Dragonrna: DNA-primed RNA-extension activities by DNA-directed RNA

Abstract

Compositions and methods are provided for the synthesis of RNA capped with DNA at the 5' end, herein termed "DragonRNA". In some embodiments the capped RNA is protected from hydrolysis, thereby enhancing RNA in-solution and enzymatic stability. This RNA synthesis platform enhances RNA stability and provides a solution for preserving RNAs.

Description

DragonRNA: DNA-PRIMED RNA-EXTENSION ACTIVITIES BY DNA-DIRECTED RNA POLYMERASESGOVERNMENT SUPPORT RESEARCH

[0001] This invention was made with Government support under contract DGE-1656518 (FELLOWSHIP) awarded by the National Science Foundation and under contracts AG066490, GM130366, GM145925, HG000044, and MH125244 awarded by the National Institutes of Health. The Government has certain rights in the invention.CROSS-REFRENCE TO RELATED APPLICATIONS

[0002] This application claims priority to the filing of United States Provisional Application Serial No. 63 / 746,172, filed January 16, 2025, the disclosure of which application is herein incorporated by reference.BACKGROUND

[0003] RNA is extremely useful as a potential regulator of gene expression as well as in biochemical, synthetic biology, and medical applications in order to promote translation of relevant proteins, including for recent vaccine development. Despite their remarkable utility, the use of RNAs for genetic, immunological, and potentially therapeutic intervention is often limited by natural mechanisms that degrade incoming RNA in cells and organisms.SUMMARY

[0004] Compositions and methods are provided for the synthesis of RNA capped with DNA at the 5’ end, herein termed “DragonRNA”. In some embodiments, the capped RNA is protected from hydrolysis, thereby enhancing RNA in-solution and enzymatic stability. The RNA synthesis platform disclosed herein enhances RNA stability and provides a solution for preserving RNAs.

[0005] This disclosure characterizes a non-canonical activity of many RNA polymerases to extend a DNA sequence covalently with RNA chains. The 5’-DNA-capped RNA is a DNA- RNA combination molecule synthesized by RNA polymerases, in which DNA sequences serve as primers and templates to be extended with RNA. The resulting molecules are serial DNA- RNA chains with the input DNA on the 5’ end and extended RNA on the 3’ end, where the sequence of the RNA portion is complementary to the input DNA. Such capped RNAs can be produced from a wide variety of DNA sequences comprising a region of complementarity to the 3’ end.

[0006] DNA dependent RNA polymerases (RNAP) useful in the methods of the disclosure include a number of single subunit RNAP and certain multi-subunit enzymes. Enzymes ofinterest include, without limitation, mitochondrial RNAP, phage RNAP, bacterial RNAP, etc. In some embodiments an RNAP for use in the methods is a mitochondrial RNAP.

[0007] DNA primers for use in the methods of the disclosure provide the sense sequence for the 5’ cap, with a DNA template providing anti-sense sequence for the synthesized RNA portion. In some embodiments, the primer and template are the same molecule. The DNA template comprises a free 3’ end. The DNA cap may be at least 2nt. in length, at least 5 nt. in length, at least about 10 nt. in length, at least about 15 nt, at least about 20 nt, at least about 25 nt, or more.

[0008] In one embodiment the DNA input is a single strand of DNA, comprising an internal region of complementarity of at least 2 or more nt. The RNAPs extend preferentially when such region of complementarity is close to the 3’ end, e.g. within at least about 20 nt of the 3’ end, within at least about 15 nt, within at least about 10 nt., within at least about 5 nt, within 3nt from the 3’ end.

[0009] In other embodiments the DNA input is a combination of two strands where the RNA is extended covalently from the 3' end of one of the two strands following pairing with the other. This system allows for different designs for a DragonRNA molecule such that the a DNA cap has a desired sequence, provided it can pair at the 3’ end with the alternate strand. The RNA sequence is designed to be templated by the input alternate DNA strand. In other embodiments the DNA input is a gapped or nicked dsDNA, e.g. as shown in FIG. 11, where RNA is extended from a free 3’ end on the DNA, e.g. at the gap or nick., e.g. as shown in FIG.11.

[0010] The RNA sequence is templated by the 3’-5’ DNA sequence, and therefore the RNA sequence is controlled by the sequence of the DNA template. In some embodiments the DNA template is a reverse complement sequence for a coding sequence of interest, e.g. a pathogen or cancer-specific sequence for use in RNA vaccination methods, a protein to be introduced into an expression system to generate a protein of interest, or other purposes. In some embodiments the DNA template or RNA product derived therefrom includes a ribosome binding site or IRES sequence. In some embodiments the DNA template is a sense sequence for a sequence of interest for inhibition of translation, where the resulting DragonRNA is an anti-sense inhibitory molecule. In some embodiment the DNA template encodes known gene regulatory RNAs, or other configurations. The DragonRNA can have increased stability and persistence relative to an RNA sequence without a DNA cap.

[0011] In some embodiments, the DragonRNA synthesis is performed in the absence of a polynucleotide providing a promoter sequence. In some embodiments the DragonRNA synthesis is performed in the absence of enzymes such as DNA polymerase, ligase, etc. The synthesis may be performed in the absence of competing oligonucleotides.

[0012] This methods of the disclosure are useful for RNA-based medical applications, therapeutics, and biological research technologies, as the RNA portion of DragonRNA is templated based on the sequence of the input, and the DNA on the 5’ end can provide additional stability and protection from degradation relative to canonical RNA. DragonRNA synthesis activities are useful in biological settings, since the RNA portion can be templated from internal sites in an input DNA molecule of desired sequence.

[0013] In some embodiments the RNA sequence component of DragonRNA corresponds to an mRNA of a eukaryotic or prokaryotic sequence. In other embodiments the RNA component is an antisense RNA. An mRNA may or may not have a cap and / or polyA tail. An RNA may or may not contain unnatural modified nucleobases. An RNA portion of DragonRNA may be at least 10 nt in length, at least about 15, at least about 20, at least about 25, and may be greater than about 100 nt, 500 nt, 750 nt, 1 kb, 1.5 kb, 2 kb, or larger.BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The invention is best understood from the following detailed description when read in conjunction with the accompanying drawings. It is emphasized that, according to common practice, the various features of the drawings are not to-scale. On the contrary, the dimensions of the various features are arbitrarily expanded or reduced for clarity. Included in the drawings are the following figures.

[0015] FIGS. 1A-1C: mtRNAP extension reactions with and without RNA primer. In vitro reactions using “Lu conditions” (see Methods) based on (Lu et al. 2018) were performed with hmtRNAP and Rpo41 and contained a DNA oligonucleotide, to serve as a template, with and without an RNA oligonucleotide, to serve as a potential primer. (A) Sequences of RNA oligonucleotide and DNA oligonucleotides used in the reaction, as well as graphical explanation of where they would anneal and initiate polymerization. (B) hmtRNAP Oh control and 24h reactions analyzed via gel electrophoresis with AF-EG-2 (short DNA oligonucleotide) with and without AF-EG-1 (RNA primer), and hmtRNAP 3h reactions with AF-EG-3 (mediumlength DNA oligonucleotide) and AF-EG-7 (long DNA oligonucleotide) with and without AF- EG-1. (C) RNAP reactions were analyzed via gel electrophoresis with AF-EG-3 input DNA oligonucleotide, with hmtRNAP, no RNAP negative control, and Rpo41. These reactions were analyzed using gel electrophoresis on a 10% TBE-Urea gel, followed by nucleic acid staining. Images for each gel were independently contrast-enhanced and shown as a montage. The ladder is labeled as “m.”

[0016] FIGS. 2A-2C: Nuclease digestions of RNAP products and extension of5’-labeled DNA oligos indicate DNA-primed, RNA-extension activity. mtRNAP reactions shown here were run under “Lu conditions” and analyzed via 10% TBE-Urea gel electrophoresis. (A) Rpo41 and hmtRNAP reaction products from AF-EG-3-containing in vitro reactions (shown in FIG. 1C)were purified, digested with Turbo DNase, RNase H, and RNase A, and analyzed via gel electrophoresis. Images for each gel were independently contrast enhanced. All nuclease digestions and corresponding gels were run in parallel with controls containing synthetic DNA and RNA oligonucleotides to confirm that each nuclease specifically digested the expected nucleic acid (data not shown). (B) In vitro reactions with hmtRNAP, no RNAP, and Rpo41 were performed using 5’-labeled DNA oligonucleotides with the same sequence as AF-EG-2, and analyzed via gel electrophoresis. 5’-label is shown overlaid with a 50% transparent image of nucleic acid stain of the same gel. The purple shadow in every lane is the dye front, which imaged at the same wavelength as the ATTO label. Images were overlaid in PowerPoint. (C) Proposed priming configurations for how the DNA input may hybridize for RNA extension, shown with intra-molecular looping and self-priming, and inter-molecular priming of two input separate oligonucleotides base-pairing. For the purpose of simplicity, future proposed priming configuration figures will be drawn with intra-molecular looping, but we acknowledge either priming model is possible.

[0017] FIGS.3A-3C: Time course ofmtRNAP DragonRNA reactions. Reactions run under “Lu conditions” with 5’-FAM-labeled AF-EG-15 were analyzed via 10% TBE-Urea gel electrophoresis. (A) Sequence of oligonucleotide AF-EG-15 used in reactions shown in (B) and (C). (B) 24 hour time course of hmtRNAP DragonRNA reactions. (C) 3 hour time course of Rpo41 DragonRNA reactions. FAM-label imaging is shown overlaid with a 50% transparent image of nucleic acid stain of the same reaction. Images were independently contrast- enhanced and overlaid in PowerPoint.

[0018] FIGS. 4A-4B: Sequence analysis of DragonRNA products. Figure shows the most common and exemplary sequence species after filtering for 5’ matches to the DNA input sequence with extension on the 3’ end that is complementary to a region of the input sequence by at least one base. Putative priming and base-pairing configurations are drawn for purposes of illustration. Boxes indicate the input DNA sequence. Circles indicate the sequencing reads. Black circles indicate the input DNA sequence (either directly from the input DNA oligonucleotide or from RNA generated with that same sequence). Purple circles and text indicate the two bases on the 3’ end of the DNA input oligo that might be expected to hybridize during a priming event. We expect that sequences downstream from the purple ‘AA’ are produced in the polymerase reaction from rNTP precursors. Red circles indicate the complementary sequence to the DNA input. Note the library preparation involved converting the RNA to cDNA, and thus the sequencing reads shown here (even regions presumed to be RNA) are shown with “T”. Arrows indicate the 5’->3’ direction of the read. mtRNAP reactions were run under Lu conditions. (A) RNA-sequencing results for hmtRNAP 3 hour reactions with AF-EG-7. The sequences show examples of reads that extend part-way complementary to the input sequence, and one example that shows extension with complementarity to the 5’ end ofthe input (inferred from simple assembly). (B) Rpo41 reaction with AF-EG-2 was set up and quench time was delayed (quenched within 1-2 minutes of setting up reaction) and RNA sequencing results shown here filtered as above. Two prominent species among the longer sequencing reads are shown below: upper example shows a structure that we term “duplicate extension,” in which the read contains the DNA input sequence on the 5' end, and two serial sequences that are reverse complementary to that input. Lower example shows what we term "back-and-forth extension," which shows the DNA input sequence on the 5' end of the read, a region of reverse-complementarity to that input sequence (shown in red), followed (continuing 5'->3') by a short region that is the same sequence of the DNA input, followed by a short region reverse-complementary to the input sequence again.

[0019] FIGS. 5A-5C: DNA oligonucleotide input requirements for RNAPs to generate DragonRNA. RNAP reactions shown here were run under “Lu conditions” and analyzed on a 15% TBE-urea gel. (A) Several DNA oligonucleotides were designed to test sequence specificity, structure, and intra-molecular priming requirements of the input oligonucleotide. The sequences of these oligonucleotides are shown here, with the FAM-label, two 3’-end bases, and the hypothesized priming loci color-coded. Below: proposed configuration showing DNA oligonucleotide looping and base-pairing with itself between the two 3’-end bases and an internal complementary site, drawn here as intra-molecular. (B) Rpo41 in vitro reactions with DNA oligonucleotides from (A). (C) hmtRNAP in vitro reactions with DNA oligonucleotides from (A). Gel images were independently contrast-enhanced, spliced together, shown as a montage, and overlaid in PowerPoint with 50% transparency of the nucleic acid-stained image over the FAM image of the same gel.

[0020] FIGS 6A-6C: Testing priming sites for RNAPs to generate DragonRNA. (A) Several DNA oligonucleotides were designed to test priming sites and priming distance from 3’ end of the input DNA oligonucleotide. The sequences of these oligonucleotides are shown here, with the FAM-label, two 3’-end bases, and the hypothesized priming loci color-coded. (B) Rpo41 in vitro reactions with DNA oligonucleotides from (A). (C) hmtRNAP in vitro reactions with DNA oligonucleotides from (A). Note that gels show both FAM labeled (green) and total (gray) nucleic acid, with the faster-migrating, total-nucleic-acid-stained bands that do not show the fluorescent label consistent with synthesis by canonical initiation on the DNA input. RNAP reactions shown in (A) and (B) were run under “NEPol conditions” and analyzed on a 15% TBE-urea gel. Gel images were independently contrast-enhanced, spliced together, shown as a montage, and overlaid in PowerPoint with 50% transparency of the nucleic acid-stained image over the FAM image of the same gel.

[0021] FIGS. 7A-7E: Mixing experiments using oligonucleotides with unspecified bases to test whether priming is intra- or inter-molecular. (A) Oligonucleotide inputs contained regions of unspecified bases ("NN"). We expected that the DNA oligonucleotide input wouldbe extended in the RNAP reaction; by interrogating whether the unspecified bases near the beginning of the input molecule matched the extended complementary region of the sequence read, we then evaluate whether the RNAP had a strong tendency to use a single molecule as both primer-and-template (intra-molecular or cis priming) or two different molecules, one as primer and another one as template (inter-molecular or trans priming); these options are diagrammed in FIG. 20. (B-D) 2D plots of sequencing reads show the unspecified bases’ sequence in the DNA input region of the sequencing read on the X-axis and the unspecified bases’ sequence in the DragonRNA extension region of the sequencing read on the Y-axis. (B and C) Cis-priming is preferred for all 32 input oligonucleotides present in the two input pools (EG-73 and EG-74). Among one of the 32 input oligos, one TTTGACGTCAACGATATAAGTTTTGAC, appears to have a somewhat higher level of apparent trans priming than others (generating the apparent horizontal stripe in Figs 7b and 7c); the unusual products with this template have not been further investigated but could reflect the coincidence of the perfect match between first six and last six nucleotides in this template that results from this specific barcode. (B) Sequencing results from Rpo41 1 minute reaction with input AF-EG-74. (C) Sequencing results from Rpo41 20 minute reaction with input AF- EG-74. (D) Sequencing results of hmtRNAP 20 minute reaction with input AF-EG-73. (E) Sequencing results of Rpo41 20 minute reaction with AF-EG-73. These reactions were performed under “NEPol” conditions and sequencing was performed using “Dru-Seq” (see Methods). Gel assay showing extension activity for this sequencing is shown in FIG. 15.

[0022] FIG. 8: Comparing extension reactions on deoxynucleotide and ribonucleotide- terminated substrates. Extension products are shown for a set of mixed-input reactions with a FAM-labeled (green, left) input containing a deoxynucleotide-terminus and an equivalent Cy5- labeled (magenta, right) input with a ribonucleotide terminus. The input sequence used was that of AF-EG-15 (FIG. 3). Rpo41 in vitro reactions with this mixture were run for 3 minutes with decreasing concentration of Rpo41. Oh timepoints were included with each oligonucleotide input as a control. Rpo41 reactions shown here were run under “NEPol conditions” and analyzed on a 15% TBE-urea gel. Gel images were independently contrast- enhanced, spliced together, and shown as a montage.

[0023] FIGS. 9A-9C: Fluorescent band-shift assay demonstrates DragonRNA activity by many RNAPs. (A) Phylogenetic tree of amino acid sequences of several single-subunit RNAPs (multiple sequence alignment generated using ClustalOmega, tree generated using IQTree and NCBI TreeViewer). Bold indicates an RNAP tested in our assay for DragonRNA synthesis activity. (B and C) In vitro RNAP reactions with 5’-FAM-labeled DNA oligonucleotides were run with several different RNAPs for 30 minutes under “Lu conditions.” (B) RNAP reactions with AF-EG-15 with a no RNAP control and Oh timepoint for all RNAPs and run with hmtRNAP, Rpo41, T7 RNAP, Sp6 RNAP, Syn5 RNAP, KP34 RNAP, and T3 RNAP for 30 minutes. Imageswere overlaid in PowerPoint with 50% transparency of the nucleic acid stain image over the FAM image of the same gel. (C) E. coli RNAP holoenzyme and core enzyme were run in an RNAP reaction with AF-EG-15 under “Lu conditions” for 30 minutes. FAM label image and nucleic acid stain image kept separate for clarity. Products were analyzed via gel electrophoresis on a 10% TBE-Urea gel, and imaged for the FAM label, nucleic acid stained, the images independently contrast-enhanced, and shown as a montage.

[0024] FIGS. 10A-10B: DragonRNA T7 RNAP assays with a T7-promoter-containing doublestranded template. T7 RNAP in vitro reactions shown here were run with a T7-promoter- containing DNA template, to test the impact on DragonRNA activity in the presence of a promoter-driven DNA template. (A) Diagram of the proposed double-stranded T7-promoter- containing DNA template after annealing, with a gray box around the T7 RNAP promoter sequence. (B) Gel analyses of T7 RNAP reactions with promoter-containing DNA templates (sequences of oligonucleotides used shown under the gel). Reactions were run with sense strand only (AF-EG-16 or AF-EG-18), or with an annealed, double-stranded promotercontaining template of the specified sense strand and AF-EG-17. AF-EG-15 was included as a positive control. As a negative control, oligonucleotides containing a T3 promoter (sense AF- EG-19 and antisense AF-EG-20) were also designed, run in parallel under “Lu conditions,” and analyzed on a 10% TBE-Urea gel. Gel images were independently contrast-enhanced, shown as a montage, and overlaid in PowerPoint with 50% transparency of the nucleic acid stain image over the FAM image of the same gel.

[0025] FIGS. 11A-11I: Extension lengths in sequencing results using double-stranded input material to DragonRNA Rpo41 reactions. Rpo41 reactions were run for 30 minutes under “NEPol conditions” with double-stranded DNA inputs containing a template oligonucleotide and a primer oligonucleotide. The primer oligonucleotide could not self-prime. Sequencing was performed using DruSeq (see Methods). Plots show distribution of extension lengths on the DNA primer from the sequencing results. (A) Cartoon showing design of input oligonucleotides with expected annealing. (B and C) Proposed model for DragonRNA extension on double-stranded input involves RNAP helicase activity. Proposed model for RNAP displacing the second strand on a hairpin-loop double-stranded, annealed DNA input in a DragonRNA reaction to extend the DNA primer oligonucleotide with RNA. This is shown in (B) with a hairpin-loop double-stranded region in a system containing a gap of 3 bases and in (C) with a three-oligonucleotide double-stranded input with a nick and no gap. (D) Extension lengths from sequencing of reaction with template DNA oligonucleotide that was a singlemolecule with a hairpin loop region and a 3-base gap between the 5’ end of the template molecule and the 3’ end of the primer molecule. (E) Extension lengths from sequencing of reaction with template DNA oligonucleotide that was a single molecule with a hairpin loop region and a 0-base nick between the 5’ end of the template molecule and the 3’ end of theprimer molecule. (F) Extension lengths from sequencing of reaction with template DNA oligonucleotide that was a single molecule template, an annealed DNA oligonucleotide to provide a double-stranded region, and a 3-base gap between the 5’ end of the doublestranded region and the 3’ end of the primer molecule. (G) Extension lengths from sequencing of reaction with template DNA oligonucleotide that was a single molecule template, an annealed DNA oligonucleotide to provide a double-stranded region, and a 0-base nick between the 5’ end of the template molecule and the 3’ end of the primer molecule. (H) RNA- sequencing example reads for Rpo41 30 minute reactions with double-stranded inputs. The sequences show examples of reads that extend part-way complementary to the template strand sequence. (I) shows the two exemplary sequence species after filtering for 5’ matches to the DNA primer sequence with putative base-pairing and templating configurations drawn for purposes of illustration. Black text indicates the input DNA sequence. Navy text indicates the template sequence or non-primer oligonucleotides. Purple text indicates the two bases on the 3’ end of the DNA input oligonucleotide primer. We expect that sequences downstream from the purple text are produced in the polymerase reaction from rNTP precursors. Red text indicates putative RNA extension on the DNA primer. Note the library preparation involved converting the RNA to cDNA, and thus the sequencing reads shown here (even regions presumed to be RNA) are shown with “T”. Gel assay showing extension activity for this sequencing is shown in FIG. 23.

