Methods of treating, ameliorating and / or preventing polycystic kidney disease and polycystic liver disease

Abstract

Described herein is a method for treating, ameliorating, and / or preventing polycystic kidney disease and polycystic liver disease in a subject. The method comprises administering to the subject an effective amount of a genetic editing agent to correct a PKD1 mutation or PKD2 mutation that causes the polycystic kidney disease or the polycystic liver disease, or convert the mutant PKD1 or mutant PKD2 into a non-pathogenic PKD1 or non-pathogenic PKD2.

Description

[0001] Attorney Docket No. 047162-7549WOl(02845)

[0002] METHODS OF TREATING, AMELIORATING AND / OR PREVENTING POLYCYSTIC KIDNEY DISEASE AND POLYCYSTIC LIVER DISEASE

[0003] CROSS-REFERENCE TO RELATED APPLICATIONS

[0004] The present application claims priority under 35 U. S. C. § 119(e) to U. S. Provisional Patent Application No. 63 / 745,963, filed January 16, 2025, which is incorporated herein by reference in its entirety.

[0005] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0006] This invention was made with government support under W81XWH2210005 awarded by the United States Department of Defense (USDOD). The government has certain rights in the invention.

[0007] SEQUENCE LISTING

[0008] The XML file named "047162-7549WOl(02845) Sequence Listing.xml" created on January 13, 2026, comprising 110,310 bytes, is hereby incorporated by reference in its entirety.

[0009] BACKGROUND

[0010] Polycystic kidney disease (PKD) is a genetic disorder that causes fluid-filled cysts to grow in the kidneys. Autosomal dominant polycystic kidney disease (ADPKD) is a highly penetrant inherited PKD which causes cysts and deformation of the kidneys, typically over the span of decades, and eventually leads to kidney failure requiring dialysis or transplantation in the majority of patients after the fifth decade of life. Although ADPKD is sometimes considered an orphan disease, the number of ADPKD patients is significant. There are estimated to be over 600,000 affected individuals with ADPKD in the US alone and over 12 million worldwide.

[0011] Polycystic liver disease (PLD) is a progressive disease. A small subset of PLD patients develop severe symptoms. Supportive management is recommended with a patient with mild symptoms. Patient with severe symptoms can be managed surgically, with liver transplantation being the only curative option.

[0012] 1

[0013] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0014] There is a need for methods of treating, ameliorating and / or preventing polycystic kidney disease and polycystic liver disease. The present invention addresses this need.

[0015] SUMMARY

[0016] In some aspects, the present invention is directed to the following non-limiting embodiments:

[0017] Method of treating, ameliorating and / or preventing polycystic kidney disease / polycystic liver disease

[0018] In some aspects, the present invention is directed to a method of treating, ameliorating and / or preventing polycystic kidney disease / polycystic liver disease in a subject in need thereof.

[0019] In some embodiments, the method comprises: administering to the subject an effective amount of a genetic editing agent to correct a PKD1 mutation or PKD2 mutation that causes the polycystic kidney disease or the polycystic liver disease.

[0020] In some embodiments, the method comprises administering to the subject an effective amount of a genetic editing agent to convert the mutant PKD1 or mutant PKD2 into a non-pathogenic PKD1 or non-pathogenic PKD2.

[0021] In some embodiments, the PKD1 mutation or PKD2 mutation is at least one selected from the mutations listed in Table 1 and Table 2.

[0022] In some embodiments, the PKD1 mutation or PKD2 mutation is a germline mutation. In some embodiments, the PKD1 mutation or PKD2 mutation is somatic mutation.

[0023] In some embodiments, the genetic editing agent is a base editing agent.

[0024] In some embodiments, the genetic editing agent is a CRISPR-based base editing agent. In some embodiments, the genetic editing agent comprises an adenine base editor or a cytosine base editor.

[0025] In some embodiments, the genetic editing agent further comprises a guide RNA (gRNA) that target the genetic editing agent to the mutation of PKD1 or PKD2 such that genetic editing agent is targeted to the base to be altered.

[0026] In some embodiments, the adenine base editor or the cytosine base editor, and / or the gRNA are administered as one or more nucleic acids encoding the adenine base editor or the cytosine base editor, and / or the gRNA.

[0027] 2

[0028] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0029] In some embodiments, the adenine base editor or the cytosine base editor, and / or the gRNA are administered as one or more viral vectors encoding the adenine base editor or the cytosine base editor, and / or the gRNA.

[0030] In some embodiments, the one or more viral vectors comprises a first viral vector and a second viral vector, and wherein the adenine base editor or the cytosine base editor is administered as the first viral vector encoding the adenine base editor or the cytosine base editor, and the gRNA is administered as the second viral vector encoding the gRNA.

[0031] In some embodiments, the one or more viral vectors are adeno-associated virus vectors (AAVs).

[0032] In some embodiments, the one or more viral vectors are AAV-8 vectors.

[0033] In some embodiments, the genetic editing agent reduces PDK1 gene or PKD2 gene carrying the targeting mutation by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or 100% in the affected tissue.

[0034] In some embodiments, the polycystic kidney disease or the polycystic liver disease is caused by R2220W mutation in the PKD1 gene.

[0035] In some embodiments, the method restores the defect in PCI cleavage.

[0036] In some embodiments, the method further comprises: acquiring a sample from the subject.

[0037] In some embodiments, the method further comprises: ascertaining that the sample carries the PKD1 mutation or PKD2 mutation that causes the polycystic kidney disease or the polycystic liver disease.

[0038] In some embodiments, the sample is a kidney sample or a liver sample.

[0039] In some embodiments, the method further comprises: determining a first percentage of PKD1 gene or PKD2 gene that harboring the PKD1 mutation or the PKD2 mutation before the administration of the genetic editing agent.

[0040] In some embodiments, the method further comprises: determining a second percentage of PKD1 gene or PKD2 gene that harboring the PKD1 mutation or the PKD2 mutation after the administration of the genetic editing agent.

[0041] In some embodiments, the method further comprises comparing the first percentage and the second percentage to evaluate the effectiveness of the genetic editing agent.

[0042] 3

[0043] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0044] In some embodiments, the subject is a mammal.

[0045] In some embodiments, the subject is a human.

[0046] Kit

[0047] In some aspects, the present invention is directed to a Kit.

[0048] In some embodiments, the kit comprises a first viral vector, which encodes an adenine base editor or a cytosine base editor.

[0049] In some embodiments, the kit further comprises a second viral vector, which encodes a gRNA that targets the adenine base editor or the cytosine base editor to PKD1 gene or PKD2 gen to correct a PKD1 mutation or PKD2 mutation that causes polycystic kidney disease or polycystic liver disease, or convert the mutant PKD1 or mutant PKD2 into a non-pathogenic PKD1 or non-pathogenic PKD2.

[0050] In some embodiments, the PKD1 mutation or PKD2 mutation is at least one selected from the mutations listed in Table 1 and Table 2.

[0051] In some embodiments, the first viral vector and / or the second viral vector are AAV vectors.

[0052] In some embodiments, the kit further comprises an instruction material instructing that the first viral vector and the second vector are to be administered to a subject suffering polycystic kidney disease or polycystic liver disease, wherein the polycystic kidney disease or polycystic liver disease is caused by the PKD1 mutation or PKD2 mutation.

[0053] In some embodiments, the PKD1 mutation or PKD2 mutation comprises R2220W mutation in the PKD1 gene.

[0054] Method of treating, ameliorating and / or preventing polycystic kidney disease polycystic liver disease by increasing PKD1 protein dosage

[0055] In some aspects, the present invention is directed to a method of treating, ameliorating and / or preventing polycystic kidney disease or polycystic liver disease in a subject in need thereof.

[0056] In some embodiments, the method comprises: administering to the subject an effective amount of a genetic editing agent to disrupt an upstream open reading frame (uORF) in the PKD1 5’UTR

[0057] 4

[0058] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0059] In some embodiments, the method comprises: administering to the subject an effective amount of a genetic editing agent to disrupt a microRNA binding motif in the PKD1 3’UTR.

[0060] In some embodiments, the method comprises: administering to the subject an effective amount of a genetic editing agent to disrupt the Ca2+-binding of the EF-hand in PKD2.

[0061] In some embodiments, the genetic editing agent is a base editing agent.

[0062] In some embodiments, the genetic editing agent is a CRISPR-based base editing agent. In some embodiments, the genetic editing agent comprises an adenine base editor or a cytosine base editor.

[0063] In some embodiments, the genetic editing agent further comprises a guide RNA (gRNA) that target the genetic editing agent to the uORF in the PKD1 5’UTR.

[0064] In some embodiments, the genetic editing agent further comprises a guide RNA (gRNA) that target the genetic editing agent to the microRNA binding motif in the PKD1 3’UTR.

[0065] In some embodiments, the genetic editing agent further comprises a guide RNA (gRNA) that target the genetic editing agent to the EF-hand in PKD2.

[0066] In some embodiments, the adenine base editor or the cytosine base editor, and / or the gRNA are administered as one or more nucleic acids encoding the adenine base editor or the cytosine base editor, and / or the gRNA.

[0067] In some embodiments, the adenine base editor or the cytosine base editor, and / or the gRNA are administered as one or more viral vectors encoding the adenine base editor or the cytosine base editor, and / or the gRNA.

[0068] In some embodiments, the one or more viral vectors comprises a first viral vector and a second viral vector, and wherein the adenine base editor or the cytosine base editor is administered as the first viral vector encoding the adenine base editor or the cytosine base editor, and the gRNA is administered as the second viral vector encoding the gRNA.

[0069] In some embodiments, the one or more viral vectors are adeno-associated virus vectors (AAVs).

[0070] In some embodiments, the AAV vectors are AAV-8 vectors.

[0071] In some embodiments, the genetic editing agent increases PDK1 protein dosage by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 100% or more, about 200% or more, or about 500% or more in the affected tissue.

[0072] 5

[0073] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0074] In some embodiments, the genetic editing agent disrupts the adenine in the initiation codon in any one of SEQ ID NOs:95-97.

[0075] In some embodiments, the genetic editing agent disrupts one or more adenines and / or one or more cytosines in any one of SEQ ID NOs:98-99.

[0076] In some embodiments, the genetic editing agent replaces the codon encoding Thr771 or Glu774 in PKD2 with codons encoding another amino acid residue,

[0077] In some embodiments, the genetic editing agent replaces the codon encoding Thr771 in PKD2 with a codon encoding alanine,

[0078] In some embodiments, the genetic editing agent replaces the codon encoding Glu774 in PKD2 with a codon encoding lysine or glycine.

[0079] In some embodiments, the subject is a mammal, such as a human.

[0080] Kit

[0081] In some aspects, the present invention is directed to a kit.

[0082] In some embodiments, the kit increases the PKD1 protein dosage.

[0083] In some embodiments, the kit comprises: a first viral vector, which encodes an adenine base editor or a cytosine base editor.

[0084] In some embodiments, the kit further comprises a second viral vector.

[0085] In some embodiments, the second viral vector encodes a gRNA that targets the adenine base editor or the cytosine base editor to an upstream open reading frame (uORF) in the PKD1 5’UTR.

[0086] In some embodiments, the second viral vector encodes a gRNA that targets the adenine base editor or the cytosine base editor to a microRNA binding motif in the PKD1 3’UTR.

[0087] In some embodiments, the second viral vector encodes a gRNA that targets the adenine base editor or the cytosine base editor to the EF-hand in PKD2.

[0088] In some embodiments: the gRNA targets the adenine base editor to change the adenine in the initiation codon in any one of SEQ ID NOs:95-97.

[0089] In some embodiments: the gRNA targets adenine base editor or the cytosine base editor to change one or more adenines and / or one or more cytosines in any one of SEQ ID NOs:98-99.

[0090] In some embodiments: the gRNA targets adenine base editor or the cytosine base editor to replace the codon encoding Thr771 or Glu774 in PKD2 with codons encoding another amino acid residue.

[0091] 6

[0092] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0093] In some embodiments: the gRNA targets adenine base editor or the cytosine base editor to replace the codon encoding Thr771 in PKD2 with a codon encoding alanine.

[0094] In some embodiments: the gRNA targets adenine base editor or the cytosine base editor to replace the codon encoding Glu774 in PKD2 with a codon encoding lysine or glycine.

[0095] In some embodiments: the first viral vector and / or the second viral vector are AAV vectors.

[0096] In some embodiments, the kit further comprises an instruction material instructing that the first viral vector and the second vector are to be administered to a subject suffering polycystic kidney disease or polycystic liver disease, wherein the polycystic kidney disease or polycystic liver disease is caused by insufficient dosage and / or activity of PKD1.

[0097] BRIEF DESCRIPTION OF THE DRAWINGS

[0098] The following detailed description of exemplary embodiments will be better understood when read in conjunction with the appended drawings. For the purpose of illustrating, nonlimiting embodiments are shown in the drawings. It should be understood, however, that the instant specification is not limited to the precise arrangements and instrumentalities of the embodiments shown in the drawings.

[0099] Figs. 1A-1D illustrate certain aspects of the renal manifestation of ADPKD in a PC1-missense mouse model, in accordance with some embodiments. Fig. 1A: Schematic of a cystic kidney as found in patients with ADPKD. PKD1 / PKD2 mutations lead to fluid-filled cysts throughout the entire nephron. Figs. 1A-1D: PkdlR2116W knock-in mice display symptoms of ADPKD with cystic kidneys at Pl 6. Mutant mice also show increased kidney to body weight ratios and elevated BUN at P16 compared to control mice (Krappitz et al. J Am Soc Nephrol. 2023 Jan 1;34(1):110-121.

[0100] Figs. 2A-2C illustrate certain aspects of the targeting strategy for correction of Pkdl R2216. Fig. 2A: Schematic of the Pkdl locus highlighting the R2216W mutation and four candidate gRNAs (grey) with different PAMs (orange), Fig. 2B: gRNA sequences are indicated and numbered relative to the PAM site (21-23). The ideal editing window for AB Emax is marked by the black box, target adenine colored in red (lower case a), while potential bystander adenines are marked in orange. Fig. 2C: DNA electroporation for base editor delivery into primary murine tubular cells. Cells were derived from PkdlR2216W / + mice; unedited,

[0101] 7

[0102] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0103] heterozygous control cells are shown in upper panel; edited, non-sorted cells shown in lower panel. Red box depicts the c.6648C>T (R2216W) target site. The sequences shown in Figs. 2A-2C are also listed below:

[0104] GTGTGGATGTGAGCCGACCCCAGCTGGTGGTGCCATGGCTGGCACTA (SEQ ID NO:100)

[0105] TAGTGCCAGCCATGGCACCACCAGCTGGGGTCGGCTCACATCCACAC (SEQ ID NO:101)

[0106] GVDVSRPQLVVPWLAL (SEQ ID NO: 102)

[0107] CCAGCCATGGCACCACCAGC (SEQ ID NO: 103)

[0108] AGCCATGGCACCACCAGCTG (SEQ ID NO: 104)

[0109] CAGCCATGGCACCACCAGCT (SEQ ID NO: 105)

[0110] GCCATGGCACCACCAGCTGG (SEQ ID NO: 106)

[0111] CAGCTGGTGGTGCCANGGCT (SEQ ID NO: 107)

[0112]

[0113] Figs. 3A-3B demonstrate that correcting Pkdl mutations with base editing reversed PCI cleavage defect, in accordance with some embodiments. Fig. 3A: When compared with wildtype PC-1 (PkdlV5 / +), the Pkd1R2216Wmutant displays a reduced expression of PCI while base editing ameliorates of the effect on PC-1 expression. The PC-1R2216W / - mutant also exhibits an increased ER-stress compared to wild-type PC-1 evident by increased levels of sXBPl expression. This effect is attenuated upon base editing. Representative immunoblots show signals for PC-1 (450 kDa), spliced XBP1 (sXBPl; 56 kDa). Fig. 3B: Graphs represent the densitometric evaluation of PC-1 and sXBPl; HSP90 or P-actin serves as loading controls (90 and 42 kDa, respectively) and are shown below the respective immunoblots. N = 3 biological replicates with two technical replicates. Data are the means ± SD, ***p < 0.001, ****p < 0.0001, ns: not significant.

[0114] Figs. 4A-4C demonstrate that correcting Pkdl mutations with base editing is effective in treating cystic liver and cystic kidney symptoms in animal models, in accordance with some embodiments. Fig. 4A: Comparative analysis of cystic animals (PkdlRW / flox, Ubc-Cre) injected 1 week after induction with doxycycline (p28-p42) reveals a reduction in liver weight (3.53g vs.

[0115] 2.74 / 2.84 / 2.2g; N=3) and cystic burden (liver sections stained with H& E) in ABE-Cas9 treated animals compared to controls; lower right inset showing a representative whole liver image.

[0116] 8

[0117] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0118] Animals were sacrificed at p126. Fig. 4B: One week after tail vein injections, liver tissue exhibits a robust infection rate among hepatocytes and cholangiocytes, highlighting the successful delivery and infection dynamics. Fig. 4C: Kidney to body weight ratio in the ABE injected kidneys is significantly smaller as compared with the un-injected controls.

[0119] Figs. 5A-5C illustrate certain aspects of editing screen for ADPKD-inducing patient mutations, in accordance with some embodiments. Fig. 5 A: From a patient cohort containing 185 ADPKD mutations, 104 were identified as point mutations, from which 67 were editable with a common base editor. 44 mutations were expressed in HEK293T cells using a transposase system and screened for efficiency of base editing. Fig. 5B: Distribution of all screened PKD1 mutations with corresponding domains and hotspot locations. Fig. 5C: Correction efficiency of base variants in the HEK293T cell model, expressed in percent. Mutations in hotspot regions are shown in red; efficiency ranged from zero to ~65%.

[0120] Fig. 6: Polycystin-2 (PKD2 protein) sequence with domain map and EF-hand close-up. The figure displays the entire amino-acid sequence with extracellular, transmembrane, and cytosolic regions annotated; a magnified inset highlights the C-terminal EF-hand where arrows mark Thr (-X) and Glu (-Z). Modelling indicates the -Z Glu is the principal Ca2+-coordinating. The sequence shown in Fig. 6 is reproduced below:

[0121] ELTEHEHQQMRDDL (SEQ ID NO: 108)

[0122]

[0123] Figs. 7A-7C: Representative whole kidney scans revealed a clear histological phenotype at p24 between wild-type (wt), PkdlR2216W7flox, Pkhdl-Cre and PkdlR2216W / flox, Pkhdl-Cre, Pkd2 TEAA / + / Pkd2 TEAA / TEAA kidneys at p24. Fig. 7C: Physiological parameters for body weight, kidney weight / body -weight ratio and BUN (blood urea nitrogen) and cystic index.

[0124] Figs. 8A-8C: Expression of mutant Pkd2TEAAslows down cyst progression due to complete conditional loss of Pkdl in the collecting duct. Aggregate data like in Figs. 7A-7C Figs. 9A-9C: Overexpression of Pkd2 (Pkd2BAC) slows down cyst progression due to missense- PCI. Aggregate data like in Figs. 7A-7C.

[0125] Figs. 10A-10E demonstrate that in vivo base editing reduces liver cysts in the RW knock-in model, in accordance with some embodiments. Fig. 10A: Schematic illustrating the experimental workflow of tamoxifen mediated Cre expression, AAV8 delivered base editing and analysis at the indicated postnatal (P) days. Fig. 10B: Schematic illustrating split-intein based

[0126] 9

[0127] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0128] AAV8 delivery of ABEmax. Fig. IOC: Macroscopic view of mouse kidney (upper part) and liver tissue (lower part). Left: base editor treated, right: untreated control. Fig. 10E: Quantification of liver to body weight ratios and liver cystic indices between wild-type mice, untreated RW knock-in mice and base editor (BE) treated RW knock-in mice; Quantification of editing efficiency in gDNA isolated from the liver of the untreated RW knock-in mice and base editor (BE) treated RW mice.

[0129] Figs. 11A-11C: Base editing screen for correction of PKD1 variants, a, Schematic indicating the experimental workflow; From 185 patients with typical ADPKD, 104 were selected with (likely) pathogenic single nucleotide variants, from which 39 variants correctable by adenine or cytosine base editors were introduced in HEK293T cells along with 150 bp of flanking endogenous sequence using a transposase system. Cells were then transfected with base editors and sgRNAs, followed by targeted amplicon sequencing. Fig. 1 IB: Genomic structure and protein domain structure of PKD1. Arrows indicate genomic positions of identified pathogenic variants from the ADPKD cohort, red indicates location in functionally important domains (e.g., REJ, PLAT). Fig. 11C: Editing efficiency across all different PKD1 variants identified in the ADPKD cohort, tested in the engineered HEK293T cell line. Beta-2 -microglobulin (B2M) served as a positive control. Asterisk highlights human c.6658C> T variant (R2220W, corresponding to murine R2216W) showing the highest editing efficiency. N = 4 biological replicates. Bar graphs indicate means ± SD.

[0130] Fig. 12: When compared with wild-type, the PC 1R2216W / - whole kidney lysate displays a pronounced cleavage defect with a decrease in PC1-CTF as seen by anti-V5 immunoblotting. When PC2 TEAA was coexpressed, an increase in PC1-CTF was observed.

[0131] DETAILED DESCRIPTION

[0132] The following disclosure provides many different embodiments, or examples, for implementing different features of the provided subject matter. Specific examples of components and arrangements are described below to simplify the present disclosure. These are, of course, merely examples and are not intended to be limiting. For example, the formation of a first feature over or on a second feature in the description that follows may include embodiments in which the first and second features are formed in direct contact, and may also include embodiments in which additional features may be formed between the first and second features,

[0133] 10

[0134] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0135] such that the first and second features may not be in direct contact. In addition, the present disclosure may repeat reference numerals and / or letters in the various examples. This repetition is for the purpose of simplicity and clarity and does not in itself dictate a relationship between the various embodiments and / or configurations discussed.

[0136] Polycystic kidney disease and polycystic liver disease are often caused by mutations in PKD1 and PKD2 genes. Such mutations can be germline mutations, or somatic mutations.

[0137] The present study discovered, in cell models and animal models, that reverting mutant PKD1 or PKD2 back to wild-type genes using base editing method was able to reverse the disease.

[0138] The present study further developed an AAV-8 based delivery method, in which a base editor and a gRNA for targeting the base editor to the desired mutation site are encoded by two different AAV-8 vectors. This delivery method resulted in unexpectedly high delivery efficiency, such that one single administration of the AAVs were sufficient to reverse the polycystic disease in a mouse model.

[0139] Furthermore, the delivery method resulted in excellent liver delivery, and good kidney delivery, which makes the method herein especially suitable for treating, ameliorating, and / or preventing polycystic liver disease and polycystic kidney disease caused by PKD1 or PKD2 mutations.

[0140] The present study further propose using the method to increase PKD1 protein (also called polycystin-1 or PCI) dosage using the same base editing method. It is known in the art that the increase of PKD1 protein dosage effectively treats, ameliorate, and / or prevents polycystic kidney disease or polycystic liver disease. PKD1 mRNA has several upstream open reading frame (uORF) in the 5’UTR and several miRNA binding sites in the 3’UTR. Both the uORF and the miRNA binding sites reduces the translation efficiency of the PKD1 mRNA, and the base editing method herein is able to disrupt both the uORF (such as by replacing the adenine of the initiation codon of the uORF with a different base) and the miRNA binding sites (such as by replace the adenines and cytosines within the binding sites with different bases).

[0141] Furthermore, the study discovered that disrupting the EF-hand (which is responsible for Ca2+binding) in PKD2 without introducing truncation at the EF-hand site is a mutationindependent strategy to restore PKD1 protein dosage. In other words, the dosage of PKD1

[0142] 11

[0143] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0144] protein can be achieved by introducing a mutation in PKD2 gene, rather than the PKD1 gene per se.

[0145] Accordingly, in some aspects, the present invention is directed to a method of treating, ameliorating, and / or preventing polycystic kidney disease or polycystic liver disease.

[0146] In some aspects, the present invention is directed to a kit for treating, ameliorating, and / or preventing polycystic kidney disease or polycystic liver disease.

[0147] Definitions

[0148] As used herein, each of the following terms has the meaning associated with it in this section. Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Generally, the nomenclature used herein and the laboratory procedures in animal pharmacology, pharmaceutical science, peptide chemistry, and organic chemistry are those well-known and commonly employed in the art. It should be understood that the order of steps or order for performing certain actions is immaterial, so long as the present teachings remain operable. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading may occur within or outside of that particular section. All publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference.

[0149] In the application, where an element or component is said to be included in and / or selected from a list of recited elements or components, it should be understood that the element or component can be any one of the recited elements or components and can be selected from a group consisting of two or more of the recited elements or components.

[0150] In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process.

[0151] 12

[0152] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0153] In this document, the terms "a," "an," or "the" are used to include one or more than one unless the context clearly dictates otherwise. The term "or" is used to refer to a nonexclusive "or" unless otherwise indicated. The statement "at least one of A and B" or "at least one of A or B" has the same meaning as " A, B, or A and B."

[0154] " About" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20% or ±10%, in certain embodiments ±5%, in certain embodiments ±1%, in certain embodiments ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.

[0155] Method of Treating, Ameliorating and / or Preventing Polycystic Kidney Disease or Polycystic Liver Disease

[0156] In some aspects, the present invention is directed to a method of treating, ameliorating and / or preventing polycystic kidney disease or polycystic liver disease in a subject in need thereof.

[0157] In some embodiments, the method comprises: administering to the subject an effective amount of a genetic editing agent to correct a PKD1 mutation or PKD2 mutation that causes the polycystic kidney disease or the polycystic liver disease, or convert the mutant PKD1 or mutant PKD2 into a non-pathogenic PKD1 or non-pathogenic PKD2.

[0158] In some embodiments, the PKD1 mutation or PKD2 mutation is a germline mutation or a somatic mutation.

[0159] In some embodiments, the PKD1 mutation or PKD2 mutation is selected from those listed in Table 1 and Table 2, attached herewith.

[0160] In some embodiments, the genetic editing agent is a base editing agent.

[0161] In some embodiments, the genetic editing agent is a CRISPR-based base editing agent. In some embodiments, the base editor is a precision genome-editing tool derived from CRISPR technology that enables the direct conversion of one DNA base into another without creating double-strand DNA breaks.

[0162] In some embodiments, instead of cutting DNA, base editors chemically modify individual nucleotides at a targeted genomic location, which reduces unwanted insertions or deletions (indels) sometimes associated with the CRISPR technology, and improves editing precision.

[0163] 13

[0164] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0165] In some embodiments, the base editor comprises a catalytically impaired Cas protein, such as one that is able to bind DNA at a specific site with the guidance of an RNA molecule, such as a guide RNA, such as a single-guide RNA (sgRNA). Non-limiting examples of catalytically impaired Cas proteins include the nickase form nCas or the catalytically dead form dCas. In some embodiments, the base editor further comprises a base editing enzyme, such as a deaminase enzyme, a glycosylase enzyme, or other enzymes that modify the base and cause mutations.

[0166] In some embodiments, the genetic editing agent comprises an adenine base editor or a cytosine base editor.

[0167] In some embodiments, the adenine base editor comprises a catalytically impaired Cas protein and an adenosine deaminase. Non-limiting examples of adenosine deaminases useful for adenine base editor include TadA derived from E.coli, as well as engineered versions thereof. In some embodiments, the adenosine deaminase convert adenine (A) to inosine (I) at the target A*T base pair. In some embodiments, cellular DNA repair mechanisms convert the I»T pair to a G*C pair, thereby replacing the A»T base pair to a G*C base pair.

[0168] In some embodiments, the cytosine base editor comprises a catalytically impaired Cas protein and a cytidine deaminase. Non-limiting examples of cytidine deaminases include the APOBEC family enzymes (e.g., APOBEC1), as well as engineered variants thereof. In some embodiments, the cytidine deaminase converts cytosine (C) to thymidine (T) at the target C*G base pair, thereby replacing the C»G base pair to a T»A base pair.

[0169] In some embodiments, the genetic editing agent further comprises a guide RNA (gRNA) that target the genetic editing agent to the mutation of PKD1 or PKD2 such that genetic editing agent.

[0170] In some embodiments, the adenine base editor or the cytosine base editor, and / or the gRNA are administered as one or more nucleic acids encoding the adenine base editor or the cytosine base editor, and / or the gRNA.

[0171] In some embodiments, the adenine base editor or the cytosine base editor, and / or the gRNA are administered as one or more viral vectors encoding the adenine base editor or the cytosine base editor, and / or the gRNA.

[0172] In some embodiments, the one or more viral vectors comprises a first viral vector and a second viral vector, and wherein the adenine base editor or the cytosine base editor is

[0173] 14

[0174] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0175] administered as the first viral vector encoding the adenine base editor or the cytosine base editor, and the gRNA is administered as the second viral vector encoding the gRNA.

[0176] In some embodiments, the in the one or more viral vectors are adeno-associated virus vectors, such as AAV-8 vectors. It was discovered that AAV-8 is effective in enriching payloads in both liver and kidney, which are the organs affected by polycystic diseases.

[0177] In some embodiments, the the genetic editing agent reduces PDK1 gene or PKD2 gene carrying the targeting mutation by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, or 100% in the affected tissue.

[0178] In some embodiments, the the polycystic kidney disease or the polycystic liver disease is caused by R2220W mutation in the PKD1 gene.

[0179] In some embodiments, the the method restore the defect in PCI cleavage.

[0180] In some embodiments, the method further comprises: acquiring a sample from the subject; and ascertaining that the sample carries the PKD1 mutation or PKD2 mutation that causes the polycystic kidney disease or the polycystic liver disease.

[0181] In some embodiments, the sample is a kidney sample or a liver sample.

[0182] In some embodiments, the method further comprises: determining a first percentage of PKD1 gene or PKD2 gene that harboring the PKD1 mutation or the PKD2 mutation before the administration of the genetic editing agent.

[0183] In some embodiments, the method further comprises determining a second percentage of PKD1 gene or PKD2 gene that harboring the PKD1 mutation or the PKD2 mutation after the administration of the genetic editing agent; and comparing the first percentage and the second percentage to evaluate the effectiveness of the genetic editing agent.

[0184] In some embodiments, the method increase PKD1 protein dosage instead of, or in addition to, correcting the mutations.

[0185] PKD1 mRNA has several upstream open reading frames (uORFs), which reduce translation of downstream coding sequences by diverting scanning ribosomes to upstream initiation sites, and limiting productive initiation at the canonical PKD1 start codon. The PKD1 3' untranslated region (3'UTR) contains several conserved microRNA binding motifs that mediate post-transcriptional repression of PKD1 protein (polycystin-1). As such, the disruption of the uORFs and / or the microRNA binding motifs in the PKD1 gene are able to increase the

[0186] 15

[0187] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0188] dosage of PKD1 protein by reducing the inhibition of the translation. The increase of PKD1 dosage is known to be an effective treatment for polycystic kidney disease and polycystic liver disease. In addition, the present study discovered that, by abolishing the calcium binging ability of the EF-hand in the PKD2 protein (PC2), the effective dosage of PKD1 protein can be increased.

[0189] In some embodiments, the genetic editing agent disrupts an upstream open reading frame (uORF) in the PKD1 5’UTR, a microRNA binding motif in the PKD1 3’UTR, and / or the Cambinding EF-hand in PKD2.

[0190] In some embodiments, the genetic editing agent disrupts the adenine in the initiation codon in any one of SEQ ID NOs:95-97.

[0191] In some embodiments, the genetic editing agent disrupts one or more adenines and / or one or more cytosines in any one of SEQ ID NOs:98-99.

[0192] In some embodiments, the genetic editing agent replaces the codon encoding Thr771 or Glu774 in PKD2 with codons encoding another amino acid residue.

[0193] In some embodiments, the genetic editing agent replaces the codon encoding Thr771 in PKD2 with a codon encoding alanine. The present study has confirmed that replacing Thr771 with an alanine was able to abolish the Ca2+binding of the EF hand.

[0194] In some embodiments, the genetic editing agent replaces the codon encoding Glu774 in PKD2 with a codon encoding lysine or glycine. Since lysine (K) is positively charged as opposed to glutamate (E) (the negative charge of Glu774 is involved in the Ca2+binding), and glycine (G) is similar to alanine (A) (which has been confirmed to abolish the Ca2+binding of the EF-hand) in that it is a small amino acid without a charged side chain, replacing Glu774 with either lysine or glycine is expected to abolish the Ca2+binding of the EF hand.

[0195] In some embodiments, the administration of the genetic editing agent increases PDK1 protein dosage by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 100% or more, about 200% or more, or about 500% or more in the affected tissue.

[0196] In some embodiments, the subject is a mammal, optionally a human.

[0197] Kit

[0198] 16

[0199] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0200] In some embodiments, the present invention is directed to a kit. Such as a kit for carrying out the methods herein.

[0201] In some embodiments, the kit comprises a first viral vector, which encodes an adenine base editor or a cytosine base editor.

[0202] In some embodiments, the kit further comprises a second viral vector, which encodes a gRNA that targets the adenine base editor or the cytosine base editor to PKD1 gene or PKD2 gen to correct a PKD1 mutation or PKD2 mutation that causes polycystic kidney disease or polycystic liver disease, or convert the mutant PKD1 or mutant PKD2 into a non-pathogenic PKD1 or non-pathogenic PKD2.

[0203] In some embodiments, the second viral vector encodes a gRNA that targets the adenine base editor or the cytosine base editor to an upstream open reading frame (uORF) in the PKD1 5’UTR, a microRNA binding motif in the PKD1 3’UTR, and / or the EF-hand of PKD2.

[0204] In some embodiments, the gRNA targets the adenine base editor to change the adenine in the initiation codon in any one of SEQ ID NOs:95-97.

[0205] In some embodiments, the gRNA targets adenine base editor or the cytosine base editor to change one or more adenines and / or one or more cytosines in any one of SEQ ID NOs:98-99.

[0206] In some embodiments, the gRNA targets adenine base editor or the cytosine base editor to replace the codon encoding Thr771 or Glu774 in PKD2 with codons encoding another amino acid residue.

[0207] In some embodiments, the gRNA targets adenine base editor or the cytosine base editor to replace the codon encoding Thr771 in PKD2 with a codon encoding alanine.

[0208] In some embodiments, the gRNA targets adenine base editor or the cytosine base editor to replace the codon encoding Glu774 in PKD2 with a codon encoding lysine or glycine.

[0209] In some embodiments, the first viral vector and / or the second viral vector are AAV vectors, such as AAV-8 vectors.

[0210] In some embodiments, the kit further comprises an instruction material instructing that the first viral vector and the second vector are to be administered to a subject suffering polycystic kidney disease or polycystic liver disease, wherein the polycystic kidney disease or polycystic liver disease is caused by the PKD1 mutation or PKD2 mutation.

[0211] Examples

[0212] 17

[0213] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0214] The instant specification further describes in detail by reference to the following experimental examples. These examples are provided for purposes of illustration only, and are not intended to be limiting unless so specified. Thus, the instant specification should in no way be construed as being limited to the following examples, but rather, should be construed to encompass any and all variations which become evident as a result of the teaching provided herein.

[0215] Example 1:

[0216] The Pkd1R2216Wmissense-mouse model (Krappitz et al., J Am Soc Nephrol. 2023 Jan 1;34(1): 110-121), which corresponds to the human pathogenic mutation R2220W, exhibits symptoms of human ADPKD. pciR2220W(Arg2220Trp) is an incompletely penetrant hypomorphic variant that occurred in trans with another missense mutation (PCIR

[0217]

[0218] 3277C) in an early-onset ADPKD family (Vujic et al., J Am Soc Nephrol. 2010 Jul;21(7): 1097-1102). The PCJR2220Wreceptor for egg jelly (REJ) domain mutant is a hypomorphic missense variant that leads to a partial defect in PCI cleavage (Hopp et al., J Clin Invest. 2012 Nov; 122(11):4257-73). Pkd1R2216W / R2216Whomozygous mice displayed a significant cystic phenotype at postnatal day 11 (Pl 1) and were severely affected at Pl 6, with significantly increased kidney-to-body -weight (KW / BW) ratio, cystic index, and BUN levels (Figs. 1B-1D). Pkd1R2216W / R2216Wmicedid not typically survive past P20. Kidney cysts in this germline mutant model arose from both proximal and collecting duct segments (data not shown). The mutated PCI was further modified by insertion of an in-frame V5 epitope tag at the C-terminus to detect the mutant protein and its respective splicing pattern. By taking advantage of the knock-in V5 tag, expression of PCI could be detected in the lung, kidney, and heart as had previously been shown in a HA epitope knock-in model (Wodarczyk et al., PLoS One. 2009 Sep 23;4(9):e7137). The PCIR22I6Wmutation resulted in a relative reduction in GPS cleavage in vivo. Kidney lysates from PC1R2216W / R2216Wmice showed a shift in the densitometric ratio of PC1-CTF to PCI full-length (PCI -FL) from around 2.5 in wild-type PC1V5kidneys to a reduced ratio of around 1 in homozygous PC1R2216Wkidneys. This in vivo finding is consistent with a relative reduction in the GPS cleavage efficiency that had been reported in vitro.

[0219] The present study used the Pkd1R2216Wanimal model for testing a proof-of-concept adenine base editing correction.

[0220] 18

[0221] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0222] Example 1-1: Base editing corrected Pkdl missense mutation in primary cells Referring to Figs. 2A-2C, the present study designed a targeting strategy for correcting mutation in the mice model containing the heterozygous Pkdl R2216W mutation.

[0223] Primary murine tubular cells derived from the heterozygous Pkd1R2216Wmouse (Pkdl variant, c.6648C>T, R2216W), and treated with the adenine base editor ABEmax(Koblan et al., Nat Biotechnol. 2018 Oct;36(9):843-846) and gRNA as indicated in Fig. 2B. Adenine base editors convert adenine to inosine, resulting in an A to G change. The ideal editing window for ABEmax is marked by the black box, target adenine colored in red (lower case a), while potential bystander adenines are marked in orange. A specific A to G change of the target adenine in the non-coding strand would revert the W (encoded by TGG) back to R (encoded by CGG).

[0224] Referring to Fig. 2C, the DNA encoding the base editor and the gRNA, when delivery into the primary murine tubular cells by electroporation, corrected a significant percentage of the cells containing the heterozygous Pkd1R2216Wmutant. Without the base editing, 66% of the Pkdl gene in the cell pool harbors the R2216W mutation. With the base editing, the R2216W mutant gene in the cell pool reduced to 55%. Notably, the bases adjacent to the target base are not affected by the base editing.

[0225] In summary, the present study was able to correct up to 15% of thymines at protospacer position 5 without any bystander products in 3 replicates using ABEmax (optimized ABE described in Koblan et al., Nat Biotechnol. 2018 Oct;36(9):843-846) and the Spacer 2 containing gRNA (Figs. 2A-2C).

[0226] Example 1-2: Base editing of mutant Pkdl rescued PCI cleavage defect and reduced ER stress response in primary cells

[0227] Furthermore, the present study confirmed the functional effect of base editing by western blotting (see Figs. 3A-3C).

[0228] Referring to Fig. 3A, when compared with wild-type PC-1 (PkdlV5 / +), the Pkd1R2216Wmutant displays a reduced expression of PCI while base editing ameliorates of the effect on PC- 1 expression. The PC-lR2216W / ~ mutant also exhibits an increased ER-stress compared to wildtype PC-1 evident by increased levels of sXBPl expression. This effect is attenuated upon base

[0229] 19

[0230] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0231] editing. Representative immunoblots show signals for PC-1 (450 kDa), spliced XBP1 (sXBPl; 56 kDa). The quantifications of PC-1 and sXBPl levels are shown in Fig. 3B.

[0232] In summary, the present study observed a partial rescue of PCI in PC1-R2216W cells treated with ABEmax (as compared to wild-type). Furthermore, XBPls, a canonical chaperone inducer of the ER stress response, which is increased in PC1-R2216W mice, was found to be decreased to baseline levels upon treatment with the ABEmax.

[0233] Example 1-3: Base editing correcting Pkdl mutation reduced polycystic liver and kidney symptoms

[0234] The present study concurrently injected equal amounts of AAV-8 carrying the adenine base editor and the corresponding gRNA into a doxycycline inducible (p28-42) polycystic liver disease mouse model carrying the Pkd1R2216W-missense mutation (Pkd1R2216W / floxPax8rtTA, Ubc-cre).

[0235] Referring to Figs. 4A-4C, correcting Pkdl mutations with base editing is effective in treating cystic liver and cystic kidney symptoms in animal models.

[0236] Referring to Fig. 4A, cystic animals (PkdlRW / flox, Ubc-Cre) were treated 1 week after induction with doxycycline (p28-p42). The present study observed a reduction in liver weight (3.53g vs. 2.74 / 2.84 / 2.2g; N=3) and cystic burden (liver sections stained with H& E) in ABE-Cas9 treated animals compared to controls.

[0237] Referring to Fig. 4B, one week after tail vein injections, the liver tissue exhibits a robust infection rate among hepatocytes and cholangiocytes, highlighting the successful delivery and infection dynamics. Referring to Fig. 4C, the kidney to body weight ratio in the ABE injected kidneys is significantly smaller as compared with the un-injected controls.

[0238] As such, the testing of the proposed approach was successful in mice with polycystic liver disease caused by the Pkd lR2216W-missense mutation. This highlights the potential of the ABE-construct in vivo.

[0239] Notably, upon sacrificing the animals at pl26, the present study observed a noteworthy reduction in cyst formation and liver weight in the treated animals, indicating the efficacy of the dual -virus approach. Additionally, an animal injected with an AAV-8-GFP construct exhibited a high infection rate among cholangiocytes at p54, further emphasizing the effectiveness of the AAV-8 delivery system in the liver.

[0240] 20

[0241] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0242] Example 1-4:

[0243] The method described herein can be used to target other mutations in PKD1 and PKD2, apart from the R2220W mutation described herein. Such mutations are listed in Table 1 and Table 2.

[0244] Table 1

[0245] C

[0246] Amino Clinical ADP 0

[0247] Regi Acid Variant Significance KD # d cDNA Designation

[0248] on Designati Type (PKDB Cou o

[0249] on Evaluation) nt n

[0250] 5'(E4 Truncating

[0251] Fl)-: Large

[0252] 1 1 l_6915del* Metlfs Pathogenic

[0253] EX1 Rearrange 1 (1) 5 ment

[0254] 5'(R Truncating

[0255] AB 2: Large

[0256] 2 1 l_8015del* Metlfs Pathogenic

[0257] 6)- Rearrange 1 (1) EX2 ment

[0258] Truncating

[0259] 5'-: Large

[0260] 3 1 l_215del Metlfs Pathogenic

[0261] IVS1 Rearrange 1 (1) ment

[0262] 5'UT Silent Likely

[0263] 4 -1 -117G> T 5'-UTR

[0264] R 5'UTR Benign - (1) 5'UT Silent Likely

[0265] 5 -1 -108C>T 5'-UTR

[0266] R 5'UTR Benign - (1) 5'UT Silent Likely

[0267] 6 -1 -76G> C 5'-UTR

[0268] R 5'UTR Benign - (1) 5'UT Silent Likely

[0269] 7 -1 -67C>T 5'-UTR

[0270] R 5'UTR Benign - (1) 5'UT Silent Likely

[0271] 8 -1 -61T> C 5'-UTR

[0272] R 5'UTR Benign - (1) 5'UT Silent Likely

[0273] 9 -1 -52C>T 5'-UTR

[0274] R 5'UTR Benign - (1)

[0275] Nontruncat

[0276] 1 5'UT ing: Likely

[0277] 1 -2C>T 1 Metlins

[0278] 0 R Deletion / In Benign - (1)

[0279] Met

[0280] sertion

[0281] Truncating

[0282] EX1- 1: Large

[0283] EX3 1 1-11269del Metlfs Pathogenic

[0284] 1 Rearrange 1 (1) 9

[0285]

[0286] ment

[0287] 21

[0288] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0289] Truncating

[0290] 1: Large

[0291] EXI 1 l-215del Metlfs Pathogenic

[0292] 2 Rearrange 2 (1) ment

[0293] Nontruncat

[0294] 1

[0295] EXI 3 8C> G Pro3Arg ing: VUS

[0296] 3 1 (1)

[0297] Missense

[0298] Truncating

[0299] 13_25delGCGCCCG

[0300] 1 Ala5fs53

[0301] EXI 5 CCCGCC (SEQ ID Pathogenic

[0302] 4 X Deletion / In 1 (1)

[0303] NO:1)

[0304] sertion

[0305] Truncating

[0306] 1 Arg8fs63

[0307] EXI 8 24_27delCCTG Pathogenic

[0308] 5 X Deletion / In 1 (1) sertion

[0309] Nontruncat

[0310] 29 46delCGCTGGC

[0311] 1 1 AlalO Le ing:

[0312] EXI CCTGGGCCTGG Pathogenic

[0313] 6 0 ul5del6 Deletion / In 1 (1)

[0314] (SEQ ID NO: 2)

[0315] sertion

[0316] Nontruncat

[0317] 1 1 Likely

[0318] EXI 38T> A Leu 13 Gin ing:

[0319] 7 3 Pathogenic 1 (1)

[0320] Missense

[0321] Nontruncat

[0322] 1 1 Gly 16 Le

[0323] EXI ing:

[0324] 46_5 IdelGGCCTG VUS 8 6 ul7del2 Deletion / In 2 (1) sertion

[0325] Truncating

[0326] 63 75delGCTGGCG

[0327] 1 2 Ala21fs47

[0328] EXI GGGGGC (SEQ ID Pathogenic

[0329] 9 1 X Deletion / In 1 (1)

[0330] NO:3)

[0331] sertion

[0332] Truncating

[0333] 2 2 Gly25fs98

[0334] EXI 74_75delGCinsA Pathogenic

[0335] 0 5 X Deletion / In 1 (1) sertion

[0336] Truncating

[0337] 2 2 Gly25fs48

[0338] EXI 74delG Pathogenic

[0339] 1 5 X Deletion / In 1 (1) sertion

[0340] Nontruncat

[0341] 2 2

[0342] EXI 74G> T Gly25Val ing: VUS

[0343] 2 5 1 (1)

[0344] Missense

[0345] Nontruncat

[0346] 2 2 Likely

[0347] EXI 82C> T Arg28Cys ing:

[0348] 3 8 Benign - (1)

[0349] Missense

[0350] 2 3 97 105delTGCGAG Cys33 Pr Nontruncat Likely

[0351] EXI

[0352]

[0353] 4 3 ccc o35del3 ing: Pathogenic 1 (1)

[0354] 22

[0355] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0356] Deletion / In

[0357] sertion

[0358] Truncating

[0359] 2 3 Cys33fs39

[0360] EXI 99delC Pathogenic

[0361] 5 3 X Deletion / In 1 (1) sertion

[0362] Truncating

[0363] 2 3 Glu34fs78

[0364] EXI 102_103delGC Pathogenic

[0365] 6 4 X Deletion / In 1 (1) sertion

[0366] Nontruncat

[0367] 2 3 Likely

[0368] EXI 107C>A Pro36His ing:

[0369] 7 6 Benign - (7)

[0370] Missense

[0371] Truncating

[0372] 2 3 Cys37fs37

[0373] EXI 108_109insCC Pathogenic 2 (2) 8 7 X Deletion / In

[0374] sertion

[0375] Truncating

[0376] 2 3 Cys37fs76

[0377] EXI 108_109insC Pathogenic 2 (2) 9 7 X Deletion / In

[0378] sertion

[0379] Truncating

[0380] 3 3 Cys37fs36

[0381] EXI 109delT Pathogenic

[0382] 0 7 X Deletion / In 1 (1) sertion

[0383] 3 3 Truncating

[0384] EXI 111C>A Cys37X Pathogenic

[0385] 1 7: Nonsense 1 (1) 3 3 Synonymo Likely

[0386] EXI 114C>T Leu38Leu

[0387] 2 8 us Benign - (1) 3 4 Synonymo Likely

[0388] EXI 138C>T Ala46Ala

[0389] 3 6 us Benign - (1)

[0390] Nontruncat

[0391] 3 4 Likely

[0392] EXI 140G> C Cys47Ser ing:

[0393] 4 7 Pathogenic 1 CD Missense

[0394] 3 4 Synonymo Likely

[0395] EXI 144C>G Arg48Arg

[0396] 5 8 us Benign - (1) 3 4 Synonymo Likely

[0397] EXI 147C>T Val49Val

[0398] 6 9 us Benign - (1)

[0399] Nontruncat

[0400] 3 5 Likely

[0401] EXI 152G> C Cys51Ser ing:

[0402] 7 1 Pathogenic 1 (1)

[0403] Missense

[0404] Nontruncat

[0405] 3 5 Likely

[0406] EXI 153C>G Cys51Trp ing:

[0407] 8 1 Pathogenic 1 (1)

[0408] Missense

[0409] 3 5 Cys51fs21 Truncating

[0410] EXI 153delC Pathogenic 1 (1)

[0411]

[0412] 9 1 X

[0413] 23

[0414] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0415] Deletion / In

[0416] sertion

[0417] Nontruncat

[0418] 4 5 Likely

[0419] EXI 155C>T Ser52Leu ing:

[0420] 0 2 Pathogenic 1 (1)

[0421] Missense

[0422] Truncating 158_179delGCCGCG

[0423] 4 5 Gly53Valf

[0424] EXI GGCTGCGGACGCT Pathogenic

[0425] 1 3 sl3X Deletion / In 1 (1)

[0426] CGG (SEQ ID NO:4)

[0427] sertion

[0428] Truncating

[0429] 4 5 165 171delGCTGCG Leu56fsl5

[0430] EXI Pathogenic

[0431] 2 6 4 (3

[0432] G X Deletion / In ) sertion

[0433] Nontruncat

[0434] 4 5 Likely

[0435] EXI 169C>T Arg57Trp ing:

[0436] 3 7 Benign - (1)

[0437] Missense

[0438] Nontruncat

[0439] 4 6 Likely

[0440] EXI 182C>T Pro61Leu ing:

[0441] 4 1 Benign - (4)

[0442] Missense

[0443] 4 7 Synonymo Likely

[0444] EXI 214C>T Leu72Leu

[0445] 5 2 us Benign - (2)

[0446] Nontruncat

[0447] 4 7 Likely

[0448] EXI 215T> A Leu72Gln ing:

[0449] 6 2 Pathogenic 1 (1)

[0450] Missense

[0451] Truncating

[0452] IVS1

[0453] 4 7: Large

[0454] EX 216 7489del* Leu72fs Pathogenic

[0455] 7 2 Rearrange 1 (1) 18

[0456] ment

[0457] Truncating

[0458] 4 IVS1 7: Large

[0459] 216-787del Leu72fs Pathogenic

[0460] 8 -EX5 2 Rearrange 1 (1) ment

[0461] 4 7 Likely Likely

[0462] 1VS1 216-79C>T Silent

[0463] 9 2 Silent IVS Benign - (1)

[0464] Leu72fs

[0465] 5 7

[0466] 1VS1 216-1G> C Truncatin Splice Pathogenic

[0467] 0 2 1 (1) g:

[0468] Nontruncat

[0469] 5 7 Likely

[0470] EX2 224C>T Ser75Phe

[0471] 1 5 ing:

[0472] Pathogenic 1 (1) Missense

[0473] Nontruncat

[0474] 5 7 Likely

[0475] EX2 230A> G Asn77Ser ing:

[0476] 2 7 Pathogenic 2 (1)

[0477] Missense

[0478] Nontruncat

[0479] 5 7 Likely

[0480] EX2 236T> C Leu79Pro

[0481] 3 9 ing:

[0482] Pathogenic 1 (1)

[0483]

[0484] Missense

[0485] 24

[0486] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0487] Nontruncat

[0488] 5 8

[0489] EX2 238C>T Arg80Trp ing:

[0490] 4 0 vus 1 (1)

[0491] Missense

[0492] Nontruncat

[0493] 5 8 Likely

[0494] EX2 239G> A Arg80Gln ing:

[0495] 5 0 Benign - (1)

[0496] Missense

[0497] Nontruncat

[0498] 5 8

[0499] EX2 259C>A Leu87Met ing: VUS

[0500] 6 7 1 (1)

[0501] Missense

[0502] Nontruncat

[0503] 5 Likely

[0504] EX2 263C>T Ala88Val ing:

[0505] 7 Benign - (1)

[0506] Missense

[0507] Nontruncat

[0508] 5 8

[0509] EX2 266A> C Asn89Thr

[0510] 8 9 ing: VUS 1 (1)

[0511] Missense

[0512] Truncating

[0513] 5 9 Ser91fs21

[0514] EX2 271_272delTC Pathogenic

[0515] 9 1 X Deletion / In 2 (1) sertion

[0516] 6 9 Truncating

[0517] EX2 272C>A Ser91X Pathogenic

[0518] 0 1: Nonsense 1 (1)

[0519] Nontruncat

[0520] 6 9 Likely

[0521] EX2 274G> A Ala92Thr ing:

[0522] 1 2 Benign - (1)

[0523] Missense

[0524] 6 9 Synonymo Likely

[0525] EX2 276G> A Ala92Ala

[0526] 2 2 us Benign - (6)

[0527] Nontruncat

[0528] 6 9 Likely

[0529] EX2 287T> C Leu96Pro ing:

[0530] 3 6 Pathogenic 1 (1)

[0531] Missense

[0532] Leu96fs

[0533] 6 9

[0534] IVS2 287+4A> C Nontrunca Splice VUS

[0535] 4 6 2 (1) ting:

[0536] 6 9 Likely Likely

[0537] IVS2 288-32A> G Silent

[0538] 5 6 Silent IVS Benign - (3) 6 9 Likely Likely

[0539] IVS2 288-21C>T Silent

[0540] 6 6 Silent IVS Benign - (1) 6 9 Likely Likely

[0541] IVS2 288-11G>C Silent

[0542] 7 6 Silent IVS Benign - (3) 6 9 Likely Likely

[0543] IVS2 288-3C>T Silent

[0544] 8 6 Silent IVS Benign - (1)

[0545] Asp97 He

[0546] 6 9 120del24

[0547] IVS2 288-2A> G Splice Pathogenic 2 (2) 9 6 Truncatin

[0548] g:

[0549] 7 9 Synonymo Likely

[0550] EX3 288G> A Leu96Leu - (1)

[0551]

[0552] 0 6 us Benign

[0553] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0554] Nontruncat

[0555] 7 9 Likely

[0556] EX3 290A> G Asp97Gly ing:

[0557] 1 7 Pathogenic 1 (1)

[0558] Missense

[0559] Nontruncat

[0560] 7 9 Likely

[0561] EX3 296G> T Ser99Ileu ing:

[0562] 2 9 Pathogenic 1 (1)

[0563] Missense

[0564] 1 Nontruncat

[0565] 7 AsnlOl As Likely

[0566] EX3 0 301A> G ing:

[0567] 3 1 (1

[0568] P Pathogenic ) 1 Missense

[0569] Nontruncat

[0570] 1

[0571] 7 ing: Likely

[0572] EX3 0 303_305delCAA AsnlOl del 2 (2) 4 Deletion / In Pathogenic

[0573] 1

[0574] sertion

[0575] 1 Nontruncat

[0576] 7 Likely

[0577] EX3 0 308T> C IlelO3Thr ing:

[0578] 5 Pathogenic 1 (1)

[0579] 3 Missense

[0580] 1 Nontruncat

[0581] 7 Likely

[0582] EX3 0 313A> T ThrlO5Ser ing:

[0583] 6 Benign - (1)

[0584] 5 Missense

[0585] 1

[0586] 7 Truncating

[0587] EX3 0 322G> T G1U108X Pathogenic

[0588] 7: Nonsense 1 (1)

[0589] 8

[0590] Nontruncat

[0591] 1

[0592] 7 in Likely

[0593] EX3 0 g:

[0594] 323_325delAAG Glul08del

[0595] 8 Deletion / In Pathogenic 1 (1)

[0596] 8

[0597] sertion

[0598] 1

[0599] 7 GlylO9Gl Synonymo Likely

[0600] EX3 0 327A> T

[0601] 9 - (1 y us Benign ) 9

[0602] 1 Nontruncat

[0603] Phe111Le Likely

[0604] EX3 1 333T> G ing:

[0605] u Benign - (1) 1 Missense

[0606] Truncating

[0607] 1

[0608] 8

[0609] EX3 1 341_345delTATTT Leull4X Pathogenic

[0610] 1 Deletion / In 1 (1)

[0611] 4

[0612] sertion

[0613] Truncating

[0614] 1

[0615] 8 Asnl 16fs

[0616] EX3 1 348_352delTTTAA Pathogenic 2 (2) 2 X Deletion / In

[0617] 6

[0618] sertion

[0619] 1 Nontruncat

[0620] 8 Likely

[0621] EX3 2 359T> C Ilel20Thr ing:

[0622] 3 Pathogenic 1 (1)

[0623] 0 Missense

[0624] 1 Ilel20fs

[0625] 8

[0626] IVS3 2 359+lG> A Truncatin Splice Pathogenic

[0627] 4 1 (1)

[0628]

[0629] 0 _

[0630] 26

[0631] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0632] Ile120fs

[0633] 8

[0634] IVS3 2 359+2T> C Truncatin Splice Pathogenic

[0635] 5 1 (2)

[0636] 0 5'

[0637] 1

[0638] 8 Unknown

[0639] IVS3 2 360-5T> C Unknown VUS

[0640] 6 IVS 1 (1)

[0641] 0

[0642] 1 Nontruncat

[0643] 8 Asnl25As Likely

[0644] EX4 2 373A> G ing:

[0645] 7 1 (1

[0646] P Pathogenic ) 5 Missense

[0647] Truncating

[0648] 1

[0649] 8 Glul28fsl

[0650] EX4 2 383_386delAGTG Pathogenic

[0651] 8 45X Deletion / In 1 (1)

[0652] 8

[0653] sertion

[0654] 1 Nontruncat

[0655] 8 Cysl29Ar Likely

[0656] EX4 2 385T> C ing:

[0657] 9 1 (1 g Pathogenic ) 9 Missense

[0658] Truncating

[0659] 1

[0660] 9 Cysl3 lfs4

[0661] EX4 3 393_394delTG Pathogenic

[0662] 0 7X Deletion / In 1 (1)

[0663] 1

[0664] sertion

[0665] 1 Nontruncat

[0666] 9

[0667] EX4 3 400G> C Alal34Pro VUS

[0668] 1 ing: 1 (1)

[0669] 4 Missense

[0670] 1

[0671] 9 Truncating

[0672] EX4 3 412C>T Argl38X Pathogenic

[0673] 2: Nonsense 3 (2)

[0674] 8

[0675] 1 Nontruncat

[0676] 9 Trpl39Cy Likely

[0677] EX4 3 417G> T ing:

[0678] 3 s Pathogenic 1 (1)

[0679] 9 Missense

[0680] 1 Nontruncat

[0681] 9 Alal40Va Likely

[0682] EX4 4 419C>T ing:

[0683] 4 1 Benign - (1)

[0684] 0 Missense

[0685] 1

[0686] 9 G1U141G1 Synonymo Likely

[0687] EX4 4 423G>A

[0688] 5 u us Benign - (1)

[0689] 1

[0690] 1 Nontruncat

[0691] 9 Cysl55Ty Likely

[0692] EX4 5 464G> A ing:

[0693] 6 r Pathogenic 1 (1)

[0694] 5 Missense

[0695] 1 Nontruncat

[0696] 9 Glyl57Gl Likely

[0697] EX4 5 470G> A ing:

[0698] 7 u Benign - (1)

[0699] 7 Missense

[0700] Truncating

[0701] 1

[0702] 9 Alal62fsl

[0703] EX4 6 485delC Pathogenic

[0704] 8 27X Deletion / In 1 (1)

[0705] 2

[0706]

[0707] sertion

[0708] 27

[0709] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0710] 1 Nontruncat

[0711] 9 Gin 164 Ar Likely

[0712] EX4 6 491A> G ing:

[0713] 9 g Benign - (2)

[0714] 4 Missense

[0715] 1 1 Nontruncat

[0716] Glyl68Al Likely

[0717] 0 EX4 6 503G> C ing:

[0718] a Benign - (1)

[0719]

[0720] 0 8 Missense

[0721] I

[0722] 1 1 Glyl77fs 2 V Pathoge 0 7 529+lG> A Truncating Splice

[0723] s nic (2 1 7

[0724] 4 ) I

[0725] 1 1 Glyl77fs Likely 1 V

[0726] 0 7 529+5G> A Nontrunca Splice Pathoge s (1 2 7 ting: nic

[0727] 4 ) I

[0728] 1 1

[0729] V Likely Likely 0 7 529+10G> A Silent

[0730] s Silent IVS Benign (1 3 7

[0731] 4 ) I

[0732] 1 1

[0733] V Likely Likely 0 7 530-26insCC Silent

[0734] s Silent IVS Benign (1 4 7

[0735] 4 ) 1 E 1 Likely 1

[0736] Nontruncating:

[0737] 0 X 8 548G> A Cysl83Tyr Pathoge Missense (1 5 5 3 nic ) 1 E 1 1

[0738] Truncating: Pathoge 0 X 8 566C>A Serl89X

[0739] Nonsense nic (1 6 5 9 ) 1 E 1

[0740] Likely 0 X 9 570C> T Gly 190Gly Synonymous

[0741] Benign (1 7 5 0 ) 1 E 1

[0742] Nontruncating: Likely 0 X 9 580G> A Alal94Thr

[0743] Missense Benign (1 8 5 4 ) 1 E 1 Truncating: 1

[0744] Vall95fs9 Pathoge 0 X 9 585delG Deletion / Insert

[0745] 4X nic (1 9 5 5 ion ) 1 E 1

[0746] Likely 1 X 9 588C>T Serl96Ser Synonymous

[0747] Benign (2 0 5 6 ) 1 E 2

[0748] Nontruncating: Likely 1 X 0 603C>G His201Gln

[0749] Missense Benign (2

[0750]

[0751] 1 5 1 )

[0752] 28

[0753] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0754] 1 E 2

[0755] Likely 1 X 0 603C>T His201His Synonymous

[0756] Benign (1 2 5 1 ) 1 E 2 Truncating: 1

[0757] Gln206fs5 Pathoge 1 X 0 616_617insC Deletion / Insert

[0758] 5X nic (1 3 5 6 ion ) 1 E 2 Truncating: 1

[0759] Pro207fs5 Pathoge 1 X 0 617_618insA Deletion / Insert

[0760] 4X nic (1 4 5 7 ion ) 1 E 2 Truncating: 1

[0761] Ala209fs5 Pathoge 1 X 0 627_628insC Deletion / Insert

[0762] IX nic (1 5 5 9 ion ) 1 E 2 Truncating: 1

[0763] Ala209fs7 Pathoge 1 X 0 627_633delCTGCAGC Deletion / Insert

[0764] 8X nic (1 6 5 9 ion ) 1 E 2 Likely 1

[0765] Cys210Gl Nontruncating:

[0766] 1 X 1 628T> G Pathoge (1 y Missense

[0767] 7 5 0 nic ) 1 E 2 Likely 1

[0768] Nontruncating:

[0769] 1 X 1 629G> A Cys210Tyr Pathoge Missense (1 8 5 0 nic ) 1 E 2 Likely 1

[0770] Cys210Ph Nontruncating:

[0771] 1 X 1 629G> T Pathoge e Missense (1 9 5 0 nic ) 1 E 2 Truncating: 3 Ser211fs5 Pathoge 2 X 1 631_632insTGCA Deletion / Insert

[0772] OX (2 nic

[0773] 0 5 1 ion ) 1 E 2

[0774] Likely 2 X 1 633OT Ser211Ser Synonymous

[0775] Benign (1 1 5 1 ) 1 E 2 1

[0776] Nontruncating:

[0777] 2 X 1 634G> A Ala212Thr VUS Missense (1 2 5 2 ) 1 E 2 661 701delCTCGCAGCCCT Truncating: 1

[0778] CLeu221fs Pathoge 2 X 2 CTCGGAGCAGGG (SEQ ID Deletion / Insert

[0779] 26X nic (1 3 5 1 NO:5) ion ) 1 E 2

[0780] Likely 2 X 2 669C>T Ala223Ala Synonymous

[0781] Benign (1 4 5 3 ) 1 E 2 Truncating: 1

[0782] Ser225fs3 Pathoge 2 X 2 673_674delTC Deletion / Insert

[0783] 4X nic (1 5 5 5 ion ) 1 E 2 1

[0784] Truncating: Pathoge 2 X 2 674C>A Ser225X

[0785] Nonsense nic (1

[0786]

[0787] 6 5 5 )

[0788] 29

[0789] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0790] 1 E 2 1

[0791] Nontruncating:

[0792] 2 X 2 674C>T Ser225Leu

[0793] Missense vus (1 7 5 5 ) 1 E 2 2 Truncating: Pathoge 2 X 2 679C>T Gln227X

[0794] Nonsense nic (2 8 5 7 ) 1 E 2 Likely 2 Nontruncating:

[0795] 2 X 3 688T> A Cys230Ser Pathoge Missense (2 9 5 0 nic ) 1 E 2 1

[0796] Truncating: Pathoge 3 X 3 690C>A Cys230X

[0797] Nonsense nic (1 0 5 0 ) 1 E 2 Likely 1

[0798] Nontruncating:

[0799] 3 X 3 695G> A Cys232Tyr Pathoge Missense (1 1 5 2 nic ) 1 E 2 1

[0800] Truncating: Pathoge 3 X 3 706C>T Gln236X

[0801] Nonsense nic (1 2 5 6 ) 1 E 2 Truncating: 1

[0802] Phe242fsl Pathoge 3 X 4 726_727insT Deletion / Insert

[0803] 8X nic (1 3 4 2 ion ) 1 E 2

[0804] Likely 3 X 4 726T> C Phe242Phe Synonymous

[0805] Benign (1 4 5 2 ) 1 E 2

[0806] Leu247Ph Nontruncating: Likely 3 X 4 739C> T (2 e Missense Benign 5 5 7 ) 1 E 2 Truncating: 1

[0807] Pro252fs8 Pathoge 3 X 5 755_756insC Deletion / Insert

[0808] X nic (1 6 5 2 ion ) 1 E 2 1

[0809] Nontruncating:

[0810] 3 X 5 755C>G Pro252Arg VUS Missense (1 7 5 2 ) 1 E 2

[0811] Likely 3 X 5 759A> G Pro253Pro Synonymous

[0812] Benign (2 8 5 3 ) 1 E 2 1

[0813] Nontruncating:

[0814] 3 X 5 776G> A Cys259Tyr VUS Missense (1 9 5 9 ) 1 E 2

[0815] Likely 4 X 6 789C>T Thr263Thr Synonymous

[0816] Benign (1 0 5 3 ) 1 E 2 3 Truncating: Pathoge 4 X 6 796C>T Gln266X

[0817] Nonsense nic (3

[0818]

[0819] 1 5 6 )

[0820] 30

[0821] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0822] 1 E 2 Likely 2 Ala271As Nontruncating:

[0823] 4 X 7 812C>A Pathoge 2 1 P Missense (2 5 nic ) 1 E 2

[0824] Likely 4 X 7 825C>T Ala275Ala Synonymous

[0825] Benign (1 3 5 5 ) 1 E 2

[0826] Nontruncating: Likely 4 X 7 827C>T Thr276Ile

[0827] Missense Benign (1 4 5 6 ) 1 E 2

[0828] Likely 4 X 7 837G> A Gly279Gly Synonymous

[0829] Benign (1 5 5 9 ) 1 E 2 Truncating: 1

[0830] Pro280fs9 Pathoge 4 X 8 837_838insG Deletion / Insert

[0831] OX nic (1 6 5 0 ion ) 1 E 2 1

[0832] Nontruncating:

[0833] 4 X 8 854C>T Ala285Val VUS Missense (1 7 5 5 ) 1 E 2 Truncating: 6 Ser286fsl Pathoge 4 X 8 856_862delTCTGGCC Deletion / Insert

[0834] X nic (3 8 5 6 ion ) 1 E 2 1

[0835] Truncating: Pathoge 4 X 8 862C>T Gln288X

[0836] Nonsense nic (1 9 5 8 ) 1 E 2

[0837] Nontruncating: Likely 5 X 9 871G> T Ala291Ser

[0838] Missense Benign (1 0 5 1 ) 1 E 3 Truncating: 1

[0839] Trp305fs2 Pathoge 5 X 0 912 913insAG Deletion / Insert

[0840] 9X nic (1 1 5 5 ion ) 1 E 3 Truncating: 1

[0841] Trp305fs2 Pathoge 5 X 0 913_914insAG Deletion / Insert

[0842] 9X nic (1 2 5 5 ion ) 1 E 3 Truncating: 1

[0843] Trp305fs2 Pathoge 5 X 0 913_914insCT Deletion / Insert

[0844] 8X nic (1 3 5 5 ion ) 1 E 3 Likely 2 Nontruncating:

[0845] 5 X 0 915G> T Trp305Cys Pathoge Missense (1 4 5 5 nic ) 1 E 3 Truncating: 1

[0846] Asp309fs5 Pathoge 5 X 0 926_939dell4 Deletion / Insert

[0847] 6X nic (1 5 5 9 ion ) 1 E 3

[0848] Likely 5 X 1 933C>T Ser311Ser Synonymous

[0849] Benign (1

[0850]

[0851] 6 5 1 )

[0852] 31

[0853] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0854] 1 E 3 1

[0855] Truncating: Pathoge 5 X 1 937G> T Glu313X

[0856] Nonsense nic (1 7 5 3 ) 1 E 3 Ala320_Al Nontruncating: Likely 1 5 X 2 959_960insGAG a321insAl Deletion / Insert Pathoge (1 8 5 0 a ion nic ) 1 E 3 960 980delTGCCTCGCATC Nontruncating: 1

[0857] Ala321 Le Pathoge 5 X 2 GCTATGTGCT (SEQ ID Deletion / Insert

[0858] u327del7 nic (1 9 5 0 NO:6) ion ) 1 E 3 Nontruncating: 1

[0859] Ala321_Al Pathoge 6 X 2 962_1006del45 Deletion / Insert

[0860] a335dell5 nic (1 0 5 1 ion ) 1 E 3 Likely 1

[0861] Nontruncating:

[0862] 6 X 2 967C> G His323Asp Pathoge Missense (1 1 5 3 nic ) 1 E 3 1

[0863] Nontruncating:

[0864] 6 X 2 968A> G His323Arg VUS Missense (1 2 5 3 ) 1 E 3

[0865] Arg324Le Nontruncating: Likely 6 X 2 971G> T

[0866] u Missense Benign (4 3 5 4 ) 1 E 3 Likely 9 Nontruncating:

[0867] 6 X 2 974A> G Tyr325Cys Pathoge Missense (3 4 5 5 nic ) 1 E 3 Truncating: 1

[0868] Tyr331fs2 Pathoge 6 X 3 993delT Deletion / Insert

[0869] X nic (1 5 5 1 ion ) 1 E 3

[0870] Likely 6 X 3 996C>T His332His Synonymous

[0871] Benign (2 6 5 2 ) 1 E 3 Truncating: 1

[0872] Leu337fs2 Pathoge 6 X 3 1009 1015delCTGGCCC Deletion / Insert

[0873] 18X nic (1 7 5 7 ion ) 1 E 3

[0874] Likely 6 X 4 1023C>T Ala341Ala Synonymous

[0875] Benign (1 8 5 1 0) 1 E 3 2 Truncating: Pathoge 6 X 5 1051C>T Gln351X

[0876] Nonsense nic (2 9 5 1 ) 1 E 3 1087 1144delTGCCCGTCC Truncating: 1

[0877] ACys363fs Pathoge 7 X 6 TCGGTGCAGAGTG (SEQ Deletion / Insert

[0878] 82X nic (1 0 5 3 ID NO: 7) ion ) 1 E 3

[0879] Likely 7 X 6 1104G> A Gln368Gln Synonymous

[0880] Benign (1

[0881]

[0882] 1 5 8 )

[0883] 32

[0884] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0885] 1 E 3 Truncating: 1

[0886] Pathoge 7 X 6 1105 1106delAG Ser369fsX Deletion / Insert

[0887] nic (1 2 5 9 ion ) 1 E 3 1

[0888] Truncating: Pathoge 7 X 7 1111G> T Glu371X

[0889] Nonsense nic (1 3 5 1 ) 1 E 3

[0890] Nontruncating: Likely 7 X 7 1115G> A Ser372Asn

[0891] Missense Benign (1 4 5 2 ) 1 E 3

[0892] Nontruncating: Likely 7 X 7 1117C>G Leu373Val

[0893] Missense Benign (1 5 5 3 ) 1 E 3

[0894] Leu373Le Likely 7 X 7 1119T> C Synonymous

[0895] u Benign (1 6 5 3 0) 1 E 3 1

[0896] Asn379Ly Nontruncating:

[0897] 7 X 7 1137C>G VUS

[0898] s Missense (1 7 5 9 ) 1 E 3 Likely 7

[0899] Nontruncating:

[0900] 7 X 8 1141G> A Gly381Ser Pathoge Missense (3 8 5 1 nic ) 1 E 3 Likely 1

[0901] Gly381Cy Nontruncating:

[0902] 7 X 8 1141G> T Pathoge s Missense (1 9 5 1 nic ) 1 E 3 1

[0903] Gly382As Nontruncating:

[0904] 8 X 8 1145G> A VUS Missens (1 0 5 2 P e

[0905] ) 1 E 3 Likely 1

[0906] Nontruncating:

[0907] 8 X 8 1166A> G Tyr389Cys Pathoge Missense (1 1 5 9 nic ) 1 E 3

[0908] Likely 8 X 9 1173C>T Ile391Ile Synonymous

[0909] Benign (1 2 5 1 ) 1 E 3

[0910] Likely 8 X 9 1185C>T Gly395Gly Synonymous

[0911] Benign (1 3 5 5 ) 1 E 4 5

[0912] Truncating: Pathoge 8 X 0 1198C>T Arg400X

[0913] Nonsense nic (2 4 5 0 ) I

[0914] 1 4

[0915] V Likely Likely 8 0 1202-48C>A Silent

[0916] s Silent IVS Benign (1 5 1

[0917] 5 ) 1 4 Ala401fs Likely 1 I

[0918] 8 0 1202-9G> A Nontrunca Splice Pathoge V (1

[0919]

[0920] 6 1 ting: nic )

[0921] 33

[0922] 57068938 1Attorney Docket No. 047162-7549WOl(02845) s

[0923] 5

[0924] 1 E 4

[0925] Nontruncating: Likely 8 X 0 1202C>T Ala401Val

[0926] Missense Benign (1 7 6 1 ) 1 E 4

[0927] Likely 8 X 0 1209C>T His403His Synonymous

[0928] Benign (2 8 6 3 ) 1 E 4 2 Nontruncating:

[0929] 8 X 0 1211C>G Pro404Arg VUS Missense (2 9 6 4 ) 1 E 4

[0930] Asn416As Likely 9 X 1 1248C>T Synonymous

[0931] n Benign (1 0 6 6 ) 1 E 4 Likely 1

[0932] Nontruncating:

[0933] 9 X 2 1259A> C Tyr420Ser Pathoge Missense (1 1 6 0 nic ) 1 E 4 Likely 1

[0934] Nontruncating:

[0935] 9 X 2 1259A> G Tyr420Cys Pathoge Missense (1 2 6 0 nic ) 1 E 4 Truncating: 1

[0936] Arg421fs9 Pathoge 9 X 2 1261_1262delCG Deletion / Insert

[0937] 6X nic (1 3 6 1 ion ) 1 E 4 Nontruncating: 2 9 X 2 1273_1275delGAG Glu425del Deletion / Insert VUS (1 4 6 5 ion ) 1 E 4

[0938] Likely 9 X 2 1281G> A Ala427Ala Synonymous

[0939] Benign (1 5 6 7 ) 1 E 4 Likely 1

[0940] Nontruncating:

[0941] 9 X 2 1286G> T Trp429Leu Pathoge Missense (1 6 6 9 nic ) 1 E 4 Truncating: 1

[0942] Gln431fs8 Pathoge 9 X 3 1291 1292insG Deletion / Insert

[0943] 7X nic (1 7 6 1 ion ) 1 E 4 Likely 2 Nontruncating:

[0944] 9 X 3 1294G> A Ala432Thr Pathoge Missense (1 8 6 2 nic ) 1 E 4 Likely 2 Nontruncating:

[0945] 9 X 3 1295C>T Ala432Val Pathoge Missense (2 9 6 2 nic ) 2 E 4 Likely 1

[0946] Cys436Ar Nontruncating:

[0947] 0 X 3 1306T> C Pathoge (1 g Missense

[0948]

[0949] 0 6 6 nic

[0950] 34

[0951] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0952] 2 E 4 Truncating: 1

[0953] Cys436fs83 Pathoge 0 X 3 1307_1308delGT Deletion / Insert

[0954] X nic (1 1 6 6 ion ) 2 E 4 Likely 1

[0955] Nontruncating:

[0956] 0 X 3 1307G> A Cys436Tyr Pathoge Missense (1 2 6 6 nic ) 2 E 4 Likely 1

[0957] Nontruncating:

[0958] 0 X 3 1308T> G Cys436Trp Pathoge Missense (1 3 6 6 nic ) 2 E 4

[0959] Likely 0 X 4 1323G> A Gly441Gly Synonymous

[0960] Benign (3 4 6 1 ) 2 E 4 Likely 1

[0961] Nontruncating:

[0962] 0 X 4 1324G> C Ala442Pro Pathoge Missense (1 5 6 2 nic ) 2 E 4

[0963] Likely 0 X 4 1326C>T Ala442Ala Synonymous

[0964] Benign (1 6 6 2 ) 2 E 4

[0965] Likely 0 X 4 1335A> G Ala445Ala Synonymous

[0966] Benign (1 7 6 5 ) 2 E 4 Truncating: 1

[0967] Pro450fsl4 Pathoge 0 X 5 1350delC Deletion / Insert

[0968] X nic (1 8 6 0 ion ) 2 E 4

[0969] Nontruncating: Likely 0 X 5 1354G> A Val452Met

[0970] Missense Benign (1 9 6 2 ) 2 E 4 1

[0971] Truncating: Pathoge 1 X 5 1357C>T Gln453X

[0972] Nonsense nic (1 0 6 3 ) 2 E 4 1

[0973] Nontruncating:

[0974] 1 X 5 1360C>T Arg454Cys VUS Missense (1 1 6 4 ) 2 E 4 1

[0975] Nontruncating:

[0976] 1 X 5 1361G> C Arg454Pro VUS Missense (1 2 6 4 ) 2 E 4

[0977] Likely 1 X 5 1368G> T Leu456Leu Synonymous

[0978] Benign (1 3 6 6 ) 2 E 4 Likely 1

[0979] Nontruncating:

[0980] 1 X 6 1379T> A Val460Asp Pathoge Missense (1 4 6 0 nic ) 2 E 4 Likely 1

[0981] Nontruncating:

[0982] 1 X 6 1379T> C Val460Ala Pathoge Missense (1

[0983]

[0984] 5 6 0 nic )

[0985] 35

[0986] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[0987] I

[0988] 2 4

[0989] V Likely Likely 1 6 1385+26C>T Silent

[0990] s Silent IVS Benign (3 6 2

[0991] 6 ) I

[0992] 2 4

[0993] V Likely Likely 1 6 1386-71G> A Silent

[0994] s Silent IVS Benign (1 7 2

[0995] 6 ) I

[0996] 2 4 1 V Unknown

[0997] 1 6 1386-16C>A Unknown VUS

[0998] s IVS (1 8 2

[0999] 6 ) 2 E 4 2

[1000] Nontruncating:

[1001] 1 X 6 1396G> A Val466Met VUS Missense (2 9 7 6 ) 2 E 4 2

[1002] Nontruncating:

[1003] 2 X 6 1396G> C Val466Leu VUS Missense (2 0 7 6 ) 2 E 4 1

[1004] Truncating: Pathoge 2 X 6 1401G> A Trp467X

[1005] Nonsense nic (1 1 7 7 ) 2 E 4 1

[1006] Nontruncating:

[1007] 2 X 7 1412C>T Ser471Leu VUS Missense (1 2 7 1 ) 2 E 4 Truncating: 1

[1008] Val476fs42 Pathoge 2 X 7 1426_1427insG Deletion / Insert

[1009] X nic (1 3 7 6 ion ) 2 E 4 1

[1010] Nontruncating:

[1011] 2 X 7 1430A> T Glu477Val VUS Missense (1 4 7 7 ) 2 E 5 1510 151 linsGGGGAGCC Truncating: 1

[1012] Thr504fs20 Pathoge 2 X 0 ACACCCAGCCA (SEQ ID Deletion / Insert

[1013] X nic (1 5 7 4 NO:8) ion ) 2 E 5 2

[1014] Truncating: Pathoge 2 X 0 1516G> T Glu506X

[1015] Nonsense nic (1 6 7 6 ) 2 E 5 Likely 5

[1016] Nontruncating:

[1017] 2 X 0 1522T> C Cys508Arg Pathoge (5

[1018] Missense

[1019] 7 7 8 nic ) 2 E 5 1

[1020] Truncating: Pathoge 2 X 0 1524C>A Cys508X

[1021] Nonsense nic (1 8 7 8 ) 2 E 5

[1022] Nontruncating: Likely 2 X 0 1525G> A Val509Ile

[1023] Missense Benign (1

[1024]

[1025] 9 7 9 )

[1026] 36

[1027] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1028] 2 E 5

[1029] Nontruncating: Likely 3 X 1 1528C>T Arg510Trp

[1030] Missense Benign (1 0 7 0 ) 2 E 5

[1031] Likely 3 X 1 1533C>T Leu511Leu Synonymous

[1032] Benign (1 1 7 1 ) 2 E 5

[1033] Likely 3 X 1 1539C>T Pro513Pro Synonymous

[1034] Benign (2 2 7 3 ) 2 E 5 Likely 2

[1035] Nontruncating:

[1036] 3 X 1 1543G> A Gly515Arg Pathoge Missense (1 3 7 5 nic ) 2 E 5 Likely 1

[1037] Nontruncating:

[1038] 3 X 1 1543G> T Gly515Trp Pathoge Missense (1 4 7 5 nic ) 2 E 5

[1039] Likely 3 X 1 1557C>T Thr519Thr Synonymous

[1040] Benign (1 5 7 9 ) 2 E 5 Truncating: 1

[1041] Cys522fs36 Pathoge 3 X 2 1564delT Deletion / Insert

[1042] X nic (1 6 7 2 ion ) 2 E 5 Likely 1

[1043] Nontruncating:

[1044] 3 X 2 1576C>G His526Asp Pathoge Missense (1 7 7 6 nic ) 2 E 5 Likely 2

[1045] Nontruncating:

[1046] 3 X 2 1583A> G Tyr528Cys Pathoge (2

[1047] Missense

[1048] 8 7 8 nic ) 2 E 5 Likely 1

[1049] Nontruncating:

[1050] 3 X 3 1589G> A Cys530Tyr Pathoge Missense (1 9 7 0 nic ) 2 E 5 Likely 1

[1051] Nontruncating:

[1052] 4 X 3 1590C>G Cys530Trp Pathoge Missense (1 0 7 0 nic ) 2 E 5

[1053] Nontruncating: Likely 4 X 3 1594C>G Leu532Val

[1054] Missense Benign (1 1 7 2 ) 2 E 5 2

[1055] Truncating: Pathoge 4 X 3 1597C>T Gln533X

[1056] Nonsense nic (2 2 7 3 ) 2 E 5

[1057] Likely 4 X 3 1602C> T Pro534Pro Synonymous

[1058] Benign (1 3 7 4 ) 2 E 5 Gly536Ser Likely 1 4 X 3 1606G> A Nontruncati Splice Pathoge (1

[1059]

[1060] 4 7 6 _ nic )

[1061] 37

[1062] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1063] I

[1064] 2 5 3 V Arg462fs Pathoge 4 3 16O6+1G> A Splice

[1065] s Truncating: nic (3 5 6

[1066] 7 ) I

[1067] 2 5 1 V Arg462fs Pathoge 4 3 1606+2T> C Splice

[1068] s Truncating: nic (1 6 6

[1069] 7 ) I

[1070] 2 5

[1071] V Likely Likely 4 3 1607-39C>T Silent

[1072] s Silent IVS Benign (1 7 6

[1073] 7 ) I

[1074] 2 5

[1075] V Likely Likely 4 3 1607-27C>T Silent

[1076] s Silent IVS Benign (2 8 6

[1077] 7 ) 2 E 5 Truncating: 1

[1078] Pathoge 4 X 3 1609_1723-44del Pro537fs Large

[1079] nic (1 9 8 7 Rearrangement ) 2 E 5

[1080] Nontruncating: Likely 5 X 4 1621G> C Ala541Pro

[1081] Missense Benign (1 0 8 1 ) 2 E 5 1

[1082] Nontruncating:

[1083] 5 X 4 1625A> G Glu542Gly VUS Missense (1 1 8 2 ) 2 E 5 Nontruncating: Likely 1 5 X 4 1637_1639delTGG Val546del Deletion / Insert Pathoge (1 2 8 6 ion nic ) 2 E 5 Truncating: 1

[1084] Glu554fs32 Pathoge 5 X 5 1659_1660insG Deletion / Insert

[1085] X nic (1 3 8 3 ion ) 2 E 5 Truncating: 1

[1086] Gly555fs31 Pathoge 5 X 5 1664_1665delGA Deletion / Insert

[1087] X nic (1 4 8 5 ion ) 2 E 5

[1088] Nontruncating: Likely 5 X 5 1666C>T Pro556Ser

[1089] Missense Benign (1 5 8 6 ) 2 E 5 Truncating: 4

[1090] Leu557fs27 Pathoge 5 X 5 1670delT Deletion / Insert

[1091] X nic (1 6 8 7 ion ) 2 E 5

[1092] Likely 5 X 5 1674G> A Thr558Thr Synonymous

[1093] Benign (1 7 8 8 ) 2 E 5 2

[1094] Truncating: Pathoge 5 X 6 1684C>T Gln562X

[1095] Nonsense nic (1

[1096]

[1097] 8 8 2 )

[1098] 38

[1099] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1100] 2 E 5 1

[1101] Truncating: Pathoge 5 X 6 1687C>T Gln563X

[1102] Nonsense nic (1 9 8 3 ) 2 E 5

[1103] Likely 6 X 6 1692C>T Asp564Asp Synonymous

[1104] Benign (1 0 8 4 ) 2 E 5 Truncating: 1

[1105] Pro569fsl4 Pathoge 6 X 6 1706delC Deletion / Insert

[1106] X nic (1 1 8 9 ion ) 2 E 5

[1107] Likely 6 X 7 1710C>T His570His Synonymous

[1108] Benign (5 2 8 0 ) 2 E 5

[1109] Nontruncating: Likely 6 X 7 1714C>T Pro572Ser

[1110] Missense Benign (6 3 8 2 ) 2 E 5 1

[1111] Nontruncating:

[1112] 6 X 7 1717G> A Val573Met VUS Missense (1 4 8 3 ) I

[1113] 2 5 1 V Val575fs Pathoge 6 7 1722+1G> A Splice

[1114] s Truncating: nic (1 5 4

[1115] 8 ) I

[1116] 2 5

[1117] V Likely Likely 6 7 1722+23C>T Silent

[1118] s Silent IVS Benign (1 6 4

[1119] 8 ) I

[1120] 2 5 1 V Val575fs Pathoge 6 7 1723-2A> C Splice

[1121] s Truncating: nic (1 7 4

[1122] 8 ) 2 E 5 Likely 1

[1123] Nontruncating:

[1124] 6 X 7 1730T> G Val577Gly Pathoge Missense (1 8 9 7 nic ) 2 E 5 Likely 1

[1125] Nontruncating:

[1126] 6 X 7 1736C>A Pro579Gln Pathoge Missense (1 9 9 9 nic ) 2 E 5

[1127] Likely 7 X 7 1737G> A Pro579Pro Synonymous

[1128] Benign (1 0 9 9 ) 2 E 5 Truncating: 1

[1129] Pathoge 7 X 8 1755_1756insT Glu586fsX Deletion / Insert

[1130] nic (1 1 9 6 ion ) 2 E 5

[1131] Nontruncating: Likely 7 X 8 1758A> C Glu586Asp

[1132] Missense Benign (2

[1133]

[1134] 2 9 6 )

[1135] 39

[1136] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1137] 2 E 5 Truncating: 1

[1138] Thr590fsl9 Pathoge 7 X 9 1768delA Deletion / Insert

[1139] 4X nic (1 3 9 0 ion ) 2 E 5 Truncating: 1

[1140] Thr591fsl9 Pathoge 7 X 9 1772delC Deletion / Insert

[1141] 4X nic (1 4 9 1 ion ) 2 E 5 Truncating: 1

[1142] Glu593fsl9 Pathoge 7 X 9 1779delA Deletion / Insert

[1143] IX nic (1 5 9 3 ion ) 2 E 5 1

[1144] Nontruncating:

[1145] 7 X 9 1781T> A Phe594Tyr VUS Missense (1 6 9 4 ) 2 E 6

[1146] Nontruncating: Likely 7 X 0 1801C>T Arg601Trp

[1147] Missense Benign (1 7 9 1 ) 2 E 6 Likely 1

[1148] Nontruncating:

[1149] 7 X 0 1814T> G Leu605Arg Pathoge Missense (1 8 9 5 nic ) 2 E 6 1

[1150] Nontruncating:

[1151] 7 X 0 1826T> G Val609Gly VUS Missense (1 9 9 9 ) 2 E 6 Truncating: 1

[1152] Tyr610fsl6 Pathoge 8 X 1 1829_1830insT Deletion / Insert

[1153] X nic (1 0 9 0 ion ) 2 E 6 Likely 1

[1154] Nontruncating:

[1155] 8 X 1 1829A> G Tyr610Cys Pathoge Missense (1 1 9 0 nic ) 2 E 6 Likely 4

[1156] Nontruncating:

[1157] 8 X 1 1831OT Arg611Trp Pathoge Missense (2 2 9 1 nic ) 2 E 6 Truncating: 1

[1158] Ala616fsl6 Pathoge 8 X 1 1846delG Deletion / Insert

[1159] 8X nic (1 3 9 6 ion ) I

[1160] 2 6 1 V Val575fs Pathoge 8 1 1849+1G> T Splice

[1161] s Truncating: nic (1 4 7

[1162] 9 ) I

[1163] 2 6 1 V Unknown

[1164] 8 1 1849+5G> A,+6A> T Unknown VUS

[1165] s IVS (1 5 7

[1166] 9 ) I

[1167] 2 6 1849+14 +27delTGGTGG

[1168] V Likely Likely 8 1 GTGGTGGG (SEQ ID Silent (2 s Silent IVS Benign 6 7 NO:9)

[1169] 9 )

[1170]

[1171] 40

[1172] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1173] I

[1174] 2 6

[1175] V 1849+18_+24delGGGTGG Likely Likely 8 1 Silent

[1176] s T Silent IVS Benign (1 7 7

[1177] 9 ) I

[1178] 2 6 Gly617? 1 V

[1179] 8 1 1849+19G> A Nontruncati Splice VUS

[1180] s (1 8 7

[1181] 9 ng: ) I

[1182] 2 6 1849+21 +34delTGGTGG

[1183] V Likely Likely 8 1 GTGGTGGG (SEQ ID Silent

[1184] s Silent IVS Benign (1 9 7 NO:10)

[1185] 9 ) I

[1186] 2 6 1 V Unknown

[1187] 9 1 1849+21T> A Unknown VUS

[1188] s IVS (1 0 7

[1189] 9 ) I

[1190] 2 6

[1191] V Likely Likely 9 1 1849+23G> A Silent

[1192] s Silent IVS Benign (1 1 7

[1193] 9 ) I

[1194] 2 6

[1195] V Likely Likely 9 1 1849+26G> A Silent

[1196] s Silent IVS Benign (1 2 7

[1197] 9 ) I

[1198] 2 6

[1199] V Likely Likely 9 1 1849+28_34delTGGTGGG Silent

[1200] s Silent IVS Benign (5 3 7

[1201] 9 ) I

[1202] 2 6

[1203] V Likely Likely 9 1 1849+30G> A Silent

[1204] s Silent IVS Benign (1 4 7

[1205] 9 ) I

[1206] 2 6

[1207] V Likely Likely 9 1 1849+67T> C Silent

[1208] s Silent IVS Benign (1 5 7

[1209] 9 ) I

[1210] 2 6

[1211] V Likely Likely 9 1 1849+91A> G Silent

[1212] s Silent IVS Benign (1 6 7

[1213] 9 ) I

[1214] 2 6

[1215] V Likely Likely 9 1 1850-44G> C Silent

[1216] s Silent IVS Benign (2 7 7

[1217]

[1218] 9 )

[1219] 41

[1220] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1221] I

[1222] 2 6

[1223] V Likely Likely 9 1 1850-27G> A Silent

[1224] s Silent IVS Benign (1 8 7

[1225] 9 ) I

[1226] 2 6

[1227] V Likely Likely 9 1 1850-4A> G Silent

[1228] Benig (7 s Silent IVS n 9 7

[1229] 9 ) I

[1230] 3 6

[1231] V Likely Likely 0 1 1850-4A> T Silent

[1232] s Silent IVS Benign (1 0 7

[1233]

[1234] 9 )

[1235] 3 6 1 IVS Gly617fs Pathog 0 1 1850-2A> G Splice

[1236] 9 Truncating: enic (1 1 7 ) 3 6

[1237] EXI Likely 0 2 1863C>T Asn621Asn Synonymous

[1238] 0 Benign (1 2 1 ) 3 6

[1239] EXI Nontruncatin Likely 0 2 1870G> A Glu624Lys

[1240] 0 g: Missense Benign (1 3 4 ) 3 6

[1241] EXI Nontruncatin Likely 0 2 1885T> A Ser629Thr

[1242] 0 g: Missense Benign (1 4 9 ) 3 6

[1243] EXI Nontruncatin Likely 0 2 1886C> T Ser629Phe

[1244] 0 g: Missense Benign (1 5 9 ) 3 6

[1245] EXI Nontruncatin Likely 0 3 1910C>T Ala637Val

[1246] 0 g: Missense Benign (1 6 7 ) 3 6 Truncating: 1 EXI Pro638fsl4 Pathog 0 3 1914delC Deletion / Inse

[1247] 0 6X enic (1 7 8 rtion ) 3 6 1921_1949delATGCCAGG Truncating: 1 EXI CMet641fs Pathog 0 4 GGGACGCTGGTGC (SEQ Deletion / Inse

[1248] 0 62X enic (1 8 1 ID NO: 11) rtion ) 3 6

[1249] EXI Nontruncatin Likely 0 4 1922T> C Met641Thr

[1250] 0 g: Missense Benign (1 9 1 ) 3 6 Truncating: 1 EXI Pro642fs70 Pathog 1 4 1926_1927delAG Deletion / Inse

[1251] 0 X enic (1 0 2 rtion ) 3 6 1 EXI Truncating: Pathog 1 4 1930G> T Gly644X

[1252] 0 Nonsense enic (1

[1253]

[1254] 1 4 )

[1255] 42

[1256] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1257] 3 6

[1258] EXI Nontruncatin Likely 1 4 1942C>T Pro648Ser

[1259] 0 g: Missense Benign (1 2 8 ) 3 6

[1260] EXI Nontruncatin Likely 1 5 1964C>T Pro655Leu

[1261] 0 g: Missense Benign (1 3 5 ) 3 6 2 EXI Nontruncatin

[1262] 1 5 1967T> A Leu656Gln VUS

[1263] 0 g: Missense (1 4 6 ) 3 6 1 EXI Nontruncatin

[1264] 1 5 1972G> A Ala658Thr VUS

[1265] 0 g: Missense (1 5 8 ) 3 6 1 EXI Truncating: Pathog 1 6 1987C>T Gln663X

[1266] 0 Nonsense enic (1 6 3 ) 3 6 Truncating: 1 EXI Gln663fsl2 Pathog 1 6 1987delC Deletion / Inse

[1267] 0 IX enic (1 7 3 rtion ) 3 6

[1268] EXI Nontruncatin Likely 1 6 1996G> A Ala666Thr

[1269] 0 g: Missense Benign (1 8 6 ) 3 6 Truncating: 1 EXI Gly672fs40 Pathog 1 7 2016_2017insG Deletion / Inse

[1270] 0 X enic (1 9 2 rtion ) 3 6 Truncating: 1 EXI 2024_2025insGGCCAGGG Leu675fs41 Pathog 2 7 Deletion / Inse

[1271] 0 CT (SEQ ID NO: 12) X enic (1 0 5 rtion ) 3 6 Truncating: 1 EXI Tyr680fsl0 Pathog 2 8 2038delT Deletion / Inse

[1272] 0 5X enic (1 1 0 rtion ) 3 6

[1273] EXI Nontruncatin Likely 2 8 2039A> T Tyr680Phe

[1274] 0 g: Missense Benign (2 2 0 ) 3 6 Likely 1 EXI Nontruncatin

[1275] 2 8 2053G> A Glu685Lys Pathog

[1276] 0 g: Missense (1 3 5 enic ) 3 6 Truncating: 1 EXI Glu685fs27 Pathog 2 8 2054_2055delAG Deletion / Inse

[1277] 0 X enic (1 4 5 rtion ) 3 6 Truncating: 1 EXI Leu687fs97 Pathog 2 8 2059delC Deletion / Inse

[1278] 0 X enic (1 5 7 rtion ) 3 6 Likely 1 EXI Nontruncatin

[1279] 2 9 2069T> A Val690Asp Pathog

[1280] 0 g: Missense (1

[1281]

[1282] 6 0 enic )

[1283] 43

[1284] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1285] 3 6 Likely 1 EXI Nontruncatin

[1286] 2 9 2069T> G Val690Gly Pathog

[1287] 0 g: Missense (1 7 0 enic ) 3 6

[1288] EXI Likely 2 9 2073C>T Pro691Pro Synonymous

[1289] 0 Benign (1 8 1 ) 3 6 1 EXI Nontruncatin

[1290] 2 9 2074G> A Ala692Thr VUS

[1291] 0 g: Missense (1 9 2 ) 3 6 Truncating: 1 EXI Gly693fs91 Pathog 3 9 2079delG Deletion / Inse

[1292] 0 X enic (1 0 3 rtion ) 3 6 Truncating: 2 EXI Pro694fsl9 Pathog 3 9 2080_2081insG Deletion / Inse

[1293] 0 X enic (1 1 4 rtion ) 3 6

[1294] EXI Likely 3 9 2082C> T Pro694Pro Synonymous

[1295] 0 Benign (1 2 4 ) 3 6 Truncating: 9 EXI Ala696fsl7 Pathog 3 9 2085_2086insC Deletion / Inse

[1296] 0 X enic (7 3 6 rtion ) 3 6 Truncating: 2 EXI Ala696fs89 Pathog 3 9 2085delC Deletion / Inse

[1297] 0 X enic (2 4 6 rtion ) 3 6

[1298] EXI Nontruncatin Likely 3 9 2086G> A Ala696Thr

[1299] 0 g: Missense Benign (1 5 6 ) 3 6 2 EXI Truncating: Pathog 3 9 2089C> T Gln697X

[1300] 0 Nonsense enic (2 6 7 ) 3 6 Likely 4 EXI Nontruncatin

[1301] 3 9 2092T> G Tyr698Asp Pathog

[1302] 0 g: Missense (1 7 8 enic ) 3 6 1 IVS Ser699fsX Pathog 3 9 2097+1G>A Splice

[1303] 10 Truncating: enic (1 8 9 )

[1304] Ser699fs77

[1305] 3 6 1 IVS X Pathog 3 9 2096_2097+23del25 Splice

[1306] 10 Nontruncati enic (1 9 9

[1307] ng: ) 3 6

[1308] IVS Likely Likely 4 9 2098-29G> A Silent

[1309] 10 Silent IVS Benign (1 0 9 ) 3 6

[1310] IVS Likely Likely 4 9 2098-100T Silent

[1311] 10 Silent IVS Benign (1

[1312]

[1313] 1 9 )

[1314] 44

[1315] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1316] 3 6

[1317] IVS Likely Likely 4 9 2098-4G> A Silent

[1318] 10 Silent IVS Benign (1 2 9 ) 3 7

[1319] EXI Likely 4 0 2109C>T His703His Synonymous

[1320] 1 Benign (1 3 3 ) 3 7 1 EXI Truncating: Pathog 4 0 2113C>T Gln705X

[1321] 1 Nonsense enic (1 4 5 ) 3 7

[1322] EXI Nontruncatin Likely 4 1 2143G> T Val715Phe

[1323] 1 g: Missense Benign (1 5 5 ) 3 7 3 EXI Truncating: Pathog 4 1 2152C> T Gln718X

[1324] 1 Nonsense enic (2 6 8 ) 3 7

[1325] EXI Nontruncatin Likely 4 2 2176C> T Leu726Phe

[1326] 1 g: Missense Benign (1 7 6 ) 3 7 Likely 1 EXI Nontruncatin

[1327] 4 2 2180T> A Leu727Gln Pathog

[1328] 1 g: Missense (1 8 7 enic ) 3 7 Likely 21 EXI Nontruncatin

[1329] 4 2 2180T> C Leu727Pro Pathog

[1330] 1 g: Missense (7 9 7 enic ) 3 7 Likely 2 EXI Nontruncatin

[1331] 5 2 2180T> G Leu727Arg Pathog

[1332] 1 (2 g: Missense

[1333] 0 7 enic ) 3 7

[1334] EXI Likely 5 3 2190G> A Ser730Ser Synonymous

[1335] 1 Benign (1 1 0 ) 3 7

[1336] EXI Nontruncatin Likely 5 3 2192C> T Pro731Leu

[1337] 1 g: Missense Benign (1 2 1 ) EXI Truncating:

[1338] 3 7 Gly734 Pr 1 1- Large Pathog 5 3 2200_5946del5604insAC ol982dell2

[1339] EX1 Rearrangeme enic (1 3 4 48

[1340] 5 nt ) 3 7

[1341] EXI Likely 5 3 2214C> G Pro738Pro Synonymous

[1342] 1 Benign (4 4 8 ) 3 7 Truncating: 1 EXI Gln739fs48 Pathog 5 3 2215_2216insTGGTCCCC Deletion / Inse

[1343] 1 X enic (1 5 9 rtion ) 3 7

[1344] EXI Nontruncatin Likely 5 3 2216A> G Gln739Arg

[1345] 1 g: Missense Benign (9

[1346]

[1347] 6 9 )

[1348] 45

[1349] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1350] 3 7

[1351] EXI Nontruncatin Likely 5 4 2222C>T Pro741Leu

[1352] 1 g: Missense Benign (1 7 1 ) 3 7

[1353] EXI Nontruncatin Likely 5 4 2227C>T Leu743Phe

[1354] 1 g: Missense Benign (1 8 3 ) 3 7

[1355] EXI Likely 5 4 2235C>G Ala745Ala Synonymous

[1356] 1 Benign -(3 9 5 ) 3 7

[1357] EXI Nontruncatin Likely 6 4 2239G> A Ala747Thr

[1358] 1 g: Missense Benign (1 0 7 ) 3 7

[1359] EXI Likely 6 4 2244G> A Ser748Ser Synonymous

[1360] 1 Benign (1 1 8 ) 3 7

[1361] EXI Likely 6 4 2244G> C Ser748Ser Synonymous

[1362] 1 Benign (1 2 8 ) 3 7 1 EXI Truncating: Pathog 6 4 2246C>G Ser749X

[1363] 1 Nonsense enic (1 3 9 ) 3 7 1 EXI Nontruncatin

[1364] 6 5 2264C>T Pro755Leu VUS

[1365] 1 g: Missense (1 4 5 ) 3 7 2 EXI Truncating: Pathog 6 5 2269C>T Gln757X

[1366] 1 Nonsense enic (1 5 7 ) 3 7 1 EXI Nontruncatin

[1367] 6 6 2294C> T Pro765Leu VUS

[1368] 1 g: Missense (1 6 5 ) 3 7 Truncating: 3 EXI 2298_2308delCTGTGCCC Cys767fs27 Pathog 6 6 Deletion / Inse

[1369] 1 TGC (SEQ ID NO: 13) X enic (2 7 7 rtion ) 3 7 Truncating: 1 EXI Arg770fs27 Pathog 6 7 2308delC Deletion / Inse

[1370] 1 X enic (1 8 0 rtion ) 3 7

[1371] EXI Likely 6 7 2319A> G Ala773Ala Synonymous

[1372] 1 Benign (1 9 3 ) 3 7 Truncating: 1 EXI Glu776fs8 Pathog 7 7 2326delG Deletion / Inse

[1373] 1 X enic (1 0 6 rtion ) 3 7

[1374] EXI Nontruncatin Likely 7 8 2338G> A Val780Met

[1375] 1 g: Missense Benign (1

[1376]

[1377] 1 0 )

[1378] 46

[1379] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1380] 3 7 Likely 1 EXI Nontruncatin

[1381] 7 9 2387G> A Tyr796Cys Pathog

[1382] 1 g: Missense (1 2 6 enic ) 3 7 1 EXI Nontruncatin

[1383] 7 9 2396G> A Arg799Gln VUS

[1384] 1 g: Missense (1 3 9 ) 3 8

[1385] EXI Nontruncatin Likely 7 1 2431C>G Leu811Val

[1386] 1 g: Missense Benign (1 4 1 ) 3 8

[1387] EXI Likely 7 1 2433C>G Leu811Leu Synonymous

[1388] 1 Benign (1 5 1 ) 3 8 Truncating: 1 EXI Ser812fs85 Pathog 7 1 2434delT Deletion / Inse

[1389] 1 X enic (1 6 2 rtion ) 3 8

[1390] EXI Likely 7 1 2439C>T Cys813Cys Synonymous

[1391] 1 Benign (1 7 3 ) 3 8

[1392] EXI Likely 7 1 2448C>T Asp816Asp Synonymous

[1393] 1 Benign (1 8 6 ) 3 8

[1394] EXI Likely 7 2 2469G> A Gly823Gly Synonymous

[1395] 1 Benign (2 9 3 ) 3 8 Truncating: 1 EXI Ile827fs72 Pathog 8 2 2477_2478insCGGGT Deletion / Inse

[1396] 1 X enic (1 0 7 rtion ) 3 8 1 EXI Truncating: Pathog 8 2 2484C>A Tyr828X

[1397] 1 Nonsense enic (1 1 8 ) 3 8 1 EXI Nontruncatin

[1398] 8 2 2486C>T Pro829Leu VUS

[1399] 1 g: Missense (1 2 9 ) 3 8 Truncating: 1 EXI Ala830fs42 Pathog 8 3 2487_2488insT Deletion / Inse

[1400] 1 X enic (1 3 0 rtion ) 3 8 Truncating: 2 EXI Arg832fs39 Pathog 8 3 2494_2495insC Deletion / Inse

[1401] 1 X enic (2 4 2 rtion ) 3 8 1 EXI Nontruncatin

[1402] 8 3 2494C>A Arg832Gly VUS

[1403] 1 g: Missense (1 5 2 ) 3 8 Truncating: 1 EXI Arg832fs65 Pathog 8 3 2494delC Deletion / Inse

[1404] 1 X enic (1

[1405]

[1406] 6 2 rtion )

[1407] 47

[1408] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1409] 3 8

[1410] EXI Nontruncatin Likely 8 3 2498A> G Asp833Gly

[1411] 1 g: Missense Benign (1 7 3 ) 3 8

[1412] EXI Nontruncatin Likely 8 3 2504G> A Arg835His

[1413] 1 g: Missense Benign (2 8 5 ) 3 8

[1414] EXI Likely 8 3 2508C>T Leu836Leu Synonymous

[1415] 1 Benign (1 9 6 ) 3 8

[1416] EXI Nontruncatin Likely 9 3 2515C>T Pro839Ser

[1417] 1 g: Missense Benign (2 0 9 ) 3 8

[1418] EXI Likely 9 4 2523C> T Asn841 Asn Synonymous

[1419] 1 Benign (1 1 1 ) 3 8

[1420] EXI Nontruncatin Likely 9 4 2527T> C Ser843Pro

[1421] 1 g: Missense Benign (2 2 3 ) 3 8 Likely 9 EXI Nontruncatin

[1422] 9 4 2534T> C Leu845Ser Pathog

[1423] 1 g: Missense (5 3 5 enic ) 3 8 1 EXI Truncating: Pathog 9 4 2542C>T Gln848X

[1424] 1 Nonsense enic (1 4 8 ) 3 8

[1425] EXI Nontruncatin Likely 9 5 2548G> A Asp850Asn

[1426] 1 g: Missense Benign (1 5 0 ) 3 8 1 EXI Truncating: Pathog 9 6 2582G> A Trp861X

[1427] 1 Nonsense enic (1 6 1 ) 3 8 Truncating: 1 EXI Asn872fs32 Pathog 9 7 2615_2616ins20 Deletion / Inse

[1428] 1 X enic (1 7 2 rtion ) 3 8 Truncating: 1 EXI Val873fs23 Pathog 9 7 2618_2621delTCTG Deletion / Inse

[1429] 1 X enic (1 8 3 rtion ) 3 8 Truncating: 1 EXI Val873fs32 Pathog 9 7 2618delTinsCC Deletion / Inse

[1430] 1 X enic (1 9 3 rtion ) 4 8

[1431] EXI Nontruncatin Likely 0 7 2618T> C Val873Ala

[1432] 1 g: Missense Benign (1

[1433]

[1434] 0 3 ) 4 8 Truncating: 1

[1435] Cys874fs Pathog 0 EX11 7 2619_2620insC Deletion / Inser

[1436] 30X enic (1

[1437]

[1438] 1 4 tion )

[1439] 48

[1440] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1441] 4 8 1

[1442] Truncating: Pathog 0 EX11 7 2622C>A Cys874X

[1443] Nonsense enic (1 2 4 ) 4 8

[1444] Val882M Nontruncating Likely 0 EX11 8 2644G> A

[1445] et: Missense Benign (1 3 2 ) 4 8

[1446] Cys885C Likely 0 EX11 8 2655C>T Synonymous

[1447] ys Benign (1 4 5 ) 4 8 2657_2658insACCTTCGT Truncating: 1

[1448] Pro886fs Pathog 0 EX11 8 GCCCGGCTGCCC (SEQ Deletion / Inser

[1449] 18X enic (1 5 6 ID NO: 14) tion ) 4 8

[1450] Asn890A Likely 0 EX11 9 2670C>T Synonymous

[1451] sn Benign (1 6 0 ) 4 8 Truncating: 1

[1452] Thr892fs Pathog 0 EX11 9 2674_2675insA Deletion / Inser

[1453] 13X enic (1 7 2 tion ) 4 8 Truncating: 1

[1454] Ser895fs9 Pathog 0 EX11 9 2684_2685delCA Deletion / Inser

[1455] X enic (1 8 5 tion ) 4 8 Truncating: 1

[1456] Val896fs Pathog 0 EX11 9 2687_2688insT Deletion / Inser

[1457] 704 enic (1 9 6 tion ) 4 8

[1458] Ala898Al Likely 1 EX11 9 2694A> C Synonymous (9 a Benign 0 8 ) 4 9 Truncating: 1

[1459] Trp901fs Pathog 1 EX11 0 2699 2700insC Deletion / Inser

[1460] 4X enic (1 1 1 tion ) 4 9

[1461] Pro900Pr Likely 1 EX11 0 2700G> A Synonymous

[1462] 0 Benign (1 2 0 1) 4 9

[1463] Ser903Gl Nontruncating Likely 1 EX11 0 2707A> G (1 y: Missense Benign 3 3 ) 4 9

[1464] His907Ty Nontruncating Likely 1 EX11 0 2719C>T

[1465] r: Missense Benign (1 4 7 )

[1466] Nontruncating

[1467] 4 9 Asp910 Likely 1

[1468] 2729 2737del ACGTGGTG

[1469] 1 EX11 1 Val912de Pathog G Deletion / Inser (1 5 0 13 enic

[1470] tion ) 4 9

[1471] Asp910A Likely 1 EX11 1 2730C>T Synonymous

[1472] sp Benign (1

[1473]

[1474] 6 0

[1475] 49

[1476] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1477] 4 9

[1478] Arg919Tr Nontruncating Likely 1 EX11 1 2755C>T (1

[1479] P: Missense Benign 7 9 ) 4 9 1

[1480] Thr927Al Nontruncating

[1481] 1 EX11 2 2779A> G VUS

[1482] a: Missense (1 8 7 ) 4 9 1

[1483] Thr927M Nontruncating

[1484] 1 EX11 2 2780C>T VUS

[1485] et: Missense (1 9 7 ) 4 9

[1486] Ala928Al Likely 2 EX11 2 2784G> A Synonymous

[1487] a Benign (3 0 8 ) 4 9

[1488] Arg936A Likely 2 EX11 3 2808C> T Synonymous

[1489] rg Benign (1 1 6 ) 4 9

[1490] Thr938Th Likely 2 EX11 3 2814G> A Synonymous

[1491] r Benign (2 2 8 ) 4 9 Likely 2

[1492] Pro939Al Nontruncating

[1493] 2 EX11 3 2815C> G Pathog

[1494] a: Missense (1 3 9 enic ) 4 9

[1495] Ala943Al Likely 2 EX11 4 2829C>G Synonymous

[1496] a Benign (1 4 3 ) 4 9 1

[1497] Arg944C Nontruncating

[1498] 2 EX11 4 2830C>T VUS

[1499] ys: Missense (1 5 4 ) 4 9 Truncating: 1

[1500] Val945fs Pathog 2 EX11 4 2833_2834delGT Deletion / Inser

[1501] 155X enic (1 6 5 tion ) 4 9 1

[1502] Truncating: Pathog 2 EX11 4 2839C>T Gln947X

[1503] Nonsense enic (1 7 7 ) 4 9 Truncating: 1

[1504] Gln947fs Pathog 2 EX11 4 2840_2841insA Deletion / Inser

[1505] 153X enic (1 8 7 tion ) 4 9 Val951fs 1 IVS1 Pathog 2 5 2853+1G>A Truncating: Splice

[1506] 1 enic (1 9 1 g: ) 4 9 Likely

[1507] IVS1 Likely 3 5 2853+23C> T Silent Silent

[1508] 1 Benign (4 0 1 IVS ) 4 9 Likely

[1509] 1VS1 Likely 3 5 2853+26C> T Silent Silent

[1510] 1 Benign (1

[1511]

[1512] 1 1 IVS )

[1513] 50

[1514] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 4 9 Likely

[1515] IVS1 Likely 3 5 2853+61A> C Silent Silent

[1516] 1 Benign (1 2 1 IVS ) 4 9 Likely

[1517] IVS1 Likely 3 5 2853+62C>T Silent Silent

[1518] 1 Benign (2 3 1 IVS ) IVS1 Truncating:

[1519] 4 9 1 1- Large Pathog 3 5 2853_10499del7646 Val951fs

[1520] IVS3 Rearrangemen enic (1 4 1

[1521] 4 t ) 4 9 1 IVS1 Unknown

[1522] 3 5 2854-9C>A Unknown

[1523] 1 IVS vus (1 5 1 ) 4 9 1 IVS1 Unknown

[1524] 3 5 2854-7C>A Unknown

[1525] 1 IVS vus (1 6 1 ) 4 9 Likely

[1526] IVS1 Likely 3 5 2854-5C>T Silent Silent

[1527] 1 Benign (4 7 1 IVS )

[1528] Arg951fs

[1529] 4 9 1 IVS1 X Pathog 3 5 2854-2A> G Splice

[1530] 1 Truncatin enic (1 8 1 ) g- Arg95 Ifs

[1531] 4 9 2 IVS1 X Pathog 3 5 2854-1G>A Splice

[1532] 1 Truncatin enic (1 9 1 ) g:

[1533] Arg95 Ifs

[1534] 4 9 1 IVS1 X Pathog 4 5 2854-1G>T Splice

[1535] 1 Truncatin enic (1 0 1 ) g- 4 9

[1536] Arg952A Likely 4 EX12 5 2856G> A Synonymous (1 rg Benign 1 2 ) 4 9 1

[1537] Truncating: Pathog 4 EX 12 5 2859C>G Tyr953X

[1538] Nonsense enic (1 2 3 ) 4 9 Truncating: 1

[1539] Val956fs Pathog 4 EX12 5 2865delC Deletion / Inser

[1540] 20X enic (1 3 6 tion ) 4 9 Likely 1

[1541] Gly960A Nontruncating

[1542] 4 EX12 6 2879G> A Pathog sp: Missense (1 4 0 enic ) 4 9 Likely 1

[1543] Asp962G Nontruncating

[1544] 4 EX12 6 2885A> G Pathog 5 2 ly: Missense (1

[1545]

[1546] enic )

[1547] 51

[1548] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1549] 4 9 Likely 4

[1550] Trp967Ar Nontruncating

[1551] 4 EX12 6 2899T> C Pathog ( g: Missense36 7 enic ) 4 9 1

[1552] Asn970L Nontruncating

[1553] 4 EX12 7 2910C>A

[1554] ys: Missense vus (1 7 0 ) 4 9

[1555] Asn970A Likely 4 EX12 7 2910C>T Synonymous

[1556] sn Benign (1 8 0 )

[1557] Nontruncating

[1558] 4 9 Ile985del Likely 1 4 EX12 8 2954_2956delTTT Tyr986As Pathog Deletion / Inser (1 9 5 n enic

[1559] tion ) 4 9 1

[1560] Truncating: Pathog 5 EX12 8 2958T> G Tyr986X

[1561] Nonsense enic (1 0 6 ) 4 9 1

[1562] Truncating: Pathog 5 EX12 8 2959OT Gln987X

[1563] Nonsense enic (1 1 7 ) 4 9 1

[1564] Gln987Hi Nontruncating

[1565] 5 EX12 8 2961G> T VUS

[1566] s: Missense (1 2 7 ) 4 9 Truncating: 1

[1567] Ser988fsl Pathog 5 EX12 8 2962 2963 del AG Deletion / Inser

[1568] 12X enic (1 3 8 tion ) 4 9 Truncating: 1

[1569] Ala989fs Pathog 5 EX12 8 2966_2970delCGGCG Deletion / Inser

[1570] 109X enic (1 4 9 tion ) 4 9 Truncating: 1

[1571] Ala990Tr Pathog 5 EX12 9 2968_2969delGCinsT Deletion / Inser

[1572] pfs7X enic (1 5 0 tion )

[1573] +

[1574] 4 9

[1575] 2969OT Nontruncating Likely 5 EX12 9 2968G> C

[1576] Ala990Le: Missense Benign (1 6 0

[1577] u ) 4 9 Truncating: 1

[1578] Val991fs Pathog 5 EX12 9 2970_2971insCG Deletion / Inser

[1579] 7X enic (1 7 1 tion ) 4 9 Truncating: 1

[1580] Val991fs Pathog 5 EX12 9 2971delG Deletion / Inser

[1581] 6X enic (1 8 1 tion ) 4 9 1

[1582] Val991Gl Nontruncating

[1583] 5 EX12 9 2972T> G VUS ( y: Missense 1

[1584]

[1585] 9 1 )

[1586] 52

[1587] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1588] 4 9 Ser995fs 1 IVS1 Pathog 6 9 2985+1G>A Truncatin Splice

[1589] 2 enic (1 0 5 S- ) 4 9 1 IVS1 Unknown

[1590] 6 9 2985_IVS12+linsGTAG Unknown

[1591] 2 IVS vus (1 1 5 ) 4 9 Ser995fs 1 IVS1 Pathog 6 9 2985+2T>A Truncatin Splice

