desired height increase or decrease. In certain embodiments, maize plants having a given modified DVL1 gene exhibit increases in expression of the DVL1 gene in one or more maize tissues of about 10%, 15%, or 20% to about 30%, 40%, 50%, 60%, 70%, 80%, or 100% in comparison to a control maize plant lacking the modified DVL1 are obtained in the allelic series. In certain embodiments, maize plants having a given modified DVL1 gene exhibit increases of expression of a DVL1 gene of about 1.2-fold or 1.5-fold to about 2-fold, 3-fold, or 5 -fold in at least one maize tissue in the maize plant in comparison to a control maize plant lacking the modified DVL1 gene. In certain embodiments, the desired height increase and / or expression level can be selected based on performance characteristics (e.g., inbred and / or hybrid seed yield) for particular germplasms and / or for use in certain target geographies.
[0043] In certain embodiments, an allelic series of different modified DVL1 genes can be obtained by insertion or formation of a transcription enhancer in the unmodified DVL1 gene such that the transcription enhancer is operably linked to the promoter of the gene but placed at different positions relative to the transcription start site (TSS). In certain embodiments, the allelic series can be obtained by locating the transcription enhancer at different positions from about 10, 20, 30, 40, 100, 150, or 200 base pairs (bp) to about 220, 240, 260, 280, 300, 350, 400, 450, 500, or 1000 bp 5’ of the transcription start site (TSS) of the DVL1 gene or TSS of a transgene encoding the DVL1 protein.
[0044] In certain embodiments, operable linkage to the endogenous promoter is achieved by insertion or formation of an enhancer in one or more of an endogenous promoter, 5’ untranslated region (5’UTR), intron, and / or 3’ untranslated region of an endogenous DVL1 gene located at its native chromosomal location (e.g., by CRISPR, TALEN, or artificial Zinc Finger mediated geneDocket No. P15033WO00editing). Transcriptional enhancer elements that can be inserted or formed in the DVL1 gene promoter, 5’ UTR, intron, or 3’ UTR can comprise one or more DNA molecules set forth in SEQ ID NO: 10, SEQ ID NO: 11-SEQ ID NO: 117, and / or SEQ ID NO: 118. In certain embodiments, two distinct enhancers independently selected from SEQ ID NO: 10, SEQ ID NO: 11-SEQ ID NO: 117, and / or SEQ ID NO: 118 are inserted or formed in the gene promoter, 5’ UTR, intron, or 3’ UTR. In certain embodiments, a distinct enhancer independently selected from SEQ ID NO: 10, SEQ ID NO: 11-SEQ ID NO: 117, and / or SEQ ID NO: 118 are inserted or formed in the DVL1 gene promoter, 5’ UTR, intron, or 3 ’ UTR. In certain embodiments, members of a modified DVL1 gene allelic series can comprise insertions of a transcription enhancer (e.g., one or more DNA molecules set forth in SEQ ID NO: 10, SEQ ID NO: 11-SEQ ID NO: 117, and / or SEQ ID NO: 118) at: (i) about 174 to about 134 base pairs or about 174, 172, 170, 168, 166, 164, 162, 160, 158, 156, 154, 152, 150, 148, 146, 144, 142, 140, 138, or 136 base pairs 5’ to the transcription start site (TSS) of the endogenous DVL1 gene or TSS of the transgene encoding the DVL1 protein; (ii) about 275 to about 235 base pairs or about 274, 272, 270, 268, 266, 264, 262, 260, 258, 256, 255, 254, 252, 250, 248, 246, 244, 242, 240, 238, or 236 base pairs 5’ to the TSS of the DVL1 gene or TSS of the transgene encoding the DVL1 protein; or (iii) in a double stranded break introduced in the endogenous DVL1 gene promoter with a Cast 2 nuclease and a Cast 2 guide RNA comprising a spacer encoded by SEQ ID NO: 123 or 127.
[0045] In certain embodiments, insertions of the transcription enhancer at any of the aforementioned positions in the DVL1 promoter is accompanied by the deletion of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, or more base pairs of DNA in the DVL1 promoter either 5’ and / or 3’ to the transcription enhancer insertion in the corresponding DNA of SEQ ID NO: 1, 120, 122, or an allelic variant thereof. In certain embodiments, any of the aforementioned transcription enhancer insertions can be combined with an insertion of a heterologous translational enhancing element and / or a heterologous intron in the DVL1 gene. A list of useful transcriptional enhancer elements that can be used to obtain an allelic series of different modified DVL1 genes is provided in Table 1.Table 1. Transcriptional enhancer elements.Docket No. P15033WO00Docket No. P15033WO00&Docket No. P15033WO00Docket No. P15033WO00Docket No. P15033WO00Docket No. P15033WO001Y= T or C; W= A or T; S=C or G; M= A or C; N= A, G, C, or T; K= G or T; R=A or G; K= G or T; D= A, G, or T; B=C, G, or T; H=A, C, or T
[0046] The transcriptional enhancer element of SEQ ID NO: 10 comprises 3 copies of a 12-nucleotide core element nucleotide sequence of SEQ ID NO: 11. The 12 nucleotide core element nucleotide sequence of SEQ ID NO: 11 is present at several locations in the maize genome. For example, it can be found at several chromosomal locations of the maize variety B73. According to the B73v4 version of the genomic sequences (available on the https world wide web internet site maizegdb.org / genome / assembly / Zm-B73-REFERENCE-GRAMENE-4.0 and hereinafter referred to as “B73v4 maize genome”), SEQ ID NO: 17 can be found on Chr3 coordinates 1,063,395..1,063,406 (intron of Zm00001d039287), on Chr3 coordinates 12,253,969..12,253,980 (immediately downstream of Zm00001d039695), on Chr3 coordinates 12, 265, 615..12, 265, 626 (intron of Zm00001d039695), on Chr3 coordinates 12,277,428..12,277,439 (intron of Zm00001d039695), on Chr3 coordinates 147,698,750..147,698,761 (not within 2 kb of an annotated gene model), on Chr6, coordinates 107, 132, 183..107, 132, 194 (about 2 kb downstream of Zm00001d036949), on ChrlO, coordinates 53, 761, 662..53, 761, 673 (not within 2 kb of an annotated gene model).
[0047] In certain embodiments, a modified DVL1 gene with increased expression that provides for increased plant height is obtained by inserting a heterologous intron in the 5’ UTR and / or within the coding region of a DVL1 gene. Materials and methods for intron mediated enhancement (IME) of plant gene expression described previously (Laxa, M. Front. Plant Sci., 06 January 2017 doi.org / 10.3389 / fpls.2016.01977; Rose, A.B. Plant J. 17 November 2004 doi.org / 10.1111 / j.1365-313X.2004.02247.x; Parra, G. et al. Nucleic Acids Research, Volume 39, Issue 13, 1 July 2011, 5328-5337, doi.org / 10.1093 / nar / gkr043) can be adapted for use in enhancing expression of DVL1 gene. Heterologous introns that can be used to increase expression of plant genes include an Actin, Hsp70, PEPC, UBQ (e.g., UBQ1, UBQ10), EF-la, EF-1 , Histone H3, ATPK1, RHD3, or MHX intron (e.g., a rice or maize Actin, Hsp70, PEPC, UBQ1, UBQ10, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron). In certain embodiments, the intron is inserted within or at about 500, 200, 100, 50, 30, or 20 base pairs of the transcription start site (TSS). In certain embodiments, the intron is inserted in the 5’ UTR and / or in the coding region within at about 500, 200, 100, 50, 30, or 20 base pairs of the translational start site (TmslSS) of a DVL1 gene. In certainDocket No. P15033WO00embodiments, the intron is inserted in the 5’ UTR and / or in the coding region within about 20 to about 100, 150, 200, 250, or 255 base pairs of the translational start site (TmslSS) of a DVL1 gene.
[0048] In certain embodiments, a modified DVL1 gene with increased expression that provides for increased plant height is obtained by inserting a heterologous translational enhancer in the 5’ UTR and / or within the coding region of the DVL1 gene. Translational enhancers can comprise 5’ UTRs and / or 5’ UTR and one or more codons of a coding region. Translational enhancers include 5’ UTRs of various rice genes that can enhance translation of linked heterologous reporter genes (e.g., a 5’ UTR of a rice Adh gene (Sugio et al. J. Biosci. Bioengin. 105(3), 300-302 (2008) doi.org / 10.1263 / jbb.105.300; glutathione transferase U50, glutathione peroxidase 1, 20S proteasome alphal subunit, pathogenesis-related protein 4b, glycine-rich cell-wall structural protein 1, orUspA domain containing protein; Yamasaki et al. Plant Biotechnology 35, 365-373 (2018) DOI: 10.5511 / plantbiotechnology.l8.0903a). In certain embodiments, the translational enhancer is encoded by a DNA molecule comprising the DNA sequence of any aforementioned 5’UTR and all or part of the 5’UTR is substituted for all or part of the DVL1 5’ UTR in the modified DVL1 gene.
[0049] Expression of a DVL1 encoding transgene can also be increased by in vitro insertion or formation of the in the transgene such that it is operably linked to the promoter that is operably linked to transgene and then introducing the transgene into the maize plant genome (e.g., by Agrobacterium-mediated transformation or biolistics). In certain embodiments, such transgenes can comprise a modified promoter that comprises any of the aforementioned modified DVL1 genes with the insertions and / or substitutions of the aforementioned transcription enhancers, introns, and / or translational enhancers. In certain embodiments, such transgenes can comprise a whole or partial substitution of a DVL1 promoter, 5’ UTR, and / or intron with a heterologous promoter, 5’ UTR, and / or intron.
[0050] Expression of a modified DVL1 gene can be increased in comparison to a control maize plant comprising the unmodified DVL1 gene. Such increases in expression can be measured by a variety of methods. In certain embodiments, an increased plant height trait conferred by increased expression of a modified DVL1 gene is measured in maize plants comprising the expression increasing element and compared to control maize plants comprising the unmodified DVL1 gene. Increase in height traits can be assessed by comparing any measure of the increased height trait itself (e.g., total height, internode length, etc.) or a proxy for the trait (e.g., yield of seed and / or other biomass in kg / hectare) in maize plants comprising the modified DVL1 gene can be increased in comparison to a control maize plant comprising the unmodified DVL1 gene. In certainDocket No. P15033WO00embodiments, increased expression of the encoded transcript itself is directly measured by determining amounts of the DVL1 gene-encoding transcript (e.g., an mRNA or non-coding RNA) in maize plants comprising the modified DVL1 gene and compared to amounts of the transcriptencoding polynucleotide in control maize plants comprising the unmodified DVL1 gene. Amounts of the DVL1 gene-encoding transcript can be determined by a variety of techniques including PCR (e.g., quantitative reverse-transcriptase PCR; qRT-PCR), hybridization, CRISPR-, and / or sequencing- based techniques (Khodakov et al., doi.org / 10.1016 / j.addr.2016.04.005; Gootenberg, et al. doi: 10.1126 / science.aaq0179). In certain embodiments, expression of a DVL1 geneencoding polynucleotide can also be determined by measuring amounts of a DVL1 protein encoded by the transcript in maize plants comprising the transcription enhancer and compared to amounts of the DVL1 protein in control maize plants comprising the unmodified DVL1 gene. Amounts of the DVL1 protein can be determined by a variety of techniques including immunoassays for the protein, and mass spectroscopy -based techniques (Chen et al. doi: 10.1186 / S12967-015-0537-6; Bruce et al. doi: 10.1002 / 0471250953.bil321s41). The magnitude of the increase in transcript production may depend on the baseline expression level of the unmodified endogenous DVL1 transcript-encoding polynucleotide in the respective cells or tissues. By way of a non-limiting example, the magnitude of the increase in expression of an endogenous DVL1 gene modified by insertion or formation of SEQ ID NO: 10 in an endogenous DVL1 promoter over baseline expression levels of the unmodified endogenous DVL1 gene will be greatest where baseline DVL1 expression levels are low. In certain embodiments, expression of the endogenous DVL1 gene modified by insertion of a heterologous expression enhancer e.g., the transcription enhancer of SEQ ID NO: 10) can be increased by at least 1.2-, 1.5-, 2-, 3-, 4-, or 5-fold over baseline expression levels of the unmodified endogenous DVL1 gene. In certain embodiments, expression of the endogenous DVL1 gene modified by insertion or formation of the heterologous expression enhancer (e.g., the transcription enhancer of SEQ ID NO: 10) can be increased by at least about 1.2- or 1.5-fold to about 2-, 3-, 4-, 5-, 6-fold or more over baseline expression levels of the unmodified endogenous DVL1 gene in unmodified control plants.
[0051] In certain embodiments, it will be desirable to use genome editing molecules to introduce or form a heterologous expression enhancing element (e.g., a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron) in an endogenous DVL1 gene. Gene editing molecules of use in methods provided herein include molecules capable of introducing a double-strand break (“DSB”) or single-strand break (“SSB”) at a specific site or sequence in a double-stranded DNA, such as in genomic DNA or in a target gene located within the genomic DNA as well as accompanying guide RNA or donor or other DNA templateDocket No. P15033WO00polynucleotides. Examples of such gene editing molecules include: (a) a nuclease comprising an RNA-guided nuclease, an RNA-guided DNA endonuclease or RNA directed DNA endonuclease (RdDe), a class 1 CRISPR type nuclease system, a type II Cas nuclease, a Cas9, a nCas9 nickase, a type V Cas nuclease, a Cas 12a nuclease, a nCas 12a nickase, a Cas 12d (CasY), a Casl2e (CasX), a Casl2b (C2cl), a Casl2c (C2c3), a Casl2i, a Casl2j, a Casl4, an engineered nuclease, a codon-optimized nuclease, a zinc-finger nuclease (ZFN) or nickase, a transcription activator-like effector nuclease (TAL-effector nuclease or TALEN) or nickase (TALE-nickase), an Argonaute, and a meganuclease or engineered meganuclease; (b) a polynucleotide encoding one or more nucleases capable of effectuating site-specific alteration (including introduction of a D SB or SSB) of a target nucleotide sequence; (c) a guide RNA (gRNA) for use with an RNA-guided nuclease, or a DNA encoding a gRNA for use with an RNA-guided nuclease; (d) donor DNA template polynucleotides suitable for insertion at a break in genomic DNA by homology-directed repair (HDR) or microhomology-mediated end joining (MMEJ); and (e) other DNA templates (e.g., dsDNA, ssDNA, or combinations thereof) suitable for insertion at a break in genomic DNA (e.g., by nonhom ologous end joining (NHEJ).