[0026] FIGS. 12A-12B: Proposed model for the process of and reactions needed for DragonRNA synthesis. (A) Proposed flow chart of the process of Dragon RNA synthesis, in which the DNA oligonucleotide base-pairs and self-primes with 3’ end either in cis (intramolecularly) or in trans (inter-molecularly), the RNAP adds the first ribonucleotide, and then the DNA oligonucleotide serves as a template for 3’ extension with RNA, and then that DragonRNA molecule unhybridizes, reprimes, and follows a similar process, in which the DragonRNA is template and primer for further RNA extension. We note that the priming can happen both in cis via a loop of one oligonucleotide or in trans via two oligonucleotides basepairing throughout the process, but extension is shown here with only intra-molecular priming and extension for simplicity. (B) Chemical reactions showing normal 3’ RNA extension on an RNA molecule (first), Stage 2 of DragonRNA synthesis in which the starting material is a DNA oligonucleotide and there is a 3’ addition to deoxyribose with ribose to polymerize the 3’ end of the DNA to a ribonucleotide, and, finally, Stage 3 of DragonRNA synthesis, in which the RNA extension on the 3’ end of the DragonRNA product after Stage 2 polymerizes the now- RNA 3’ end with a ribonucleotide. Mammalian mtRNAPs may serve as primases in mitochondrial DNA lagging-strand replication, making short RNA primers that are extended with DNA on the 3’ end. Additionally, ribonucleotides can be incorporated into genomic DNA by DNA polymerases during DNA replication. DragonRNA is the inverse of the intermediateRNA^DNA hybrid molecules formed in the process of DNA replication, in which short RNAs prime Okazaki-fragmented DNA polymerization; an intermediate molecule is thus made during DNA replication that builds DNA on the 3’ end of an RNA primer. The products are temporary RNA^DNA combination molecules with RNA on the 5’ end and DNA on the 3’ end. Here, we show the inverse, in which the in vitro RNA-generated DragonRNA molecules are DNA 5’^RNA 3’ combination molecules.

[0027] FIG. 13: Assessment of DNA-primed, RNA-extension activity with nuclease digestions of products from RNAP reactions with 5’-labeled DNA oligonucleotides. Products from mtRNAP reactions containing 5’ FAM-labeled DNA oligonucleotide AF-EG-15 from FIG. 2 in the main text were purified, and then independently digested with Turbo DNase to digest the DNA input oligonucleotide, RNase H to digest any RNA products paired with that DNA oligonucleotide, or RNase A to digest all RNA products. The digestion reactions were then purified with phenol:chloroform extraction followed by ethanol precipitation. These results replicated those performed on the reaction products from in vitro mtRNAP reactions with the unlabeled DNA oligonucleotide AF-EG-3. The dispersed electrophoretic pattern of nucleic acid stain in lanes 5 and 6 may be RNA generated in the Rpo41 reaction. Images were overlaid using ImageJ. All nuclease digestions and corresponding gels were run in parallel with controls containing DNA and RNA oligonucleotides to confirm that each nuclease specifically digested the expected nucleic acid (data not shown). Products were run on a 10% TBE-Urea gel, and imaged for the 5' FAM label, then nucleic acid stained. Images were independently contrast- enhanced and overlaid using ImageJ.

[0028] FIGS. 14A-14D: RNAPs make DragonRNA within minutes of reaction initiation. Reactions were run under “Lu conditions” and analyzed on a TBE-urea gel. Results show that Rpo41, Sp6, and T7 RNAPs all generate DragonRNA within minutes of reaction initiation, as observed by the up-shifted bands. (A) Sequences of oligonucleotide inputs used in reaction time courses and graphical explanation of the intra-molecular priming for AF-EG-30. (B) Rpo41 reaction with AF-EG-2 was set up and quench time was delayed; quenched within 1 -2 minutes of setting up reaction. Products were analyzed on a 10% gel, nucleic acid stained, and imaged on an Alphaimager. (C) T7 RNAP reaction time course was run with AF-EG-15, no oligonucleotide input, and AF-EG-30 and analyzed on a 15% gel. (D) hmtRNAP, Sp6 RNAP reaction time course, and T7 RNAP serial dilution were run with AF-EG-30 and analyzed on a 15% gel. The phage RNAPs showed DragonRNA synthesis activity even after 5 minutes (Sp6) and even at low RNAP concentration (T7). The nucleic acid-stained bands in FIGS. 14B and 14C, especially by T7 and Sp6 RNAPs, that do not appear in the FAM-label-imaging could be direct RNA products without DNA on the 5’ end. A fraction of the RNA products that are not FAM labeled appear longer than template, potentially reflecting a multi-round extension process such as a rolling-circle or rolling-hairpin synthesis. Banding patterns are different withdifferent input sequences and we hypothesize that detailed features of input oligonucleotide structure have substantial influences on the preferred products of these reactions. We also observed that DragonRNA activity on AF-EG-30 does not show the slowest migrating bands observed in DragonRNA reactions with AF-EG-15 input. We hypothesize that the band pattern appears different because the sequence and / or structure of AF-EG-15 and the DragonRNA sequences made from AF-EG-15 are “preferred” by the RNAP to make DragonRNA compared to that of AF-EG-30. Gel images were independently contrast-enhanced, shown as a montage, and overlaid in PowerPoint with 50% transparency of the nucleic acid stain image over the FAM image of the same gel.

[0029] FIGS. 15A-15B: Gel analysis of mixing experiments using oligonucleotides with unspecified bases to test whether priming is intra- or inter-molecular. Figure shows gel assay of reactions of hmtRNAP and Rpo41 with 5’phosphate DNA oligonucleotides to facilitate sequencing. (A) Oligonucleotide input sequences for these reactions. (B) Gel assay of hmtRNAP and Rpo41 reactions with inputs from (A). AF-EG-15 was included as a positive control. Reactions showed DragonRNA extension activity on all inputs (AF-EG-15, 65, 73, and 74) by hmtRNAP and Rpo41. Red label indicates a sample that was run for sequencing, data for several of which are shown in FIG. 7 of the main text. These reactions also showed that hmtRNAP and Rpo41 have similar activities under “NEPol conditions,” as evidenced by showing DragonRNA products after 1 -minute reactions with both enzymes. Reactions shown here were run under “NEPol conditions” and analyzed on 15% TBE-urea gels. Gels with the black background were imaged on the Alphaimager and gels with the white background were imaged on the Typhoon. Gel images were independently contrast-enhanced, spliced together, and shown as a montage.

[0030] FIG. 16: Test DNA oligonucleotide input requirements for T7 RNAP to generate DragonRNA. T7 RNAP in vitro reactions shown here were run in parallel under “Lu conditions” and analyzed on a 15% TBE-urea gel. Results from these oligonucleotides with T7 RNAP mirrored the requirements identified with hmtRNAP and Rpo41, and showed overall similar results. Gel images were independently contrast-enhanced, spliced together where indicated by break, shown as a montage, and overlaid in PowerPoint with 50% transparency of the nucleic acid stain image over the FAM image of the same gel.

[0031] FIG. 17: 24 hour time course of KP34 RNAP with AF-EG-15 to test if KP34 makes DragonRNA. KP34 RNAP in vitro reactions shown here were run under “Lu conditions” and analyzed on a 15% TBE-Urea gel. T7 RNAP was used as a positive control and run in parallel under the same conditions. Gel images were independently contrast-enhanced and overlaid in PowerPoint with 50% transparency of the nucleic acid image over the FAM image of the same gel.

[0032] FIGS. 18A-18D: Assessing reaction conditions for DragonRNA synthesis by RNAPs. RNAP in vitro reactions shown here were run in parallel with AF-EG-15 and analyzed on a 10% TBE-Urea gel. (A) Sequences of oligonucleotides used in reactions to test conditions for DragonRNA synthesis. (B) RNAP reactions with HiT7 RNAP (NEB M0658; temperature- tolerant T7 RNAP variant) and Rpo41 were run under “Lu conditions” for the buffer at 50°C, the highest hypothesized temperature in the mitochondria, though the exact temperature may be lower. HiT7 shows a dispersed electrophoretic pattern of both DragonRNA (extended 5’ FAM-labeled DNA oligonucleotide) and nucleic acid stain, which may be stronger due to RNA but could also be because of staining strength. Rpo41 also shows DragonRNA activity at 50°C. Although the exact temperature in the mitochondria is unknown, 50°C was chosen for this reaction because it has been hypothesized as the effective temperature in the mitochondria. (C) T7 RNAP reactions were run in parallel in a time course with “Lu conditions” from and “KS conditions”. Under “KS conditions,” T7 RNAP generates more RNA but still also makes DragonRNA on the input DNA oligonucleotide. Under “Lu conditions,” T7 RNAP generates less RNA, though still some, and makes DragonRNA, using up much more of the input DNA oligonucleotide during the course of the reaction than in the “KS conditions” reactions. (D) RNAP in vitro reactions were run for 35 minutes under “KS conditions” with E. coli RNAP core enzyme with AF-EG-21 and AF-EG-22, and T7 RNAP, and Rpo41, all of which show DragonRNA activity on these templates under KS conditions. Gel images were independently contrast-enhanced, spliced together where indicated by break, and shown as a montage. FAM and nucleic acid stained images were kept separate, with FAM-labeled images on the left and nucleic acid stained images on the right for each sub-figure.

[0033] FIG. 19: Diverse NTP and salt conditions show DragonRNA activity with Rpo41. Rpo41 in vitro reactions shown here were run in parallel with AF-EG-15 and analyzed on a 15% TBE- Urea gel. Reactions were run in parallel under “Lu conditions” following the protocol and “NEPol conditions” (see Methods) following NEB’s protocol (M0251), as well as under conditions with NEPol’s NTP concentration (0.5mM) with Lu buffer and temperature, and vice versa with Lu’s NTP concentration (4mM) with NEPol buffer and temperature, as well as each condition with the addition of 50mM NaCI. Activity is observed under both of these conditions and under both conditions with the addition of NaCI. (We note that observed DragonRNA activity in these reactions was lost with either decreased NTPs and the high magnesium concentration in Lu buffer or with increased NTPs and the low magnesium concentration in the NEPol buffer; we hypothesize that these inefficient reactions reflect NTPs chelating the magnesium and vice versa and thus a disrupted balance between magnesium and NTPs required for RNAP activity. We note here that only DragonRNA activity was measured.) Gel images were independently contrast-enhanced and overlaid in PowerPoint with 50% transparency of the nucleic acid image over the FAM image of the same gel.

[0034] FIGS. 20A-20C: Molecular modeling of Rpo41, T7 RNAP, and E. coli RNAP selectivity for the 2’OH of an incoming NTP and of a primer terminus. Modeling was done using Phenix and figures of the models were made using Chimera. Model neighborhood surrounding the conserved Arg in the active site and terminal 2’ OH for (A) Rpo41, (B) T7 RNAP, (C) E. coli RNAP |3 subunit.

[0035] FIGS. 21A-21B: Modeled Rpo41 DragonRNA synthesis. (A) Proposed reaction scheme for DragonRNA synthesis begins with Rpo41 binding to a hairpin DNA input AF-EG- 2 (left). Binding of a GTP and closing the active site positions it in a catalytically-competent location (middle). This results in incorporation of the first ribonucleotide and formation of DragonRNA (right), followed by the second NTP (CTP) incorporation. (B) Closeup of the active site prior to first NTP (left) and second NTP (right) addition in DragonRNA synthesis.

[0036] FIGS. 22A-22C: Fluorescence-based gel assay using double-stranded input material to DragonRNA Rpo41 reactions. Rpo41 reactions were run for 30 minutes under " NEPol conditions" with double-stranded DNA inputs containing a template oligonucleotide and a primer oligonucleotide. The primer oligonucleotides could not self-prime. (A) Table of oligonucleotide inputs for the reaction. AF-EG-15 was included as a positive control. AF- EG-66 and AF-EG-67 served as DNA primers for DragonRNA extension. AF-EG-68 to AF- EG-72 served as templates for DragonRNA extension. AF-EG-68 served as a single-stranded template to test DragonRNA activity in a system with a primer input and alternative strand template. AF-EG-69 to AF-EG-72 all could form hairpin loops to create double-stranded templates for DragonRNA extension. (B) 5’FAM label gel analyses of Rpo41 reactions with double-stranded DNA inputs from (A). Reactions were run with an annealed, double-stranded template of the specified primer and template oligonucleotides. AF-EG-15 was included as a positive control. Reactions were analyzed on a 15% TBE-Urea gel. (C) 5’FAM label gel analyses overlaid with total nucleic acid stain of Rpo41 reactions with double-stranded inputs from (A). Gel images were independently contrast-enhanced, shown as a montage, and overlaid in PowerPoint with 50% transparency of the nucleic acid stain image over the FAM image of the same gel.

[0037] FIGS. 23A-23C: Gel analysis of Rpo41 reactions with double-stranded DNA input material. Figure shows gel assay of reactions of Rpo41 with 5’phosphate DNA primer to facilitate sequencing; corresponding sequencing analysis of these experiments shown in FIG.11 in the main text. Oligonucleotide input sequences for these reactions shown in the table above. Gel assay of Rpo41 reactions with double-stranded, annealed inputs from table is shown below. AF-EG-85 alone was included as a negative control. Reactions showed DragonRNA extension activity on all double-stranded systems by Rpo41, even beyond oligonucleotide gaps in the double-strandedness. These reactions also showed that Rpo41 has DragonRNA activity on double-stranded oligonucleotides, further confirmed by thesequencing in FIG. 11. Reactions shown here were run under “NEPol conditions” and analyzed on 15% TBE-urea gels. Gel images were independently contrast-enhanced and shown as a montage.DETAILED DESCRIPTION

[0038] Before the present methods and compositions are described, it is to be understood that this invention is not limited to particular method or composition described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the present invention will be limited only by the appended claims.

[0039] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0040] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, some potential and preferred methods and materials are now described. All publications mentioned herein are incorporated herein by reference to disclose and describe the methods and / or materials in connection with which the publications are cited. It is understood that the present disclosure supercedes any disclosure of an incorporated publication to the extent there is a contradiction.

[0041] It must be noted that as used herein and in the appended claims, the singular forms "a", "an", and "the" include plural referents unless the context clearly dictates otherwise. Thus, for example, reference to "a cell" includes a plurality of such cells and reference to "the peptide" includes reference to one or more peptides and equivalents thereof, e.g. polypeptides, known to those skilled in the art, and so forth.

[0042] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.Further, the dates of publication provided may be different from the actual publication dates which may need to be independently confirmed.

[0043] As used herein, compounds which are "commercially available" may be obtained from commercial sources including but not limited to Acros Organics (Pittsburgh PA), Aldrich Chemical (Milwaukee Wl, including Sigma Chemical and Fluka), Apin Chemicals Ltd. (Milton Park UK), Avocado Research (Lancashire U. K.), BDH Inc. (Toronto, Canada), Bionet (Cornwall, U. K.), Chemservice Inc. (West Chester PA), Crescent Chemical Co. (Hauppauge NY), Eastman Organic Chemicals, Eastman Kodak Company (Rochester NY), Fisher Scientific Co. (Pittsburgh PA), Fisons Chemicals (Leicestershire UK), Frontier Scientific (Logan UT), ICN Biomedicals, Inc. (Costa Mesa CA), Key Organics (Cornwall U. K.), Lancaster Synthesis (Windham NH), Maybridge Chemical Co. Ltd. (Cornwall U. K.), Parish Chemical Co. (Orem UT), Pfaltz & Bauer, Inc. (Waterbury CN), Polyorganix (Houston TX), Pierce Chemical Co. (Rockford IL), Riedel de Haen AG (Hannover, Germany), Spectrum Quality Product, Inc. (New Brunswick, NJ), TCI America (Portland OR), Trans World Chemicals, Inc. (Rockville MD), Wako Chemicals USA, Inc. (Richmond VA), Novabiochem and Argonaut Technology.

[0044] Compounds can also be made by methods known to one of ordinary skill in the art. As used herein, "methods known to one of ordinary skill in the art" may be identified though various reference books and databases. Suitable reference books and treatises that detail the synthesis of reactants useful in the preparation of compounds of the present invention, or provide references to articles that describe the preparation, include for example, " Synthetic Organic Chemistry", John Wiley & Sons, Inc., New York; S. R. Sandler et al., " Organic Functional Group Preparations," 2nd Ed., Academic Press, New York, 1983; H. O. House, " Modern Synthetic Reactions", 2nd Ed., W. A. Benjamin, Inc. Menlo Park, Calif. 1972; T. L. Gilchrist, “Heterocyclic Chemistry”, 2nd Ed., John Wiley & Sons, New York, 1992; J. March, “Advanced Organic Chemistry: Reactions, Mechanisms and Structure”, 4th Ed., Wiley-lnterscience, New York, 1992. Specific and analogous reactants may also be identified through the indices of known chemicals prepared by the Chemical Abstract Service of the American Chemical Society, which are available in most public and university libraries, as well as through on-line databases (the American Chemical Society, Washington, D. C., may be contacted for more details). Chemicals that are known but not commercially available in catalogs may be prepared by custom chemical synthesis houses, where many of the standard chemical supply houses (e.g., those listed above) provide custom synthesis services.

[0045] Salts include but are not limited to: Na, K, Ca, Mg, ammonium, tetraalkyl ammonium, aryl and alkyl sulfonates, phosphates, carboxylates, sulfates, Cl, Br, and guanidinium.

[0046] Unless otherwise specified, reference to an atom is meant to include isotopes of that atom. For example, reference to H is meant to include1H,2H (i.e., D) and3H (i.e., T), and reference to C is meant to include12C and all isotopes of carbon (such as13C).

[0047] Pharmaceutically acceptable excipients, such as vehicles, adjuvants, carriers or diluents, are commercially available. Moreover, pharmaceutically acceptable auxiliary substances, such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents and the like, are commercially available. Any compound useful in the methods and compositions of the invention can be provided as a pharmaceutically acceptable base addition salt. " Pharmaceutically acceptable base addition salt" refers to those salts which retain the biological effectiveness and properties of the free acids, which are not biologically or otherwise undesirable. These salts are prepared from addition of an inorganic base or an organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, the sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Preferred inorganic salts are the ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins and the like. Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine.

[0048] Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyidimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides, disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG). Formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.

[0049] The term “sample” with reference to a patient encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom and the progeny thereof. The term also encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents; washed; or enrichment for certain cell populations, such as diseased cells. The definition also includes samples that have been enriched for particular types of molecules, e.g., nucleic acids, polypeptides, etc. The term “biological sample” encompasses a clinical sample, and also includes tissue obtained by surgical resection, tissue obtained by biopsy, cells in culture, cell supernatants, cell lysates, tissue samples, organs, bone marrow, blood, plasma, serum, and the like. A “biological sample” includes a sample obtained from a patient’s diseased cell, e.g., a sample comprising polynucleotides and / or polypeptides that is obtained from a patient’s diseased cell (e.g., a cell lysate or other cell extract comprising polynucleotides and / or polypeptides); and a sample comprising diseased cells from a patient. A biological sample comprising a diseased cell from a patient can also include non-diseased cells. The term “sample” may also mean products from a particular reaction that is further studied.