[1592] 2 enic (1 2 5 8- ) 4 9 Likely

[1593] IVS1 Likely 6 9 2985+4G> A Silent Silent

[1594] 2 Benign (1 3 5 IVS ) 4 9 1 IVS1 Unknown

[1595] 6 9 2985+5G> A Unknown VUS

[1596] 2 IVS (1 4 5 ) 4 9 Likely

[1597] IVS1 Likely 6 9 2985+31insGGGGA Silent Silent

[1598] 2 Benign (1 5 5 IVS ) 4 9 Likely

[1599] IVS1 Likely 6 9 2986-40C>T Silent Silent

[1600] 2 Benign (1 6 5 IVS ) 4 9 Likely

[1601] IVS1 Likely 6 9 2986-15C>T Silent Silent

[1602] 2 Benign (7 7 5 IVS )

[1603] 1

[1604] 4

[1605] 0 His1001 Likely 6 EX13 3003C>T Synonymous

[1606] 0 His Benign (1 8

[1607] 1 ) 1

[1608] 4

[1609] 0 Val1002 Likely 6 EX13 3006G> C Synonymous

[1610] 0 Vai Benign (2 9

[1611] 2 ) 1

[1612] 4 Truncating: 1

[1613] 0 Ser1003fs Pathog 7 EX13 3009_3012delCAAC Deletion / Inser

[1614] 0 3X enic (1 0 tion

[1615] 3 ) 1

[1616] 4

[1617] 0 Val1005 Likely 7 EX 13 3015C> T Synonymous

[1618] 0 Vai Benign (1 1

[1619] 5 ) 1 Nontruncating

[1620] 4 Asn1008 1

[1621] 0 Pathog 7 EXI3 3024_3025insl8 _Tyrl009

[1622] 0 Deletion / Inser enic (1 2 ins6

[1623]

[1624] 8 tion )

[1625] 53

[1626] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1627] 1 Nontruncating

[1628] 4 Likely 1

[1629] 0 Tyr1009d

[1630] 7 EXI3 3025_3027delTAC Pathog

[1631] 0 el Deletion / Inser (1 3 enic

[1632] 9 tion ) 1

[1633] 4

[1634] 0 Asn1017 Likely 7 EX13 3051C>T Synonymous

[1635] 1 Asn Benign (1 4

[1636] 7 ) 1

[1637] 4 5

[1638] 0 Gln1020 Truncating: Pathog 7 EX13 3058C>T

[1639] 2 X Nonsense enic (4 5

[1640] 0 ) 1

[1641] 4

[1642] 0 Gly1021 Likely 7 EX13 3063T> C Synonymous

[1643] 2 Gly Benign (1 6

[1644] 1 0) 1

[1645] 4

[1646] 0 Gln1023 Nontruncating Likely 7 EX13 3068A> G

[1647] 2 Arg: Missense Benign (1 7

[1648] 3 ) 1

[1649] 4

[1650] 0 Ser1025S Likely 7 EXI3 3075C>T Synonymous

[1651] 2 er Benign (1 8

[1652] 5 ) 1

[1653] 4

[1654] 0 Pro1028P Likely 7 EX13 3084G> A Synonymous

[1655] 2 ro Benign (1 9

[1656] 8 ) 1

[1657] 4 Truncating: 1

[1658] 0 Asp1034f Pathog 8 EX13 3099_3100insC Deletion / Inser

[1659] 3 s68X enic (1 0 tion

[1660] 3 ) 1

[1661] 4 Truncating: 1

[1662] 0 Pro1033f Pathog 8 EXI3 3099delC Deletion / Inser

[1663] 3 s4X enic (1 1 tion

[1664] 3 ) 1

[1665] 4

[1666] 0 Asn1034 Nontruncating Likely 8 EX13 3101A> G

[1667] 3 Ser: Missense Benign G 2

[1668] 4 ) 1

[1669] 4

[1670] 0 AsnlO34I Nontruncating Likely 8 EX13 3101A> T

[1671] 3 le: Missense Benign (1 3

[1672]

[1673] 4 )

[1674] 54

[1675] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1676] 1

[1677] 4

[1678] 0 Thr1036T Likely 8 EX13 3108G> T Synonymous

[1679] 3 hr Benign (1 4

[1680] 6 ) 1

[1681] 4

[1682] 0 Leu1037 Likely 8 EX13 3111A> G Synonymous

[1683] 3 Leu Benign (1 5

[1684] 7 0) 1

[1685] 4

[1686] 0 Ala1038 Nontruncating Likely 8 EX13 3113C>A

[1687] 3 Glu: Missense Benign (1 6

[1688] 8 ) 1

[1689] 4

[1690] 0 Ala1038 Likely 8 EX13 3114A> G Synonymous

[1691] 3 Ala Benign (1 7

[1692] 8 ) 1 Nontruncating

[1693] 4 Likely 1

[1694] 0 Ala1041d

[1695] 8 EX13 3122_3124delCGG Pathog

[1696] 4 el Deletion / Inser (1 8 enic

[1697] 1 tion ) 1

[1698] 4 Truncating: 1

[1699] 0 Gly1042f Pathog 8 EXI3 3125delG Deletion / Inser

[1700] 4 s61X enic (1 9 tion

[1701] 2 ) 1

[1702] 4 1

[1703] 0 Val1045 Nontruncating

[1704] 9 EX13 3133G> A

[1705] 4 Met: Missense vus (1 0

[1706] 5 ) 1

[1707] 4

[1708] 0 Ser1047L Nontruncating Likely 9 EX13 3140C>T

[1709] 4 eu: Missense Benign (2 1

[1710] 7 ) 1

[1711] 4 1

[1712] 0 Leu1054 Nontruncating

[1713] 9 EXI3 3161T> C VUS

[1714] 5 Pro: Missense (1 2

[1715] 4 ) 1

[1716] 4 Likely

[1717] IVS1 0 Likely 9 3162-18G>C Silent Silent

[1718] 3 5 Benign (1 3 IVS

[1719] 4 ) 1 Leu1054f

[1720] 4 1 IVSl 0 s Pathog 9 3162-2A> G Splice

[1721] 3 5 Truncatin enic (1 4

[1722]

[1723] 4 )

[1724] V _

[1725] 55

[1726] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1727] 1 Leu1054f

[1728] 4 2 IVS1 0 s Pathog 9 3162-2A> T Splice

[1729] 3 5 Truncatin enic (2 5

[1730] 4 )

[1731] S- 1

[1732] 4 1

[1733] 0 Asp1059 Nontruncating

[1734] 9 EX14 3175G> A

[1735] 5 Asn: Missense vus (1 6

[1736] 9 ) 1

[1737] 4

[1738] 0 Glu1061 Likely 9 EX14 3183G> A Synonymous

[1739] 6 Glu Benign (2 7

[1740] 1 ) 1

[1741] 4 3

[1742] 0 Gin 1062 Truncating: Pathog 9 EX14 3184C>T

[1743] 6 X Nonsense enic (2 8

[1744] 2 ) 1

[1745] 4 3194 3209delACCAGTTC Truncating: 1

[1746] 0 His1065f Pathog 9 EX14 CAGCCTCC (SEQ ID Deletion / Inser

[1747] 6 s33X enic (1 9 NO:15) tion

[1748] 5 ) 1

[1749] 5 1

[1750] 0 Gln1066 Truncating: Pathog 0 EX14 3196C>T

[1751] 6 X Nonsense enic (1 0

[1752]

[1753] 6 )

[1754] 1

[1755] 5 1 EXI 0 Truncating: Pathog 0 3202C>T Gln1068X

[1756] 4 6 Nonsense enic (1 1

[1757] 8 ) 1

[1758] 5 Truncating: 1 EXI 0 Prol069fs Pathog 0 3207_3208insT Deletion / Inse

[1759] 4 6 31X enic (1 2 rtion

[1760] 9 ) 1

[1761] 5 3212 3245 del AC A AC GAG Truncating: 1 EXI 0 ATyr1071 Pathog 0 TCCTTCCCGGTTCC Deletion / Inse

[1762] 4 7 fs22X enic (1 3 (SEQ ID NO: 16) rtion

[1763] 1 ) 1

[1764] 5 2 EXI 0 Truncating: Pathog 0 3213C> G Tyr1071X

[1765] 4 7 Nonsense enic (1 4

[1766] 1 ) 1

[1767] 5 Truncating: 1 EXI 0 Asn1072fs Pathog 0 3215 3216insA Deletion / Inse

[1768] 4 7 28X enic (1 5 rtion

[1769]

[1770] 2 )

[1771] 56

[1772] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1

[1773] 5

[1774] EXI 0 Pro1076Pr Likely 0 3228G> A Synonymous

[1775] 4 7 0 Benign (2 6

[1776] 6 ) 1

[1777] 5 Truncating: 1 EXI 0 Ser1081fs Pathog 0 3241_3242insC Deletion / Inse

[1778] 4 8 19X enic (1 7 rtion

[1779] 1 ) 1

[1780] 5 1 EXI 0 Truncating: Pathog 0 3242C>A Ser1081X

[1781] 4 8 Nonsense enic (1 8

[1782] 1 ) 1

[1783] 5 1 EXI 0 Truncating: Pathog 0 3250C>T Gln1084X

[1784] 4 8 Nonsense enic (1 9

[1785] 4 ) 1

[1786] 5 Truncating: 1 EXI 0 Leu1086fs Pathog 1 3257_3258insT Deletion / Inse

[1787] 4 8 14X enic (1 0 rtion

[1788] 6 ) 1

[1789] 5 Likely 1 EXI 0 Val1087G Nontruncatin

[1790] 1 3260T> G Pathog 4 8 g: Missense (1 1 ly enic

[1791] 7 ) 1 Nontruncatin

[1792] 5 3272 3289delTCATGCAC Val1091_ 2 EXI 0 Pathog 1 ACCTACGCTG (SEQ ID Ala1096de g:

[1793] 4 9 Deletion / Inse enic (2 2 NO:17) 16

[1794] 1 rtion ) 1

[1795] 5

[1796] EXI 0 Met1092T Nontruncatin Likely 1 3275T> C

[1797] 4 9 hr g: Missense Benign (7 3

[1798] 2 ) 1

[1799] 5 1 EXI 0 His1093A Nontruncatin

[1800] 1 3277C>G VUS

[1801] 4 9 sp g: Missense (1 4

[1802] 3 ) 1

[1803] 5

[1804] EXI 0 His1093T Nontruncatin Likely 1 3277C>T

[1805] 4 9 ( yr g: Missense Benign 2 5

[1806] 3 ) 1

[1807] 5 1 EXI 0 Truncating: Pathog 1 3285C>G Tyr1095X

[1808] 4 9 Nonsense enic (1 6

[1809] 5 )

[1810]

[1811] 57

[1812] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1813] 1

[1814] 5 Trp1055fs 1 IVS1 0 Pathog 1 3295+1G>A Truncatin Splice

[1815] 4 9 enic (1 7

[1816] 9 g- ) 1

[1817] 5 Trp1055fs 1 IVS1 0 Pathog 1 3295+1G>C Truncatin Splice

[1818] 4 9 enic (1 8

[1819] 9 g: ) 1

[1820] 5

[1821] IVS1 0 Likely Likely 1 3295+3G> T Silent

[1822] 4 9 Silent IVS Benign (1 9

[1823] 9 ) 1

[1824] 5

[1825] IVS1 0 Likely Likely 2 3295+53G> T Silent

[1826] 4 9 Silent IVS Benign (1 0

[1827] 9 ) 1

[1828] 5

[1829] IVS1 0 Likely Likely 2 3296-15G> A Silent

[1830] 4 9 Silent IVS Benign (2 1

[1831] 9 ) 1

[1832] 5 Gly1099fs Likely 1 IVS1 0

[1833] 2 3296-3C>G Nontrunca Splice Pathog 4 9 (1 2 ting: enic

[1834] 9 ) 1

[1835] 5 Gly1099fs 1 IVS1 0 Pathog 2 3296-2A> C Truncatin Splice

[1836] 4 9 enic (1 3

[1837] 9 g: ) 1

[1838] 5 Gly1099fs 1 IVS1 0 Pathog 2 3296-lG> A Truncatin Splice

[1839] 4 9 enic (1 4

[1840] 9 g: ) 1 Truncating:

[1841] 5 EXI 1

[1842] 0 Gly1099fs Large Pathog 2 5 IV 3296_8016del*

[1843] 9 * Rearrangeme enic (1 5 S21

[1844] 9 nt ) 1

[1845] 5

[1846] EXI 1 Leu1102V Nontruncatin Likely 2 3304C>G

[1847] 5 0 al g: Missense Benign (1 6

[1848] 2 ) 1

[1849] 5 Truncating: 1 EXI 1 3315 3324delGCTGGCAT Leu1106fs Pathog 2 Deletion / Inse

[1850] 5 0 CT 6X enic (1 7 rtion

[1851]

[1852] 6 )

[1853] 58

[1854] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1855] 1

[1856] 5

[1857] EXI 1 Leu1106V Nontruncatin Likely 2 3316C>G

[1858] 5 0 al g: Missense Benign (4 8

[1859] 6 ) 1 Nontruncatin

[1860] 5 Likely 1 EXI 1 Gln1117d

[1861] 2 3349_3351delCAG g- Pathog

[1862] 5 1 el Deletion / Inse (1 9 enic

[1863] 7 rtion ) 1

[1864] 5 3 EXI 1 Truncating: Pathog 3 3349C>T Gln1117X

[1865] 5 1 Nonsense enic (3 0

[1866] 7 ) 1

[1867] 5 Truncating: 1 EXI 1 Pro1119fs Pathog 3 3356_3357insA Deletion / Inse

[1868] 5 1 16X enic (1 1 rtion

[1869] 9 ) 1

[1870] 5 Truncating: 1 EXI 1 Val1120fs Pathog 3 3359_3360delTG Deletion / Inse

[1871] 5 2 15X enic (1 2 rtion

[1872] 0 ) 1

[1873] 5

[1874] EXI 1 Ala1124A Likely 3 3372C>T Synonymous

[1875] 5 2 la Benign (1 3

[1876] 4 0) 1

[1877] 5

[1878] EXI 1 Ser1125Se Likely 3 3375C>T Synonymous

[1879] 5 2 r Benign (1 4

[1880] 5 0) 1

[1881] 5

[1882] EXI 1 Pro1127L Nontruncatin Likely 3 3380C> T

[1883] 5 2 eu g: Missense Benign (1 5

[1884] 7 ) 1

[1885] 5

[1886] EXI 1 Ser1128Se Likely 3 3384C>T Synonymous

[1887] 5 2 r Benign (1 6

[1888] 8 ) 1

[1889] 5

[1890] EXI 1 Gly1136C Nontruncatin Likely 3 3406G> T

[1891] 5 3 ys g: Missense Benign (1 7

[1892] 6 ) 1

[1893] 5

[1894] EXI 1 Arg1142T Nontruncatin Likely 3 3424C>T

[1895] 5 4 rp g: Missense Benign (1 8

[1896]

[1897] 2 )

[1898] 59

[1899] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1900] 1

[1901] 5 Truncating: 2 EXI 1 Arg1142fs Pathog 3 3425_3428delGGCC Deletion / Inse

[1902] 5 4 27X enic (2 9 rtion

[1903] 2 ) 1

[1904] 5

[1905] EXI 1 Arg1142G Nontruncatin Likely 4 3425G> A

[1906] 5 4 In g: Missense Benign (1 0

[1907] 2 ) 1

[1908] 5 Truncating: 1 EXI 1 Pro1143fs Pathog 4 3428_3429ins4 Deletion / Inse

[1909] 5 4 68X enic (1 1 rtion

[1910] 3 ) 1

[1911] 5

[1912] EXI 1 Val1144Il Nontruncatin Likely 4 3430G> A

[1913] 5 4 e g: Missense Benign (2 2

[1914] 4 ) 1

[1915] 5 1 EXI 1 Truncating: Pathog 4 3441C>G Tyr1147X

[1916] 5 4 Nonsense enic (1 3

[1917] 7 ) 1

[1918] 5

[1919] EXI 1 Pro1148Pr Likely 4 3444G> A Synonymous

[1920] 5 4 0 Benign (2 4

[1921] 8 ) 1

[1922] 5

[1923] EXI 1 Gly1156A Nontruncatin Likely 4 3467G> C

[1924] 5 5 la g: Missense Benign (1 5

[1925] 6 ) 1

[1926] 5 1 EXI 1 Truncating: Pathog 4 3477C>G Tyr1159X

[1927] 5 5 Nonsense enic (1 6

[1928] 9 ) 1

[1929] 5

[1930] EXI 1 Thr1160T Likely 4 3480G>A Synonymous

[1931] 5 6 hr Benign (1 7

[1932] 0 ) 1

[1933] 5

[1934] EXI 1 Thr1160T Likely 4 3480G>T Synonymous

[1935] 5 6 hr Benign (1 8

[1936] 0 ) 1

[1937] 5 2 EXI 1 Truncating: Pathog 4 3483G> A Trp1161X

[1938] 5 6 Nonsense enic (2 9

[1939]

[1940] 1 )

[1941] 60

[1942] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1943] 1

[1944] 5

[1945] EXI 1 Phell63P Likely 5 3489C>T Synonymous

[1946] 5 6 he Benign (2 0

[1947] 3 ) 1

[1948] 5 Truncating: 1 EXI 1 Aspl 165fs Pathog 5 3493delG Deletion / Inse

[1949] 5 6 6X enic (1 1 rtion

[1950] 5 ) 1

[1951] 5 3 EXI 1 Aspll65G Nontruncatin

[1952] 5 3494A> G

[1953] 5 6 ly g: Missense vus (1 2

[1954] 5 ) 1

[1955] 5 1 EXI 1 Glyll66S Nontruncatin

[1956] 5 3496G> A

[1957] 5 6 er g: Missense vus (1 3

[1958] 6 ) 1

[1959] 5

[1960] EXI 1 Proll68Se Nontruncatin Likely 5 3502C>T

[1961] 5 6 r g: Missense Benign (7 4

[1962] 8 ) 1

[1963] 5 Truncating: 1 EXI 1 Proll68fs Pathog 5 3503_3504delCT Deletion / Inse

[1964] 5 6 89X enic (1 5 rtion

[1965] 8 ) 1

[1966] 5

[1967] EXI 1 Thrll71T Likely 5 3513C>G Synonymous

[1968] 5 7 hr Benign (5 6

[1969] 1 ) 1

[1970] 5 1 EXI 1 Truncating: Pathog 5 3514C>T Glnll72X

[1971] 5 7 Nonsense enic (1 7

[1972] 2 ) 1 Nontruncatin

[1973] 5 3538_3564delACCTATGC AThrll80 1 EXI 1

[1974] G g: Pathog 5 CTC AGGGGCACCT _Hisll88d

[1975] 5 8 Deletion / Inse enic (1 8 (SEQ ID NO: 18) el 9

[1976] 0 rtion ) 1

[1977] 5 Truncating: 1 EXI 1 Tyrll81fs Pathog 5 3539_3540insAC Deletion / Inse

[1978] 5 8 18X enic (1 9 rtion

[1979] 1 ) 1

[1980] 5

[1981] EXI 1 Alai 182V Nontruncatin Likely 6 3545C>T

[1982] 5 8 al g: Missense Benign (1 0

[1983]

[1984] 2 )

[1985] 61

[1986] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[1987] 1

[1988] 5

[1989] EXI 1 Argll84A Likely 6 3552G> A Synonymous

[1990] 5 8 ( rg Benign 1 1

[1991] 4 ) 1

[1992] 5 1 EXI 1 Truncating: Pathog 6 3561C>A Tyrll87X

[1993] 5 8 Nonsense enic (1 2

[1994] 7 ) 1

[1995] 5 Truncating: 1 EXI 1 Serll98fs Pathog 6 3593_3599delGCGGTGC Deletion / Inse

[1996] 5 9 20X enic (1 3 rtion

[1997] 8 ) 1

[1998] 5

[1999] EXI 2 Alal200A Likely 6 3600G> A Synonymous

[2000] 5 0 la Benign (2 4

[2001] 0 ) 1

[2002] 5

[2003] EXI 2 Alal204G Nontruncatin Likely 6 3611C>A

[2004] 5 0 lu g: Missense Benign (1 5

[2005] 4 ) 1

[2006] 5

[2007] EXI 2 Alal204V Nontruncatin Likely 6 3611C>T

[2008] 5 0 al g: Missense Benign (1 6

[2009] 4 ) 1

[2010] 5 Likely 5 EXI 2 Vall206G Nontruncatin

[2011] 6 3617T> G Pathog

[2012] 5 0 ly g: Missense (2 7 enic

[2013] 6 ) 1

[2014] 5 Truncating: 1 EXI 2 Vall208fs Pathog 6 3623_3624insGTGT Deletion / Inse

[2015] 5 0 2X enic (1 8 rtion

[2016] 8 ) 1 Nontruncatin

[2017] 5 Phel209_ 1 EXI 2 g Pathog 6 3624_3645del22insT Leul215d:

[2018] 5 0 Deletion / Inse enic (1 9 el 7

[2019] 9 rtion ) 1

[2020] 5 1 EXI 2 Truncating: Pathog 7 3628G> T Glu1210X

[2021] 5 1 Nonsense enic (1 0

[2022] 0 ) 1

[2023] 5 1 EXI 2 Truncating: Pathog 7 3640G> T Glyl214X

[2024] 5 1 Nonsense enic (1 1

[2025]

[2026] 4 )

[2027] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2028] 1

[2029] 5 Likely 1 EXI 2 Leul215P Nontruncatin

[2030] 7 3644T> C Pathog

[2031] 5 1 ro g: Missense (1 2 enic

[2032] 5 ) 1

[2033] 5

[2034] EXI 2 Alal227S Nontruncatin Likely 7 3679G> T

[2035] 5 2 er g: Missense Benign (1 3

[2036] 7 ) 1

[2037] 5 Truncating: 1 EXI 2 Vall229fs Pathog 7 3684_3685insC Deletion / Inse

[2038] 5 2 73X enic (1 4 rtion

[2039] 8 ) 1

[2040] 5 Truncating: 1 EXI 2 Prol228fs Pathog 7 3684delC Deletion / Inse

[2041] 5 2 44X enic (1 5 rtion

[2042] 8 ) 1

[2043] 5 1 EXI 2 Truncating: Pathog 7 3706C> T Glnl236X

[2044] 5 3 Nonsense enic (1 6

[2045] 6 ) 1 Nontruncatin

[2046] 5 Likely 6 EXI 2 Asnl240d

[2047] 7 3719_3721delACA g: Pathog

[2048] 5 4 el Deletion / Inse (3 7 enic

[2049] 0 rtion ) 1

[2050] 5 1 EXI 2 Asnl240Il Nontruncatin

[2051] 7 3719A> T

[2052] 5 4 e g: Missense vus (1 8

[2053] 0 ) 1

[2054] 5 Likely 1 EXI 2 Ilel241As Nontruncatin

[2055] 7 3722T>A Pathog

[2056] 5 4 n g: Missense (1 9 enic

[2057] 1 ) 1

[2058] 5 1 EXI 2 Ilel241Th Nontruncatin

[2059] 8 3722T> C VUS

[2060] 5 4 r g: Missense (1 0

[2061] 1 ) 1

[2062] 5 Likely 1 EXI 2 Thrl242M Nontruncatin

[2063] 8 3725C>T Pathog

[2064] 5 4 et g: Missense (1 1 enic

[2065] 2 ) 1

[2066] 5 1 EXI 2 Truncating: Pathog 8 3729G> A Trpl243X

[2067] 5 4 Nonsense enic (1 2

[2068]

[2069] 3 )

[2070] 63

[2071] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1

[2072] 5 1 EXI 2 Serl254Le Nontruncatin

[2073] 8 3761C>T

[2074] 5 5 u g: Missense vus (1 3

[2075] 4 ) 1

[2076] 5 Truncating: 1 EXI 2 Hisl262fs Pathog 8 3784_3785insC Deletion / Inse

[2077] 5 6 38X enic (1 4 rtion

[2078] 2 ) 1

[2079] 5

[2080] EXI 2 Hisl262A Nontruncatin Likely 8 3785A> G

[2081] 5 6 ( rg g: Missense Benign 1 5

[2082] 2 ) 1

[2083] 5 1 EXI 2 Truncating: Pathog 8 3792C>A Tyrl264X

[2084] 5 6 Nonsense enic (1 6

[2085] 4 ) 1

[2086] 5 Truncating: 3 EXI 2 Vall272fs Pathog 8 3814delG Deletion / Inse

[2087] 5 7 X enic (1 7 rtion

[2088] 2 ) 1 Truncating:

[2089] 5 1 EXI 2 Vall272fs Large Pathog 8 3815_4890dell076

[2090] 5 7 385X Rearrangeme enic (1 8

[2091] 2 nt ) 1

[2092] 5 1 EXI 2 Vall274M Nontruncatin

[2093] 8 3820G> A VUS

[2094] 5 7 et g: Missense (1 9

[2095] 4 ) 1

[2096] 5 Truncating: 1 EXI 2 Glyl275fs Pathog 9 3824delG Deletion / Inse

[2097] 5 7 70X enic (1 0 rtion

[2098] 5 ) 1

[2099] 5 Likely 2 EXI 2 Serl278Ar Nontruncatin

[2100] 9 3834C>A Pathog

[2101] 5 7 ( g g: Missense 1 1 enic

[2102] 8 ) 1

[2103] 5 Truncating: 1 EXI 2 Pathog 9 3860delT Leul287fs Deletion / Inse

[2104] 5 8 enic (1 2 rtion

[2105] 7 ) 1

[2106] 5

[2107] EXI 2 Hisl288Hi Likely 9 3864C>T Synonymous

[2108] 5 8 s Benign (1 3

[2109] 8 )

[2110]

[2111] 64

[2112] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2113] 1

[2114] 5 Likely 1 EXI 2 Vall289G Nontruncatin

[2115] 9 3866T> A Pathog

[2116] 5 8 lu g: Missense (1 4 enic

[2117] 9 ) 1

[2118] 5

[2119] EXI 2 Leu 1290V Nontruncatin Likely 9 3868C>G

[2120] 5 9 al g: Missense Benign (1 5

[2121] 0 ) 1

[2122] 5 1 EXI 2 Phel292L Nontruncatin

[2123] 9 3876C>A VUS

[2124] 5 9 eu g: Missense (1 6

[2125] 2 ) 1

[2126] 5 Truncating: 1 EXI 2 Leul294fs Pathog 9 3880delC Deletion / Inse

[2127] 5 9 51X enic (1 7 rtion

[2128] 4 ) 1

[2129] 5 1 EXI 3 Truncating: Pathog 9 3898G> T Glu1300X

[2130] 5 0 Nonsense enic (1 8

[2131] 0 ) 1

[2132] 5 1 EXI 3 Prol301Al Nontruncatin

[2133] 9 3901C>G VUS

[2134] 5 0 a g: Missense (1 9

[2135] 1 ) 1

[2136] 6 Truncating: 1 EXI 3 Alal303fs Pathog 0 3907_3908delGC Deletion / Inse

[2137] 5 0 7X enic (1 0 rtion

[2138]

[2139] 3 )

[2140] 1

[2141] 6 E Truncating: 1

[2142] 3 Ilel305fs Pathoge 0 X 3915 3918delCCCC Deletion / Inser

[2143] 0 40X nic (1 1 15 tion

[2144] 5 ) 1

[2145] 6 E Truncating: 1

[2146] 3 Prol309fs Pathoge 0 X 3926_3927delCT Deletion / Inser

[2147] 0 120X nic (1 2 15 tion

[2148] 9 ) 1

[2149] 6 E

[2150] 3 Aspl310A Likely 0 X 3930C>T Synonymous

[2151] 1 sp Benign -(3 3 15

[2152] 0 ) 1

[2153] 6 E

[2154] 3 Alal311T Nontruncating Likely 0 X 3931G> A

[2155] 1 hr: Missense Benign (2 4 15

[2156] 1 )

[2157]

[2158] 65

[2159] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1

[2160] 6 E

[2161] 3 Argl312G Nontruncating Likely 0 X 3935G> A

[2162] 1 In: Missense Benign (1 5 15

[2163] 2 ) 1

[2164] 6 E 1

[2165] 3 Thrl314P Nontruncating

[2166] 0 X 3940A> C VUS

[2167] 1 ro: Missense (1 6 15

[2168] 4 ) 1

[2169] 6 E Truncating: 1

[2170] 3 Alal315fs Pathoge 0 X 3942_3969del28 Deletion / Inser

[2171] 1 22X nic (1 7 15 tion

[2172] 5 ) 1

[2173] 6 E Truncating: 1

[2174] 3 Asnl320f Pathoge 0 X 3958_3959insG Deletion / Inser

[2175] 2 sllOX nic (1 8 15 tion

[2176] 0 ) 1

[2177] 6 E Likely 1

[2178] 3 Trpl328A Nontruncating

[2179] 0 X 3982T> C Pathoge 2 ( rg: Missense 1 9 15 nic

[2180] 8 ) 1

[2181] 6 E 1

[2182] 3 Truncating: Pathoge 1 X 3984G> A Trpl328X

[2183] 2 Nonsense nic (1 0 15

[2184] 8 ) 1

[2185] 6 E

[2186] 3 Phel330P Likely 1 X 3990C>T Synonymous

[2187] 3 he Benign (1 1 15

[2188] 0 ) 1

[2189] 6 E 3994 3995insGAACCCGGC Truncating: 1

[2190] 3 GAspl332 Pathoge 1 X CCACTACCTCTTC (SEQ Deletion / Inser

[2191] 3 fsl5X nic (1 2 15 ID NO: 19) tion

[2192] 2 ) 1

[2193] 6 E

[2194] 3 Aspl332A Nontruncating Likely 1 X 3994G> A

[2195] 3 sn: Missense Benign (1 3 15

[2196] 2 ) 1

[2197] 6 E

[2198] 3 Thrl338T Likely 1 X 4014C>T Synonymous

[2199] 3 hr Benign (1 4 15

[2200] 8 ) 1

[2201] 6 E

[2202] 3 Vall339M Nontruncating Likely 1 X 4015G> A

[2203] 3 et: Missense Benign (2 5 15

[2204] 9 )

[2205]

[2206] 66

[2207] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2208] 1

[2209] 6 E

[2210] 3 Argl340T Nontruncating Likely 1 X 4018C>T

[2211] 4 rp: Missense Benign (6 6 15

[2212] 0 ) 1

[2213] 6 E

[2214] 3 Argl340G Nontruncating Likely 1 X 4019G> A

[2215] 4 In: Missense Benign (1 7 15

[2216] 0 ) 1

[2217] 6 E Truncating: 1

[2218] 3 Hisl347fs Pathoge 1 X 4040_4041delAC Deletion / Inser

[2219] 4 82X nic (1 8 15 tion

[2220] 7 ) 1

[2221] 6 E 1

[2222] 3 Thrl350M Nontruncating

[2223] 1 X 4049C>T VUS

[2224] 5 et: Missense (1 9 15

[2225] 0 ) 1

[2226] 6 E Truncating: 1

[2227] 3 Argl35 Ifs Pathoge 2 X 4051_4052delGG Deletion / Inser

[2228] 5 77X nic (1 0 15 tion

[2229] 1 ) 1

[2230] 6 E

[2231] 3 Argl351T Nontruncating Likely 2 X 4051C>T

[2232] 5 rp: Missense Benign (3 1 15

[2233] 1 ) 1

[2234] 6 E

[2235] 3 Argl351A Likely 2 X 4053G> T Synonymous

[2236] 5 ( rg Benign 1 2 15

[2237] 1 ) 1

[2238] 6 E Truncating: 1

[2239] 3 Serl352fs Pathoge 2 X 4054_4055insG Deletion / Inser

[2240] 5 78X nic (1 3 15 tion

[2241] 2 ) 1

[2242] 6 E 2

[2243] 3 Serl352A Nontruncating

[2244] 2 X 4055G> A VUS

[2245] 5 sn: Missense (2 4 15

[2246] 2 ) 1

[2247] 6 E Truncating: 1

[2248] 3 Leul357fs Pathoge 2 X 4069delC Deletion / Inser

[2249] 5 9X nic (1 5 15 tion

[2250] 7 ) 1

[2251] 6 E Truncating: 4

[2252] 3 Leul357fs Pathoge 2 X 4070delT Deletion / Inser

[2253] 5 8X nic (3 6 15 tion

[2254]

[2255] 7 )

[2256] 67

[2257] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1

[2258] 6 E Likely 2

[2259] 3 Leul357P Nontruncating

[2260] 2 X 4070T> C Pathoge 5 ro: Missense (1 7 15 nic

[2261] 7 ) 1

[2262] 6 E

[2263] 3 Leul357L Likely 2 X 4071G> T Synonymous

[2264] 5 eu Benign (5 8 15

[2265] 7 ) 1

[2266] 6 E Truncating: 1

[2267] 3 Vall360fs Pathoge 2 X 4080delG Deletion / Inser

[2268] 6 5X nic (1 9 15 tion

[2269] 0 ) 1

[2270] 6 E Likely 2

[2271] 3 Serl362Pr Nontruncating

[2272] 3 X 4084T> C Pathoge 6 o: Missense (2 0 15 nic

[2273] 2 ) 1

[2274] 6 E

[2275] 3 Arg 1364 A Likely 3 X 4092C>T Synonymous

[2276] 6 ( rg Benign 1 1 15

[2277] 4 ) 1

[2278] 6 E Truncating: 1

[2279] 3 Argl367fs Pathoge 3 X 4099_4100delAG Deletion / Inser

[2280] 6 62X nic (1 2 15 tion

[2281] 7 ) 1

[2282] 6 E 2

[2283] 3 Alal368V Nontruncating

[2284] 3 X 4103C>T VUS

[2285] 6 al: Missense (1 3 15

[2286] 8 ) 1

[2287] 6 E Truncating: 1

[2288] 3 Tyrl370fs Pathoge 3 X 4109_4120dell2insG Deletion / Inser

[2289] 7 57X nic (1 4 15 tion

[2290] 0 ) 1

[2291] 6 E Truncating: 1

[2292] 3 Pathoge 3 X 4110 4113delCTTC Tyrl370X Deletion / Inser

[2293] 7 nic (1 5 15 tion

[2294] 0 ) 1

[2295] 6 E

[2296] 3 Tyrl370T Likely 3 X 4110C>T Synonymous

[2297] 7 yr Benign (1 6 15

[2298] 0 ) 1

[2299] 6 E

[2300] 3 Serl373S Likely 3 X 4119C>T Synonymous

[2301] 7 er Benign (2 7 15

[2302] 3 )

[2303]

[2304] 68

[2305] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2306] 1

[2307] 6 E

[2308] 3 Ilel374Ph Nontruncating Likely 3 X 4120A> T

[2309] 7 e: Missense Benign (1 8 15

[2310] 4 ) 1

[2311] 6 E Likely 1

[2312] 3 Cysl375T Nontruncating

[2313] 3 X 4124G> A Pathoge 7 yr: Missense (1 9 15 nic

[2314] 5 ) 1

[2315] 6 E 1

[2316] 3 Vall376M Nontruncating

[2317] 4 X 4126G> A VUS

[2318] 7 et: Missense (1 0 15

[2319] 6 ) 1

[2320] 6 E 1

[2321] 3 Truncating: Pathoge 4 X 4135G> T Glul379X

[2322] 7 Nonsense nic (1 1 15

[2323] 9 ) 1

[2324] 6 E Likely 1

[2325] 3 Vall383A Nontruncating

[2326] 4 X 4148T> A Pathoge 8 sp: Missense (1 2 15 nic

[2327] 3 ) 1

[2328] 6 E 1

[2329] 3 Glul388G Nontruncating

[2330] 4 X 4163A> G VUS

[2331] 8 ly: Missense (1 3 15

[2332] 8 ) 1

[2333] 6 E

[2334] 3 Glu1388G Likely 4 X 4164G> A Synonymous

[2335] 8 lu Benign (1 4 15

[2336] 8 ) 1

[2337] 6 E

[2338] 3 Leu 1394V Nontruncating Likely 4 X 4180C>G

[2339] 9 al: Missense Benign (2 5 15

[2340] 4 ) 1

[2341] 6 E Likely 1

[2342] 3 Glyl395A Nontruncating

[2343] 4 X 4183G> A Pathoge 9 ( rg: Missense 1 6 15 nic

[2344] 5 ) 1

[2345] 6 E

[2346] 3 Trpl399A Nontruncating Likely 4 X 4195T> C

[2347] 9 ( rg: Missense Benign 1 7 15

[2348] 9 1) 1

[2349] 6 E Truncating: 1

[2350] 4 Leul400fs Pathoge 4 X 4198_4201delCTGG Deletion / Inser

[2351] 0 31X nic (1 8 15 tion

[2352]

[2353] 0 )

[2354] 69

[2355] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2356] 1

[2357] 6 E Truncating: 1

[2358] 4 Leul400fs Pathoge 4 X 4199delT Deletion / Inser

[2359] 0 30X nic (1 9 15 tion

[2360] 0 ) 1

[2361] 6 E

[2362] 4 Alal404P Nontruncating Likely 5 X 4210G> C

[2363] 0 ro: Missense Benign (1 0 15

[2364] 4 ) 1

[2365] 6 E 1

[2366] 4 Truncating: Pathoge 5 X 4214G> A Trpl405X

[2367] 0 Nonsense nic (1 1 15

[2368] 5 ) 1

[2369] 6 E Truncating: 1

[2370] 4 Prol407fs Pathoge 5 X 4220_4221insC Deletion / Inser

[2371] 0 23X nic (1 2 15 tion

[2372] 7 ) 1

[2373] 6 E 1

[2374] 4 Argl411C Nontruncating

[2375] 5 X 4231C>T VUS

[2376] 1 ys: Missense (1 3 15

[2377] 1 ) 1

[2378] 6 E Likely 1

[2379] 4 Tyrl412A Nontruncating

[2380] 5 X 4234T> G Pathoge 1 sp: Missense (1 4 15 nic

[2381] 2 ) 1

[2382] 6 E Truncating: 1

[2383] 4 Phel416fs Pathoge 5 X 4247_4248delTT Deletion / Inser

[2384] 1 14X nic (1 5 15 tion

[2385] 6 ) 1

[2386] 6 E 4255 4274delGAGGAAGCC Truncating: 1

[2387] 4 sGlul419 Pathoge 5 X GCCCCCACCCG in (SEQ Deletion / Inser

[2388] 1 X nic (1 6 15 ID NO:20) tion

[2389] 9 ) 1

[2390] 6 E

[2391] 4 Alal421A Likely 5 X 4263C>T Synonymous

[2392] 2 la Benign (2 7 15

[2393] 1 ) 1

[2394] 6 E

[2395] 4 Alal422T Nontruncating Likely 5 X 4264G> A

[2396] 2 hr: Missense Benign (3 8 15

[2397] 2 ) 1

[2398] 6 E Truncating: 1

[2399] 4 Argl427fs Pathoge 5 X 4279delA Deletion / Inser

[2400] 2 5X nic (1 9 15 tion

[2401]

[2402] 7 )

[2403] 70

[2404] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2405] 1

[2406] 6 E Truncating: 2

[2407] 4 Phel433fs Pathoge 6 X 4297_4298insCACGT Deletion / Inser

[2408] 3 13X nic (1 0 15 tion

[2409] 3 ) 1

[2410] 6 E

[2411] 4 Likely 6 X 4302C>T Ilel434Ile Synonymous

[2412] 3 Benign (1 1 15

[2413] 4 ) 1

[2414] 6 E 2

[2415] 4 Truncating: Pathoge 6 X 4306C>T Argl436X

[2416] 3 Nonsense nic (2 2 15

[2417] 6 ) 1

[2418] 6 E Truncating: 1

[2419] 4 Thrl444fs Pathoge 6 X 4331_4332delCA Deletion / Inser

[2420] 4 12X nic (1 3 15 tion

[2421] 4 ) 1

[2422] 6 E

[2423] 4 Vall445V Likely 6 X 4335C>A Synonymous

[2424] 4 al Benign (1 4 15

[2425] 5 ) 1

[2426] 6 E

[2427] 4 Alal447V Nontruncating Likely 6 X 4340C>T

[2428] 4 al: Missense Benign (1 5 15

[2429] 7 ) 1 Nontruncating

[2430] 6 E Likely 2

[2431] 4 Asnl450d

[2432] 6 X 4347_4349delCAA Pathoge 5 el Deletion / Inser (2 6 15 nic

[2433] 0 tion ) 1

[2434] 6 E

[2435] 4 Serl452S Likely 6 X 4356T>C Synonymous

[2436] 5 er Benign (2 7 15

[2437] 2 ) 1

[2438] 6 E Truncating: 2

[2439] 4 Serl457fs Pathoge 6 X 4369_4370delTC Deletion / Inser

[2440] 5 64X nic (2 8 15 tion

[2441] 7 ) 1

[2442] 6 E 2

[2443] 4 Truncating: Pathoge 6 X 4370C>G Serl457X

[2444] 5 Nonsense nic (2 9 15

[2445] 7 ) 1

[2446] 6 E Likely 1

[2447] 4 Vall460G Nontruncating

[2448] 7 X 4379T>G Pathoge 6: Missense (1 0 15 ly nic

[2449]

[2450] 0 )

[2451] 71

[2452] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2453] 1

[2454] 6 E 1

[2455] 4 Truncating: Pathoge 7 X 4387C>T Glnl463X

[2456] 6 Nonsense nic (1 1 15

[2457] 3 ) 1

[2458] 6 E 1

[2459] 4 G1U1480G Nontruncating

[2460] 7 X 4439A> G VUS

[2461] 8 ly: Missense (1 2 15

[2462] 0 ) 1

[2463] 6 E

[2464] 4 Leul481 Nontruncating Likely 7 X 4441C>A

[2465] 8 Met: Missense Benign (1 3 15

[2466] 1 ) 1

[2467] 6 E Truncating: 1

[2468] 4 Glnl482fs Pathoge 7 X 4442_4443insT Deletion / Inser

[2469] 8 41X nic (1 4 15 tion

[2470] 2 ) 1

[2471] 6 E 4

[2472] 4 Truncating: Pathoge 7 X 4444C>T Glnl482X

[2473] 8 Nonsense nic (2 5 15

[2474] 2 ) 1

[2475] 6 E 1

[2476] 4 Truncating: Pathoge 7 X 4447C>T Glnl483X

[2477] 8 Nonsense nic (1 6 15

[2478] 3 ) 1

[2479] 6 E

[2480] 4 Prol484Pr Likely 7 X 4452G> A Synonymous

[2481] 8 o Benign (2 7 15

[2482] 4 ) 1

[2483] 6 E 1

[2484] 4 Truncating: Pathoge 7 X 4455C>G Tyrl485X

[2485] 8 Nonsense nic (1 8 15

[2486] 5 ) 1

[2487] 6 E Truncating: 1

[2488] 4 Phel487fs Pathoge 7 X 4460_4461insA Deletion / Inser

[2489] 8 36X nic (1 9 15 tion

[2490] 7 ) 1

[2491] 6 E

[2492] 4 Leul499L Likely 8 X 4495C>T Synonymous

[2493] 9 eu Benign (4 0 15

[2494] 9 ) 1

[2495] 6 E 1

[2496] 5 Truncating: Pathoge 8 X 4499G> A Trpl500X

[2497] 0 Nonsense nic (1 1 15

[2498]

[2499] 0 )

[2500] 72

[2501] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2502] 1

[2503] 6 E Likely 1

[2504] 5 Glyl503A Nontruncating

[2505] 8 X 4507G> A Pathoge 0 ( rg: Missense 1 2 15 nic

[2506] 3 ) 1

[2507] 6 E Likely 2

[2508] 5 Glyl503A Nontruncating

[2509] 8 X 4507G> C Pathoge 0 ( rg: Missense 2 3 15 nic

[2510] 3 ) 1

[2511] 6 E

[2512] 5 Glyl503G Likely 8 X 4509G> T Synonymous

[2513] 0 ( ly Benign 1 4 15

[2514] 3 ) 1

[2515] 6 E 1

[2516] 5 Truncating: Pathoge 8 X 4521G> A Trpl507X

[2517] 0 Nonsense nic (1 5 15

[2518] 7 ) 1

[2519] 6 E

[2520] 5 Leul508L Likely 8 X 4524C>T Synonymous

[2521] 0 eu Benign (1 6 15

[2522] 8 ) 1

[2523] 6 E

[2524] 5 Prol511Pr Likely 8 X 4533G> A Synonymous

[2525] 1 o Benign (2 7 15

[2526] 1 ) 1

[2527] 6 E Likely 1

[2528] 5 Hisl515Pr Nontruncating

[2529] 8 X 4544A> C Pathoge 1 o: Missense (1 8 15 nic

[2530] 5 ) 1

[2531] 6 E

[2532] 5 Alal516T Nontruncating Likely 8 X 4546G> A

[2533] 1 hr: Missense Benign (7 9 15

[2534] 6 ) 1

[2535] 6 E Likely 1

[2536] 5 Tyrl517A Nontruncating

[2537] 9 X 4549T> G Pathoge 1 sp: Missense (1 0 15 nic

[2538] 7 ) 1

[2539] 6 E Likely 2

[2540] 5 Tyrl517C Nontruncating

[2541] 9 X 4550A> G Pathoge 1 ys: Missense (1 1 15 nic

[2542] 7 ) 1

[2543] 6 E 1

[2544] 5 Truncating: Pathoge 9 X 4551C>G Tyrl517X

[2545] 1 Nonsense nic (1 2 15 )

[2546]

[2547] 7

[2548] 73

[2549] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2550] 1

[2551] 6 E

[2552] 5 Glyl521G Likely 9 X 4563T> C Synonymous

[2553] 2 ( ly Benign 1 3 15

[2554] 1 ) 1

[2555] 6 E Truncating: 1

[2556] 5 Vall525fs Pathoge 9 X 4573delG Deletion / Inser

[2557] 2 8X nic (1 4 15 tion

[2558] 5 ) 1

[2559] 6 E Likely 1

[2560] 5 Vall525G Nontruncating

[2561] 9 X 4574T> G Pathoge 2 ly: Missense (1 5 15 nic

[2562] 5 ) 1

[2563] 6 E

[2564] 5 Glyl529G Likely 9 X 4587C>A Synonymous

[2565] 2 ly Benign (1 6 15

[2566] 9 ) 1 Nontruncating

[2567] 6 E Asnl531 1

[2568] 5 Pathoge 9 X 4593_4844del252 Glul614d

[2569] 3 Deletion / Inser nic (1 7 15 el84

[2570] 1 tion ) 1

[2571] 6 E 1

[2572] 5 Truncating: Pathoge 9 X 4609G> T Glul537X

[2573] 3 Nonsense nic (1 8 15

[2574] 7 ) 1

[2575] 6 E 6

[2576] 5 Truncating: Pathoge 9 X 4617G> A Trpl539X

[2577] 3 Nonsense nic (1 9 15

[2578] 9 ) 1

[2579] 7 E

[2580] 5 Thrl543T Likely 0 X 4629G> A Synonymous

[2581] 4 hr Benign (1 0 15

[2582] 3 )

[2583]

[2584] 1

[2585] 7 E

[2586] 5 Lysl545L Likely 0 X 4635G>A Synonymous

[2587] 4 ys Benign 1 15 (1)

[2588] 5

[2589] 1

[2590] 7 E

[2591] 5 Argl546T Nontruncating 1 0 X 4636C>T VUS

[2592] 4 rp: Missense

[2593] 2 15 (1)

[2594] 6

[2595] 1

[2596] 7 E

[2597] 5 Argl547A Likely 0 X 4641C>T Synonymous

[2598] 4 Benign 3 15 rg (1)

[2599]

[2600] 7

[2601] 74

[2602] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2603] 1

[2604] 7 E

[2605] 5 Alal555A Likely 0 X 4665A> C Synonymous

[2606] 5 la Benign 4 15 (9)

[2607] 5

[2608] 1

[2609] 7 E

[2610] 5 Argl557C Nontruncating Likely 0 X 4669C>T

[2611] 5 ys: Missense Benign 5 15 (1)

[2612] 7

[2613] 1

[2614] 7 E

[2615] 5 Thrl558T Likely 0 X 4674G> A Synonymous

[2616] 5 hr Benign (1 6 15

[2617] 8 1) 1

[2618] 7 E

[2619] 5 Leul562L Likely 0 X 4684C>T Synonymous

[2620] 6 eu Benign 7 15 (1)

[2621] 2

[2622] 1

[2623] 7 E Truncating:

[2624] 5 Asnl563f Pathog 1 0 X 4689_4690delTG Deletion / Inser

[2625] 6 S12X enic 8 15 tion (1)

[2626] 3

[2627] 1

[2628] 7 E

[2629] 5 Thrl570M Nontruncating 1 0 X 4709C>T VUS

[2630] 7 et: Missense

[2631] 9 15 (1)

[2632] 0

[2633] 1

[2634] 7 E

[2635] 5 Thrl570T Likely 1 X 4710G> C Synonymous

[2636] 7 hr Benign 0 15 (1)

[2637] 0

[2638] 1

[2639] 7 E

[2640] 5 Truncating: Pathog 3 1 X 4746G> A Trpl582X

[2641] 8 Nonsense enic 1 15 (3)

[2642] 2

[2643] 1

[2644] 7 E

[2645] 5 Ilel597Va Nontruncating Likely 1 X 4789A> G

[2646] 9 1: Missense Benign 2 15 (1)

[2647] 7

[2648] 1

[2649] 7 E Truncating:

[2650] 5 Phel599fs Pathog 1 1 X 4795_4802insTACACCTT Deletion / Inser

[2651] 9 17X enic 3 15 tion (1)

[2652] 9

[2653] 1

[2654] 7 E

[2655] 5 Truncating: Pathog 1 1 X 4797C>G Tyrl599X

[2656] 9 Nonsense enic 4 15 (1)

[2657]

[2658] 9

[2659] 75

[2660] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2661] 1

[2662] 7 E

[2663] 6 Serl6O3S Likely 1 X 4809C>T Synonymous

[2664] 0 er Benign 5 15 (2)

[2665] 3

[2666] 1

[2667] 7 E

[2668] 6 Vall604M Nontruncating Likely 1 X 4810G> A

[2669] 0 et: Missense Benign 6 15 (2)

[2670] 4

[2671] 1

[2672] 7 E

[2673] 6 Thrl606S Nontruncating 1 1 X 4817C>G VUS

[2674] 0 er: Missense

[2675] 7 15 (1)

[2676] 6

[2677] 1 Nontruncating

[2678] 7 E

[2679] 6 Ilel610de

[2680] 1 X 4828_4830delATC

[2681] 1 1 Deletion / Inser vus 5 8 15 (2)

[2682] 0 tion

[2683] 1

[2684] 7 E

[2685] 6 Likely 1 X 4830C> A Ilel610Ue Synonymous

[2686] 1 Benign 9 15 (1)

[2687] 0

[2688] 1

[2689] 7 E Truncating:

[2690] 6 Vall611fs Pathog 1 2 X 4830_4831insC Deletion / Inser

[2691] 1 3X enic 0 15 tion (1)

[2692] 1

[2693] 1

[2694] 7 E

[2695] 6 Vai 161111 Nontruncating 1 2 X 4831G> A VUS

[2696] 1 e: Missense

[2697] 1 15 (1)

[2698] 1

[2699] 1

[2700] 7 E

[2701] 6 Thrl612T Likely 2 X 4836G> A Synonymous

[2702] 1 hr Benign 2 15 (3)

[2703] 2

[2704] 1

[2705] 7 E

[2706] 6 Asnl615A Likely 2 X 4845C>T Synonymous

[2707] 1 sn Benign 3 15 (3)

[2708] 5

[2709] 1

[2710] 7 E

[2711] 6 Serl619P Nontruncating Likely 2 X 4856C>T

[2712] 1 he: Missense Benign 4 15 (2)

[2713] 9

[2714] 1

[2715] 7 E

[2716] 6 Truncating: Pathog 1 2 X 4861C>T Glnl621X

[2717] 2 Nonsense enic 5 15 (1)

[2718]

[2719] 1

[2720] 76

[2721] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2722] 1

[2723] 7 E

[2724] 6 Likely 2 X 4872C>T Ilel624Ile Synonymous

[2725] 2 Benign 6 15 (1)

[2726] 4

[2727] 1

[2728] 7 E

[2729] 6 Vai 162611 Nontruncating Likely 2 X 4876G> A

[2730] 2 e: Missense Benign 7 15 (1)

[2731] 6

[2732] 1

[2733] 7 E

[2734] 6 Vai 1626V Likely 2 X 4878OT Synonymous

[2735] 2 al Benign 8 15 (1)

[2736] 6

[2737] 1

[2738] 7 E Truncating:

[2739] 6 Tyrl627fs Pathog 1 2 X 4879_4880insT Deletion / Inser

[2740] 2 30X enic 9 15 tion (1)

[2741] 7

[2742] 1

[2743] 7 E Truncating:

[2744] 6 Tyrl627fs Pathog 2 3 X 4880_4881delAT Deletion / Inser

[2745] 2 29X enic 0 15 tion (2)

[2746] 7

[2747] 1

[2748] 7 E

[2749] 6 Vall628L Nontruncating 1 3 X 4882G> C VUS

[2750] 2 eu: Missense

[2751] 1 15 (1)

[2752] 8

[2753] 1

[2754] 7 E

[2755] 6 Truncating: Pathog 1 3 X 4888C>T Glnl630X

[2756] 3 Nonsense enic 2 15 (1)

[2757] 0

[2758] 1

[2759] 7 E Truncating:

[2760] 6 Ilel632fs Pathog 1 3 X 4894_4895delAT Deletion / Inser

[2761] 3 24X enic 3 15 tion (1)

[2762] 2

[2763] 1

[2764] 7 E Truncating:

[2765] 6 Ilel632fs Pathog 1 3 X 4895_4896delTA Deletion / Inser

[2766] 3 24X enic 4 15 tion (1)

[2767] 2

[2768] 1

[2769] 7 E Truncating:

[2770] 6 Glul633fs Pathog 2 3 X 4897 4898insT Deletion / Inser

[2771] 3 23X enic 5 15 tion (2)

[2772] 3

[2773] 1

[2774] 7 E

[2775] 6 Truncating: Pathog 3 3 X 4906C>T Glnl636X

[2776] 3 Nonsense enic 6 15 (2)

[2777]

[2778] 6

[2779] 77

[2780] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2781] 1

[2782] 7 E

[2783] 6 Vai 1638V Likely 3 X 4914G> A Synonymous

[2784] 3 al Benign 7 15 (1)

[2785] 8

[2786] 1

[2787] 7 E

[2788] 6 Glyl639G Likely 3 X 4917C>G Synonymous

[2789] 3 Benign 8 15 ly (1)

[2790] 9

[2791] 1

[2792] 7 E

[2793] 6 Glyl639G Likely 3 X 4917C>T Synonymous

[2794] 3 Benign 9 15 ly (1)

[2795] 9

[2796] 1

[2797] 7 E Truncating:

[2798] 6 Thrl646fs Pathog 1 4 X 4935delC Deletion / Inser

[2799] 4 76X enic 0 15 tion (1)

[2800] 6

[2801] 1

[2802] 7 E

[2803] 6 Asnl647A Likely 4 X 4941C>T Synonymous

[2804] 4 sn Benign 1 15 (1)

[2805] 7

[2806] 1

[2807] 7 E

[2808] 6 Thrl649M Nontruncating Likely 4 X 4946C>T

[2809] 4 et: Missense Benign 2 15 (2)

[2810] 9

[2811] 1

[2812] 7 E

[2813] 6 Thrl649T Likely 4 X 4947G> A Synonymous

[2814] 4 hr Benign 3 15 (1)

[2815] 9

[2816] 1

[2817] 7 E Truncating:

[2818] 6 Vall650fs Pathog 1 4 X 4948delG Deletion / Inser

[2819] 5 71X enic 4 15 tion (1)

[2820] 0

[2821] 1

[2822] 7 E

[2823] 6 Truncating: Pathog 1 4 X 4951C>T Glnl651X

[2824] 5 Nonsense enic 5 15 (1)

[2825] 1

[2826] 1

[2827] 7 E

[2828] 6 Truncating: Pathog 4 4 X 4957C>T Glnl653X

[2829] 5 Nonsense enic 6 15 (3)

[2830] 3

[2831] 1

[2832] 7 E

[2833] 6 Vall655L Nontruncating Likely 4 X 4963G> T

[2834] 5 eu: Missense Benign 7 15 (1)

[2835]

[2836] 5

[2837] 78

[2838] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2839] 1

[2840] 7 E

[2841] 6 Thrl667P Nontruncating 1 4 X 4999A> C

[2842] 6 ro: Missense vus 8 15 (1)

[2843] 7

[2844] 1

[2845] 7 E 5006 5007insATGGCACCA Truncating:

[2846] 6 CTrpl669 Pathog 1 4 X ACGTCTCCTACAG (SEQ Deletion / Inser

[2847] 6 X enic 9 15 ID NO:21) tion (1)

[2848] 9

[2849] 1

[2850] 7 E Truncating: 43

[2851] 6 Argl672fs Pathog 5 X 5014_5015delAG Deletion / Inser

[2852] 7 97X enic (1 0 15 tion

[2853] 2 2) 1

[2854] 7 E Truncating:

[2855] 6 Argl672fs Pathog 5 5 X 5014delA Deletion / Inser

[2856] 7 50X enic 1 15 tion (3)

[2857] 2

[2858] 1

[2859] 7 E

[2860] 6 Prol674L Nontruncating Likely 5 X 5021C>T

[2861] 7 eu: Missense Benign 2 15 (1)

[2862] 4

[2863] 1

[2864] 7 E

[2865] 6 Glyl678S Nontruncating Likely 5 X 5032G> A

[2866] 7 er: Missense Benign 3 15 (1)

[2867] 8

[2868] 1

[2869] 7 E Truncating:

[2870] 6 Lysl681fs Pathog 1 5 X 5043delA Deletion / Inser

[2871] 8 40X enic 4 15 tion (1)

[2872] 1

[2873] 1

[2874] 7 E

[2875] 6 Serl684L Nontruncating Likely 5 X 5051C>T

[2876] 8 eu: Missense Benign 5 15 (4)

[2877] 4

[2878] 1

[2879] 7 E

[2880] 6 Leul688L Likely 5 X 5064C>T Synonymous

[2881] 8 eu Benign 6 15 (1)

[2882] 8

[2883] 1

[2884] 7 E

[2885] 6 Alal690A Likely 5 X 5070C>T Synonymous

[2886] 9 la Benign 7 15 (1)

[2887] 0

[2888] 1

[2889] 7 E

[2890] 6 Truncating: Pathog 2 5 X 5079C>A Tyrl693X

[2891] 9 Nonsense enic 8 15 (2)

[2892]

[2893] 3

[2894] 79

[2895] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2896] 1 Nontruncating

[2897] 7 E 5080_5103delCATGTGCAG AHisl694

[2898] 6 Pathog 1 5 X CTGCGGGCCACCA (SEQ Asnl701

[2899] 9 Deletion / Inser enic 9 15 ID NO:22) del8 (1)

[2900] 4 tion

[2901] 1

[2902] 7 E

[2903] 6 Hisl694A Nontruncating Likely 6 X 5081A> G

[2904] 9 rg: Missense Benign 0 15 (1)

[2905] 4

[2906] 1

[2907] 7 E

[2908] 6 Truncating: Pathog 4 6 X 5086C>T Glnl696X

[2909] 9 Nonsense enic 1 15 (3)

[2910] 6

[2911] 1

[2912] 7 E

[2913] 6 Argl698T Nontruncating 1 6 X 5092C>T VUS

[2914] 9 rp: Missense

[2915] 2 15 (1)