[0052] CRISPR technology for editing the genes of eukaryotes is disclosed in US Patent Application Publications 2016 / 0138008A1 and US2015 / 0344912A1, and in US Patents 8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406, 8,889,418, 8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616. Cpfl endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication 2016 / 0208243 Al. Plant RNA promoters for expressing CRISPR guide RNA and plant codon optimized CRISPR Cas9 endonuclease are disclosed in International Patent Application PCT / US2015 / 018104 (published as WO 2015 / 131101 and claiming priority to US Provisional Patent Application 61 / 945,700). Methods of using CRISPR technology for genome editing in plants are disclosed in US Patent Application Publications US 2015 / 0082478A1 and US 2015 / 0059010A1 and in International Patent Application PCT / US2015 / 038767 Al (published as WO 2016 / 007347 and claiming priority to US Provisional Patent Application 62 / 023,246). In certain embodiments, an RNA-guided endonuclease that leaves a blunt end following cleavage of the target site is used. Blunt-end cutting RNA-guided endonucleases include Cas9, Casl2c, Casl2i, and Cas 12h (Yan et al., 2019). In certain embodiments, an RNA-guided endonuclease that leaves a staggered single stranded DNA overhanging end following cleavage of the target site following cleavage of the target site is used. Staggered-end cutting RNA-guided endonucleases include Cas 12a, Cas 12b, and Casl2e. The target Cas nuclease cleavage site in the promoters ofDocket No. P15033WO00the endogenous DVL1 gene is set forth in SEQ ID NO: 1, 120, or 122. All of the patent publications referenced in this paragraph are incorporated herein by reference in their entirety.
[0053] CRISPR-type genome editing can be adapted for use in the plant cells and methods provided herein in several ways. CRISPR elements, e.g., gene editing molecules comprising CRISPR endonucleases and CRISPR guide RNAs including single guide RNAs or guide RNAs in combination with tracrRNAs or scoutRNA, or polynucleotides encoding the same, are useful in effectuating genome editing without remnants of the CRISPR elements or selective genetic markers occurring in progeny. In certain embodiments, the CRISPR elements are provided directly to the eukaryotic cell (e.g., maize plant cells), systems, methods, and compositions as isolated molecules, as isolated or semi-purified products of a cell free synthetic process (e.g., in vitro translation), or as isolated or semi -purified products of in a cell-based synthetic process (e.g., such as in a bacterial or other cell lysate). In certain embodiments, maize plants or maize plant cells used in the systems, methods, and compositions provided herein can comprise a transgene that expresses a CRISPR endonuclease (e.g., a Cas9, a Cpfl-type or other CRISPR endonuclease). In certain embodiments, one or more CRISPR endonucleases with unique PAM recognition sites can be used. Guide RNAs (sgRNAs or crRNAs and a tracrRNA) can form an RNA-guided endonuclease / guide RNA complex which can specifically bind sequences in the gDNA target site that are adjacent to a protospacer adjacent motif (PAM) sequence. Such guide RNAs comprise a spacer RNA which is complementary to a target site in the DNA which is adjacent to the PAM sequence. The type of RNA-guided endonuclease typically informs the location of suitable PAM sites and design of crRNAs or sgRNAs. G-rich PAM sites, e.g., 5’-NGG are typically targeted for design of crRNAs or sgRNAs used with Cas9 proteins. Examples of PAM sequences include 5’-NGG (Streptococcus pyogenes), 5’-NNAGAA (Streptococcus thermophilus CRISPR1), 5’-NGGNG (Streptococcus thermophilus CRISPR3), 5’-NNGRRT or 5’-NNGRR (Staphylococcus aureus Cas9, SaCas9), and 5’-NNNGATT (Neisseria meningitidis). T-rich PAM sites (e.g., 5’-TTN or 5’-TTTV, where "V" is A, C, or G) are typically targeted for design of crRNAs or sgRNAs used with Casl2a proteins. In some instances, Casl2a can also recognize a 5’-CTA PAM motif. Other examples of potential Casl2a PAM sequences include TTN, CTN, TCN, CCN, TTTN, TCTN, TTCN, CTTN, ATTN, TCCN, TTGN, GTTN, CCCN, CCTN, TTAN, TCGN, CTCN, ACTN, GCTN, TCAN, GCCN, and CCGN (wherein N is defined as any nucleotide). Cpfl endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication 2016 / 0208243 Al, which is incorporated herein by reference for its disclosure of DNA encoding Cpfl endonucleases and guide RNAs and PAM sites.Docket No. P15033WO00
[0054] In certain embodiments, zinc finger nucleases or zinc finger nickases can also be used in the methods provided herein. Zinc-finger nucleases are site-specific endonucleases comprising two protein domains: a DNA-binding domain, comprising a plurality of individual zinc finger repeats that each recognize between 9 and 18 base pairs, and a DNA-cleavage domain that comprises a nuclease domain (typically Fokl). The cleavage domain dimerizes in order to cleave DNA; therefore, a pair of ZFNs are required to target non-palindromic target polynucleotides. In certain embodiments, zinc finger nuclease and zinc finger nickase design methods which have been described (Urnov et al. (2010) Nature Rev. Genet., 11:636 - 646; Mohanta et al. (2017) Genes vol. 8,12: 399; Ramirez et al. Nucleic Acids Res. (2012); 40(12): 5560-5568; Liu et al. (2013) Nature Communications, 4: 2565) can be adapted for use in the methods set forth herein. The zinc finger binding domains of the zinc finger nuclease or nickase provide specificity and can be engineered to specifically recognize any desired target DNA sequence. The zinc finger DNA binding domains are derived from the DNA-binding domain of a large class of eukaryotic transcription factors called zinc finger proteins (ZFPs). The DNA-binding domain of ZFPs typically contains a tandem array of at least three zinc “fingers” each recognizing a specific triplet of DNA. A number of strategies can be used to design the binding specificity of the zinc finger binding domain. One approach, termed “modular assembly”, relies on the functional autonomy of individual zinc fingers with DNA. In this approach, a given sequence is targeted by identifying zinc fingers for each component triplet in the sequence and linking them into a multi-finger peptide. Several alternative strategies for designing zinc finger DNA binding domains have also been developed. These methods are designed to accommodate the ability of zinc fingers to contact neighboring fingers as well as nucleotide bases outside their target triplet. Typically, the engineered zinc finger DNA binding domain has a novel binding specificity, compared to a naturally occurring zinc finger protein. Engineering methods include, for example, rational design and various types of selection. Rational design includes, for example, the use of databases of triplet (or quadruplet) nucleotide sequences and individual zinc finger amino acid sequences, in which each triplet or quadruplet nucleotide sequence is associated with one or more amino acid sequences of zinc fingers which bind the particular triplet or quadruplet sequence. See, e.g., US Patents 6,453,242 and 6,534,261, both incorporated herein by reference in their entirety. Exemplary selection methods (e.g., phage display and yeast two-hybrid systems) can be adapted for use in the methods described herein. In addition, enhancement of binding specificity for zinc finger binding domains has been described in US Patent 6,794,136, incorporated herein by reference in its entirety. In addition, individual zinc finger domains may be linked together using any suitable linker sequences. Examples of linker sequences are publicly known, e.g., see USDocket No. P15033WO00Patents 6,479,626; 6,903,185; and 7,153,949, incorporated herein by reference in their entirety. The nucleic acid cleavage domain is non-specific and is typically a restriction endonuclease, such as Fokl. This endonuclease must dimerize to cleave DNA. Thus, cleavage by Fokl as part of a ZFN requires two adjacent and independent binding events, which must occur in both the correct orientation and with appropriate spacing to permit dimer formation. The requirement for two DNA binding events enables more specific targeting of long and potentially unique recognition sites. Fokl variants with enhanced activities have been described and can be adapted for use in the methods described herein; see, e.g., Guo et al. (2010) J. Mol. Biol., 400:96 - 107.
[0055] Transcription activator like effectors (TALEs) are proteins secreted by certain Xanthomonas species to modulate gene expression in host plants and to facilitate the colonization by and survival of the bacterium. TALEs act as transcription factors and modulate expression of resistance genes in the plants. Recent studies of TALEs have revealed the code linking the repetitive region of TALEs with their target DNA-binding sites. TALEs comprise a highly conserved and repetitive region consisting of tandem repeats of mostly 33 or 34 amino acid segments. The repeat monomers differ from each other mainly at amino acid positions 12 and 13. A strong correlation between unique pairs of amino acids at positions 12 and 13 and the corresponding nucleotide in the TALE-binding site has been found. The simple relationship between amino acid sequence and DNA recognition of the TALE binding domain allows for the design of DNA binding domains of any desired specificity. TALEs can be linked to a non-specific DNA cleavage domain to prepare genome editing proteins, referred to as TAL-effector nucleases or TALENs. As in the case of ZFNs, a restriction endonuclease, such as Fokl, can be conveniently used. Methods for use of TALENs in plants have been described and can be adapted for use in the methods described herein, see Mahfouz et al. (2011) Proc. Natl. Acad. Sci. USA, 108:2623 -2628; Mahfouz (2011) GM Crops, 2:99 - 103; and Mohanta et al. (2017) Genes vol. 8,12: 399). TALE nickases have also been described and can be adapted for use in methods described herein (Wu et al.; Biochem Biophys Res Commun. (2014);446( 1 ):261 -6; Luo et al; Scientific Reports 6, Article number: 20657 (2016)).
[0056] In certain embodiments where heterologous expression enhancing element (e.g., a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron) is inserted into the genome at a site of a double stranded break in the endogenous DVL1 gene introduced by one or more nucleases or nickases e.g., a CRISPR / guide RNA complex with site-specific endonuclease or nickase, an aZF nuclease or nickase, and / or a TALE nuclease or nickase), the donor DNA template or other DNA template comprises the heterologous expression enhancing element (e.g., a heterologous transcription enhancer, aDocket No. P15033WO00heterologous translational enhancing element, and / or a heterologous intron). In certain embodiments where the heterologous expression enhancing element is formed in the genome at a site of a double stranded break in the maize plant genome introduced by a nuclease, the donor DNA template or other DNA template can comprise less than the complete set of nucleotides or base pairs of the transcription enhancer (e.g., less than the entire 36 nucleotides or base pairs of SEQ ID NO: 10 sequence) and genomic DNA at the site of integration can contribute the nucleotides or base pairs of the transcription enhancer that are absent from the donor DNA template or other DNA template. In certain embodiments where SEQ ID NO: 10 is formed in the genomic DNA, the donor DNA template or other DNA template can comprise up to 35 contiguous nucleotides or base pairs of SEQ ID NO: 10, the genomic DNA at the site of integration can contribute 1 or more nucleotides or base pairs of the SEQ ID NO: 10 sequence which are lacking from the donor DNA template or other DNA template, and the complete 36 base pair sequence of SEQ ID NO: 10 is formed at the site of integration in the genome. Donor DNA template molecules used in the methods provided herein include DNA molecules comprising, from 5’ to 3’, a first homology arm, a replacement DNA, and a second homology arm, wherein the homology arms containing sequences that are partially or completely homologous to genomic DNA (gDNA) sequences flanking a target site-specific endonuclease cleavage site in the gDNA. In certain embodiments, the replacement DNA can comprise an insertion, deletion, or substitution of 1 or more DNA base pairs relative to the target gDNA. In one embodiment, the donor DNA template molecule is double-stranded and perfectly base-paired through all or most of its length, with the possible exception of any unpaired nucleotides at either terminus or both termini. In another embodiment, the donor DNA template molecule is double-stranded and includes one or more nonterminal mismatches or non-terminal unpaired nucleotides within the otherwise double-stranded duplex. In an embodiment, the donor DNA template molecule that is integrated at the site of at least one double-strand break (DSB) includes between 2-20 nucleotides in one (if single-stranded) or in both strands (if double-stranded), e. g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides on one or on both strands, each of which can be base-paired to a nucleotide on the opposite strand of the targeted integration site (in the case of a perfectly basepaired double-stranded polynucleotide molecule). Such donor DNA templates can be integrated in genomic DNA containing blunt and / or staggered double stranded DNA breaks by homology-directed repair (HDR) or microhomology-mediated end joining (MMEJ). In certain embodiments, a donor DNA template homology arm can be about 20, 50, 100, 200, 400, or 600 to about 800, or 1000 base pairs in length. In certain embodiments, integration of the donor DNA templates by HDR can be facilitated by use of an exonuclease (e.g., bacteriophage lambda exonuclease), aDocket No. P15033WO00single-stranded DNA annealing protein (SSAP; e.g., bacteriophage lambda beta SSAP protein), and a single-stranded DNA binding protein (SSB; e.g., an E. coli SSB) essentially as set forth in US Patent Application Publication 20200407754, which is incorporated herein by reference in its entirety. In certain embodiments, a donor DNA template molecule can be delivered to a maize plant cell in a circular (e.g., a plasmid or a viral vector including a geminivirus vector) or a linear DNA molecule. In certain embodiments, a circular or linear DNA molecule that is used can comprise a modified donor DNA template molecule comprising, from 5’ to 3’, a first copy of the target sequence-specific endonuclease cleavage site sequence, the first homology arm, the replacement DNA, the second homology arm, and a second copy of the target sequence-specific endonuclease cleavage site sequence. In other embodiments, DNA templates suitable for NHEJ insertion will lack homology arms that are partially or completely homologous to genomic DNA (gDNA) sequences flanking a target site-specific endonuclease cleavage site in the gDNA. In certain embodiments, the DNA template comprising all of an expression enhancing element (e.g., dsDNA, ssDNA, or combinations thereof) can be inserted at a double-stranded break in gDNA by non-homologous end joining (NHEJ). In certain embodiments, the DNA template (e.g., dsDNA, ssDNA, or combinations thereof) comprising less than the complete set of nucleotides of the expression enhancing element (e.g., a transcription enhancer less than 36 nucleotides or base pairs of SEQ ID NO: 16 sequence) can be inserted at a double-stranded break in gDNA by non-homologous end joining (NHEJ), gDNA at the site of insertion can contribute the nucleotides or base pairs of the expression enhancing element (e.g., SEQ ID NO: 10) that are absent from the DNA template, and the expression enhancing element (e.g., SEQ ID NO: 10) can be formed at the site of the double-stranded break in the gDNA.