[0050] " Comparable cell" shall mean a cell whose type is identical to that of another cell to which it is compared. Examples of comparable cells are cells from the same cell line.

[0051] " Inhibiting" the expression of a gene in a cell shall mean either lessening the degree to which the gene is expressed, or preventing such expression entirely. " Specifically inhibit" the expression of a protein shall mean to inhibit that protein's expression (a) more than the expression of any other protein, or (b) more than the expression of all but 10 or fewer other proteins. Inhibiting RNA expression may also refer to RNAthat is not translated, and may be present in a non-biological environment, e.g. RNA expression from a nucleic acid template but not from a gene.

[0052] “Anti-sense nucleic acid” refers to any nucleic acid (for example, DNA, RNA, or LNA) for which the sequence is the reverse complement of a sequence of another nucleic acid in the reaction, whether synthetic, designed, or biological. One common application of "antisense nucleic acid" uses any nucleic acid which, when introduced into a cell, specifically hybridizes to at least a portion of an mRNA in the cell encoding a protein ("target protein") whose expression is to be inhibited, and thereby inhibits the target protein's expression. These and other applications of anti-sense nucleic acids are also discussed herein.

[0053] " Specifically hybridize" to a nucleic acid shall mean, with respect to a first nucleic acid, that the first nucleic acid hybridizes to a second nucleic acid with greater affinity than to any other nucleic acid.

[0054] " Subject" or "patient" shall mean any animal, such as a human, non-human primate, mouse, rat, guinea pig or rabbit.

[0055] " Suitable conditions" shall have a meaning dependent on the context in which this term is used. That is, when used in connection with an antibody, the term shall mean conditions that permit an antibody to bind to its corresponding antigen. When this term is used in connection with nucleic acid hybridization, the term shall mean conditions that permit a nucleic acid or portion of nucleic acid of any length to hybridize to a nucleic acid having a sequence complementary thereto. When used in connection with contacting an agent to a cell, this term shall mean conditions that permit an agent capable of doing so to enter a cell and perform its intended function. In one embodiment, the term "suitable conditions" as used herein means physiological conditions.

[0056] " In combination with", "combination therapy" and "combination products" refer, in certain embodiments, to the concurrent use of a first agent and a second agent. When administered in combination, each component can be used at the same time or sequentially in any order at different points in time. Thus, each component can be used separately but sufficiently closely in time so as to provide the desired effect.

[0057] “Concomitant” use of a first agent with a second agent means use of the agents at such time that both the agents will have an effect. Such concomitant use may involve concurrent (i.e. at the same time), prior, or subsequent use. A person of ordinary skill in the art would have no difficulty determining the appropriate timing, sequence and dosages.

[0058] As used herein, the term “correlates,” or “correlates with,” and like terms, refers to a statistical association between instances of two events, where events include numbers, data sets, and the like. For example, when the events involve numbers, a positive correlation (also referred to herein as a “direct correlation”) means that as one increases, the other increases as well. A negative correlation (also referred to herein as an “inverse correlation”) means that as one increases, the other decreases.

[0059] " Dosage unit" refers to physically discrete units suited as unitary dosages for the particular individual to be treated. Each unit can contain a predetermined quantity of active compound(s) calculated to produce the desired therapeutic effect(s) in association with the required pharmaceutical carrier. The specification for the dosage unit forms can be dictated by (a) the unique characteristics of the active compound(s) and the particular therapeutic effect(s) to be achieved, and (b) the limitations inherent in the art of compounding such active compound(s).

[0060] " Pharmaceutically acceptable excipient "means an excipient that is useful in preparing a pharmaceutical composition that is generally safe, non-toxic, and desirable, and includes excipients that are acceptable for veterinary use as well as for human pharmaceutical use. Such excipients can be solid, liquid, semisolid, or, in the case of an aerosol composition, gaseous.

[0061] The terms "pharmaceutically acceptable", "physiologically tolerable" and grammatical variations thereof, as they refer to compositions, carriers, diluents and reagents, are used interchangeably and represent that the materials are capable of administration to or upon a human without the production of undesirable physiological effects to a degree that would prohibit administration of the composition.

[0062] A "therapeutically effective amount" means the amount that, when administered to a subject for treating a disease, is sufficient to effect treatment for that disease.

[0063] The phrase “determining the treatment efficacy” and variants thereof can include any methods for determining that a treatment is providing a benefit to a subject. The term “treatment efficacy” and variants thereof are generally indicated by alleviation of one or more signs or symptoms associated with the disease and can be readily determined by one skilled in the art. “Treatment efficacy” may also refer to the prevention or amelioration of signs and symptoms of toxicities typically associated with standard or non-standard treatments of a disease. Determination of treatment efficacy is usually indication and disease specific and can include any methods known or available in the art for determining that a treatment is providing a beneficial effect to a patient. For example, evidence of treatment efficacy can include but is not limited to remission of the disease or indication. Further, treatment efficacy can also include general improvements in the overall health of the subject, such as but not limited to enhancement of patient life quality, increase in predicted subject survival rate, decrease in depression or decrease in rate of recurrence of the indication (increase in remission time). (See, e.g., Physicians' Desk Reference (2010).)

[0064] Determining a therapeutically or prophylactically effective amount of an agent can be done based on animal data using routine computational methods. In one embodiment, the therapeutically or prophylactically effective amount contains between about 0.01 mg and about 1 g of agent, e.g. nucleic acid, etc., as applicable. In another embodiment, the effective amount contains between about 1 mg and about 100 mg of agent, as applicable. In a further embodiment, the effective amount contains between about 10 mg and about 50 mg of the agent, as applicable.

[0065] Administering the instant compositions can be effected or performed using any of the various methods and delivery systems known to those skilled in the art. The administering can be performed, for example, intravenously, orally, via implant, transmucosally, transdermally, intramuscularly, intrathecally, and subcutaneously. The following delivery systems, which employ a number of routinely used pharmaceutical carriers, are only representative of the many embodiments envisioned for administering the instant compositions.

[0066] The pharmaceutical compositions are generally formulated as sterile, substantially isotonic and in full compliance with all Good Manufacturing Practice (GMP) regulations of theU. S. Food and Drug Administration. Preferably, a therapeutically effective dose will provide therapeutic benefit without causing substantial toxicity.

[0067] Toxicity of the biomolecules described herein can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., by determining the LD50 (the dose lethal to 50% of the population) or the LD100 (the dose lethal to 100% of the population). The dose ratio between toxic and therapeutic effect is the therapeutic index. The data obtained from these cell culture assays and animal studies can be used in formulating a dosage range that is not toxic for use in human. The dosage of the proteins described herein lies preferably within a range of circulating concentrations that include the effective dose with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See, e.g., Fingl et al., 1975, In: The Pharmacological Basis of Therapeutics, Ch.1).

[0068] DNA-dependent RNA polymerases (RNAPs) are enzymes that catalyze the synthesis of RNA from a DNA template, playing a critical role in gene expression. These polymerases may transcribe genes by unwinding the DNA double helix, reading the template strand, and incorporating ribonucleotides to form RNA complementary to the DNA sequence. In eukaryotic cells, nuclear RNA polymerases (RNA polymerase I, II, and III) are responsible fortranscribing ribosomal RNA (rRNA), messenger RNA (mRNA), and transfer RNA (tRNA), respectively. Additionally, mitochondria possess their own RNA polymerase (mitochondrial RNA polymerase, or mtRNAP).

[0069] Mitochondrial RNA polymerase may be structurally and functionally distinct from nuclear RNAPs, resembling bacterial RNA polymerases and bacteriophage T7 RNA polymerase in its mechanism. Encoded in humans by the nuclear gene POLRMT and in yeast by the nuclear gene Rpo41, mtRNAPs transcribe the mitochondrial genome, producing RNA species essential for mitochondrial protein synthesis and function.Methods

[0070] Methods are provided for synthesis of protected RNA, the method comprising utilizing a DNA dependent RNA polymerase to extend a DNA molecules covalently with RNA chains. DNA sequences serve as primers, and templates to be extended with RNA. The resulting molecules are serial DNA- RNA chains with input DNA on the 5’ end and extended RNA on the 3’ end, where the sequence of the RNA portion is complementary to the input DNA. Such capped RNAs can be produced from a wide variety of DNA sequences comprising a region of complementarity.

[0071] DNA dependent RNA polymerases (RNAP) useful in the methods of the disclosure include a number of single subunit RNAP and certain multi-subunit enzymes. Enzymes of interest include without limitation mitochondrial RNAP, phage RNAP, bacterial RNAP, etc. In some embodiments the RNAP is a mitochondrial enzyme.

[0072] DNA templates for use in the methods of the disclosure provide the sense sequence for the 5’ cap, and anti-sense sequence for the synthesized RNA. The DNA template comprises a free 3’ end. The DNA cap may be any length, including about 5 nt. in length or less, at least about 10 nt, at least about 20 nt, at least about 25 nt, or more.

[0073] In one embodiment the DNA template is a single stranded DNA, comprising an internal region of complementarity of at least 1 nt, 2 nt, or at least 3 or more nt., preferably close to the 3’ end, e.g. within at least about 20 nt of the 3’ end, within at least about 15 nt, within at least about 10 nt., within at least about 5 nt. In other embodiments the DNA template is a gapped or nicked dsDNA, e.g. as shown in FIG. 11 and FIGS. 22-23, where RNA is extended from a free 3’ end of the DNA, e.g. at the gap or nick.

[0074] The RNA sequence is templated by the 3’- 5’ DNA sequence, and therefore the RNA sequence is controlled by the sequence of the DNA template. In some embodiments the DNA template is an anti-sense sequence for a coding sequence of interest, e.g. a protein of interest that may be useful for expression, a protein of interest that may be useful in treatemtns for genetic disaeases or other relevant gene-targeted therapies, or a pathogen or cancer-specific sequence for use in RNA vaccination methods, all of which would be encoded in the resulting DragonRNA. In some embodiments the DNA template includes a ribosome binding site or IRES sequence in order to express such protein coding DragonRNA products. In some embodiments the DNA template is a sense sequence for a sequence of interest for inhibition of translation, where the resulting DragonRNA is an anti-sense inhibitory molecule.

[0075] The synthesis is performed in the presence of suitable NTPs, usually ATP, UTP, CTP and GTP, although in some embodiments a subset may be provided, or one or more modified or non-natural NTPs could be present. In some embodiments, the DragonRNA synthesis is performed in the presence or absence of a promoter sequence. In some embodiments the DragonRNA synthesis is performed in the absence of enzymes such as DNA polymerase, ligase, etc. In some embodiments the synthesis is performed in the absence of free dNTPs. In some embodiments the synthesis is performed in the absence of competing oligonucleotides.

[0076] In an embodiment, a reaction mixture comprises an effective amount of a DNA dependent RNA polymerase as describe herein, a DNA template, and suitable NTPs is incubated at a temperature appropriate for the polymerase, for example and without limitation from about 25°C to about 42°C, for a period of time sufficient to synthesize DNA capped RNA molecules. The RNA molecules are optionally separated from the reaction mixture by anyconvenient methodology, e.g. gel electrophoresis, column chromotagraphy, enzymatic digestion, etc. as known in the art. The resulting RNA species may be substantially pure, e.g. where at least about 50%, 75%, 80%, 90%, 95% or more of the RNA present in a composition is the desired DragonRNA. The resulting RNA may be formulated for various purposes, e.g. may be lyophilized, suspended in a pharmaceutically acceptable excipient, packaged in nanoparticles, liosome, and the like.

[0077] Synthesis may be performed in the presence of bioengineered expression system, for example a system that uses a biosensor to initiate or inhibit expression of a desired DragonRNA, or other such bioengineered systems that promote or curb DragonRNA expression

[0078] This methods and the RNA produced of the disclosure are useful for RNA-based medical applications, therapeutics, and biological research technologies, as the RNA portion of DragonRNA is templated based on the sequence of the input, and the DNA on the 5’ end can provide additional stability and protection from degradation relative to canonical RNA. DragonRNA synthesis activities are useful in biological settings, since the RNA portion can be templated from internal sites in the DNA molecule or from an alternative DNA molecule that contains a coding sequence of interest to generate a desired DragonRNA of desired sequence in both the DNA and the RNA portions.

[0079] In some embodiments the RNA portion of the DragonRNA sequence corresponds to a synthetic RNA or an mRNA of eukaryotic or prokaryotic sequence. In other embodiments the DragonRNA is an antisense nucleic acid. An mRNA may or may not have a cap and / or polyA tail, and a DragonRNA may not have an additional cap beyond the DNA on the 5’ end and may or may not have a polyA tail. A DragonRNA may or may not contain unnatural modified nucleobases. A DragonRNA may be at least 12 nt in length, at least about 15, at least about 20, at least about 25, and may be greater than about 100 nt, 500 nt, 750 nt, 1 kb, 1.5 kb, 2 kb, or larger; the DNA portion of DragonRNA could be as short as 1 nt in length or as long as 2kb or larger; the RNA portion of the DragonRNA could be as short as 1 nt in length or as long as 2kb or larger.Formulations

[0080] Compositions comprising modified RNA comprising a 5’ DNA cap are provided, denoted “DragonRNA,” where the RNA synthesis is performed according to the methods disclosed herein. In some embodiments the composition is formulated with a pharmaceutically acceptable excipient.

[0081] The modified RNA may be mRNA, tRNA, rRNA, viral RNA, or any other form of RNA, such as hnRNA and viroid RNA. A population of capped RNA may comprise at least about10% capped RNA, at least about 30% capped RNA, at least about 50% capped RNA, at least about 75% capped RNA, at least about 90% capped RNA, or more.

[0082] Formulations may be provided in a unit dosage form, where the term "unit dosage form," refers to physically discrete units suitable as unitary dosages for subjects, each unit containing a predetermined quantity of active agent in an amount calculated sufficient to produce the desired effect in association with a pharmaceutically acceptable diluent, carrier or vehicle. The specifications for the unit dosage forms of the present invention depend on the particular complex employed and the effect to be achieved, and the pharmacodynamics associated with each complex in the host. In some embodiments the unit dose is an effective amount for achieving a desired effect, for example, expression of a protein encoded by the capped RNA, anti-sense inhibition by the capped RNA, etc.

[0083] The capped RNA can be formulated with an a pharmaceutically acceptable carrier (one or more organic or inorganic ingredients, natural or synthetic, with which a subject agent is combined to facilitate its application). A suitable carrier includes sterile saline although other aqueous and non-aqueous isotonic sterile solutions and sterile suspensions known to be pharmaceutically acceptable are known to those of ordinary skill in the art.

[0084] The formulation may comprise, depending on the desired use, pharmaceutically- acceptable, non-toxic carriers or diluents, which are defined as vehicles commonly used to formulate pharmaceutical compositions for animal or human administration. The diluent is selected so as not to affect the biological activity of the combination. Examples of such diluents are distilled water, physiological phosphate-buffered saline, Ringer's solutions, dextrose solution, and Hank's solution. In addition, the formulation may also include other carriers, adjuvants, or nontoxic, nontherapeutic, nonimmunogenic stabilizers and the like. In pharmaceutical dosage forms, the capped RNA may be provided in the form of pharmaceutically acceptable salts.

[0085] The capped RNA can be combined with appropriate additives to make tablets, powders, granules or capsules, for example, with conventional additives, such as lactose, mannitol, corn starch or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrators, such as corn starch, potato starch or sodium carboxymethylcellulose; with lubricants, such as talc or magnesium stearate; and if desired, with diluents, buffering agents, moistening agents, preservatives and flavoring agents.

[0086] The pharmaceutically acceptable excipients, such as vehicles, adjuvants, carriers or diluents, are commercially available. Moreover, pharmaceutically acceptable auxiliary substances, such as pH adjusting and buffering agents, tonicity adjusting agents, stabilizers, wetting agents and the like, are commercially available. Any compound useful in the methods and compositions of the invention can be provided as a pharmaceutically acceptable baseaddition salt. " Pharmaceutically acceptable base addition salt" refers to those salts which retain the biological effectiveness and properties of the free acids, which are not biologically or otherwise undesirable. These salts are prepared from addition of an inorganic base or an organic base to the free acid. Salts derived from inorganic bases include, but are not limited to, the sodium, potassium, lithium, ammonium, calcium, magnesium, iron, zinc, copper, manganese, aluminum salts and the like. Preferred inorganic salts are the ammonium, sodium, potassium, calcium, and magnesium salts. Salts derived from organic bases include, but are not limited to, salts of primary, secondary, and tertiary amines, substituted amines including naturally occurring substituted amines, cyclic amines and basic ion exchange resins, such as isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, 2-dimethylaminoethanol, 2-diethylaminoethanol, dicyclohexylamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, methylglucamine, theobromine, purines, piperazine, piperidine, N-ethylpiperidine, polyamine resins and the like. Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline and caffeine.

[0087] Depending on use and on the administration route, the capped RNA may be present in a unit dose at a range of from about 100 ng, 1 μg, 10 μg, 100 μg, 1 mg, 10 mg, 100 mg, 1 g, 10 g, 100 g, etc. Dosages will be appropriately adjusted for the desired use.

[0088] In some embodiments, pharmaceutical compositions can also include large, slowly metabolized macromolecules such as proteins, polysaccharides such as chitosan, polylactic acids, polyglycolic acids and copolymers (such as latex functionalized Sepharose™, agarose, cellulose, and the like), polymeric amino acids, amino acid copolymers, and lipid aggregates (such as oil droplets or liposomes). A carrier may bear the agents in a variety of ways, including covalent bonding either directly or via a linker group, and non-covalent associations. Suitable covalent-bond carriers include proteins such as albumins, peptides, and polysaccharides such as amino dextran, each of which have multiple sites for the attachment of moieties. The nature of the carrier can be either soluble or insoluble for purposes of the invention.

[0089] Acceptable carriers, excipients, or stabilizers are non-toxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid and methionine; preservatives (such as octadecyidimethylbenzyl ammonium chloride; hexamethonium chloride; benzalkonium chloride, benzethonium chloride; phenol, butyl or benzyl alcohol; alkyl parabens such as methyl or propyl paraben; catechol; resorcinol; cyclohexanol; 3-pentanol; and m-cresol); low molecular weight (less than about 10 residues) polypeptides; proteins, such as serum albumin, gelatin, or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone; amino acids such as glycine, glutamine, asparagine, histidine, arginine, or lysine; monosaccharides,disaccharides, and other carbohydrates including glucose, mannose, or dextrins; chelating agents such as EDTA; sugars such as sucrose, mannitol, trehalose or sorbitol; salt-forming counter-ions such as sodium; metal complexes (e.g., Zn-protein complexes); and / or non-ionic surfactants such as TWEEN™, PLURONICS™ or polyethylene glycol (PEG). Formulations to be used for in vivo administration must be sterile. This is readily accomplished by filtration through sterile filtration membranes.

[0090] The active ingredients may also be entrapped in microcapsules prepared, for example, by coacervation techniques or by interfacial polymerization, for example, hydroxymethylcellulose or gelatin-microcapsule and poly-(methylmethacylate) microcapsule, respectively, in colloidal drug delivery systems (for example, liposomes, albumin microspheres, microemulsions, nano-particles, for example lipid nanoparticles, and nanocapsules) or in macroemulsions. Such techniques are disclosed in Remington's Pharmaceutical Sciences 16th edition, Osol, A. Ed. (1980).

[0091] Compositions can be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid vehicles prior to injection can also be prepared. The preparation also can be emulsified or encapsulated in liposomes or micro particles such as polylactide, polyglycolide, or copolymer for enhanced adjuvant effect, as discussed above. Langer, Science 249: 1527, 1990 and Hanes, Advanced Drug Delivery Reviews 28: 97-119, 1997. The agents of this invention can be administered in the form of a depot injection or implant preparation which can be formulated in such a manner as to permit a sustained or pulsatile release of the active ingredient. Such agents could be similarly administered using bioengineered nucleic acid sensors or nucleic acid-protein sensor systems for biologically or physiologically-determined release of DragonRNA, potentially to increase the extended release or to increase the utility or function of the capped RNA. The pharmaceutical compositions are generally formulated as sterile, substantially isotonic and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U. S. Food and Drug Administration.