[2916] 8

[2917] 1

[2918] 7 E Likely

[2919] 6 Alal699A Nontruncating 1 6 X 5096C>A Pathog

[2920] 9 sp: Missense

[2921] 3 15 enic (1)

[2922] 9

[2923] 1

[2924] 7 E Likely

[2925] 7 Asnl701A Nontruncating 2 6 X 5101A>G Pathog

[2926] 0: Missense

[2927] 4 15 sp enic (1)

[2928] 1

[2929] 1

[2930] 7 E

[2931] 7 Truncating: Pathog 3 6 X 5120G> A Trpl707X

[2932] 0 Nonsense enic 5 15 (2)

[2933] 7

[2934] 1

[2935] 7 E Truncating:

[2936] 7 Alal708fs Pathog 1 6 X 5124delC Deletion / Inser

[2937] 0 13X enic 6 15 tion (1)

[2938] 8

[2939] 1

[2940] 7 E

[2941] 7 Thrl71111 Nontruncating 3 6 X 5132C>T VUS

[2942] 1 e: Missense

[2943] 7 15 (1)

[2944] 1

[2945] 1

[2946] 7 E Truncating:

[2947] 7 Phel714fs Pathog 1 6 X 5141delT Deletion / Inser

[2948] 1 7X enic 8 15 tion (1)

[2949] 4

[2950] 1

[2951] 7 E

[2952] 7 Truncating: Pathog 1 6 X 5146G>T Glul716X

[2953] 1 Nonsense enic 9 15 (1)

[2954]

[2955] 6

[2956] 80

[2957] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[2958] 1

[2959] 7 E Truncating:

[2960] 7 5147 5157del AGCCTGTGG Glul716fs Pathog 2 7 X Deletion / Inser

[2961] 1 GG (SEQ ID NO:23) 50X enic 0 15 tion (1)

[2962] 6

[2963] 1

[2964] 7 E Truncating:

[2965] 7 Vall718fs Pathog 1 7 X 5154_5155insT Deletion / Inser

[2966] 1 52X enic 1 15 tion (1)

[2967] 8

[2968] 1

[2969] 7 E

[2970] 7 Alal724A Likely 7 X 5172C>T Synonymous

[2971] 2 la Benign (1 2 15

[2972] 4 1) 1

[2973] 7 E

[2974] 7 Prol727L Nontruncating 2 7 X 5180C>T VUS

[2975] 2 eu: Missense

[2976] 3 15 (2)

[2977] 7

[2978] 1

[2979] 7 E Truncating:

[2980] 7 Prol729fs Pathog 2 7 X 5186delC Deletion / Inser

[2981] 2 30X enic 4 15 tion (1)

[2982] 9

[2983] 1

[2984] 7 E

[2985] 7 Leul738L Likely 7 X 5214C>T Synonymous

[2986] 3 eu Benign 5 15 (1)

[2987] 8

[2988] 1

[2989] 7 E Truncating:

[2990] 7 5242 5257delGTCGTATAC Vall748fs Pathog 1 7 X Deletion / Inser

[2991] 4 ACTTGGT (SEQ ID NO:24) 6X enic 6 15 tion (1)

[2992] 8

[2993] 1

[2994] 7 E

[2995] 7 Vall748V Likely 7 X 5244C>T Synonymous

[2996] 4 al Benign 7 15 (1)

[2997] 8

[2998] 1

[2999] 7 E Truncating:

[3000] 7 Vall749fs Pathog 1 7 X 5245delG Deletion / Inser

[3001] 4 9X enic 8 15 tion (1)

[3002] 9

[3003] 1

[3004] 7 E Likely

[3005] 7 Trpl752C Nontruncating 1 7 X 5256G> C Pathog

[3006] 5 ys: Missense

[3007] 9 15 enic (1)

[3008] 2

[3009] 1

[3010] 7 E

[3011] 7 Serl763C Nontruncating 1 8 X 5288C>G VUS

[3012] 6: Missense

[3013] 0 15 ys (1)

[3014]

[3015] 3

[3016] 81

[3017] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3018] 1

[3019] 7 E

[3020] 7 Serl763S Likely 8 X 5289C>T Synonymous

[3021] 6 er Benign 1 15 (1)

[3022] 3

[3023] 1

[3024] 7 E

[3025] 7 Truncating: Pathog 1 8 X 5290G> T Glu1764X

[3026] 6 Nonsense enic 2 15 (1)

[3027] 4

[3028] 1

[3029] 7 E

[3030] 7 Hisl769H Likely 8 X 5307T> C Synonymous

[3031] 6 is Benign 3 15 (2)

[3032] 9

[3033] 1

[3034] 7 E

[3035] 7 Thrl773Il Nontruncating Likely 8 X 5318C>T

[3036] 7 e: Missense Benign 4 15 (1)

[3037] 3

[3038] 1

[3039] 7 E

[3040] 7 Hisl777Pr Nontruncating Likely 8 X 5330A>C

[3041] 7 0: Missense Benign 5 15 (1)

[3042] 7

[3043] 1

[3044] 7 E

[3045] 7 Prol786L Nontruncating Likely 8 X 5357C>T

[3046] 8 eu: Missense Benign 6 15 (2)

[3047] 6

[3048] 1

[3049] 7 E

[3050] 7 Leul787L Likely 8 X 5359C>T Synonymous

[3051] 8 eu Benign 7 15 (1)

[3052] 7

[3053] 1

[3054] 7 E Truncating:

[3055] 7 Glyl788fs Pathog 1 8 X 5363delG Deletion / Inser

[3056] 8 9X enic 8 15 tion (1)

[3057] 8

[3058] 1

[3059] 7 E

[3060] 7 Glyl788A Nontruncating Likely 8 X 5363G> A

[3061] 8 sp: Missense Benign 9 15 (1)

[3062] 8

[3063] 1

[3064] 7 E

[3065] 7 Alal790P Nontruncating Likely 9 X 5368G> C

[3066] 9 ro: Missense Benign 0 15 (1)

[3067] 0

[3068] 1

[3069] 7 E

[3070] 7 Alal790V Nontruncating Likely 9 X 5369C>T

[3071] 9 al: Missense Benign 1 15 (2)

[3072]

[3073] 0

[3074] 82

[3075] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3076] 1

[3077] 7 E

[3078] 7 Asnl791A Likely 9 X 5373C>T Synonymous

[3079] 9 sn Benign 2 15 (2)

[3080] 1

[3081] 1

[3082] 7 E

[3083] 7 Alal792T Nontruncating Likely 9 X 5374G> A

[3084] 9 hr: Missense Benign 3 15 (1)

[3085] 2

[3086] 1

[3087] 7 E

[3088] 7 Truncating: Pathog 1 9 X 5395C>T Glnl799X

[3089] 9 Nonsense enic 4 15 (1)

[3090] 9

[3091] 1

[3092] 7 E

[3093] 8 Prol801Pr Likely 9 X 5403T> C Synonymous

[3094] 0 0 Benign 5 15 (1)

[3095] 1

[3096] 1

[3097] 7 E

[3098] 8 Serl806A Nontruncating Likely 9 X 5418C>A

[3099] 0 rg: Missense Benign 6 15 (1)

[3100] 6

[3101] 1

[3102] 7 E

[3103] 8 Glul811L Nontruncating 1 9 X 5431G> A VUS

[3104] 1 ys: Missense

[3105] 7 15 (1)

[3106] 1

[3107] 1

[3108] 7 E 5432 5477delAGCCCGGAG Truncating:

[3109] 8 CGlu1811 Pathog 1 9 X GCAGCTTCGTGG (SEQ ID Deletion / Inser

[3110] 1 fsllX enic 8 15 NO:25) tion (1)

[3111] 1

[3112] 1

[3113] 7 E

[3114] 8 Glul811A Nontruncating Likely 9 X 5433G> T

[3115] 1 sp: Missense Benign 9 15 (1)

[3116] 1

[3117] 1

[3118] 8 E

[3119] 8 Vall817M Nontruncating 1 0 X 5449G> A VUS

[3120] 1 et: Missense

[3121] 0 15 (1)

[3122]

[3123] 7

[3124] 1

[3125] 8 E

[3126] 8 Alal818Al Likely 0 X 5454G> A Synonymous

[3127] 1 a Benign (5 1 15

[3128] 8 ) 1

[3129] 8 E

[3130] 8 Glyl820Ar Nontruncating: Likely 0 X 5458G> A

[3131] 2 (1 g Missense Benign 2 15

[3132]

[3133] 0 )

[3134] 83

[3135] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1

[3136] 8 E 1

[3137] 8 Truncating: Pathoge 0 X 5478G> A Trpl826X

[3138] 2 Nonsense nic (1 3 15

[3139] 6 ) 1

[3140] 8 E Truncating: 1

[3141] 8 Glnl828fs9 Pathoge 0 X 5481_5482insGG Deletion / Inserti

[3142] 2 X nic (1 4 15 on

[3143] 8 ) 1

[3144] 8 E 3

[3145] 8 Truncating: Pathoge 0 X 5482C>T Glnl828X

[3146] 2 Nonsense nic (3 5 15

[3147] 8 ) 1

[3148] 8 E 1

[3149] 8 Glnl828Ar Nontruncating:

[3150] 0 X 5483A> G VUS

[3151] 2 ( g Missense 1 6 15

[3152] 8 ) 1

[3153] 8 E

[3154] 8 Leul829Le Likely 0 X 5485C>T Synonymous

[3155] 2 u Benign (1 7 15

[3156] 9 ) 1

[3157] 8 E Likely 1

[3158] 8 Glyl832Se Nontruncating:

[3159] 0 X 5494G> A Pathoge 3 r Missense (1 8 15 nic

[3160] 2 ) 1

[3161] 8 E 1

[3162] 8 Truncating: Pathoge 0 X 5511G> A Trpl837X

[3163] 3 Nonsense nic (1 9 15

[3164] 7 ) 1

[3165] 8 E Truncating: 1

[3166] 8 Trpl839fsl Pathoge 1 X 5515delT Deletion / Inserti

[3167] 3 10X nic (1 0 15 on

[3168] 9 ) 1

[3169] 8 E Likely 2

[3170] 8 Trpl839Ar Nontruncating:

[3171] 1 X 5515T> A Pathoge 3 ( g Missense 1 1 15 nic

[3172] 9 ) 1

[3173] 8 E

[3174] 8 Lysl847Ly Likely 1 X 5541G> A Synonymous

[3175] 4 s Benign (1 2 15

[3176] 7 ) 1

[3177] 8 E Truncating: 2

[3178] 8 Hisl851fsl Pathoge 1 X 5552_5553delAT Deletion / Inserti

[3179] 5 37X nic (1 3 15 on

[3180] 1 )

[3181]

[3182] 84

[3183] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3184] 1

[3185] 8 E Truncating: 1

[3186] 8 Vall852fsl Pathoge 1 X 5555_5556insT Deletion / Inserti

[3187] 5 37X nic (1 4 15 on

[3188] 2 ) 1

[3189] 8 E Truncating: 1

[3190] 8 Metl854fs Pathoge 1 X 5560_5561insA Deletion / Inserti

[3191] 5 136X nic (1 5 15 on

[3192] 4 ) 1

[3193] 8 E Truncating: 1

[3194] 8 Aspl856fs Pathoge 1 X 5567_5568insT Deletion / Inserti

[3195] 5 132X nic (1 6 15 on

[3196] 6 ) 1

[3197] 8 E Truncating: 1

[3198] 8 Aspl858fs Pathoge 1 X 5572delG Deletion / Inserti

[3199] 5 90X nic (1 7 15 on

[3200] 8 ) 1

[3201] 8 E

[3202] 8 Alal859Al Likely 1 X 5577T> C Synonymous

[3203] 5 a Benign (1 8 15

[3204] 9 ) 1

[3205] 8 E

[3206] 8 Glyl860Gl Likely 1 X 5580C>A Synonymous

[3207] 6 ( y Benign 2 9 15

[3208] 0 ) 1

[3209] 8 E

[3210] 8 Nontruncating: Likely 2 X 5582C>T Thrl861Ile

[3211] 6 Missense Benign (2 0 15

[3212] 1 ) 1

[3213] 8 E Truncating: 1

[3214] 8 Argl865fs8 Pathoge 2 X 5595delG Deletion / Inserti

[3215] 6 3X nic (1 1 15 on

[3216] 5 ) 1

[3217] 8 E 1

[3218] 8 Leul866Pr Nontruncating:

[3219] 2 X 5597T> C VUS

[3220] 6 o Missense (1 2 15

[3221] 6 ) 1

[3222] 8 E

[3223] 8 Leul866Le Likely 2 X 5598C>T Synonymous

[3224] 6 u Benign (2 3 15

[3225] 6 ) 1

[3226] 8 E Likely 1

[3227] 8 Asnl870Hi Nontruncating:

[3228] 2 X 5608A> C Pathoge 7 s Missense (1 4 15 nic

[3229]

[3230] 0 )

[3231] 85

[3232] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1

[3233] 8 E Likely 1

[3234] 8 Asnl87OAs Nontruncating:

[3235] 2 X 5608A> G Pathoge 7 Mis (1

[3236] P sense

[3237] 5 15 nic

[3238] 0 ) 1

[3239] 8 E Likely 1

[3240] 8 Asnl870Ly Nontruncating:

[3241] 2 X 5610C> G Pathoge 7 s Missense (1 6 15 nic

[3242] 0 ) 1

[3243] 8 E

[3244] 8 Alal871Th Nontruncating: Likely 2 X 5611G> A

[3245] 7 r Missense Benign (4 7 15

[3246] 1 ) 1

[3247] 8 E Likely 1

[3248] 8 Nontruncating:

[3249] 2 X 5618G> T Serl873Ile Pathoge 7 Missense (1 8 15 nic

[3250] 3 ) 1

[3251] 8 E 1

[3252] 8 Truncating: Pathoge 2 X 5622G> A Trpl874X

[3253] 7 Nonsense nic (1 9 15

[3254] 4 ) 1

[3255] 8 E Truncating: 1

[3256] 8 Alal877fs7 Pathoge 3 X 5628_5629delAGinsC Deletion / Inserti

[3257] 7 2X nic (1 0 15 on

[3258] 7 ) 1

[3259] 8 E

[3260] 8 Thrl878Me Nontruncating: Likely 3 X 5633OT

[3261] 7 t Missense Benign (1 1 15

[3262] 8 ) 1

[3263] 8 E 5659 5672delATCGTGG Truncating: 1

[3264] 8 Ilel887fs9 Pathoge 3 X GCCTGGT (SEQ ID Deletion / Inserti

[3265] 8 7X nic (1 2 15 NO:26) on

[3266] 7 ) 1

[3267] 8 E

[3268] 8 Vall888Me Nontruncating: Likely 3 X 5662G> A

[3269] 8 t Missense Benign (1 3 15

[3270] 8 ) 1

[3271] 8 E

[3272] 8 Alal894Al Likely 3 X 5682OT Synonymous

[3273] 9 a Benign (5 4 15

[3274] 4 ) 1

[3275] 8 E 1

[3276] 9 Truncating: Pathoge 3 X 5707C> T Glnl903X

[3277] 0 Nonsense nic (1 5 15

[3278] 3 )

[3279]

[3280] 86

[3281] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3282] 1

[3283] 8 E 1

[3284] 9 Truncating: Pathoge 3 X 5722C>T Glnl908X

[3285] 0 Nonsense nic (1 6 15

[3286] 8 ) 1

[3287] 8 E

[3288] 9 Alal913Al Likely 3 X 5739C>T Synonymous

[3289] 1 a Benign (1 7 15

[3290] 3 ) 1

[3291] 8 E Likely 1

[3292] 9 Glyl914Al Nontruncating:

[3293] 3 X 5741G> C Pathoge

[3294] 1 a Missense (1 8 15 nic

[3295] 4 ) 1

[3296] 8 E 1

[3297] 9 5757C>A Truncating: Pathoge 3 X 5756T> A,

[3298] 1 Phel919X Nonsense nic (1 9 15

[3299] 9 ) 1

[3300] 8 E Truncating: 1

[3301] 9 Argl920fs2 Pathoge 4 X 5758delC Deletion / Inserti

[3302] 2 9X nic (1 0 15 on

[3303] 0 ) 1

[3304] 8 E

[3305] 9 Leul921Le Likely 4 X 5763G> A Synonymous

[3306] 2 u Benign (9 1 15

[3307] 1 ) 1

[3308] 8 E 2

[3309] 9 Truncating: Pathoge 4 X 5764C>T Glnl922X

[3310] 2 Nonsense nic (2 2 15

[3311] 2 ) 1

[3312] 8 E

[3313] 9 Vall923Va Likely 4 X 5769C>T Synonymous

[3314] 2 1 Benign (1 3 15

[3315] 3 ) 1

[3316] 8 E

[3317] 9 Glyl924Gl Likely 4 X 5772C>T Synonymous

[3318] 2 ( y Benign 1 4 15

[3319] 4 ) 1

[3320] 8 E

[3321] 9 Alal926Va Nontruncating: Likely 4 X 5777C>T

[3322] 2 1 Missense Benign (1 5 15

[3323] 6 ) 1

[3324] 8 E

[3325] 9 Prol928Ar Nontruncating: Likely 4 X 5783C>G

[3326] 2 (1 g Missense Benign 6 15

[3327]

[3328] 8 )

[3329] 87

[3330] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1

[3331] 8 E Truncating: 1

[3332] 9 Hisl938fs5 Pathoge 4 X 5813_5814insC Deletion / Inserti

[3333] 3 IX nic (1 7 15 on

[3334] 8 ) 1

[3335] 8 E Truncating: 1

[3336] 9 Argl942fs4 Pathoge 4 X 5824_5825insC Deletion / Inserti

[3337] 4 8X nic (1 8 15 on

[3338] 2 ) 1

[3339] 8 E

[3340] 9 Argl942Hi Nontruncating: Likely 4 X 5825G> A

[3341] 4 s Missense Benign (1 9 15

[3342] 2 ) 1

[3343] 8 E

[3344] 9 Arg1942Ar Likely 5 X 5826C>T Synonymous

[3345] 4 ( g Benign 1 0 15

[3346] 2 ) 1

[3347] 8 E

[3348] 9 Nontruncating: Likely 5 X 5827G> A Vall943Ile

[3349] 4 Missense Benign (5 1 15

[3350] 3 ) 1

[3351] 8 E 1

[3352] 9 Glyl944Ar Nontruncating:

[3353] 5 X 5830G> A

[3354] 4 vus ( g Missense 1 2 15

[3355] 4 ) 1

[3356] 8 E

[3357] 9 Likely 5 X 5847C>T Serl949Ser Synonymous

[3358] 4 Benign (4 3 15

[3359] 9 ) 1

[3360] 8 E 1

[3361] 9 Vall950Me Nontruncating:

[3362] 5 X 5848G> A VUS

[3363] 5 t Missense (1 4 15

[3364] 0 ) 1

[3365] 8 E

[3366] 9 Glyl952As Nontruncating: Likely 5 X 5855G> A

[3367] 5 P Missense Benign (2 5 15

[3368] 2 ) 1

[3369] 8 E Truncating: 1

[3370] 9 Asnl954fs Pathoge 5 X 5861_5862insA Deletion / Inserti

[3371] 5 36X nic (1 6 15 on

[3372] 4 ) 1

[3373] 8 E Truncating: 1

[3374] 9 Vall956fs3 Pathoge 5 X 5866_5867insG Deletion / Inserti

[3375] 5 3X nic (1 7 15 on

[3376] 6 )

[3377]

[3378] 88

[3379] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1

[3380] 8 E Likely 1

[3381] 9 Vall956Gl Nontruncating:

[3382] 5 X 5867T> A Pathoge 5 u Missense (1 8 15 nic

[3383] 6 ) 1

[3384] 8 E 2

[3385] 9 Truncating: Pathoge 5 X 5878OT Glnl960X

[3386] 6 (2

[3387] Nonsense nic

[3388] 9 15

[3389] 0 ) 1

[3390] 8 E Nontruncating: Likely 1

[3391] 9

[3392] 6 X 5899_5901delGTG Vall967del Deletion / Inserti Pathoge 6 (1 0 15 on nic

[3393] 7 ) 1

[3394] 8 E Truncating: 1

[3395] 9 Vall967fs5 Pathoge 6 X 5899delG Deletion / Inserti

[3396] 6 X nic (1 1 15 on

[3397] 7 ) 1

[3398] 8 E 1

[3399] 9 Vall967Me Nontruncating:

[3400] 6 X 5899G> A VUS

[3401] 6 t Missense (1 2 15

[3402] 7 ) 1

[3403] 8 E 1

[3404] 9 Truncating: Pathoge 6 X 5905G> T Glul969X

[3405] 6 Nonsense nic (1 3 15

[3406] 9 ) 1

[3407] 8 E Truncating: 1

[3408] 9 Vall971fsl Pathoge 6 X 5912_5913delTG Deletion / Inserti

[3409] 7 8X nic (1 4 15 on

[3410] 1 ) 1

[3411] 8 E 2

[3412] 9 Truncating: Pathoge 6 X 5923OT Glnl975X

[3413] 7 Nonsense nic (2 5 15

[3414] 5 ) 1

[3415] 8 E Likely 1

[3416] 9 Cysl979Ty Nontruncating:

[3417] 6 X 5936G> A Pathoge 7 r Missense (1 6 15 nic

[3418] 9 ) 1

[3419] 8 E 1

[3420] 9 Glyl987As Nontruncating:

[3421] 6 X 5960G> A VUS

[3422] 8 P Missense (1 7 15

[3423] 7 ) 1

[3424] 8 E Truncating: 1

[3425] 9 Argl990fs5 Pathoge 6 X 5967_5968delGA Deletion / Inserti

[3426] 9 8X nic (1 8 15 on

[3427] 0 )

[3428]

[3429] 89

[3430] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1

[3431] 8 E Truncating: 1

[3432] 9 Argl990fs5 Pathoge 6 X 5968_5969delAG Deletion / Inserti

[3433] 9 8X nic (1 9 15 on

[3434] 0 ) 1

[3435] 8 E Asnl991 T Nontruncating: 1

[3436] 9 Pathoge 7 X 5969_6016del48 rp2006dell Deletion / Inserti

[3437] 9 nic (1 0 15 6 on

[3438] 1 ) 1

[3439] 8 E

[3440] 9 Asnl991 As Likely 7 X 5973C>T Synonymous

[3441] 9 n Benign (1 1 15

[3442] 1 ) 1

[3443] 8 E Phel992Le Nontruncating: Likely 4

[3444] 9

[3445] 7 X 5976_5978delCAC u: Thrl993d Deletion / Inserti Pathoge 9 (4 2 15 el on nic

[3446] 3 ) 1

[3447] 8 E 1

[3448] 9 Argl995Cy Nontruncating:

[3449] 7 X 5983C>T VUS

[3450] 9 s Missense (1 3 15

[3451] 5 ) 1

[3452] 8 E

[3453] 9 Argl995Hi Nontruncating: Likely 7 X 5984G> A

[3454] 9 s Missense Benign (1 4 15

[3455] 5 ) 1

[3456] 8 E Likely 3

[3457] 9 Glyl999Se Nontruncating:

[3458] 7 X 5995G> A Pathoge 9 r Missense (3 5 15 nic

[3459] 9 ) 1

[3460] 8 E Likely 1

[3461] 9 Glyl999Al Nontruncating:

[3462] 7 X 5996G> C Pathoge 9 a Missense (1 6 15 nic

[3463] 9 ) 1

[3464] 8 E Likely 1

[3465] 9 Glyl999Va Nontruncating:

[3466] 7 X 5996G> T Pathoge 9 1 Missense (1 7 15 nic

[3467] 9 ) 2

[3468] 8 E Nontruncating: 1

[3469] 0 Ser2000 T Pathoge 7 X 5997_6020del24 Deletion / Inserti

[3470] 0 yr2007del8 nic (1 8 15 on

[3471] 0 ) 2

[3472] 8 E 1

[3473] 0 Nontruncating:

[3474] 7 X 5998T>C Ser2000Pro VUS

[3475] 0 Missense (1 9 15

[3476] 0 )

[3477]

[3478] 90

[3479] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 2

[3480] 8 E

[3481] 0 Arg2001Tr Nontruncating: Likely 8 X 60010T

[3482] 0 (

[3483] P Missense Benign 1 0 15

[3484] 1 ) 2

[3485] 8 E

[3486] 0 Ala2003Th Nontruncating: Likely 8 X 6007G> A

[3487] 0 r (

[3488] Missense Benign 2 1 15

[3489] 3 ) 2

[3490] 8 E Truncating: 1

[3491] 0 Tyr2004fsl Pathoge 8 X 6010delT Deletion / Inserti

[3492] 0 11X nic (1 2 15 on

[3493] 4 ) 2

[3494] 8 E Likely 1

[3495] 0 Trp2006Cy Nontruncating:

[3496] 8 X 6018G> T Pathoge 0 s Missense (1 3 15 nic

[3497] 6 ) 2

[3498] 8 E

[3499] 0 Tyr2007Ty Likely 8 X 6021C>T Synonymous

[3500] 0 r Benign (1 4 15

[3501] 7 ) 2

[3502] 8 E 1

[3503] 0 Ser2009Le Nontruncating:

[3504] 8 X 6026C> T

[3505] 0 u Missense vus (1 5 15

[3506] 9 ) 2

[3507] 8 E 1

[3508] 0 Truncating: Pathoge 8 X 6031C>T Gln2011X

[3509] 1 Nonsense nic (1 6 15

[3510] 1 ) 2

[3511] 8 E 2

[3512] 0 Truncating: Pathoge 8 X 6040C>T Gln2014X

[3513] 1 Nonsense nic (2 7 15

[3514] 4 ) 2

[3515] 8 E 1

[3516] 0 Truncating: Pathoge 8 X 6050C> A Ser2017X

[3517] 1 Nonsense nic (1 8 15

[3518] 7 ) 2

[3519] 8 E 1

[3520] 0 Leu2021Pr Nontruncating:

[3521] 8 X 6062T> C VUS

[3522] 2 o Missense (1 9 15

[3523] 1 ) 2

[3524] 8 E

[3525] 0 Leu2021Le Likely 9 X 6063G> A Synonymous

[3526] 2 u Benign (1 0 15

[3527] 1 )

[3528]

[3529] 91

[3530] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3531] 2

[3532] 8 E 1

[3533] 0 Truncating: Pathoge 9 X 6065C>A Ser2022X

[3534] 2 Nonsense nic (1 1 15

[3535] 2 ) 2

[3536] 8 E

[3537] 0 Val2026Va Likely 9 X 6078C>T Synonymous

[3538] 2 1 Benign (2 2 15

[3539] 6 ) 2

[3540] 8 E Truncating: 1

[3541] 0 Pro2030fs8 Pathoge 9 X 6088_6091delCCCG Deletion / Inserti

[3542] 3 4X nic (1 3 15 on

[3543] 0 ) 2

[3544] 8 E Truncating: 2

[3545] 0 Val2031fs8 Pathoge 9 X 6090delC Deletion / Inserti

[3546] 3 5X nic (1 4 15 on

[3547] 0 ) 2

[3548] 8 E

[3549] 0 Ala2033Al Likely 9 X 6099G> A Synonymous

[3550] 3 a Benign (1 5 15

[3551] 3 ) 2

[3552] 8 E 2

[3553] 0 Truncating: Pathoge 9 X 6115C>T Gln2039X

[3554] 3 Nonsense nic (2 6 15

[3555] 9 ) 2

[3556] 8 E 1

[3557] 0 Arg2041Pr Nontruncating:

[3558] 9 X 6122G> C VUS

[3559] 4 o Missense (1 7 15

[3560] 1 ) 2

[3561] 8 E Truncating: 1

[3562] 0 Gly2047fs2 Pathoge 9 X 6140_6141insG Deletion / Inserti

[3563] 4 X nic (1 8 15 on

[3564] 7 ) 2

[3565] 8 E Truncating: 1

[3566] 0 Glu2049fs3 Pathoge 9 X 6145_6146insG Deletion / Inserti

[3567] 4 IX nic (1 9 15 on

[3568] 9 ) 2

[3569] 9 E

[3570] 0 Arg2051Cy Nontruncating: Likely 0 X 6151C>T

[3571] 5 s Missense Benign (1 0 15

[3572] 1 )

[3573]

[3574] E 2

[3575] 9

[3576] X 0 Leu2053Le Likely 0 6159G> C Synonymous

[3577] 1 5 u Benign (1 1

[3578]

[3579] 5 3 )

[3580] 92

[3581] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3582] E 2

[3583] 9 1 X 0 Truncating: Pathog 0 6166G> T Glu2056X

[3584] 1 5 Nonsense enic (1 2

[3585] 5 6 ) E 2

[3586] 9 2 X 0 Truncating: Pathog 0 6172C>T Gln2058X

[3587] 1 5 Nonsense enic (1 3

[3588] 5 8 ) E 2

[3589] 9

[3590] X 0 Gln2062Le Nontruncating Likely 0 6185A> T

[3591] 1 6 u: Missense Benign (1 4

[3592] 5 2 ) E 2

[3593] 9 2 X 0 Truncating: Pathog 0 6199C>T Gln2067X

[3594] 1 6 Nonsense enic (2 5

[3595] 5 7 ) E 2

[3596] 9

[3597] X 0 Gln2067Ar Nontruncating Likely 0 6200A> G

[3598] 1 6 ( g: Missense Benign 1 6

[3599] 5 7 ) E 2

[3600] 9

[3601] X 0 Likely 0 6204C>T Ser2068Ser Synonymous

[3602] 1 6 Benign (1 7

[3603] 5 8 ) E 2

[3604] 9

[3605] X 0 Gly2069Se Nontruncating Likely 0 6205G> A

[3606] 1 6 r: Missense Benign (1 8

[3607] 5 9 ) E 2

[3608] 9 Truncating: 1 X 0 Gly2069fs4 Pathog 0 6206_6207delGCinsA Deletion / Inser

[3609] 1 6 7X enic (1 9 tion

[3610] 5 9 ) E 2

[3611] 9 6223_6250delCGCTCGGC Truncating: 1 X 0 GArg2075f Pathog 1 GCAGTTTGAGGCC (SEQ Deletion / Inser

[3612] 1 7 s31X enic (1 0 ID NO:27) tion

[3613] 5 5 ) E 2

[3614] 9

[3615] X 0 Arg2075Hi Nontruncating Likely 1 6224G> A

[3616] 1 7 s: Missense Benign (1 1

[3617] 5 5 ) E 2

[3618] 9

[3619] X 0 Ala2077Al Likely 1 6231G> A Synonymous

[3620] 1 7 a Benign (2 2

[3621]

[3622] 5 7 )

[3623] 93

[3624] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3625] E 2

[3626] 9

[3627] X 0 Ala2082Th Nontruncating Likely 1 6244G> A

[3628] 1 8 r: Missense Benign (1 3

[3629] 5 2 ) E 2

[3630] 9 1 X 0 Nontruncating

[3631] 1 6248C>T Thr2083Ile VUS

[3632] 1 8: Missense (1 4

[3633] 5 3 ) E 2

[3634] 9

[3635] X 0 Likely 1 6255C>T Pro2085Pro Synonymous

[3636] 1 8 Benign (1 5

[3637] 5 5 ) E 2

[3638] 9 Truncating: 1 X 0 Pro2085fs3 Pathog 1 6255delC Deletion / Inser

[3639] 1 8 OX enic (1 6 tion

[3640] 5 5 ) E 2

[3641] 9 Likely 1 X 0 Tyr2092Cy Nontruncating

[3642] 1 6275A> G Pathog

[3643] 1 9 s: Missense (1 7 enic

[3644] 5 2 ) E 2

[3645] 9

[3646] X 0 Gly2099Gl Likely 1 6297G> T Synonymous

[3647] 1 9 (3 y Benign 8

[3648] 5 9 ) E 2

[3649] 9

[3650] X 1 Ser2100Le Nontruncating Likely 1 6299C> T

[3651] 1 0 u: Missense Benign (2 9

[3652] 5 0 ) E 2

[3653] 9 1 X 1 Truncating: Pathog 2 6307C>T Gln2103X

[3654] 1 0 Nonsense enic (1 0

[3655] 5 3 ) E 2

[3656] 9

[3657] X 1 Ala2110Al Likely 2 6330C>G Synonymous

[3658] 1 1 a Benign (1 1

[3659] 5 0 ) E 2

[3660] 9

[3661] X 1 Ala2110Al Likely 2 6330C>T Synonymous

[3662] 1 1 a Benign (2 2

[3663] 5 0 ) E 2

[3664] 9

[3665] X 1 Glu2111Ly Nontruncating Likely 2 6331G> A

[3666] 1 1 s: Missense Benign (1 3

[3667]

[3668] 5 1 )

[3669] 94

[3670] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3671] E 2

[3672] 9 1 X 1 Truncating: Pathog 2 6331G> T Glu2111X

[3673] 1 1 Nonsense enic (1 4

[3674] 5 1 ) E 2

[3675] 9

[3676] X 1 Arg2121Ar Likely 2 6363C>T Synonymous

[3677] 1 2 ( g Benign 3 5

[3678] 5 1 ) E 2

[3679] 9 Likely 1 X 1 Asn2128Hi Nontruncating

[3680] 2 6382A> C Pathog

[3681] 1 2 s: Missense (1 6 enic

[3682] 5 8 ) E 2

[3683] 9

[3684] X 1 Phe2132Cy Nontruncating Likely 2 6395T> G

[3685] 1 3 s: Missense Benign (2 7

[3686] 5 2 ) E 2 Nontruncating

[3687] 9 Likely 3 X 1

[3688] 2 6397_6399delTTC Phe2133del Pathog

[3689] 1 3 Deletion / Inser (1 8 enic

[3690] 5 3 tion ) E 2

[3691] 9 1 X 1 Ala2135Th Nontruncating

[3692] 2 6403G> A VUS

[3693] 1 3 r: Missense (1 9

[3694] 5 5 ) E 2

[3695] 9 3 X 1 Truncating: Pathog 3 6406C> T Gln2136X

[3696] 1 3 Nonsense enic (1 0

[3697] 5 6 ) E 2

[3698] 9

[3699] X 1 Thr2140Th Likely 3 6420C>T Synonymous

[3700] 1 4 r Benign (1 1

[3701] 5 0 ) E 2

[3702] 9 2 X 1 Truncating: Pathog 3 6424C>T Gln2142X

[3703] 1 4 Nonsense enic (2 2

[3704] 5 2 ) E 2

[3705] 9

[3706] X 1 Arg2147Tr Nontruncating Likely 3 6439C>T

[3707] 1 4 (

[3708] P: Missense Benign 1 3

[3709] 5 7 ) E 2

[3710] 9 6440_6467delGGGAGCCG Truncating: 2 X 1 TArg2147f Pathog 3 GAGGTGGACGTGG (SEQ Deletion / Inser

[3711] 1 4 s4X enic (1 4 ID NO:28) tion

[3712]

[3713] 5 7 )

[3714] 95

[3715] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3716] E 2

[3717] 9 1 X 1 Truncating: Pathog 3 6442G> T Glu2148X

[3718] 1 4 Nonsense enic (1 5

[3719] 5 8 ) E 2

[3720] 9 Truncating: 1 X 1 Asp2152fs Pathog 3 6454_6455insG Deletion / Inser

[3721] 1 5 22X enic (1 6 tion

[3722] 5 2 ) E 2

[3723] 9

[3724] X 1 Asp2152As Likely 3 6456C>T Synonymous

[3725] 1 5 P Benign (1 7

[3726] 5 2 ) E 2

[3727] 9 Truncating: 1 X 1 Val2153fs2 Pathog 3 6457_6458insG Deletion / Inser

[3728] 1 5 2X enic (1 8 tion

[3729] 5 3 ) E 2

[3730] 9

[3731] X 1 Val2153Me Nontruncating Likely 3 6457G> A

[3732] 1 5 t: Missense Benign (1 9

[3733] 5 3 ) E 2

[3734] 9 6461 6462insCCTGCCGGG Truncating: 1 X 1 AVal2154f Pathog 4 AGCCGGAGGTGG (SEQ Deletion / Inser

[3735] 1 5 s29X enic (1 0 ID NO:29) tion

[3736] 5 4 ) E 2

[3737] 9 2 X 1 Truncating: Pathog 4 6472C> T Gln2158X

[3738] 1 5 Nonsense enic (2 1

[3739] 5 8 ) E 2

[3740] 9 Truncating: 1 X 1 Val2159fsl Pathog 4 6475_6476insCCCC Deletion / Inser

[3741] 1 5 7X enic (1 2 tion

[3742] 5 9 ) E 2

[3743] 9 Truncating: 2 X 1 Met2161fs Pathog 4 6483_6484insG Deletion / Inser

[3744] 1 6 12X enic (1 3 tion

[3745] 5 1 ) E 2

[3746] 9

[3747] X 1 Arg2162Tr Nontruncating Likely 4 6484C>T

[3748] 1 6 P: Missense Benign (1 4

[3749] 5 2 ) E 2

[3750] 9 1 X 1 Arg2162Gl Nontruncating

[3751] 4 6485G> A VUS

[3752] 1 6 n: Missense (1 5

[3753]

[3754] 5 2 )

[3755] 96

[3756] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3757] E 2

[3758] 9 6 X 1 Truncating: Pathog 4 6487C>T Arg2163X

[3759] 1 6 Nonsense enic (3 6

[3760] 5 3 ) E 2

[3761] 9

[3762] X 1 Arg2163Gl Nontruncating Likely 4 6488G> A

[3763] 1 6 n: Missense Benign (1 7

[3764] 5 3 ) E 2

[3765] 9 2 X 1 Truncating: Pathog 4 6491C>G Ser2164X

[3766] 1 6 Nonsense enic (2 8

[3767] 5 4 ) E 2

[3768] 9 6 X 1 Arg2166Cy Nontruncating

[3769] 4 6496C>T VUS

[3770] 1 6 s: Missense (3 9

[3771] 5 6 ) E 2

[3772] 9 1 X 1 Truncating: Pathog 5 6504C>G Tyr2168X

[3773] 1 6 Nonsense enic (1 0

[3774] 5 8 ) E 2

[3775] 9 Truncating: 1 X 1 6518_6528delTTGACCTGC Val2173fs8 Pathog 5 Deletion / Inser

[3776] 1 7 GC (SEQ ID NO: 30) X enic (1 1 tion

[3777] 5 3 ) E 2

[3778] 9

[3779] X 1 Thr2180Th Likely 5 6540C>T Synonymous

[3780] 1 8 r Benign (2 2

[3781] 5 0 ) E 2

[3782] 9 1 X 1 Truncating: Pathog 5 6543C>G Tyr2181X

[3783] 1 8 Nonsense enic (1 3

[3784] 5 1 ) E 2

[3785] 9

[3786] X 1 Gln2182Ar Nontruncating Likely 5 6545A> G

[3787] 1 8 ( g: Missense Benign 2 4

[3788] 5 2 ) E 2

[3789] 9 Truncating: 4 X 1 Glu2184fs Pathog 5 6549_6550insT Deletion / Inser

[3790] 1 8 X enic (2 5 tion

[3791] 5 4 ) E 2

[3792] 9 Likely 1 X 1 Tyr2185As Nontruncating

[3793] 5 6553T> G Pathog

[3794] 1 8 P: Missense (1 6 enic

[3795]

[3796] 5 5 )

[3797] 97

[3798] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3799] E 2

[3800] 9 Likely 1 X 1 Trp2187Ar Nontruncating

[3801] 5 6559T> C Pathog

[3802] 1 8 ( g: Missense 1 7 enic

[3803] 5 7 ) E 2

[3804] 9 1 X 1 Truncating: Pathog 5 6560G> A Trp2187X

[3805] 1 8 Nonsense enic (1 8

[3806] 5 7 ) E 2

[3807] 9 1 X 1 Truncating: Pathog 5 6570T> A Tyr2190X

[3808] 1 9 Nonsense enic (1 9

[3809] 5 0 ) E 2

[3810] 9

[3811] X 1 Arg2191Hi Nontruncating Likely 6 6572G> A

[3812] 1 9 s: Missense Benign (1 0

[3813] 5 1 ) E 2

[3814] 9 Truncating: 3 X 1 Thr2192fsl Pathog 6 6574_6580delACCGCCA Deletion / Inser

[3815] 1 9 7X enic (3 1 tion

[3816] 5 2 ) E 2

[3817] 9

[3818] X 1 Thr2192Th Likely 6 6576C>T Synonymous

[3819] 1 9 r Benign (1 2

[3820] 5 2 ) E 2

[3821] 9 Truncating: 1 X 1 Cys2195fsl Pathog 6 6577_6583delGCCAGCT Deletion / Inser

[3822] 1 9 4X enic (1 3 tion

[3823] 5 5 ) E 2

[3824] 9 Truncating: 2 X 1 Cys2195fsl Pathog 6 6583_6589delTGCCAGC Deletion / Inser

[3825] 1 9 4X enic (2 4 tion

[3826] 5 5 ) E 2

[3827] 9 1 X 1 Truncating: Pathog 6 6586C>T Gln2196X

[3828] 1 9 Nonsense enic (1 5

[3829] 5 6 ) E 2

[3830] 9

[3831] X 1 Pro2198Le Nontruncating Likely 6 6593C>T

[3832] 1 9 u: Missense Benign (1 6

[3833] 5 8 ) E 2

[3834] 9

[3835] X 2 Arg2200Cy Nontruncating Likely 6 6598C>T

[3836] 1 0 s: Missense Benign (6 7

[3837]

[3838] 5 0 )

[3839] 98

[3840] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3841] E 2

[3842] 9

[3843] X 2 Ala2202Al Likely 6 6606G> A Synonymous

[3844] 1 0 a Benign (2 8

[3845] 5 2 ) E 2

[3846] 9

[3847] X 2 Arg2203Hi Nontruncating Likely 6 6608G> A

[3848] 1 0 s: Missense Benign (1 9

[3849] 5 3 ) E 2

[3850] 9

[3851] X 2 Likely 7 6621C>G Pro2207Pro Synonymous

[3852] 1 0 Benign (1 0

[3853] 5 7 ) E 2

[3854] 9 6625_6626insCGTGTGGCC Truncating: 1 X 2 Val2209fs5 Pathog 7 CTGCCCGGCG (SEQ ID Deletion / Inser

[3855] 1 0 9X enic (1 1 NO:31) tion

[3856] 5 9 ) E 2

[3857] 9

[3858] X 2 Val2209Me Nontruncating Likely 7 6625G> A

[3859] 1 0 t: Missense Benign (1 2

[3860] 5 9 ) E 2

[3861] 9

[3862] X 2 Ser2212As Nontruncating Likely 7 6635G> A

[3863] 1 1 n: Missense Benign (1 3

[3864] 5 2 ) E 2

[3865] 9 2 X 2 Arg2215Tr Nontruncating

[3866] 7 6643C> T VUS

[3867] 1 1 P: Missense (2 4

[3868] 5 5 ) E 2

[3869] 9

[3870] X 2 Arg2215Gl Nontruncating Likely 7 6644G> A

[3871] 1 1 n: Missense Benign (1 5

[3872] 5 5 ) E 2

[3873] 9 Likely 1 X 2 Leu2216Gl Nontruncating

[3874] 7 6647T> A Pathog

[3875] 1 1 n: Missense (1 6 enic

[3876] 5 6 ) E 2 Nontruncating

[3877] 9 2 X 2 6650 6664delTGCTGCCGC Val2217 L Pathog 7

[3878] 1 1 GGCTGG (SEQ ID NO: 32) eu2221del5 Deletion / Inser enic (2 7

[3879] 5 7 tion ) E 2 Nontruncating

[3880] 9 Pro2219_A 1 X 2 6656 6657insTCGGCTGGT Pathog 7 rg2220insA

[3881] 1 1 GCTGCC (SEQ ID NO:33) Deletion / Inser enic (1 8 rg L )

[3882]

[3883] 5 9 tion

[3884] 99

[3885] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3886] E 2 Nontruncating

[3887] 9 4 X 2 6657_6671delGCGGCTGG Pro2219_L Pathog 7

[3888] 1 1 CGCTGCC (SEQ ID NO:34) eu2223del5 Deletion / Inser enic (2 9

[3889] 5 9 tion ) E 2

[3890] 9 2 X 2 Arg2220Tr Nontruncating

[3891] 8 6658C>T VUS

[3892] 1 2 (2

[3893] P: Missense

[3894] 0

[3895] 5 0 ) E 2 Nontruncating

[3896] 9 Leu2221 A 1 X 2 6664_6665insTGCTGCCGC Pathog 8 2222insVal

[3897] 1 2 GGCTGG (SEQ ID NO:35) Deletion / Inser enic (1 1 Le u

[3898] 5 1 tion ) E 2

[3899] 9

[3900] X 2 Ala2222Va Nontruncating Likely 8 6665C>T

[3901] 1 2 1: Missense Benign (1 2

[3902] 5 2 ) E 2

[3903] 9

[3904] X 2 Ala2222Al Likely 8 6666G> A Synonymous

[3905] 1 2 a Benign (1 3

[3906] 5 2 ) E 2

[3907] 9 Truncating: 1 X 2 Pro2224fs3 Pathog 8 6670_6671insA Deletion / Inser

[3908] 1 2 7X enic (1 4 tion

[3909] 5 4 ) E 2

[3910] 9 1 X 2 Pro2224Le Nontruncating

[3911] 8 6671C>T VUS

[3912] 1 2 u: Missense (1 5

[3913] 5 4 ) E 2

[3914] 9 1 X 2 Nontruncating

[3915] 8 6680A> C His2227Pro VUS

[3916] 1 2: Missense (1 6

[3917] 5 7 ) E 2

[3918] 9 2 X 2 Truncating: Pathog 8 6687C>A Cys2229X

[3919] 1 2 Nonsense enic (1 7

[3920] 5 9 ) E 2 Nontruncating

[3921] 9 Likely 1 X 2 Val2231 P

[3922] 8 6693_6698delGTTTGT Pathog

[3923] 1 3 he2232del2 Deletion / Inser (1 8 enic

[3924] 5 1 tion ) E 2

[3925] 9 Truncating: 1 X 2 Phe2232fs8 Pathog 8 6696_6699delTGTC Deletion / Inser

[3926] 1 3 X enic (1 9 tion

[3927]

[3928] 5 2 )

[3929] 100

[3930] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3931] E 2

[3932] 9

[3933] X 2 Thr2239Th Likely 9 6717G> A Synonymous

[3934] 1 3 r Benign (1 0

[3935] 5 9 ) E 2

[3936] 9 Truncating: 4 X 2 Gln2243fsl Pathog 9 6726_6727delAC Deletion / Inser

[3937] 1 4 8X (4 enic

[3938] 1 tion

[3939] 5 3 ) E 2

[3940] 9 Truncating: 2 X 2 Gln2243fsl Pathog 9 6727_6728delCA Deletion / Inser

[3941] 1 4 7X enic (1 2 tion

[3942] 5 3 ) E 2

[3943] 9 Truncating: 1 X 2 Gln2243fs6 Pathog 9 6727_6730delCAGA Deletion / Inser

[3944] 1 4 X enic (1 3 tion

[3945] 5 3 ) E 2

[3946] 9 3 X 2 Truncating: Pathog 9 6727C>T Gln2243X

[3947] 1 4 (2

[3948] Nonsense enic

[3949] 4

[3950] 5 3 ) E 2

[3951] 9 Truncating: 3 X 2 Ser2244fsl Pathog 9 6730_673 IdelAG Deletion / Inser

[3952] 1 4 6X enic (2 5 tion

[3953] 5 4 ) E 2

[3954] 9 Truncating: 1 X 2 Ile2245fs5 Pathog 9 6734delT Deletion / Inser

[3955] 1 4 X enic (1 6 tion

[3956] 5 5 ) E 2

[3957] 9 1 X 2 Truncating: Pathog 9 6736C>T Gln2246X

[3958] 1 4 Nonsense enic (1 7

[3959] 5 6 ) E 2

[3960] 9 Truncating: 1 X 2 Asn2248fs Pathog 9 6744_6745insA Deletion / Inser

[3961] 1 4 12X enic (1 8 tion

[3962] 5 8 ) E 2

[3963] 9

[3964] X 2 Thr2250Me Nontruncating Likely 9 6749C>T

[3965] 1 5 t: Missense Benign (4 9

[3966] 5 0 ) 1 E 2

[3967] 1 0 X 2 Arg2255Cy Nontruncating

[3968] 6763C>T VUS

[3969] 0 1 5 s: Missense (1

[3970]

[3971] 0 5 5 )

[3972] 101

[3973] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[3974] 1 2

[3975] 0 2 Likely EX15 6771G> A Val2257Val Synonymous

[3976] 0 5 Benign (3 1 7 ) 1 2

[3977] 1 0 2

[3978] EX15 6777C>A Ile2259Ile Synonymous VUS

[3979] 0 5 (1 2 9 ) 1 2 Nontruncating

[3980] Likely 3 0 2

[3981] EX15 6778_6780delATT Ile2260del Pathog 0 6 Deletion / Inser (2 enic

[3982] 3 0 tion ) 1 2

[3983] Truncating: 1 0 2 Glu2261fs52 Pathog EX15 6781delG Deletion / Inser

[3984] 0 6 X enic (1 tion

[3985] 4 1 ) 1 2

[3986] 1 0 2 Truncating: Pathog EX15 6791C>G Ser2264X

[3987] 0 6 Nonsense enic (1 5 4 ) 1 2

[3988] 0 2 Likely EX15 6792A> C Ser2264Ser Synonymous

[3989] 0 6 Benign (1 6 4 ) 1 2

[3990] Truncating: 1 0 2 Tyr2265fs49 Pathog EX15 6794_6795insTA Deletion / Inser

[3991] 0 6 X enic (1 tion

[3992] 7 5 ) 1 2

[3993] 1 0 2 Truncating: Pathog EX15 6795C>A Tyr2265X

[3994] 0 6 Nonsense enic (1 8 5 ) 1 2

[3995] Likely 1 0 2 Nontruncating

[3996] EX15 6797G> C Arg2266Pro Pathog 0 6: Missense (1 enic

[3997] 9 6 ) 1 2

[3998] 0 2 Nontruncating Likely EX15 6799G> A Val2267Met

[3999] 1 6: Missense Benign (2 0 7 ) 1 2

[4000] Truncating: 1 0 2 Ser2269fs47 Pathog EX15 6803_6804insGTGTG Deletion / Inser

[4001] 1 6 X enic (1 tion

[4002]

[4003] 1 9 )

[4004] 102

[4005] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4006] 1 2

[4007] 2 0 2 Truncating: Pathog EX15 6806C>G Ser2269X

[4008] 1 6 Nonsense enic (2 2 9 ) 1 2

[4009] Truncating: 1 0 2 Asp2270fs43 Pathog EX15 6806_6809delCAGA Deletion / Inser

[4010] 1 7 X enic (1 tion

[4011] 3 0 ) 1 2

[4012] Truncating: 1 0 2 Thr2271fsl4 Pathog EX15 6813_6814delAC Deletion / Inser

[4013] 1 7 7X enic (1 tion

[4014] 4 1 ) 1 2

[4015] 0 2 Nontruncating Likely EX15 6815G> A Arg2272Gln

[4016] 1 7: Missense Benign (1 5 2 ) 1 2

[4017] Likely 1 0 2 Nontruncating

[4018] EX15 6832G> A Gly2278Arg Pathog 1 7: Missense (1 enic

[4019] 6 8 ) 1 2

[4020] Likely 1 0 2 Nontruncating

[4021] EX15 6841T> C Ser2281Pro Pathog 1 8: Missense (1 enic

[4022] 7 1 ) 1 2

[4023] 0 2 Likely EX15 6843C>G Ser2281Ser Synonymous

[4024] 1 8 Benign (1 8 1 ) 1 2

[4025] Likely 1 0 2 Nontruncating

[4026] EX15 6845A> G Tyr2282Cys Pathog 1 8: Missense (1 enic

[4027] 9 2 ) 1 2

[4028] 0 2 Likely EX15 6864C> T Asp2288Asp Synonymous

[4029] 2 8 Benign (1 0 8 ) 1 2

[4030] 1 0 2 Truncating: Pathog EX15 6871C> T Gln2291X

[4031] 2 9 Nonsense enic (1 1 1 ) 1 2

[4032] 0 2 Nontruncating Likely EX15 6878C>T Pro2293Leu

[4033] 2 9: Missense Benign (1

[4034]

[4035] 2 3 )

[4036] 103

[4037] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4038] 1 2

[4039] Truncating: 1 0 2 Lys2294fsl8 Pathog EX15 6882_6883delCA Deletion / Inser

[4040] 2 9 X enic (1 tion

[4041] 3 4 ) 1 2

[4042] 1 0 2 Nontruncating

[4043] EX15 6889C>T His2297Tyr VUS

[4044] 2 9: Missense (1 4 7 ) 1 2

[4045] Likely 1 0 2 Nontruncating

[4046] EX15 6890A> C His2297Pro Pathog 2 9: Missense (1 enic

[4047] 5 7 ) 1 2

[4048] Likely 2 0 2 Nontruncating

[4049] EX15 6892T> G Trp2298Gly Pathog 2 9: Missense (2 enic

[4050] 6 8 ) 1 2

[4051] 1 0 2 Truncating: Pathog EX15 6893G> A Trp2298X

[4052] 2 9 Nonsense enic (1 7 8 ) 1 2

[4053] 0 3 Nontruncating Likely EX15 6905C> G Ala2302Gly

[4054] 2 0: Missense Benign (1 8 2 ) 1 2

[4055] 0 3 Likely EX15 6909G> A Ser2303Ser Synonymous

[4056] 2 0 Benign (1 9 3 ) 1 2

[4057] Truncating: 1 0 3 Gln2305fsll Pathog EX15 6913_6914delCA Deletion / Inser

[4058] 3 0 3X enic (1 tion

[4059] 0 5 ) 1 2

[4060] 1 0 IVS1 3 Gln2305fs Pathog 6915+1G> A Splice

[4061] 3 5 0 Truncating: enic (1 1 5 ) 1 2

[4062] 3 0 IVS1 3 Gln2305fs Pathog 6915+2T> G Splice

[4063] 3 5 0 Truncating: enic (3 2 5 ) 1 2

[4064] Gln2305fs 1 0 IVS1 3

[4065] 6915+4A> G Nontruncatin Splice VUS

[4066] 3 5 0 (1

[4067]

[4068] 3 5 g: )

[4069] 104

[4070] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4071] 1 2

[4072] 0 IVS1 3 Likely Silent Likely 6915+14A> G Silent

[4073] 3 5 0 IVS Benign (2 4 5 ) 1 2

[4074] 0 IVS1 3 Likely Silent Likely 6915+20G> A Silent

[4075] 3 5 0 IVS Benign (1 5 5 ) 1 2

[4076] 0 IVS1 3 Likely Silent Likely 6915+22C>T Silent

[4077] 3 5 0 IVS Benign (1 6 5 ) 1 2

[4078] 0 IVS1 3 Likely Silent Likely 6915+27A> C Silent

[4079] 3 5 0 IVS Benign (1 7 5 ) 1 2

[4080] 0 IVS1 3 Likely Silent Likely 6916-25G> T Silent

[4081] 3 5 0 IVS Benign (2 8 6 ) 1 2 Arg2306fsl l

[4082] Likely 1 0 IVS1 3 5X

[4083] 6916-10C>A Splice Pathog 3 5 0 Nontruncatin (1 enic

[4084] 9 6 ) g:

[4085] 1 2 Arg2306fsl0

[4086] Likely 2 0 IVS1 3 X

[4087] 6916-9G>A Splice Pathog 4 5 0 Nontruncatin (2 enic

[4088] 0 6 ) s

[4089] 1 2

[4090] 1 0 3 Truncating: Pathog EX16 6919G> T Glu2307X

[4091] 4 0 Nonsense enic (1 1 7 ) 1 2

[4092] 0 3 Likely EX16 6927C>T Gly2309Gly Synonymous

[4093] 4 0 Benign (1 2 9 0) 1 2

[4094] 0 3 Nontruncating Likely EX16 6928G> A Gly2310 Arg

[4095] 4 1: Missense Benign (1 3 0 ) 1 2

[4096] 0 3 Nontruncating Likely EX16 6934G> A Ala2312Thr

[4097] 4 1: Missense Benign (1

[4098]

[4099] 4 2 )

[4100] 105

[4101] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4102] 1 2

[4103] 0 3 Nontruncating Likely EX16 6935C>T Ala2312Val

[4104] 4 1: Missense Benign (1 5 2 ) 1 2

[4105] 0 3 Likely EX16 6936G> A Ala2312Ala Synonymous

[4106] 4 1 Benign (1 6 2 ) 1 2

[4107] 1 0 3 Nontruncating

[4108] EX16 6952C>T Arg2318Cys VUS

[4109] 4 1: Missense (1 7 8 ) 1 2

[4110] Truncating: 1 0 3 Arg2318fs22 Pathog EX16 6952delC Deletion / Inser

[4111] 4 1 X enic (1 tion

[4112] 8 8 ) 1 2

[4113] 0 3 Nontruncating Likely EX16 6953G> A Arg2318His

[4114] 4 1: Missense Benign (1 9 8 ) 1 2

[4115] 6968 6981delTCACC Truncating: 2 0 3 Val2323fs91 Pathog EX16 ATTCCACGG (SEQ Deletion / Inser

[4116] 5 2 X enic (1

[4117] ID NO: 36) tion

[4118] 0 3 ) 1 2

[4119] 0 3 Nontruncating Likely EX16 6979C>T Arg2327Trp

[4120] 5 2: Missense Benign (2 1 7 ) 1 2

[4121] 2 0 3 Nontruncating

[4122] EX16 6985C>T Arg2329Trp VUS

[4123] 5 2: Missense (2 2 9 ) 1 2

[4124] 0 3 Nontruncating Likely EX16 6986G> A Arg2329Gln

[4125] 5 2: Missense Benign (1 3 9 ) 1 2

[4126] Truncating: 1 0 3 Leu2330fsl l Pathog EX16 6988delC Deletion / Inser

[4127] 5 3 X enic (1 tion

[4128] 4 0 ) 1 2

[4129] Truncating: 6 0 3 6994 7000delGCTGG Pathog EX16 Ala2332fs6X Deletion / Inser

[4130] 5 3 CG enic (4 tion

[4131]

[4132] 5 2 )

[4133] 106

[4134] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4135] 1 2

[4136] Truncating: 1 0 3 6996_7002delTGGCG Pathog EX16 Gly2333fs5X Deletion / Inser

[4137] 5 3 TG enic (1 tion

[4138] 6 3 ) 1 2

[4139] Truncating: 2 0 3 7000_7001insGCTGG Pathog EX16 Val2334fs Deletion / Inser

[4140] 5 3 CG enic (1 tion

[4141] 7 4 ) 1 2

[4142] 3 0 3 Truncating: Pathog EX16 7003G> T Glu2335X

[4143] 5 3 Nonsense enic (1 8 5 ) 1 2

[4144] Likely 1 0 3 Nontruncating

[4145] EX16 7006T> G Tyr2336Asp Pathog 5 3: Missense (1 enic

[4146] 9 6 ) 1 2

[4147] 3 0 3 Truncating: Pathog EX16 7008C>A Tyr2336X

[4148] 6 3 Nonsense enic (3 0 6 ) 1 2

[4149] 0 3 Likely EX16 7008C> T Tyr2336Tyr Synonymous

[4150] 6 3 Benign (1 1 6 ) 1 2 Nontruncating

[4151] Likely 1 0 3 7010_7015delCCTTC Thr2337 Phe

[4152] EX16 Pathog 6 3 A 2338delThr P Deletion / Inser (1 enic

[4153] 2 7 tion ) 1 2

[4154] 1 0 3 Nontruncating

[4155] EX16 7010C>T Thr2337Ile

[4156] 6 3: Missense vus (1 3 7 ) 1 2

[4157] 1 0 3 Truncating: Pathog EX16 7029G> A Trp2343X

[4158] 6 4 Nonsense enic (1 4 3 ) 1 2

[4159] 2 0 3 Truncating: Pathog EX16 7045G> T Glu2349X

[4160] 6 4 Nonsense enic (2 5 9 ) 1 2

[4161] 2 0 3 Truncating: Pathog EX16 7060C>T Gln2354X

[4162] 6 5 Nonsense enic (2

[4163]