[0057] In some embodiments, the expression enhancing element (e.g., a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron) replaces or largely replaces a corresponding sequence in a gene, such as in a promoter, a 5’ UTR, or an intron. Accordingly, a replacement rather than an insertion leaves the positioning of other elements unchanged. A replacement target site may be chosen by similarity to the expression enhancing element or a portion thereof. A replacement template could be used in an HDR process, and / or DNA base editing and / or genome editing could be used to produce the desired replacement region that corresponds to the expression enhancing element or a portion thereof. Base editors include for example, a site-specific base edit mediated by a C*G to T A or an A T to G*C base editing deaminase enzymes (Gaudelli et al., Programmable base editing of A T to G*C in genomic DNA without DNA cleavage." Nature (2017); Nishida et al. "Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems." ScienceDocket No. P15033WO00353 (6305) (2016); Komor et al. "Programmable editing of a target base in genomic DNA without double-stranded DNA cleavage." Nature 533 (7603) (2016):420-4. Catalytically dead dCas9 fused to a cytidine deaminase or an adenine deaminase protein becomes a specific base editor that can alter DNA bases without inducing a DNA break. Base editors convert C->T (or G->A on the opposite strand) or an adenine base editor that would convert adenine to inosine, resulting in an A->G change within an editing window specified by the gRNA.
[0058] Maize plant cells, plant parts, and plants comprising at least one mutation in the maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof are provided. In certain embodiments, the at least one mutation is a non-natural mutation. In certain embodiments, the at least one mutation comprises a loss-of-function allele of the DVL1 gene of SEQ ID NO: 1, 120, or 122 or an allelic variant thereof. In certain embodiments, the Examples of mutations can include a deletion, an insertion, and / or a substitution of one or more nucleotides of the endogenous DVL1 gene. The insertion, deletion, and / or substitution can be made anywhere in the DVL1 gene including, for example, in the promoter region, an exon, an intron, and / or the untranslated regions (5’ UTR or 3’ UTR). In certain embodiments, the maize plants, plant parts, and plant cells are homozygous for the at least one mutation. In certain embodiments, the at least one mutation comprises, consists essentially of, or consists of a deletion, insertion, and / or substitution of at least one nucleotide (e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1250, 1500, 1750, 2000, or 2216 nucleotides) of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof. In certain embodiments, the at least one mutation comprises, consists essentially of, or consists of a deletion, insertion, and / or substitution in the coding region (z.e., nucleotides 3187-3390 of SEQ ID NO: 1, nucleotides 3001-3204 in SEQ ID NO: 120, nucleotides 3236-3439 in SEQ ID NO: 122, or in an equivalent position of an allelic variant of SEQ ID NO: 1) of the DVL1 gene. In certain embodiments, the at least one mutation in the DVL1 gene can comprise a deletion of the entire coding region or any portion of the coding region required for biological activity. In certain embodiments, the at least one mutation in the DVL1 gene comprises, consists essentially of, or consists of a deletion, insertion, and / or substitution of one or more nucleotides of: (i) an N-terminal DVL1 protein coding region (e g., nucleotides 3187-3234 of SEQ ID NO: 1 or in an equivalent position of an allelic variant of SEQ ID NO: 1). In certain embodiments, the at least one mutation comprises, consists essentially of, or consists of a deletion, insertion, and / or substitution of at least one nucleotide (e.g, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, 200, or 201 nucleotides) corresponding to nucleotidesDocket No. P15033WO003187-3387 within the protein coding region of the DVL1 gene of SEQ ID NO: 1 or in an equivalent position of an allelic variant of SEQ ID NO: 1, 120, or 122. In certain embodiments, the at least one mutation comprises, consists essentially of, or consists of a deletion, insertion, and / or substitution of at least one nucleotide e.g., at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides) corresponding to: nucleotides 3187-3234 or 3187-3387; all of the DVL1 gene of SEQ ID NO: 1, 120, or 122 or in an equivalent position of an allelic variant of SEQ ID NO: 1, 120, or 122.
[0059] In certain embodiments, the at least one mutation comprises, consists essentially of, or consists of a deletion, an insertion, and / or substitution that results in a frameshift mutation and / or a nonsense mutation in the coding region of the DVL1 gene. In certain embodiments, mutations of the DVL1 gene can comprise a deletion of any number of nucleotides that are not divisible by 3 in the exon of the DVL1 gene (e.g., the exon located between 3187-3387 of SEQ ID NO: 1, 120, or 122 or in an equivalent position of an allelic variant of SEQ ID NO: 1, 120, or 122). In certain embodiments, mutations of the DVL1 gene can comprise, consist essentially of, or consist of a deletion of 1, 2, 4, 5, 7, 8, 10, 11, 13, 14, 16, 17, 19, 20, 22, 23, 25, 26, 28, 29, 31, 32, 34, 35, 37, 38, 40, 41, 43, 44, 46, 47, 49, 50, 52, 53, 55, 56, 58, 59, 61, 62, 64, 65, 67, 68, 70, 71, 73, 74, 76, 77, 79, 80, 82, 83, 85, 86, 88, 89, 91, 92, 94, 95, 97, 98, 100, 101, 103, 104, 106, 107, 109, 110, 112, 113, 115, 116, 118, 119, 121, 122, 124, 125, 127, 128, 130, 131, 133, 134, 136, 137, 139, 140, 142, 143, 145, 146, 148, 149, 151, 152, 154, 155, 157, 158, 160, 161, 163, 164, 166, 167, 169, 170, 172, 173, 175, 176, 178, 179, 181, 182, 184, 185, 187, 188, 190, 191, 193, 194, 196, 197, 199, or 200 nucleotides of the exon located in the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122 or in an equivalent position of an allelic variant of SEQ ID NO: 1, 120, or 122 and result in a frameshift mutation and / or a nonsense mutation. In certain embodiments, the frameshift mutation and / or a nonsense mutation occurs at nucleotides corresponding to nucleotides 3187-3234 or 3187-3387; all ofthe DVLl gene of SEQ ID NO: 1, 120, or 122 or in an equivalent position of an allelic variant of SEQ ID NO: 1, 120, or 122.
[0060] In certain embodiments, the at least one mutation comprises, consists essentially of, or consists of an internal deletion that preserves the reading frame of the encoded DVL1 protein while removing at least one, two, three codons, thus resulting in a mutant DVL1 protein lacking at least one, two, or three amino acid residues. In certain embodiments, mutations of the DVL1 gene can comprise a deletion of any number of nucleotides that are divisible by 3 in a protein coding region of an exon of the In certain embodiments, guide RNAs comprising the spacers encoded by any one of SEQ ID NO: 139-194 or 195 are used in conjunction with suitable Cas nucleases to introduce amorphic or hypomorphic mutations in an exon which contains an openDocket No. P15033WO00reading frame (ORF) encoding a portion of the DVL1 protein. In other embodiments, distinct gRNAs can be used to introduce amorphic or hypomorphic mutations in the DVL1 gene or allelic variants thereof.
[0061] In certain embodiments, guide RNAs comprising the spacers encoded by any one of SEQ ID NO: 139-194 or 195 are used in conjunction with suitable Cas nucleases to introduce amorphic or hypomorphic mutations in an exon which contains an open reading frame (ORF) encoding a portion of the DVL1 protein. In other embodiments, distinct gRNAs can be used to introduce amorphic or hypomorphic mutations in the DVL1 gene or allelic variants thereof.
[0062] In certain embodiments, the at least one mutation of the DVL1 gene can comprise, consist essentially of, or consist of a deletion of 3, 6, 9, 12, 15, 18, 21, 24, 27, 30, 33, 36, 39, 42, 45, 48, 51, 54, 57, 60, 63, 66, 69, 72, 75, 78, 81, 84, 87, 90, 93, 96, 99, 102, 105, 108, 111, 114, 117, 120, 123, 126, 129, 132, 135, 138, 141, 144, 147, 150, 153, 156, 159, 162, 165, 168, 171, 174, 177, 180, 183, 186, 189, 192, 195, 198, or 201 nucleotides in a protein coding region of the exon of SEQ ID NO: 1, 120, or 122 or at an equivalent position in an allelic variant of SEQ ID NO: 1, 120, or 122 and preserve the reading frame.
[0063] In certain embodiments, height and / or internode length of the maize plant comprising at least one amorphic or hypomorphic allele of the endogenous maize DVL1 gene is decreased in comparison to the height and / or internode length of a wild-type or control maize plant lacking the at least one amorphic or hypomorphic allele of the DVL1 gene. Reduction in height traits can be assessed by comparing any measure of the reduced height trait itself (e.g., total height, internode length, etc.) or a proxy for the trait (e.g., yield of seed and / or other biomass in kg / hectare) in maize plants comprising the modified DVL1 gene can be decreased in comparison to a control maize plant comprising the unmodified DVL1 gene.
[0064] In certain embodiments, the plant height for the maize plant comprising the at least one mutation (e.g., loss-of-function mutation) in the DVL1 gene is decreased in comparison to the plant height for a wild-type or control maize plant lacking the at least one mutation. In certain embodiments, the plant height is decreased by at least about 2%, 3%, 4%, 5%, 6%, 7%, 8%, 9%, 10%, 12%, 15%, 18%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% in comparison to the plant height from the corresponding wild-type or control maize plant lacking the at least one mutation.
[0065] Also provided are polynucleotides comprising any of the aforementioned mutated DVL1 genes or fragments thereof. In certain embodiments, polynucleotides comprising at least one mutation relative to the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122 are provided. In certain embodiments, the polynucleotide comprises a sequence having at least 95%, 96, 97%, 98%, 99%, 99.5%, 99.6%, 99.7%, 99.8%, or 99.9% sequence identity across the entire length ofDocket No. P15033WO00SEQ ID NO: 1, 120, or 122 with the proviso that the sequences are not identical to across their entire length to SEQ ID NO: 1, 120, or 122. In certain embodiments, the polynucleotide is an isolated polynucleotide.
[0066] Biological samples and maize by-products comprising any of the aforementioned polynucleotides are also provided.
[0067] The disclosure also provides a method of making a maize plant comprising an amorphic or hypomorphic allele of aDVLl gene. In certain embodiments, the methods can comprise making a deletion, an insertion and / or a substitution which results in an amorphic or hypomorphic allele of a DVL1 gene. Gene editing molecules of use in methods provided herein include molecules capable of introducing a double-strand break (“DSB”) or single-strand break (“SSB”) at a specific site or sequence in a double-stranded DNA, such as in genomic DNA or in a target gene located within the genomic DNA as well as accompanying guide RNA. In certain embodiments, the at least one mutation results from introduction of a DSB at a target site in the DVL1 gene (e.g., SEQ ID NO: 1 or an allelic variant thereof) to induce non-homologous end joining (NHEJ) at the site of the break followed by recovery of the desired mutation. In certain embodiments, the at least one mutation results from introduction of a DSB at a target site in the DVL1 gene (e.g., SEQ ID NO: 1 or an allelic variant thereof) followed by homology-directed repair (HDR), microhomology-mediated end joining (MMEJ), or NHEJ to introduce a desired donor or other DNA template polynucleotide at the DSB, followed by recovery of the desired mutation. Examples of such gene editing molecules include: (a) a nuclease comprising an RNA-guided nuclease, an RNA-guided DNA endonuclease or RNA directed DNA endonuclease (RdDe), a class 1 CRISPR type nuclease system, a class 2 type II Cas nuclease, a Cas9, a nCas9 nickase, a class 2 type V Cas nuclease, a Cas 12a nuclease, a nCasl2a nickase, a Cas 12d (CasY), a Casl2e (CasX), a Casl2b (C2cl), a Casl2c (C2c3), a Casl2i, a Casl2j, a Casl4, an engineered nuclease, a codon-optimized nuclease, a zinc-finger nuclease (ZFN) or nickase, a transcription activatorlike effector nuclease (TAL-effector nuclease or TALEN) or nickase (TALE-nickase), an Argonaute, and a meganuclease or engineered meganuclease; (b) a polynucleotide encoding one or more nucleases capable of effectuating site-specific alteration (including introduction of a DSB or SSB) of a target nucleotide sequence; (c) a guide RNA (gRNA) for use with an RNA-guided nuclease, or a DNA encoding a gRNA for use with an RNA-guided nuclease; (d) optionally donor DNA template polynucleotides suitable for insertion at a break in genomic DNA by homology-directed repair (HDR) or microhomology -mediated end joining (MMEJ); and (e) optionally other DNA templates (e.g, dsDNA, ssDNA, or combinations thereof) suitable for insertion at a break in genomic DNA (e.g., by non-homologous end joining (NHEJ). In certain embodiments, the atDocket No. P15033WO00least one mutation is made with a cytosine and / or adenine base editor, or by a PRIME editing system.
[0068] In certain embodiments, the mutated DVL1 gene and plant cells, parts including seeds, and plants comprising the mutated DVL1 gene are generated by CRISPR technology. CRISPR technology for editing the genes of eukaryotes is disclosed in US Patent Application Publications 2016 / 0138008 Al and US2015 / 0344912A1, and in US Patents 8,697,359, 8,771,945, 8,945,839, 8,999,641, 8,993,233, 8,895,308, 8,865,406, 8,889,418, 8,871,445, 8,889,356, 8,932,814, 8,795,965, and 8,906,616. Cpfl endonuclease and corresponding guide RNAs and PAM sites are disclosed in US Patent Application Publication 2016 / 0208243 Al. Plant RNA promoters for expressing CRISPR guide RNA and plant codon-optimized CRISPR Cas9 endonuclease are disclosed in International Patent Application PCT / US2015 / 018104 (published as WO 2015 / 131101 and claiming priority to US Provisional Patent Application 61 / 945,700). Methods of using CRISPR technology for genome editing in plants are disclosed in US Patent Application Publications US 2015 / 0082478A1 and US 2015 / 0059010A1 and in International Patent Application PCT / US2015 / 038767 Al (published as WO 2016 / 007347 and claiming priority to US Provisional Patent Application 62 / 023,246). All of the patent publications referenced in this paragraph are incorporated herein by reference in their entirety. In certain embodiments, an RNA-guided endonuclease that leaves a blunt end following cleavage of the target site is used. Blunt-end cutting RNA-guided endonucleases include Cas9. In certain embodiments, an RNA-guided endonuclease that leaves a staggered single stranded DNA overhanging end following cleavage of the target site following cleavage of the target site is used. Staggered-end cutting RNA-guided endonucleases include Cast 2a, Cast 2b, Cast 2d, Casl2e, and Casl2i.