[0092] Also within the scope of the invention are kits comprising the compositions of the invention and instructions for use. The kit can further contain a least one additional reagent. Kits typically include a label indicating the intended use of the contents of the kit. The term label includes any writing, or recorded material supplied on or with the kit, or which otherwise accompanies the kit.

[0093] As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of theother several embodiments without departing from the scope or spirit of the present invention. Any recited method can be carried out in the order of events recited or in any other order which is logically possible. It is also understood that the terminology used herein is for the purposes of describing particular embodiments

[0094] Although the foregoing invention has been described in some detail by way of illustration and example for purposes of clarity of understanding, it will be readily apparent to one of ordinary skill in the art in light of the teachings of this invention that certain changes and modifications may be made thereto without departing from the spirit or only and is not intended to limit the scope of the present invention which will be limited only by the appended claims.

[0095] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the appended claims.EXPERIMENTAL

[0096] The following examples are put forth so as to provide those of ordinary skill in the art with a complete disclosure and description of howto make and use the present invention, and are not intended to limit the scope of what the inventors regard as their invention nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to numbers used (e.g. amounts, temperature, etc.) but some experimental errors and deviations should be accounted for. Unless indicated otherwise, parts are parts by weight, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric.EXAMPLE 1DragonRNA: Generality of DNA-primed RNA-extension activities by DNA-directed RNA polymerases

[0097] RNA polymerases (RNAPs) transcribe DNA into RNA. Several RNAPs, including from bacteriophages Sp6 and T7, E. coli, and wheat germ, had been shown to add ribonucleotides to DNA 3’ ends. Mitochondria have their own RNAPs (mtRNAPs). Examining reaction products of RNAPs acting on DNA molecules with free 3’ ends, we found yeast and human mtRNAP preparations exhibit a robust activity of extending DNA 3’ ends with ribonucleotides. The resulting molecules are serial DNA— »RNA chains with the input DNA on the 5’ end and extended RNA on the 3’ end. Such chains were produced from a wide variety of DNA oligonucleotide inputs with short complementarity in the sequence to the DNA 3’ end, and the sequence of the RNA portion is complementary to the input DNA. We provide a set offluorescence-based assays for facile detection of such products and show that this activity is a general property of diverse RNAPs, including phage RNAPs and multi-subunit E. coli RNAP. These results support a model in which DNA serves as both primer and template, with extension beginning when the 3’ end of the DNA is elongated with a ribonucleotide. As this DNA^RNA class of molecule remains unnamed, we propose the name DragonRNA.

[0098] The central dogma of molecular biology posits the transcription of DNA into RNA as a fundamental and critical process for gene expression, genetic inheritance, and life (Crick 1970; R. D. Kornberg 2007). Transcription is performed by DNA-directed RNA polymerases (RNAPs), which copy DNA into RNA beginning at promoter sequences (Hurwitz et al. 1961; R. D. Kornberg 2007; Weiss and Gladstone 1959). Several studies have found RNAP from T7 bacteriophage (T7 RNAP) can perform promoter-less DNA-directed transcription (Mu et al.2018; Zaher and Unrau 2004) and RNA-templated RNA synthesis (Jain et al. 2020; Konarska and Sharp 1989; 1990). T7 RNAP can also use individual short RNA oligonucleotides as both primer and RNA template in a single-base extension reaction, in which the RNA input forms a transient loop for the 3’ end to base-pair with a site in the input sequence, priming a single¬ base extension templated by the base upstream from the pairing (Zaher and Unrau 2004). Mitochondria, the organelle that produces and stores energy in eukaryotic cells (Hutton and Boyer 1979), have their own DNA (Nass and Nass 1963), which is transcribed by a nuclear- encoded mitochondrial-specific DNA-directed RNA polymerase (mtRNAP) (Walberg and Clayton 1983). mtRNAPs are single-subunit transcription polymerases very similar in structure to T7 RNAP (Masters, Stohl, and Clayton 1987; Ringel et al. 2011; Arnold et al. 2012). The mtRNAP from slime mold Physarum polycephalum has also been found to perform non- templated single-ribonucleotide extensions on RNA (Miller and Miller 2008). The mitochondrial RNAP from Saccharomyces cerevisiae (Rpo41) (Greenleaf, Kelly, and Lehman 1986) and humans (hmtRNAP) (Arnold et al. 2012) are investigated here.

[0099] In addition to critically providing RNA for mitochondrial functions, mtRNAPs are the potential targets of interventions in cancer (Bonekamp et al. 2020) and antiviral drug toxicity (Feng et al. 2016). hmtRNAP mutations inhibit mitochondrial transcription and cause neurological disease and developmental delays (Olahova et al. 2021). Having discovered and defined a new capability of mtRNAPs provides both previously unavailable tools for directed synthesis of unique nucleic acid chimeras and a platform to undestand the potential for specific biotechnological applications..

[0100] A few studies have shown that RNAPs can covalently link a ribonucleotide to the 3’ end of a DNA molecule. T7 RNAP can add single ribonucleotides to the 3’ end of either an RNA or DNA molecule, which has been posited as an RNA- or DNA-editing mechanism (Sarcar and Miller 2018). In the Sarcar and Miller work (the most recent description of RNA addition to DNA 3’ termini), the authors present a model of an activity that adds singlenucleotides as a potential editing mechanism. RNAPs from bacteriophages T7 and Sp6 have been shown by G. Krupp to use DNA oligonucleotides as primers for RNA synthesis, making hybrid DNA^RNA molecules (also observed with SPβ RNAP (Forrest et al. 2017)). Furthermore, Krupp found that this T7 and Sp6 RNAP activity was robust with several different templates and generated DNA-primed and DNA-templated RNA extension with a “fold-back” structure (Krupp 1989). Multi-subunit RNAPs wheat germ Pol II, in in vitro transcription reactions of SV40 virus (Lewis and Burgess 1980), and E. coli RNAP (Wickner et al. 1972; Van Kreijl, Beelen, and Borst 1977; Forrest et al. 2017), have also been shown to covalently attach a ribonucleotide to the 3’ end of a DNA, often a single-stranded nicked DNA, and extend that 3’ end with an RNA chain. Together, these studies show that some nominally promoterdependent and DNA-directed RNA polymerases, specifically from T7 and Sp6 bacteriophages, E. coli, and wheat germ, can extend the 3’ end of a DNA molecule with ribonucleotides. We here extend the analysis of serial DNA— »RNA hybrids. We show that single subunit mitochondrial RNAPs have robust DNA-primed and DNA-templated RNA extension activities and can be used as models for formation of such DNA-capped RNAs. We also found corroborating results in assays with both phage (T7, Sp6, T3, and Syn5) and multisubunit (E. coli) RNAPs. Sequencing these DNA— > RNA molecules, we showthat the RNA portion istemplated by the DNA input sequence, and that this activity happens in various input configurations, in both cis and trans priming and on double-stranded DNA input with two strands of different lengths and on double-stranded DNA input containing a gap or nick. The previous studies show evidence of adding single ribonucleotides to a DNA strand or adding a string of RNA to a DNA strand, but not evidence of a fully designed product. Our work shows that we can used synthetic DNA strands of designed sequence and length to serve as both primer and template, providing a useful engineering method to generate an entirely designed product, providing utility that is useful in developing an application of this technology. We propose to name these DNA^RNA combination molecules “DragonRNA.” The possibilities raised by DragonRNA are important in designing in vitro transcription reactions, and should be considered in studying the nature of diverse RNA synthesis mechanisms in cells.Results

[0101] Human and yeast mitochondrial RNA polymerases can produce extended molecules from a DNA template in reactions that do not require an RNA primer. In vitro reactions were performed with yeast mtRNAP (Rpo41) and human mtRNAP (hmtRNAP) with a DNA oligonucleotide template and RNA oligonucleotide primer pair based on previously published designs for hmtRNAP assays (G. Lu et al. 2018). The RNA primer included an overhang so that RNA extension products would be 8nt longer than the DNA input, in order to distinguish the RNA extension from the DNA input on the gel assay. These reactions showed newsynthesis, as evident from the appearance of material that migrated more slowly than the starting material. Somewhat to our surprise, the appearance of new material was not dependent on the RNA primer. Further, we observed that the DNA input oligonucleotide band was depleted following the reaction. These phenomena, a higher molecular weight band in reactions with a DNA oligonucleotide and no RNA primer, as well as weakened DNA oligonucleotide input band after the reaction, were replicated across experiments under the same conditions with both Rpo41 and hmtRNAP and with three similar DNA oligonucleotides of different lengths: short 27nt AF-EG-2, medium 37nt AF-EG-3, and long 70nt AF-EG-7 (FIG.1 ). We hypothesized that this product was a serial DNA— > RNA chimera molecule.

[0102] DNA primes RNA extension activity by hmtRNAP and Rpo41. \Ne tested the hypothesis that the product was a DNA-primed, RNA-extended combination molecule using nuclease digestions of the products of the RNAP reactions. The analysis was carried out in mtRNAP reactions on standard DNA oligonucleotides (FIG. 2A), or with 5’ labeled DNA oligonucleotides (FIG. 2B, FIG. 13). DNase digestion showed a near-disappearance of all bands on the gel, as expected for relatively short RNA extensions; we hypothesize that the faint bands that remain from Rpo41 reactions may be RNA, possibly from the 3’ end of the DragonRNA molecule. RNase H and RNase A digestions shift the products to lower sizes, with migrations comparable or slightly slower than the input molecules (compared to FIG. 1 C). The RNase H digestions of the reaction products provide evidence that the DNA^RNA combination molecule forms a structure in which the synthesized RNA is hybridized to the input DNA oligonucleotide (FIG. 2C).

[0103] An additional test for synthesis of DNA-primed, RNA-extended combination molecules used 5’ labeled DNA oligonucleotides in the RNAP reaction (FIG. 2B). In such an assay, we expect that extension on the input oligonucleotide itself would yield a slower-migrating band on the gel. Oligonucleotides were designed with two different 5’ labels (FAM and ATTO633) with the same oligonucleotide sequence as AF-EG-2, and were run in RNAP reactions under the same conditions with hmtRNAP and Rpo41. All of these reactions showed the fluorescent label shifting higher on the gel following the mtRNAP reactions with two different 5’ labels, thus yielding products that were covalently extended beyond the DNA input. Since the reaction conditions only included rNTPs, we hypothesized that the input molecules had been extended with RNA. This hypothesis was further supported by nuclease digestion, with the label bands becoming undetectable following treatment with DNasel digestion and with bands returning to a size near the input DNA oligonucleotide when treated with RNase H and RNase A (FIG. 13). The effect of the RNase H treatment in this assay corroborated that the sequences were hybridized to the DNA molecule (FIG. 13). Based on the inference that the slower-migrating bands represent chimeric 5’ DNA oligonucleotides extended on the 3’ end with RNA (and dragged on the gel), we use the term “DragonRNA” to describe these products.

[0104] Time courses of DragonRNA synthesis by mtRNAPs. To further characterize the activities of mtRNAPs in producing DragonRNA, we performed time courses of hmtRNAP and Rpo41. This hmtRNAP reaction forms one predominant DragonRNA extension band on the input DNA oligonucleotide (FIG. 3A). We found that Rpo41 generates DragonRNA within minutes in these reactions (FIG. 14A), with longer extension products over the course of time (FIG. 3B). The slowest-migrating bands observed in the Rpo41 reactions appear longer than any predicted DragonRNA band would be if the RNA extension was generated via singleround self-templating (FIG. 3B; the longest such band would be twice the length of the input minus 3-5 bases [27*2-(3to5) = 49-51 nt]; we observe bands consistent with single extension to 5’ end close to 50 nt, and multiple longer bands above 70 nt, suggesting a more complex reaction). We also observed bands stained with total nucleic acid stain that lack a FAM fluorescent label that we hypothesize are RNAs de novo-transcribed based on the DNA template (FIG. 14B, 14C).

[0105] RNA sequencing of mtRNAP-generated DragonRNA demonstrates templating on DNA input sequences. VJe had proposed above that the RNA extended on the 3’ end was templated from the DNA input sequences. We then tested this directly using RNA sequencing to understand the RNA generated in these DragonRNA reactions. We sequenced samples of DNA-oligonucleotide-initiated reactions with and without the RNA primer. This entailed dual- end-capture, cDNA synthesis library preparation and sequencing on DNase-treated, purified products from hmtRNAP (hours-scale [3 hour] reaction with AF-EG-7, the longest DNA input tested, with and without the RNA primer), and from Rpo41 (minutes-scale [~1 minute] reaction with AF-EG-2, with and without the RNA primer).

[0106] We utilize the sequencing data to build a picture of the hybrid DragonRNA molecules subject to sequencing. In parsing the DragonRNA sequencing reads from DNasel-digested sequencing data, we note that DNasel digestions of oligonucleotides are notably partial, especially for single-stranded DNA (Laukova et al. 2020) or DNA: RNA hybrids (Sutton et al. 1997). Thus, an expectation was that a fraction of the molecules would remain intact, while others would lack varying portions of the 5’ DNA sequence. We analyzed the sequencing results to determine the sense / antisense composition and to identify the highest-counts species for products that (i) retain the input DNA sequence on the 5’ end, and (ii) where the 5’ sequences may be absent but the read contains a direct match or complementarity to the input DNA sequence. The former group would presumably indicate circumstances where the initial oligonucleotide may have escaped the DNase I, while the latter would indicate molecules that had been trimmed by DNase degradation. We interpret these sequencing reads as examples of products represented amongst the up-shifted material on the gel, while noting that thequantitative representations may not be precise; in particular, it remains possible some DNA^RNA combination molecules would be captured or represented poorly with sequencing.

[0107] The sequencing showed that the “sense” DNA template sequence was followed by antisense sequences from that template with both Rpo41 acting on AF-EG-2 and hmtRNAP acting on AF-EG-7. These results indicated that the mtRNAPs were using the DNA oligonucleotide input as a template for the RNA that was generated. Since the sequencing showed reads with and without the 5’ DNA input, the aggregate data provides an opportunity to examine both DNA and RNA portions of the resulting molecules.

[0108] We visualized sequences filtered by specific length and relatedness to DNA input requirements using AgniAlign (FireLabSoftware Github; AgniAlign does not modify the input sequences, but simply provides a visualization of complementarity for single- or multi-pass polymerase self-priming reaction products) (FIG. 4). The 3’ RNA extensions shown here had regions complementary to the input DNA sequence, consistent with the RNAPs using the DNA as a template when making DragonRNA (hmtRNAP in FIG. 4A, Rpo41 in 4B). When looking at longer sequences, though these were less common, there were sequences that extend the initial product through apparent priming, transient unhybridizing, and repriming, of the original sequence and through potential priming of the RNA product (the latter producing downstream sequences matching the input DNA strand) (FIG. 4B). These longer reads may correspond to the slower-migrating bands on the gel assay, that correspond to sizes longer than would be observed in DragonRNA extension templated to the 5’ end of the input DNA. Interestingly, we also found that both mtRNAPs often added variable numbers (between 2-7 nt) of rAs or rUs to the 3’ end of the DNA input prior to extending the RNA using the input DNA as a template. We hypothesize that this could be due to a stuttering mechanism, in which homopolymer tracks (in this case rAs or rUs) are copied iteratively by the RNAP (alternatively, single bases could be added arbitrarily and potentially edited if they are not accurately templated based on the DNA input).

[0109] DragonRNA synthesis depends on ability for 3’ end of the DNA oligonucleotide to basepair with the sequence. Previous studies of RNAPs have shown that 1 -2 nt of complementarity between the primer and template were sufficient to initiate extension in T7 RNAP, in which both the primer and template were a single input RNA (Zaher and Unrau 2004), and in E. coli RNAP in which the primer was an RNA dinucleotide and a DNA template (Skalenko et al.2021). To test our hypothesis that DragonRNA synthesis depends on priming between the 3’ end of the DNA input oligonucleotide and a complementary site elsewhere in the DNA sequence, we generated input DNA oligonucleotides with different priming capabilities (FIG.5A), ran mtRNAP reactions with these oligonucleotides, and analyzed them via gel electrophoresis. We generated two sets of DNA oligonucleotides, two with a 3’ end predicted to disallow base-pairing, and two with 2-nt additions that allow them to base pair (AF-EG-23has no Gs and cannot self-prime; AF-EG-24 has no Gs and can self-prime; AF-EG-25 has no Ts and cannot self-prime; AF-EG-26 has no Ts and can self-prime). The nucleic acid-stained bands in FIG. 5B that do not appear in the FAM-label-imaging could be direct RNA products without DNA on the 5’ end. Removing complementarity between the 3’ end and internal sequences of the DNA input eliminated extended DragonRNA synthesis in these reactions (oligonucleotides AF-EG-23 and AF-EG-25, FIGS. 5B and 50), although the Rpo41 reaction with AF-EG-23 has a faint and slightly up-shifted FAM-labeled band that may be indicative of occasional base addition (FIG. 5B). These oligonucleotides can be compared to counterparts (AF-EG-24 and AF-EG-26) where the 3’ ends are expected to allow internal priming at two loci each. Both AF-EG-24 and AF-EG-26 show DragonRNA extension activity with Rpo41 (FIG.5B) and hmtRNAP (FIG. 5C). These data support a model in which DragonRNA synthesis depends on the ability of the DNA input oligonucleotide to base pair and prime between the 3’ end and another locus in the sequence, via either looping or priming with another molecule in the DNA input.

[0110] To assess whether there were unusual sequence characteristics of the initially-tested DNA oligonucleotides that allowed DragonRNA synthesis, we tested two additional DNA input oligonucleotides that share overall features with AF-EG-15 but have quite different sequences. One such oligonucleotide was AF-EG-21, where AF-EG-15 has been modified by switching Gs with As and Ts with Cs (FIG. 5A). The other oligonucleotide, AF-EG-22, maintained similar base-proportions as AF-EG-15. Each of the additional oligonucleotides allow some complementarity to the sequence with the two bases at the 3’ end; AF-EG-21 has three such complementary sites to the internal sequence while AF-EG-22’s 3’ end has two. Both AF-EG- 21 and AF-EG-22 generated DragonRNA in in vitro reactions of both Rpo41 and hmtRNAP (FIGS. 5B and 5C). The reaction with AF-EG-21 yielded a strong DragonRNA band that appeared on the gel assay to go to completion, as the input material band was not observed after the reaction with AF-EG-21. We hypothesize that this is due to a more stable terminal loop in AF-EG-21 than AF-EG-15, or due to stronger priming between the 3’ end and the internal site due to the guanine / cytosine base-pairing. As with AF-EG-15, the slowest- migrating band from AF-EG-22 was longer than any that would be made with the initial DNA oligonucleotide as primer and template alone (FIGS. 5B and 5C). These results indicate that the synthesis of DragonRNA by mtRNAPs is a common feature with different single-stranded DNA oligonucleotide inputs.

[0111] Proximity and terminal homology impact priming site choice. To test a set of choices between different priming sites, we designed a family of input DNA oligonucleotides with multiple potential priming sites (FIG. 6A). The oligonucleotides had a maximum of three possible priming sites (AF-EG-62), with a series of variants mutating a combination of priming sites so they could no longer base-pair with the 3’ end of the oligonucleotide. We ran reactionswith each oligonucleotide input using Rpo41 and hmtRNAP. We refer to the 5’-most site Site 1, the middle site Site 2, and the 3’-most site Site 3. Dropping priming Sites 1 and 2 individually and combinatorially did not change or remove the dominant DragonRNA product (FIG. 6B and 6C). In reactions with both Rpo41 (FIG. 6B) and hmtRNAP (FIG. 6C), any variants without Priming Site 3 decreased activity to the levels observed in reactions with the oligonucleotide variant AF-EG-76, which contained no priming site options between the 3’ end and elsewhere in the sequence. Thus, with these input DNA sequences, both RNAPs preferred the 3’-most complementary site to prime DragonRNA extension. Additionally, losing all priming sites weakens the dominant DragonRNA band, but does not always get rid of it, and therefore a lack of priming does not always completely abolish DragonRNA extension activity.