[4164] 6 4 )

[4165] 107

[4166] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1 2

[4167] Likely 1 0 3 Nontruncating

[4168] EX16 7061A>G Gln2354Arg Pathog 6 5: Missense (1 enic

[4169] 7 4 ) 1 2

[4170] 1 0 IVS1 3 Thr2355fs Pathog 7065+1G>C Splice

[4171] 6 6 5 Truncating: enic (1 8 5 ) 1 2

[4172] 1 0 IVS1 3 Thr2355fs Pathog 7065+1G>T Splice

[4173] 6 6 5 Truncating: enic (1 9 5 ) 1 IVS1 2 Truncating:

[4174] 1 0 6- 3 Large Pathog 7066_7864del* Thr2355fs*

[4175] 7 IVS2 5 Rearrangemen enic (1 0 1 5 t ) 1 2

[4176] Thr2355fs Likely 1 0 IVS1 3

[4177] 7065+5G>C Nontruncatin Splice Pathog 7 6 5 (1 g: enic

[4178] 1 5 ) 1 2

[4179] 0 IVS1 3 G> A Likely Likely 7065+10 Silent

[4180] 7 6 5 Silent IVS Benign (1 2 5 ) 1 2

[4181] 0 IVS1 3 Likely Silent Likely 7065+21G> A Silent

[4182] 7 6 5 IVS Benign -(3 3 5 ) 1 2

[4183] Thr2355fs Likely 1 0 IVS1 3 7066-16 - Nontruncatin Splice Pathog 7 6 5 8delCCCACTCCC (1 g- enic

[4184] 4 5 ) 1 2

[4185] 1 0 IVS1 3 Unknown

[4186] 7066-9C>A Unknown

[4187] 7 6 5 IVS vus (1 5 5 ) 1 2

[4188] 0 IVS1 3 Likely Silent Likely 7066-5G>A Silent

[4189] 7 6 5 IVS Benign (1 6 5 ) 1 2

[4190] Thr2355fs Likely 1 0 IVS1 3

[4191] 7066-3C>G Nontruncatin Splice Pathog 7 6 5 (1 g: enic

[4192]

[4193] 7 5 )

[4194] 108

[4195] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1 2

[4196] 1 0 IVS1 3 Thr2355fs Pathog 7066-2A> G Splice

[4197] 7 6 5 Truncating: enic (1 8 5 ) 1 2

[4198] 0 3 Likely EX17 7077G> C Arg2359Arg Synonymous

[4199] 7 5 Benign (3 9 9 ) 1 2

[4200] Likely 1 0 3 Nontruncating

[4201] EX17 7088T> A Val2363Glu Pathog 8 6: Missense (1 enic

[4202] 0 3 ) 1 2

[4203] Likely 3 0 3 Nontruncating

[4204] EX17 7108T> A Cys2370Ser Pathog 8 7: Missense (3 enic

[4205] 1 0 ) 1 2

[4206] Likely 1 0 3 Nontruncating

[4207] EX17 7108T> C Cys2370Arg Pathog 8 7: Missense (1 enic

[4208] 2 0 ) 1 2

[4209] 2 0 3 Truncating: Pathog EX17 7110T> A Cys2370X

[4210] 8 7 Nonsense enic (2 3 0 ) 1 2

[4211] Truncating: 1 0 3 Val2371fsl0 Pathog EX17 7111delG Deletion / Inser

[4212] 8 7 X enic (1 tion

[4213] 4 1 ) 1 2

[4214] Truncating: 1 0 3 Val2371fs47 Pathog EX17 7113_7114delGT Deletion / Inser

[4215] 8 7 X enic (1 tion

[4216] 5 1 ) 1 2

[4217] Truncating: 1 0 3 Ser2372fs47 Pathog EX17 7114_7115insT Deletion / Inser

[4218] 8 7 X enic (1 tion

[4219] 6 2 ) 1 2

[4220] Likely 1 0 3 Nontruncating

[4221] EX17 7114T> C Ser2372Pro Pathog 8 7: Missense (1 enic

[4222] 7 2 ) 1 2

[4223] Likely 1 0 3 Nontruncating

[4224] EX17 7115C>G Ser2372Cys Pathog 8 7: Missense (1 enic

[4225] 8 2 )

[4226]

[4227] 109

[4228] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4229] 1 2

[4230] Likely 1 0 3 Nontruncating

[4231] EX17 7115C>T Ser2372Phe Pathog 8 7: Missense (1 enic

[4232] 9 2 ) 1 2

[4233] 0 3 Likely EX17 7116C>G Ser2372Ser Synonymous

[4234] 9 7 Benign (1 0 2 ) 1 2

[4235] Likely 2 0 3 Nontruncating

[4236] EX17 7118G> A Cys2373Tyr Pathog 9 7: Missense (2 enic

[4237] 1 3 ) 1 2

[4238] 1 0 3 Truncating: Pathog EX17 7119C>A Cys2373X

[4239] 9 7 Nonsense enic (1 2 3 ) 1 2

[4240] 0 3 Nontruncating Likely EX17 7124C>T Ala2375Val

[4241] 9 7: Missense Benign (1 3 5 ) 1 2

[4242] 1 0 3 Truncating: Pathog EX17 7126C>T Gln2376X

[4243] 9 7 Nonsense enic (1 4 6 ) 1 2

[4244] 0 3 Likely EX17 7134G> T Val2378Val Synonymous

[4245] 9 7 Benign (2 5 8 ) 1 2

[4246] Likely 5 0 3 Nontruncating

[4247] EX17 7136A> G Tyr2379Cys Pathog 9 7: Missense (2 enic

[4248] 6 9 ) 1 2

[4249] 1 0 3 Truncating: Pathog EX17 7137C>G Tyr2379X

[4250] 9 7 Nonsense enic (1 7 9 ) 1 2

[4251] 2 0 3 Truncating: Pathog EX17 7138G> T Glu2380X

[4252] 9 8 Nonsense enic (1 8 0 ) 1 2

[4253] 0 3 Nontruncating Likely EX17 7147C>T Arg2383Cys

[4254] 9 8: Missense Benign (1

[4255]

[4256] 9 3 )

[4257] 110

[4258] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4259] 2

[4260] 1 3 Nontruncating

[4261] EX17 7148G> A Arg2383His

[4262] 0 8: Missense vus (1 0

[4263]

[4264] 3

[4265] 1 2

[4266] Truncating: 1 1 EXI 3 Pathog 7156_7157insT Tyr2386fs33X Deletion / Inse 0 7 8 enic (1 rtion

[4267] 1 6 ) 1 2

[4268] 1 1 EXI 3 Truncating: Pathog 7158C>G Tyr2386X

[4269] 0 7 8 Nonsense enic (1 2 6 ) 1 2

[4270] 1 EXI 3 Likely 7165T> C Leu2389Leu Synonymous 0 7 8 Benign (1 3 9 4) 1 2 Nontruncatin

[4271] Likely 2 1 EXI 3

[4272] 7169_7171delAGG Glu2390del g: Pathog 0 7 9 Deletion / Inse (1 enic

[4273] 4 0 rtion ) 1 2

[4274] Likely 2 1 EXI 3 Nontruncatin

[4275] 7172G> A Gly2391Asp Pathog 0 7 9 (2 g: Missense

[4276] enic

[4277] 5 1 ) 1 2

[4278] 1 1 EXI 3 Nontruncatin

[4279] 7175G> C Arg2392Pro VUS

[4280] 0 7 9 g: Missense (1 6 2 ) 1 2

[4281] 7186 7187insTTGCC Truncating: 1 1 EXI 3 Cys2396fs227 Pathog TCAATT (SEQ ID Deletion / Inse 0 7 9 X enic (1

[4282] NO:37) rtion

[4283] 7 6 ) 1 2

[4284] 1 EXI 3 Nontruncatin Likely 7190G> A Ser2397Asn

[4285] 0 7 9 g: Missense Benign (1 8 7 ) 1 2

[4286] Truncating: 1 1 EXI 4 Lys2401fs218 Pathog 7202delA Deletion / Inse 0 7 0 X enic (1 rtion

[4287] 9 1 ) 1 2

[4288] 4 1 EXI 4 Truncating: Pathog 7204C>T Arg2402X

[4289] 1 7 0 Nonsense enic (3

[4290]

[4291] 0 2 )

[4292] 111

[4293] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4294] 1 IVS1 2 Truncating:

[4295] 1 1 7- 4 7328_7329ins7209+l_ (246bp) Large Pathog 1 EX1 4 7328 Gly2443fs Rearrangeme enic (1 1 8 3 nt ) 1 2

[4296] Val2356_Gly2 Likely 2 1 IVS1 4

[4297] 7209+4_+7delAGTG 403del Splice Pathog 1 7 0 (3

[4298] Nontruncating: enic

[4299] 2 3 ) 1 2

[4300] 1 IVS1 4 Likely Silent Likely 7209+16G> A Silent

[4301] 1 7 0 IVS Benign (1 3 3 ) 1 2

[4302] 1 IVS1 4 Likely Silent Likely 7210-27C>A Silent

[4303] 1 7 0 IVS Benign (1 4 3 ) 1 2

[4304] 2 1 IVS1 4

[4305] 7210-10C> A Unknown IVS Unknown VUS

[4306] 1 7 0 (2 5 3 ) 1 2

[4307] 1 1 IVS1 4 Arg2403fs Pathog 7210-2A> G Splice

[4308] 1 7 0 Truncating: enic (1 6 3 ) 1 2

[4309] 1 EXI 4 Nontruncatin Likely 7210C>T Arg2404Trp

[4310] 1 8 0 g: Missense Benign (2 7 4 ) 1 EXI 2 Truncating:

[4311] 1 1 8- 4 Large Pathog 7210_8015del* Arg2404fs*

[4312] 1 EX2 0 Rearrangeme enic (1 8 1 4 nt ) 1 2

[4313] Likely 1 1 EXI 4 Nontruncatin

[4314] 7213T> C Trp2405Arg Pathog 1 8 0 g: Missense (1 enic

[4315] 9 5 ) 1 2

[4316] 1 1 EXI 4 Truncating: Pathog 7215G> A Trp2405X

[4317] 2 8 0 Nonsense enic (1 0 5 ) 1 2

[4318] 1 1 EXI 4 Nontruncatin

[4319] 7222C>T Arg2408Cys VUS

[4320] 2 8 0 g: Missense (1

[4321]

[4322] 1 8 )

[4323] 112

[4324] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4325] 1 2

[4326] 1 EXI 4 Nontruncatin Likely 7241C>T Thr2414Met

[4327] 2 8 1 g: Missense Benign (1 2 4 ) 1 2

[4328] Likely 1 1 EXI 4 Nontruncatin

[4329] 7244T> C Leu2415Pro Pathog 2 8 1 g: Missense (1 enic

[4330] 3 5 ) 1 2

[4331] Truncating: 1 1 EXI 4 Leu2417fs203 Pathog 7250delT Deletion / Inse 2 8 1 X enic (1 rtion

[4332] 4 7 ) 1 2

[4333] Likely 1 1 EXI 4 Nontruncatin

[4334] 7250T> A Leu2417Gln Pathog 2 8 1 g: Missense (1 enic

[4335] 5 7 ) 1 2 Nontruncatin

[4336] Likely 1 1 EXI 4

[4337] 7261_7263delACC Thr2421del s Pathog 2 8 2 Deletion / Inse (1 enic

[4338] 6 1 rtion ) 1 2

[4339] Likely 4 1 EXI 4 Nontruncatin

[4340] 7265C>A Thr2422Lys Pathog 2 8 2 g: Missense (4 enic

[4341] 7 2 ) 1 2

[4342] Likely 4 1 EXI 4 Nontruncatin

[4343] 7268C>T Ser2423Phe Pathog 2 8 2 g: Missense (4 enic

[4344] 8 3 ) 1 2

[4345] 1 1 EXI 4 Nontruncatin

[4346] 7271C>T Thr2424Met VUS

[4347] 2 8 2 g: Missense (1 9 4 ) 1 2

[4348] 7 1 EXI 4

[4349] 7275C>T Gly2425Gly Synonymous VUS

[4350] 3 8 2 (2 0 5 ) 1 2

[4351] 1 EXI 4 Likely 7278T> C Ser2426Ser Synonymous 3 8 2 Benign (2 1 6 ) 1 2

[4352] 1 EXI 4 Nontruncatin Likely 7280C>T Ala2427Val

[4353] 3 8 2 g: Missense Benign (1

[4354]

[4355] 2 7 )

[4356] 113

[4357] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4358] 1 2

[4359] 14 1 EXI 4 Truncating: Pathog 7288C>T Arg2430X

[4360] 3 8 3 Nonsense enic (8 3 0 ) 1 2 Nontruncatin

[4361] 7297 7308delCTGCG 1 1 EXI 4 Leu2433_Gly2 g- Pathog GCGGGGC (SEQ ID

[4362] 3 8 3 436del4 Deletion / Inse enic (1

[4363] NO:38)

[4364] 4 3 rtion ) 1 2 Nontruncatin

[4365] Likely 1 1 EXI 4

[4366] 7298_7300delTGC Leu2433del g: Pathog 3 8 3 Deletion / Inse (1 enic

[4367] 5 3 rtion ) 1 2

[4368] Likely 5 1 EXI 4 Nontruncatin

[4369] 7300C>T Arg2434Trp Pathog 3 8 3 g: Missense (4 enic

[4370] 6 4 ) 1 2

[4371] Likely 1 1 EXI 4 Nontruncatin

[4372] 7301G> A Arg2434Gln Pathog 3 8 3 g: Missense (1 enic

[4373] 7 4 ) 1 2 Nontruncatin

[4374] 7303 7317delCGGGG 2 1 EXI 4 Arg2435_Arg2

[4375] CGTG T C G S Q g: Pathog C G G ( E

[4376] 3 8 3 439del5 Deletion / Inse enic (2

[4377] ID NO:39)

[4378] 8 5 rtion ) 1 2

[4379] Truncating: 1 1 EXI 4 Pathog 7308_7309insC Gly2436fs64X Deletion / Inse 3 8 3 enic (1 rtion

[4380] 9 6 ) 1 2 Nontruncatin

[4381] 2 1 EXI 4 Asp2440_Gly2

[4382] 7321_7322ins12

[4383] 4 8 4 441ins4 Deletion / Inse enic (1 0 0 rtion ) 1 2 Nontruncatin

[4384] Likely 1 1 EXI 4 Gly2441 Glu2

[4385] 7324_7325insGCG g: Pathog 4 8 4 442insGly Deletion / Inse (1 enic

[4386] 1 1 rtion ) 1 2

[4387] 1 EXI 4 Nontruncatin Likely 7324G> C Glu2442Gln

[4388] 4 8 4 g: Missense Benign (1 2 2 ) 1 2

[4389] 1 1 EXI 4 Truncating: Pathog 7330_7331insGAT Tyr2444X

[4390] 4 8 4 Nonsense enic (1

[4391]

[4392] 3 4 )

[4393] 114

[4394] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4395] 1 2

[4396] Likely 2 1 EXI 4 Nontruncatin

[4397] 7343T> C Leu2448Pro Pathog 4 8 4 g: Missense (2 enic

[4398] 4 8 ) 1 2

[4399] 1 EXI 4 Likely 7344C>G Leu2448Leu Synonymous 4 8 4 Benign (1 5 8 ) 1 2

[4400] 1 1 EXI 4 Truncating: Pathog 7372G> T Glu2458X

[4401] 4 8 5 Nonsense enic (1 6 8 ) 1 2

[4402] Likely 1 1 EXI 4 Nontruncatin

[4403] 7375G> T Gly2459Cys Pathog 4 8 5 g: Missense (1 enic

[4404] 7 9 ) 1 2

[4405] Likely 1 1 EXI 4 Nontruncatin

[4406] 7376G> A Gly2459Asp Pathog 4 8 5 g: Missense (1 enic

[4407] 8 9 ) 1 2

[4408] Likely 1 1 EXI 4 Nontruncatin

[4409] 7382C>A Ala2461Asp Pathog 4 8 6 g: Missense (1 enic

[4410] 9 1 ) 1 2

[4411] 7385_7394delCCATC Truncating: 1 1 EXI 4 Ser2462fsl54 Pathog CGCCT (SEQ ID Deletion / Inse 5 8 6 X enic (1

[4412] NO:40) rtion

[4413] 0 2 ) 1 2

[4414] 1 1 EXI 4 Nontruncatin

[4415] 7388T> C Ile2463Thr VUS

[4416] 5 8 6 g: Missense (1 1 3 ) 1 2

[4417] 1 EXI 4 Nontruncatin Likely 7391G> A Arg2464His

[4418] 5 8 6 g: Missense Benign (1 2 4 ) 1 2

[4419] 1 1 EXI 4 Nontruncatin

[4420] 7391G> C Arg2464Pro VUS

[4421] 5 8 6 g: Missense (1 3 4 ) 1 2

[4422] Likely 1 1 EXI 4 Nontruncatin

[4423] 7400C>T Pro2467Leu Pathog 5 8 6 g: Missense (1 enic

[4424]

[4425] 4 7 )

[4426] 115

[4427] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4428] 1 2

[4429] Truncating: 1 1 EXI 4 Pro2470fsl49 Pathog 7409delC Deletion / Inse 5 8 7 X enic (1 rtion

[4430] 5 0 ) 1 2

[4431] Likely 1 1 EXI 4 Nontruncatin

[4432] 7412C>T Pro2471Leu Pathog 5 8 7 g: Missense (1 enic

[4433] 6 1 ) 1 2

[4434] Truncating: 1 1 EXI 4 Pathog 7415_7416insT Leu2472fs28X Deletion / Inse 5 8 7 enic (1 rtion

[4435] 7 2 ) 1 2

[4436] Truncating: 1 1 EXI 4 Gly2474fsl46 Pathog 7421delG Deletion / Inse 5 8 7 X enic (1 rtion

[4437] 8 4 ) 1 2

[4438] 2 1 EXI 4 Nontruncatin

[4439] 7424C>T Ser2475Phe VUS

[4440] 5 8 7 g: Missense (1 9 5 ) 1 2

[4441] Truncating: 1 1 EXI 4 Cys2476fsl42 Pathog 7426_7429delTGCC Deletion / Inse 6 8 7 X enic (1 rtion

[4442] 0 6 ) 1 2

[4443] Likely 1 1 EXI 4 Nontruncatin

[4444] 7426T> A Cys2476Ser Pathog 6 8 7 g: Missense (1 enic

[4445] 1 6 ) 1 2

[4446] Truncating: 1 1 EXI 4 Arg2477fsl45 Pathog 7429_7430insACAGT Deletion / Inse 6 8 7 X enic (1 rtion

[4447] 2 7 ) 1 2

[4448] 1 EXI 4 Nontruncatin Likely 7429C>T Arg2477Cys

[4449] 6 8 7 g: Missense Benign (2 3 7 ) 1 2

[4450] 1 EXI 4 Nontruncatin Likely 7430G> A Arg2477His

[4451] 6 8 7 g: Missense Benign (2 4 7 ) 1 2

[4452] 1 EXI 4 Likely 7441C>T Leu2481Leu Synonymous 6 8 8 Benign (1

[4453]

[4454] 5 1 2)

[4455] 116

[4456] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4457] 1 2

[4458] 1 EXI 4 Likely 7446C>T Gly2482Gly Synonymous 6 8 8 Benign (1 6 2 ) 1 2

[4459] 1 EXI 4 Nontruncatin Likely 7448C>T Ala2483Val

[4460] 6 8 8 g: Missense Benign (1 7 3 ) 1 2

[4461] Truncating: 1 1 EXI 4 His2485fsl33 Pathog 7455delC Deletion / Inse 6 8 8 X enic (1 rtion

[4462] 8 5 ) 1 2

[4463] 1 EXI 4 Nontruncatin Likely 7463C>T Thr2488Ile

[4464] 6 8 8 g: Missense Benign (1 9 8 ) 1 2

[4465] Likely 1 1 EXI 4 Nontruncatin

[4466] 7483T> C Cys2495Arg Pathog 7 8 9 g: Missense (1 enic

[4467] 0 5 ) 1 2

[4468] 1 EXI 4 Likely 7485C>T Cys2495Cys Synonymous 7 8 9 Benign (1 1 5 ) 1 2

[4469] 1 1 EXI 4 Nontruncatin

[4470] 7487C>T Thr2496Met VUS

[4471] 7 8 9 g: Missense (1 2 6 ) 1 2

[4472] 1 1 IVS1 4 Likely Silent

[4473] 7490-10C>A Unknown VUS

[4474] 7 8 9 IVS (1 3 7 ) 1 2

[4475] 1 IVS1 4 Likely Silent Likely 7490-10C>T Silent

[4476] 7 8 9 IVS Benign (1 4 7 ) 1 2

[4477] 3 1 IVS1 4 Gly2497fs

[4478] 7490-5C>G Splice VUS

[4479] 7 8 9 Nontruncating: (2 5 7 ) 1 2

[4480] Likely 1 1 IVS1 4 Gly2497fs

[4481] 7490-3C>G Splice Pathog 7 8 9 Nontruncating: (1 enic

[4482]

[4483] 6 7 )

[4484] 117

[4485] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1 2

[4486] 3 1 IVS1 4 Gly2497fs Pathog 7490-2A> G Splice

[4487] 7 8 9 Truncating: enic (2 7 7 ) 1 2

[4488] 1 EXI 4 Likely 7491C>T Gly2497Gly Synonymous 7 9 9 Benign (1 8 7 ) 1 2

[4489] 1 1 EXI 4 Truncating: Pathog 7493G>A Trp2498X

[4490] 7 9 9 Nonsense enic (1 9 8 ) 1 2

[4491] 1 1 EXI 4 Truncating: Pathog 7494G> A Trp2498X

[4492] 8 9 9 Nonsense enic (1 0 8 ) 1 2

[4493] Truncating: 1 1 EXI 5 Pathog 7498_7499insG Asp2500fs94X Deletion / Inse 8 9 0 enic (1 rtion

[4494] 1 0 ) 1 2

[4495] 1 EXI 5 Likely 7500C>T Asp2500Asp Synonymous 8 9 0 Benign (1 2 0 ) 1 2

[4496] 1 EXI 5 Likely 7503G> A Ala2501Ala Synonymous 8 9 0 Benign (1 3 1 ) 1 2

[4497] 1 EXI 5 Likely 7515C>T Gly2505Gly Synonymous 8 9 0 Benign (1 4 5 ) 1 2

[4498] 1 EXI 5 Nontruncatin Likely 7516G> A Ala2506Thr

[4499] 8 9 0 g: Missense Benign (1 5 6 ) 1 2

[4500] 1 EXI 5 Nontruncatin Likely 7531G> C Ala2511Pro

[4501] 8 9 1 g: Missense Benign (1 6 1 ) 1 2

[4502] Likely 1 1 EXI 5 Nontruncatin

[4503] 7535T> G Leu2512Arg Pathog 8 9 1 g: Missense (1 enic

[4504] 7 )

[4505]

[4506] 2

[4507] 118

[4508] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4509] 1 2 Nontruncatin

[4510] 1 1 EXI 5 Leu2514_Arg2 Pathog 7540_7541insl2 g- 8 9 1 515ins4 Deletion / Inse enic (1 8 4 rtion ) 1 2 Nontruncatin

[4511] Likely 1 1 EXI 5 7543_7548delCGGCG Arg2515_Arg2 g- Pathog 8 9 1 C 516del2 Deletion / Inse (1 enic

[4512] 9 5 rtion ) 1 2

[4513] Likely 10 1 EXI 5 Nontruncatin

[4514] 7546C>T Arg2516Cys Pathog 9 9 1 g: Missense (6 enic

[4515] 0 6 ) 1 2

[4516] 1 1 EXI 5 Nontruncatin

[4517] 7547G> A Arg2516His VUS

[4518] 9 9 1 g: Missense (1 1 6 ) 1 2

[4519] 1 1 EXI 5 Truncating: Pathog 7555C>T Gln2519X

[4520] 9 9 1 Nonsense enic (1 2 9 ) 1 2

[4521] 1 1 EXI 5 Nontruncatin

[4522] 7556A> T Gln2519Leu VUS

[4523] 9 9 1 g: Missense (1 3 9 ) 1 2

[4524] 1 EXI 5 Likely 7566C>T Cys2522Cys Synonymous 9 9 2 Benign (1 4 2 ) 1 2

[4525] 1 1 EXI 5 Truncating: Pathog 7567G> T Glu2523X

[4526] 9 9 2 Nonsense enic (1 5 3 ) 1 2

[4527] 1 1 EXI 5 Truncating: Pathog 7570G>T Glu2524X

[4528] 9 9 2 Nonsense enic (1 6 4 ) 1 2

[4529] 1 EXI 5 Likely 7575C>T Phe2525Phe Synonymous 9 9 2 Benign (1 7 5 ) 1 2

[4530] 1 EXI 5 Likely 7581C>T Val2527Val Synonymous 9 9 2 Benign (1

[4531]

[4532] 8 7 )

[4533] 119

[4534] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4535] 1 2

[4536] 1 1 EXI 5 Truncating: Pathog 7584C>G Tyr2528X

[4537] 9 9 2 Nonsense enic (1 9 8 ) 1 2

[4538] Likely 1 2 EXI 5 Nontruncatin

[4539] 7589G> A Gly2530Asp Pathog 0 9 3 g: Missense (1 enic

[4540]

[4541] 0 0 )

[4542] 1 2

[4543] 2 EXI 5 Likely 7593C>T Ser2531Ser Synonymous 0 9 3 Benign (1 1 1 ) 1 2 Nontruncatin

[4544] 1 2 EXI 5 Tyr2535_Le Pathog 7603_7698del96 g:

[4545] 0 9 3 u2566del32 Deletion / Inse enic (1 2 5 rtion ) 1 2

[4546] 2 EXI 5 Likely 7605C>T Tyr2535Tyr Synonymous 0 9 3 Benign (1 3 5 ) 1 2

[4547] Truncating: 2 2 EXI 5 Arg2544fs5 Pathog 7622_7623insC Deletion / Inse 0 9 4 IX (2 enic rtion

[4548] 4 1 ) 1 2

[4549] 2 EXI 5 Likely 7623G>A Pro2541Pro Synonymous 0 9 4 Benign (1 5 1 ) 1 2

[4550] 2 EXI 5 Nontruncatin Likely 7636C>T His2546Tyr

[4551] 0 9 4 g: Missense Benign (2 6 6 ) 1 2

[4552] 2 EXI 5 Nontruncatin Likely 7637A> G His2546Arg

[4553] 0 9 4 g: Missense Benign (1 7 6 ) 1 2

[4554] 2 EXI 5 Nontruncatin Likely 7642G>C Glu2548Gln

[4555] 0 9 4 g: Missense Benign (6 8 8 ) 1 2

[4556] Truncating: 1 2 EXI 5 Val2553fs6 Pathog 7656delC Deletion / Inse 0 9 5 7X enic (1 rtion

[4557]

[4558] 9 3 )

[4559] 120

[4560] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4561] 1 2

[4562] 7 2 EXI 5 Truncating: Pathog 7666C>T Gln2556X

[4563] 1 9 5 Nonsense enic (4 0 6 ) 1 2

[4564] 7669 7681 delGACCAGC Truncating: 1 2 EXI 5 Asp2557fs5 Pathog TGGGAG (SEQ ID Deletion / Inse 1 9 5 8X enic (1

[4565] NO:41) rtion

[4566] 1 7 ) 1 2

[4567] 1 2 EXI 5 Asp2557Gl Nontruncatin

[4568] 7670A> G VUS 1 9 5 y g: Missense (1 2 7 ) 1 2

[4569] Truncating: 1 2 EXI 5 Gln2558fs3 Pathog 7672_7673insC Deletion / Inse 1 9 5 7X enic (1 rtion

[4570] 3 8 ) 1 2

[4571] 1 2 EXI 5 Truncating: Pathog 7672C>T Gln2558X

[4572] 1 9 5 Nonsense enic (1 4 8 ) 1 2

[4573] 2 EXI 5 Likely 7683C>T Ala2561Ala Synonymous 1 9 6 Benign (2 5 1 ) 1 EXI 2

[4574] 7702_7703+29delAGGTG Truncating: 1 2 9- 5 AArg2567fs Pathog AGCCAGGCCGTGGG Deletion / Inse 1 IVS1 6 25X enic (1

[4575] (SEQ ID NO:42) rtion

[4576] 6 9 7 ) 1 2

[4577] 1 2 IVS1 5 Arg2568fs Pathog 77O3 + 1G> A Splice

[4578] 1 9 6 Truncating: enic (1 7 8 ) 1 2

[4579] 1 2 IVS1 5 Arg2568fs Pathog 77O3 + 1G> T Splice

[4580] 1 9 6 Truncating: enic (1 8 8 ) 1 2

[4581] 2 IVS1 5 Likely Likely 7703 + 12C> T Silent

[4582] 1 9 6 Silent IVS Benign (1 9 8 ) 1 2

[4583] 2 IVS1 5 Likely Likely 7703+23G> A Silent

[4584] 2 9 6 Silent IVS Benign (1

[4585]

[4586] 0 8 )

[4587] 121

[4588] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4589] 1 2

[4590] 2 IVS1 5 Likely Likely 7703+24C>A Silent

[4591] 2 9 6 Silent IVS Benign (3 1 8 ) 1 2

[4592] 2 IVS1 5 Likely Likely 7704-12C>T Silent

[4593] 2 9 6 Silent IVS Benign (1 2 8 ) 1 2

[4594] Truncating: 2 2 EX2 5 Arg2568fs5 Pathog 7704delG Deletion / Inse 2 0 6 IX enic (2 rtion

[4595] 3 8 ) 1 2

[4596] 1 2 EX2 5 Nontruncatin

[4597] 7706C>G Ser2569Cys VUS 2 0 6 g: Missense (1 4 9 ) 1 2

[4598] 2 EX2 5 Leu2570Le Likely 7708T> C Synonymous 2 0 7 u Benign (9 5 0 ) 1 2

[4599] 2 EX2 5 Nontruncatin Likely 7712C>T Ala2571Val

[4600] 2 0 7 g: Missense Benign (1 6 1 ) 1 2

[4601] Truncating: 1 2 EX2 5 7730_7737delCCAACGG Pro2577fsl Pathog Deletion / Inse

[4602] 2 0 7 C 5X enic (1 rtion

[4603] 7 7 ) 1 2 Nontruncatin

[4604] 1 2 EX2 5

[4605] 7734_7736delGGC Gly2579del g: VUS 2 0 7 Deletion / Inse (1 8 9 rtion ) 1 2

[4606] 2 EX2 5 Likely 7740C>T Ser2580Ser Synonymous 2 0 8 Benign (1 9 0 ) 1 2

[4607] 2 EX2 5 Thr2582Me Nontruncatin Likely 7745C>T

[4608] 3 0 8 t g: Missense Benign (2 0 2 ) 1 2

[4609] Truncating: 1 2 EX2 5 Leu2584fs3 Pathog 7750delC Deletion / Inse 3 0 8 6X enic (1 rtion

[4610]

[4611] 1 4 )

[4612] 122

[4613] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4614] 1 2

[4615] Truncating: 1 2 EX2 5 Ala2593fs6 Pathog 7779_7780insC Deletion / Inse 3 0 9 6X enic (1 rtion

[4616] 2 3 ) 1 2

[4617] 2 EX2 5 Nontruncatin Likely 7789C>G Pro2597Ala

[4618] 3 0 9 g: Missense Benign (1 3 7 ) 1 2

[4619] 2 EX2 5 Likely 7791A> G Pro2597Pro Synonymous 3 0 9 Benign (2 4 7 ) 1 2

[4620] Likely 1 2 EX2 5 Leu2599Ar Nontruncatin

[4621] 7796T> G Pathog 3 0 9 ( g g: Missense 1 enic

[4622] 5 9 ) 1 2

[4623] 2 2 EX2 6 Truncating: Pathog 7804C>T Gln2602X

[4624] 3 0 0 Nonsense enic (2 6 2 ) 1 2

[4625] 1 2 EX2 6 Asp2604As Nontruncatin

[4626] 7810G> A VUS 3 0 0 n g: Missense (1 7 4 ) 1 2

[4627] 2 EX2 6 Nontruncatin Likely 7813C>T Pro2605Ser

[4628] 3 0 0 g: Missense Benign (1 8 5 ) 1 2

[4629] 2 2 EX2 6 Truncating: Pathog 7816C>T Gln2606X

[4630] 3 0 0 Nonsense enic (1 9 6 ) 1 2

[4631] Truncating: 1 2 EX2 6 His2607fs5 Pathog 7819_7823delCACGT Deletion / Inse 4 0 0 IX enic (1 rtion

[4632] 0 7 ) 1 2

[4633] Truncating: 1 2 EX2 6 Val2608fs5 Pathog 7821 7825delCGTCA Deletion / Inse 4 0 0 IX enic (1 rtion

[4634] 1 8 ) 1 2 Nontruncatin

[4635] Likely 1 2 EX2 6

[4636] 7825_7827delATC Ile2609del g: Pathog 4 0 0 Deletion / Inse (1 enic

[4637]

[4638] 2 9 rtion )

[4639] 123

[4640] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4641] 1 2

[4642] 1 2 EX2 6 Truncating: Pathog 7833C>G Tyr2611X

[4643] 4 0 1 Nonsense enic (1 3 1 ) 1 2

[4644] Likely 1 2 EX2 6 Nontruncatin

[4645] 7835C>G Ser2612Trp Pathog 4 0 1 g: Missense (1 enic

[4646] 4 2 ) 1 2

[4647] 1 2 EX2 6 Nontruncatin

[4648] 7835C>T Ser2612Leu VUS 4 0 1 g: Missense (1 5 2 ) 1 2 Nontruncatin

[4649] Likely 1 2 EX2 6

[4650] 7836_7838delGTT Leu2613del g: Pathog 4 0 1 Deletion / Inse (1 enic

[4651] 6 3 rtion ) 1 2

[4652] 2 EX2 6 Leu2613Le Likely 7837T> C Synonymous 4 0 1 u Benign (1 7 3 ) 1 2

[4653] 2 EX2 6 Likely 7854G> C Val2618Val Synonymous 4 0 1 Benign (1 8 8 ) 1 2

[4654] Likely 1 2 EX2 6 Nontruncatin

[4655] 7856T> C Leu2619Pro Pathog 4 0 1 g: Missense (1 enic

[4656] 9 9 ) 1 2 Asn2620fs5

[4657] EX2 1 2 6 7859 7863+4delACGAGG 9X Pathog 0_IV Splice

[4658] 5 2 TGA Nontruncati enic (1 S20

[4659] 0 0 ng: ) 1 2

[4660] 1 2 IVS2 6 Tyr2621fs Pathog 7863 + lG> T Splice

[4661] 5 0 2 Truncating: enic (1 1 1 ) 1 2

[4662] 2 IVS2 6 Likely Likely 7863 + 11C> T Silent

[4663] 5 0 2 Silent IVS Benign (1 2 1 ) 1 2

[4664] 2 IVS2 6 Likely Likely 7863 + 16G> C Silent

[4665] 5 0 2 Silent IVS Benign (1

[4666]

[4667] 3 1 )

[4668] 124

[4669] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4670] 1 2

[4671] 2 IVS2 6 Likely Likely 7863+24G> C Silent

[4672] 5 0 2 Silent IVS Benign (1 4 1 ) 1 2

[4673] 2 IVS2 6 Likely Likely 7863+47T> G Silent

[4674] 5 0 2 Silent IVS Benign (3 5 1 ) 1 2

[4675] 2 IVS2 6 Likely Likely 7863+142C>G Silent

[4676] 5 0 2 Silent IVS Benign (1 6 1 ) 1 2

[4677] 2 IVS2 6 Likely Likely 7864-16C>G Silent

[4678] 5 0 2 Silent IVS Benign (1 7 1 ) 1 2

[4679] 2 IVS2 6 Likely Likely 7864-16C>T Silent

[4680] 5 0 2 Silent IVS Benign (1 8 1 ) 1 2

[4681] 2 IVS2 6 Likely Likely 7864-15C>G Silent

[4682] 5 0 2 Silent IVS Benign (1 9 1 ) 1 2

[4683] 1 2 IVS2 6 Tyr2621fs Pathog 7864-2A> G Splice

[4684] 6 0 2 Truncating: enic (1 0 1 ) 1 2

[4685] 1 2 IVS2 6 Tyr2621fs Pathog 7864-lG> T Splice

[4686] 6 0 2 Truncating: enic (1 1 1 ) 1 2

[4687] 1 2 EX2 6 Truncating: Pathog 7866C>A Tyr2622X

[4688] 6 1 2 Nonsense enic (1 2 2 ) 1 2

[4689] 2 EX2 6 Likely 7866C>T Tyr2622Tyr Synonymous 6 1 2 Benign (3 3 2 ) 1 2

[4690] Truncating: 1 2 EX2 6 Arg2624fs2 Pathog 7871_7874delGGGC Deletion / Inse 6 1 2 8X enic (1 rtion

[4691]

[4692] 4 4 )

[4693] 125

[4694] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4695] 1 2

[4696] 2 EX2 6 Val2628Me Nontruncatin Likely 7882G> A

[4697] 6 1 2 t g: Missense Benign (1 5 8 ) 1 2

[4698] 2 EX2 6 Likely 7887G> A Ala2629Ala Synonymous 6 1 2 Benign (1 6 9 ) 1 2

[4699] 2 EX2 6 Nontruncatin Likely 7888G> A Ala2630Thr

[4700] 6 1 3 g: Missense Benign (1 7 0 ) 1 2

[4701] 2 2 EX2 6 Truncating: Pathog 7909C>T Gln2637X

[4702] 6 1 3 Nonsense enic (2 8 7 ) 1 2

[4703] 2 EX2 6 Nontruncatin Likely 7913A> G His2638Arg

[4704] 6 1 3 g: Missense Benign (1 9 8 1) 1 2

[4705] 7915 7916insC AAGCAC Truncating: 1 2 EX2 6 Arg2639fs2 Pathog GAGCGGCAGCACC Deletion / Inse 7 1 3 IX enic (2

[4706] (SEQ ID NO:43) rtion

[4707] 0 9 ) 1 2

[4708] 7 2 EX2 6 Truncating: Pathog 7915C>T Arg2639X

[4709] 7 1 3 Nonsense enic (4 1 9 ) 1 2

[4710] 2 EX2 6 Nontruncatin Likely 7918G> C Ala2640Pro

[4711] 7 1 4 g: Missense Benign (2 2 0 ) 1 2

[4712] 1 2 EX2 6 Truncating: Pathog 7921C>T Gln2641X

[4713] 7 1 4 Nonsense enic (1 3 1 ) 1 2

[4714] Likely 6 2 EX2 6 Arg2643Cy Nontruncatin

[4715] 7927C>T Pathog 7 1 4 s g: Missense (3 enic

[4716] 4 3 ) 1 2

[4717] Truncating: 1 2 EX2 6 Arg2643fsl Pathog 7927delC Deletion / Inse 7 1 4 OX enic (1 rtion

[4718]

[4719] 5 3 )

[4720] 126

[4721] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4722] 1 2

[4723] 2 2 EX2 6 Nontruncatin

[4724] 7937T> C Ile2646Thr

[4725] 7 1 4 g: Missense vus (2 6 6 ) 1 2

[4726] 1 2 EX2 6 Nontruncatin

[4727] 7946C>T Thr2649Ile

[4728] 7 1 4 g: Missense vus (1 7 9 ) 1 2

[4729] Truncating: 2 2 EX2 6 Leu2650fs9 Pathog 7948_7949delCT Deletion / Inse 7 1 5 X enic (2 rtion

[4730] 8 0 ) 1 2

[4731] 2 EX2 6 Arg2654Gl Nontruncatin Likely 7960A> G

[4732] 7 1 5 y g: Missense Benign (1 9 4 ) 1 2

[4733] Truncating: 1 2 EX2 6 7972_7979delGTGGATG Val2658fsl Pathog Deletion / Inse

[4734] 8 1 5 A 60X enic (1 rtion

[4735] 0 8 ) 1 2

[4736] Truncating: 1 2 EX2 6 Asp2659fs2 Pathog 7976_7977insA Deletion / Inse 8 1 5 X enic (1 rtion

[4737] 1 9 ) 1 2

[4738] 2 EX2 6 Asp266OAs Likely 7980C>T Synonymous 8 1 6 (

[4739] P Benign 1 2 0 ) 1 2

[4740] 1 2 EX2 6 Truncating: Pathog 7984C>T Gln2662X

[4741] 8 1 6 Nonsense enic (1 3 2 ) 1 2

[4742] 1 2 EX2 6 Truncating: Pathog 7987C>T Gln2663X

[4743] 8 1 6 Nonsense enic (1 4 3 ) 1 2

[4744] 2 EX2 6 Nontruncatin Likely 7993G> A Ala2665Thr

[4745] 8 1 6 g: Missense Benign (1 5 5 ) 1 2

[4746] 1 2 EX2 6 Truncating: Pathog 8008C>T Gln2670X

[4747] 8 1 7 Nonsense enic (1

[4748]

[4749] 6 0 )

[4750] 127

[4751] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4752] 1 2

[4753] 2 IVS2 6 Likely Likely 8016+13delC Silent

[4754] 8 1 7 Silent IVS Benign (1 7 2 ) 1 2

[4755] 2 IVS2 6 Likely Likely 8016+16C>A Silent

[4756] 8 1 7 Silent IVS Benign (1 8 2 ) 1 2

[4757] 2 IVS2 6 Likely Likely 8016+26T> C Silent

[4758] 8 1 7 Silent IVS Benign (2 9 2 ) 1 2

[4759] 2 IVS2 6 Likely Likely 8016+71G> A Silent

[4760] 9 1 7 Silent IVS Benign (1 0 2 ) 1 2

[4761] 2 IVS2 6 Likely Likely 8016+77C>T Silent

[4762] 9 1 7 Silent IVS Benign (1 1 2 ) 1 2

[4763] 2 IVS2 6 Likely Likely 8017-44G> C Silent

[4764] 9 1 7 Silent IVS Benign (- 2 3 ) 1 2

[4765] 2 IVS2 6 Likely Likely 8017-29C>T Silent

[4766] 9 1 7 Silent IVS Benign (2 3 3 ) 1 2

[4767] Gly2673fs 9 2 IVS2 6 Pathog 8017-2_-ldelAG Nontruncati Splice

[4768] 9 1 7 enic (7 4 3 ng: ) 1 2

[4769] 3 2 IVS2 6 Gly2673fs Pathog 8017-2A> G Splice

[4770] 9 1 7 Truncating: enic (3 5 3 ) 1 2

[4771] 1 2 IVS2 6 Gly2673fs Pathog 8O17-1G> C Splice

[4772] 9 1 7 Truncating: enic (1 6 3 ) 1 2

[4773] 2 EX2 6 Nontruncatin Likely 8020C>T Pro2674Ser

[4774] 9 2 7 g: Missense Benign (6

[4775]

[4776] 7 4 )

[4777] 128

[4778] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4779] 1 2

[4780] 2 EX2 6 Likely 8037A> G Val2679Val Synonymous 9 2 7 Benign (2 8 9 ) 1 2

[4781] 1 2 EX2 6 Truncating: Pathog 8045C> A Ser2682X

[4782] 9 2 8 Nonsense enic (1 9 2 ) 1 2

[4783] 1 3 EX2 6 Nontruncatin

[4784] 8045C>T Ser2682Leu VUS 0 2 8 g: Missense (1

[4785]

[4786] 0 2 ) 1 E 2 Likel 3 X 6 Synonymo

[4787] 8046G> A Ser2682Ser y 0 2 8 us Benig (1 1 2 2 n ) 1 E 2

[4788] 8049_8050insGCCGC Truncating: 1 3 X 6 Patho TCGTGC (SEQ ID Cys2683fs4X Deletion / In 0 2 8 genic (1

[4789] NO:44) sertion

[4790] 2 2 3 ) 1 E 2

[4791] Truncating: 1 3 X 6 Patho 8051_8052ins49 Leu2684fsl53X Deletion / In 0 2 8 genic (1 sertion

[4792] 3 2 4 ) 1 E 2

[4793] 1 3 X 6 Truncating: Patho 8056C>T Gln2686X

[4794] 0 2 8 Nonsense genic (1 4 2 6 ) 1 E 2

[4795] Truncating: 1 3 X 6 Patho 8070delG Lys2691fs4X Deletion / In 0 2 9 genic (1 sertion

[4796] 5 2 1 ) 1 E 2 Likel Nontruncat

[4797] 3 X 6

[4798] 8087T> C Leu2696Pro ing: y 0 2 9 Benig (2

[4799] Missense

[4800] 6 2 6 n ) 1 E 2 Likel Nontruncat

[4801] 3 X 6

[4802] 8087T> G Leu2696Arg ing: y 0 2 9 Benig (5

[4803] Missense

[4804] 7 2 6 n ) 1 E 2 Nontruncat Likel 1 3 X 6 8094_8095insCTCAT Leu2698_Gln2699insL ing: y

[4805] 0 2 9 CCTG eu Deletion / In Patho (1

[4806] )

[4807]

[4808] 8 2 8 sertion genic 129

[4809] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4810] 1 E 2

[4811] 1 3 X 6 Truncating: Patho 8095C> T Gln2699X

[4812] 0 2 9 Nonsense genic (1 9 2 9 ) 1 E 2 Likel 3 X 7 Synonymo

[4813] 8109C>T Thr2703Thr y 1 2 0 us Benig (1 0 2 3 n ) 1 E 2 Likel Nontruncat

[4814] 3 X 7

[4815] 8111C>T Ala2704Val ing: y 1 2 0 Benig (2

[4816] Missense

[4817] 1 2 4 n ) 1 E 2

[4818] 8118 8127delCGTGA Truncating: 1 3 X 7 Patho CGCCC (SEQ ID Thr2706fs46X Deletion / In 1 2 0 genic (1

[4819] NO:45) sertion

[4820] 2 2 6 ) 1 E 2 Likel Nontruncat

[4821] 3 X 7

[4822] 8123C>T Thr2708Met ing: y 1 2 0 Benig (7

[4823] Missense

[4824] 3 2 8 n ) 1 E 2

[4825] Truncating: 1 3 X 7 Patho 8124_8127delGCCC Thr2710fs44X Deletion / In 1 2 0 genic (1 sertion

[4826] 4 2 8 ) 1 E 2

[4827] Nontruncat 1 3 X 7

[4828] 8129C>A Thr2710Asn ing:

[4829] 1 2 1 vus (1

[4830] Missense

[4831] 5 2 0 ) 1 E 2 Likel 3 X 7 Synonymo

[4832] 8136C>T Ile2712Ile y 1 2 1 us Benig (1 6 2 2 n ) 1 E 2

[4833] 1 3 X 7 Truncating: Patho 8137G> T Gly2713X

[4834] 1 2 1 Nonsense genic (1 7 2 3 ) 1 E 2

[4835] Nontruncat 1 3 X 7

[4836] 8138G> A Gly2713Glu VUS 1 2 1 ing: (1

[4837] Missense

[4838] 8 2 3 ) 1 E 2

[4839] 1 3 X 7

[4840] 8160A> G Thr2720Thr IVS Unknown VUS 1 2 2 (1

[4841]

[4842] 9 2 0 )

[4843] 130

[4844] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4845] I

[4846] 1 2 Likel V

[4847] 3 7

[4848] s 8161+8G> A Likely Silent IVS Silent y

[4849] 2 2 Benig (4 2

[4850] 0 1 n ) 2

[4851] I

[4852] 1 2 Likel V

[4853] 3 7

[4854] s 8161+12C>T Likely Silent IVS Silent y

[4855] 2 2 Benig (1 2

[4856] 1 1 n ) 2

[4857] I

[4858] 1 2 Likel V

[4859] 3 7

[4860] s 8161+21T> C Likely Silent IVS Silent y

[4861] 2 2 Benig (3 2

[4862] 2 1 n ) 2

[4863] I

[4864] 1 2 Likel V

[4865] 3 7

[4866] s 8161+23C>T Likely Silent IVS Silent y

[4867] 2 2 Benig (1 2

[4868] 3 1 n ) 2

[4869] I

[4870] 1 2 Likel V

[4871] 3 7

[4872] s 8161+24C>G Likely Silent IVS Silent y

[4873] 2 2 Benig (1 2

[4874] 4 1 n ) 2

[4875] I

[4876] 1 2 Likel V

[4877] 3 7

[4878] s 8161+25A> G Likely Silent IVS Silent y

[4879] 2 2 Benig (1 2

[4880] 5 1 n ) 2

[4881] I

[4882] 1 2 Likel V

[4883] 3 7

[4884] s 8161+29_+46del18 Likely Silent IVS Silent y

[4885] 2 2 Benig (1 2

[4886] 6 1 n ) 2

[4887] I

[4888] 1 2 Likel V

[4889] 3 7

[4890] s 8161+29G> A Likely Silent IVS Silent y

[4891] 2 2 Benig (1 2

[4892] 7 1 n ) 2

[4893] I

[4894] 1 2 Likel V

[4895] 3 7

[4896] s 8161+30C>G Likely Silent IVS Silent y

[4897] 2 2 Benig (1 2

[4898] 8 1 n )

[4899]

[4900] 2

[4901] 131

[4902] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4903] I

[4904] 1 2 Likel V

[4905] 3 7

[4906] s 8161+31C>T Likely Silent IVS Silent y

[4907] 2 2 Benig (1 2

[4908] 9 1 n ) 2

[4909] I

[4910] 1 2 Likel V

[4911] 3 7

[4912] s 8161+38G> A Likely Silent IVS Silent y

[4913] 3 2 Benig (2 2

[4914] 0 1 n ) 2

[4915] I

[4916] 1 2 Likel V

[4917] 3 7

[4918] s 8161+39T> C Likely Silent IVS Silent y

[4919] 3 2 Benig (2 2

[4920] 1 1 n ) 2

[4921] I

[4922] 1 2 Likel V

[4923] 3 7

[4924] s 8161+41C>T Likely Silent IVS Silent y

[4925] 3 2 Benig (1 2

[4926] 2 1 n ) 2

[4927] I

[4928] 1 2 Likel V

[4929] 3 7

[4930] s 8161+42C>G Likely Silent IVS Silent y

[4931] 3 2 Benig (1 2

[4932] 3 1 n ) 2

[4933] I

[4934] 1 2 Likel V

[4935] 3 7

[4936] s 8161+46_+47insl8 Likely Silent IVS Silent y

[4937] 3 2 Benig (1 2

[4938] 4 1 n ) 2

[4939] 1 E 2 Likel 3 X 7 Synonymo

[4940] 8176C>T Leu2726Leu y 3 2 2 us Benig (1 5 3 6 n ) 1 E 2 Likel 3 X 7 Synonymo

[4941] 8187G> A Ser2729Ser y 3 2 2 us Benig (2 6 3 9 n ) 1 E 2

[4942] 8197 8198insGGAGA Truncating: 1 3 X 7 Patho CCTCATCCACCTGG GAla2733fsl00X Deletion / In 3 2 3 genic (1

[4943] CCA (SEQ ID NO:46) sertion

[4944] 7 3 3 ) 1 E 2 Likel Nontruncat

[4945] 3 X 7

[4946] 8200C> A Pro2734Thr ing: y 3 2 3 Benig (2

[4947] Missense

[4948]

[4949] 8 3 4 n )

[4950] 132

[4951] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4952] 1 E 2

[4953] 1 3 X 7 Truncating: Patho 8203C>T Gln2735X

[4954] 3 2 3 Nonsense genic (1 9 3 5 ) 1 E 2 Likel Nontruncat

[4955] 3 X 7

[4956] 8204A> T Gln2735Leu ing: y 4 2 3 Benig (2

[4957] Missense

[4958] 0 3 5 n ) 1 E 2

[4959] Truncating: 1 3 X 7 Patho 8213_8214delAG Glu2738fs82X Deletion / In 4 2 3 genic (1 sertion

[4960] 1 3 8 ) 1 E 2 Likel 3 X 7 Synonymo

[4961] 8217G> C Leu2739Leu y 4 2 3 us Benig (1 2 3 9 n ) 1 E 2 Likel 3 X 7 Synonymo

[4962] 8223C>T Ala2741Ala y 4 2 4 us Benig (1 3 3 1 n ) 1 E 2 Likel Nontruncat

[4963] 3 X 7

[4964] 8224G> A Glu2742Lys ing: y 4 2 4 Benig (3

[4965] Missense

[4966] 4 3 2 n ) 1 E 2 Likel 8279T> C, 8282G> C, Nontruncat 2 3 X 7

[4967] 8235T> G, 8291T> C Ser2745Ser, ing: y 4 2 4 Patho (1

[4968] Met2760Th r Missense

[4969] 5 3 5 genic ) 1 E 2 8279T> C, 8282G> C, Likel Nontruncat 2 3 X 7 8291T> C, 8477T

[4970] 8235T> G, ing: y 4 2 4 > Ser2745Ser, Patho (2

[4971] Missense

[4972] 6 3 5 Met2760Th r genic ) 1 E 2

[4973] Nontruncat 1 3 X 7

[4974] 8237G> A Arg2746Gln ing:

[4975] 4 2 4 vus (1

[4976] Missense

[4977] 7 3 6 ) 1 E 2 Likel 3 X 7 Synonymo

[4978] 8247G> A Ala2749Ala y 4 2 4 us Benig (2 8 3 9 n ) 1 E 2 Likel Nontruncat 1 3 X 7

[4979] 8255C>A Ala2752Asp ing: y 4 2 5 Patho (1

[4980] Missense

[4981]

[4982] 9 3 2 genic )

[4983] 133

[4984] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[4985] 1 E 2

[4986] Truncating: 1 3 X 7 Patho 8257_8260delTACA Tyr2753fs2X Deletion / In 5 2 5 genic (1 sertion

[4987] 0 3 3 ) 1 E 2

[4988] 1 3 X 7 Truncating: Patho 8259C>G Tyr2753X

[4989] 5 2 5 Nonsense genic (1 1 3 3 ) 1 E 2 Likel Nontruncat

[4990] 3 X 7

[4991] 8262C>A Asn2754Lys ing: y 5 2 5 Benig (1

[4992] Missense

[4993] 2 3 4 n ) 1 E 2 Likel Nontruncat

[4994] 3 X 7

[4995] 8282G> A Arg2761His ing: y 5 2 6 Benig (1

[4996] Missense

[4997] 3 3 1 n ) 1 E 2 Nontruncat

[4998] 8284 8295delATCCT 1 3 X 7 Ile2762_Arg2765delIl ing: Patho CATGCGC (SEQ ID

[4999] 5 2 6 eLe u Deletion / In genic (1

[5000] NO:47)

[5001] 4 3 2 sertion ) 1 E 2 Nontruncat Likel 1 3 X 7 ing:

[5002] 8287_8289delCTC Leu2763del y 5 2 6 Deletion / In Patho (1 5 3 3 sertion genic ) 1 E 2 1

[5003] Nontruncat

[5004] 3 X 7 4

[5005] 8293C>T Arg2765Cys ing:

[5006] 5 2 6 vus Missense (5 6 3 5 ) 1 E 2 Nontruncat

[5007] 8295 8296insATCCT 1 3 X 7 Arg2765 Ser2766insll ing: Patho CATGCGC (SEQ ID

[5008] 5 2 6 eL e Deletion / In genic (1

[5009] NO:48)

[5010] 7 3 5 sertion ) 1 E 2 Likel 3 X 7 Synonymo

[5011] 8298C> G Ser2766Ser y 5 2 6 us Benig (1 8 3 6 n ) 1 E 2 Likel 3 X 7 Synonymo

[5012] 8298C> T Ser2766Ser y 5 2 6 us Benig 0 9 3 6 n ) 1 E 2 Likel Nontruncat 6 3 X 7

[5013] 8299C>T Arg2767Cys ing: y 6 2 6 Patho (3

[5014] Missense

[5015]

[5016] 0 3 7 genic )

[5017] 134

[5018] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5019] 1 E 2

[5020] Nontruncat 1 3 X 7

[5021] 8300G> A Arg2767His ing:

[5022] 6 2 6 vus (1

[5023] Missense

[5024] 1 3 7 ) 1 E 2 Likel Nontruncat 3 3 X 7

[5025] 8300G> C Arg2767Pro ing: y 6 2 6 (2

[5026] Patho Missense

[5027] 2 3 7 genic ) 1 E 2

[5028] Nontruncat 1 3 X 7

[5029] 8302G> A Val2768Met ing: VUS 6 2 6 (1

[5030] Missense

[5031] 3 3 8 ) 1 E 2

[5032] Nontruncat 1 3 X 7

[5033] 8305C>T Leu2769Phe ing: VUS 6 2 6 (1

[5034] Missense

[5035] 4 3 9 ) 1 E 2

[5036] Truncating: 5 3 X 7 8308_831 IdelAACGin Patho Asn2770fs6X Deletion / In

[5037] 6 2 7 sCTCGTT genic (1 sertion

[5038] 5 3 0 ) 1 E 2 Likel Nontruncat 1 3 X 7

[5039] 8309A> T Asn2770Ile ing: y 6 2 7 Patho (1

[5040] Missense

[5041] 6 3 0 genic ) 1 E 2 Likel 2

[5042] Nontruncat

[5043] 3 X 7

[5044] 8311G>A Glu2771Lys ing:

[5045] 6 2 7 Patho Missense (8 7 3 1 genic ) 1 E 2

[5046] Truncating: 2 3 X 7 Patho 8320_8321delCT Leu2774fs47X Deletion / In 6 2 7 genic (1 sertion

[5047] 8 3 4 ) 1 E 2

[5048] Truncating: 1 3 X 7 Patho 8320delC Leu2774X Deletion / In 6 2 7 genic (1 sertion

[5049] 9 3 4 ) 1 E 2 Likel Nontruncat 1 3 X 7

[5050] 8321T> C Leu2774Pro

[5051] 7 2 7 ing: y Patho (1 Missense

[5052] 0 3 4 genic ) 1 E 2 Likel 3 X 7 Synonymo

[5053] 8331G> A Ala2777Ala y 7 2 7 us Benig (3

[5054]

[5055] 1 3 7 n )

[5056] 135

[5057] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5058] 1 E 2

[5059] Truncating: 1 3 X 7 Patho 8332_8335delGGCG Gly2778fs95X Deletion / In 7 2 7 genic (1 sertion

[5060] 2 3 8 ) 1 E 2 Likel 3 X 7 Synonymo

[5061] 8334C>T Gly2778Gly y 7 2 7 us Benig (1 3 3 8 n ) 1 E 2 Likel Nontruncat

[5062] 3 X 7

[5063] 8335G> A Glu2779Lys ing: y 7 2 7 Benig (2

[5064] Missense

[5065] 4 3 9 n ) 1 E 2 Likel Nontruncat

[5066] 3 X 7

[5067] 8344G> A Val2782Met ing: y 7 2 8 Benig (1

[5068] Missense

[5069] 5 3 2 n ) 1 E 2

[5070] 1 3 X 7 Truncating: Patho 8350C>T Gln2784X

[5071] 7 2 8 Nonsense genic (1 6 3 4 ) 1 E 2 Likel Nontruncat 1 3 X 7

[5072] 8354G> A Gly2785Asp ing: y 7 2 8 Patho (1

[5073] Missense

[5074] 7 3 5 genic ) 1 E 2

[5075] Nontruncat 1 3 X 7

[5076] 8360G> A Arg2787His ing:

[5077] 7 2 8 vus (1

[5078] Missense

[5079] 8 3 7 ) 1 E 2 Likel Nontruncat 2 3 X 7

[5080] 8363C>G Ser2788Trp ing: y 7 2 8 Patho (1

[5081] Missense

[5082] 9 3 8 genic ) 1 E 2

[5083] Nontruncat 1 3 X 7

[5084] 8363C>T Ser2788Leu ing: VUS 8 2 8 (1

[5085] Missense

[5086] 0 3 8 ) 1 E 2 Likel 3 X 7 Synonymo

[5087] 8364G> A Ser2788Ser y 8 2 8 us Benig (2 1 3 8 n ) 1 E 2 Likel 3 X 7 Synonymo

[5088] 8367C>T Asp2789Asp y 8 2 8 us Benig (2

[5089]

[5090] 2 3 9 n )

[5091] 136

[5092] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5093] 1 E 2 Likel Nontruncat

[5094] 3 X 7

[5095] 8371C>T Arg2791Trp ing: y 8 2 9 Benig (1

[5096] Missense

[5097] 3 3 1 n ) 1 E 2 Likel Nontruncat

[5098] 3 X 7

[5099] 8372G>A Arg2791Gln ing: y 8 2 9 Benig (1

[5100] Missense

[5101] 4 3 1 n ) 1 E 2

[5102] 2 3 X 7 Truncating: Patho 8388T> A Try2796X

[5103] 8 2 9 Nonsense genic (1 5 3 6 ) 1 E 2

[5104] Nontruncat 1 3 X 7

[5105] 8392G> T Gly2798Cys ing:

[5106] 8 2 9 vus (1

[5107] Missense

[5108] 6 3 8 ) 1 E 2 Likel Nontruncat 1 3 X 8

[5109] 8404C>T Pro2802Leu ing: y 8 2 0 Patho (1

[5110] Missense

[5111] 7 3 2 genic ) 1 E 2 Likel Nontruncat 1 3 X 8

[5112] 8426C>T Pro2809Leu ing: y 8 2 0 Patho (1

[5113] Missense

[5114] 8 3 9 genic ) 1 E 2

[5115] 4 3 X 8 Truncating: Patho 8428G> T Glu2810X

[5116] 8 2 1 Nonsense genic (4 9 3 0 ) 1 E 2 Likel 3 X 8 Synonymo

[5117] 8439C>T Ser2813Ser y 9 2 1 us Benig (7 0 3 3 n ) 1 E 2 Likel Nontruncat

[5118] 3 X 8

[5119] 8440G> A Gly2814Arg ing: y 9 2 1 Benig (7

[5120] Missense

[5121] 1 3 4 n ) 1 E 2 Likel Nontruncat

[5122] 3 X 8

[5123] 8444C>T Ala2815Val

[5124] 9 2 1 ing: y Benig (1 Missense

[5125] 2 3 5 n ) 1 E 2

[5126] Truncating: 1 3 X 8 Patho 8446delC Leu2816fs58X Deletion / In 9 2 1 genic (1 sertion

[5127]

[5128] 3 3 6 )

[5129] 137

[5130] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5131] 1 E 2 Likel Nontruncat 1 3 X 8

[5132] 8447T> A Leu2816Gln ing: y 9 2 1 Patho (1

[5133] Missense

[5134] 4 3 6 genic ) 1 E 2 Likel Nontruncat 6 3 X 8

[5135] 8447T> C Leu2816Pro ing: y 9 2 1 (4

[5136] Patho Missense

[5137] 5 3 6 genic ) 1 E 2 Likel 3 X 8 Synonymo

[5138] 8451C>T Ala2817Ala y 9 2 1 us Benig (2 6 3 7 n ) 1 E 2

[5139] Nontruncat 3 3 X 8

[5140] 8464G> A Val2822Met ing: VUS 9 2 2 (3

[5141] Missense

[5142] 7 3 2 ) 1 E 2 Likel Nontruncat

[5143] 3 X 8

[5144] 8473C>T Leu2825Phe ing: y 9 2 2 Benig (1

[5145] Missense

[5146] 8 3 5 n ) 1 E 2 Nontruncat Likel 6 3 X 8 Leu2825 Ile2826insAl

[5147] 8475_8476insGCT ing: y 9 2 2 a Deletion / In Patho (1 9 3 5 sertion genic ) 1 E 2 Likel Nontruncat 1 4 X 8

[5148] 8497C> T Pro2833Ser ing: y 0 2 3 Patho (1

[5149] Missense

[5150]

[5151] 0 3 3 genic )

[5152] Likely 1 14 EX 28 Nontruncating:

[5153] 8498C> G Pro2833 Arg Pathogeni 01 23 33 Missense (1 c ) 14 EX 28 Likely 8499C> T Pro2833Pro Synonymous

[5154] 02 23 33 Benign (1

[5155] ) 1 14 EX 28 Truncating: Pathogeni 8502delT Phe2834fsX

[5156] 03 23 34 Deletion / Insertion c (1

[5157] ) 14 EX 28 Likely 8529C>T Thr2843Thr Synonymous

[5158] 04 23 43 Benign (1

[5159] ) 14 EX 28 Likely 8535C>G Ser2845Ser Synonymous

[5160] 05 23 45 Benign (1

[5161]

[5162] )

[5163] 138

[5164] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5165] Likely 1 14 EX 28 Nontruncating:

[5166] 8537C>T Thr2846Ile Pathogeni 06 23 46 Missense (1 c )

[5167] 1 14 EX 28 Nontruncating:

[5168] 8545G> C Ala2849Pro

[5169] 07 23 49 Missense vus (1

[5170] ) 14 EX 28 Likely 8550G> A Ser2850Ser Synonymous

[5171] 08 23 50 Benign (1

[5172] ) Likely 2 14 EX 28 8557_8562delT Phe2853_Gln Nontruncating:

[5173] Pathogeni 09 23 53 TCCAG 2854del Deletion / Insertion (1 c ) Likely 1 14 EX 28 Nontruncating:

[5174] 8558T> C Phe2853Ser Pathogeni 10 23 53 Missense (1 c ) 14 EX 28 Likely 8559C>T Phe2853Phe Synonymous

[5175] 11 23 53 Benign (1

[5176] ) 2 14 EX 28 Truncating: Pathogeni 8560C>T Gln2854X

[5177] 12 23 54 Nonsense c (1

[5178] ) 1 14 EX 28 Nontruncating:

[5179] 8572G> A Gly2858Ser VUS

[5180] 13 23 58 Missense (1

[5181] ) 1 14 EX 28 8586_8587insC Truncating: Pathogeni Pro2862fsl2X

[5182] 14 23 62 C Deletion / Insertion c (1

[5183] ) 1 14 EX 28 Truncating: Pathogeni 8586delC Ile2863fsl2X

[5184] 15 23 63 Deletion / Insertion c (1

[5185] ) 14 EX 28 Nontruncating: Likely 8593C>T Arg2865Trp

[5186] 16 23 65 Missense Benign (2

[5187] ) 14 EX 28 Likely 8595G> A Arg2865Arg Synonymous

[5188] 17 23 65 Benign (1

[5189] ) Likely 1 14 EX 28 Nontruncating:

[5190] 8597T> C Leu2866Pro Pathogeni 18 23 66 Missense (1 c )

[5191] 1 14 EX 28 Truncating: Pathogeni 8603C> A Ser2868X

[5192] 19 23 68 Nonsense c (1

[5193] ) 1 14 EX 28 8604_8605insT Truncating: Pathogeni Ser2868fsX

[5194] 20 23 68 T Deletion / Insertion c (1

[5195]

[5196] )

[5197] 139

[5198] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5199] 1 14 EX 28 8606_8607delA Truncating: Pathogeni Glu2869fs66X

[5200] 21 23 69 G Deletion / Insertion c (1

[5201] ) 14 EX 28 Nontruncating: Likely 8609G> A Arg2870His

[5202] 22 23 70 Missense Benign (1

[5203] ) 1 14 EX 28 Truncating: Pathogeni 8614delA Ile2872fs3X

[5204] 23 23 72 Deletion / Insertion c (1

[5205] ) Likely 1 14 EX 28 Nontruncating:

[5206] 8615T> G Ile2872Ser Pathogeni 24 23 72 Missense (1 c )

[5207] 1 14 EX 28 Truncating: Pathogeni 8617delA Thr2873fslX

[5208] 25 23 73 Deletion / Insertion c (1

[5209] ) 14 EX 28 Nontruncating: Likely 8620G> A Val2874Met

[5210] 26 23 74 Missense Benign (1

[5211] ) 1 14 EX 28 Nontruncating:

[5212] 8639C>T Ser2880Leu VUS

[5213] 27 23 80 Missense (1

[5214] ) 14 EX 28 Nontruncating: Likely 8644T> A Trp2882Arg

[5215] 28 23 82 Missense Benign (5

[5216] ) 1 14 EX 28 Gly2886fsl07 Truncating: Pathogeni 8657delG

[5217] 29 23 86 X Deletion / Insertion c (1

[5218] ) 14 EX 28 Nontruncating: Likely 8662C>G Arg2888Gly

[5219] 30 23 88 Missense Benign (1

[5220] ) 1 14 EX 28 8666 8674delG Ser2889 Ala2 Nontruncating:

[5221] VUS

[5222] 31 23 89 CTCCGCCA 891del3 Deletion / Insertion (1

[5223] ) 14 EX 28 Nontruncating: Likely 8666G> A Ser2889Asn

[5224] 32 23 89 Missense Benign (1

[5225] ) 14 EX 28 Nontruncating: Likely 8667C>G Ser2889Arg

[5226] 33 23 89 Missense Benign (1

[5227] ) 14 EX 28 Likely 8670C>T Ser2890Ser Synonymous

[5228] 34 23 90 Benign (1

[5229] ) 14 EX 28 Likely 8679C>G Ser2893Ser Synonymous

[5230] 35 23 93 Benign (4

[5231]

[5232] )

[5233] 140

[5234] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5235] 1 14 EX 28 Ala2894fs100X Truncating: Pathogeni 8679delC

[5236] 36 23 94 X Deletion / Insertion c (1

[5237] ) 14 EX 28 8681_8689delC Ala2894_Ser2 Nontruncating: Likely

[5238] 37 23 94 CAACTCCG 896del3 Deletion / Insertion Benign (6

[5239] ) 14 EX 28 Nontruncating: Likely 8689G> A Val2897Ile

[5240] 38 23 97 Missense Benign (2

[5241] ) 2 14 EX 29 Truncating: Pathogeni 8698C>T Gln2900X

[5242] 39 23 00 (2

[5243] Nonsense c

[5244] ) 1 14 EX 29 Nontruncating:

[5245] 8702C>T Pro2901Leu

[5246] 40 23 01 Missense vus (1

[5247] ) 1 14 EX 29 Truncating: Pathogeni 8712_8713insC Ser2904fs33X

[5248] 41 23 04 Deletion / Insertion c (1

[5249] ) 14 EX 29 Nontruncating: Likely 8713G> A Val2905Ile

[5250] 42 23 05 Missense Benign (1

[5251] ) 14 EX 29 Nontruncating: Likely 8716G> A Gly2906Ser

[5252] 43 23 06 Missense Benign (1

[5253] ) 14 EX 29 Nontruncating: Likely 8750C>T Ala2917Val

[5254] 44 23 17 Missense Benign (1

[5255] ) 14 EX 29 Likely 8751G> A Ala2917Ala Synonymous

[5256] 45 23 17 Benign (1

[5257] ) 2 14 EX 29 Nontruncating:

[5258] 8755G> A Gly2919Arg VUS

[5259] 46 23 19 Missense (2

[5260] ) Likely 1 14 EX 29 Nontruncating:

[5261] 8756G> T Gly2919Val Pathogeni 47 23 19 Missense (1 c ) Likely 1 14 EX 29 Nontruncating:

[5262] 8762A> C His2921Pro Pathogeni 48 23 21 Missense (1 c )

[5263] 2 14 EX 29 Truncating: Pathogeni 8767C>T Gln2923X

[5264] 49 23 23 Nonsense c (1

[5265] ) 2 14 EX 29 8772_8776delC Truncating: Pathogeni Lys2924fs9X

[5266] 50 23 24 A ACT Deletion / Insertion c (1

[5267]

[5268] )

[5269] 141

[5270] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5271] 14 EX 29 Nontruncating: Likely 8780C> T Thr2927Met

[5272] 51 23 27 Missense Benign (1

[5273] ) 2 14 EX 29 8786_8787ins2 Leu2929_Asp Nontruncating: Pathogeni 52 23 29 4 2930ins8 Deletion / Insertion c (1

[5274] ) IV Gly2931fs Likely 1 14 29

[5275] S2 8791+5G> C Nontruncating Splice Pathogeni 53 31 (1 3 c ) IV

[5276] 14 29 Likely Silent Likely

[5277] S2 8791 + 12G> A Silent

[5278] 54 31 IVS Benign (1 3 ) IV

[5279] 14 29 Likely Silent Likely

[5280] S2 8791+25G> A Silent

[5281] 55 31 IVS Benign (1 3 ) IV

[5282] 14 29 Likely Silent Likely

[5283] S2 8791+27G> A Silent

[5284] 56 31 IVS Benign (1 3 ) IV

[5285] 14 29 Likely Silent Likely

[5286] S2 8791+59T> C Silent

[5287] 57 31 IVS Benign (1 3 ) IV

[5288] 14 29 8792-88_- Likely Silent Likely

[5289] S2 Silent

[5290] 58 31 87insA IVS Benign (1 3 ) IV

[5291] 14 29 Likely Silent Likely

[5292] S2 8792-34C>A Silent

[5293] 59 31 IVS Benign (1 3 ) IV

[5294] 14 29 Likely Silent Likely

[5295] S2 8792-32G> A Silent

[5296] 60 31 IVS Benign (1 3 ) IV

[5297] 14 29 Likely Silent Likely

[5298] S2 8792-14G> A Silent

[5299] 61 31 IVS Benign (1 3 ) IV 1 14 29 Gly2931fs Pathogeni S2 8792-2A> G Splice

[5300] 62 31 Truncating: c (1 3 ) IV 1 14 29 Gly2931fs Pathogeni S2 8792-1 G> C Splice

[5301] 63 31 Truncating: c (1 3 )

[5302] 1 14 EX 29 Truncating: Pathogeni 8799C>G Tyr2933X

[5303] 64 24 33 Nonsense c (1

[5304] ) 1 14 EX 29 Nontruncating:

[5305] 8804C>T Sal2935Phe

[5306] 65 24 35 Missense vus (1

[5307]

[5308] )

[5309] 142

[5310] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5311] Likely 1 14 EX 29 Nontruncating:

[5312] 8819C>T Pro2940Leu Pathogeni 66 24 40 Missense (1 c )

[5313] 1 14 EX 29 8822_8825delA Truncating: Pathogeni Tyr2941fs51X

[5314] 67 24 41 CCT Deletion / Insertion c (1

[5315] ) 1 14 EX 29 Truncating: Pathogeni 8823C>A Tyr2941X

[5316] 68 24 41 Nonsense c (1

[5317] ) 14 EX 29 Likely 8823C>T Tyr2941Tyr Synonymous

[5318] 69 24 41 Benign (2

[5319] ) Likely 1 14 EX 29 Nontruncating:

[5320] 8825T> A Leu2942Gln Pathogeni 70 24 42 Missense (1 c ) Likely 1 14 EX 29 Nontruncating:

[5321] 8825T> C Leu2942Pro Pathogeni 71 24 42 Missense (1 c )

[5322] 1 14 EX 29 Nontruncating:

[5323] 8834A> G Tyr2945Cys

[5324] 72 24 45 Missense vus (1

[5325] ) 1 14 EX 29 Truncating: Pathogeni 8843C>A Ser2948X

[5326] 73 24 48 Nonsense c (1

[5327] ) 14 EX 29 Likely 8850C> T Pro2950Pro Synonymous

[5328] 74 24 50 Benign (1

[5329] ) 14 EX 29 Nontruncating:

[5330] 8873C>T Ser2958Leu VUS

[5331] 75 24 58 Missense (1

[5332] ) 14 EX 29 Likely 8874G> A Ser2958Ser Synonymous

[5333] 76 24 58 Benign (1

[5334] ) 14 EX 29 Nontruncating: Likely 8898G> C Glu2966Asp

[5335] 77 24 66 Missense Benign (6

[5336] ) 2 14 EX 29 Truncating: Pathogeni 8905C>T Gln2969X

[5337] 78 24 69 Nonsense c (2

[5338] ) 14 EX 29 Likely 8913T> C Ala2971Ala Synonymous

[5339] 79 24 71 Benign (6

[5340] ) 14 EX 29 Nontruncating: Likely 8914G> A Asp2972Asn

[5341] 80 24 72 Missense Benign (2

[5342]

[5343] )

[5344] 143

[5345] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5346] 14 EX 29 Likely 8916C>T Asp2972Asp Synonymous

[5347] 81 24 72 Benign (3

[5348] ) 1 14 EX 29 Nontruncating:

[5349] 8918A> G His2973Arg VUS

[5350] 82 24 73 Missense (1

[5351] ) 1 14 EX 29 Nontruncating:

[5352] 8920C>T Arg2974Trp VUS

[5353] 83 24 74 Missense (1

[5354] ) 14 EX 29 Nontruncating: Likely 8921G> A Arg2974Gln

[5355] 84 24 74 Missense Benign (1

[5356] ) 1 14 EX 29 Truncating: Pathogeni 8923_8924insT Pro2975fs93X

[5357] 85 24 75 Deletion / Insertion c (1

[5358] ) 1 14 EX 29 Nontruncating:

[5359] 8930C> A Thr2977Asn VUS

[5360] 86 24 77 Missense (1

[5361] ) Likely 1 14 EX 29 Nontruncating:

[5362] 8930C>T Thr2977Ile Pathogeni 87 24 77 Missense (1 c ) Likely 1 14 EX 29 8932_8933delT Nontruncating:

[5363] Phe2978Thr Pathogeni 88 24 78 TinsAC Missense (1 c ) Likely 1 14 EX 29 Nontruncating:

[5364] 8933T> C Phe2978Ser Pathogeni 89 24 78 Missense (1 c ) Likely 1 14 EX 29 Nontruncating:

[5365] 8933T> G Phe2978Cys Pathogeni 90 24 78 Missense (1 c ) Likely 5 14 EX 29 8935 8937delT Nontruncating:

[5366] Phe2979del Pathogeni 91 24 79 TC Deletion / Insertion (3 c ) IV 1 14 29 Gly2983fs Pathogeni S2 8948+lG> T Splice

[5367] 92 83 Truncating: c (1 4 ) IV Gly2983fs Likely 2 14 29

[5368] S2 8948+5G> C Nontruncating Splice Pathogeni 93 83 (1 4 c ) IV

[5369] 14 29 Likely Silent Likely

[5370] S2 8948+11C> T Silent

[5371] 94 83 IVS Benign (2 4 ) IV

[5372] 14 29 Likely Silent Likely

[5373] S2 8948+12G> A Silent

[5374] 95 83 IVS Benign (1

[5375]

[5376] 4 )

[5377] 144

[5378] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5379] IV

[5380] 14 29 Likely Silent Likely

[5381] S2 8948+17A> G Silent

[5382] 96 83 IVS Benign (5 4 ) IV

[5383] 14 29 Likely Silent Likely

[5384] S2 8948+28G> T Silent

[5385] 97 83 IVS Benign (2 4 ) IV

[5386] 14 29 Likely Silent Likely

[5387] S2 8948+34C>T Silent

[5388] 98 83 IVS Benign (1 4 ) IV

[5389] 14 29 Likely Silent Likely

[5390] S2 8948+80A> G Silent

[5391] 99 83 ( IVS Benign 2 4 ) IV

[5392] 15 29 Likely Silent Likely

[5393] S2 8949-54G> A Silent

[5394] 00 83 IVS Benign (2

[5395]

[5396] 4 ) 1 IVS2 2 Truncating:

[5397] 1 5 4- 9 Large Pathog 8949_10051del1102 Gly2983fs

[5398] 0 IVS3 8 Rearrangeme enic (2 1 0 3 nt ) 1 2

[5399] 5 IVS2 9 Likely Likely 8949-20G> A Silent

[5400] 0 4 8 Silent IVS Benign (4 2 3 ) 1 2

[5401] 5 IVS2 9 Likely Likely 8949-17A> G Silent

[5402] 0 4 8 Silent IVS Benign (8 3 3 ) 1 2

[5403] 5 IVS2 9 Likely Likely 8949-15C>G Silent

[5404] 0 4 8 Silent IVS Benign (1 4 3 ) 1 2

[5405] 5 EX2 9 Gly2983G Likely 8949G> A Synonymous 0 5 8 ( ly Benign 1 5 3 ) 1 2

[5406] 5 EX2 9 Arg2985G Nontruncatin Likely 8953A> G

[5407] 0 5 8 g: Missense Benign (1 iy

[5408] 6 5 ) 1 2

[5409] 1 5 EX2 9 Ala2988V Nontruncatin

[5410] 8963C>T VUS

[5411] 0 5 8 al g: Missense (1

[5412]

[5413] 7 8 )

[5414] 145

[5415] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5416] 1 2

[5417] 5 EX2 9 Ala2988Al Likely 8964G> A Synonymous 0 5 8 a Benign (7 8 8 ) 1 2

[5418] Truncating: 1 5 EX2 9 Pathog 8972_8973insA Tyr2991X Deletion / Inse 0 5 9 enic (1 rtion

[5419] 9 1 ) 1 2

[5420] 1 5 EX2 9 Truncating: Pathog 8973OG Tyr2991X

[5421] 1 5 9 Nonsense enic (1 0 1 ) 1 2

[5422] Likely 1 5 EX2 9 Leu2993Pr Nontruncatin

[5423] 8978T> C Pathog 1 5 9 0 g: Missense (1 enic

[5424] 1 3 ) 1 2

[5425] Likely 1 5 EX2 9 Leu2995A Nontruncatin

[5426] 8984T> G Pathog 1 5 9 ( rg g: Missense 1 enic

[5427] 2 5 ) 1 2

[5428] 5 EX2 9 Leu2995L Likely 8985C>A Synonymous 1 5 9 eu Benign (1 3 5 ) 1 2

[5429] Likely 1 5 EX2 9 Nontruncatin

[5430] 8990G> T Ser2997Ile Pathog 1 5 9 g: Missense (1 enic

[5431] 4 7 ) 1 3

[5432] 5 EX2 0 Arg3000G Nontruncatin Likely 8998C>G

[5433] 1 5 0 ly g: Missense Benign (1 5 0 ) 1 3

[5434] 1 5 EX2 0 Arg3000C Nontruncatin

[5435] 8998C>T VUS

[5436] 1 5 0 ys g: Missense (1 6 0 ) 1 3

[5437] 2 5 EX2 0 Truncating: Pathog 9002G> A Trp3001X

[5438] 1 5 0 Nonsense enic (2 7 1 ) 1 3

[5439] 5 EX2 0 Leu3004L Likely 9010C>T Synonymous 1 5 0 eu Benign (1

[5440]

[5441] 8 4 )

[5442] 146

[5443] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5444] 1 3

[5445] 1 5 EX2 0 Leu3004Pr Nontruncatin

[5446] 9011T> C

[5447] 1 5 0 0 g: Missense vus (1 9 4 ) 1 3

[5448] 1 5 EX2 0 Truncating: Pathog 9013C>T Gln3005X

[5449] 2 5 0 Nonsense enic (1 0 5 ) 1 3

[5450] Likely 1 5 EX2 0 Ser3007Pr Nontruncatin

[5451] 9019T> C Pathog 2 5 0 0 g: Missense (1 enic

[5452] 1 7 ) 1 3

[5453] 5 EX2 0 Ser3007Se Likely 9021C>T Synonymous 2 5 0 r Benign (2 2 7 ) 1 3

[5454] 5 EX2 0 Val3008M Nontruncatin Likely 9022G> A

[5455] 2 5 0 et g: Missense Benign (2 3 8 ) 1 3

[5456] 5 EX2 0 Val3008L Nontruncatin Likely 9022G> C (1 2 5 0 eu g: Missense Benign 4 8 ) 1 3 Nontruncatin

[5457] 9034 905 IdelACGTCCCT Thr3012 1 5 EX2 0 Pathog GTGCCAGTAC (SEQ ID Tyr3017de g:

[5458] 2 5 1 Deletion / Inse enic (1

[5459] NO:49) 16

[5460] 5 2 rtion ) 1 3 Nontruncatin

[5461] Th 9035 9036insGTCCGTGG r3012 1 5 EX2 0 g: Pathog GCCTGTACAC (SEQ ID Ser3013in

[5462] 2 5 1 Deletion / Inse enic (1

[5463] NO:50) sSer V

[5464] 6 2 rtion ) 1 3

[5465] 1 5 EX2 0 Thr3012M Nontruncatin

[5466] 9035C>T VUS (1 2 5 1 et g: Missense

[5467] ) 7 2

[5468] 1 3

[5469] 1 Likely 5 EX2 0 Cys3015T Nontruncatin

[5470] 9044G> A Pathog (1 2 5 1 g: Missense yr enic ) 8 5

[5471] 1 3

[5472] 1 Likely 5 EX2 0 Cys3015T Nontruncatin

[5473] 9045C>G Pathog (1 2 5 1 g: Missense rp enic ) 9 5

[5474]

[5475] 147

[5476] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5477] 1 3

[5478] Likely 7 5 EX2 0 Gln3016A Nontruncatin

[5479] 9047A> G Pathog 3 5 1 ( rg g: Missense 5 enic

[5480] 0 6 ) 1 3

[5481] Likely 1 5 EX2 0 Phe3018S Nontruncatin

[5482] 9053T> C Pathog 3 5 1 er g: Missense (1 enic

[5483] 1 8 ) 1 3

[5484] 5 EX2 0 Ser3019Se Likely 9057C>T Synonymous 3 5 1 r Benign (1 2 9 ) 1 3

[5485] 1 5 EX2 0 Truncating: Pathog 9058G> T Glu3020X

[5486] 3 5 2 Nonsense enic (1 3 0 ) 1 3

[5487] 5 EX2 0 Met3023L Nontruncatin Likely 9068T> A

[5488] 3 5 2 ys g: Missense Benign (1 4 3 ) 1 3 Nontruncatin

[5489] 9082 9120delGAGGGGC GGlu3028 1 5 EX2 0

[5490] TG l 3 4 g: Pathog CTGCCCCTGGAG _G n 0 0

[5491] 3 5 2 Deletion / Inse enic (1

[5492] (SEQ ID NO:51) del 13

[5493] 5 8 rtion ) 1 3

[5494] Truncating: 1 5 EX2 0 Glu3028fs Pathog 9083_9084delAG Deletion / Inse 3 5 2 39X enic (1 rtion

[5495] 6 8 ) 1 3

[5496] Truncating: 1 5 EX2 0 Leu3030fs Pathog 9088delC Deletion / Inse 3 5 3 43X enic (1 rtion

[5497] 7 0 ) 1 3

[5498] Likely 1 5 EX2 0 Thr3036Il Nontruncatin

[5499] 9107C>T Pathog 3 5 3 e g: Missense (1 enic

[5500] 8 6 ) 1 3

[5501] 1 5 EX2 0 Truncating: Pathog 9110C>A Ser3037X

[5502] 3 5 3 Nonsense enic (1 9 7 ) 1 3

[5503] 9111_9132delGCCCCGCC Truncating: 1 5 EX2 0 CSer3037f Pathog AGGCCGTCTGCCT (SEQ Deletion / Inse 4 5 3 s29X enic (1

[5504] ID NO:52) rtion

[5505]

[5506] 0 7 )

[5507] 148

[5508] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5509] 1 3

[5510] 5 EX2 0 Ser3037Se Likely 9111G> A Synonymous 4 5 3 r Benign (2 1 7 ) 1 3

[5511] 3 5 EX2 0 Arg3039C Nontruncatin

[5512] 9115C>T VUS

[5513] 4 5 3 (2 ys g: Missense

[5514] 2 9 ) 1 3

[5515] Truncating: 1 5 EX2 0 Cys3043fs Pathog 9127delT Deletion / Inse 4 5 4 31X enic (1 rtion

[5516] 3 3 ) 1 3

[5517] Truncating: 1 5 EX2 0 Ala3050fs Pathog 9148_9149insG Deletion / Inse 4 5 5 18X enic (1 rtion

[5518] 4 0 ) 1 3

[5519] 5 EX2 0 Gly3052S Nontruncatin Likely 9154G> A

[5520] 4 5 5 er g: Missense Benign (1 5 2 ) 1 3

[5521] Likely 1 5 EX2 0 Gly3052A Nontruncatin

[5522] 9154G> C Pathog 4 5 5 ( rg g: Missense 1 enic

[5523] 6 2 ) 1 3

[5524] 1 5 EX2 0 Gly3052V Nontruncatin

[5525] 9155G> T VUS

[5526] 4 5 5 al g: Missense (1 7 2 ) 1 3

[5527] 5 EX2 0 Gly3052G Likely 9156C>T Synonymous 4 5 5 ( ly Benign 3 8 2 ) 1 3

[5528] 5 EX2 0 Val3057M Nontruncatin Likely 9169G> A

[5529] 4 5 5 et g: Missense Benign (2 9 7 ) 1 3

[5530] 5 EX2 0 Val3062V Likely 9186C>A Synonymous 5 5 6 al Benign (1 0 2 ) 1 3

[5531] 5 EX2 0 Arg3063C Nontruncatin Likely 9187C>T

[5532] 5 5 6 ys g: Missense Benign (2

[5533]

[5534] 1 3 )

[5535] 149

[5536] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5537] 1 3

[5538] 1 5 EX2 0 Arg3063Pr Nontruncatin

[5539] 9188G> C

[5540] 5 5 6 0 g: Missense vus (1 2 3 ) 1 3 +

[5541] 5 EX2 0 9196T> C Nontruncatin Likely 9195G> C

[5542] 5 5 6 Phe3066L g: Missense Benign (1 3 6 eu 3) 1 3

[5543] Pro3067fs 1 5 IVS2 0 Pathog 9201+1G>C Truncating Splice

[5544] 5 5 6 enic (1 4 7 ) 1 3

[5545] Pro3067fs 1 5 IVS2 0 Pathog 9201+1G>T Truncating Splice

[5546] 5 5 6 enic (1 5 7 ) 1 3

[5547] Pro3067fs 1 5 IVS2 0

[5548] 9201+6T> C Nontrunca Splice VUS

[5549] 5 5 6 (1 ting:

[5550] 6 7 ) 1 3

[5551] Pro3067fs Likely 2 5 IVS2 0

[5552] 9202-16G> A Nontrunca Splice Pathog 5 5 6 (2 ting: enic

[5553] 7 7 ) 1 3

[5554] Pro3067fs 1 5 IVS2 0 Pathog 9202-2A> G Truncating Splice

[5555] 5 5 6 enic (1 8 7 ) 1 3

[5556] Pro3067fs 1 5 IVS2 0 Pathog 9202-1 G> A Truncating Splice

[5557] 5 5 6 enic (1 9 7 ) 1 3

[5558] 5 EX2 0 Glu3068G Nontruncatin Likely 9202G> C

[5559] 6 6 6 In g: Missense Benign (1 0 8 ) 1 3

[5560] 1 5 EX2 0 Glu3068A Nontruncatin

[5561] 9204G> C VUS

[5562] 6 6 6 sp g: Missense (1 1 8 ) 1 3

[5563] 1 5 EX2 0 Pro3069Le Nontruncatin

[5564] 9206OT VUS

[5565] 6 6 6 u g: Missense (1

[5566]

[5567] 2 9 )

[5568] 150

[5569] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5570] 1 3

[5571] 5 EX2 0 Ala3071Al Likely 9213G> A Synonymous 6 6 7 a Benign (1 3 1 ) 1 3

[5572] Truncating: 1 5 EX2 0 Asp3072fs Pathog 9214delG Deletion / Inse 6 6 7 2X enic (1 rtion

[5573] 4 2 ) 1 3

[5574] 1 5 EX2 0 Asn3074L Nontruncatin

[5575] 9222C>G

[5576] 6 6 7 ys g: Missense vus (1 5 4 ) 1 3

[5577] Truncating: 1 5 EX2 0 Asn3074fs Pathog 9221delA Deletion / Inse 6 6 7 5X enic (1 rtion

[5578] 6 4 ) 1 3

[5579] 1 5 EX2 0 Met3078T Nontruncatin

[5580] 9233T> C VUS

[5581] 6 6 7 hr g: Missense (1 7 8 ) 1 3

[5582] Truncating: 6 5 EX2 0 Ala3082fs Pathog 9240_9241delAT Deletion / Inse 6 6 8 95X enic (5 rtion

[5583] 8 1 ) 1 3

[5584] Likely 1 5 EX2 0 Cys3081A Nontruncatin

[5585] 9241T> C Pathog 6 6 8 ( rg g: Missense 1 enic

[5586] 9 1 ) 1 3

[5587] 5 EX2 0 Thr3087T Likely 9261C>G Synonymous 7 6 8 hr Benign (1 0 7 ) 1 3

[5588] 1 5 EX2 0 Truncating: Pathog 9264C>G Tyr3088X

[5589] 7 6 8 Nonsense enic (1 1 8 ) 1 3

[5590] 5 EX2 0 Tyr3088T Likely 9264C>T Synonymous 7 6 8 ( yr Benign 1 2 8 ) 1 3

[5591] 5 EX2 0 Val3090V Likely 9270C>T Synonymous 7 6 9 al Benign (8

[5592]

[5593] 3 0 )

[5594] 151

[5595] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5596] 1 3

[5597] Truncating: 1 5 EX2 0 9283_9293delCTGCACAA Leu3095fs Pathog Deletion / Inse

[5598] 7 6 9 GCT (SEQ ID NO:53) 80X enic (1 rtion

[5599] 4 5 ) 1 3

[5600] 1 5 EX2 1 Arg3105T Nontruncatin

[5601] 9313C>T

[5602] 7 6 0 rp g: Missense vus (1 5 5 ) 1 3

[5603] Truncating: 1 5 EX2 1 Arg3107fs Pathog 9317_9318insG Deletion / Inse 7 6 0 72X enic (1 rtion

[5604] 6 7 ) 1 3

[5605] Truncating: 3 5 EX2 1 Ile3109fs2 Pathog 9324_9325insGCGCC Deletion / Inse 7 6 0 11X enic (2 rtion

[5606] 7 9 ) 1 3

[5607] 5 EX2 1 Pro31 lOPr Likely 9330T> C Synonymous 7 6 1 0 Benign (1 8 0 3) 1 3

[5608] Likely 1 5 EX2 1 Cys3112T Nontruncatin

[5609] 9335G> A Pathog 7 6 1 yr g: Missense (1 enic

[5610] 9 2 ) 1 3

[5611] Likely 1 5 EX2 1 Cys3112P Nontruncatin

[5612] 9335G> T Pathog 8 6 1 he g: Missense (1 enic

[5613] 0 2 ) 1 3

[5614] 5 EX2 1 Arg3115G Nontruncatin Likely 9344G> A

[5615] 8 6 1 In g: Missense Benign (1 1 5 ) 1 3

[5616] 5 EX2 1 Arg3117C Nontruncatin Likely 9349C>T

[5617] 8 6 1 ys g: Missense Benign (1 2 7 ) 1 3

[5618] 5 EX2 1 Arg3117H Nontruncatin Likely 9350G> A

[5619] 8 6 1 is g: Missense Benign (1 3 7 ) 1 3

[5620] Likely 1 5 EX2 1 Glu3121L Nontruncatin

[5621] 9361G> A Pathog 8 6 2 (1 ys g: Missense

[5622] enic

[5623]

[5624] 4 1 )

[5625] 152

[5626] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5627] 1 3

[5628] Likely 1 5 EX2 1 Thr3126L Nontruncatin

[5629] 9377C>A Pathog 8 6 2 ys g: Missense (1 enic

[5630] 5 6 ) 1 3

[5631] Likely 2 5 EX2 1 Thr312611 Nontruncatin

[5632] 9377C>T Pathog 8 6 2 e g: Missense (1 enic

[5633] 6 6 ) 1 3

[5634] 1 5 EX2 1 Truncating: Pathog 9384G> A Trp3128X

[5635] 8 6 2 Nonsense enic (1 7 8 ) 1 3 Nontruncatin

[5636] 5 EX2 Arg3130 Likely 1

[5637] 1

[5638] 9388_9393delCGGGGC Gly313 Ide g: Pathog 8 6 3 Deletion / Inse (1

[5639] 12 enic

[5640] 8 0 rtion ) 1 3

[5641] 1 5 EX2 1 Arg3130T Nontruncatin

[5642] 9388C>T

[5643] 8 6 3 rp g: Missense vus (1 9 0 ) 1 3

[5644] Likely 1 5 EX2 1 Ser3132Le Nontruncatin

[5645] 9395C>T Pathog 9 6 3 u g: Missense (1 enic

[5646] 0 2 ) 1 3

[5647] Ser3238fs 1 5 IVS2 1 Pathog 9397+lG> A Truncating Splice

[5648] 9 6 3 enic (1 1 3 ) 1 3

[5649] 5 IVS2 1 Likely Likely 9397+12A> G Silent

[5650] 9 6 3 Silent IVS Benign (1 2 3 ) 1 3

[5651] 5 IVS2 1 Likely Likely 9397+22C>T Silent

[5652] 9 6 3 Silent IVS Benign (1 3 3 ) 1 3

[5653] 5 IVS2 1 Likely Likely 9397+76C>A Silent

[5654] 9 6 3 Silent IVS Benign (1 4 3 ) 1 3

[5655] 5 IVS2 1 Likely Likely 9397+81C>A Silent

[5656] 9 6 3 Silent IVS Benign (1

[5657]

[5658] 5 3 )

[5659] 153

[5660] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5661] 1 3

[5662] 5 IVS2 1 Likely Likely 9397+214G>A Silent

[5663] 9 6 3 Silent IVS Benign (1 6 3 ) 1 IVS2 3 Truncating:

[5664] 1 5 6- 1 Large Pathog 9397 11156del 1758 Gly3133fs

[5665] 9 IVS3 3 (2

[5666] Rearrangeme enic

[5667] 7 8 3 nt ) 1 3

[5668] 5 IVS2 1 Likely Likely 9398-47T> G Silent

[5669] 9 6 3 Silent IVS Benign (1 8 3 ) 1 3

[5670] Likely 2 5 EX2 1 Thr3135M Nontruncatin

[5671] 9404C>T Pathog 9 7 3 et g: Missense (2 enic

[5672] 9 5 ) 1 3

[5673] Likely 1 6 EX2 1 His3137T Nontruncatin

[5674] 9409C>T Pathog 0 7 3 ( yr g: Missense 1 enic

[5675]

[5676] 0 7 )

[5677] 1 3 Nontruncatin

[5678] Likely 2 6 EX2 1

[5679] 9412_9414delGTG Val3138del Pathog 0 7 3 (2

[5680] Deletion / Inse

[5681] enic

[5682] 1 8 rtion ) 1 3

[5683] Likely 3 6 EX2 1 Val3138Me Nontruncatin

[5684] 9412G> A Pathog 0 7 3 t g: Missense (2 enic

[5685] 2 8 ) 1 3

[5686] Likely 1 6 EX2 1 Val3138Gl Nontruncatin

[5687] 9413T> A Pathog 0 7 3 u g: Missense (1 enic

[5688] 3 8 ) 1 3

[5689] 1 6 EX2 1 Gly3139Va Nontruncatin

[5690] 9416G> T VUS

[5691] 0 7 3 1 g: Missense (1 4 9 ) 1 3

[5692] 6 EX2 1 Met3141Le Nontruncatin Likely 9421A> C

[5693] 0 7 4 u g: Missense Benign (1 5 1 ) 1 3

[5694] Likely 1 6 EX2 1 Leu3142Pr Nontruncatin

[5695] 9425T> C Pathog 0 7 4 o g: Missense (1 enic

[5696]

[5697] 6 2 )

[5698] 154

[5699] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5700] 1 3

[5701] Likely 1 6 EX2 1 Gly3144Tr Nontruncatin

[5702] 9430G> T Pathog 0 7 4 (

[5703] P g: Missense 1 enic

[5704] 7 4 ) 1 3

[5705] Likely 2 6 EX2 1 Gly3144Gl Nontruncatin

[5706] 9431G> A Pathog 0 7 4 u g: Missense (2 enic

[5707] 8 4 ) 1 3

[5708] 6 EX2 1 Arg3152Ar Likely 9456G> A Synonymous 0 7 5 ( g Benign 1 9 2 ) 1 3

[5709] Likely 1 6 EX2 1 Leu3154Pr Nontruncatin

[5710] 9461T> C Pathog 1 7 5 o g: Missense (1 enic

[5711] 0 4 ) 1 3

[5712] 6 EX2 1 Gly3156Gl Likely 9468C>T Synonymous 1 7 5 ( y Benign 1 1 6 ) 1 3

[5713] Truncating: 2 6 EX2 1 Arg3158fs2 Pathog 9474_9475delAG Deletion / Inse 1 7 5 OX enic (2 rtion

[5714] 2 8 ) 1 3

[5715] 1 6 EX2 1 Arg3162Cy Nontruncatin

[5716] 9484C>T VUS

[5717] 1 7 6 s g: Missense (1 3 2 ) 1 3

[5718] Likely 1 6 EX2 1 Arg3162Le Nontruncatin

[5719] 9485G> T Pathog 1 7 6 u g: Missense (1 enic

[5720] 4 2 ) 1 3

[5721] 10 6 EX2 1 Nontruncatin

[5722] 9499A> T Ile3167Phe VUS

[5723] 1 7 6 g: Missense (2 5 7 ) 1 3 Nontruncatin

[5724] Likely 2 6 EX2 1

[5725] 9502_9504delTTC Phe3168del g- Pathog 1 7 6 Deletion / Inse (2 enic

[5726] 6 8 rtion ) 1 3

[5727] Likely 4 6 EX2 1 Phe3168Le Nontruncatin

[5728] 9504C>G Pathog 1 7 6 u g: Missense (4 enic

[5729]

[5730] 7 8 )

[5731] 155

[5732] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5733] 1 3

[5734] 6 EX2 1 Arg3169Gl Nontruncatin Likely 9506G> A

[5735] 1 7 6 n g: Missense Benign (1 8 9 ) 1 3

[5736] Likely 1 6 EX2 1 Nontruncatin

[5737] 9511G> C Ala3171Pro Pathog 1 7 7 g: Missense (1 enic

[5738] 9 1 ) 1 3

[5739] 1 6 EX2 1 Nontruncatin

[5740] 9533G> T Ser3178Ile VUS

[5741] 2 7 7 g: Missense (1 0 8 ) 1 3

[5742] 6 EX2 1 Likely 9534C>T Ser3178Ser Synonymous 2 7 7 Benign (1 1 8 ) 1 3

[5743] 1 6 EX2 1 Truncating: Pathog 9540G> A Trp3180X

[5744] 2 7 8 Nonsense enic (1 2 0 ) 1 3

[5745] Likely 1 6 EX2 1 Lys3181As Nontruncatin

[5746] 9543G> C Pathog 2 7 8 n g: Missense (1 enic

[5747] 3 1 ) 1 3

[5748] 3 6 EX2 1 Truncating: Pathog 9547C>T Arg3183X

[5749] 2 7 8 Nonsense enic (2 4 3 ) 1 3

[5750] Truncating: 1 6 EX2 1 Arg3183fs 1 Pathog 9547delC Deletion / Inse 2 7 8 33X enic (1 rtion

[5751] 5 3 ) 1 3

[5752] 6 EX2 1 Arg3183Gl Nontruncatin Likely 9548G> A

[5753] 2 7 8 n g: Missense Benign (2 6 3 ) 1 3

[5754] 2 6 EX2 1 Truncating: Pathog 9555G> A Trp3185X

[5755] 2 7 8 Nonsense enic (1 7 5 ) 1 3

[5756] Likely 2 6 EX2 1 Nontruncatin

[5757] 9556C>T His3186Tyr Pathog 2 7 8 g: Missense (1 enic

[5758]

[5759] 8 6 )

[5760] 156

[5761] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5762] 1 3

[5763] Likely 1 6 EX2 1 His3186Gl Nontruncatin

[5764] 9558C>G Pathog 2 7 8 n g: Missense (1 enic

[5765] 9 6 ) 1 3

[5766] 1 6 EX2 1 Asp3187Gl Nontruncatin

[5767] 9561C>A VUS

[5768] 3 7 8 u g: Missense (1 0 7 ) 1 3 Nontruncatin

[5769] Likely 3 6 EX2 1

[5770] 9562_9564delAAC Asn3188 del g: Pathog 3 7 8 Deletion / Inse (2 enic

[5771] 1 8 rtion ) 1 3

[5772] 1 6 EX2 1 Asn3188As Nontruncatin

[5773] 9562A> G VUS

[5774] 3 7 8 P g: Missense (1 2 8 ) 1 3

[5775] 1 6 EX2 1 Asn3188Se Nontruncatin

[5776] 9563A> G VUS

[5777] 3 7 8 r g: Missense (1 3 8 ) 1 3

[5778] Likely 1 6 EX2 1 Nontruncatin

[5779] 9563A> T Asn3188Ile Pathog 3 7 8 g: Missense (1 enic

[5780] 4 8 ) 1 3 Nontruncatin

[5781] Likely 2 6 EX2 1

[5782] 9564_9566delCAA Lys3189del g: Pathog 3 7 8 Deletion / Inse (1 enic

[5783] 5 9 rtion ) 1 3

[5784] 1 6 IVS 1 Leu3196fs Pathog 9568+lG> A Splice

[5785] 3 27 8 Truncating: enic (1 6 9 ) 1 3

[5786] 6 IVS 1 Likely Likely 9569-13T> C Silent

[5787] 3 27 8 Silent IVS Benign (7 7 9 ) 1 3

[5788] 6 IVS 1 Likely Likely 9569-11C>T Silent

[5789] 3 27 8 Silent IVS Benign (1 8 9 ) 1 3

[5790] 1 6 IVS 1 Leu3196fs Pathog 9569-2A> G Splice

[5791] 3 27 8 Truncating: enic (1

[5792]

[5793] 9 9 )

[5794] 157

[5795] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5796] 1 3

[5797] 6 EX2 1 Leu3191Le Likely 9573C>G Synonymous 4 8 9 u Benign (1 0 1 ) 1 3

[5798] 1 6 EX2 1 Nontruncatin

[5799] 9577C>G Pro3193Ala VUS

[5800] 4 8 9 g: Missense (1 1 3 ) 1 3

[5801] Likely 1 6 EX2 1 Nontruncatin

[5802] 9577C>T Pro3193Ser Pathog 4 8 9 g: Missense (1 enic

[5803] 2 3 ) 1 3

[5804] Likely 2 6 EX2 1 Pro3193Le Nontruncatin

[5805] 9578C>T Pathog 4 8 9 u g: Missense (2 enic

[5806] 3 3 ) 1 3

[5807] 1 6 EX2 1 Truncating: Pathog 9592C>T Gln3198X

[5808] 4 8 9 Nonsense enic (1 4 8 ) 1 3

[5809] 3 6 EX2 2 Truncating: Pathog 9616C>T Gln3206X

[5810] 4 8 0 Nonsense enic (3 5 6 ) 1 3

[5811] 6 EX2 2 Thr3207Me Nontruncatin Likely 9620C>T

[5812] 4 8 0 t g: Missense Benign (2 6 7 ) 1 3

[5813] 6 EX2 2 Arg3209Cy Nontruncatin Likely 9625C>T

[5814] 4 8 0 s g: Missense Benign (1 7 9 ) 1 3

[5815] 6 EX2 2 Arg3209Hi Nontruncatin Likely 9626G> A

[5816] 4 8 0 s g: Missense Benign (1 8 9 ) 1 EX2 3

[5817] GArg3209 Likely 1 6 8- 2 9626G> A, 9631G> A, 9714 Nontruncatin His, Ala321 Pathog 4 EX3 0 C> T,9715G> C,9726T> g: Missense (1

[5818] IThr, S enic

[5819] 9 2 9 ) 1 3

[5820] 6 EX2 2 Ala3211Th Nontruncatin Likely 9631G> A

[5821] 5 8 1 r g: Missense Benign (1

[5822]

[5823] 0 1 )

[5824] 158

[5825] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5826] 1 3

[5827] 6 EX2 2 Phe3212Ph Likely 9636C>T Synonymous 5 8 1 e Benign (1 1 2 ) 1 3

[5828] Truncating: 1 6 EX2 2 Phe3212fsl Pathog 9636delC Deletion / Inse 5 8 1 03X enic (1 rtion

[5829] 2 2 ) 1 3

[5830] 6 EX2 2 Phe3213Ph Likely 9639C>T Synonymous 5 8 1 e Benign (1 3 3 ) 1 3

[5831] 6 EX2 2 Leu3214Le Likely 9640C>T Synonymous 5 8 1 u Benign (1 4 4 ) 1 3

[5832] Likely 1 6 EX2 2 Nontruncatin

[5833] 9647A> T Asn3216Ile Pathog 5 8 1 g: Missense (1 enic

[5834] 5 6 ) 1 3

[5835] 1 6 EX2 2 Truncating: Pathog 9654G> A Trp3218X

[5836] 5 8 1 Nonsense enic (1 6 8 ) 1 3

[5837] Truncating: 2 6 EX2 2 Ser3220fs9 Pathog 9658delT Deletion / Inse 5 8 2 5X enic (2 rtion

[5838] 7 0 ) 1 3

[5839] 6 EX2 2 Thr3223Th Likely 9669G> A Synonymous 5 8 2 r Benign (6 8 3 ) 1 3 Nontruncatin 9674_9700delCCAACGG AAla3225_ 1 6 EX2 2

[5840] GG C T G G A g: Pathog G C G T G GA Glu3233del

[5841] 5 8 2 Deletion / Inse enic (1

[5842] (SEQ ID NO:54) 9

[5843] 9 5 rtion ) 1 3

[5844] Truncating: 1 6 EX2 2 Gly3228fs8 Pathog 9683delG Deletion / Inse 6 8 2 7X enic (1 rtion

[5845] 0 8 ) 1 3 Nontruncatin

[5846] Likely 1 6 EX2 2

[5847] 9694_9696delAAG Lys3232del g: Pathog 6 8 3 Deletion / Inse (1 enic

[5848]

[5849] 1 2 rtion )

[5850] 159

[5851] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5852] 1 3

[5853] 1 6 EX2 2 Lys3232Gl Nontruncatin

[5854] 9694A> G

[5855] 6 8 3 u g: Missense vus (1 2 2 ) 1 3

[5856] Likely 1 6 EX2 2 Glu3233Va Nontruncatin

[5857] 9698A> T Pathog 6 8 3 1 g: Missense (1 enic

[5858] 3 3 ) 1 3

[5859] 1 6 IVS 2 Ser3238fs Pathog 9712+1G> T Splice

[5860] 6 28 3 Truncating: enic (1 4 8 ) 1 3

[5861] 6 IVS 2 Likely Likely 9712+30T> G Silent

[5862] 6 28 3 Silent IVS Benign (1 5 8 ) 1 3

[5863] 6 IVS 2 Likely Likely 9713-22T> G Silent

[5864] 6 28 3 Silent IVS Benign (1 6 8 ) 1 3

[5865] 6 IVS 2 Likely Likely 9713-21G> A Silent

[5866] 6 28 3 Silent IVS Benign (1 7 8 ) 1 3

[5867] 6 IVS 2 Likely Likely 9713-20C>T Silent

[5868] 6 28 3 Silent IVS Benign (1 8 8 ) 1 3

[5869] 6 IVS 2 Likely Likely 9713-17C>G Silent

[5870] 6 28 3 Silent IVS Benign (1 9 8 ) 1 3

[5871] 6 EX2 2 Likely 9714C>T Ser3238Ser Synonymous 7 9 3 Benign (1 0 8 ) 1 3

[5872] 6 EX2 2 Ala3240Th Nontruncatin Likely 9718G> A

[5873] 7 9 4 r g: Missense Benign (1 1 0 ) 1 3

[5874] 6 EX2 2 Leu3242Le Likely 9726T> G Synonymous 7 9 4 u Benign (1

[5875]

[5876] 2 2 )

[5877] 160

[5878] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5879] 1 3

[5880] 6 EX2 2 Arg3244Hi Nontruncatin Likely 9731G> A

[5881] 7 9 4 s g: Missense Benign (1 3 4 ) 1 3

[5882] 1 6 EX2 2 Arg3244Cy Nontruncatin

[5883] 9730C>T VUS

[5884] 7 9 4 s g: Missense (1 4 4 ) 1 3

[5885] 6 EX2 2 Arg3247Hi Nontruncatin Likely 9740G> A

[5886] 7 9 4 s g: Missense Benign (2 5 7 ) 1 3

[5887] 6 EX2 2 Arg3255Ar Likely 9765T> C Synonymous 7 9 5 ( g Benign 1 6 5 ) 1 3

[5888] Likely 1 6 EX2 2 Trp3263Ar Nontruncatin

[5889] 9787T> C Pathog 7 9 6 ( g g: Missense 1 enic

[5890] 7 3 ) 1 3

[5891] Likely 1 6 EX2 2 Trp3263Cy Nontruncatin

[5892] 9789G> T Pathog 7 9 6 s g: Missense (1 enic

[5893] 8 3 ) 1 3

[5894] 6 EX2 2 Leu3264Le Likely 9792C>T Synonymous 7 9 6 u Benign (1 9 4 ) 1 3

[5895] Likely 1 6 EX2 2 Nontruncatin

[5896] 9794C>T Ser3265Phe Pathog 8 9 6 g: Missense (1 enic

[5897] 0 5 ) 1 3

[5898] 6 EX2 2 Likely 9795C>T Ser3265Ser Synonymous 8 9 6 Benign (4 1 5 ) 1 3

[5899] 1 6 EX2 2 Truncating: Pathog 9801G> A Trp3267X

[5900] 8 9 6 Nonsense enic (1 2 7 ) 1 3

[5901] Truncating: 1 6 EX2 2 Ser3273fs4 Pathog 9817delA Deletion / Inse 8 9 7 2X enic (1 rtion

[5902]

[5903] 3 3 )

[5904] 161

[5905] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5906] 1 3

[5907] 8 6 EX2 2 Arg3277Cy Nontruncatin

[5908] 9829C>T

[5909] 8 9 7 s g: Missense vus (4 4 7 ) 1 3

[5910] Truncating: 1 6 EX2 2 Ala3281fs3 Pathog 9843_9844insGGCC Deletion / Inse 8 9 8 2X enic (1 rtion

[5911] 5 1 ) 1 3

[5912] 6 EX2 2 Nontruncatin Likely 9853G> A Val3285Ile

[5913] 8 9 8 g: Missense Benign (1 6 5 ) 1 3 Nontruncatin

[5914] Likely 8 6 EX2 2

[5915] 9859_9861delCTC Leu3287del g: Pathog 8 9 8 Deletion / Inse (5 enic

[5916] 7 7 rtion ) 1 3

[5917] 1 6 EX2 2 Asn3295Se Nontruncatin

[5918] 9884A> G VUS

[5919] 8 9 9 r g: Missense (1 8 5 ) 1 3

[5920] Likely 1 6 EX2 2 Asn3295Ly Nontruncatin

[5921] 9885C>A Pathog 8 9 9 s g: Missense (1 enic

[5922] 9 5 ) 1 3

[5923] 6 EX2 2 Ala3296Al Likely 9888C>T Synonymous 9 9 9 a Benign (1 0 6 ) 1 3

[5924] 2 6 EX2 2 Truncating: Pathog 9894G> A Trp3298X

[5925] 9 9 9 Nonsense enic (2 1 8 ) 1 3

[5926] 1 6 EX2 3 Gly3300Ar Nontruncatin

[5927] 9898G> A VUS

[5928] 9 9 0 ( g g: Missense 1 2 0 ) 1 3

[5929] 6 IVS 3 Likely Likely 9923+35G> T Silent

[5930] 9 29 0 Silent IVS Benign (1 3 8 ) 1 3

[5931] 6 IVS 3 Likely Likely 9924-19OT Silent

[5932] 9 29 0 Silent IVS Benign (1

[5933]

[5934] 4 8 )

[5935] 162

[5936] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5937] 1 3

[5938] 6 IVS 3 Indetermin Likely 9924-11C>T Silent

[5939] 9 29 0 ate IVS Benign (1 5 8 ) 1 3

[5940] 6 IVS 3 Likely Likely 9924-9_-7delTCC Silent

[5941] 9 29 0 Silent IVS Benign (1 6 8 ) 1 3

[5942] Likely 1 6 IVS 3 Likely

[5943] 9924-3C>G Silent Pathog 9 29 0 Silent IVS (1 enic

[5944] 7 8 ) 1 3

[5945] 1 6 IVS 3 Ser3308fs Pathog 9924-2A> T Splice

[5946] 9 29 0 Truncating: enic (1 8 8 ) 1 3

[5947] 1 6 IVS 3 Ser3308fs Pathog 9924- 1G> A Splice

[5948] 9 29 0 Truncating: enic (1 9 8 ) 1 3

[5949] 1 7 IVS 3 Ser3308fs Pathog 9924-lG> C Splice

[5950] 0 29 0 Truncating: enic (1

[5951]

[5952] 0 8 )

[5953] 1 3 1 7 EX3 3 Thr3309M Nontruncatin

[5954] 9926OT

[5955] 0 0 0 et g: Missense vus (

[5956] 1 1 9 ) 1 3

[5957] 7 EX3 3 His3311Ar Nontruncatin Likely 9932A> G ( 0 0 1 g g: Missense Benign 1 2 1 ) 1 3 1

[5958] Truncating:

[5959] 7 EX3 3 Ser3319fs6 Pathog 9957_9958delCG Deletion / Inse ( 0 0 1 9X enic 1 rtion

[5960] 3 9 ) 1 3

[5961] 7 EX3 3 Ser3319Se Likely 9957OT Synonymous ( 0 0 1 r Benign 4 4 9 ) 1 3 1

[5962] Likely 7 EX3 3 Gly3326Ar Nontruncatin

[5963] 9976G> C Pathog ( 0 0 2 g g: Missense 1 enic

[5964]

[5965] 5 6 )

[5966] 163

[5967] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5968] 1 3 1

[5969] Truncating:

[5970] 7 EX3 3 9978_9985delCCTGGTGTi Gly3326fs Pathog Deletion / Inse ( 0 0 2 nsACA 61X enic 1 rtion

[5971] 6 6 ) 1 3

[5972] 7 EX3 3 Ser3330Th Nontruncatin Likely 9989G> C ( 0 0 3 r g: Missense Benign 1 7 0 ) 1 3

[5973] 7 EX3 3 Leu3341Le Likely 10023T> C Synonymous ( 0 0 4 u Benign 2 8 1 ) 1 3 1

[5974] Truncating:

[5975] 7 EX3 3 Phe3342fs Pathog 10026delT Deletion / Inse ( 0 0 4 54X enic 1 rtion

[5976] 9 2 ) 1 3 1

[5977] Truncating:

[5978] 7 EX3 3 Leu3343fs Pathog 10028delT Deletion / Inse ( 1 0 4 52X enic 1 rtion

[5979] 0 3 ) 1 3 1

[5980] Truncating:

[5981] 7 EX3 3 Leu3343fs Pathog 10029delC Deletion / Inse ( 1 0 4 53X enic 1 rtion

[5982] 1 3 ) 1 3 2 7 EX3 3 Arg3348Gl Nontruncatin

[5983] 10044G> A VUS ( 1 0 4 n g: Missense 3 2 8 ) 1 3

[5984] 7 EX3 3 Arg3348Ar Likely 10044G> T Synonymous ( 1 0 4 g Benign 1 3 8 ) 1 3 2