[0069] Guide RNA molecules comprising a spacer RNA molecule which targets the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof are provided. In certain embodiments, the spacer RNA molecule targets a portion of the protein and intron coding region ( / .< ., nucleotides 3187-3390 of SEQ ID NO: 1, nucleotides 3001-3204 in SEQ ID NO: 120, nucleotides 3236-3439 in SEQ ID NO: 122, or in an equivalent position of an allelic variant of SEQ ID NO: 1) of the DVL1 gene of SEQ ID NO: 1 or an allelic variant thereof. In certain embodiments, the spacer RNA molecule comprises the RNA encoded by any one of SEQ ID NO: 139-194 or 195. Type V guide RNAs comprising a spacer RNA molecule encoded by SEQ ID NO: 193, 194, or 195 can be used in conjunction with a type V (Casl2a or Casl2i nuclease), or Cas9 guide RNAs comprising a spacer RNA molecule encoded by SEQ ID NO: 139-191 or 192 can be used in conjunction with a Cas9 nuclease, to generate mutated DVL1 genes which: (i) comprise, consist essentially of, or consist of a deletion, insertion, and / or substitution of at least one nucleotide (e.g.,Docket No. P15033WO00at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1250, 1500, 1750, 2000, or 2216 nucleotides) of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof; (ii) comprise, consist essentially of, or consist of a deletion, insertion, and / or substitution of at least one nucleotide (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, 200, or 201 nucleotides) corresponding to nucleotides 3187-3387 oftheDVLl gene of SEQ ID NO: 1, 120, or 122 or in an equivalent position of an allelic variant of SEQ ID NO: 1; or (iii) comprise, consist essentially of, or consist of a deletion, insertion, and / or substitution of at least one nucleotide (e.g., at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides) corresponding to: nucleotides 3191-3382 or nucleotides 3191-3258 in aDVLl gene of SEQ ID NO: 1, 120, or 122 or in an equivalent position of an allelic variant of SEQ ID NO: 1, 120, or 122.
[0070] Various treatments can be used for delivery of gene editing molecules and / or other molecules to a plant cell. In certain embodiments, one or more treatments is employed to deliver the gene editing or other molecules e.g., comprising a polynucleotide, polypeptide, or combination thereof) into a eukaryotic or plant cell, e.g., through barriers such as a cell wall, a plasma membrane, a nuclear envelope, and / or other lipid bilayer. In certain embodiments, a polynucleotide-, polypeptide-, or RNP (ribonucleoprotein) -containing composition comprising the molecules are delivered directly, for example by direct contact of the composition with a plant cell. Aforementioned compositions can be provided in the form of a liquid, a solution, a suspension, an emulsion, a reverse emulsion, a colloid, a dispersion, a gel, liposomes, micelles, an injectable material, an aerosol, a solid, a powder, a particulate, a nanoparticle, or a combination thereof can be applied directly to a plant, plant part, plant cell, or plant explant (e.g., through abrasion or puncture or otherwise disruption of the cell wall or cell membrane, by spraying or dipping or soaking or otherwise directly contacting, by microinjection). For example, a plant cell or plant protoplast is soaked in a liquid genome editing molecule-containing composition, whereby the agent is delivered to the plant cell. In certain embodiments, the agent-containing composition is delivered using negative or positive pressure, for example, using vacuum infiltration or application of hydrodynamic or fluid pressure. In certain embodiments, the agentcontaining composition is introduced into a plant cell or plant protoplast, e.g., by microinjection or by disruption or deformation of the cell wall or cell membrane, for example by physical treatments such as by application of negative or positive pressure, shear forces, or treatment with a chemical or physical delivery agent such as surfactants, liposomes, or nanoparticles; see, e.g.,Docket No. P15033WO00delivery of materials to cells employing microfluidic flow through a cell-deforming constriction as described in US Published Patent Application 2014 / 0287509, incorporated by reference in its entirety herein. Other techniques useful for delivering the agent-containing composition to a eukaryotic cell, plant cell or plant protoplast include: ultrasound or sonication; vibration, friction, shear stress, vortexing, cavitation; centrifugation or application of mechanical force; mechanical cell wall or cell membrane deformation or breakage; enzymatic cell wall or cell membrane breakage or permeabilization; abrasion or mechanical scarification (e.g., abrasion with carborundum or other particulate abrasive or scarification with a file or sandpaper) or chemical scarification (e.g., treatment with an acid or caustic agent); and electroporation. In certain embodiments, the agent-containing composition is provided by bacterially mediated (e.g., Agrobacterium sp., Rhizobium sp., Sinorhizobium sp., Mesorhizobium sp., Bradyrhizobium sp., Azobacter sp., Phyllobacterium sp.) transfection of the plant cell or plant protoplast with a polynucleotide encoding the genome editing molecules (e.g., RNA dependent DNA endonuclease, RNA dependent DNA binding protein, RNA dependent nickase, ABE, or CBE, and / or guide RNA); see, e.g., Broothaerts et al. (2005) Nature, 433:629 - 633). Any of these techniques or a combination thereof are alternatively employed on the plant explant, plant part or tissue or intact plant (or seed) from which a plant cell is optionally subsequently obtained or isolated; in certain embodiments, the agent-containing composition is delivered in a separate step after the plant cell has been isolated.
[0071] Commodity plant products obtained from maize plants or maize plant parts comprising at least one modified DVL1 gene as well as methods for making such products are provided. In certain embodiments, the commodity products are processed products are made from the maize plant or its seeds, including: (a) maize seed meal (defatted or non-defatted); (b) extracted maize proteins, oils, sugars, syrups, and starches; (c) soy fermentation products; (d) maize based animal feed or human food products (e.g., feed and food comprising maize seed meal (defatted or nondefatted) and other ingredients (e.g., other cereal grains, other seed meal, other protein meal, other oil, other starch, other sugar, a binder, a preservative, a humectant, a vitamin, and / or mineral); (e) a pharmaceutical; (f) raw or processed biomass (e.g., cellulosic and / or lignocellulosic material; silage); and (g) various industrial products.
[0072] Also provided herein are methods for detecting a DNA fragment comprising a modified DVL1 gene comprising a detectable amount of a DNA molecule comprising a heterologous transcription enhancer, a heterologous intron, and / or heterologous translational enhancing element located in a DNA fragment of a modified DVL1 gene in any of the aforementioned biological samples and commodity products. Non-limiting and illustrative examples of such DNA fragmentsDocket No. P15033WO00include those wherein the SEQ ID NO: 10 enhancer is inserted. Detection of the DNA molecules comprising insertions and / or substitutions of the enhancer in the transcriptional regulatory region can be achieved by any combination of nucleic acid amplification (e.g., PCR amplification), hybridization, sequencing, and / or mass-spectrometry based techniques. Methods set forth for detecting foreign nucleic acids in transgenic loci set forth in US 20190136331 and US 9,738,904, both incorporated herein by reference in their entireties, can be adapted for use in detection of the nucleic acids provided herein. In certain embodiments, such detection is achieved by amplification and / or hybridization-based detection methods using a method (e.g., selective amplification primers) and / or probe (e.g., capable of selective hybridization or generation of a specific primer extension product) which specifically recognizes the target DNA molecule e.g., a heterologous transcription enhancer, a heterologous intron, and / or heterologous translational enhancing element located in a DNA fragment of a modified DVL1 gene) but does not recognize DNA from an unmodified DVL1 gene. In certain embodiments, the hybridization probes (e.g., polynucleotides comprising at least about 18 to 30 base pairs which span the junction of a , respectively) can comprise detectable labels (e.g., fluorescent, radioactive, epitope, and chemiluminescent labels). In certain embodiments, a single nucleotide polymorphism detection assay can be adapted for detection of the target DNA molecule (e.g., a heterologous transcription enhancer, a heterologous intron, and / or heterologous translational enhancing element located in a DNA fragment of a modified DVL1 gene).
[0073] Inbred and hybrid maize plants and seeds comprising a modified DVL1 gene are provided herein along with methods for making and using such hybrid and inbred seed. Methods for inbred seed production include selfing inbred maize plants and restricting cross-pollination by any maize plants other than the inbred maize plant. Methods for production of such hybrid seed can comprise crossing elite crop maize plant lines where at least one of the pollen donor or recipient comprises the modified DVL1 gene comprising an expression enhancing element (e.g. transcriptional enhancer) or an amorphic or hypomorphic allele of the DVL1 gene. In certain embodiments, methods of making hybrid seed can comprise crossing elite crop maize plant lines where the pollen recipient comprises the modified DVL1 gene comprising an expression enhancing element (e.g. transcriptional enhancer) or an amorphic or hypomorphic allele of the DVL1 gene and where the pollen recipient is homozygous for the modified DVL1 gene. In certain embodiments, methods of making hybrid seed can comprise crossing elite crop maize plant lines where both the pollen donor and recipient comprise the modified DVL1 gene comprising an expression enhancing element (e.g. transcriptional enhancer) or an amorphic or hypomorphic allele of the DVL1 gene and where both the pollen donor and pollen recipient are homozygous for the modified DVL1 gene. MethodsDocket No. P15033WO00for hybrid seed production have been disclosed (MacRobert, J.F., P.S. Setimela, J. Gethi, and M. Worku. 2014. Maize Hybrid Seed Production Manual. Mexico, D.F.: CIMMYT) and can be adapted to the production of hybrids disclosed herein. In certain embodiments, the inbred maize plant, the hybrid maize plant, the pollen donor and / or the pollen recipient can each comprise a transgenic locus which confers a trait (e.g., herbicide tolerance or insect resistance such as coleopteran or lepidopteran insects). Transgenes that can be introduced into the maize plant lines comprising a modified DVL1 gene by breeding or by direct transformation include: (i) transgenes that confer insect resistance (e.g., transgenes that produce Bacillus thuringiensis proteins including CrylAb, CrylAc, CrylF, Cry2Ab, Cry2Ae, Cry3A, Cry3Bb, Cry9c, Cry34, Cry35, VIP3A, and variants thereof; transgenes that induce insect-inhibitory RNAi responses); and (ii) transgenes that confer tolerance to distinct herbicides e.g., CP4-EPSPS or other EPSPS genes which confer glyphosate tolerance; PAT or BAR genes which confer resistance to glufosinate herbicides; aad-1 genes which confer resistance to 2,4-D and aryl oxy phenoxy propionate herbicides; DM0 genes which confer resistance to dicamba herbicide). Examples of selected transgenic maize plant events which contain transgenes that confer traits such as herbicide tolerance and / or pest tolerance are disclosed in U.S. Patent Nos. 6342660, 7956246, 8575434, 7314970, 8759618, 6852915, 10316330, 8618358, 8450561, 8686230, 9428765, 8455720, 7897748, 8273959, 8093453, 8502047, and 8466346, which are each incorporated herein by reference in their entireties.
[0074] In certain embodiments, maize plants provided herein which comprise a modified DVL1 gene can further comprise one or more targeted genetic changes introduced by one or more of gene editing molecules or systems. Such targeted genetic changes include those conferring traits such as improved yield, improved food and / or feed characteristics (e.g., improved oil, starch, protein, or amino acid quality or quantity), improved nitrogen use efficiency, improved biofuel use characteristics, herbicide tolerance (e.g., by targeting endogenous ALS, EPSPS, HPPD, or other herbicide target genes), delayed flowering, non-flowering, increased biotic stress resistance (e.g., resistance to insect, nematode, bacterial, or fungal damage), increased abiotic stress resistance (e.g., resistance to drought, cold, heat, metal, or salt), enhanced lodging resistance, enhanced growth rate, enhanced biomass, enhanced branching, delayed flowering time, delayed senescence, increased flower number, improved architecture for high density planting, improved photosynthesis, increased root mass, increased cell number, improved seedling vigor, improved seedling size, increased rate of cell division, improved metabolic efficiency, and increased meristem size in comparison to a control maize plant lacking the targeted genetic change. Types of targeted genetic changes that can be introduced include insertions, deletions, and substitutionsDocket No. P15033WO00of one or more nucleotides in the maize plant genome. Sites in endogenous maize plant genes for the targeted genetic changes include promoter, coding, and non-coding regions (e.g., 5’ UTRs, introns, splice donor and acceptor sites and 3’ UTRs). In certain embodiments, the targeted genetic change comprises an insertion of a regulatory or other DNA sequence in an endogenous maize plant gene. Non-limiting examples of regulatory sequences which can be inserted into endogenous maize plant genes with gene editing molecules to effect targeted genetic changes which confer useful phenotypes include those set forth in US Patent Application Publication 20190352655, which is incorporated herein by reference in its entirety, such as: (a) auxin response element (AuxRE) sequence; (b) at least one Dl-4 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971), (c) at least one DR5 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971); (d) at least one m5-DR5 sequence (Ulmasov et al. (1997) Plant Cell, 9:1963-1971); (e) at least one P3 sequence; (f) a small RNA recognition site sequence bound by a corresponding small RNA (e.g., an siRNA, a microRNA (miRNA), a trans-acting siRNA as described in U.S. Patent No.8,030,473, or a phased sRNA as described in U.S. Patent No. 8,404,928; both of these cited patents are incorporated by reference herein); (g) a microRNA (miRNA) recognition site sequence; (h) a microRNA (miRNA) recognition sequence for an engineered miRNA wherein the specific binding agent is the corresponding engineered mature miRNA; (i) a transposon recognition sequence; (j) a sequence recognized by an ethylene-responsive element binding-factor-associated amphiphilic repression (EAR) motif; (k) a splice site sequence (e.g., a donor site, a branching site, or an acceptor site; see, for example, the splice sites and splicing signals set forth in the internet site lemur[dot]amu[dot]edu[dot]pl / share / ERISdb / home.html); (1) a recombinase recognition site sequence that is recognized by a site-specific recombinase; (m) a sequence encoding an RNA or amino acid aptamer or an RNA riboswitch, the specific binding agent is the corresponding ligand, and the change in expression is upregulation or downregulation; (n) a hormone responsive element recognized by a nuclear receptor or a hormone-binding domain thereof; (o) a transcription factor binding sequence; and (p) a poly comb response element (see Xiao et al. (2017) Nature Genetics, 49:1546-1552, doi: 10.1038 / ng.3937). Non-limiting examples of target maize genes that can be subj ected to targeted gene edits to confer useful traits include quality and herbicide tolerance traits. In certain embodiments, such targeted genetic changes can be combined with plants which comprise the modified DVL1 gene by breeding techniques. Such breeding techniques include crossing and / or introgression by backcrossing to a recurrent parent. In such crosses, the plants which comprise the modified DVL1 gene can be either a pollen donor or recipient. In certain embodiments, plants which comprise the modified DVL1 gene can be used as the recurrent parent in such backcrosses to introgress the targeted genetic change into plant germplasm comprising theDocket No. P15033WO00modified DVL1 gene. In certain embodiments, plants which comprise the target genetic change(s) can be used as the recurrent parent in such backcrosses to introgress the genomic region comprising the modified DVL1 gene into plant germplasm comprising the target genetic change(s).