[0112] Assessing cis- and trans- priming events in DragonRNA synthesis. Our results showed that priming between the 3’ end of the input DNA and elsewhere in the sequence was important for the observed DragonRNA synthesis reactions, and we wanted to know whether that priming was intra-molecular (a single DNA molecule looping and priming on itself) or inter- molecular (between two molecules). An oligonucleotide pool design with unspecified bases (a ‘barcode’) near the beginning facilitated this distinction, as we could determine whether the products resulting from DragonRNA synthesis on such templates had a strong tendency for extension bases to match their own barcode. Two such oligonucleotide pools were designed and tested in parallel, each with two unspecified bases toward the beginning of the sequence. With each oligonucleotide pool, we ran reactions with Rpo41 and hmtRNAP, and performed RNA-sequencing on the product. We then analyzed the sequencing to determine which unspecified bases were present in the primer region of the DragonRNA sequencing read, and whether the extended region contained bases complementary to those, and thus templated by the primer, or non-complementary, and thus templated by another oligonucleotide in the reaction. We found that both hmtRNAP and Rpo41 with both templates tested showed DragonRNA extension regions antisense to the region of unspecified bases from the primer oligonucleotide and other oligonucleotides in the reaction, but that templating by the primer oligonucleotide occurred more frequently (consistent with intra-molecular or cis priming) than priming by alternative oligonucleotides’ sequences (consistent with inter-molecular or trans priming) (FIG. 7). This provides strong evidence that priming in cis is the prevalent mode of DragonRNA synthesis in these reactions. A signal consistent with trans priming was seen at a lower level, with the ability of the polymerases to use atrans-priming configuration confirmed below.

[0113] Rpo41 acts rapidly to extend either DNA or RNA termini. DragonRNA synthesis reactions involve two types of nucleoside addition; the first base added to the initial input reflects ribonucleotide addition to a DNA 3’ end chemistry (2’-H, 3’OH), while subsequent additions represent addition of nucleosides to a canonical RNA 3’ end chemistry (2’OH, 3’OH).As the first is a noncanonical activity for a nominally-DNA-dependent RNA polymerase, we considered the possibility that this first addition would be a rare (and potentially rate limiting) event. If this were the case, we would expect that providing a RNA-like 3’ terminus on an otherwise DNA-like input might greatly facilitate the reaction. To test this, we designed a chemically-synthesized DragonRNA oligonucleotide with the same sequence as AF-EG-15, in which the final base was a ribonucleotide adenine instead of a deoxyribonucleotide adenine. Visualization of products from the two templates was facilitated through two-color imaging (DNA terminus: green, RNA-terminus: red, pseudocolored as magenta in FIG. 8). Both templates were extended in three minute reactions with Rpo41, with no evident difference between the two. To observe potential differential usage, we ran reactions with progressively decreasing the Rpo41 concentration, finding comparable extension activities even when the reaction did not go to completion (FIG. 8), Thus we found no evidence that DNA termini form an inferior template for the RNA polymerase.

[0114] Many RNAPs generate DragonRNA with equivalent templates. To test whether DragonRNA synthesis activity was specific to the tested mitochondrial RNAPs or common across a larger class of RNA polymerases, we ran DragonRNA experiments using a number of single-subunit RNAPs with varying degrees of relatedness to mtRNAPs. We generated a phylogenetic tree of the amino acid sequences of these single-subunit RNAPs in order to assess relatedness at the protein level (FIG. 9A, generated using (Sievers et al. 2011; Madeira et al. 2022; Sayers et al. 2021; Minh et al. 2020)). We found that most of the RNAPs tested generated DragonRNA, including RNAPs from bacteriophages T7, T3, Sp6, and Syn5 (FIG. 9B; FIG. 14). We tested the oligonucleotides from FIG. 5A with T7 RNAP as well, and found the results to be similar to hmtRNAP and Rpo41 (FIG. 16). Interestingly, RNAP from bacteriophage KP34 did not generate DragonRNA (FIG. 9B), even after 24h (FIG. 16), despite the ability of this polymerase to synthesize RNA from a double-stranded template under these conditions. It is possible that KP34 RNAP could generate DragonRNA under different conditions, or that DragonRNA synthesis is not an activity inherent to this enzyme, in which case, KP34 could be useful to produce RNA in a population without extension on input DNA, potentially generating a more pure RNA product in some applications.

[0115] Since we had found that many single-subunit RNAPs generate DragonRNA, we tested whether the multi-subunit, cellular E. coli RNAP can generate DragonRNA in vitro. We found that both E. coli holoenzyme and core RNAPs generated DragonRNA with AF-EG-15 (FIG.9C), indicating that this activity is shared by at least one multi-subunit RNAP. We also found that E. coli core RNAP also generated DragonRNA with AF-EG-21 and AF-EG-22 and under “KS conditions,” which have been used for T7 RNAP in vitro transcription reactions (see Methods) (FIG.17C).

[0116] To understand the technical aspects of the DragonRNA synthesis process and its potential impacts in physiology and biotechnology applications, it was of interest to determine how robust DragonRNA synthesis activity was across various of the RNAPs under diverse conditions. We tested different reaction conditions for T7 RNAP, Rpo41, and E. coli core RNAP to assess whether temperature and buffer conditions influenced DragonRNA synthesis activity (See Methods for condition details). Under “Lu conditions” for the buffer with a reaction temperature at 50°C (the highest hypothesized temperature in the mitochondria (Moreno- Loshuertos et al. 2023)), HiT7 (T7 RNAP that is stable at high temperatures) showed a dispersed electrophoretic pattern of DragonRNA, while Rpo41 showed a discrete band of the same size as at 22°C (FIG. 17A). Time courses of T7 RNAP with AF-EG-15 under both “Lu” and “KS” conditions showed synthesis of DragonRNA, and under “KS conditions,” showed more RNA signal on the gel, which is not as strong under “Lu conditions” (FIG. 17B). E. coli core RNAP and Rpo41 showed DragonRNA synthesis under “KS conditions” (FIG. 17C). A set of conditions referred to as “NEPol” (see Methods) that have lower NTP concentration than the other conditions show DragonRNA activity (FIG. 18) and conditions with the addition of NaCI show DragonRNA activity (FIG. 18) for Rpo41 reactions. Overall, these data show that a diversity of conditions allow DragonRNA synthesis activity.

[0117] Assessing T7 RNAP DragonRNA activity with a promoter-containing DNA template. A method for production of defined RNA products with T7 RNA polymerase entails the use of a pair of oligonucleotides of different lengths to generate a partly -double-stranded duplex with a promoter region that then transcribes into a single stranded region from a template (J F Milligan et aL 1987). Such templates also provide a potential starting point for DragonRNA and we assessed the consequences to the input DNA in these reactions, using both the singlestranded sense strand as input as well as the double-stranded promoter-containing template in parallel reactions (FIG. 10A). We ran these reactions with the sense-strand only (AF-EG-16 and AF-EG-18) as well as the annealed promoter-containing, double-stranded template mixtures (AF-EG-16 or 18 annealed to AF-EG-17 as described in the Methods). In addition to the T7-promoter-containing templates, we also ran these reactions with T7 RNAP with a non- T7-promoter-containing double-stranded template (with the T3 promoter instead of the T7 promoter). In these reactions, T7 RNAP produced a DragonRNA band in the sense-strand- only reactions under both “Lu” and “KS” conditions. In the reactions containing a doublestranded template, under “Lu conditions,” or under control conditions with a non-T7 promoter (T3 RNAP promoter), T7 RNAP made a very faint band of DragonRNA and showed a dispersed electrophoretic pattern at approximately the size of the promoter-driven RNA transcript product; under “KS conditions,” T7 RNAP did not make DragonRNA, but made strong bands of the expected, promoter-driven RNA transcript (FIG. 10B). These experimentsraise the possibility that native template characteristics (double-stranded structure and presence of the promoter) are among the conditions that may limit DragonRNA synthesis in the complex environment of a functioning transcription complex. In at least this example, T7 RNAP reactions with a double-stranded, promoter-containing DNA template favored the promoter-driven RNA over DNA extension with RNA (FIG. 10B, Lane 9), but both products can be observed under appropriate conditions (FIG. 10B, Lane 4).

[0118] Molecular modeling of yeast Rpo41 generating a DragonRNA. To visualize the potential mechanism for DragonRNA synthesis, we modeled an Rpo41 complexed with input AF-EG-2 hairpin DNA oligonucleotide and an incoming rNTP. We based our model on the existing cryo-electron microscopy (cryo-EM) structure of an Rpo41 initiation complex with a promoter DNA and a 6-mer RNA primer primer (Goovaerts et al. 2023). Upon this model, we superimposed the 3’-terminal two A-T base pairs of the AF-EG-2 hairpin input DNA to the 3’-RNA / DNA heteroduplex of the cryo-EM structure. We note one particular Arginine residue of interest: in the yeast Rpo41 enzyme, this residue is Arg829; the residue is highly conserved among single-subunit RNAPs, including T7 RNAP (Arg425), and multi-subunit RNA polymerases, including E. coli RNA (Arg352of the p subunit), as well as with the DNA Pol I family (Imburgio, Anikin, and McAllister 2002). The corresponding Arg in T7 RNAP (Arg425) is involved in catalysis and transition from initiation to elongation (Imburgio, Anikin, and McAllister 2002). We model DragonRNA additions and the distance from the building nucleic acid and the Arginine of interest by Rpo41 (FIG. 20A), T7 RNAP (FIG. 20B), and E. coli RNAP P subunit (FIG. 20C). We hypothesize the 2’-OH of the terminal nucleoside in DragonRNA could interact with Arg829and another amino acid, Asp1166(located 7.2 A from the 2’-terminus in the model; FIG. 20A).

[0119] Further modeling (FIG. 21) also suggests that the hairpin DNA input oligonucleotide allows the conformation of the Rpo41 active site to mimic the Rpo41 conformation during the DNA template / RNA hybrid, and thus enables Rpo41 passing the very early stages of de novo RNA synthesis and entering the more stable RNA transcription reaction. Thus, this suggests that the conformation of Rpo41 at the start of DragonRNA synthesis could be more similar to that at the elongation stage of RNA synthesis, making the DragonRNA extension complex more stable and potentially more biochemically similar to RNA elongation than initiation.

[0120] Beyond the specific model of initial nucleotide addition, the structure is instructive in that the modeled DragonRNA occupies the same Rpo41 binding channel for the DNA / RNA heteroduplex in the promoter-containing initiation complex, offering an explanation for how promoter-driven RNA transcription can suppress DragonRNA synthesis.

[0121] DragonRNA activity takes place on double-stranded templates. As our initial DragonRNA reactions used single-stranded DNA oligonucleotides as the input material forDragonRNA reactions, we designed DNA oligonucleotide inputs with double-stranded character to test whether DragonRNA activity takes place on such templates. These designs entailed a set of oligonucleotide systems that consisted of (i) a DNA primer that could not selfprime and (ii) a pairing-capable template with substantial double stranded structure formed either with a hairpin loop or through annealing between the template oligonucleotide and a third oligonucleotide (FIG. 22A). In each case, we annealed the constituent oligonucleotides through heat-cooling prior to running the RNAP reactions. With either DNA oligonucleotide input design, Rpo41 generates DragonRNA templated based on the longer region of the template strand (FIG. 11; FIG. 22). Such products can only be produced by a trans-priming event, and evidence the use of an essentially double stranded template (with an effective nick or gap) as the substrate for the reaction.

[0122] In examining the products of these reactions, we observe that Rpo41 can extend DragonRNA past a region of gap between the primer and double-stranded region of the input material, indicating that Rpo41 is able to displace the non-template strand. Rpo41 extends DragonRNA to varying lengths when the alternative (template) strand’s double-stranded region is from a hairpin loop (FIG. 11 D,11 E), potentially reflecting an ability of the hairpin loop to re-anneal while the Rpo41 is extending the DragonRNA, forming a structure that the Rpo41 must again displace (FIG. 11 B, 11 H). Rpo41 extends DragonRNA to the 5’ end of the input oligonucleotide when the template strand is linear and its double-stranded region is from a third oligonucleotide in the reaction (FIG. 11 F, 11G). This indicates that the Rpo41 displaces the third oligonucleotide from the template strand and, being an independent molecule, it may have less propensity to re-anneal as the Rpo41 is extending the DragonRNA (FIG. 11C, 11 H).

[0123] We characterized the activities of several RNA polymerases in catalyzing a DNA→RNA extension, beginning with a non-canonical reaction in which the 2’deoxy,3’hydroxyl end of the DNA is elongated with a ribonucleotide (FIG. 12B), thus extending the 3’ end of the DNA with RNA. We determined that this activity is common but not ubiquitous across RNAPs, including single-subunit mtRNAPs. These results extend previous findings with single-subunit phage RNAPs (Sarcar and Miller 2018; Krupp 1989), and multisubunit cellular E. coli RNAP (Wickner et al. 1972; Van Kreijl et al. 1977). Our results demonstrate that these activities are shared by additional phage DNA-directed RNA polymerases, from T3 and Syn5, and by mitochondrial RNA polymerases from human and yeast. Analyzing the activities of mitochondrial RNAPs in more detail, we also find that a variety of DNA oligonucleotides can support such reactions, that extension can occur very quickly in varied polymerase reaction conditions, and that the RNA portion of such products are templated in large part by the input DNA sequence. We found that the mitochondrial RNAPs are particularly robust at DNA→RNA covalent extension, and that Rpo41 is able to displace a double-stranded region.

[0124] We have termed the resulting DNA→RNA combination molecule “DragonRNA” to provide clarity and distinction from other RNA / DNA chimeras and hybrids. The priming and initial 3’ rNTP addition are perhaps the most non-canonical aspects of this reaction. We found that the DNA oligonucleotide 3’ end pairs with another site in the input DNA sequence followed by templated extension with ribonucleotides. After addition of the first ribonucleotide to the 3’ end of the DNA chain, the DragonRNA extension reaction shares characteristics with the classic RNA polymerization reaction (Kornberg 2007; Hurwitz et al. 1961; Weiss and Gladstone 1959; Kornberg and Baker 1992; Voet and Voet 2010). Our results indicate that, for each input DNA oligonucleotide, the RNAPs often have one preferred priming site, as indicated by the consistent extension sizes observed in many of the reactions.

[0125] Sequencing allows a precise analysis of where DragonRNA synthesis reactions with the mitochondrial RNA polymerases finish on a DNA template. We find that many DragonRNA molecules terminate at the same point: at the 5’ end of the DNA template. We also found that longer extension reactions generated products that migrated more slowly, including longer nucleotide fragments than would have been possible from a single round of priming-and- templating with input DNA alone (gel bands FIG. 3B, sequencing FIG. 4B). Based on mobility and sequences present, we propose a multi-round repriming with the 3’ end, as diagrammed in FIG. 12. We found that such rounds of transient priming and repriming could be templated either on the same molecule or extended version of the original primer molecule (as exemplified in FIG. 12A), or can also take place via hybridization between two separate oligonucleotides in the reaction, followed by extension one one of them and templated by the other (both exemplified in FIG. 12A). We posit that DragonRNA sequentially serves as a primer and template in these reactions for successive rounds of RNA extension. Similar conclusions on phage polymerases from Sp6 and T7 were drawn by Krupp (Krupp 1989). In both cases, the possibility of more complex reactions such as rolling circle (as proposed in (Krupp 1989)) or rolling hairpin replication resulting from such activities is intriguing.

[0126] Mammalian mtRNAPs may serve as primases in mitochondrial DNA lagging-strand replication, making short RNA primers that are extended with DNA on the 3’ end (Wanrooij et al. 2008). Additionally, ribonucleotides can be incorporated into genomic DNA by DNA polymerases during DNA replication (Nick McElhinny et al. 2010). DragonRNA is the inverse of the intermediate RNA / DNA hybrid molecules formed in the process of DNA replication, in which short RNAs prime Okazaki-fragmented DNA polymerization (Okazaki et al. 1968; Sugimoto et al. 1968; Conaway and Lehman 1982); an intermediate molecule is thus made during DNA replication that builds DNA on the 3’ end of an RNA primer (Yagura et al. 1982; Tseng et al. 1979). The products are temporary RNA— »DNA combination molecules with RNA on the 5’ end and DNA on the 3’ end (Sugimoto et al. 1968; Okazaki et al. 1968; Conaway and Lehman 1982; Yagura et al. 1982; Tseng et al. 1979). Here, we show the inverse, in whichthe in vitro RNA-generated DragonRNA molecules are DNA 5’— > RNA 3’ combination molecules.On potential biological roles of DragonRNA

[0127] An extensive in vivo study to determine whether DragonRNA is synthesized in cells was outside the scope of this study; such analysis will be key to understanding the roles of the DragonRNA synthesis activities we describe across RNAPs. Combined with previous research (Sarcar and Miller 2018; Krupp 1989; Lewis and Burgess 1980; Wickner et al. 1972; Van Kreijl et al. 1977), the work here shows the potential for formation of unusual DNA→RNA chimeras by enzymes present in diverse biological contexts that counter the textbook view of transcription. This work here shows the generality of this capability by numerous RNA polymerases, raising the question of whether such processes have not yet been observed because they are universally suppressed in vivo, or whether they are permitted or active under specific circumstances, or potentially broadly present and have simply been missed.

[0128] Previous studies focused on the basic biology of such extension, rather than the potential utility and testing needed to make an application out of DragonRNA that we included, and thus those studies focused on on a limited number of templates, and each study focusing on one or two related polymerases. Krupp’s and Sarcar and Miller’s works specifically showed this activity on the bacteriophage polymerases (from Sp6 and T7 phages), but not on any cellular polymerases, which Lewis and Burgess showed with wheat germ pol II and Van Kreijl et al and Wickner et al showed with E. coli RNAP. The data provided herein focuses on the generality of the activity across a larger number of RNA polymerases from more diverse sources, including a diverse set of phage polymerases, and organelle and cellular polymerases. These previous studies had observed fortuitous reactions could make DragonRNA, but by testing the generality of this activity across RNAPs, and importantly also describe a polymerase (KP34) that lacks this activity and that thus could have utility in preparing RNA populations without DragonRNA. We were also able to compare RNAP efficiency and specificity in DragonRNA synthesis, through which we identified mtRNAPs as particularly adept at DragonRNA synthesis and found Rpo41 was able to displace a doublestranded region. Krupp’s work showed covalent extension on DNA with a string of ribonucleotides, templated by the DNA, in particular, showed this activity specifically on DNA- primed and DNA-templated extension on the same single-stranded molecule; Sarcar and Miller used similar single stranded single-molecule inputs. Our work introduces a very different input design and analysis, yielding a flexible process sufficient to design DragonRNA of any desired composition and structure. Knowing what makes a successful precursor allows for engineering of Dragon RNA that was not previously evident. Overall, we identified the generality of this activity that had not been previously observed in the literature and honed inon DragonRNA synthesis of RNAPs as a preparative tool to make functional DNA-capped RNA. We determined design characteristics required for such templates to serve as precursors. Our results showed several RNAPs extend DNA with RNA in systems with synthetic DNA primers of different lengths and sequences, and synthetic alternative strand DNA templates. The success of DragonRNA generation in these systems provides for the engineering potential of DragonRNA, to be discussed at length in the next section.