[5985] Thr3308fs

[5986] 7 IVS3 3 Pathog 10050+lG> A Truncating Splice ( 1 0 5 enic 2 4 0 ) 1 3

[5987] 7 IVS3 3 Likely Likely 10050+54A> C Silent ( 1 0 5 Silent IVS Benign 1 5 0 ) 1 3

[5988] 7 IVS3 3 Likely Likely 10050+54A> G Silent ( 1 0 5 Silent IVS Benign 3 6 0 ) 1 IVS3 3 Likely Likely 10050+62T> C Silent

[5989]

[5990] 7 0 3 Silent IVS Benign (

[5991] 164

[5992] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[5993] 1 5 1 7 0 ) 1 3

[5994] 7 IVS3 3 Likely Likely 10050+65G> A Silent ( 1 0 5 Silent IVS Benign 1 8 0 ) 1 IVS3 3 Truncating: 1 7 0- 3 Large Pathog 10051_10496del446* Lys3350fs ( 1 IVS3 5 Rearrangeme enic 1 9 4 0 nt ) 1 3

[5995] 7 IVS3 3 Likely Likely 10051-25G> A Silent ( 2 0 5 Silent IVS Benign 1 0 0 ) 1 3

[5996] 7 IVS3 3 Likely Likely 10051-12C>G Silent ( 2 0 5 Silent IVS Benign 1 1 0 ) 1 3 1 7 EX3 3 Pro3355Le Nontruncatin

[5997] 10064C>T VUS ( 2 1 5 u g: Missense 1 2 5 ) 1 3 1

[5998] Truncating:

[5999] 7 EX3 3 Pro3359fs3 Pathog 10076delC Deletion / Inse ( 2 1 5 8X enic 1 rtion

[6000] 3 9 ) 1 3 1 7 EX3 3 Truncating: Pathog 10084C>T Gln3362X ( 2 1 6 Nonsense enic 1 4 2 ) 1 3 1 7 EX3 3 Truncating: Pathog 10087C>T Gln3363X ( 2 1 6 Nonsense enic 1 5 3 ) 1 3

[6001] 7 EX3 3 Nontruncatin Likely 10099A> G Ile3367Val ( 2 1 6 g: Missense Benign 1 6 7 ) 1 3

[6002] 7 EX3 3 Asp3368A Nontruncatin Likely 10102G> A ( 2 1 6 sn g: Missense Benign 1 7 8 ) 1 3

[6003] 7 EX3 3 Asp3372A Likely 10114G> A Synonymous ( 2 1 7 sp Benign 1

[6004]

[6005] 8 2 )

[6006] 165

[6007] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6008] 1 3

[6009] 7 EX3 3 Val3375M Nontruncatin Likely 10123G> A ( 2 1 7 et g: Missense Benign 1 9 5 ) 1 3 1 7 EX3 3 Thr3382M Nontruncatin

[6010] 10145C>T VUS ( 3 1 8 et g: Missense 1 0 2 ) 1 3 1 7 EX3 3 Truncating: Pathog 10151C>G Ser3384X ( 3 1 8 Nonsense enic 1 1 4 ) 1 3

[6011] 7 EX3 3 His3387Hi Likely 10159C>G Synonymous ( 3 1 8 s Benign 1 2 7 ) 1 3

[6012] 7 EX3 3 Ala3388Al Likely 10163C>T Synonymous ( 3 1 8 a Benign 1 3 8 ) 1 3 1

[6013] Gln3390fs

[6014] 7 IVS3 3 Pathog 10167+2_+3delTG Nontruncat Splice ( 3 1 9 enic 1 ing:

[6015] 4 0 ) 1 3

[6016] 7 IVS3 3 Likely Likely 10167+7A> G Silent ( 3 1 9 Silent IVS Benign 1 5 0 ) 1 3

[6017] 7 IVS3 3 Likely Likely 10167+14T> C Silent ( 3 1 9 Silent IVS Benign 2 6 0 ) 1 3 4

[6018] 10167+25_+43delGGCTG Gln3390fs Likely 7 IVS3 3

[6019] GGCTGGGGGTCCTG Nontruncat Splice Pathog ( 3 1 9 4

[6020] (SEQ ID NO:55) ing: enic

[6021] 7 0 ) 1 3

[6022] 7 IVS3 3 Likely Likely 10167+37G> T Silent ( 3 1 9 Silent IVS Benign 1 8 0 ) 1 3

[6023] 7 IVS3 3 Likely Likely 10167+43G> A Silent ( 3 1 9 Silent IVS Benign 1 9 0 ) 1 IVS3 3 Likely Likely 10167+45C>T Silent

[6024]

[6025] 7 1 3 Silent IVS Benign (

[6026] 166

[6027] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6028] 4 9 1 0 0 ) 1 3 1

[6029] Gln3390fs

[6030] 7 IVS3 3 Pathog 10168-8_-2delCCTCTCA Nontruncat Splice ( 4 1 9 enic 1 ing:

[6031] 1 0 ) 1 3

[6032] 7 IVS3 3 Likely Likely 10168-8C>T Silent ( 4 1 9 Silent IVS Benign 1 2 0 ) 1 3 1 7 EX3 3 Truncating: Pathog 10168C>T Gln3390X ( 4 2 9 Nonsense enic 1 3 0 ) 1 3

[6033] 7 EX3 3 Ala3391Va Nontruncatin Likely 10173C>T ( 4 2 9 1 g: Missense Benign 1 4 1 ) 1 3 1

[6034] Truncating:

[6035] 7 EX3 3 Gly3394fs Pathog 10179_10180insT Deletion / Inse ( 4 2 9 6X enic 1 rtion

[6036] 5 4 ) 1 3 1 7 EX3 3 Truncating: Pathog 10183C>T Gln3395X ( 4 2 9 Nonsense enic 1 6 5 ) 1 EX3 3 ALys3406f 1

[6037] 10216 10220+20del AAGA

[6038] 7 2- 4 s Pathog GGTGGGTTCCCTAG Splice ( 4 IVS3 0 Nontruncat enic 1

[6039] (SEQ ID NO:56)

[6040] 7 2 6 ing: ) 1 3 1

[6041] Ser3407fs

[6042] 7 IVS3 4 Pathog 10220+1G>T Truncating Splice ( 4 2 0 enic 1 8 7 ) 1 3 1 7 IVS3 4 Unknown

[6043] 10220+6T> A Unknown VUS ( 4 2 0 IVS 1 9 7 ) 1 3

[6044] 7 IVS3 4 Likely Likely 10220+33G> A Silent ( 5 2 0 Silent IVS Benign 1 0 7 ) 1 3

[6045] 7 IVS3 4 Likely Likely 10220+36G> C Silent ( 5 2 0 Silent IVS Benign 1

[6046]

[6047] 1 7 )

[6048] 167

[6049] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6050] 1 3

[6051] 7 IVS3 4 Likely Likely 10221-14OT Silent ( 5 2 0 Silent IVS Benign 1 2 7 ) 1 3

[6052] 7 EX3 4 Val3409Le Nontruncatin Likely 10225G> C ( 5 3 0 u g: Missense Benign 5 3 9 ) 1 3 1 7 EX3 4 Trp3411Cy Nontruncatin

[6053] 10233G>T VUS ( 5 3 1 s g: Missense 1 4 1 ) 1 3

[6054] 7 EX3 4 Pro3412Se Nontruncatin Likely 10234C>T ( 5 3 1 r g: Missense Benign 2 5 2 ) 1 3

[6055] 7 EX3 4 Gly3414Se Nontruncatin Likely 10240G> A ( 5 3 1 r g: Missense Benign 2 6 4 ) 1 3 1 7 EX3 4 Glu3415Ly Nontruncatin

[6056] 10243G> A VUS ( 5 3 1 s g: Missense 1 7 5 ) 1 3

[6057] 7 EX3 4 Thr3417Th Likely 10251G> A Synonymous ( 5 3 1 r Benign 2 8 7 ) 1 3 1

[6058] Truncating:

[6059] 7 EX3 4 Leu3418fs Pathog 10253_10254insT Deletion / Inse ( 5 3 1 8X enic 1 rtion

[6060] 9 8 ) 1 3 1 7 EX3 4 Truncating: Pathog 10260G> A Trp3420X ( 6 3 2 Nonsense enic 1 0 0 ) 1 3

[6061] 7 EX3 4 Val3430Va Likely 10290G> A Synonymous ( 6 3 3 1 Benign 1 1 0 ) 1 3

[6062] 7 EX3 4 Leu3434Le Likely 10300C>T Synonymous ( 6 3 3 u Benign 1 2 4 ) 1 EX3 3 Arg3435Gl Nontruncatin Likely

[6063] 10304G> A

[6064]

[6065] 7 3 4 n g: Missense Benign (

[6066] 168

[6067] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6068] 6 3 4 3 5 ) 1 3

[6069] 7 EX3 4 Ala3442Va Nontruncatin Likely 10325C>T ( 6 3 4 1 g: Missense Benign 1 4 2 ) 1 3

[6070] 7 EX3 4 Ala3442Al Likely 10326G> A Synonymous ( 6 3 4 a Benign 1 5 2 ) 1 3 1

[6071] Truncating:

[6072] 7 EX3 4 Leu3446fs Pathog 10335delG Deletion / Inse ( 6 3 4 27X enic 1 rtion

[6073] 6 6 ) 1 3 1

[6074] 10337 10338insGGGCCA Truncating:

[6075] 7 EX3 4 CLeu3446f Pathog GGCGGGCCATGGG Deletion / Inse ( 6 3 4 s enic 1

[6076] (SEQ ID NO:57) rtion

[6077] 7 6 ) 1 3 1

[6078] Truncating:

[6079] 7 EX3 4 Pro3448fs2 Pathog 10343delC Deletion / Inse ( 6 3 4 5X enic 1 rtion

[6080] 8 8 ) 1 EX3 3 1

[6081] Truncating:

[6082] 7 3- 4 Pathog 10345_10406-24dell 15 Glu3449fs Deletion / Inse ( 6 IVS3 4 enic 1 rtion

[6083] 9 3 9 ) 1 3

[6084] 7 EX3 4 Gly3452Se Nontruncatin Likely 10354G> A ( 7 3 5 r g: Missense Benign 1 0 2 ) 1 3

[6085] 7 EX3 4 Leu3455Le Likely 10363C>T Synonymous ( 7 3 5 u Benign 1 1 5 ) 1 3

[6086] 7 EX3 4 Ala3456Al Likely 10368C>T Synonymous ( 7 3 5 a Benign 5 2 6 ) 1 3 1

[6087] Truncating:

[6088] 7 EX3 4 Tyr3459fs Pathog 10374_10375insC Deletion / Inse ( 7 3 5 12X enic 1 rtion

[6089] 3 9 ) 1 3 1 7 EX3 4 Truncating: Pathog 10377C>G Tyr3459X ( 7 3 5 Nonsense enic 1

[6090]

[6091] 4 9 )

[6092] 169

[6093] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6094] 1 3

[6095] 7 EX3 4 Ser3460Se Likely 10380G> T Synonymous ( 7 3 6 r Benign 1 5 0 ) 1 3

[6096] 7 EX3 4 Lys3463Gl Nontruncatin Likely 10387A> G ( 7 3 6 u g: Missense Benign 1 6 3 ) 1 3

[6097] 7 EX3 4 Ala3467Va Nontruncatin Likely 10400C>T ( 7 3 6 1 g: Missense Benign 1 7 7 ) 1 3 1 7 EX3 4 Truncating: Pathog 10403C>G Ser3468X ( 7 3 6 Nonsense enic 1 8 8 ) 1 3 1 7 EX3 4 Asp3469A Nontruncatin

[6098] 10405G> A

[6099] 7 3 6 sn g: Missen vus ( se 1 9 9 ) 1 3 1

[6100] Likely 7 EX3 4 Asp3469T Nontruncatin

[6101] 10405G> T Pathog ( 8 3 6 yr g: Missense 1 enic

[6102] 0 9 ) 1 3 1

[6103] Asp3469fs

[6104] 7 IVS3 4 Pathog 10405+1G>T Truncating Splice ( 8 3 6 enic 1 1 9 ) 1 3 1

[6105] Asp3469fs Likely 7 IVS3 4

[6106] 10405+5G> T Nontruncat Splice Pathog ( 8 3 6 1 ing: enic

[6107] 2 9 ) 1 3

[6108] 7 IVS3 4 Likely Likely 10405+22G> A Silent ( 8 3 6 Silent IVS Benign 1 3 9 ) 1 3

[6109] 7 IVS3 4 Likely Likely 10406-4C>T Silent ( 8 3 6 Silent IVS Benign 1 4 9 ) 1 3 1

[6110] Asp3469fs

[6111] 7 IVS3 4 Pathog 10406-1G>C Truncating Splice ( 8 3 6 enic 1

[6112]

[6113] 5 9 )

[6114] 170

[6115] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6116] 1 3 1

[6117] Truncating:

[6118] 7 EX3 4 Glu3470fs Pathog 10408_10409insT Deletion / Inse ( 8 4 7 156X enic 1 rtion

[6119] 6 0 ) 1 3 1 7 EX3 4 Truncating: Pathog 10420C>T Gln3474X ( 8 4 7 Nonsense enic 1 7 4 ) 1 3 3 7 EX3 4 Truncating: Pathog 10423C>T Gln3475X ( 8 4 7 Nonsense enic 3 8 5 ) 1 3 1

[6120] 10426 10448delGTCCTTG Truncating:

[6121] 7 EX3 4 CVal3476f Pathog CCGAGGGGGTCAG Deletion / Inse ( 8 4 7 S142X enic 1

[6122] (SEQ ID NO:58) rtion

[6123] 9 6 ) 1 3

[6124] 7 EX3 4 Leu3477Le Likely 10431C>T Synonymous ( 9 4 7 u Benign 1 0 7 ) 1 3

[6125] 7 EX3 4 Ala3478Al Likely 10434C>T Synonymous ( 9 4 7 a Benign 1 1 8 ) 1 3

[6126] 7 EX3 4 Glu3479As Nontruncatin Likely 10437G> C ( 9 4 7 P g: Missense Benign 1 2 9 ) 1 3 1

[6127] Truncating:

[6128] 7 EX3 4 Val3481fs Pathog 10441_10442insG Deletion / Inse ( 9 4 8 146X enic 1 rtion

[6129] 3 1 ) 1 3 1

[6130] Truncating:

[6131] 7 EX3 4 Val3481fs Pathog 10441_10442insGG Deletion / Inse ( 9 4 8 47X enic 1 rtion

[6132] 4 1 ) 1 3

[6133] 7 EX3 4 Ser3483Se Likely 10449C>T Synonymous ( 9 4 8 r Benign 1 5 3 ) 1 3 1 7 EX3 4 Truncating: Pathog 10462C>T Gln3488X ( 9 4 8 Nonsense enic 1

[6134]

[6135] 6 8 )

[6136] 171

[6137] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6138] 1 3 1

[6139] Truncating:

[6140] 7 EX3 4 Gln3488fs Pathog 10463_10464insC Deletion / Inse ( 9 4 8 138X enic 1 rtion

[6141] 7 8 ) 1 3 1

[6142] Truncating:

[6143] 7 EX3 4 Gln3488fs Pathog 10464delA Deletion / Inse ( 9 4 8 39X enic 1 rtion

[6144] 8 8 ) 1 3

[6145] 7 EX3 4 Asp3495Gl Nontruncatin Likely 10485C>A ( 9 4 9 u g: Missense Benign 1 9 5 ) 1 3

[6146] 8 IVS3 5 Likely Likely 10499+18G> A Silent ( 0 4 0 Silent IVS Benign 1

[6147]

[6148] 0 0 ) 1 3

[6149] Likely 8 IVS 5 Likely Silent

[6150] 10499+20G> A Silent Benig 0 34 0 IVS (1 n

[6151] 1 0 ) 1 IVS 3 Truncating:

[6152] 1 8 34- 5 Large Pathog 10499 3'UTRdel Leu3500fs

[6153] 0 EX4 0 Rearrangem enic (1 2 6 0 ent ) 1 IVS 3

[6154] Ala3757_Ala3 3 8 39- 7 Pathog 11270-25 11316del72 773dell7 Splice

[6155] 0 EX4 5 enic (3

[6156] Nontruncating:

[6157] 3 0 7 ) 1 3

[6158] 1 8 IVS 5 Leu3500fs Pathog 10500-1G>A Splice

[6159] 0 34 0 Truncating: enic (1 4 0 ) 1 EX3 3 Truncating:

[6160] 1 8 5- 5 Large Pathog 10500_3'UTRdel Leu3500fs

[6161] 0 EX4 0 Rearrangem enic (1 5 6 0 ent ) 1 3

[6162] Truncating: 1 8 EX3 5 Pathog 10516delG Glu3506fs20X Deletion / Ins 0 5 0 enic (1 ertion

[6163] 6 6 ) 1 3

[6164] Truncating: 2 8 EX3 5 Glu3509fsll6 Pathog 10527 10528delGA Deletion / Ins 0 5 0 X enic (2 ertion

[6165]

[6166] 7 9 )

[6167] 172

[6168] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6169] 1 3

[6170] Likely 8 EX3 5 Nontruncatin 10529C>T Thr3510Met Benig 0 5 1 g: Missense (1 n

[6171] 8 0 0) 1 3

[6172] Likely 8 EX3 5 Nontruncatin 10531C>G Leu3511Val Benig 0 5 1 g: Missense (3 n

[6173] 9 1 ) 1 3

[6174] Likely 8 EX3 5 Nontruncatin 10535C>T Ala3512Val Benig 1 5 1 g: Missense (9 n

[6175] 0 2 ) 1 3

[6176] 4 8 EX3 5 Truncating: Pathog 10540C>T Gln3514X

[6177] 1 5 1 Nonsense enic (2 1 4 ) 1 3 Nontruncatin

[6178] 1 8 EX3 5 Gly3517_Glu3

[6179] 10550_10551insCCA § VUS 1 5 1 518insPro Deletion / Ins (1 2 7 ertion ) 1 3 Nontruncatin

[6180] 1 8 EX3 5 10556 10565dell0insAG Leu3519 Vai 3 g: VUS 1 5 1 TT 522delLeu G Deletion / Ins (1 3 9 ertion ) 1 3

[6181] 2 8 EX3 5 Truncating: Pathog 10588C>T Gln3530X

[6182] 1 5 3 Nonsense enic (2 4 0 ) 1 3

[6183] 1 8 EX3 5 Nontruncatin 10598C>G Ala3533Gly VUS 1 5 3 g: Missense (1 5 3 ) 1 3

[6184] Likely 8 EX3 5

[6185] 10602G> A Ala3534Ala Synonymous Benig 1 5 3 (1 n

[6186] 6 4 ) 1 3

[6187] Likely 1 8 EX3 5 Nontruncatin 10618G> C Gly3540Arg Pathog 1 5 4 g: Missense (1 enic

[6188] 7 0 ) 1 3

[6189] 1 8 IVS 5 Gly3540fs Pathog 10618+2T> C Splice

[6190] 1 35 4 Truncating: enic (1

[6191]

[6192] 8 0 )

[6193] 173

[6194] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6195] 1 3

[6196] delCCCinsAA Likely 8 IVS 5

[6197] 10618+16_+18 A Likely Silent Benig 1 35 4 (1

[6198] Silent IVS n

[6199] 9 0 ) 1 3

[6200] 1 8 IVS 5 Likely Silent

[6201] 10619-45_-29dell7 Unknown VUS 2 35 4 IVS (1 0 0 ) 1 3

[6202] Likely 8 IVS 5 Likely Silent

[6203] 10619-14C>T Silent Benig 2 35 4 IVS (2 n

[6204] 1 0 ) 1 3

[6205] Likely 8 IVS 5 Likely Silent

[6206] 10619-13delT Silent Benig 2 35 4 IVS (1 n

[6207] 2 0 ) 1 3

[6208] 1 8 IVS 5 Gly3540fs Pathog 10619-2A> G Splice

[6209] 2 35 4 Truncating: enic (1 3 0 ) 1 3

[6210] Likely 8 EX3 5 Nontruncatin 10619G> C Gly3540Ala Benig 2 6 4 g: Missense (1 n

[6211] 4 0 ) 1 3

[6212] Truncating: 1 8 EX3 5 Pathog 10634_10637delTGCG Leu3545fs39X Deletion / Ins 2 6 4 enic (1 ertion

[6213] 5 5 ) 1 3

[6214] 1 8 EX3 5 Nontruncatin 10642C>T Arg3548Cys VUS 2 6 4 g: Missense (1 6 8 ) 1 3

[6215] Likely 8 EX3 5

[6216] 10656C>G Ala3552Ala Synonymous Benig 2 6 5 (1 n

[6217] 7 2 ) 1 3

[6218] 1 8 EX3 5 Nontruncatin 10667C> T Ser3556Phe VUS 2 6 5 g: Missense (1 8 6 ) 1 3

[6219] Likely 8 EX3 5

[6220] 10674C>T Ala3558Ala Synonymous Benig 2 6 5 (1 n

[6221]

[6222] 9 8 )

[6223] 174

[6224] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6225] 1 3

[6226] Truncating: 1 8 EX3 5 Pathog 10676_10677insl3 His3559fs70X Deletion / Ins 3 6 5 enic (1 ertion

[6227] 0 9 ) 1 3

[6228] Likely 8 EX3 5 Nontruncatin 10676A> C His3559Pro Benig 3 6 5 g: Missense (1 n

[6229] 1 9 ) 1 3

[6230] Likely 8 EX3 5 Nontruncatin 10678G> A Gly3560Arg Benig 3 6 6 g: Missense (3 n

[6231] 2 0 ) 1 3

[6232] 1 8 EX3 5 Nontruncatin 10682T> C Leu3561Pro VUS 3 6 6 g: Missense (1 3 1 ) 1 3

[6233] 1 8 EX3 5 Nontruncatin 10685G> A Ser3562Asn VUS 3 6 6 g: Missense (1 4 2 ) 1 3 Nontruncatin

[6234] Likely 1 8 EX3 5 10693 10696delCTGGin Leu3565 Val3 g: Pathog 3 6 6 sA 566del2ins Deletion / Ins (1 enic

[6235] 5 5 ertion ) 1 3

[6236] 10701 10720delTGTGG Truncating: 1 8 EX3 5 Pathog CTGTGGCTGTCTCAG Ala3569fs51X Deletion / Ins 3 6 6 enic (1

[6237] (SEQ ID NO:59) ertion

[6238] 6 9 ) 1 3 Nontruncatin

[6239] Likely 1 8 EX3 5 Ala3571 Val3

[6240] 10710 10715del6 g: Pathog 3 6 7 572delAla V Deletion / Ins (1 enic

[6241] 7 1 ertion ) 1 3

[6242] 1 8 EX3 5 Truncating: Pathog 10718C>G Ser3573X

[6243] 3 6 7 Nonsense enic (1 8 3 ) 1 3

[6244] Truncating: 1 8 EX3 5 Pathog 10719 10720delAG Gly3574fs52X Deletion / Ins 3 6 7 enic (1 ertion

[6245] 9 4 ) 1 3

[6246] 10722_10732delGTGGG Truncating: 1 8 EX3 5 Pathog TGGGTG (SEQ ID Trp3575fs48X Deletion / Ins 4 6 7 enic (1

[6247] NO:60) ertion

[6248]

[6249] 0 5 )

[6250] 175

[6251] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 1 3

[6252] 1 8 EX3 5 Truncating: Pathog 10725G> A Trp3575X

[6253] 4 6 7 Nonsense enic (1 1 5 ) 1 3

[6254] Truncating: 1 8 EX3 5 Pathog 10739_10740insT Phe3580fs46X Deletion / Ins 4 6 8 enic (1 ertion

[6255] 2 0 ) 1 3

[6256] Truncating: 5 8 EX3 5 Pathog 10745_10746insC Val3584fs42X Deletion / Ins 4 6 8 enic (3 ertion

[6257] 3 2 ) 1 3

[6258] Truncating: 1 8 EX3 5 Pathog 10745delC Pro3582fs22X Deletion / Ins 4 6 8 enic (1 ertion

[6259] 4 2 ) 1 3

[6260] Truncating: 1 8 EX3 5 Pathog 10746_10747insC Val3584fs41X Deletion / Ins 4 6 8 enic (1 ertion

[6261] 5 2 ) 1 3

[6262] Likely 8 EX3 5

[6263] 10749C>T Gly3583Gly Synonymous Benig 4 6 8 (1 n

[6264] 6 3 ) 1 3 Nontruncatin

[6265] 1 8 EX3 5

[6266] 6 g: Pathog 10756_10757delGT Val3586fs39X

[6267] 4 6 8 Deletion / Ins enic (1 7 6 ertion ) 1 3

[6268] Likely 8 EX3 5 Nontruncatin 10765C>T Leu3589Phe Benig 4 6 8 g: Missense (1 n

[6269] 8 9 ) 1 3

[6270] 1 8 EX3 5 Nontruncatin 10768C>A Leu3590Met VUS 4 6 9 g: Missense (1 9 0 ) 1 3

[6271] Likely 8 EX3 5

[6272] 10768C>T Leu3590Leu Synonymous Benig 5 6 9 (6 n

[6273] 0 0 ) 1 3

[6274] Likely 8 EX3 5 Nontruncatin 10778G> T Ser3593Ile Benig 5 6 9 g: Missense (1 n

[6275] 1 3 )

[6276]

[6277] 176

[6278] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6279] 1 3

[6280] Truncating: 1 8 EX3 5 Pathog 10780_10781insG Ala3594fs34X Deletion / Ins 5 6 9 enic (1 ertion

[6281] 2 4 ) 1 3 Nontruncatin

[6282] Likely 1 8 EX3 5 10780_10785delGCCAG Ala3594_Ser3 g- Pathog 5 6 9 C 595del2 Deletion / Ins (1 enic

[6283] 3 4 ertion ) 1 3

[6284] Truncating: 1 8 EX3 5 Pathog 10789delC Leu3597fslOX Deletion / Ins 5 6 9 enic (1 ertion

[6285] 4 7 ) 1 3

[6286] 1 8 EX3 5 Truncating: Pathog 10796C>A Ser3599X

[6287] 5 6 9 Nonsense enic (1 5 9 ) 1 3

[6288] Likely 1 8 EX3 5 Nontruncatin 10796C>T Ser3599Leu Pathog 5 6 9 g: Missense (1 enic

[6289] 6 9 ) 1 3

[6290] 1 8 EX3 6 Nontruncatin 10804G> A Gly3602Ser VUS 5 6 0 g: Missense (1 7 2 ) 1 3

[6291] Likely 1 8 EX3 6 Nontruncatin 10807T> C Trp3603Arg Pathog 5 6 0 g: Missense (1 enic

[6292] 8 3 ) 1 3

[6293] 2 8 EX3 6 Truncating: Pathog 10808G> A Trp3603X

[6294] 5 6 0 Nonsense enic (3 9 3 ) 1 3

[6295] Likely 1 8 EX3 6 Nontruncatin 10810G> A Glu3604Lys Pathog 6 6 0 g: Missense (1 enic

[6296] 0 4 ) 1 3

[6297] 1 8 IVS 6 Lys3607fs Pathog 10821+2G> T Splice

[6298] 6 36 0 Truncating: enic (1 1 7 ) 1 3

[6299] Likely 8 IVS 6 Likely Silent

[6300] 10822-14C>T Silent Benig 6 36 0 IVS (1 n

[6301]

[6302] 2 7 )

[6303] 177

[6304] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6305] 1 3

[6306] Likely 8 IVS 6 Likely Silent

[6307] 10822-8C>G Silent Benig 6 36 0 IVS (1 n

[6308] 3 7 ) 1 3

[6309] Likely 8 IVS 6 Likely Silent

[6310] 10822-8C>T Silent Benig 6 36 0 IVS (1 n

[6311] 4 7 ) 1 3

[6312] Likely 8 IVS 6 Likely Silent

[6313] 10822-8delC Silent Benig 6 36 0 IVS (1 n

[6314] 5 7 ) 1 3

[6315] Val3905 Lys4 1 8 IVS 9 Pathog 11712+2T> G 001del97 Splice

[6316] 6 43 0 enic (1

[6317] Truncating:

[6318] 6 5 ) 1 3

[6319] Likely 8 IVS 6 Likely Silent

[6320] 10822-3delC Silent Benig 6 36 0 IVS (1 n

[6321] 7 7 ) 1 3

[6322] 1 8 EX3 6 Nontruncatin 10829T> C Leu3610Pro VUS 6 7 1 g: Missense (1 8 0 ) 1 3

[6323] Val3905 Lys4 Likely 4 8 IVS 9

[6324] 11712+14_+33del20 001del97 Splice Pathog 6 43 0 (4

[6325] Nontruncating: enic

[6326] 9 5 ) 1 3

[6327] Val3905 Lys4 Likely 1 8 IVS 9

[6328] 11712+17_+34del 18 001del97 Splice Pathog 7 43 0 (1

[6329] Nontruncating: enic

[6330] 0 5 ) 1 3

[6331] Truncating: 1 8 EX3 6 Pathog 10833delA Ala3612fs20X Deletion / Ins 7 7 1 enic (1 ertion

[6332] 1 2 ) 1 3

[6333] Likely 8 EX3 6

[6334] 10836C> G Ala3612Ala Synonymous Benig 7 7 1 (1 n

[6335] 2 2 ) 1 3

[6336] Likely 1 8 EX3 6 Nontruncatin 10840T> C Tyr3614His Pathog 7 7 1 g: Missense (1 enic

[6337]

[6338] 3 4 )

[6339] 178

[6340] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6341] 1 3

[6342] Likely 1 8 EX3 6 Nontruncatin 10850T> C Leu3617Pro Pathog 7 7 1 g: Missense (1 enic

[6343] 4 7 ) 1 3

[6344] Truncating: 1 8 EX3 6 Pathog 10857_10858insC Lys3620fs8X Deletion / Ins 7 7 2 enic (1 ertion

[6345] 5 0 ) 1 3

[6346] Likely 8 EX3 6

[6347] 10872G> A Pro3624Pro Synonymous Benig 7 7 2 (1 n

[6348] 6 4 ) 1 3

[6349] Truncating: 1 8 EX3 6 Pathog 10895_10898delAGAG Glu3632fs4X Deletion / Ins 7 7 3 enic (1 ertion

[6350] 7 2 ) 1 3

[6351] 1 8 EX3 6 Nontruncatin 10896G> C Glu3632Asp VUS 7 7 3 g: Missense (1 8 2 ) 1 3

[6352] Truncating: 1 8 EX3 6 Pathog 10897_10898delAG Ser3633fs88X Deletion / Ins 7 7 3 enic (1 ertion

[6353] 9 3 ) 1 3

[6354] Likely 8 EX3 6

[6355] 10908G> A Val3636Val Synonymous Benig 8 7 3 (1 n

[6356] 0 6 ) 1 3

[6357] Truncating: 1 8 EX3 6 Pathog 10933delC Arg3645fs38X Deletion / Ins 8 7 4 enic (1 ertion

[6358] 1 5 ) 1 3

[6359] Likely 1 8 EX3 6 Nontruncatin 10943C>T Pro3648Leu Pathog 8 7 4 g: Missense (1 enic

[6360] 2 8 ) 1 3

[6361] Truncating: 1 8 EX3 6 10945 10952delCCCCA Pathog Pro3649fs69X Deletion / Ins

[6362] 8 7 4 CGG enic (1 ertion

[6363] 3 9 ) 1 3 Nontruncatin

[6364] Likely 1 8 EX3 6 10948 10949delCinsGT His3650Pro G g: Pathog 8 7 5 GG ly3651ins V Deletion / Ins (1 enic )

[6365]

[6366] 4 0 ertion

[6367] 179

[6368] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6369] 1 3

[6370] Likely 7 8 EX3 6 Nontruncatin 10951G>A Gly3651 Ser Pathog 8 7 5 g: Missense (4 enic

[6371] 5 1 ) 1 3

[6372] Likely 1 8 EX3 6 Nontruncatin 10952G> A Gly3651Asp Pathog 8 7 5 g: Missense (1 enic

[6373] 6 1 ) 1 3

[6374] Likely 2 8 EX3 6 Nontruncatin 10958C>T Ala3653Val Pathog 8 7 5 g: Missense (1 enic

[6375] 7 3 ) 1 3

[6376] Likely 2 8 EX3 6 Nontruncatin 10960C>G Leu3654Val Pathog 8 7 5 g: Missense (2 enic

[6377] 8 4 ) 1 3

[6378] Truncating: 1 8 EX3 6 Pathog 10966delC Leu3656fs28X Deletion / Ins 8 7 5 enic (1 ertion

[6379] 9 6 ) 1 3

[6380] 1 8 EX3 6 Nontruncatin 10969G> C Ala3657Pro VUS 9 7 5 g: Missense (1 0 7 ) 1 3

[6381] Likely 1 8 EX3 6 Nontruncatin 10970C>A Ala3657Asp Pathog 9 7 5 g: Missense (1 enic

[6382] 1 7 ) 1 3

[6383] Truncating: 1 8 EX3 6 Pathog 10984delC Arg3662fs21X Deletion / Ins 9 7 6 enic (1 ertion

[6384] 2 2 ) 1 3

[6385] Truncating: 1 8 EX3 6 Pathog 11004_11005insT Gly3669fs53X Deletion / Ins 9 7 6 enic (1 ertion

[6386] 3 9 ) 1 3

[6387] Likely 8 EX3 6

[6388] 11007C>T Gly3669Gly Synonymous Benig 9 7 6 (1 n

[6389] 4 9 ) 1 3

[6390] Likely 8 EX3 6 Nontruncatin 11015G> A Arg3672Gln Benig 9 7 7 g: Missense (1 n

[6391]

[6392] 5 2 )

[6393] 180

[6394] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6395] 1 3

[6396] Likely 1 8 EX3 6 Nontruncatin 11015G> C Arg3672Pro Pathog 9 7 7 g: Missense (1 enic

[6397] 6 2 ) 1 3

[6398] 2 8 IVS 6 Arg3672fs Pathog 11O16+1G> A Splice

[6399] 9 37 7 Truncating: enic (1 7 2 ) 1 3

[6400] Likely 8 IVS 6 Likely Silent

[6401] 11016+35C>T Silent Benig 9 37 7 IVS (1 n

[6402] 8 2 ) 1 3

[6403] Likely 8 IVS 6 Likely Silent

[6404] 11016+36C>T Silent Benig 9 37 7 IVS (1 n

[6405] 9 2 ) 1 3

[6406] Likely 9 IVS 6 Likely Silent

[6407] 11016+42_+43delTT Silent Benig 0 37 7 IVS (2 n

[6408]

[6409] 0 2 )

[6410] 1 3

[6411] IV

[6412] 9 6 Likely Likely S3 11016+155C> G Silent ( 0 7 Silent IVS Benign 1 7

[6413] 1 2 ) 1 3

[6414] IV

[6415] 9 6 Likely Likely S3 11017-23C>G Silent ( 0 7 Silent IVS Benign 1 7

[6416] 2 2 ) 1 3

[6417] IV

[6418] 9 6 Likely Likely S3 11017-10_-9insC Silent ( 0 7 Silent IVS Benign 1 7

[6419] 3 2 ) 1 3 Arg3672fsl 8 IV Likely 9 6 X

[6420] S3 11017-10C>A Splice Pathog ( 0 7 Nontruncati 6 7 enic

[6421] 4 2 ng: ) 1 3 1 IV

[6422] 9 6 Unknown

[6423] S3 11017-9_-8insG Unknown ( 0 7 IVS vus 1 7

[6424] 5 2 ) 1 3

[6425] IV

[6426] 9 6 Likely Likely S3 11017-4C>T Silent ( 0 7 Silent IVS Benign 2 7

[6427]

[6428] 6 2 )

[6429] 181

[6430] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6431] 1 3

[6432] IV

[6433] 9 6 Likely Likely S3 11017-3C>T Silent ( 0 7 Silent IVS Benign 2 7

[6434] 7 2 ) 1 3 1 IV

[6435] 9 6 Arg3672fs Pathog S3 11O17-1G> T Splice ( 0 7 Truncating: enic 1 7

[6436] 8 2 ) 1 3

[6437] E

[6438] 9 6 Leu3675Le Likely X 11025G> A Synonymous ( 0 7 u Benign 1 38

[6439] 9 5 ) 1 3 1 E

[6440] 9 6 Nontruncating

[6441] X 11033T> C Met3678Thr VUS ( 1 7: Missense 1 38

[6442] 0 8 ) 1 3 1 E Likely 9 6 Nontruncating

[6443] X 11045T> A Leu3682Gln Pathog ( 1 8: Missense 2 38 enic

[6444] 1 2 ) 1 3 1 E Truncating:

[6445] 9 6 Ala3692fs2 Pathog X 11073 11074insT Deletion / Inser ( 1 9 9X enic 2 38 tion

[6446] 2 2 ) 1 3 1 E Truncating:

[6447] 9 6 Ser3693fs2 Pathog X 11076 11077insC Deletion / Inser ( 1 9 8X enic 1 38 tion

[6448] 3 3 ) 1 3 2 E Truncating:

[6449] 9 6 Cys3694fs2 Pathog X 11078 11079insC Deletion / Inser ( 1 9 8X enic 1 38 tion

[6450] 4 3 ) 1 3 1 E

[6451] 9 6 Nontruncating

[6452] X 11078C>T Ser3693Leu VUS ( 1 9: Missense 1 38

[6453] 5 3 ) 1 3

[6454] E

[6455] 9 6 Cys3694Ar Nontruncating Likely X 11080T> C ( 1 9 g: Missense Benign 1 38

[6456] 6 4 ) 1 3 2 E

[6457] 9 6 Truncating: Pathog X 11082C>A Cys3694X ( 1 9 Nonsense enic 1 38

[6458]

[6459] 7 4 )

[6460] 182

[6461] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6462] 1 3 Nontruncating 1 E

[6463] 9 6 His3697fs2 Pathog X 11090 11091insA ( 1 9 5X Deletion / Inser enic 1 38

[6464] 8 7 tion ) 1 3 1 E Truncating:

[6465] 9 6 His3697fsl Pathog X 11091delC Deletion / Inser ( 1 9 29X enic 1 38 tion

[6466] 9 7 ) 1 3 1 E

[6467] 9 6 Nontruncating

[6468] X 11092G> A Ala3698Thr ( 2 9: Missense vus 1 38

[6469] 0 8 ) 1 3 1 E

[6470] 9 7 Truncating: Pathog X 11104C>T Gln3702X ( 2 0 Nonsense enic 1 38

[6471] 1 2 ) 1 3

[6472] E

[6473] 9 7 Nontruncating Likely X 11108G> C Ser3703Thr ( 2 0: Missense Benign 1 38

[6474] 2 3 ) 1 3 1 E

[6475] 9 7 Truncating: Pathog X 11119C>T Gln3707X ( 2 0 Nonsense enic 1 38

[6476] 3 7 ) 1 3 1 E 11129 11142delACAGCCG Truncating:

[6477] 9 7 His3710fs7 Pathog X GGCCTTC (SEQ ID Deletion / Inser ( 2 1 X enic 1 38 NO:61) tion

[6478] 4 0 ) 1 3 1 E

[6479] 9 7 Nontruncating

[6480] X 11134C>T Arg3712Trp VUS ( 2 1: Missense 1 38

[6481] 5 2 ) 1 3 1 E Truncating:

[6482] 9 7 Arg3712fsl Pathog X 11134delC Deletion / Inser ( 2 1 13X enic 1 38 tion

[6483] 6 2 ) 1 3

[6484] E

[6485] 9 7 Leu3715Le Likely X 11143C>T Synonymous ( 2 1 u Benign 1 38

[6486] 7 5 ) 1 3 1 E Truncating:

[6487] 9 7 Leu3715fsl Pathog X 11143delC Deletion / Inser ( 2 1 10X enic 1 38 tion

[6488]

[6489] 8 5 )

[6490] 183

[6491] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6492] 1 3 2 E Likely 9 7 Nontruncating

[6493] X 11156G> A Arg3719Gln Pathog ( 2 1: Missense 2 38 enic

[6494] 9 9 ) 1 3 1 IV

[6495] 9 7 Arg3719fsX Pathog S3 11156+1G> T Splice ( 3 1 Truncating: enic 1 8

[6496] 0 9 ) 1 3

[6497] IV

[6498] 9 7 Likely Likely S3 11156+11G> A Silent ( 3 1 Silent IVS Benign 1 8

[6499] 1 9 ) 1 3

[6500] IV

[6501] 9 7 Likely Likely S3 11156+12C>T Silent ( 3 1 Silent IVS Benign 1 8

[6502] 2 9 ) 1 3

[6503] IV

[6504] 9 7 Likely Likely S3 11156+13G> A Silent ( 3 1 Silent IVS Benign 5 8

[6505] 3 9 ) 1 3

[6506] IV

[6507] 9 7 Likely Likely S3 11157-77C>A Silent ( 3 1 Silent IVS Benign 2 8

[6508] 4 9 ) 1 3

[6509] IV

[6510] 9 7 Likely Likely S3 11157-5G> T Silent ( 3 1 Silent IVS Benign 1 8

[6511] 5 9 ) 1 3 1 E Truncating:

[6512] 9 7 Leu3723fs9 Pathog X 11168 11169insl9 Deletion / Inser ( 3 2 8X enic 1 39 tion

[6513] 6 3 ) 1 3 1 E Likely 9 7 Nontruncating

[6514] X 11176T> C Trp3726Arg Pathog ( 3 2: Missense 1 39 enic

[6515] 7 6 ) 1 3 1 E Likely 9 7 Nontruncating

[6516] X 11177G> C Trp3726Ser Pathog ( 3 2: Missense 1 39 enic

[6517] 8 6 ) 1 3

[6518] E

[6519] 9 7 Nontruncating Likely X 11182G> C Ala3728Pro ( 3 2: Missense Benign 1 39

[6520]

[6521] 9 8 )

[6522] 184

[6523] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6524] 1 3 1 E Truncating:

[6525] 9 7 His3729fs9 Pathog X 11185delC Deletion / Inser ( 4 2 6X enic 1 39 tion

[6526] 0 9 ) 1 3 1 E Likely 9 7 Nontruncating

[6527] X 11192T>A Leu3731Gln Pathog ( 4 3: Missense 1 39 enic

[6528] 1 1 ) 1 3 Nontruncating 1 E Likely 9 7 Val3735_Hi

[6529] X 11204_11209delTCCACG Pathog ( 4 3 s3736del2 Deletion / Inser 1 39 enic

[6530] 2 5 tion ) 1 3 1 E Likely 9 7 Nontruncating

[6531] X 11204T> A Val3735Asp Pathog ( 4 3: Missense 1 39 enic

[6532] 3 5 ) 1 3 Nontruncating 1 E 11233 11247delGGGCCCC

[6533] 9 7 Gly3745_Le Pathog X CACGGCTG (SEQ ID ( 4 4 u3749del5 Deletion / Inser enic 1 39 NO:62)

[6534] 4 5 tion ) 1 3 Nontruncating 1 E 11241 11255delACGGCTG

[6535] 9 7 Arg3748_V Pathog X CGGCAGGT (SEQ ID ( 4 4 al3752del5 Deletion / Inser enic 1 39 NO:63)

[6536] 5 8 tion ) 1 3 Nontruncating 1 E Likely 9 7

[6537] X 11246 11248delTGC Leu3749del Pathog ( 4 4 Deletion / Inser 1 39 enic

[6538] 6 9 tion ) 1 3 1 E Likely 9 7 Nontruncating

[6539] X 11246T> C Leu3749Pro Pathog ( 4 4: Missense 1 39 enic

[6540] 7 9 ) 1 3 3 E Likely 9 7 Nontruncating

[6541] X 11249 11250delGGinsAA Arg3750Gln Pathog ( 4 5: Missense 1 39 enic

[6542] 8 0 ) 1 3 Nontruncating 1 E 11249 11263delGGCAGGT

[6543] 9 7 Arg3750_L Pathog X GCGGCTGC (SEQ ID ( 4 5 eu3754del5 Deletion / Inser enic 1 39 NO:64)

[6544] 9 0 tion ) 1 3 5 E Likely 9 7 Nontruncating

[6545] X 11249G> A Arg3750Gln Pathog ( 5 5: Missense 5 39 enic

[6546]

[6547] 0 0 )

[6548] 185

[6549] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6550] 1 3 1 E Likely 9 7 Nontruncating

[6551] X 11251C>A Gln3751Lys Pathog ( 5 5: Missense 1 39 enic

[6552] 1 1 ) 1 3 1 E

[6553] 9 7 Truncating: Pathog X 11251C>T Gln3751X ( 5 5 Nonsense enic 1 39

[6554] 2 1 ) 1 3 3 E Likely 9 7 Nontruncating

[6555] X 11252A> G Gln3751 Arg Pathog ( 5 5: Missense 2 39 enic

[6556] 3 1 ) 1 3

[6557] E

[6558] 9 7 Arg3753Ar Likely X 11257C>A Synonymous ( 5 5 g Benign 3 39

[6559] 4 3 ) 1 3 8 E Likely 9 7 Nontruncating

[6560] X 11257C>T Arg3753Trp Pathog ( 5 5: Missense 4 39 enic

[6561] 5 3 ) 1 3 2 E Likely 9 7 Nontruncating

[6562] X 11258G> A Arg3753Gln Pathog ( 5 5: Missense 2 39 enic

[6563] 6 3 ) 1 3 1 E Likely 9 7 Arg3753Le Nontruncating

[6564] X 11258G> T Pathog ( 5 5 u: Missense 1 39 enic

[6565] 7 3 ) 1 3

[6566] E

[6567] 9 7 Leu3754Le Likely X 11262G> C Synonymous ( 5 5 u Benign 5 39

[6568] 8 4 ) 1 3 1 IV

[6569] 9 7 Ala3757fs Pathog S3 11269+1G> C Splice ( 5 5 Truncating: enic 1 9

[6570] 9 7 ) 1 3

[6571] IV

[6572] 9 7 Likely Likely S3 11269+128OT Silent ( 6 5 Silent IVS Benign 1 9

[6573] 0 7 ) 1 3 1 IV

[6574] 9 7 Ala3657fs Pathog S3 1127O-1G> T Splice ( 6 5 Truncating: enic 1 9

[6575]

[6576] 1 7 )

[6577] 186

[6578] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6579] 1 3 1 E

[6580] 9 7 Nontruncating

[6581] X 11285C>T Pro3762Leu ( 6 6: Missense vus 1 40

[6582] 2 2 ) 1 3

[6583] E

[6584] 9 7 Likely X 11292C>A Gly3764Gly Synonymous ( 6 6 Benign 1 40

[6585] 3 4 ) 1 3 1 E Truncating:

[6586] 9 7 Val3767fs4 Pathog X 11296delAinsCG Deletion / Inser ( 6 6 9X enic 1 40 tion

[6587] 4 7 ) 1 3 1 E 11299 11321delGTCCACA Truncating:

[6588] 9 7 AVal3767fs Pathog X CGTGCTCGGCCGC (SEQ Deletion / Inser ( 6 6 41X enic 1 40 ID NO:65) tion

[6589] 5 7 ) 1 3 1 E Truncating:

[6590] 9 7 Thr3769fs3 Pathog X 11307 11367del61 Deletion / Inser ( 6 6 6X enic 1 40 tion

[6591] 6 9 ) 1 3 1 E Truncating:

[6592] 9 7 Cys3770fs4 Pathog X 11309 11310insG Deletion / Inser ( 6 7 6X enic 1 40 tion

[6593] 7 0 ) 1 3

[6594] E

[6595] 9 7 Likely X 11313G> A Ser3771 Ser Synonymous ( 6 7 Benign 1 40

[6596] 8 1 ) 1 3 1 E Truncating:

[6597] 9 7 Ala3773fs4 Pathog X 11316 11317insA Deletion / Inser ( 6 7 3X enic 1 40 tion

[6598] 9 3 ) 1 3 1 E Truncating:

[6599] 9 7 Gly3774fs5 Pathog X 11322 11323insAA Deletion / Inser ( 7 7 IX enic 1 40 tion

[6600] 0 4 ) 1 3 Nontruncating 1 E

[6601] 9 7 Phe3776 G1 Pathog X 11327 11353del27 ( 7 7 y3784del9 Deletion / Inser enic 1 40

[6602] 1 6 tion ) 1 3

[6603] E

[6604] 9 7 Nontruncating Likely X 11333C>A Thr3778Asn ( 7 7: Missense Benign 1 40

[6605]

[6606] 2 8 )

[6607] 187

[6608] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6609] 1 3

[6610] E

[6611] 9 7 Nontruncating Likely X 11337C>G Ser3779Arg ( 7 7: Missense Benign 1 40

[6612] 3 9 ) 1 3 1 E 11337 11338insAGGAGGC Truncating:

[6613] 9 7 Asp3780fs4 Pathog X TTCAGCACCAGC (SEQ Deletion / Inser ( 7 8 OX enic 1 40 ID NO: 66) tion

[6614] 4 0 ) 1 3 1 E Truncating:

[6615] 9 7 11340 11347delTTACGAC Asp3780fs3 Pathog X Deletion / Inser ( 7 8 G 2X enic 1 40 tion

[6616] 5 0 ) 1 3 Nontruncating 1 E Likely 9 7 Tyr3781_As

[6617] X 11340 11345delTTACGA Pathog ( 7 8 p3782del2 Deletion / Inser 1 40 enic

[6618] 6 1 tion ) 1 3 1 E Truncating:

[6619] 9 7 11341 11342insACCAGCG Tyr3781fs3 Pathog X Deletion / Inser ( 7 8 ATT (SEQ ID NO:67) 7X enic 1 40 tion

[6620] 7 1 ) 1 3 2 E

[6621] 9 7 Truncating: Pathog X 11343C>G Tyr3781X ( 7 8 Nonsense enic 2 40

[6622] 8 1 ) 1 3 Nontruncating 1 E Tyr3781 As Likely 9 7

[6623] X 11344 11345insAAG p3782insGl Pathog ( 7 8 Deletion / Inser 1 40 u enic

[6624] 9 1 tion ) 1 3 1 E Truncating:

[6625] 9 7 11345 11346insGATTACG Asp3782fs4 Pathog X Deletion / Inser ( 8 8 A 6X enic 1 40 tion

[6626] 0 2 ) 1 3 Nontruncating 1 E Asp3782_V Likely 9 7

[6627] X 11345 11346insTTACGA al3783insTy Pathog ( 8 8 Deletion / Inser 1 40 r A enic

[6628] 1 2 tion ) 1 3 Nontruncating 1 E Likely 9 7

[6629] X 11345 11347delACG Asp3782del Pathog ( 8 8 Deletion / Inser 1 40 enic

[6630] 2 2 tion ) 1 3 Nontruncating 1 E Likely 9 7 Asp3782 V

[6631] X 11346 11347ins6 Pathog ( 8 8 al3783ins2 Deletion / Inser 1 40 enic

[6632]

[6633] 3 2 tion )

[6634] 188

[6635] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6636] 1 3

[6637] E

[6638] 9 7 Asp3782As Likely X 11346C>T Synonymous ( 8 8 P Benign 4 40

[6639] 4 2 ) 1 3 1 E Truncating:

[6640] 9 7 Val3783fs3 Pathog X 11346 11347insTTACGAC Deletion / Inser ( 8 8 5X enic 1 40 tion

[6641] 5 3 ) 1 3 2 E Truncating:

[6642] 9 7 Gly3784fs3 Pathog X 11350 1351insT Deletion / Inser ( 8 8 IX enic 1 40 tion

[6643] 6 4 ) 1 3 3 E

[6644] 9 7 Truncating: Pathog X 11355G> A Trp3785X ( 8 8 Nonsense enic 3 40

[6645] 7 5 ) 1 3

[6646] E

[6647] 9 7 Nontruncating Likely X 11356G> C Glu3786Gln ( 8 8: Missense Benign 2 40

[6648] 8 6 ) 1 3 1 E Truncating:

[6649] 9 7 Pro3788fs3 Pathog X 11361delT Deletion / Inser ( 8 8 8X enic 1 40 tion

[6650] 9 8 ) 1 3 1 E 11363 11364insGACGTTG Truncating:

[6651] 9 7 His3789fs4 Pathog X GCTGGGAGAGTCC (SEQ Deletion / Inser ( 9 8 4X enic 1 40 ID NO:68) tion

[6652] 0 9 ) 1 3 Nontruncating 1 E Asn3790 S Likely 9 7

[6653] X 11370 11375delTGGCTC er3792delA Pathog ( 9 9 Deletion / Inser 1 40 s n enic

[6654] 1 0 tion ) 1 3 1 E Truncating:

[6655] 9 7 Gly3791fs4 Pathog X 11371 11372ins44 Deletion / Inser ( 9 9 9X enic 1 40 tion

[6656] 2 1 ) 1 3

[6657] E

[6658] 9 7 Likely X 11376G> C Ser3792Ser Synonymous ( 9 9 Benign 4 40

[6659] 3 2 ) 1 3 8 E Truncating:

[6660] 9 7 Thr3794fs3 Pathog X 11379delG Deletion / Inser ( 9 9 IX enic 5 40 tion

[6661]

[6662] 4 3 )

[6663] 189

[6664] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6665] 1 3 1 E

[6666] 9 7 Truncating: Pathog X 11384G> A Trp3795X ( 9 9 Nonsense enic 1 40

[6667] 5 5 ) 1 3 1 E Truncating:

[6668] 9 8 Pro3800fsl Pathog X 11397 11398delGC Deletion / Inser ( 9 0 5X enic 1 40 tion

[6669] 6 0 ) 1 3 1 E Truncating:

[6670] 9 8 Pro3800fs2 Pathog X 11398 11399insl9 Deletion / Inser ( 9 0 IX enic 1 40 tion

[6671] 7 0 ) 1 3 1 IV Gly3804fs

[6672] 9 8 Pathog S4 11411+1delG Nontruncati Splice ( 9 0 enic 1 0

[6673] 8 4 ng:

[6674] ) 1 3

[6675] IV

[6676] 9 8 Likely Likely S4 11411+17_+30del Silent ( 9 0 Silent IVS Benign 1 0

[6677] 9 4 ) 2 3

[6678] IV

[6679] 0 8 Likely Likely S4 11411 + 18OT Silent ( 0 0 Silent IVS Benign 2 0

[6680]

[6681] 0 4 ) 2 3

[6682] IV

[6683] 0 8 Likely Likely S4 11411+53delT Silent ( 0 0 Silent IVS Benign 1 0

[6684] 1 4 ) 2 3

[6685] IV

[6686] 0 8 Likely Likely S4 11411+60G> C Silent ( 0 0 Silent IVS Benign 1 0

[6687] 2 4 ) 2 3

[6688] IV

[6689] 0 8 Likely Likely S4 11411+66C>T Silent ( 0 0 Silent IVS Benign 1 0

[6690] 3 4 ) 2 3

[6691] IV

[6692] 0 8 Likely Likely S4 11412-51G> A Silent ( 0 0 Silent IVS Benign 1 0

[6693] 4 4 ) 2 3 1 IV

[6694] 0 8 Gly3804fs Pathog S4 11412-2A> T Splice ( 0 0 Truncating: enic 1 0

[6695]

[6696] 5 4 )

[6697] 190

[6698] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6699] 2 3 2 IV

[6700] 0 8 Gly3804fs Pathog S4 11412-1G> A Splice ( 0 0 Truncating: enic 2 0

[6701] 6 4 ) 2 3 1 IV

[6702] 0 8 Gly3804fs Pathog S4 11412-1G> C Splice ( 0 0 Truncating: enic 1 0

[6703] 7 4 ) 2 3 1 E

[6704] 0 8 Truncating: Pathog X 11417G> A Trp3806X ( 0 0 Nonsense enic 1 41

[6705] 8 6 ) 2 3 1 E Truncating:

[6706] 0 8 Ser3807fs9 Pathog X 11418insG Deletion / Inser ( 0 0 X enic 1 41 tion

[6707] 9 7 ) 2 3 1 E

[6708] 0 8 Truncating: Pathog X 11423G> A Trp3808X ( 1 0 Nonsense enic 1 41

[6709] 0 8 ) 2 3 1 E Likely 0 8 Asp3815As Nontruncating

[6710] X 11443G> A Pathog ( 1 1 n: Missense 1 41 enic

[6711] 1 5 ) 2 3 1 E Likely 0 8 Gly3817Tr Nontruncating

[6712] X 11449G> T Pathog ( 1 1: Missens 1 41 P e

[6713] enic

[6714] 2 7 ) 2 3 1 E Truncating:

[6715] 0 8 Gly3818fsl Pathog X 11453 11454insG Deletion / Inser ( 1 1 42X enic 1 41 tion

[6716] 3 8 ) 2 3 1 E Likely 0 8 Tyr3819Cy Nontruncating

[6717] X 11456A> G Pathog ( 1 1 s: Missense 1 41 enic

[6718] 4 9 ) 2 3 2 E

[6719] 0 8 Truncating: Pathog X 11457C>A Tyr3819X ( 1 1 Nonsense enic 3 41

[6720] 5 9 ) 2 3 Nontruncating 1 E Likely 0 8 Gln3821 G

[6721] X 11461_11466delCAGGAG Pathog ( 1 2 Iu3822del2 Deletion / Inser 1 41 enic

[6722]

[6723] 6 1 tion )

[6724] 191

[6725] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6726] 2 3 7 E

[6727] 0 8 Truncating: Pathog X 11461C>T Gln3821X ( 1 2 Nonsense enic 3 41

[6728] 7 1 ) 2 3 1 E Truncating:

[6729] 0 8 Glu3822fsl Pathog X 11466_11467insG Deletion / Inser ( 1 2 38X enic 1 41 tion

[6730] 8 2 ) 2 3 1 E Likely 0 8 Leu3823Pr Nontruncating

[6731] X 11468T> C Pathog ( 1 2 0: Missense 1 41 enic

[6732] 9 3 ) 2 3

[6733] E

[6734] 0 8 Leu3825Le Likely X 11473C>T Synonymous ( 2 2 u Benign 1 41

[6735] 0 5 ) 2 3 Nontruncating 1 E Likely 0 8

[6736] X 11482_11484delGAG Glu3828del Pathog ( 2 2 Deletion / Inser 1 41 enic

[6737] 1 8 tion ) 2 3 1 E

[6738] 0 8 Truncating: Pathog X 11482G> T Glu3828X ( 2 2 Nonsense enic 1 41

[6739] 2 8 ) 2 3 1 E Truncating:

[6740] 0 8 Ser3830fsl Pathog X 11489_11490insGAGAG Deletion / Inser ( 2 3 17X enic 1 41 tion

[6741] 3 0 ) 2 3 1 E Likely 0 8 Leu3834Ar Nontruncating

[6742] X 11501T> G Pathog ( 2 3: Missense 1 41 g enic

[6743] 4 4 ) 2 3 1 E Likely 0 8 Leu3837Ar Nontruncating

[6744] X 11510T> G Pathog ( 2 3 g: Missense 1 41 enic

[6745] 5 7 ) 2 3 3 E

[6746] 0 8 Truncating: Pathog X 11512C> T Gln3838X ( 2 3 Nonsense enic 3 41

[6747] 6 8 ) 2 3 Nontruncating 1 E

[6748] 0 8 His3840 A Pathog X 11520_1521ins15 ( 2 4 sn3841ins5 Deletion / Inser enic 1 41

[6749]

[6750] 7 0 tion )

[6751] 192

[6752] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6753] 2 3

[6754] E

[6755] 0 8 His3840Gl Nontruncating Likely X 11520C>A ( 2 4 n: Missense Benign 1 41

[6756] 8 0 ) 2 3

[6757] E

[6758] 0 8 Asn3841 As Likely X 11523C>T Synonymous ( 2 4 n Benign 1 41

[6759] 9 1 ) 2 3 3 E

[6760] 0 8 Truncating: Pathog X 11525G> A Trp3842X ( 3 4 Nonsense enic 2 41

[6761] 0 2 ) 2 3 1 E Likely 0 8 Trp3842Se Nontruncating

[6762] X 11525G> C Pathog ( 3 4 r: Missense 1 41 enic

[6763] 1 2 ) 2 3 1 IV

[6764] 0 8 Arg3846fs Pathog S4 11537+1G> T Splice ( 3 4 Truncating: enic 1 1

[6765] 2 6 ) 2 3 1 IV

[6766] 0 8 Arg3846fs Pathog S4 11537+2T> G Splice ( 3 4 Truncating: enic 1 1

[6767] 3 6 ) 2 3

[6768] IV

[6769] 0 8 Likely Likely S4 11537+5_+6insGGG Silent ( 3 4 Silent IVS Benign 9 1

[6770] 4 6 ) 2 3

[6771] IV

[6772] 0 8 Likely Likely S4 11537+7_+8insGAG Silent ( 3 4 Silent IVS Benign 1 1

[6773] 5 6 ) 2 3

[6774] IV

[6775] 0 8 Likely Likely S4 11537+17C>T Silent ( 3 4 Silent IVS Benign 2 1

[6776] 6 6 ) 2 3

[6777] IV

[6778] 0 8 Likely Likely S4 11537+20C>T Silent ( 3 4 Silent IVS Benign 1 1

[6779] 7 6 ) 2 3

[6780] IV

[6781] 0 8 Likely Likely S4 11537+31delG Silent ( 3 4 Silent IVS Benign 1 1

[6782]

[6783] 8 6 )

[6784] 193

[6785] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6786] 2 3

[6787] IV

[6788] 0 8 Likely Likely S4 11538-55T> G Silent ( 3 4 Silent IVS Benign 1 1

[6789] 9 6 ) 2 3

[6790] IV

[6791] 0 8 Likely Likely S4 11538-54C>G Silent ( 4 4 Silent IVS Benign 1 1

[6792] 0 6 ) 2 3

[6793] IV

[6794] 0 8 Likely Likely S4 11538-11C> T Silent ( 4 4 Silent IVS Benign 4 1

[6795] 1 6 ) 2 3 1 IV p. Arg3846?