[0075] In certain embodiments, plants provided herein which comprise a modified DVL1 gene can further comprise one or more genetic loci conferring traits such as improved yield, improved food and / or feed characteristics (e.g., improved oil, starch, protein, or amino acid quality or quantity), improved nitrogen use efficiency, improved biofuel use characteristics (e.g., improved ethanol production), tolerance to herbicides (e.g., by targeting endogenous ALS, EPSPS, HPPD, or other herbicide target genes), delayed flowering, non-flowering, increased biotic stress resistance (e.g., resistance to insect, nematode, bacterial, or fungal damage), increased abiotic stress resistance (e.g., resistance to drought, cold, heat, metal, or salt), enhanced lodging resistance, enhanced growth rate, enhanced biomass, enhanced tillering, enhanced branching, delayed flowering time, delayed senescence, increased flower number, improved architecture for high density planting, improved photosynthesis, increased root mass, increased cell number, improved seedling vigor, improved seedling size, increased rate of cell division, improved metabolic efficiency, and increased meristem size in comparison to a control plant lacking the targeted genetic change. Sources of such genetic loci include elite cultivars, sexually compatible wild or other relatives (e.g., Zea sp.), plant germplasm which has been subjected to random mutagenesis (e.g., with a chemical mutagen such as EMS or with gamma-ray mutagenesis), and the like. In certain embodiments, such genetic loci can be combined with plants which comprise the modified DVL1 gene by breeding techniques. Such breeding techniques include crossing and / or introgression by backcrossing to a recurrent parent. In such crosses, the plants which comprise modified DVL1 gene can be either a pollen donor or recipient. In certain embodiments, plants which comprise the modified DVL1 gene can be used as the recurrent parent in such backcrosses to introgress the genetic locus into plant germplasm comprising the genetically altered transcriptional regulatory region. In certain embodiments, plants which comprise the genetic locus or loci can be used as the recurrent parent in such backcrosses to introgress the genomic region comprising modified DVL1 gene into plant germplasm comprising the genetic locus or loci.
[0076] Also provided herein are methods for producing a commodity plant product or plant material comprising growing any of the aforementioned plants comprising the modified DVL1 gene or growing plants from seeds comprising the modified DVL1 gene. In certain embodiments, such plants and / or seeds are irrigated, fertilized, and / or treated with a biological agent (e.g., a plant beneficial microorganism including a Bacillus sp., &Rhizobium sp., a Bradyrhizobium sp., and theDocket No. P15033WO00like), nematicide (e.g., a carbamate or organophosphate insecticide), insecticide e.g., a neonicotinoid, pyrethroid, carbamate, or organophosphate insecticide) and / or fungicide (e.g., a benzimidazole, imidazole, or strobilurin fungicide). Plants can be treated with such fertilizers, biological agents, nematicides, insecticides, and fungicides by methods including spraying, fumigating, and / or soil drenching. Seeds can be treated with such fertilizers, biological agents, nematicides, insecticides, and fungicides by methods including in-furrow applications or by coating e.g., with a drum coater, rotary coater, tumbling drum, fluidized bed, and / or spouted bed apparatus). Methods and compositions including various binders, fillers, film coats, and active ingredients such as fertilizers, surfactants, plant growth regulators, crop desiccants, fungicides, bacteriocides, bacteriostats, insecticides, and insect repellants for coating seeds that can be adapted for use with seeds provided herein are disclosed in US Patent No. 10745578, which is incorporated herein by reference in its entirety.Embodiments
[0077] Various embodiments of the DNA molecules, plants, plant parts, genomes, chromosomes, methods, biological samples, and other compositions described herein are set forth in the following set of numbered embodiments.
[0078] 1. A maize plant comprising: (i) a modified endogenous DVL1 gene wherein a heterologous expression enhancing element is located in the modified gene and wherein the unmodified endogenous DVL1 gene comprises the DNA molecule of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof; or (ii) a transgene comprising a heterologous expression enhancing element which is operably linked to a gene encoding a DVL1 protein of SEQ ID NO: 6 or an allelic variant thereof wherein expression of the DVL1 protein is increased in comparison to a control maize plant lacking the transgene.
[0079] 2. The maize plant of embodiment 1, wherein the modified endogenous DVL1 gene and / or the unmodified endogenous DVL1 gene encode the DVL1 protein of SEQ ID NO: 6 or an allelic variant thereof.
[0080] 3. The maize plant of embodiment 1 or 2, wherein the modified endogenous DVL1 gene is located in the native chromosomal location of the unmodified endogenous DVL1 gene.
[0081] 4. The maize plant of any one of embodiments 1-3, wherein the heterologous expression enhancing element comprises: (i) a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron; or (ii) a heterologous promoter, heterologous 5’ UTR, and / or heterologous intron.Docket No. P15033WO00
[0082] 5. The maize plant of embodiment 4, wherein the heterologous transcription enhancer is located in the promoter, the 5’ untranslated region (5’ UTR), an intron, a 3’ untranslated region (3’ UTR), or a 3’ flanking region of the modified endogenous DVL1 gene or of the transgene encoding the DVL1 protein.
[0083] 6. The maize plant of embodiment 4 or 5, wherein the heterologous transcription enhancer comprises a DNA molecule set forth in SEQ ID NO: 10, 11-117 and / or 118.
[0084] 7. The maize plant of any one of embodiments 4-6, wherein the transcription enhancer is located about 10, 20, 30, 40, 100, 150, or 200 base pairs (bp) to about 220, 240, 260, 280, 300, 350, 400, 450, 500, or 1000 bp 5’ of the transcription start site (TSS) of the endogenous DVL1 or TSS of the transgene encoding the DVL1 protein.
[0085] 8. The maize plant of any one of embodiments 4-7, wherein the transcription enhancer comprises SEQ ID NO: 10 and the insertion is located: (i) about 174 to about 134 base pairs or about 154 base pairs 5’ to the transcription start site (TSS) of the endogenous DVL1 gene or TSS of the transgene encoding the DVL1 protein; (ii) about 275 to about 235 base pairs or about 255 base pairs 5’ to the TSS of the DVL1 gene or TSS of the transgene encoding the DVL1 protein; or (iii) in a double stranded break introduced in the endogenous DVL1 gene promoter with a Casl2 nuclease and a Casl2 guide RNA comprising a spacer encoded by SEQ ID NO: 119 or 125; or wherein the modified endogenous DVL1 gene comprises the enhancer insertion set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 136, SEQ ID NO: 137, or an allelic variant thereof.
[0086] 9. The maize plant of any one of embodiments 4-8, wherein the heterologous intron is located in the 5’ UTR and / or within the coding region of the modified endogenous DVL1 gene or transgene encoding the DVL1 protein, optionally wherein the intron is located within about 500, 200, 100, 50, 30, or 20 base pairs of the translation start site (TrnslSS).
[0087] 10. The maize plant of embodiment 9, wherein the heterologous intron comprises a UBQ, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron.
[0088] 11. The maize plant of any one of embodiments 4-10, wherein the heterologous translational enhancer is located in the 5’ UTR and / or within the coding region of the modified endogenous DVL1 gene or of the transgene encoding the DVL1 protein.
[0089] 12. The maize plant of any one of embodiments 4-11, wherein the translational enhancer is encoded by a DNA molecule comprising the DNA sequence of a rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (Os Gst U50), glutathione peroxidase 1 (Os Gsp 1), 20S proteasome alphal subunit (Os20Sal), pathogenesis-related protein 4b (OsPrp4b),Docket No. P15033WO00glycine-rich cell-wall structural protein 1 (Os Grcwpl), or UspA domain containing protein (Os UspA) 5’UTR and wherein all or part of said OsAdh, Os GstU50, Os20Sal, OsPrp4b, Os Grcwpl, or Os UspA 5’UTR is substituted for all or part of the DVL1 5’ UTR in the modified endogenous DVL1 gene.
[0090] 13. The maize plant of any one of embodiments 1 to 12, wherein the heterologous promoter that is operably linked to the transgene encoding the DVL1 protein is a promoter that is expressed in maize stem tissue prior to or during internode elongation.
[0091] 14. The maize plant of any one of embodiments 1 to 13, wherein expression of the DVL1 protein is increased in at least one tissue of the maize plant in comparison to a control maize plant lacking the modified endogenous DVL1 gene or transgene encoding the DVL1 protein, optionally wherein expression of the DVL1 is increased in at least stalk tissue.
[0092] 15. The maize plant of any one of embodiments 1 to 14, wherein height and / or internode length of the maize plant is increased in comparison to a control maize plant lacking the modified endogenous DVL1 gene, optionally wherein the height and / or the internode length is increased by about 5% or 10% to about 15%, 20%, 30%, or 50% in comparison to a control maize plant lacking the modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
[0093] 16. The maize plant of any one of embodiments 1 to 15, wherein the maize plant is a hybrid maize plant which is heterozygous for the modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
[0094] 17. The maize plant of any one of embodiments 1 to 16, wherein the maize plant is a maize plant which is homozygous for the modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
[0095] 18. The maize plant of any one of embodiments 1 to 17, wherein expression of aDVLl gene product in a plant having the modified endogenous DVL1 gene or transgene encoding the DVL1 protein is increased by about 20% to 80% in at least one tissue in the maize plant in comparison to a control maize plant lacking the modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
[0096] 19. The maize plant of any one of embodiments 1 to 18, wherein expression of aDVLl gene product in a plant having the modified endogenous DVL1 gene or transgene encoding the DVL1 protein is increased by about 1.2-fold or 1.5-fold to about 2-fold, 3-fold, or 5-fold in at least one maize tissue in the maize plant in comparison to a control maize plant lacking the modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
[0097] 20. A maize plant part comprising the modified endogenous DVL1 gene or transgene encoding the DVL1 protein of any one of embodiments 1 to 19.Docket No. P15033WO00
[0098] 21. The maize plant part of embodiment 20, wherein the part is a seed, stalk, stem, or leaf.
[0099] 22. The maize plant part of embodiment 21 , wherein the seed further comprises at least a partial coating of a composition comprising a biological agent, nematicide, insecticide, or fungicide.
[0100] 23. The maize plant part of embodiment 21 or 22, wherein the maize plant seed is a hybrid maize plant seed which is heterozygous for the modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
[0101] 24. The maize plant part of any one of embodiments 21-23, wherein the maize plant seed is a maize plant seed which is homozygous for the modified endogenous DVL1 gene.
[0102] 25. A method of producing maize seed, comprising growing the maize plant of any one of embodiments 1 to 19 and harvesting seed therefrom.
[0103] 26. A method of producing hybrid maize seed comprising crossing a maize plant homozygous for the modified endogenous DVL1 gene set forth in any one of embodiments 1 to 19 to another maize plant homozygous for the modified endogenous DVL1 gene and harvesting seed from a pollen recipient of the cross.
[0104] 27. A method of producing a maize plant comprising an added desired trait, said method comprising introducing a transgene, a targeted genetic change, and / or a genetic locus conferring the desired trait into the maize plant of any one of embodiments 1 to 19.
[0105] 28. A method of producing a commodity maize plant product, said method comprising: (i) processing a maize plant of any one of embodiments 1 to 19 or a maize seed obtained therefrom; and (ii) recovering the commodity maize plant product from the processed maize plant or maize seed.
[0106] 29. The method of embodiment 28, wherein the commodity maize plant product is seed meal, starch, syrup, silage, oil, or protein.
[0107] 30. The method of embodiment 28 or 29, wherein the commodity maize plant product comprises a detectable amount of a DNA molecule comprising the heterologous transcription enhancer, the heterologous translational enhancing element, and / or the heterologous intron located in a DNA fragment of the modified endogenous DVL1 gene.
[0108] 31. A biological sample comprising a detectable amount of a DNA molecule comprising a heterologous transcription enhancer, a heterologous intron, and / or heterologous translational enhancing element located in a DNA fragment of a modified endogenous DVL1 gene or transgene encoding the DVL1 protein.Docket No. P15033WO00
[0109] 32. The biological sample of embodiment 31, wherein the biological sample comprises material obtained from the maize plant of any one of claims 1 to 12 or a part thereof, wherein the part is optionally a seed.
[0110] 33. The biological sample of embodiment 31 or 32, wherein the biological sample is non-regenerable.[oni] 34. The biological sample of any one of embodiments 31-33, wherein the biological sample comprises maize seed meal.
[0112] 35. A method of making a maize plant of any one of embodiments 1 to 19, comprising: (a) contacting a maize plant genome with gene editing molecules comprising a first site-specific nuclease which introduces a double stranded DNA break in a promoter region, a 5’ UTR, a coding region, a 3’ UTR, or a 3’ flanking region in an unmodified endogenous DVL1 gene comprising the DNA molecule of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof; and a donor DNA template or other DNA template comprising a heterologous expression enhancing element; and (b) selecting a maize plant comprising a modified endogenous DVL1 gene, wherein the modified endogenous DVL1 gene comprises an insertion of the heterologous expression enhancing element in the promoter region, the 5’ UTR, the coding region, the 3’ UTR, or the 3’ flanking region of the gene, wherein expression of the modified endogenous DVL1 gene is increased in at least one tissue, and wherein height and / or internode length of the maize plant comprising the modified endogenous DVL1 gene is increased in comparison to a control maize plant lacking the modified endogenous DVL1 gene.
[0113] 36. The method of embodiment 35, wherein the heterologous expression enhancing element comprises a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron.
[0114] 37. The method of embodiment 35 or 36, wherein the double stranded break is introduced in the promoter, the 5’ untranslated region (5’ UTR), an intron, a 3’ untranslated region (3’ UTR), or a 3’ flanking region of the unmodified DVL1 gene and the donor DNA template or other DNA template comprises the heterologous transcription enhancer.