[0129] Mechanisms that might suppress the production of DragonRNA in the cell include ancillary factors that interact with a polymerase to increase specificity (e.g. E. coli DNA ligase has been shown to link 5’ DNA oligonucleotides with the 3’ end of RNA oligonucleotides (Nath and Hurwitz 1974)), a minimization of DNA 3’ ends in cells, complex structures that might engage or protect DNA 3’ ends, competition with canonical DNA polymerases, or yet-to-be- defined conditions that prevent the extension activities. Prevention of such activities could be critical for cells to avoid unwanted side products that would otherwise result in unwanted events at the chromosome level and potential production of inflammatory or damaging products. Free 3’ ends do occur in cells, with examples including the sites of nick- or overhangproducing DNA damage, processes coincident with Okazaki-fragmented DNA replication, viral or mobile element integration involving DNA breaks, or replication strategies that leave transient 3’ ends (e.g., (Okazaki et al. 1968; Sugimoto et al. 1968))..

[0130] Despite the existence of potentially suppressive mechanisms, there remains a possibility that DNA extension with RNA does occur in the cell under specific circumstances- remaining to be identified. Certainly previous and extant methodologies would have often been insufficient to detect the DragonRNA observed in these experiments. Further, DragonRNA could be produced transiently yet still formed, play key roles, and / or represent molecular challenges to cells. RNAs that are primed by a nicked DNA (supported by (Lewis and Burgess 1980)) would perhaps be a component of transcription induced upon DNA damage, allowing an additional functional modality for potential repair and / or expression mechanisms (Frosina and Wood 1990; Salinas-Rios et al. 2011). These processes leave transient single-stranded DNA 3’ ends that may be susceptible to potential mitigation or interference by DragonRNA synthesis. If there are loci in the genome prone to events that yield available single-stranded 3’ ends that can be extended with RNA as a repair mechanism, the resulting DragonRNAs could serve either as a functional marker or productive effector in cell states associated with specific DNA damage. It is further conceivable that there is a class of RNAs that are generated via priming and extension, potentially iteratively. Future in cellulo or in vivo studies could follow up on work of DragonRNA to study these conditions and investigate the presence of DragonRNA in cells.Dragons doing good? Potential for DragonRNA in Biotechnology

[0131] We consider the options for DragonRNA synthesis to be leveraged for technological and therapeutic applications. RNA is extremely useful as a potential regulator of gene expression as well as in biochemical, synthetic biology, and medical applications (Kariko et al.2005; Jackson et al. 2020; Polack et al. 2020; Kent et al. 2024). Despite their remarkable utility, the use of RNAs for genetic, immunological, and potentially therapeutic intervention is often limited by natural mechanisms that degrade incoming RNA in cells and organisms (Kent et al. 2024; Wadhwa et al. 2020), with efficacy and consequence determined by mechanisms including innate immune sensing and response pathways (Kariko et al. 2005). In cells, a diversity of 5’ caps are added to RNAs to protect against degradation, most canonically 7- methylguanosine, but also including a diversity of other caps including adenine-containing cofactors (Bird et al. 2018; Potuznik and Cahova, n.d.). Certain synthetically-introduced 5’ caps on RNAs have similarly shown promise for increased translation and improved stability (Ohno et al. 2023). DragonRNA is effectively 5’ DNA capped RNA. While we don’t know the capabilities of DragonRNA in vivo, such capabilities may include downstream events that provide value (either translation or modulation of gene expression) and for the DNA cap to provide either stability or application-favorable interaction with innate immune mechanisms.

[0132] In considering potential applications of DragonRNA, key questions are whether DragonRNA is active in translation or in hybridization to potential target mRNAs. A translatable DragonRNA (potentially utilizing an internal ribosome entry site (Chen and Sarnow 1995)) can be a useful tool for RNA-based vaccines or therapeutics. If DragonRNA shows promise for such applications, RNAPs may be be engineered to specifically have DragonRNA activity. The mechanistic understanding of DragonRNA synthesis presented here provides an opportunity for further research on non-canonical activity by RNA polymerases and in the mitochondrial transcription systems.

[0133] Important for biotechnology applications, we showed that DragonRNA activity is robust in reactions where the input DNA oligonucleotides are double-stranded, with Rpo41 able to displace a double-stranded region to extend DNA with RNA (FIG. 11 B, C). This result indicates a helicase activity of Rpo41 that would allow for DragonRNA activity on effectively doublestranded templates, including dsDNA templates (e.g. plasmids) in vitro, and cellular environments where DNA is nicked or gapped. Furthermore, this ability of the RNAP could also be a useful synthetic tool, allowing flexibility in the design of molecules synthesized in vitro (e.g. programming defined templates by addition of designed molecules to in vitro transcription reactions) or in vivo (e.g. utilizing targeted nickase activity). This could design a DragonRNA with user-defined DNA and RNA sequences, enabling a variety of applications.Conclusion

[0134] The many non-canonical RNAP activities give interesting insight into the complex nature of biology, the central dogma, the interactions between DNA, RNA, and protein. DragonRNA furthermore lends itself to studies of the transition from the RNA-Protein World to the DNA World governed by the central dogma focused on non-canonical activities of RNA polymerases. Functional RNAs are known with a variety of 5’ structures. E. coli RNAP has been shown to extend various nucleotide and nucleoside derivatives with RNA (Julius and Yuzenkova 2017), and hmtRNAP and Rpo41 have similarly been shown to extend NAD+ and NADH with RNA (Bird et al. 2018), resulting in molecules with a diversity of 5’ chemical structures. Perhaps DragonRNA provides an additional population of 5’ capped RNAs in certain biological contexts, fulfilling roles as either coding or noncoding nucleic acids. Given previous research identifying DNA— »RNA extension, and our findings that this is relatively common across many RNAPs, perhaps some transcriptions entail a priming reaction such as those shown here and previously. This poses questions about RNAPs’ activities, on whether all transcription is truly a de novo process, the RNA / DNA World Hypotheses, and about the evolution of genetic inheritance at the dawn of life.Materials and Methods

[0135] Expression and purification of polymerases. Recombinant Rpo41AN51 with His6tag was expressed and purified with modifications as previously described (Matsunaga, Jang, and Jaehning 2004). E. coli Rosetta (DE3) cells (Millipore Sigma 70954) expressing Rpo41 were resuspended in lysis buffer [50 mM Tris (pH 7.8), 100 mM NaCI, 10% glycerol, 1 mM PMSF, and EDTA-free Pierce™ protease inhibitor tablet (Thermo Fisher A32965)] and sonicated. The lysate was centrifuged at 31,000 ref for 1 hour at 4°C. After centrifugation, the supernatant was incubated with Ni-NTA resin (Qiagen 30210) equilibrated with buffer N [20 mM Tris (pH 7.8), 100 mM NaCI, 10% glycerol, 1 mM PMSF] for 1 hour. Ni-NTA resin was washed with buffer N supplemented with 10 mM imidazole (pH 8.0) and 1 mM p-Mercaptoethanol (BME) and eluted with buffer N containing 250 mM imidazole (pH 8.0) and 1 mM BME. Eluent was concentrated and loaded onto the Superdex 200 size exclusion column (Cytiva) in buffer S [20 mM Tris (pH. 7.8), 1 M NaCI, 10% glycerol, 1 mM EDTA (pH 8.0), 10 mM BME], The peak fractions containing Rpo41 were pooled, concentrated, and aliquoted for storage at -80°C. Protein concentrations were determined based on the absorbance at 280 nm using a NanoDrop spectrophotometer (Thermo Fisher Scientific).

[0136] Recombinant hmtRNAPAN150 with His6tag were cloned into pProEX HTb (Gibco BRL) and transformed into Rosetta (DE3) cells (Millipore Sigma). Cells were grown in LB media to 0.5 OD600, induced with 0.2 mM of isopropyl-p-D-thiogalactoside (IPTG) at 16°C for 18 hours, and harvested at 6,000 ref for 10 min. at 4°C. Cells were resuspended in lysis buffer [25 mM Tris (pH 7.8), 300 mM NaCI, 10 mM BME, and EDTA-free Pierce™ protease inhibitortablet (Thermo Fisher A32965)] and sonicated. High salt buffer [20 mM Tris (pH 7.8) and 5 M NaCI] was added to bring up the final NaCI concentration in the supernatant to 750 mM. After stirring for 5 min., the lysate was centrifuged at 31,000 ref for 45 min. at 4°C. After centrifugation, the supernatant was subjected to PEI precipitation at [0.05%]finaland stirred for 5 min and centrifuged again at 31,000 ref for 45 min. at 4°C. The supernatant was loaded onto Ni-NTA resin (Qiagen), equilibrated with buffer N [20 mM Tris (pH7.8), 500 mM NaCI, 10% glycerol, and 1 mM BME], The resin was then washed with the buffer N containing 750 mM NaCI and eluted with buffer N supplemented with 1 M NaCI and 250 mM imidazole (pH 8.0). Eluent was dialyzed against dialysis buffer [20 mM Tris (pH 7.8), 100 mM NaCI, 10% glycerol, 0.5 mM EDTA (pH 8.0), and 1 mM DTT] for 4 hours and centrifuged at 3,000 ref for 15 min. at 4°C to remove any precipitates. The dialyzed sample was loaded onto a Heparin column and ran on a gradient from 100 mM to 1 M NaCI in buffer H [20 mM Tris (pH 7.8), 10% glycerol, 0.5 mM EDTA (pH 8.0), and 1 mM DTT], Fractions containing hmtRNAP were concentrated and loaded onto Superdex 200 size exclusion column in buffer S [20 mM Tris (pH 7.8), 500 mM NaCI, 10% glycerol, 0.5 mM EDTA (pH 8.0), and 1 mM DTT], Peak fractions containing hmtRNAP were pooled, concentrated, and aliquoted for storage at -80°C. Protein concentrations were determined based on the absorbance at 280 nm using a NanoDrop spectrophotometer (Thermo Fisher Scientific).

[0137] Syn5 and KP34 RNA polymerase sequences were based on the sequences provided in (Zhu et al. 2013) and (X. Lu et al. 2019), respectively. RNAPs were synthesized with an N- terminal Hiss tag. RNAP purifications were performed by Ni-NTA chromatography in 50 mM HEPES KOH pH 7.5, 100 mM NaCI, 10 mM DTT, 0.1% Triton X-100 and stored in 50% glycerol.

[0138] Design of DNA oligonucleotides. \Ne adapted a set of DNA oligonucleotides based on templates, since these templates were used in previous canonical assays for hmtRNAP activity (G. Lu et al. 2018). Each oligonucleotide was synthesized by IDT DNA and DNA oligonucleotides were resuspended in TE pH 8.0, RNA oligonucleotides were resuspended in TE pH 7.4, and all oligonucleotide names, descriptions, and sequences are shown in Table 1. We used an adapted DNA oligonucleotide of three different lengths, with added nucleotides chosen randomly using Python random. choice with similar NTP proportions to the oligonucleotide from (30): short 27nt AF-EG-2 DNA, medium 37nt AF-EG-3 DNA, and long 70nt AF-EG-7 DNA. Some reactions, where noted, also contained a 20nt RNA oligonucleotide, AF-EG-1.

[0139] Following initial results, we designed AF-EG-15, a 5’ FAM-labeled DNA oligonucleotide of AF-EG-2, and made variants with 5’ FAM labels and sequences shown in Table 1. These variants all were 5’-FAM-labeled and included AF-EG-21, in which the Cs and Gs in AF-EG-15 were switched to Ts and As, respectively, and vice versa, to maintain the potential for basepairing within the sequence, while changing the sequence and base-pairing strength. AF-EG- 22 was a DNA oligonucleotide generated using Python random. choice with roughly the same base-proportions as AF-EG-15. AF-EG-30, was an oligonucleotide designed with three potential internal sites at which the two bases on the 3’ end could base-pair.

[0140] Table 1. This table shows all of the oligonucleotides used in this study and their IDs, sequences, and descriptions of their functionName Sequence FunctionA F-EG - 1 AG AACCU G G AACAAA AGE RNA primerAF-EG-2 AGATAATTATTACGTGCTTTTGTTCAA DNA short oligoAF-EG-3 TTGATAGTGGAGATAATTATTACGTGCTTTTGTTCAA E> NA medium oligoAF-EG-7 TTTA TCCTAA AA ACTGGGTTTTGTTA ATTTTGGTTCCGTGTTAA DNA long oligo ACCCATTATTACGTGCTTTTGTTCAA AF-EG-14 / 5ATT0633N / AGATA TTATT CGTGCTTTTGTTCAA Short DNA oligo with ATT0633 5. label AF-EG-15 / 56-FA / AGAT ATTATTACGTGCTTTTGTTCAA Short DNA oligo with FAM 5 _label AF-EG- 16 / 56-FAM / ATCG ATTTAATACGACTCACTATAG T7 promoter-containing short DNA 5.FAM AF-EG-17 AA TTCGAGGGGTAA TCCTCCTCCCCTATAGTGAGTCGTATTA AA T7 promoter-containing antisense DNA TTCGATTAGCTG 3 _AF-EG 18 ATCGAATTTAATACGACTCACTATAG AF-EG-16 without FAM label AF-EG-19 / 56-FAM / ATCG AATTAATTAACCCTCACTAAAG T3 promoter-containing short DNA 5.FAM AF-EG-20 AA TTCGAGGGGTAA TCCTCCTCCCCTTTAGTGAGGGTTAA TTAA T3 promoter-containing short DNA 3 _TTCGATTAGCTG AF-EG-21 / 56-FAM / GAGCGGCCGCCGTACATCCCCACCTGG '■lnverse"short DNA oligo FAM labeled AF-EG-22 / 56-FAM / TTTTACGTCAACGATATAAGTTTTGAC Random short oligo with same NTP proportions as AF-EG-15AF-EG-23 / 56-F M / TCTACACATACTTAAACCAATTACATCC Random oligo with no Gs that can’t primeAF-EG-24 / 56-FAM / TCTACACATACTTAAACCAATTACATCCAA AF-EG-23 with no Gs that can prime AF-EG-25 / 56-FAM / CGACAACAGGCACCGAAACCAAGGCAA Radom oligo with no Ts that can’t prime AF-EG-26 / 56-FAM / CGACAACAGGCACCGAAACCAAGGCAACC AF-EG-25 with no Ts that can prime AF-EG-30 / 56-FA M / GA AGACAGCA TGAGCA ACGTGA CGAA CGTGCA AGCA Oligo with 5 _FAM label and three priming sitesAF-EG-61 / 5FAM / AG ACAATTATTACGAGCACACAACCTAA Version of AF-EG-62 with no site 3 AF-EG-62 / 56-F M / AGACAATTATTACGAGCCATTACCTAA Oligo with 5 _FAM label and three priming sitesAF-EG-63 / 5FAM / AGACAAcaATTACGAGCCATTACCTAA Version of AF-EG-62 with no site 1 AF-EG-64 / 5FAM / AGACAAcaAcaACGAGCCATTACCTAA Version of AF-EG-62 with no sites 1 and 2AF-EG-65 / 5Phos / AGATAATTATT CGTGCTTTTGTTCAA 5. phosphate version of EG-2 to facilitate sequencingAF-EG-66 / 56-FA / TCGTT Short FAM primer for double stranded experimentsAF-EG-67 / 56-FAM / TTCGTGTGTCTGTTGTCGTT Long FAM primer for double stranded experimentsAF-EG-68 GA GA CGAGACAA GA CA CGACACCA CCGA ACGA CA CAGACACAC GA AA CA 6Ci nt template with no Ts, can’t selfCA AGAGACAA prime; to serve as template for AF-EG- 66 and AF-EG-67AF-EG-69 GTCCTCTCTTGTCTCGTCTCACCTGA GA CGAGACAA GA GA GGAC AGAA CCAA Hairpin with 20 base gap template for ACGA GA AGAG CAA CGAC A CA GA CA CA CGA AF-EG-66 and AF-EG-67 AF-EG-70 GTCCTCTCTTGTCTCGTCTCACCTGA GA CGAGACAA. GA GA GGAC ACGA ACGA Hairpin with 3 base gap template for C ACAGACACACGA A AF-EG-66 and AF-EG-67 AF-EG-71 GTCCTCTCTTGTCTCGTCTCACCTGA GA CGAGACAA GA GA GGAC GA ACGA CA Hairpin with 1 base gap template far ACAG CACACGA A AF-EG-66 and AF-EG-67 AF-EG-72 GTCCTCTCTTGTCTCGTCTCACCTGA GA CGAGACAA GA GA GG C AA CGACA Hairpin with 0 base, nick template for CA GA CA C CGAA AF-EG-66 and AF-EG-67 AF-EG-73 / 5Phos / AGANN AT ATTACGTGCTTTTGTTCAA AF-EG-2 with unspecified bases AF-EG-74 / SPhos / TTNNACCTCAACGATATAAGTTTTGAC AF-EG-22 with unspecified bases AF-EG-75 / 5Cy5. / AGATAATTATTACGTGCTTTTGTTCArA DragonRNA with CyS of AF-EG-2 AF-EG-76 / 5FAM / AGACAAcaAcaACCAGCCAcaACCTAA AF-EG-62 with no primingsites AF-EG-77 I 5FAM / AGACAAcaATTACGAC-CCAcaACCTAA AF-EG-62 with no sites 1 and 3 AF-eg-78 / FAM / AGACAATTAcaACGAGCCAcaACCTAA AF-EG-62 with no sites 2 and 3 AF-EG-79 / 5FAM / AGACAATTAcaACGAGCCATTACCTAA AF-EG-62 with no site 2AF-EG-80 GTCTCTGTCTCGTCTGTCACATGA C GA CGAGACAGAGACACGA ACGA CA GA Hairpin loop with 3 base gap for double- C CA CGA strandednessAF-EG-81 GTCTCTCTCTCGTCTGTCACATGA GA GA CGAGACAGAGACAA CG Hairpin loop with 0 base nick for for ACAGAGAGAC double -s tr an d e d n e ss AF-EG-82 GA GA GA CGAGACAGAGACACGA ACGA GA GA GA GA GGA Three-oligo-design template with 3 base gap for for double-strandedness AF-EG-83 GACAGACGAGACAGAGACAACGACAGACACACGA Three-oligo-design with 0 base nick for double-strandednessAF-EG-84 GTCTCTGTGTCGTCTGTC Three-oligo complementary region for generating double-stran edness AF-EG-8S / SPhos / TCGTCTCGTGTGTCTGTCGTT DNA primer for double-stranded system sequencingAF-DG-3 GCCTTGGCACCCGAGAATTCCA RT primer DruSeqAF DC-4 AA TGATACGGCGACCA CCGA GA TCTA GA CGTTCA GA GTTGTA GA GTGCGA Universal PGR primer DruSeq AF-DG-35 / 5Phos / TGGAATTCTCGGGTGCCAAGG / 3ddG / 3. adapter DruSeqAF DG-36 rGrUrUrCrA rGrA rGrUrUrCrUrA rCrA rGrUrCrCrGrA rC rGrArUrC 5.adapter DruSeqAF DG 37 rGrA rA rUrUrCrCrA rCrCrA rCrGrUrUrCrCrCrGrUrGrG STP oligo

[0141] We designed oligonucleotides containing the promoter sequence for RNAPs from bacteriophages T7 (John F. Milligan et al. 1987; Morris, Klement, and McAllister 1986) and T3 (Morris, Klement, and McAllister 1986), based on oligonucleotides adapted from (John F. Milligan et al. 1987).

[0142] To test requirements for priming conditions between the 3’ end and other locations on the sequence, we made two sets of two 5’ FAM-labeled DNA oligonucleotides (AF-EG- 23 and 24 had no Gs; AF-EG-25 and 26 had no Ts); each pair has one design predicted to prime via base-pairing between the two bases on the 3’ end and another location in the sequence and one design where no such priming is predicted. To test requirements or preferences for priming location, we produced a series of 5’FAM-labeled DNA oligonucleotides, including an oligonucleotide that contained three potential priming sites (AF-EG-62), and variations of AF- EG-62 without each priming site and each combination of priming sites (AF-EG-61,63,64,76- 79).