[0115] 38. The method of embodiment 36 or 37, wherein the transcription enhancer comprises a DNA molecule set forth in SEQ ID NO: 10, 11-117 and / or 118.
[0116] 39. The method of any one of embodiments 35-38, wherein the double stranded break is introduced about 10, 20, 30, 40, 100, 150, or 200 base pairs (bp) to about 220, 240, 260, 280, 300, 350, 400, 450, 500, or 1000 bp 5’ of the translation start site (TSS) of the DVL1 gene.
[0117] 40. The method of any one of embodiments 36-39, wherein the transcription enhancer comprises SEQ ID NO: 10 or 11 and the double stranded break is introduced: (i) about 174 toDocket No. P15033WO00about 134 base pairs or about 154 base pairs 5’ to the TSS of the DVL1 gene; (ii) about 275 to about 235 base pairs or about 255 base pairs 5’ to the TSS of the DVL1 gene; or (iii) in a double stranded break introduced in the DVL1 promoter with a Cast 2 nuclease and a Cast 2 guide RNA comprising a spacer encoded by SEQ ID NO: 123 or 127.
[0118] 41. The method of any one of embodiments 35-40, wherein the donor DNA template or other DNA template comprises a heterologous translational enhancer and the double stranded break is introduced in the 5’ UTR and / or within the coding region of the unmodified endogenous DVL1 gene.
[0119] 42. The method of embodiment 41, wherein the translational enhancer is encoded by a DNA molecule comprising the DNA sequence of a rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (OsGst U50), glutathione peroxidase 1 (OsGsp 1), 20S proteasome alphal subunit (Os20Sal), pathogenesis-related protein 4b (OsPrp4b), glycine-rich cell-wall structural protein 1 (OsGrcwpl), or UspA domain containing protein (OsUspA) 5’UTR and wherein all or part of said OsAdh, OsGstU50, Os20Sal, OsPrp4b, OsGrcwpl, or OsUspA 5’UTR is substituted for all or part of the DVL1 5’ UTR in the modified endogenous DVL1 gene.
[0120] 43. The method of any one of embodiments 35-42, wherein the DNA donor template or other DNA template comprises a heterologous intron and the double stranded break is introduced in the 5’ UTR and / or within the coding region of the modified endogenous DVL1 gene, optionally wherein the double stranded break is introduced within about 500, 200, 100, 50, 30, or 20 base pairs of the TrnslSS.
[0121] 44. The method of embodiment 43, wherein the heterologous intron comprises a UBQ10, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ10, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron.
[0122] 45. A method of making a maize plant of any one of embodiments 1 to 19, comprising: (a) contacting a maize plant genome with a transgene comprising a heterologous promoter, heterologous 5’ UTR, and / or heterologous intron which is operably linked to a coding region encoding the DVL1 protein of SEQ ID NO: 6 or an allelic variant thereof; and (b) selecting a transgenic maize plant comprising the transgene, wherein expression of the DVL1 gene is increased in at least one tissue and wherein height and / or internode length of the maize plant is increased in comparison to a control maize plant lacking the transgene.
[0123] 46. The method of embodiment 45, wherein the promoter is a ubiquitin promoter, an actin promoter, or a plant viral promoter, optionally wherein the plant viral promoter comprises a caulimovirus promoter.Docket No. P15033WO00
[0124] 47. The method of embodiment 45 or 46, wherein the heterologous intron comprises a UBQ, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron.
[0125] 48. A maize plant chromosome comprising: (i) a modified endogenous DVL1 gene wherein a heterologous expression enhancing element is located in the modified gene and wherein the unmodified endogenous DVL1 gene comprises the DNA molecule of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the heterologous expression enhancing element is a transcription enhancer comprising SEQ ID NO: 10 and the insertion is located: (i) about 174 to about 134 base pairs or about 154 base pairs 5’ to the transcription start site (TSS) of the endogenous DVL1 gene or TSS of the transgene encoding the DVL1 protein; (ii) about 275 to about 235 base pairs or about 255 base pairs 5’ to the TSS of the DVL1 gene or TSS of the transgene encoding the DVL1 protein; or (iii) in a double stranded break introduced in the endogenous DVL1 gene promoter with a Casl2 nuclease and a Casl2 guide RNA comprising a spacer encoded by SEQ ID NO: 123 or 127; or optionally wherein the modified endogenous DVL1 gene comprises the enhancer insertion set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 136, SEQ ID NO: 137, or an allelic variant thereof; or (ii) a transgene comprising a heterologous expression enhancing element which is operably linked to a gene encoding a DVL1 protein of SEQ ID NO: 6 or an allelic variant thereof wherein expression of the DVL1 protein is increased in comparison to a control maize plant lacking the transgene.
[0126] 49. A maize plant cell comprising the maize plant chromosome of embodiment 48.
[0127] 50. A maize plant cell comprising at least one mutation in the DVL1 gene of SEQ ID NO: 1, 120, or 122, wherein the at least one mutation comprises an amorphic or hypomorphic allele of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
[0128] 51. The maize plant of embodiment 50, wherein the amorphic or hypomorphic allele reduces expression of the DVL1 gene relative to a wild-type or control maize plant cell lacking the at least one mutation.
[0129] 52. The maize plant cell of embodiment 50 or 51, wherein the plant cell is homozygous for the at least one mutation in the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
[0130] 53. The maize plant cell of any one of embodiments 50-52, wherein the at least one mutation is a non-natural mutation.
[0131] 54. The maize plant cell of any one of embodiments 50-53, wherein the at least one mutation comprises an amorphic allele of the DVL1 gene of SEQ ID NO: 1. 120, or 122, or an allelic variant thereof.Docket No. P15033WO00
[0132] 55. The maize plant cell of any one of embodiments 50-54, wherein the at least one mutation comprises a hypomorphic allele of the DVL1 gene.
[0133] 56. The maize plant cell of any one of embodiments 50-55, wherein the at least one mutation comprises a frameshift mutation or a nonsense mutation in the coding region of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
[0134] 57. The maize plant cell of any one of embodiments 50-56, wherein the at least one mutation comprises an internal deletion in the coding region of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the internal deletion preserves the reading frame of the encoded mutant DVL1 protein comprising the at least one mutation with respect to amino acid residues of the mutant DVL1 protein which have not been deleted.
[0135] 58. The maize plant cell of any one of embodiments 50-57, wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least one nucleotide of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1250, 1500, 1750, 2000, or 3000 nucleotides of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
[0136] 59. The maize plant cell of any one of embodiments 50-58, wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least one nucleotide corresponding to nucleotides 3187-3234 or 3187-3387 of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, or 903 nucleotides corresponding to nucleotides 3187-3234 or 3187-3387 of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
[0137] 60. The maize plant cell of any one of embodiments 50-59, wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least one nucleotide corresponding to nucleotides 3187-3234 or 3187-3387 of the maize gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides corresponding to nucleotides 3187-3234 or 3187-3387 of the maize gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.Docket No. P15033WO00
[0138] 61. The maize plant cell of any one of embodiments 50-61, with the proviso that the maize plant cell is not exclusively produced by an essentially biological method, optionally wherein the maize plant cell is produced by introducing one or more gene editing molecules into a maize plant cell and selecting the maize plant cell comprising at least one non-natural mutation.
[0139] 62. The maize plant cell of any one of embodiments 50-61, wherein the maize plant cell comprises elite maize germplasm, optionally wherein the elite maize germplasm comprises germplasm of a maize cultivar or variety.
[0140] 63. The maize plant cell of any one of embodiments 50-62, wherein the maize plant cell further comprises at least one mutation in a distinct maize gene.
[0141] 64. The maize plant cell of any one of embodiments 50-63, wherein the maize plant cell further comprises one or more transgenes, optionally wherein the transgenes encode proteins or RNAs conferring herbicide tolerance or pest tolerance.
[0142] 65. A maize plant or maize plant part comprising the maize plant cell of any one of embodiments 50-64.
[0143] 66. The maize plant part of embodiment 65, wherein the part is a seed, stalk, stem, or leaf.
[0144] 67. The maize plant of embodiment 65, wherein the height and / or internode length of the maize plant is decreased as compared to a maize plant lacking the at least one mutation.
[0145] 68. A plant or plant part of an elite maize plant, cultivar, or variety with decreased height and / or internode length comprising at least one mutation comprising an amorphic or hypom orphic allele in the endogenous DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, wherein the decreased height and / or internode length is in comparison to a wildtype or control maize plant lacking the at least one mutation.
[0146] 69. The plant or plant part of embodiment 68, wherein the elite maize plant, cultivar, or variety is homozygous for the at least one mutation in the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
[0147] 70. The plant or plant part of embodiment 68 or 69, wherein the at least one mutation comprises a loss-of-function allele of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, wherein the loss-of-function allele reduces expression of the DVL1 gene relative to a wild-type or control plant or plant part lacking the at least one mutation.
[0148] 71. The plant or plant part of any one of embodiments 68-70, wherein the at least one mutation is a non-natural mutation.
[0149] 72. A biological sample comprising a nucleic acid containing at least one mutation in the maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, wherein the atDocket No. P15033WO00least one mutation comprises an amorphic or hypomorphic allele of the DVL1 gene of SEQ ID NO: 1, 120, or 122.
[0150] 73. The biological sample of embodiment 72, wherein the at least one mutation is a non-natural mutation.
[0151] 74. The biological sample of embodiment 72 or 73, wherein the at least one mutation comprises a frameshift mutation or a nonsense mutation in the coding region of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
[0152] 75. The biological sample of any one of embodiments 72-74, wherein the at least one mutation comprises an internal deletion in the coding region of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the internal deletion preserves the reading frame of the encoded mutant DVL1 protein comprising the at least one mutation with respect to amino acid residues of the mutant DVL1 protein which have not been deleted.
[0153] 76. The biological sample of any one of embodiments 72-75, wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least one nucleotide corresponding to nucleotides 3187-3234 or 3187-3387 of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, or 903 nucleotides corresponding to nucleotides 3187-3234 or 3187-3387 of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof
[0154] 77. The biological sample of any one of embodiments 72-76, wherein the sample lacks a nucleic acid comprising the wild-type allele of the maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
[0155] 78. A polynucleotide comprising at least one mutation relative to the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the polynucleotide is isolated.
[0156] 79. The polynucleotide of embodiment 78, wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least one nucleotide corresponding to nucleotides 3187-3234 or 3187-3387 of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, or 903 nucleotides corresponding toDocket No. P15033WO00nucleotides 3187-3234 or 3187-3387 of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof
[0157] 80. A guide RNA molecule comprising a spacer RNA molecule which targets the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the spacer RNA molecule comprises the RNA encoded by SEQ ID NO: 139-194 or 195.
[0158] 81. The guide RNA molecule of embodiment 80, wherein the spacer RNA molecule comprises the RNA encoded by SEQ ID NO: 139, 141, 142, 145, 147, 149, 150, 193, 194, or 195.
[0159] 82. A guide RNA molecule comprising a Casl2 direct repeat element which is operably linked to the spacer RNA of embodiment 80 or 81.
[0160] 83. An expression cassette comprising: a polynucleotide encoding CRISPR-Cas effector protein comprising a cleavage domain and the guide RNA molecule of any one of embodiments 80-82.
[0161] 84. A method for generating a maize plant cell of any one of embodiments 50-64, maize plant part of any one of embodiments 65-67, or maize plant of any one of embodiments 68-71 comprising introducing at least one mutation in the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof of a maize plant cell.
[0162] 85. The method of embodiment 84, further comprising regenerating a maize plant comprising the at least one mutation in the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof from the maize plant cell, and optionally selecting a maize plant with decreased height and / or internode length as compared to a maize plant lacking the at least one mutation.
[0163] 86. The method of embodiment 84 or 85, wherein the at least one mutation is introduced by: (i) directing both: (a) a guide RNA (gRNA) molecule comprising a spacer RNA molecule which targets the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, or a spacer RNA molecule comprising the RNA encoded by SEQ ID NO: 139-194 or 195; and (b) an RNA dependent endonuclease (RDE) which recognizes the gRNA molecule to the genome of a target maize plant cell; and (ii) isolating a maize plant cell, maize plant part, or maize plant comprising the at least one mutation in the maize gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
[0164] 87. The method of embodiment 86, wherein the directing of the gRNA and the RDE to the genome of the target maize plant cell comprises introducing the gRNA, the RDE, a gRNA / RDE complex, a nucleic acid encoding the gRNA, and / or a nucleic acid encoding the RDE into the target maize plant cell.Docket No. P15033WO00
[0165] 88. The method of any one of embodiments 84-87, wherein the at least one mutation is introduced by crossing a maize plant comprising the at least one mutation with a second maize plant and harvesting Fl seed comprising the at least one mutation, thereby producing progeny maize seed comprising the at least one mutation.
[0166] 89. A method for decreasing height and / or internode length in a maize plant, comprising: introducing at least one mutation comprising an amorphic or hypomorphic allele in the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof of a maize plant cell.
[0167] 90. The method of embodiment 89, further comprising regenerating a maize plant comprising the at least one mutation in the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof from the maize plant cell, and optionally selecting a maize plant with decreased height and / or internode length.
[0168] 91. The method of embodiment 89 or 90, wherein the height and / or internode length is decreased in comparison to height and / or internode length of a wild-type or control maize crop lacking the at least one mutation.
[0169] 92. A maize plant or plant cell produced by the method of any one of embodiments 89-91.EXAMPLESExample 1. Insertion of a transcription enhancer in the DVL1 (SEQ ID NO: 1) promoter
[0170] Maize gene DVL1 (SEQ ID NO: 1 and 120) was targeted for insertion of a transcription enhancer (SEQ ID NO: 10) to increase expression of the genes. Summaries of the guide RNAs designed for the gene are provided in Table 3.Table 2. Summary of Biological SequencesDocket No. P15033WO00Table 3. Maize Lines Bl 04 & LH224 DVL1 guide RNA design
[0171] Immature embryos of a transgenic Bl 04 “editor” maize line constitutively overexpressing a CasS nuclease polypeptide were harvested 13 days after pollination and transformed by biolistics with: a plasmid containing herbicide and visual selection markers (p35S::pat::tNOS and pZmUbi::mScarlet::tZmUbi), a single guide RNA for the CasS nuclease comprising one of the indicated spacers (CR2395), and DNA of the 3x enhancer ( / 5Phos / G*T*AAGCGCTTACGTAAGCGCTTACGTAAGCGCTT*A*C; SEQ ID NO: 10; * is a phosphorothioate bond) for NHEJ insertion. The guide RNA and DNA were from Integrated DNA Technologies (Coralville, IA, USA). Callus was induced, the transformed cells selected, and transformed TO generation plants regenerated by conventional methods. Hybrid plants were regenerated in TO and selected for further characterization.Example 2. Analysis of plants comprising an insertion of a transcription enhancer in the DVL1 promoter
[0172] TO plants such as those described in Example 1 were backcrossed to a B104 wild type. The resulting T1 plants were analyzed for the presence / absence of the enhancer at the target site and T1 plants were grown in a greenhouse and subjected to phenotypic analysis, using siblings lacking the enhancer insertion as controls and focusing on plant height, internode length, ear height, and general plant development.Docket No. P15033WO00
[0173] To assess the effect of the inserted enhancer sequence on the expression level of DVL1, bulk RNA was extracted from harvested protoplasts, and converted to cDNA. Using qRT-PCR, the expression level of DVL1 will be measured relative to that of GADPH, a well-known reference gene. In maize plant lines heterozygous for a DVL1 enhancer insertion the expression levels of WKRY98 are expected to be 2-5-fold higher compared to control (null) plant lines.
[0174] Plant height was measured from the crown roots to the ligule of the flag leaf. Table 4 shows measurements for 29, 43, 57, and 71 days after sowing. Preliminary data show increased plant height in lines homozygous for a DVL1 enhancer insertion compared to lines heterozygous for a DVL1 enhancer insertion (SEQ ID NO: 10) and control lines.Docket No. P15033WO00Table 4. Plant Height and Ear HeightExample 3. Further Analysis of plants comprising an insertion of a transcription enhancer in DVL1 promoters
[0175] Plants such as those described in Example 2 are backcrossed to a B 104 wild type. The resulting T2 or other progeny plants are analyzed for the presence / absence of the enhancer at the target site and T2 plants are grown in the field and subjected to phenotypic analysis, using siblings lacking the enhancer insertion as controls and focusing on plant height, internode length, ear height, and general plant development. For example, it is predicted that plants with a DVL1 enhancer insertion disclosed herein will result in an increase of: (i) internode length (ii) in-season or final plant height; and / or (iii) in-season or final ear height.Example 4. Insertion of a transcription enhancer in the DVL1 (SEQ ID NO: 122) promoter in additional maize lines
[0176] Maize line PHR03 are also targeted for insertion of a transcription enhancer (SEQ ID NO: 10) into the promoter of gene DVL1 (SEQ ID NO: 122) to increase expression of the gene and decrease maize plant height. Summaries of the guide RNAs designed for the gene are provided in Table 5.Docket No. P15033WO00Table 5. Maize Line PHR03 DVL1 guide RNA designxCas nuclease which provides a staggered cut.
[0177] TO hybrid plants are created as described in Example 1 using a single guide RNA for the Cas nuclease comprising one of the indicated spacers (CR2543) and backcrossed to a PHR03 wild type. The resulting T1 plants are analyzed as described in Example 2. In maize plant lines heterozygous for a DVL1 enhancer insertion the expression level of DVL1 is expected to be 2-5-fold higher compared to control (null) plant lines. Maize plant lines homozygous for a DVL1 enhancer insertion are expected to show increased plant height compared to lines heterozygous for a DVL1 enhancer insertion and control lines.
[0178] T1 hybrid plants are backcrossed to a PHR03 wild type. The resulting T2 plants are analyzed as described in Example 3. It is predicted that plants with a DVL1 enhancer insertion disclosed herein will result in an increase of: (i) internode length (ii) in-season or final plant height; (iii) in-season or final ear height.Example 5. Generation of maize with an amorphic allele of a DVL1 gene
[0179] A vector was created to transform maize plants and disrupt the open reading frame of the DVL1 gene (SEQ ID NO: 1 and 120) through CRISPR-mediated gene editing. At least one CRISPR guide RNA comprising a crRNA fused to a spacer RNA (encoded by SEQ ID NO: 139-194 or 195) was designed to target the of the maize DVL1 gene (Figure 3) to decrease expression of the genes. Summaries of the guide RNAs designed for the gene are provided in Table 6.Docket No. P15033WO00Table 6. Maize Line PHR03 DVL1 RNA designDocket No. P15033WO00*K0 guides introduce a break in the first 33% of CDS; CDS guides introduce a break in the last 66% of CDS
[0180] Immature embryos of a transgenic Bl 04 “editor” maize line constitutively overexpressing a Cas9 or Casl2i nuclease polypeptide were harvested 13 days after pollination and transformed by biolistics with: a plasmid containing herbicide and visual selection markers (p35S::pat::tNOS and pZmUbi: :mScarlet: :tZmUbi), a single guide RNA for the Cas9 or Casl2i nuclease comprising one or more of the indicated spacers (SEQ ID NO: 139-194 or 195) targeting the open reading frame. The guide RNA and DNA were from Integrated DNA Technologies (Coralville, IA, USA). Callus was induced, the transformed cells selected, and transformed TO generation plants regenerated by conventional methods. Hybrid plants were regenerated in TO and selected for further characterization.Example 6. Performance of maize with an amorphic allele of a DVL1 gene
[0181] Plants such as those described in Example 5 are backcrossed to a B 104 wild type. The resulting T1 plants are analyzed as described in Example 2. In maize plant lines heterozygous for a DVL1 open reading frame deletion the expression level of DVL1 is expected to be lower compared to control (null) plant lines. Maize plant lines homozygous for a DVL1 open readingDocket No. P15033WO00frame deletion are expected to show decreased plant height compared to lines heterozygous for a DVL1 open reading frame deletion and control lines.
[0182] T1 hybrid plants are backcrossed to a B 104 wild type. The resulting T2 plants are analyzed as described in Example 3. It is predicted that plants with a DVL1 open reading frame deletion disclosed herein will result in a reduction of: (i) internode length (ii) in-season or final plant height; (iii) in-season or final ear height.
[0183] The breadth and scope of the present disclosure should not be limited by any of the abovedescribed exemplary embodiments but should be defined only in accordance with the following claims and their equivalents.
Claims
Docket No. P15033WO00CLAIMSWhat is claimed is:
1. A maize plant comprising:(i) a modified endogenous DVL1 gene wherein a heterologous expression enhancing element is located in the modified gene and wherein the unmodified endogenous DVL1 gene comprises the DNA molecule of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof; or (ii) a transgene comprising a heterologous expression enhancing element which is operably linked to a gene encoding a DVL1 protein of SEQ ID NO: 6 or an allelic variant thereof wherein expression of the DVL1 protein is increased in comparison to a control maize plant lacking the transgene.2 The maize plant of claim 1, wherein the modified endogenous DVL1 gene and / or the unmodified endogenous DVL1 gene encode the DVL1 protein of SEQ ID NO: 6 or an allelic variant thereof.3 The maize plant of claim 1, wherein the modified endogenous DVL1 gene is located in the native chromosomal location of the unmodified endogenous DVL1 gene.4 The maize plant of claim 1, wherein the heterologous expression enhancing element comprises: (i) a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron; or (ii) a heterologous promoter, heterologous 5’ UTR, and / or heterologous intron.5 The maize plant of claim 4, wherein the heterologous transcription enhancer is located in the promoter, the 5’ untranslated region (5’ UTR), an intron, a 3’ untranslated region (3’ UTR), or a 3’ flanking region of the modified endogenous DVL1 gene or of the transgene encoding the DVL1 protein.6 The maize plant of claim 4, wherein the heterologous transcription enhancer comprises a DNAmolecule set forth in SEQ ID NO: 10, 11-117 and / or 118.7 The maize plant of claim 4, wherein the transcription enhancer is located about 10, 20, 30 40, 100, 150, or 200 base pairs (bp) to about 220, 240, 260, 280, 300, 350, 400, 450, 500, orDocket No. P15033WO001000 bp 5’ of the transcription start site (TSS) of the endogenous DVL1 or TSS of the transgene encoding the DVL1 protein.
8. The maize plant of claim 4, wherein the transcription enhancer comprises SEQ ID NO: 10 and the insertion is located:(i) about 174 to about 134 base pairs or about 154 base pairs 5’ to the transcription start site (TSS) of the endogenous DVL1 gene or TSS of the transgene encoding the DVL1 protein;(ii) about 275 to about 235 base pairs or about 255 base pairs 5’ to the TSS of the DVL1 gene or TSS of the transgene encoding the DVL1 protein; or(iii) in a double stranded break introduced in the endogenous DVL1 gene promoter with a Casl2 nuclease and a Casl2 guide RNA comprising a spacer encoded by SEQ ID NO: 119 or 125; orwherein the modified endogenous DVL1 gene comprises the enhancer insertion set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 136, SEQ ID NO: 137, or an allelic variant thereof.9 The maize plant of claim 4, wherein the heterologous intron is located in the 5’ UTR and / or within the coding region of the modified endogenous DVL1 gene or transgene encoding the DVL1 protein, optionally wherein the intron is located within about 500, 200, 100, 50, 30, or 20 base pairs of the translation start site (TmslSS).10 The maize plant of claim 9, wherein the heterologous intron comprises a UBQ, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ, EF-la, EF-ip Histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron.11 The maize plant of claim 4, wherein the heterologous translational enhancer is located in the 5’ UTR and / or within the coding region of the modified endogenous DVL1 gene or of the transgene encoding the DVL1 protein.12 The maize plant of claim 4, wherein the translational enhancer is encoded by a DNA molecule comprising the DNA sequence of a rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (Os Gst U50), glutathione peroxidase 1 (Os Gsp 1), 20S proteasome alphal subunit (Os20Sal), pathogenesis-related protein 4b (OsPrp4b), glycine-rich cell-wall structuralDocket No. P15033WO00protein 1 (Os Grcwpl), or UspA domain containing protein (Os UspA) 5’UTR and wherein all or part of said OsAdh, Os GstU50, Os20Sal, OsPrp4b, Os Grcwpl, or Os UspA 5’UTR is substituted for all or part of the DVL1 5’ UTR in the modified endogenous DVL1 gene.
13. The maize plant of any one of claims 1 to 12, wherein the heterologous promoter that is operably linked to the transgene encoding the DVL1 protein is a promoter that is expressed in maize stem tissue prior to or during internode elongation.
14. The maize plant of any one of claims 1 to 12, wherein expression of the DVL1 protein is increased in at least one tissue of the maize plant in comparison to a control maize plant lacking the modified endogenous DVL1 gene or transgene encoding the DVL1 protein, optionally wherein expression of the DVL1 is increased in at least stalk tissue.
15. The maize plant of any one of claims 1 to 12, wherein height and / or internode length of the maize plant is increased in comparison to a control maize plant lacking the modified endogenous DVL1 gene, optionally wherein the height and / or the internode length is increased by about 5% or 10% to about 15%, 20%, 30%, or 50% in comparison to a control maize plant lacking the modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
16. The maize plant of any one of claims 1 to 12, wherein the maize plant is a hybrid maize plant which is heterozygous for the modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
17. The maize plant of any one of claims 1 to 12, wherein the maize plant is a maize plant which is homozygous for the modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
18. The maize plant of any one of claims 1 to 12, wherein expression of a DVL1 gene product in a plant having the modified endogenous DVL1 gene or transgene encoding the DVL1 protein is increased by about 20% to 80% in at least one tissue in the maize plant in comparison to a control maize plant lacking the modified endogenous DVL1 gene or transgene encoding the DVL1 protein.Docket No. P15033WO0019. The maize plant of any one of claims 1 to 12, wherein expression of a DVL1 gene product in a plant having the modified endogenous DVL1 gene or transgene encoding the DVL1 protein is increased by about 1.2-fold or 1.5-fold to about 2-fold, 3-fold, or 5-fold in at least one maize tissue in the maize plant in comparison to a control maize plant lacking the modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
20. A maize plant part comprising the modified endogenous DVL1 gene or transgene encoding the DVL1 protein of any one of claims 1 to 12.
21. The maize plant part of claim 20, wherein the part is a seed, stalk, stem, or leaf.
22. The maize plant part of claim 21, wherein the seed further comprises at least a partial coating of a composition comprising a biological agent, nematicide, insecticide, or fungicide.
23. The maize plant part of claim 21, wherein the maize plant seed is a hybrid maize plant seed which is heterozygous for the modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
24. The maize plant part of claim 21, wherein the maize plant seed is a maize plant seed which is homozygous for the modified endogenous DVL1 gene.
25. A method of producing maize seed, comprising growing the maize plant of any one of claims 1 to 12 and harvesting seed therefrom.
26. A method of producing hybrid maize seed comprising crossing a maize plant homozygous for the modified endogenous DVL1 gene set forth in any one of claims 1 to 12 to another maize plant homozygous for the modified endogenous DVL1 gene and harvesting seed from a pollen recipient of the cross.
27. A method of producing a maize plant comprising an added desired trait, said method comprising introducing a transgene, a targeted genetic change, and / or a genetic locus conferring the desired trait into the maize plant of any one of claims 1 to 12.Docket No. P15033WO0028. A method of producing a commodity maize plant product, said method comprising: (i) processing a maize plant of any one of claims 1 to 12 or a maize seed obtained therefrom; and (ii) recovering the commodity maize plant product from the processed maize plant or maize seed.
29. The method of claim 28, wherein the commodity maize plant product is seed meal, starch, syrup, silage, oil, or protein.
30. The method of claim 28, wherein the commodity maize plant product comprises a detectable amount of a DNA molecule comprising the heterologous transcription enhancer, the heterologous translational enhancing element, and / or the heterologous intron located in a DNA fragment of the modified endogenous DVL1 gene.
31. A biological sample comprising a detectable amount of a DNA molecule comprising a heterologous transcription enhancer, a heterologous intron, and / or heterologous translational enhancing element located in a DNA fragment of a modified endogenous DVL1 gene or transgene encoding the DVL1 protein.
32. The biological sample of claim 31, wherein the biological sample comprises material obtained from the maize plant of any one of claims 1 to 12 or a part thereof, wherein the part is optionally a seed.