[0143] For experiments where we sought to characterize the pool of products by sequencing without DNAse treatment, we designed oligonucleotides containing 5’-phosphate to facilitate and focus an initial 5’ end capture. We designed AF-EG-65 with the sequence of AF-EG-2, and oligonucleotides AF-EG-73 and 74 containing unspecified bases to test intra versus inter molecular priming. We also designed 5’-phosphate AF-EG-85 as a primer to test the impact of double-stranded templates on DragonRNA activity and used templates of a single molecule with a hairpin loop containing a 0-base nick (AF-EG-81) and 3-base gap (AF-EG-80), and linear versions of this system with a third oligonucleotide providing double-strandedness (AF- EG-84) and templates containing a 0-base nick (AF-EG-83) and a 3-base gap (AF-EG-82). For oligonucleotides in a double-stranded DNA system for fluorescence gel assays, we designed two 5’-FAM labeled DNA primers: AF-EG-66, a 5 nt DNA primer, and AF-EG-67, a 20-nt DNA primer. We designed templates for these 5’ FAM labeled DNA primers: AF-EG-68, a template that could not self-prime, and designed AF-EG-69 to AF-EG-72, template oligonucleotides with hairpin loops and double-stranded regions with gaps of 20 nt, 3 nt, 1 nt, and a 0 nt nick between the 3’ end of the primer and the start of the double-stranded region.

[0144] Oligonucleotide hybridization. Some reactions were run containing an RNA oligonucleotide, AF-EG-1, as well as the DNA oligonucleotide, to serve as a DNA-templated RNA extension reaction. These RNA / DNA oligonucleotide complexes were annealed using 8pM of the RNA oligonucleotide and 80pM of the DNA oligonucleotide in 50mM NaCI, heated to 95°C for 10 minutes, ramped down 4.5% per minute to 20°C to anneal, followed by a 4°C hold. We also performed this heat-cool process on the DNA-oligonucleotide-only and RNA- oligonucleotide-only conditions for the parallel reactions in those experiments. For these reactions, the annealed DNA / RNA oligonucleotides were added to the RNAP reaction at 200nM.

[0145] For reactions with a double-stranded, promoter-containing DNA templates (AF-EG-16 to AF-EG-20), and for the fluorescence assay with a double-stranded DNA system (AF-EG- 66 to AF-EG-72), oligonucleotides were annealed following the same protocol, except that equal amounts of each strand were used, and the annealed product was added to the RNAP reaction at 1.25pM.

[0146] For reactions with a double-stranded DNA system used for sequencing, oligonucleotides were annealed following the same protocol, except that these oligonucleotide complexes were annealed using 25pM of the DNA primer AF-EG-85 and 50pM of the template (which may be AF-EG-80, 81, 83, or 83), and in the versions with three oligonucleotides, 25pM AF-EG-84 was included in the same annealing reaction. The annealed product was added to the RNAP reaction at 2.5pM.

[0147] In vitro mtRNAP assays with DNA oligonucleotides. We performed in vitro assays with hmtRNAP from human and Rpo41 from yeast using three conditions to confirm activity. One condition was similar to those from, denoted as “Lu conditions.” Lu reaction buffer was made up of 5mM Tris-HCI, pH 7.5, 10mM DTT, 20mM MgCl2, 0.1% Triton X-100, 10% glycerol, 75ug / ml Kanamycin, and 4mM each rNTPs. These reactions were run at 22°C (30). The other condition was denoted “KS conditions,” and these reactions were run under conditions typical to T7 RNAP in vitro reactions. KS reaction buffer was made up of 40mM Tris-HCI, pH 8.0, 80mg / mL polyethylene glycol (PEG) 8000, 20mM MgCl2, 0.01% Triton X-100, 1 mM spermidine, 5mM DTT, and 4mM each rNTPs, and these reactions were run at 37°C (Jain et al. 2020). The final condition, denoted as “NEPol,” followed the NEB protocol for RNA synthesis (NEB cat# M0251), which used a buffer containing 40mM Tris-HCI pH 7.9, 6mM MgCl2, 1 mM DTT, 2mM spermidine, and 0.5mM each rNTPs, and reactions were run at 37°C. Rpo41 and hmtRNAP showed different activities, as evidenced by hmtRNAP generating DragonRNA on a slower time scale than Rpo41. We found that their activities were more similar under different reaction conditions using “NEPol” conditions and a 37°C reaction (FIG.15).

[0148] Except in hybridized reactions as described above, 2.5pM of the specified DNA oligonucleotide was added to each reaction. Reactions were activated by addition of RNAP, with amount given per 10uL reaction (3.26µg Rpo41NΔ51, 3.75µg hmtRNAPNΔ150, 2 pg T7 RNAP, 5 pg Sp6 RNAP, 0.4pg KP34 RNAP, 2pg Syn5 RNAP, 4pg E. coli holoenzyme, 3.5pg E. coli RNAP, core enzyme).

[0149] These reactions were run for the indicated time and quenched with equal volume of a quench buffer containing 100mM EDTA, pH 8.0, and 0.4% SDS. Following quench, the crude products were mixed with 75% v / v Gel Loading Buffer II (Ambion AM8547), the mixture heated to 95°C for 5 minutes, and run on a pre-run 10% or 15% TBE-Urea gel (Novex 10% EC6875BOX, 15% EC6885BOX). Gel percentages are noted with each figure, and we note that the 15% TBE-Urea gels was generally preferred in later experiments as we observed that the separation was clearer between the slower migrating bands and the input DNA oligonucleotides. Gels were stained with either SyBr Gold (Invitrogen S11494) or Helixyte Gold (AAT Bio 17595), which are chemically equivalent, to visualize nucleic acids by diluting 1:10,000 in TBE and incubating at room temperature for 15 minutes. Gels were imaged on Typhoon FLA 9500 (except figures with the black background, Figures 1B and S3A, imaged on the Alphaimager) and color-edited and contrast-enhanced using Imaged. Note that FAM- labeled oligonucleotides appeared on the gel slightly higher up than expected based on ladder migration.

[0150] Purification of nucleic acid reaction products from RNAP reactions containing DNA oligonucleotides. RNA from the Rpo41 and hmtRNAP in vitro reactions used for nuclease digestions and for sequencing (Figures 2, 4, 7, and 11), were extracted using saturated phenol chloroform (1:1 v / v) followed by ethanol precipitation. Quenched reaction samples were diluted in a solution of 1M ammonium acetate, 10mM EDTA pH 8.0, 0.2% SDS, and 2pL per sample of Glycoblue (Thermo Fisher AM9516). This was mixed with equal volume 1:1 phenol chloroform, then centrifuged for 5 minutes at room temperature at 16,000g in pre-spun (30s, 16,000g) Heavy Phase Lock tubes (QuantaBio 2302830). The supernatant was mixed with equal volume chloroform and then centrifuged in the Phase Lock tubes (5min, room temperature, 16,000g). The aqueous phase was then transferred to clean siliconized tubes and mixed with three-times volume molecular-grade ethanol and incubated at -80°C for at least 16 hours. The reactions were then spun at 4°C at max speed for at least 1 hour followed by aspiration of the alcohol solution, washed with 80% ethanol, and dried prior to resuspension in TE pH 7.4.

[0151] Nuclease digestions of RNAP in vitro reaction products. Purified reaction products from the DNA-oligonucleotide-containing RNAP reactions were nuclease-digested with Turbo DNase (Invitrogen AM2238), RNase H (Epicentre H39500), and RNase A (NEB T3018-2). The Turbo DNase digestion was carried out using the provided buffer. RNase H digestion wascarried out using a buffer containing 500mM Tris-HCl, 1M NaCl, and 200mM MgCl2. To avoid potential contamination with RNase A, reactions with Turbo DNase and RNase H were set up in parallel and put in the PCR machine, and all reagents returned to the freezer prior to the tube of RNase A being taken out of the freezer. RNase A digestions were run with rCutSmart buffer (NEB B6004S). Digestions were run in parallel for 1 hour at 37°C, followed by phenol:chloroform extraction and ethanol precipitation as provided above. Turbo DNase and RNase H purifications were performed in parallel, while RNase A reactions and purifications were performed after and independently to avoid RNase A contamination to the other samples. Digested-and-purified samples were mixed with 75% v / v Gel Loading Buffer II (Ambion), heated to 95°C for 5 minutes, and run on a pre-run 10% TBE-Urea gel (Novex). Gels were imaged on Typhoon FLA 9500 and color-edited and contrast-enhanced using Imaged. All nuclease digestions and corresponding gels were run in parallel with controls containing DNA and RNA oligonucleotides to confirm that each nuclease specifically digested the expected nucleic acid.

[0152] Sequencing of hmtRNAP and Rpo41 DragonRNA. Prior to sequencing, the in vitro mtRNAP reaction products were purified using saturated phenokchloroform extraction followed by ethanol precipitation as described above. The products from hmtRNAP reaction with AF-EG-7 and Rpo41 reaction with AF-EG-2 were digested with DNase I (NEB M0303) in effort to remove remaining input DNA oligonucleotides, and purified using phenokchloroform extraction and ethanol precipitation prior to library preparation (Figure 4). As the DNAse step has the downside of removing input DNA sequences, we confirm their presence using a parallel strategy for library construction where DNase treatment was omitted to allow a somewhat smaller number of molecules to be sequenced completely from the 5’ end (SRA BioProject ID: PRJNA1117892). For sequencing experiments in Figures 7 and 11, we did not perform DNase digestion on the DragonRNA products prior to sequencing.

[0153] For RNA-sequencing of DragonRNA, we used a derivative of the TruSeq Small RNA sequencing protocol from Illumina (RS-200-0012), which utilizes adapter ligation (we call this protocol DruSeq for_derivitized TruSeq). DruSeq utilized adapters and primers designed and adenylated in-house, and the addition of 20% polyethylene glycol (PEG) in the ligation steps, as has been shown to improve adapter ligation and reduce bias (Kim et al. 2019).

[0154] Oligo preparations: The 3’ adapter, AF-DG-35 was adenylated using the 5’ DNA adenylation kit (NEB E2610) according to manufacturer’s protocol. The adenylation reaction was purified with the Oligo Clean & Concentrator-5 (Zymo Research D4060) following manufacturer’s protocol, with two additional steps: (1) the spin column was spun empty prior to elution to remove wash buffer and (2) the wash step was repeated for a total of two washes.

[0155] 3’ adapter ligation: Sample RNA was mixed with 10ng / pL final concentration adenylated adapter AF-DG-35 to a total volume of 2pL and heated to 70°C for 2 minutes and cooled on ice. Then, 3pL total volume made up of 0.5pL T4 RNA Ligase 2, truncated K227Q (NEB M0373), 1X final concentration T4 RNA Ligase Buffer (NEB M0373), and 20% final concentration PEG-8000 was added to the RNA-adapter mix. The reaction was incubated at 25°C for 1 hour, after which 0.5pL STR oligonucleotide (AF-DG-37) was added to a final concentration of 1.8pM, followed by incubation at 25°C for 15 minutes.

[0156] 5' adapter ligation: The 5’ adapter (AF-DG-36) was heated at 70°C for 2 minutes and cooled on ice. Then, 0.5pL of 20pM AF-DG-36 (1.4pM final concentration), 0.5pL T4 RNA Ligase 1 (NEB M0204), 1X final concentration T4 RNA Ligase Buffer (NEB M0204), 1mM final concentration ATP, and 16.3% final concentration PEG-8000 were added to the reaction mix and incubated for 1 hour at 25°C. The total volume of the reaction was 7pL.

[0157] Reverse transcription (RT): 6pL of ligation reaction mix was transferred to a new tube and 1 pL of RT Primer (AF-DG-3 at 4pM stock concentration) was added, and the mixture was heated to 70°C for 2 minutes and cooled on ice. 5.5pL RT reaction buffer containing 1 pL SuperScript II (Thermo Fisher 18064014), 1X final concentration First Strand Buffer (Thermo Fisher 18064014), 500pM final concentration dNTPs, and 8mM final concentration DTT was added to the ligated RNA-RT primer mix, and the reaction was incubated at 50°C for 1 hour.

[0158] PCR amplification: PCR amplification of the ligated, reverse-transcribed libraries was performed using NEBNext High Fidelity PCR kit (NEB M0541L). Briefly, 1X NEBNext High Fidelity PCR Master Mix was mixed with 300nM Universal Primer (AF-DG-4), and 300nM indexing primer from TruSeq Small RNA Library Preparation Kit (Illumina RS-200-0012). PCR was initiated at 98°C for 30 seconds for initial denaturation, followed by 16 cycles of 98°C for 10 seconds, 60°C for 30 seconds, and 72°C for 15 seconds, followed by final extension at 72°C for 15 minutes and 4°C hold.

[0159] Gel purification: Amplified libraries were separated on a 2% agarose gel and DNA in the range -122-200 nt was excised with a razor blade. Gel pieces were purified using Qiagen QiaQuick Gel Extraction kit (Qiagen 28704) according to manufacturer’s protocol.

[0160] Sequencing: Purified libraries were pooled, denatured with sodium hydroxide, and 12pM was loaded on Illumina MiSeq v3 with 150 cycles, single-end reads.

[0161] Bioinformatics. Sequencing data of DragonRNA reactions were analyzed using a k- mer counting algorithm, DragonMostCommon, to generate the highest-counts reads filtered to contain the input DNA sequence on the 5’ end and complementary sequences on the 3’ end. Note that there were numerous other structures present in the data with different starts, lengths, and configurations of homology to the input not shown in the text. Potential parsimony priming and base-pairing structure of reads were modeled using AgniAlign. AgniAlign can be found on the.. FireLabSoftware Github and the code for DragonMostCommon. Sequencingdata of DragonRNA reactions with unspecified bases to determine inter- versus intramolecular priming were analyzed using a matching algorithm NNcomplementarity and was visualized (with coding suggestions from ChatGPT) using matplotlib and seaborn. Sequencing data of DragonRNA reactions with double-stranded input to determine how robust DragonRNA extension is on DNA primers annealed to a double-stranded template were analyzed using an algorithm to determine lengths of extension dsDragonExtension and was visualized (with help from ChatGPT) using matplotlib and seaborn. Code has been deposited.Significance of non-canonical mtRNAP studies

[0162] The studies described herein provide insight into behaviors of mitochondrial RNA polymerases that counter the textbook model of transcription, and demonstrate alternative synthesis activities that provide insight about transcription. This work provides evidence that some RNA synthesis activity may require nucleic acid priming, potentially revealing that perhaps not all transcription is a de novo process. These findings provide further insight into the roles and behaviors of RNA.

[0163] RNA is extremely useful as a potential regulator of gene expression as well as in biochemical, synthetic biology, and medical applications in order to promote translation of relevant proteins, including for recent vaccine development. Despite their remarkable utility, the use of RNAs for genetic, immunological, and potentially therapeutic intervention is often limited by natural mechanisms that degrade RNA in vivo. Scattered reports have described some ability of individual RNA polymerases (RNAPs) to extend DNA chains, specifically phage RNAPs (Krupp 1989; Sarcar and Miller 2018), E. coli RNAP (Wickner et al. 1972; van Kreijl et al. 1977), and wheat germ Pol II (Lewis and Burgess 1980). The DragonRNA work identified and characterized an RNA extension activity on DNA oligonucleotides by many RNAPs, generating a DNA-capped RNA, which we termed DragonRNA. We found that the RNA portion of DragonRNA is templated by the DNA input sequence. DragonRNA is a useful tool to synthesize functionally stable RNAs that are resistant to degradation, thus allowing for longer persistence of RNA in cells. DragonRNA synthesis can be leveraged for technological and therapeutic applications, and RNAPs can be engineered to control for or against desired synthesis applications.

[0164] The conclusions from these studies give an opportunity for further research on non- canonical activity by RNA polymerases and in the mitochondrial transcription systems. We ran in vitro mtRNAP reactions with a given template and observed insertions of adenine in between the DNA input and the RNA extension. Nickase experiments into known loci in mitochondrial DNA, either in reactions containing mitochondrial transcription factors including mtRNAPs, or in organelle or in cellulo experiments, can be performed in order to generate free 3’ ends on one strand, and assess if ribonucleotides or RNA chains are incorporated priorto or during DNA repair. Previous research has identified and confirmed inhibitors of mitochondrial transcription, and found promising results for such inhibition as a potential candidate for a non-toxic cancer therapy (Bonekamp et al., 2020), indicating even broader impacts of research of mtRNAP activity.

[0165] To determine the functional applications of DragonRNA, studies could show whether DragonRNA is active in producing protein or in carrying out other RNA tasks including protein synthesis-related and inhibitory-related (e.g. RNAi, siRNA, and CRISPR), to determine its suitabil- ity in standard delivery systems and to determine under what circumstances these molecules con- tribute to or modulate immunogenicity. Control mechanisms for DragonRNA synthesis may be engineered, including terminator sequences or chemical modifications at the desired stopping point or 5’ end of the DNA template to stop the serial nature of continuing to extend the RNA portion past the first round of DragonRNA synthesis, in order to fully control the DragonRNA product sequence and length. Encoding a terminator sequence or the introduction of a chemical modification may be sufficient to control the length of a DragonRNA product; or a cleavage system may be introduced, or a stop codon introduced to ensure potential protein translation does not continue serially along a longer DragonRNA chain.

[0166] A genetically-regulated detection mechanism for DragonRNA translation of desired proteins under certain conditions can be engineered to use DragonRNA as a therapeutic for patients with loss-of-protein-based diseases. If DragonRNA is translated, this makes a useful tool for RNA-based therapeutics.

[0167] The inhibitory potential of DragonRNA for biotechnology or biomedical applications can be tested, e.g. whether DragonRNA hybridizes to an mRNA and thus can inhibit translation.

[0168] DragonRNA poses a potential improvement to existing mRNA vaccines and technologies that are used to promote protein production that primes the body’s defenses against diseases, because the mRNA in vaccines is degraded by the body relatively quickly, and we hypothesize DragonRNA may have an ability to persist for longer because it would be less susceptible to degradation by traditional RNases and exonucleases due to the DNA chain on the 5’ end.

[0169] Table 2. Table of sequencing sense / antisense counts resultshmtRNAP - hmtRNAP O h 464 76.32% 144 105379 Oh- vlongtemp noprimer hmtRNAP- hmtRNAP 3 h 568830 68.01% 267522 31.99% 1 269834 3h- vlongtemp- noprimer hmtRNAP- hmtRNAP 1 025154 68 320 6.25% 2093382 3h-vlongtemp-wprimerRpo41- Rpo41 I min AF-EG-2 No 461935 84,15% 86959 15,84% 1174655 1min- shorttemp- noprimerRpo41- Rpo41 I min AF-EG-2 Yes 410819 89.99% 45 660 10.00% 859579 1min- shorttemp- wprimerReferences

[0170] Arnold, Jamie J., Eric D. Smidansky, Ibrahim M. Moustafa, and Craig E. Cameron. 2012. “Human Mitochondrial RNA Polymerase: Structure-Function, Mechanism and Inhibition.” Biochimica et Biophysica Acta (BBA) - Gene Regulatory Mechanisms, Mitochondrial Gene Expression, vol. 1819 (9): 948-60.

[0171] Bird, Jeremy G, Urmimala Basu, David Kuster, et al. 2018. “Highly Efficient 5’ Capping of Mitochondrial RNA with NAD+ and NADH by Yeast and Human Mitochondrial RNA Polymerase.” eLife 7 (December): e42179.

[0172] Bonekamp, Nina A., Bradley Peter, Hauke S. Hillen, et al. 2020. “Small-Molecule Inhibitors of Human Mitochondrial DNA Transcription.” Nature 588 (7839): 7839.

[0173] Chen, Chang-you, and Peter Sarnow. 1995. “Initiation of Protein Synthesis by the Eukaryotic Translational Apparatus on Circular RNAs.” Science 268 (5209): 415-17.

[0174] Conaway, R C, and I R Lehman. 1982. “A DNA Primase Activity Associated with DNA Polymerase Alpha from Drosophila Melanogaster Embryos.” Proceedings of the National Academy of Sciences of the United States of America 79 (8): 2523-27.

[0175] Crick, Francis. 1970. “Central Dogma of Molecular Biology.” Nature 227 (5258): 5258.