33. The biological sample of claim 31, wherein the biological sample is non-regenerable.
34. The biological sample of claim 33, wherein the biological sample comprises maize seed meal.
35. A method of making a maize plant of any one of claims 1 to 12, comprising:(a) contacting a maize plant genome with gene editing molecules comprising a first site-specific nuclease which introduces a double stranded DNA break in a promoter region, a 5’ UTR, a coding region, a 3’ UTR, or a 3’ flanking region in an unmodified endogenous DVL1 gene comprising the DNA molecule of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof; and a donor DNA template or other DNA template comprising a heterologous expression enhancing element; andDocket No. P15033WO00(b) selecting a maize plant comprising a modified endogenous DVL1 gene, wherein the modified endogenous DVL1 gene comprises an insertion of the heterologous expression enhancing element in the promoter region, the 5’ UTR, the coding region, the 3’ UTR, or the 3’ flanking region of the gene, wherein expression of the modified endogenous DVL1 gene is increased in at least one tissue, and wherein height and / or internode length of the maize plant comprising the modified endogenous DVL1 gene is increased in comparison to a control maize plant lacking the modified endogenous DVL1 gene.
36. The method of claim 35, wherein the heterologous expression enhancing element comprises a heterologous transcription enhancer, a heterologous translational enhancing element, and / or a heterologous intron.
37. The method of claim 35, wherein the double stranded break is introduced in the promoter, the 5’ untranslated region (5’ UTR), an intron, a 3’ untranslated region (3’ UTR), or a 3’ flanking region of the unmodified DVL1 gene and the donor DNA template or other DNA template comprises the heterologous transcription enhancer.
38. The method of claim 37, wherein the transcription enhancer comprises a DNA molecule set forth in SEQ ID NO: 10, 11-117 and / or 118.
39. The method of claim 37, wherein the double stranded break is introduced about 10, 20, 30, 40, 100, 150, or 200 base pairs (bp) to about 220, 240, 260, 280, 300, 350, 400, 450, 500, or 1000 bp 5’ of the translation start site (TSS) of the DVL1 gene.
40. The method of claim 39, wherein the transcription enhancer comprises SEQ ID NO: 10 or 11 and the double stranded break is introduced:(i) about 174 to about 134 base pairs or about 154 base pairs 5’ to the TSS of the DVL1 gene;(ii) about 275 to about 235 base pairs or about 255 base pairs 5’ to the TSS of the DVL1 gene; or(iii) in a double stranded break introduced in the DVL1 promoter with a Cast 2 nuclease and a Casl2 guide RNA comprising a spacer encoded by SEQ ID NO: 123 or 127.Docket No. P15033WO0041. The method of claim 35, wherein the donor DNA template or other DNA template comprises a heterologous translational enhancer and the double stranded break is introduced in the 5’ UTR and / or within the coding region of the unmodified endogenous DVL1 gene.
42. The method of claim 41, wherein the translational enhancer is encoded by a DNA molecule comprising the DNA sequence of a rice alcohol dehydrogenase (OsAdh), glutathione transferase U50 (OsGst U50), glutathione peroxidase 1 (OsGsp 1), 20S proteasome alphal subunit (Os20Sal), pathogenesis-related protein 4b (OsPrp4b), glycine-rich cell-wall structural protein 1 (OsGrcwpl), or UspA domain containing protein (OsUspA) 5’UTR and wherein all or part of said OsAdh, OsGstU50, Os20Sal, OsPrp4b, OsGrcwpl, or OsUspA 5’UTR is substituted for all or part of the DVL1 5’ UTR in the modified endogenous DVL1 gene.
43. The method of claim 35, wherein the DNA donor template or other DNA template comprises a heterologous intron and the double stranded break is introduced in the 5’ UTR and / or within the coding region of the modified endogenous DVL1 gene, optionally wherein the double stranded break is introduced within about 500, 200, 100, 50, 30, or 20 base pairs of the TmslSS.
44. The method of claim 43, wherein the heterologous intron comprises a UBQ10, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ10, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron.
45. A method of making a maize plant of any one of claims 1 to 12, comprising:(a) contacting a maize plant genome with a transgene comprising a heterologous promoter, heterologous 5’ UTR, and / or heterologous intron which is operably linked to a coding region encoding the DVL1 protein of SEQ ID NO: 6 or an allelic variant thereof; and(b) selecting a transgenic maize plant comprising the transgene, wherein expression of the DVL1 gene is increased in at least one tissue and wherein height and / or internode length of the maize plant is increased in comparison to a control maize plant lacking the transgene.
46. The method of claim 45, wherein the promoter is a ubiquitin promoter, an actin promoter, or a plant viral promoter, optionally wherein the plant viral promoter comprises a caulimovirus promoter.Docket No. P15033WO0047. The method of claim 45, wherein the heterologous intron comprises a UBQ, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron, optionally wherein the UBQ, EF-la, EF-ip, Histone H3, ATPK1, RHD3, or MHX intron comprises a rice or maize intron.
48. A maize plant chromosome comprising:(i) a modified endogenous DVL1 gene wherein a heterologous expression enhancing element is located in the modified gene and wherein the unmodified endogenous DVL1 gene comprises the DNA molecule of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the heterologous expression enhancing element is a transcription enhancer comprising SEQ ID NO: 10 and the insertion is located: (i) about 174 to about 134 base pairs or about 154 base pairs 5’ to the transcription start site (TSS) of the endogenous DVL1 gene or TSS of the transgene encoding the DVL1 protein; (ii) about 275 to about 235 base pairs or about 255 base pairs 5’ to the TSS of the DVL1 gene or TSS of the transgene encoding the DVL1 protein; or (iii) in a double stranded break introduced in the endogenous DVL1 gene promoter with a Casl2 nuclease and a Casl2 guide RNA comprising a spacer encoded by SEQ ID NO: 123 or 127; or optionally wherein the modified endogenous DVL1 gene comprises the enhancer insertion set forth in SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 136, SEQ ID NO: 137, or an allelic variant thereof; or(ii) a transgene comprising a heterologous expression enhancing element which is operably linked to a gene encoding a DVL1 protein of SEQ ID NO: 6 or an allelic variant thereof wherein expression of the DVL1 protein is increased in comparison to a control maize plant lacking the transgene.
49. A maize plant cell comprising the maize plant chromosome of claim 48.
50. A maize plant cell comprising at least one mutation in the DVL1 gene of SEQ ID NO: 1, 120, or 122, wherein the at least one mutation comprises an amorphic or hypomorphic allele of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
51. The maize plant of claim 50, wherein the amorphic or hypomorphic allele reduces expression of the DVL1 gene relative to a wild-type or control maize plant cell lacking the at least one mutation.Docket No. P15033WO0052. The maize plant cell of claim 50, wherein the plant cell is homozygous for the at least one mutation in the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
53. The maize plant cell of claim 50, wherein the at least one mutation is a non-natural mutation.
54. The maize plant cell of claim 50, wherein the at least one mutation comprises an amorphic allele of the DVL1 gene of SEQ ID NO:
1. 120, or 122, or an allelic variant thereof.
55. The maize plant cell of claim 50, wherein the at least one mutation comprises a hypom orphic allele of the DVL1 gene.
56. The maize plant cell of claim 50, wherein the at least one mutation comprises a frameshift mutation or a nonsense mutation in the coding region of the DVL1 gene of SEQ ID O: 1, 120, or 122, or an allelic variant thereof.
57. The maize plant cell of claim 50, wherein the at least one mutation comprises an internal deletion in the coding region of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the internal deletion preserves the reading frame of the encoded mutant DVL1 protein comprising the at least one mutation with respect to amino acid residues of the mutant DVL1 protein which have not been deleted.
58. The maize plant cell of claim 50, wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least one nucleotide of the DVL1 gene of SEQ ID O: 1, 120, or 122, or an allelic variant thereof, optionally wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, 1250, 1500, 1750, 2000, or 3000 nucleotides of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
59. The maize plant cell of claim 50, wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least one nucleotide corresponding to nucleotides 3187-3234 or 3187-3387 of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variantDocket No. P15033WO00thereof, optionally wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, or 903 nucleotides corresponding to nucleotides 3187-3234 or 3187-3387 of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
60. The maize plant cell of claim 50, wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least one nucleotide corresponding to nucleotides 3187-3234 or 3187-3387 of the maize gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides corresponding to nucleotides 3187-3234 or 3187-3387 of the maize gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
61. The maize plant cell of claim 50, with the proviso that the maize plant cell is not exclusively produced by an essentially biological method, optionally wherein the maize plant cell is produced by introducing one or more gene editing molecules into a maize plant cell and selecting the maize plant cell comprising at least one non-natural mutation.
62. The maize plant cell of claim 50, wherein the maize plant cell comprises elite maize germplasm, optionally wherein the elite maize germplasm comprises germplasm of a maize cultivar or variety.
63. The maize plant cell of claim 50, wherein the maize plant cell further comprises at least one mutation in a distinct maize gene.
64. The maize plant cell of claim 50, wherein the maize plant cell further comprises one or more transgenes, optionally wherein the transgenes encode proteins or RNAs conferring herbicide tolerance or pest tolerance.
65. A maize plant or maize plant part comprising the maize plant cell of any one of claims 50-64.Docket No. P15033WO0066. The maize plant part of claim 65, wherein the part is a seed, stalk, stem, or leaf.
67. The maize plant of claim 65, wherein the height and / or internode length of the maize plant is decreased as compared to a maize plant lacking the at least one mutation.
68. A plant or plant part of an elite maize plant, cultivar, or variety with decreased height and / or internode length comprising at least one mutation comprising an amorphic orhypom orphic allele in the endogenous DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, wherein the decreased height and / or internode length is in comparison to a wildtype or control maize plant lacking the at least one mutation.
69. The plant or plant part of claim 68, wherein the elite maize plant, cultivar, or variety is homozygous for the at least one mutation in the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
70. The plant or plant part of claim 68, wherein the at least one mutation comprises a loss-of-function allele of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, wherein the loss-of-function allele reduces expression of the DVL1 gene relative to a wild-type or control plant or plant part lacking the at least one mutation.
71. The plant or plant part of claim 68, wherein the at least one mutation is a non-natural mutation.
72. A biological sample comprising a nucleic acid containing at least one mutation in the maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, wherein the at least one mutation comprises an amorphic or hypomorphic allele of the DVL1 gene of SEQ ID O: 1, 120, or 122.
73. The biological sample of claim 72, wherein the at least one mutation is a non-natural mutation.
74. The biological sample of claim 72, wherein the at least one mutation comprises a frameshift mutation or a nonsense mutation in the coding region of the DVL1 gene of SEQ ID O: 1, 120, or 122, or an allelic variant thereof.Docket No. P15033WO0075. The biological sample of claim 72, wherein the at least one mutation comprises an internal deletion in the coding region of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the internal deletion preserves the reading frame of the encoded mutant DVL1 protein comprising the at least one mutation with respect to amino acid residues of the mutant DVL1 protein which have not been deleted.
76. The biological sample of claim 72, wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least one nucleotide corresponding to nucleotides 3187-3234 or 3187-3387 ofthe DVLl gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, or 903 nucleotides corresponding to nucleotides 3187-3234 or 3187-3387 ofthe DVLl gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof77. The biological sample of claim 72, wherein the sample lacks a nucleic acid comprising the wild-type allele of the maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.
78. A polynucleotide comprising at least one mutation relative to the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the polynucleotide is isolated.
79. The polynucleotide of claim 78, wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least one nucleotide corresponding to nucleotides 3187-3234 or 3187-3387 of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the at least one mutation comprises, consists essentially of, or consists of a deletion of at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 17, 18, 19, 20, 21, 22, 23, 24, 25, 30, 35, 50, 45, 50, 65, 70, 75, 80, 85, 95, 100, 125, 150, 175, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 750, 800, 850, or 903 nucleotides corresponding to nucleotides 3187-3234 or 3187-3387 of the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereofDocket No. P15033WO0080. A guide RNA molecule comprising a spacer RNA molecule which targets the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, optionally wherein the spacer RNA molecule comprises the RNA encoded by SEQ ID NO: 139-194 or 195.
81. The guide RNA molecule of claim 80, wherein the spacer RNA molecule comprises the RNA encoded by SEQ ID NO: 139, 141, 142, 145, 147, 149, 150, 193, 194, or 195.
82. A guide RNA molecule comprising a Casl2 direct repeat element which is operably linked to the spacer RNA of claim 80.
83. An expression cassette comprising:a polynucleotide encoding CRISPR-Cas effector protein comprising a cleavage domain and the guide RNA molecule of claim 80.
84. A method for generating a maize plant cell of claim 50, maize plant part of claim 65, or maize plant of claim 68 comprising introducing at least one mutation in the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof of a maize plant cell.
85. The method of claim 84, further comprising regenerating a maize plant comprising the at least one mutation in the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof from the maize plant cell, and optionally selecting a maize plant with decreased height and / or internode length as compared to a maize plant lacking the at least one mutation.
86. The method of claim 84, wherein the at least one mutation is introduced by:(i) directing both: (a) a guide RNA (gRNA) molecule comprising a spacer RNA molecule which targets the DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof, or a spacer RNA molecule comprising the RNA encoded by SEQ ID NO: 139-194 or 195; and (b) an RNA dependent endonuclease (RDE) which recognizes the gRNA molecule to the genome of a target maize plant cell; and(ii) isolating a maize plant cell, maize plant part, or maize plant comprising the at least one mutation in the maize gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof.Docket No. P15033WO0087. The method of claim 86, wherein the directing of the gRNA and the RDE to the genome of the target maize plant cell comprises introducing the gRNA, the RDE, a gRNA / RDE complex, a nucleic acid encoding the gRNA, and / or a nucleic acid encoding the RDE into the target maize plant cell.
88. The method of claim 84, wherein the at least one mutation is introduced by crossing a maize plant comprising the at least one mutation with a second maize plant and harvesting Fl seed comprising the at least one mutation, thereby producing progeny maize seed comprising the at least one mutation.
89. A method for decreasing height and / or internode length in a maize plant, comprising: introducing at least one mutation comprising an amorphic or hypomorphic allele in the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof of a maize plant cell.
90. The method of claim 89, further comprising regenerating a maize plant comprising the at least one mutation in the endogenous maize DVL1 gene of SEQ ID NO: 1, 120, or 122, or an allelic variant thereof from the maize plant cell, and optionally selecting a maize plant with decreased height and / or internode length.
91. The method of claim 89 or 90, wherein the height and / or internode length is decreased in comparison to height and / or internode length of a wild-type or control maize crop lacking the at least one mutation.
92. A maize plant or plant cell produced by the method of claim 89 or 90.