[0176] Feng, Joy Y., Yili Xu, Ona Barauskas, et al. 2016. “Role of Mitochondrial RNA Polymerase in the Toxicity of Nucleotide Inhibitors of Hepatitis C Virus.” Antimicrobial Agents and Chemotherapy 60 (2): 806-17.

[0177] Forrest, David, Katherine James, Yulia Yuzenkova, and Nikolay Zenkin. 2017. “Single- Peptide DNA-Dependent RNA Polymerase Homologous to Multi-Subunit RNA Polymerase.” Nature Communications 8 (1): 15774.

[0178] Frosina, Guido, and Richard D. Wood. 1990. “Influence of RNA Synthesis on DNA- Repair Replication in Human Cell Extracts.” Mutation Research Letters 244 (4): 287-93.

[0179] Goovaerts, Quinten, Jiayu Shen, Brent De Wijngaert, Urmimala Basu, Smita S. Patel, and Kalyan Das. 2023. “Structures Illustrate Step-by-Step Mitochondrial Transcription Initiation.” Nature 622 (7984): 872-79.

[0180] Greenleaf, A L, J L Kelly, and I R Lehman. 1986. “Yeast RPO41 Gene Product Is Required for Transcription and Maintenance of the Mitochondrial Genome.” Proceedings of the National Academy of Sciences of the United States of America 83 ( 10): 3391 -94.

[0181] Hurwitz, Jerard, J. J. Furth, Monika Anders, P. J. Ortiz, and J. T. August. 1961. “The Enzymatic Incorporation of Ribonucleotides into RNA and the Role of DNA.” Cold Spring Harbor Symposia on Quantitative Biology 26 (January): 91-100.

[0182] Hutton, R. L., and P. D. Boyer. 1979. “Subunit Interaction during Catalysis. Alternating Site Cooperativity of Mitochondrial Adenosine Triphosphatase.” Journal of Biological Chemistry 254 (20): 9990-93.

[0183] Imburgio, Diane, Michael Anikin, and William T. McAllister. 2002. “Effects of Substitutions in a Conserved DX2GR Sequence Motif, Found in Many DNA-Dependent Nucleotide Polymerases, on Transcription by T7 RNA Polymerase.” Journal of Molecular Biology 319 (1): 37-51.

[0184] Jackson, Lisa A., Evan J. Anderson, Nadine G. Rouphael, et al. 2020. “An mRNA Vaccine against SARS-CoV-2 — Preliminary Report.” New England Journal of Medicine 383 (20): 1920-31.

[0185] Jain, Nimit, Lucas R. Blauch, Michal R. Szymanski, et al. 2020. “Transcription Polymerase-Catalyzed Emergence of Novel RNA Replicons.” Science (New York, N. Y.) 368 (6487).

[0186] Julius, Christina, and Yulia Yuzenkova. 2017. “Bacterial RNA Polymerase Caps RNA with Various Cofactors and Cell Wall Precursors.” Nucleic Acids Research 45 (14): 8282-90.

[0187] Kariko, Katalin, Michael Buckstein, Houping Ni, and Drew Weissman. 2005. “Suppression of RNA Recognition by Toll-like Receptors: The Impact of Nucleoside Modification and the Evolutionary Origin of RNA.” Immunity 23 (2): 165-75.

[0188] Kent, Stephen J., Shiyao Li, Thakshila H. Amarasena, et al. 2024. “Blood Distribution of SARS-CoV-2 Lipid Nanoparticle mRNA Vaccine in Humans.” ACS Nano 18 (39): 27077- 89.

[0189] Kim, Haedong, Jimi Kim, Kijun Kim, Hyeshik Chang, Kwontae You, and V Narry Kim.2019. “Bias-Minimized Quantification of microRNA Reveals Widespread Alternative Processing and 3' End Modification.” Nucleic Acids Research 47 (5): 2630-40.

[0190] Konarska, Maria M., and Phillip A. Sharp. 1989. “Replication of RNA by the DNA- Dependent RNA Polymerase of Phage T7.” Cell 57 (3): 423-31.

[0191] Konarska, Maria M., and Phillip A. Sharp. 1990. “Structure of RNAs Replicated by the DNA-Dependent T7 RNA Polymerase.” Cell 63 (3): 609-18.

[0192] Kornberg, Arthur, and Tania A. Baker. 1992. DNA Replication. W. H. Freeman.

[0193] Kornberg, Roger D. 2007. “The Molecular Basis of Eukaryotic Transcription.” Proceedings of the National Academy of Sciences 104 (32): 12955-61.

[0194] Krupp, Guido. 1989. “Unusual Promoter-Independent Transcription Reactions with Bacteriophage RNA Polymerases.” Nucleic Acids Research 17 (8): 3023-36.

[0195] Laukova, Lucia, Barbora Konecna, Lubica Janovicova, Barbora Vlkova, and Peter Celec. 2020. “Deoxyribonucleases and Their Applications in Biomedicine.” Biomolecules 10 (7): 1036.

[0196] Lewis, M. K., and R. R. Burgess. 1980. “Transcription of Simian Virus 40 DNA by Wheat Germ RNA Polymerase II. Priming of RNA Synthesis by the 3’-Hydroxyl of DNA at Single Strand Nicks.” Journal of Biological Chemistry 255 (10): 4928-36.

[0197] Lu, Gaofei, Gregory R. Bluemling, Shuli Mao, et al. 2018. “Simple In Vitro Assay To Evaluate the Incorporation Efficiency of Ribonucleotide Analog 5'-Triphosphates into RNA by Human Mitochondrial DNA-Dependent RNA Polymerase.” Antimicrobial Agents and Chemotherapy 62 (2): 10.1128 / aac. O1830-17.

[0198] Lu, Xueling, Hui Wu, Heng Xia, et al. 2019. “Klebsiella Phage KP34 RNA Polymerase and Its Use in RNA Synthesis.” Frontiers in Microbiology 10 (October).

[0199] Madeira, Fabio, Matt Pearce, Adrian R N Tivey, et al. 2022. “Search and Sequence Analysis Tools Services from EMBL-EBI in 2022.” Nucleic Acids Research 50 (W1): W276- 79.

[0200] Masters, Brian S., Lori L. Stohl, and David A. Clayton. 1987. “Yeast Mitochondrial RNA Polymerase Is Homologous to Those Encoded by Bacteriophages T3 and T7.” Cell 51 (1): 89-99.

[0201] Matsunaga, Michio, Sei-Heon Jang, and Judith A Jaehning. 2004. “Expression and Purification of Wild Type and Mutant Forms of the Yeast Mitochondrial Core RNA Polymerase, Rpo41.” Protein Expression and Purification 35 (1): 126-30.

[0202] Miller, Mara L., and Dennis L. Miller. 2008. “Non-DNA-Templated Addition of Nucleotides to the 3' End of RNAs by the Mitochondrial RNA Polymerase of Physarum Polycephalum.” Molecular and Cellular Biology 28 (18): 5795-802.

[0203] Milligan, J F, D R Groebe, G W Witherell, and O C Uhlenbeck. 1987. “Oligoribonucleotide Synthesis Using T7 RNA Polymerase and Synthetic DNA Templates.” Nucleic Acids Research e (21): 8783-98.

[0204] Milligan, John F., Duncan R. Groebe, Gary W. Witherell, and Olke C. Uhlenbeck. 1987. “Oligoribonucleotide Synthesis Using T7 RNA Polymerase and Synthetic DNA Templates.” Nucleic Acids Research ed (21): 8783-98.

[0205] Minh, Bui Quang, Heiko A Schmidt, Olga Chernomor, et al. 2020. “IQ-TREE 2: New Models and Efficient Methods for Phylogenetic Inference in the Genomic Era.” Molecular Biology and Evolution 37 (5): 1530-34.

[0206] Moreno-Loshuertos, Raquel, Joaquin Marco-Brualla, Patricia Meade, Ruth Soler- Agesta, Jose A. Enriquez, and Patricio Fernandez-Silva. 2023. “How Hot Can Mitochondria Be? Incubation at Temperatures above 43 °C Induces the Degradation of RespiratoryComplexes and Supercomplexes in Intact Cells and Isolated Mitochondria.” Mitochondrion 69 (March): 83-94.

[0207] Morris, Claire E., John F. Klement, and William T. McAllister. 1986. “Cloning and Expression of the Bacteriophage T3 RNA Polymerase Gene.” Gene 41 (2): 193-200.

[0208] Mu, Xin, Emily Greenwald, Sadeem Ahmad, and Sun Hur. 2018. “An Origin of the Immunogenicity of in Vitro Transcribed RNA.” Nucleic Acids Research 46 (10): 5239-49.

[0209] Nass, Sylvan, and Margit M. K. Nass. 1963. “Intramitochondrial Fibers with DNA Characteristics: II. Enzymatic and Other Hydrolytic Treatments.” Journal of Cell Biology 19 (3): 613-29.

[0210] Nath, Kamalendu, and Jerard Hurwitz. 1974. “Covalent Attachment of Polyribonucleotides to Polydeoxyribonucleotides Catalyzed by Deoxyribonucleic Acid Ligase.” Journal of Biological Chemistry 249 (12): 3680-88.

[0211] Nick McElhinny, Stephanie A., Brian E. Watts, Dinesh Kumar, et al. 2010. “Abundant Ribonucleotide Incorporation into DNA by Yeast Replicative Polymerases.” Proceedings of the National Academy of Sciences 107 (11 ): 4949-54.

[0212] Ohno, Hirohisa, Sae Akamine, Megumi Mochizuki, et al. 2023. “Versatile Strategy Using Vaccinia Virus-Capping Enzyme to Synthesize Functional 5' Cap-Modified mRNAs.” Nucleic Acids Research 51 (6): e34.

[0213] Okazaki, R, T Okazaki, K Sakabe, K Sugimoto, and A Sugino. 1968. “Mechanism of DNA Chain Growth. I. Possible Discontinuity and Unusual Secondary Structure of Newly Synthesized Chains.” Proceedings of the National Academy of Sciences of the United States of America 59 (2): 598-605.

[0214] Olahova, Monika, Bradley Peter, Zsolt Szilagyi, et al. 2021. “POLRMT Mutations Impair Mitochondrial Transcription Causing Neurological Disease.” Nature Communications 12 (1): 1135.

[0215] OpenAI. 2022. “ChatGPT-3.5.”

[0216] Polack, Fernando P., Stephen J. Thomas, Nicholas Kitchin, et al. 2020. “Safety and Efficacy of the BNT162b2 mRNA Covid-19 Vaccine.” New England Journal of Medicine 383 (27): 2603-15.

[0217] Potuznlk, Jin Frantisek, and Hana Cahova. n.d. “If the 5’ Cap Fits (Wear It) - Non- Canonical RNA Capping.” RNA Biology 21 (1): 1-13.

[0218] Ringel, Rieke, Marina Sologub, Yaroslav I. Morozov, Dmitry Litonin, Patrick Cramer, and Dmitry Temiakov. 2011. “Structure of Human Mitochondrial RNA Polymerase.” Nature 478 (7368): 269-73.

[0219] Salinas-Rios, Viviana, Boris P. Belotserkovskii, and Philip C. Hanawalt. 2011. “DNA Slip-Outs Cause RNA Polymerase II Arrest in Vitro: Potential Implications for Genetic Instability.” Nucleic Acids Research 39 (17): 7444-54.

[0220] Sarcar, Subha Narayan, and Dennis L. Miller. 2018. “A Specific, Promoter- Independent Activity of T7 RNA Polymerase Suggests a General Model for DNA / RNA Editing in Single Subunit RNA Polymerases.” Scientific Reports 8 (1): 1.

[0221] Sayers, Eric W, Evan E Bolton, J Rodney Brister, et al. 2021. “Database Resources of the National Center for Biotechnology Information.” Nucleic Acids Research 50 (D1): D20-26.

[0222] Sievers, Fabian, Andreas Wilm, David Dineen, et al. 2011. “Fast, Scalable Generation of High-quality Protein Multiple Sequence Alignments Using Clustal Omega.” Molecular Systems Biology 7 (1): 539.

[0223] Skalenko, Kyle S., Lingting Li, Yuanchao Zhang, et al. 2021. “Promoter-Sequence Determinants and Structural Basis of Primer-Dependent Transcription Initiation in Escherichia Coli.” Proceedings of the National Academy of Sciences 118 (27): e2106388118.

[0224] Spiegelman, S., I. Haruna, I. B. Holland, G. Beaudreau, and D. Mills. 1965. “The Synthesis of a Self-Propagating and Infectious Nucleic Acid with a Purified Enzyme.” Proceedings of the National Academy of Sciences of the United States of America 54 (3): 919-27.

[0225] Sugimoto, K, T Okazaki, and R Okazaki. 1968. “Mechanism of DNA Chain Growth, II. Accumulation of Newly Synthesized Short Chains in E. Coli Infected with Ligase- Defective T4 Phages.” Proceedings of the National Academy of Sciences of the United States of America 60 (4): 1356-62.

[0226] Sutton, D H, G L Conn, T Brown, and A N Lane. 1997. “The Dependence of DNase I Activity on the Conformation of Oligodeoxynucleotides.” Biochemical Journal 321 (Pt 2): 481- 86.

[0227] Tseng, B. Y., J. M. Erickson, and M. Goulian. 1979. “Initiator RNA of Nascent DNA from Animal Cells.” Journal of Molecular Biology 129 (4): 531-45.

[0228] Van Kreijl, C. F., R. H. J. Beelen, and P. Borst. 1977. “On the Mechanism of Oligonucleotide-Primed RNA Synthesis. I. Model Studies with Deoxy-Homopolymer Templates and Escherichia Coli RNA Polymerase.” Nucleic Acids Research 4 (2): 425-44.

[0229] Voet, Donald, and Judith G. Voet. 2010. Biochemistry. John Wiley & Sons.

[0230] Wadhwa, Abishek, Anas Aljabbari, Abhijeet Lokras, Camilla Foged, and Aneesh Thakur. 2020. “Opportunities and Challenges in the Delivery of mRNA-Based Vaccines.” Pharmaceutics 12 (2): 102.

[0231] Walberg, M W, and D A Clayton. 1983. “In Vitro Transcription of Human Mitochondrial DNA. Identification of Specific Light Strand Transcripts from the Displacement Loop Region.” Journal of Biological Chemistry 258 (2): 1268-75.

[0232] Wanrooij, Sjoerd, Javier Miralles Fuste, Geraldine Farge, Yonghong Shi, Claes M. Gustafsson, and Maria Falkenberg. 2008. “Human Mitochondrial RNA Polymerase PrimesLagging-Strand DNA Synthesis in Vitro.” Proceedings of the National Academy of Sciences 105 (32): 11122-27.

[0233] Weiss, Samuel B., and Leonard Gladstone. 1959. “A Mammalian System for the Incorporation of Cytidine Triphosphate into Ribonucleic Acid.” Journal of the American Chemical Society 81 (15): 4118-19.

[0234] Wetmur, James G. 1976. “HYBRIDIZATION AND RENATURATION KINETICS OF NUCLEIC ACIDS.” Annual Review of Biophysics and Bioengineering 5 (1 ): 337-61.

[0235] Wickner, Sue, Jerard Hurwitz, Kalamendu Nath, and Lynwood Yarborough. 1972. “DNA Dependent RNA Polymerase Catalyzed Synthesis of Polyribonucleotide Chains Covalently Linked to DNA.” Biochemical and Biophysical Research Communications 48 (3).

[0236] Yagura, T., T. Kozu, and T. Seno. 1982. “Mouse DNA Polymerase Accompanied by a Novel RNA Polymerase Activity: Purification and Partial Characterization.” Journal of Biochemistry 91 (2): 607-18.

[0237] Zaher, Hani S., and Peter J. Unrau. 2004. “T7 RNA Polymerase Mediates Fast Promoter- Independent Extension of Unstable Nucleic Acid Complexes.” Biochemistry 43 (24): 7873-80.

[0238] Zhu, Bin, Stanley Tabor, Desislava A. Raytcheva, Alfredo Hernandez, Jonathan A. King, and Charles C. Richardson. 2013. “The RNA Polymerase of Marine Cyanophage Syn5.” The Journal of Biological Chemistry 288 (5): 3545-52.

[0239] The preceding merely illustrates the principles of the invention. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein. Rather, the scope and spirit of the present invention is embodied by the appended claims.

Claims

What is Claimed is:

1. An enzymatically-synthesized nucleic acid comprising a 5’ DNA-capped RNA, generated by an enzymatic reaction, wherein the DNA cap is at least 1 nucleotide in length, at least about 10 nt in length, at least 1 kb in length, up to 2kb in length or larger, and wherein the RNA portion is at least 1 nucleotide in length, at least about 10 nt in length, at least 1kb in length, up to 2kb in length or larger.

2. A method of synthesizing the 5’-DNA-capped RNA molecule of claim 1, the method comprising:contactinga DNA molecule comprising a free 3’ end and a region of complementarity, with an RNA polymerase (RNAP)in the presence of NTPs, wherein the DNA molecule serves as primer and template for extension with RNA, generating a molecule with input DNA on the 5’ end and extended RNA on the 3’ end, wherein the RNA sequence is complementary to the input DNA region of complementarity, to generate an RNA with a 5’ DNA cap.

3. The method of claim 2 in which the RNAP is an mtRNAP or an engineered variant of an mtRNAP.

4. The method of claim 2 or claim 3, wherein the input DNA comprises two separate strands where the 3' end or entirety of the first strand is complementary to a site within the second strand.

5. The method of any of claims 2-4, wherein the DNA cap is at least 2, at least about 5, at least about 10, at least about 15 nt in length.

6. The method of any of claims 2-5, wherein the 5’-DNA-capped RNA is at least about 1 nt in length, at least about 10 nt in length and may be greater than about 100 nt, 500 nt, 750 nt, 1 kb, 1.5 kb, 2 kb, or larger in length.

7. The method of any of claims 2-6, wherein the 5’-DNA-capped RNA encodes a polypeptide of interest.

8. The method of any of claims 2-7, wherein the 5’-DNA-capped RNA is an anti-sense sequence complementary to a coding sequence of interest.

9. The method of any of claims 2-8, wherein the 5’-DNA-capped comprises a ribosome binding site.

10. The method of any of claims 2-9, wherein the input DNA molecule is a single stranded DNA comprising an internal region of complementarity close to the 3’ end.

11. The method of any claims 2-10, wherein the input DNA comprises LNA, PNA, or other synthetically-generated nucleic acid.

12. The method of any claims 2-9, wherein the input nucleic acid is comprised of two separate strands, one a DNA strand and one an RNA strand, such that the 3’ end or entirety of the DNA strand is complementary to a site in the RNA strand, wherein the DNA strand acts as a primer and the RNA strand acts as a template.

13. The method of any of claims 2-9, wherein the input DNA is a gapped dsDNA made from either two separate strands of DNA or a hairpin-looped DNA molecule.

14. The method of any of claims 2-9, wherein the input DNA is a nicked DNA made from either two separate strands of DNA or a hairpin-looped DNA molecule.

15. The method of any of claims 2-14, wherein synthesis is performed in the presence or absence of a promoter sequence.

16. The method of any claims 2-15, wherein synthesis is performed in the presence of a bioengineered expression system.

17. The method of any of claims 2-16, wherein the RNAP is a mitochondrial RNAP, a phage RNAP, a bacterial RNAP, a eukaryotic RNAP, an engineered or designed protein, protein domain, or protein-RNA system that synthesizes RNA from a DNA template.

18. The method of any claims 1-17 wherein an RNAP is engineered to specifically synthesize DNA-capped RNAs.

19. The method of any of claims 1 -17, wherein the RNAP is a single-subunit RNAP.

20. The method of any of claims 1-17, wherein the RNAP is a multi-subunit RNAP, or a subset of subunits or single subunit from a multi-subunit RNAP.

21. A 5’-DNA-capped RNA molecule produced by the method of any of claims 1 -20.

22. A pharmaceutical formulation comprising a 5’-DNA-capped RNA molecule of claim 21, and an excipient.

Images