[6796] 0 8

[6797] S4 11538-10C> A Nontruncat Splice VUS ( 4 4 1 1 ing:

[6798] 2 6 ) 2 3 1 IV

[6799] 0 8 Arg3846fs Pathog S4 11538-2A> G Splice ( 4 4 Truncating: enic 1 1

[6800] 3 6 ) 2 3 1 IV

[6801] 0 8 Arg3846fs Pathog S4 11538-1G> A Splice ( 4 4 Truncating: enic 1 1

[6802] 4 6 ) 2 3 Nontruncating 1 E

[6803] 0 8 Leu3852fs Pathog X 11554delC ( 4 5 82X Deletion / Inser enic 1 42

[6804] 5 2 tion ) 2 3 2 E Likely 0 8 Leu3852Pr Nontruncating

[6805] X 11555T> C Pathog ( 4 5 0: Missense 2 42 enic

[6806] 6 2 ) 2 3 1 E Likely 0 8 Glu3853Ly Nontruncating

[6807] X 11557G> A Pathog ( 4 5 s: Missense 1 42 enic

[6808] 7 3 ) 2 3 1 E Truncating:

[6809] 0 8 His3864fs9 Pathog X 11588_11589insT Deletion / Inser ( 4 6 7X enic 1 42 tion

[6810] 8 4 ) 2 3

[6811] E

[6812] 0 8 Ala3865Al Likely X 11595C> T Synonymous ( 4 6 a Benign 1 42

[6813]

[6814] 9 5 )

[6815] 194

[6816] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6817] 2 3 1 E 11612_11637delTCGAGTT Truncating:

[6818] 0 8 CLeu3871f Pathog X CCCGGCGGCCGGC (SEQ Deletion / Inser ( 5 7 s81X enic 1 42 ID NO:69) tion

[6819] 0 1 ) 2 3 3 E Likely 0 8 Glu3872Gl Nontruncating

[6820] X 11614G> C Pathog ( 5 7 n: Missense 2 42 enic

[6821] 1 2 ) 2 3 1 E

[6822] 0 8 Truncating: Pathog X 11614G> T Glu3872X ( 5 7 Nonsense enic 1 42

[6823] 2 2 ) 2 3

[6824] E

[6825] 0 8 Glu3872Gl Likely X 11616G> A Synonymous ( 5 7 u Benign 3 42

[6826] 3 2 ) 2 3 1 E Truncating:

[6827] 0 8 Pro3874fs7 Pathog X 11621delC Deletion / Inser ( 5 7 OX enic 1 42 tion

[6828] 4 4 ) 2 3 1 E 11623_11645delGCGGCCG Truncating:

[6829] 0 8 CAla3875f Pathog X GCCGCGCCCTGG (SEQ Deletion / Inser ( 5 7 s62X enic 1 42 ID NO:70) tion

[6830] 5 5 ) 2 3

[6831] E

[6832] 0 8 Ala3876Va Nontruncating Likely X 11627C> T ( 5 7 1: Missense Benign 1 42

[6833] 6 6 ) 2 3 1 E Truncating:

[6834] 0 8 Ala3876fs6 Pathog X 11628delC Deletion / Inser ( 5 7 8X enic 1 42 tion

[6835] 7 6 ) 2 3 1 E Truncating:

[6836] 0 8 Gly3877fs6 Pathog X 11630delG Deletion / Inser ( 5 7 8X enic 1 42 tion

[6837] 8 7 ) 2 3

[6838] E

[6839] 0 8 Likely X 11652C> T Ser3884Ser Synonymous ( 5 8 Benign 1 42

[6840] 9 4 ) 2 3 1 E Likely 0 8 Val3885Gl Nontruncating

[6841] X 11654T> G Pathog ( 6 8 y: Missense 1 42 enic

[6842]

[6843] 0 5 )

[6844] 195

[6845] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6846] 2 3 1 E 11660_11661insGCGCCCT Truncating:

[6847] 0 8 GPhe3888f Pathog X GGCCGCCCTCAGC (SEQ Deletion / Inser ( 6 8 s82X enic 1 42 ID NO:71) tion

[6848] 1 8 ) 2 3 1 E Truncating:

[6849] 0 8 11660_11661insTCAGCGT Phe3888fs8 Pathog X Deletion / Inser ( 6 8 CCGCCC (SEQ ID NO:72) 2X enic 1 42 tion

[6850] 2 8 ) 2 3 1 E Truncating:

[6851] 0 8 Arg3892fs Pathog X 11673_11674insTGCGC Deletion / Inser ( 6 9 54X enic 1 42 tion

[6852] 3 2 ) 2 3

[6853] E

[6854] 0 8 Likely X 11682C> T Ser3894Ser Synonymous ( 6 9 Benign 8 42

[6855] 4 4 ) 2 3

[6856] E

[6857] 0 8 Leu3897Ph Nontruncating Likely X 11689C> T ( 6 9 e: Missense Benign 1 42

[6858] 5 7 ) 2 3 1 E

[6859] 0 8 Truncating: Pathog X 11693C>A Ser3898X ( 6 9 Nonsense enic 1 42

[6860] 6 8 ) 2 3

[6861] E

[6862] 0 9 Pro3900Pr Likely X 11700T> C Synonymous ( 6 0 o Benign 1 42

[6863] 7 0 ) 2 3 1 E Truncating:

[6864] 0 9 Leu3901fs Pathog X 11703_11704insG Deletion / Inser ( 6 0 58X enic 1 42 tion

[6865] 8 1 ) 2 3 1 E

[6866] 0 9 Ser3904Tr Nontruncating

[6867] X 11711C>G vus ( 6 0 P: Missense 1 42

[6868] 9 4 ) 2 3 1 E

[6869] 0 9 Ser3904Le Nontruncating

[6870] X 11711C>T ( 7 0 u: Missense vus 1 42

[6871] 0 4 ) 2 3

[6872] IV

[6873] 0 9 Likely Likely S4 IVS42SSRP Silent ( 7 0 Silent IVS Benign 1 2

[6874]

[6875] 1 4 )

[6876] 196

[6877] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6878] 2 3

[6879] IV

[6880] 0 9 Likely Likely S4 11712+8C>T Silent ( 7 0 Silent IVS Benign 1 2

[6881] 2 4 ) 2 3

[6882] IV

[6883] 0 9 Likely Likely S4 11712+28G> C Silent ( 7 0 Silent IVS Benign 2 2

[6884] 3 4 ) 2 3

[6885] IV

[6886] 0 9 Likely Likely S4 11712+29C>T Silent ( 7 0 Silent IVS Benign 2 2

[6887] 4 4 ) 2 3

[6888] IV

[6889] 0 9 Likely Likely S4 11712+33C>A Silent ( 7 0 Silent IVS Benign 1 2

[6890] 5 4 ) 2 3 1 IV

[6891] 0 9 Unknown

[6892] S4 11713-9C>A Unknown VUS ( 7 0 IVS 1 2

[6893] 6 4 ) 2 3 1 IV Ser3904fs Likely 0 9

[6894] S4 11713-7C>G Nontruncat Splice Pathog ( 7 0 1 2 ing: enic

[6895] 7 4 ) 2 3

[6896] IV

[6897] 0 9 Likely Likely S4 11713-3C>T Silent ( 7 0 Silent IVS Benign 1 2

[6898] 8 4 ) 2 3

[6899] E

[6900] 0 9 Cys3906Ph Nontruncating Likely X 11717G> T ( 7 0 e: Missense Benign 2 43

[6901] 9 6 ) 2 3 Nontruncating 1 E Leu3907_A

[6902] 0 9 Pathog X 11719_11787del69 rg3929del2 ( 8 0 Deletion / Inser enic 1 43 3

[6903] 0 7 tion ) 2 3 1 E Truncating:

[6904] 0 9 Leu3908fs Pathog X 11722_11723insC Deletion / Inser ( 8 0 52X enic 1 43 tion

[6905] 1 8 ) 2 3 1 E Likely 0 9 Leu3908Ar Nontruncating

[6906] X 11723T> G Pathog ( 8 0 g: Missense 1 43 enic

[6907]

[6908] 2 8 )

[6909] 197

[6910] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6911] 2 3

[6912] E

[6913] 0 9 Ala3911Al Likely X 11733C>A Synonymous ( 8 1 a Benign 1 43

[6914] 3 1 ) 2 3 1 E Truncating:

[6915] 0 9 Val3916fs2 Pathog X 11745delC Deletion / Inser ( 8 1 9X enic 1 43 tion

[6916] 4 6 ) 2 3 1 E

[6917] 0 9 Truncating: Pathog X 11752G> T Glu3918X ( 8 1 Nonsense enic 1 43

[6918] 5 8 ) 2 3 3 E

[6919] 0 9 Truncating: Pathog X 11766G> A Trp3922X ( 8 2 Nonsense enic 2 43

[6920] 6 2 ) 2 3 1 E Truncating:

[6921] 0 9 Glu3925fs2 Pathog X 11773delG Deletion / Inser ( 8 2 OX enic 1 43 tion

[6922] 7 5 ) 2 3 1 E

[6923] 0 9 Glu3925Al Nontruncating

[6924] X 11774A> C ( 8 2 a: Missense vus 1 43

[6925] 8 5 ) 2 3 1 E

[6926] 0 9 Truncating: Pathog X 11783G> A Trp3928X ( 8 2 Nonsense enic 1 43

[6927] 9 8 ) 2 3

[6928] E

[6929] 0 9 Leu3933Le Likely X 11799OT Synonymous ( 9 3 u Benign 1 43

[6930] 0 3 ) 2 3 1 E Truncating:

[6931] 0 9 Leu3933fs Pathog X 11799delC Deletion / Inser ( 9 3 11X enic 1 43 tion

[6932] 1 3 ) 2 3 1 E Truncating:

[6933] 0 9 Ala3935fs2 Pathog X 11802_11803delAG Deletion / Inser ( 9 3 5X enic 1 43 tion

[6934] 2 5 ) 2 3

[6935] E

[6936] 0 9 Arg3938Ar Likely X 11814G> C Synonymous ( 9 3 Benign 1 43 g

[6937]

[6938] 3 8 )

[6939] 198

[6940] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6941] 2 3 1 E Likely 0 9 Leu3944Pr Nontruncating

[6942] X 11831T> C Pathog ( 9 4 o: Missense 1 43 enic

[6943] 4 4 ) 2 3 1 E 1844 11944delGGCACTGG Truncating:

[6944] 0 9 GThr3948f Pathog X TACGCCTCGCCCA (SEQ Deletion / Inser ( 9 4 S174X enic 1 43 ID NO:73) tion

[6945] 5 8 ) 2 3 1 E Truncating:

[6946] 0 9 Arg3952fs Pathog X 11856_11857ins19 Deletion / Inser ( 9 5 13X enic 1 43 tion

[6947] 6 2 ) 2 3 2 E

[6948] 0 9 Ala3954Pr Nontruncating

[6949] X 11860G> C ( 9 5 o: Missense vus 1 43

[6950] 7 4 ) 2 3 1 E

[6951] 0 9 Truncating: Pathog X 11863C> T Gln3955X ( 9 5 Nonsense enic 1 43

[6952] 8 5 ) 2 3

[6953] E

[6954] 0 9 Gln3955Ar Nontruncating Likely X 11864A> G ( 9 5: Missens Benign 1 43 g e

[6955] 9 5 ) 2 3

[6956] E

[6957] 1 9 Leu3956Le Likely X 11866C> T Synonymous ( 0 5 u Benign 1 43

[6958]

[6959] 0 6 ) 2 3

[6960] E 1 1 9 Leu3956Ar Nontruncating

[6961] X 11867T> G VUS

[6962] 0 5 ( g: Missense 1 43

[6963] 1 6 ) 2 3

[6964] E

[6965] 1 9 Gly3957As Nontruncating Likely

[6966] X 11870G> A

[6967] 0 5: Missense Benign (1 43 P

[6968] 2 7 ) 2 3

[6969] E 3 1 9 Truncating: Pathog X 11884C>T Gln3962X

[6970] 0 6 Nonsense enic (1 43

[6971] 3 2 ) 2 3 Nontruncating

[6972] E 1 1 9 Gln3962fs Pathog X 11885delA

[6973] 0 6 21X Deletion / Inser enic (1 43 )

[6974]

[6975] 4 2 tion

[6976] 199

[6977] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[6978] 2 3

[6979] E Likely 1 1 9 Trp3963Ar Nontruncating

[6980] X 11887T> C Pathog 0 6 ( g: Missense 1 43 enic

[6981] 5 3 ) 2 3

[6982] E 1 1 9 Arg3965Se Nontruncating

[6983] X 11893C>A VUS

[6984] 0 6 r: Missense (1 43

[6985] 6 5 ) 2 3 Nontruncating

[6986] E 11909_11926delGCCCGCG 1 1 9 Pro3971_S Pathog X CCGCTTCACTA (SEQ ID

[6987] 0 7 er3976del6 Deletion / Inser enic (1 43 NO:74)

[6988] 7 0 tion ) 2 3

[6989] E

[6990] 1 9 Arg3970Ar Likely

[6991] X 11910C>T Synonymous

[6992] 0 7 ( g Benign 1 43

[6993] 8 0 ) 2 3

[6994] E

[6995] 1 9 Arg3972Ar Likely

[6996] X 11916C>G Synonymous

[6997] 0 7 g Benign (2 43

[6998] 9 2 ) 2 3

[6999] E

[7000] 1 9 Arg3972Ar Likely

[7001] X 11916C>T Synonymous

[7002] 1 7 ( g Benign 6 43

[7003] 0 2 ) 2 3

[7004] E Likely 1 1 9 Nontruncating

[7005] X 11927G> T Ser3976Ile Pathog 1 7: Missense (1 43 enic

[7006] 1 6 ) 2 3

[7007] E

[7008] 1 9 Asp3978A Likely

[7009] X 11934C>T Synonymous

[7010] 1 7 sp Benign (1 43

[7011] 2 8 ) 2 3

[7012] E 5 1 9 Truncating: Pathog X 11935C>T Gln3979X

[7013] 1 7 Nonsense enic (3 43

[7014] 3 9 ) 2 3

[7015] E Truncating: 1 1 9 Ala3981fs Pathog X 11943_11967del25bp Deletion / Inser

[7016] 1 8 50X enic (1 43 tion

[7017] 4 1 ) 2 3

[7018] E 3 1 9 Truncating: Pathog X 11944C>T Gln3982X

[7019] 1 8 Nonsense enic (2 43

[7020]

[7021] 5 2 )

[7022] 200

[7023] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7024] 2 3

[7025] E

[7026] 1 9 Ala3987Gl Nontruncating Likely

[7027] X 11960C>G

[7028] 1 8 ( y: Missense Benign 1 43

[7029] 6 7 ) 2 3

[7030] E

[7031] 1 9 Ala3987Al Likely

[7032] X 11961C>T Synonymous

[7033] 1 8 a Benign (3 43

[7034] 7 7 ) 2 3

[7035] E 1 1 9 Ala3991Va Nontruncating

[7036] X 11972C>T VUS

[7037] 1 9 1: Missense (1 43

[7038] 8 1 ) 2 3

[7039] E Truncating: 1 1 9 Ala3991fs Pathog X 11972delC Deletion / Inser

[7040] 1 9 47X enic (1 43 tion

[7041] 9 1 ) 2 3

[7042] E

[7043] 1 9 Ala3992Al Likely

[7044] X 11976C>G Synonymous

[7045] 2 9 a Benign (5 43

[7046] 0 2 ) 2 3 Nontruncating

[7047] E Phe3996 L Likely 1 1 9 11988 11989insCTGCTCT

[7048] X eu3996ins Pathog 2 9 TC Deletion / Inser (1 43 Le u enic

[7049] 1 6 tion ) 2 4

[7050] IV Ala4002fs 1 1 0 Pathog S4 12OO3+1G> A Truncating Splice

[7051] 2 0 enic (1 3

[7052] 2 1 ) 2 4

[7053] IV

[7054] 1 0 Likely Likely S4 12003+38A> C Silent

[7055] 2 0 Silent IVS Benign (1 3

[7056] 3 1 ) 2 4

[7057] IV

[7058] 1 0 Likely Likely S4 12003+42C>A Silent

[7059] 2 0 Silent IVS Benign (3 3

[7060] 4 1 ) 2 4

[7061] IV

[7062] 1 0 Likely Likely S4 12004-34C> A Silent

[7063] 2 0 Silent IVS Benign (3 3

[7064] 5 1 ) 2 4

[7065] IV Ala4002fs 1 1 0 Pathog S4 12004-2A> G Truncating Splice

[7066] 2 0 enic (1 3

[7067]

[7068] 6 2 )

[7069] 201

[7070] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7071] 2 4

[7072] E 6 1 0 Truncating: Pathog X 12010C>T Gln4004X

[7073] 2 0 Nonsense enic (3 44

[7074] 7 4 ) 2 4

[7075] E 5 1 0 Truncating: Pathog X 12013C>T Gln4005X

[7076] 2 0 (4

[7077] Nonsense enic

[7078] 44

[7079] 8 5 ) 2 4

[7080] E 1 1 0 Arg4007C Nontruncating

[7081] X 12019C>T VUS

[7082] 2 0 ys: Missense (1 44

[7083] 9 7 ) 2 4

[7084] E 1 1 0 Phe4008Le Nontruncating

[7085] X 12022T> C VUS

[7086] 3 0 u: Missense (1 44

[7087] 0 8 ) 2 4

[7088] E 6 1 0 Truncating: Pathog X 12031C>T Gln4011X

[7089] 3 1 Nonsense enic (6 44

[7090] 1 1 ) 2 4

[7091] E 2 1 0 Truncating: Pathog X 12035G> A Trp4012X

[7092] 3 1 Nonsense enic (1 44

[7093] 2 2 ) 2 4

[7094] E 2 1 0 Truncating: Pathog X 12036G> A Trp4012X

[7095] 3 1 Nonsense enic (2 44

[7096] 3 2 ) 2 4

[7097] E Truncating: 2 1 0 Phe4015fs Pathog X 12044_12045delTT Deletion / Inser

[7098] 3 1 140X enic (1 44 tion

[7099] 4 5 ) 2 4

[7100] E Truncating: 1 1 0 Thr4018fs Pathog X 12054_12055delAT Deletion / Inser

[7101] 3 1 137X enic (1 44 tion

[7102] 5 8 ) 2 4

[7103] E

[7104] 1 0 Thr4018Th Likely

[7105] X 12054A> G Synonymous

[7106] 3 1 r Benign (1 44

[7107] 6 8 ) 2 4

[7108] E 2 1 0 Truncating: Pathog X 12056T> G Leu4019X

[7109] 3 1 Nonsense enic (2 44

[7110]

[7111] 7 9 )

[7112] 202

[7113] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7114] 2 4

[7115] E 7 1 0 Truncating: Pathog X 12061C>T Arg4021X

[7116] 3 2 Nonsense enic (6 44

[7117] 8 1 ) 2 4

[7118] E 1 1 0 Truncating: Pathog X 12073G> T Glu4025X

[7119] 3 2 Nonsense enic (1 44

[7120] 9 5 ) 2 4

[7121] E

[7122] 1 0 Glu4025Gl Likely

[7123] X 12075G> A Synonymous

[7124] 4 2 u Benign (1 44

[7125] 0 5 ) 2 4

[7126] E

[7127] 1 0 Leu4026Le Likely

[7128] X 12078C>T Synonymous

[7129] 4 2 u Benign (3 44

[7130] 1 6 ) 2 4

[7131] E

[7132] 1 0 Leu4027Le Likely

[7133] X 12079C>T Synonymous

[7134] 4 2 u Benign (1 44

[7135] 2 7 ) 2 4

[7136] E Truncating: 2 1 0 Val4029fs Pathog X 12085_12086insG Deletion / Inser

[7137] 4 2 128X enic (1 44 tion

[7138] 3 9 ) 2 4

[7139] E Truncating: 2 1 0 Val4029fs Pathog X 12085_12121del37 Deletion / Inser

[7140] 4 2 157X enic (1 44 tion

[7141] 4 9 ) 2 4

[7142] E 1 1 0 Nontruncating

[7143] X 12085G> A Val4029Ile VUS

[7144] 4 2: Missense (1 44

[7145] 5 9 ) 2 4

[7146] E 2 1 0 Gly4032As Nontruncating

[7147] X 12095G> A VUS

[7148] 4 3: Missense (2 44 P

[7149] 6 2 ) 2 4

[7150] E

[7151] 1 0 Leu4033Le Likely

[7152] X 12099G> C Synonymous

[7153] 4 3 u Benign (1 44

[7154] 7 3 ) 2 4

[7155] E

[7156] 1 0 Leu4036Le Likely

[7157] X 12108C>T Synonymous

[7158] 4 3 u Benign (2 44

[7159]

[7160] 8 5 )

[7161] 203

[7162] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7163] 2 4

[7164] E 1 1 0 Truncating: Pathog X 12120C>A Tyr4040X

[7165] 4 4 Nonsense enic (1 44

[7166] 9 0 ) 2 4

[7167] E 9 1 0 Truncating: Pathog X 12124C>T Gln4042X

[7168] 5 4 Nonsense enic (8 44

[7169] 0 2 ) 2 4

[7170] E

[7171] 1 0 Nontruncating Likely

[7172] X 12133A> G Ile4045Val

[7173] 5 4: Missense Benign (1 44

[7174] 1 5 3) 2 4

[7175] IV Leu4047fs 1 1 0 Pathog S4 12138+1G> A Truncating Splice

[7176] 5 4 enic (1 4

[7177] 2 6 ) 2 4

[7178] IV Leu4047fs 1 1 0 Pathog S4 12138+1G> C Truncating Splice

[7179] 5 4 enic (1 4

[7180] 3 6 ) 2 4

[7181] IV Leu4047fs 2 1 0 Pathog S4 12138+2T> C Truncating Splice

[7182] 5 4 enic (2 4

[7183] 4 6 ) 2 4

[7184] IV Leu4047fs 1 1 0 Pathog S4 12138+2T> G Truncating Splice

[7185] 5 4 enic (1 4

[7186] 5 6 ) 2 4

[7187] IV Leu4047fs Likely 2 1 0

[7188] S4 12138+3_+6delAGGT Nontruncat Splice Pathog 5 4 (2 4 ing: enic

[7189] 6 6 ) 2 4

[7190] IV

[7191] 1 0 Likely Likely S4 12138+17C>T Silent

[7192] 5 4 Silent IVS Benign (1 4

[7193] 7 6 ) 2 4

[7194] IV

[7195] 1 0 Likely Likely S4 12138+22delG Silent

[7196] 5 4 Silent IVS Benign (1 4

[7197] 8 6 2) 2 4

[7198] IV

[7199] 1 0 Likely Likely S4 12138+37ins5 Silent

[7200] 5 4 Silent IVS Benign (1 4

[7201]

[7202] 9 6 )

[7203] 204

[7204] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7205] 2 4

[7206] IV

[7207] 1 0 Likely Likely S4 12138+44C>A Silent

[7208] 6 4 Silent IVS Benign (1 4

[7209] 0 6 ) 2 4

[7210] IV

[7211] 1 0 Likely Likely S4 12139-5C>T Silent

[7212] 6 4 Silent IVS Benign (1 4

[7213] 1 6 ) 2 4

[7214] IV

[7215] 1 0 Likely Likely S4 12139-3C>T Silent

[7216] 6 4 Silent IVS Benign (1 4

[7217] 2 6 ) 2 4

[7218] IV Leu4047fs Likely 1 1 0

[7219] S4 12139-3C>G Nontruncat Splice Pathog 6 4 (1 4 ing: enic

[7220] 3 7 ) 2 4

[7221] IV Leu4047fs 1 1 0 Pathog S4 12139-2A> C Truncating Splice

[7222] 6 4 enic (1 4

[7223] 4 7 ) 2 4

[7224] IV Leu4047fs 1 1 0 Pathog S4 12139-1G> A Truncating Splice

[7225] 6 4 enic (1 4

[7226] 5 7 ) 2 4

[7227] IV Leu4047fs 1 1 0 Pathog S4 12139-1G> C Truncating Splice

[7228] 6 4 enic (1 4

[7229] 6 7 ) 2 4

[7230] E Truncating: 1 1 0 12146 12155delCTTCCTG Ser4049fsl Pathog X Deletion / Inser

[7231] 6 4 TGT (SEQ ID NO:75) 46X enic (1 45 tion

[7232] 7 9 ) 2 4

[7233] E

[7234] 1 0 Cys4051C Likely

[7235] X 12153T> C Synonymous

[7236] 6 5 ys Benign (1 45

[7237] 8 1 ) 2 4

[7238] E Truncating: 1 1 0 Val4052fs Pathog X 12155 12156delTG Deletion / Inser

[7239] 6 5 103X enic (1 45 tion

[7240] 9 2 ) 2 4

[7241] E

[7242] 1 0 Ser4054Ph Nontruncating Likely

[7243] X 12161C> T

[7244] 7 5 e: Missense Benign (1 45

[7245]

[7246] 0 4 )

[7247] 205

[7248] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7249] 2 4

[7250] E 2 1 0 Truncating: Pathog X 12167G> A Trp4056X

[7251] 7 5 Nonsense enic (2 45

[7252] 1 6 ) 2 4

[7253] E

[7254] 1 0 Ala4059Va Nontruncating Likely

[7255] X 12176C>T

[7256] 7 5 1: Missense Benign (1 45

[7257] 2 9 0) 2 4

[7258] E Truncating: 1 1 0 Ala4059fs Pathog X 12177_12178insGGCC Deletion / Inser

[7259] 7 5 98X enic (1 45 tion

[7260] 3 9 ) 2 4

[7261] E Truncating: 1 1 0 Gln4060fs Pathog X 12178_12179insC Deletion / Inser

[7262] 7 6 97X enic (1 45 tion

[7263] 4 0 ) 2 4

[7264] E 1 1 0 Truncating: Pathog X 12178C> T Gln4060X

[7265] 7 6 Nonsense enic (1 45

[7266] 5 0 ) 2 4

[7267] E Truncating: 1 1 0 12198 12207delCCCTGGG Cys4066fs Pathog X Deletion / Inser

[7268] 7 6 ACT (SEQ ID NO:76) 128X enic (1 45 tion

[7269] 6 6 ) 2 4

[7270] E

[7271] 1 0 Cys4066C Likely

[7272] X 12198C> T Synonymous

[7273] 7 6 ys Benign (2 45

[7274] 7 6 ) 2 4

[7275] E

[7276] 1 0 Pro4067Pr Nontruncating Likely

[7277] X 12201T> C

[7278] 7 6 0: Missense Benign (1 45

[7279] 8 7 ) 2 4

[7280] E Truncating: 1 1 0 Ser4072fs8 Pathog X 12215_12216delCT Deletion / Inser

[7281] 7 7 4X enic (1 45 tion

[7282] 9 2 ) 2 4

[7283] E

[7284] 1 0 Thr4073Th Likely

[7285] X 12219C> A Synonymous

[7286] 8 7 r Benign (1 45

[7287] 0 3 ) 2 4

[7288] E Truncating: 1 1 0 Leu4074fs Pathog X 12220_12221delCT Deletion / Inser

[7289] 8 7 82X enic (1 45 tion

[7290]

[7291] 1 4 )

[7292] 206

[7293] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7294] 2 4

[7295] E

[7296] 1 0 Leu4074M Nontruncating Likely

[7297] X 12220C>A

[7298] 8 7 et: Missense Benign (1 45

[7299] 2 4 ) 2 4

[7300] E Truncating: 1 1 0 Cys4075fs Pathog X 12224_12225delGT Deletion / Inser

[7301] 8 7 81X enic (1 45 tion

[7302] 3 5 ) 2 4

[7303] E 12224 12225insGGGCTCT Truncating: 1 1 0 Cys4075fs Pathog X CTACCCTGTGTCC (SEQ Deletion / Inser

[7304] 8 7 128X enic (1 45 ID NO: 77) tion

[7305] 4 5 ) 2 4

[7306] E 2 1 0 Truncating: Pathog X 12239G> A Trp4080X

[7307] 8 8 Nonsense enic (1 45

[7308] 5 0 ) 2 4

[7309] E 1 1 0 Truncating: Pathog X 12240G> A Trp4080X

[7310] 8 8 Nonsense enic (1 45

[7311] 6 0 ) 2 4

[7312] E 1 1 0 Truncating: Pathog X 12248C>G Ser4083X

[7313] 8 8 Nonsense enic (1 45

[7314] 7 3 ) 2 4

[7315] E

[7316] 1 0 Pro4084Ar Nontruncating Likely

[7317] X 12251C>G

[7318] 8 8 ( g: Missense Benign 1 45

[7319] 8 4 ) 2 4

[7320] E

[7321] 1 0 Leu4085Le Likely

[7322] X 12253C>T Synonymous

[7323] 8 8 u Benign (1 45

[7324] 9 5 ) 2 4

[7325] E 1 1 0 Truncating: Pathog X 12261T> A Cys4087X

[7326] 9 8 Nonsense enic (1 45

[7327] 0 7 ) 2 4

[7328] E Truncating: 1 1 0 Val4088fs Pathog X 12262_12263insA Deletion / Inser

[7329] 9 8 68X enic (1 45 tion

[7330] 1 8 ) 2 4

[7331] E Truncating: 1 1 0 Val4088fs Pathog X 12263_12264delTG Deletion / Inser

[7332] 9 8 67X enic (1 45 tion

[7333]

[7334] 2 8 )

[7335] 207

[7336] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7337] 2 4

[7338] E Truncating: 1 1 0 Trp4089fs Pathog X 12264_12265insTG Deletion / Inser

[7339] 9 8 109X enic (1 45 tion

[7340] 3 8 ) 2 4

[7341] E

[7342] 1 0 Val4088Va Likely

[7343] X 12264G> A Synonymous

[7344] 9 8 1 Benign (1 45

[7345] 4 8 ) 2 4

[7346] E Truncating: 1 1 0 Gly4089fs Pathog X 12266_12267delGG Deletion / Inser

[7347] 9 8 66X enic (1 45 tion

[7348] 5 9 ) 2 4

[7349] E

[7350] 1 0 Leu4090Le Likely

[7351] X 12270C>G Synonymous

[7352] 9 9 u Benign (3 45

[7353] 6 0 ) 2 4

[7354] E Truncating: 1 1 0 Ala4092fs Pathog X 12274delG Deletion / Inser

[7355] 9 9 105X enic (1 45 tion

[7356] 7 2 ) 2 4

[7357] E

[7358] 1 0 Ala4092Al Likely

[7359] X 12276A> C Synonymous

[7360] 9 9 a Benign (3 45

[7361] 8 2 ) 2 4

[7362] E

[7363] 1 0 Ala4092Al Likely

[7364] X 12276A> G Synonymous

[7365] 9 9 a Benign (1 45

[7366] 9 2 1) 2 4

[7367] E

[7368] 2 0 Ala4092Al Likely

[7369] X 12276A> T Synonymous

[7370] 0 9 a Benign (1 45

[7371]

[7372] 0 2 )

[7373] 2 4

[7374] Nontruncati 1 2 EX4 0

[7375] 12277C>G Leu4093Val ng:

[7376] 0 5 9 vus (1

[7377] Missense

[7378] 1 3 ) 2 4

[7379] Nontruncati 1 2 EX4 0

[7380] 12286T> C Trp4096Arg

[7381] 0 5 9 ng: vus (1

[7382] Missense

[7383] 2 6 ) 2 4

[7384] 1 2 EX4 0 Truncating: Pathog 12287G> A Trp4096X

[7385] 0 5 9 Nonsense enic (1

[7386]

[7387] 3 6 )

[7388] 208

[7389] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7390] 2 4

[7391] Nontruncati Likely 2 EX4 0

[7392] 12292G> A Ala4098Thr Benig 0 5 9 ng: (1

[7393] Missense n

[7394] 4 8 ) 2 4

[7395] Nontruncati Likely 2 EX4 1

[7396] 12305G> A Gly4102Glu Benig 0 5 0 ng: (1

[7397] Missense n

[7398] 5 2 ) 2 4

[7399] Truncating: 1 2 EX4 1 Pathog 12307_12308insG Ala4103fs53X Deletion / Ins 0 5 0 enic (1 ertion

[7400] 6 3 ) 2 4

[7401] Truncating: 1 2 EX4 1 Pathog 12310_12313delGTTA Val4104fs93X Deletion / Ins 0 5 0 enic (1 ertion

[7402] 7 4 ) 2 4

[7403] Truncating: 1 2 EX4 1 Pathog 12313_12314insA Ile4105fs51X Deletion / Ins 0 5 0 enic (1 ertion

[7404] 8 5 ) 2 4

[7405] Nontruncati 1 2 EX4 1

[7406] 12317T> C Leu4106Pro

[7407] 0 5 0 ng: vus (1

[7408] Missense

[7409] 9 6 ) 2 4

[7410] 1 2 EX4 1 Truncating: Pathog 12330C>G Tyr4110X

[7411] 1 5 1 Nonsense enic (1 0 0 ) 2 4

[7412] Truncating: 1 2 EX4 1 Pathog 12332delA His4111fs86X Deletion / Ins 1 5 1 enic (1 ertion

[7413] 1 1 ) 2 4

[7414] Likely 2 EX4 1

[7415] 12337T> C Leu4113Leu Synonymous Benig 1 5 1 (1 n

[7416] 2 3 ) 2 4

[7417] Nontruncati Likely 2 EX4 1

[7418] 12339G> C Leu4113Phe Beni 1 5 1 ng: g (1

[7419] Missense n

[7420] 3 3 ) 2 4

[7421] Likely 2 EX4 1

[7422] 12360G> A Pro4120Pro Synonymous Benig 1 5 2 (1 n

[7423]

[7424] 4 0 )

[7425] 209

[7426] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7427] 2 4

[7428] Nontruncati Likely 2 EX4 1

[7429] 12370C>T Pro4124Ser Benig 1 5 2 ng: (1

[7430] Missense n

[7431] 5 4 ) 2 4

[7432] 5 2 EX4 1 Truncating: Pathog 12373C>T Gln4125X

[7433] 1 5 2 (4

[7434] Nonsense enic

[7435] 6 5 ) 2 4

[7436] 4 2 EX4 1 Truncating: Pathog 12381C>G Tyr4127X

[7437] 1 5 2 Nonsense enic (4 7 7 ) 2 4

[7438] 1 2 EX4 1 Truncating: Pathog 12382G> T Glu4128X

[7439] 1 5 2 Nonsense enic (1 8 8 ) 2 4

[7440] Truncating: 1 2 EX4 1 Pathog 12385delA Met4129fs68X Deletion / Ins 1 5 2 enic (1 ertion

[7441] 9 9 ) 2 4 Nontruncati

[7442] Likely 2 2 EX4 1

[7443] 12389_12391delTGG Val4130del ng: Pathog 2 5 3 Deletion / Ins (2 enic

[7444] 0 0 ertion ) 2 4 Nontruncati

[7445] Likely 1 2 EX4 1 ng:

[7446] 12391_12393delGAG Glu4131del Pathog 2 5 3 Deletion / Ins (1 enic

[7447] 1 1 ertion ) 2 4 Nontruncati

[7448] Likely 1 2 EX4 1

[7449] 12396_12398delGTT ng:

[7450] Leu4132del Pathog 2 5 3 Deletion / Ins (1 enic

[7451] 2 2 ertion ) 2 4 Nontruncati

[7452] 1 2 EX4 1 12400 12408delCTGCG Leu4134 Arg4 ng: Pathog 2 5 3 CAGG 136del3 Deletion / Ins enic (1 3 4 ertion ) 2 4

[7453] Truncating: 2 2 EX4 1 Pathog 12400delC Leu4134fs63X Deletion / Ins 2 5 3 enic (1 ertion

[7454] 4 4 ) 2 4

[7455] Likely 2 EX4 1

[7456] 12402G> A Leu4134Leu Synonymous Benig 2 5 3 (1 n

[7457]

[7458] 5 4 )

[7459] 210

[7460] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7461] 2 4

[7462] Nontruncati Likely 1 2 EX4 1

[7463] 12406A>G Arg4136Gly Pathog 2 5 3 ng: (1

[7464] Missense enic

[7465] 6 6 ) 2 4 Nontruncati

[7466] 12409 12420delCTGCG 1 2 EX4 1 Leu4137_Trp4 ng: Pathog CCTCTGG (SEQ ID

[7467] 2 5 3 140del4 Deletion / Ins enic (1

[7468] NO:78)

[7469] 7 7 ertion ) 2 4

[7470] Likely 2 EX4 1

[7471] 12409C>T Leu4137Leu Synonymous Benig 2 5 3 (8 n

[7472] 8 7 ) 2 4

[7473] Truncating: 2 2 EX4 1 Pathog 12409delC Leu4137fs60X Deletion / Ins 2 5 3 enic (2 ertion

[7474] 9 7 ) 2 4

[7475] Nontruncati Likely 3 2 EX4 1

[7476] 12410T>C Leu4137Pro ng: Pathog 3 5 3 (2

[7477] Missense enic

[7478] 0 7 ) 2 4

[7479] Nontruncati 1 2 EX4 1

[7480] 12413G>A Arg4138His

[7481] 3 5 3 ng: vus (1

[7482] Missense

[7483] 1 8 ) 2 4

[7484] Nontruncati Likely 1 2 EX4 1

[7485] 12416T>C Leu4139Pro Pathog 3 5 3 ng: (1

[7486] Missense enic

[7487] 2 9 ) 2 4

[7488] 3 2 EX4 1 Truncating: Pathog 12420G>A Trp4140X

[7489] 3 5 4 Nonsense enic (2 3 0 ) 2 4

[7490] Truncating: 1 2 EX4 1 Pathog 12421_12422insA Met4141fsl6X Deletion / Ins 3 5 4 enic (1 ertion

[7491] 4 1 ) 2 4

[7492] Nontruncati 1 2 EX4 1

[7493] 12431G>C Ser4144Thr ng: VUS 3 5 4 (1

[7494] Missense

[7495] 5 4 ) 2 4

[7496] Nontruncati Likely 2 EX4 1

[7497] 12436G>A Val4146Ile Benig 3 5 4 ng: (5

[7498] Missense n

[7499]

[7500] 6 6 )

[7501] 211

[7502] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7503] 2 4

[7504] Likely 2 IVS 1 Likely Silent

[7505] 12444+17_-16insG Silent Benig 3 45 4 IVS (1 n

[7506] 7 8 ) 2 4

[7507] Likely 2 IVS 1 Likely Silent

[7508] 12444+23_+24insG Silent Benig 3 45 4 IVS (3 n

[7509] 8 8 ) 2 4

[7510] 1 2 IVS 1

[7511] 12444+34_+47dell4 Unknown IVS Unknown 3 45 4 vus (1 9 8 ) 2 4

[7512] Likely 2 IVS 1 Likely Silent

[7513] 12444+34G>T Silent Benig 4 45 4 IVS (1 n

[7514] 0 8 ) 2 4

[7515] Likely 1 2 IVS 1 Glu4148fs

[7516] 12445_12500del56 Splice Pathog 4 45 4 Nontruncating: (1 enic

[7517] 1 8 ) 2 4

[7518] Glu4148 Phe4 Likely 1 2 IVS 1

[7519] 12445_12446ins90 149ins30 Splice Pathog 4 45 4 (1

[7520] Nontruncating: enic

[7521] 2 8 ) 2 4

[7522] Likely 2 IVS 1 Likely Silent

[7523] 12445-9C>T Silent Benig 4 45 4 IVS (1 n

[7524] 3 8 ) 2 IVS 4

[7525] 12445- 1 2 45_ 1 Phe4149fs48X Pathog 5 1245 IdelCCCAGTTC Splice

[7526] 4 EX4 4 Nontruncating: enic (1

[7527] CGCC (SEQ ID NO:79)

[7528] 4 6 8 ) 2 4

[7529] Likely 1 2 IVS 1 Glu4148fs

[7530] 12445-3C>G Splice Pathog 4 45 4 Nontruncating: (1 enic

[7531] 5 8 ) 2 4

[7532] 2 2 IVS 1 Glu4149fs Pathog 12445-1G>A Splice

[7533] 4 45 4 Truncating: enic (2 6 9 ) 2 4

[7534] Likely 2 EX4 1

[7535] 12447C>T Phe4149Phe Synonymous Benig 4 6 4 (1 n

[7536]

[7537] 7 9 )

[7538] 212

[7539] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7540] 2 4

[7541] Nontruncati Likely 7 2 EX4 1

[7542] 12448C>T Arg4150Cys Pathog 4 6 5 ng: (4

[7543] Missense enic

[7544] 8 0 ) 2 4

[7545] Nontruncati 1 2 EX4 1

[7546] 12449G>A Arg4150His

[7547] 4 6 5 ng: vus (1

[7548] Missense

[7549] 9 0 ) 2 4 Nontruncati

[7550] 12451 12452insCCCAG 1 2 EX4 1 His415 Idelins ng: Pathog TTCCGCC (SEQ ID

[7551] 5 6 5 ProGlnPhe A Deletion / Ins enic (1

[7552] NO:80)

[7553] 0 1 ertion ) 2 4

[7554] Nontruncati 1 2 EX4 1

[7555] 12455A>C Lys4152Thr ng: VUS 5 6 5 (1

[7556] Missense

[7557] 1 2 ) 2 4

[7558] Likely 2 EX4 1

[7559] 12459C>T Val4153Val Synonymous Benig 5 6 5 (2 n

[7560] 2 2 ) 2 4

[7561] Nontruncati 6 2 EX4 1

[7562] 12460C>T Arg4154Cys VUS 5 6 5 ng: (2

[7563] Missense

[7564] 3 4 ) 2 4

[7565] Nontruncati Likely 2 2 EX4 1

[7566] 12463T>G Phe4155Val Pathog 5 6 5 ng: (1

[7567] Missense enic

[7568] 4 5 ) 2 4

[7569] Nontruncati 1 2 EX4 1

[7570] 12465T>G Phe4155Leu ng: VUS 5 6 5 (1

[7571] Missense

[7572] 5 5 ) 2 4

[7573] Nontruncati 1 2 EX4 1

[7574] 12469G>A Gly4157Arg

[7575] 5 6 5 ng: vus (1

[7576] Missense

[7577] 6 7 ) 2 4

[7578] Nontruncati 1 2 EX4 1

[7579] 12473T>C Met4158Thr

[7580] 5 6 5 ng: vus (1

[7581] Missense

[7582] 7 8 ) 2 4

[7583] 12483_12493delGCCCT Truncating: 1 2 EX4 1 Pathog CTCGCT (SEQ ID Leu4161fs44X Deletion / Ins 5 6 6 enic (1

[7584] NO:81) ertion

[7585]

[7586] 8 1 )

[7587] 213

[7588] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7589] 2 4

[7590] Likely 2 EX4 1

[7591] 12486C>A Pro4162Pro Synonymous Benig 5 6 6 (1 n

[7592] 9 2 ) 2 4

[7593] Likely 2 EX4 1

[7594] 12489T>G Ser4163Ser Synonymous Benig 6 6 6 (1 n

[7595] 0 3 ) 2 4

[7596] Truncating: 1 2 EX4 1 Pathog 12514delT Ser4172fs25X Deletion / Ins 6 6 7 enic (1 ertion

[7597] 1 2 ) 2 4

[7598] Nontruncati Likely 2 EX4 1

[7599] 12526C>A Pro4176Thr Benig 6 6 7 ng: (1

[7600] Missense n

[7601] 2 6 ) 2 4

[7602] 12530 12531insAAGGT Truncating: 1 2 EX4 1 CPro4177fs28 Pathog ATCCCCGGATGTGCC Deletion / Ins 6 6 7 X enic (1

[7603] (SEQ ID NO:82) ertion

[7604] 3 7 ) 2 4

[7605] Truncating: 1 2 EX4 1 Pathog 12530_12531insC Pro4178fs32X Deletion / Ins 6 6 7 enic (1 ertion

[7606] 4 8 ) 2 4

[7607] Truncating: 1 2 EX4 1 Pathog 12531_12532insA Pro4178fs32X Deletion / Ins 6 6 7 enic (1 ertion

[7608] 5 8 ) 2 4

[7609] Truncating: 1 2 EX4 1 Pathog 12531delA Pro4178fsl9X Deletion / Ins 6 6 7 enic (1 ertion

[7610] 6 8 ) 2 4

[7611] Truncating: 1 2 EX4 1 Pathog 12534_12537delCAGC Pro4179fsl8X Deletion / Ins 6 6 7 enic (1 ertion

[7612] 7 9 ) 2 4

[7613] 12544_12560delTCCGA Truncating: 1 2 EX4 1 Pathog TGCCTCGCACCC (SEQ Ser4182fs22X Deletion / Ins 6 6 8 enic (1

[7614] ID NO:83) ertion

[7615] 8 2 ) 2 4

[7616] Likely 2 EX4 1

[7617] 12546C>T Ser4182Ser Synonymous Benig 6 6 8 (1 n

[7618]

[7619] 9 2 )

[7620] 214

[7621] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7622] 2 4

[7623] Nontruncati 1 2 EX4 1

[7624] 12554C>G Ser4185Trp ng: VUS 7 6 8 (1

[7625] Missense

[7626] 0 5 ) 2 4

[7627] Truncating: 2 2 EX4 1 Pathog 12564_12565insC Ser 4188fs21X Deletion / Ins 7 6 8 (2 enic ertion

[7628] 1 8 ) 2 4

[7629] Truncating: 1 2 EX4 1 Pathog 12568_12569insT Ser4190fs20X Deletion / Ins 7 6 9 enic (1 ertion

[7630] 2 0 ) 2 4

[7631] Nontruncati Likely 2 EX4 1

[7632] 12569C>T Ser4190Phe ng Benig 7 6 9: (3

[7633] Missense n

[7634] 3 0 ) 2 4

[7635] Likely 2 EX4 1

[7636] 12570C>T Ser4190Ser Synonymous Benig 7 6 9 (1 n

[7637] 4 0 ) 2 4

[7638] Truncating: 1 2 EX4 1 Pathog 12580_12581insCAGC Leu4194fsl7X Deletion / Ins 7 6 9 enic (1 ertion

[7639] 5 4 ) 2 4

[7640] 12593_12620delGCGTG Truncating: 1 2 EX4 1 Ser4198fsl50 Pathog AGCCTGGGCCGGCTG Deletion / Ins 7 6 9 X enic (2

[7641] (SEQ ID NO:84) ertion

[7642] 6 8 ) 2 4

[7643] 12604_12631delGGCCG Truncating: 1 2 EX4 2 Gly4202fsl46 Pathog GCTGGGGACAAGGTG Deletion / Ins 7 6 0 X enic (1

[7644] (SEQ ID NO:85) ertion

[7645] 7 2 ) 2 4

[7646] 12605_12632delGCCGG Truncating: 2 2 EX4 2 GGly4202fsl4 Pathog CTGGGGACAAGGTGT Deletion / Ins 7 6 0 6X enic (1

[7647] (SEQ ID NO:86) ertion

[7648] 8 2 ) 2 4

[7649] 12608_12635delGGCTG Truncating: 2 2 EX4 2 CArg4203fs92 Pathog GGGACAAGGTGTGAG Deletion / Ins 7 6 0 X enic (2

[7650] (SEQ ID NO:87) ertion

[7651] 9 3 ) 2 4

[7652] Truncating: 1 2 EX4 2 Pathog 12624_12625delTG Cys4208X Deletion / Ins 8 6 0 enic (1 ertion

[7653]

[7654] 0 8 )

[7655] 215

[7656] 57068938 1Attorney Docket No. 047162-7549WOl(02845) 2 4

[7657] 1 2 EX4 2 Truncating: Pathog 12624T>A Cys4208X

[7658] 8 6 0 Nonsense enic (1 1 8 ) 2 4

[7659] Likely 2 EX4 2

[7660] 12630T>C Pro4210Pro Synonymous Benig 8 6 1 (1 n

[7661] 2 0 1) 2 4

[7662] Truncating: 1 2 EX4 2 Pro4212fsl54 Pathog 12635_12636ins28 Deletion / Ins 8 6 1 X enic (1 ertion

[7663] 3 2 ) 2 4

[7664] 2 2 EX4 2 Truncating: Pathog 12646C>T Gln4216X

[7665] 8 6 1 Nonsense enic (1 4 6 ) 2 4

[7666] Nontruncati Likely 2 EX4 2

[7667] 12648A>C Gln4216His ng: Benig 8 6 1 (2

[7668] Missense n

[7669] 5 6 ) 2 4

[7670] Likely 2 EX4 2

[7671] 12651C>T Ala4217Ala Synonymous Benig 8 6 1 (1 n

[7672] 6 7 ) 2 4

[7673] Truncating: 1 2 EX4 2 Pathog 12651delC Ala4217fs86X Deletion / Ins 8 6 1 enic (1 ertion

[7674] 7 7 ) 2 4

[7675] Likely 2 EX4 2

[7676] 12657C>T Phe4219Phe Synonymous Benig 8 6 1 (1 n

[7677] 8 9 ) 2 4

[7678] Nontruncati 1 2 EX4 2

[7679] 12658G>C Glu4220Gln

[7680] 8 6 2 ng: vus (1

[7681] Missense

[7682] 9 0 ) 2 4

[7683] 2 2 EX4 2 Truncating: Pathog 12658G>T Glu4220X

[7684] 9 6 2 Nonsense enic (2 0 0 ) 2 4

[7685] Likely 2 EX4 2

[7686] 12664C>T Leu4222Leu Synonymous Benig 9 6 2 (2 n

[7687] 1 2 )

[7688]

[7689] 216

[7690] 57068938 1Attorney Docket No. 047162-7549WOl(02845)

[7691] 2 4

[7692] Truncating: 1 2 EX4 2 Pathog 12666_12667insG Leu...

Claims

1. Attorney Docket No. 047162-7549WOl(02845)CLAIMSWhat is claimed is:

1. A method of treating, ameliorating and / or preventing polycystic kidney disease or polycystic liver disease in a subject in need thereof, the method comprises:administering to the subject an effective amount of a genetic editing agent to correct a PKD1 mutation or PKD2 mutation that causes the polycystic kidney disease or the polycystic liver disease, or convert the mutant PKD1 or mutant PKD2 into a non -pathogenic PKD1 or non-pathogenic PKD2.

2. The method of claim 1, wherein the PKD1 mutation or PKD2 mutation comprises at least one selected from the mutations listed in Table 1 and Table 2.

3. The method of any one of claims 1-3, wherein the PKD1 mutation or PKD2 mutation is a germline mutation or a somatic mutation.

4. The method of any one of claims 1-3, wherein the genetic editing agent is a base editing agent.

5. The method of any one of claims 1-4, wherein the genetic editing agent is a CRISPR-based base editing agent.

6. The method of any one of claims 1-5, wherein the genetic editing agent comprises an adenine base editor or a cytosine base editor.

7. The method of claim 6, wherein the genetic editing agent further comprises a guide RNA (gRNA) that target the genetic editing agent to the mutation of PKD1 or PKD2 such that genetic editing agent is targeted to the base to be altered.

8. The method of claim 7, wherein the adenine base editor or the cytosine base editor, and / or the gRNA are administered as one or more nucleic acids encoding the adenine base editor or the cytosine base editor, and / or the gRNA.25857068938 1Attorney Docket No. 047162-7549WOl(02845)9. The method of claim 7, wherein the adenine base editor or the cytosine base editor, and / or the gRNA are administered as one or more viral vectors encoding the adenine base editor or the cytosine base editor, and / or the gRNA.

10. The method of claim 9, wherein the one or more viral vectors comprises a first viral vector and a second viral vector, and wherein the adenine base editor or the cytosine base editor is administered as the first viral vector encoding the adenine base editor or the cytosine base editor, and the gRNA is administered as the second viral vector encoding the gRNA.

11. The method of any one of claims 9-10, wherein the one or more viral vectors are adeno-associated virus vectors (AAVs).

12. The method of claim 11, wherein the AAV vectors are AAV-8 vectors.

13. The method of any one of claims 1-12, wherein the genetic editing agent reduces PDK1 gene or PKD2 gene carrying the targeting mutation by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60%o or more, about 70% or more, about 80% or more, about 90%> or more, or 100% in the affected tissue.

14. The method of any one of claims 1-13, wherein the polycystic kidney disease or the polycystic liver disease is caused by R2220W mutation in the PKD1 gene.

15. The method of claim 14, wherein the method restores the defect in PCI cleavage.

16. The method of any one of claims 1-15, wherein the method further comprises:acquiring a sample from the subject; andascertaining that the sample carries the PKD1 mutation or PKD2 mutation that causes the polycystic kidney disease or the polycystic liver disease.25957068938 1Attorney Docket No. 047162-7549WOl(02845)17. The method of any one of claims 1-16, wherein the sample is a kidney sample or a liver sample.

18. The method of any one of claims 16-17, further comprises: determining a first percentage of PKD1 gene or PKD2 gene that harboring the PKD1 mutation or the PKD2 mutation before the administration of the genetic editing agent.

19. The method of claim 18, wherein the method further comprises:determining a second percentage of PKD1 gene or PKD2 gene that harboring the PKD1 mutation or the PKD2 mutation after the administration of the genetic editing agent; and comparing the first percentage and the second percentage to evaluate the effectiveness of the genetic editing agent.

20. The method of any one of claims 1-19, wherein the subject is a mammal.

21. The method of any one of claims 1-20, wherein the subject is a human.

22. A kit, comprising:a first viral vector, which encodes an adenine base editor or a cytosine base editor; and a second viral vector, which encodes a gRNA that targets the adenine base editor or the cytosine base editor to PKD1 gene or PKD2 gen to correct a PKD1 mutation or PKD2 mutation that causes polycystic kidney disease or polycystic liver disease, or convert the mutant PKD1 or mutant PKD2 into a non-pathogenic PKD1 or non-pathogenic PKD2.

23. The kit of claim 22, wherein the PKD1 mutation or PKD2 mutation comprises at least one selected from those listed in Table 1 and Table 2.

24. The kit of any one selected from claims 22-23, wherein the first viral vector and / or the second viral vector are AAV vectors.26057068938 1Attorney Docket No. 047162-7549WO1(02845)25. The kit of any one of claims 22-24, further comprises an instruction material instructing that the first viral vector and the second vector are to be administered to a subject suffering polycystic kidney disease or polycystic liver disease, wherein the polycystic kidney disease or polycystic liver disease is caused by the PKD1 mutation or PKD2 mutation.

26. The kit of any one of claims 22-25, wherein the PKD1 mutation or PKD2 mutation is R2220W mutation in the PKD1 gene.

27. A method of treating, ameliorating and / or preventing polycystic kidney disease or polycystic liver disease in a subject in need thereof, the method comprises:administering to the subject an effective amount of:(a) a genetic editing agent to disrupt an upstream open reading frame (uORF) in the PKD1 5’UTR, and / or a microRNA binding motif in the PKD1 3’UTR, and / or (b) genetic editing agent to disrupt the Ca2+-binding of the EF-hand in PKD2.

28. The method of claim 27, wherein the genetic editing agent is a base editing agent.

29. The method of any one of claims 27-28, wherein the genetic editing agent is a CRISPR-based base editing agent.

30. The method of any one of claims 27-39, wherein the genetic editing agent comprises an adenine base editor or a cytosine base editor.

31. The method of claim 30, wherein the genetic editing agent further comprises a guide RNA (gRNA) that target the genetic editing agent to the uORF in the PKD1 5’UTR, the microRNA binding motif in the PKD1 3’UTR, and / or the EF-hand in PKD2.

32. The method of claim 31, wherein the adenine base editor or the cytosine base editor, and / or the gRNA are administered as one or more nucleic acids encoding the adenine base editor or the cytosine base editor, and / or the gRNA.26157068938 1Attorney Docket No. 047162-7549WO1(02845)33. The method of claim 31, wherein the adenine base editor or the cytosine base editor, and / or the gRNA are administered as one or more viral vectors encoding the adenine base editor or the cytosine base editor, and / or the gRNA.

34. The method of claim 33, wherein the one or more viral vectors comprises a first viral vector and a second viral vector, and wherein the adenine base editor or the cytosine base editor is administered as the first viral vector encoding the adenine base editor or the cytosine base editor, and the gRNA is administered as the second viral vector encoding the gRNA.

35. The method of any one of claims 33-34, wherein the one or more viral vectors are adeno-associated virus vectors (AAVs).

36. The method of claim 35, wherein the AAV vectors are AAV-8 vectors.

37. The method of any one of claims 27-36, wherein the genetic editing agent increases PDK1 protein dosage by about 10% or more, about 20% or more, about 30% or more, about 40% or more, about 50% or more, about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 100% or more, about 200% or more, or about 500% or more in the affected tissue.

38. The method of any one of claims 27-37, wherein at least one of the following applies:(a) the genetic editing agent disrupts the adenine in the initiation codon in any one of SEQ ID NOs:95-97,(b) the genetic editing agent disrupts one or more adenines and / or one or more cytosines in any one of SEQ ID NOs:98-99,(c) the genetic editing agent replaces the codon encoding Thr771 or Glu774 in PKD2 with codons encoding another amino acid residue,(d) the genetic editing agent replaces the codon encoding Thr771 in PKD2 with a codon encoding alanine,(e) the genetic editing agent replaces the codon encoding Glu774 in PKD2 with a codon encoding lysine or glycine.26257068938 1Attorney Docket No. 047162-7549WO1(02845)39. The method of any one of claims 27-38, wherein the subject is a mammal.

40. The method of any one of claims 27-39, wherein the subject is a human.

41. A kit, comprising:a first viral vector, which encodes an adenine base editor or a cytosine base editor; and a second viral vector, which encodes a gRNA that targets the adenine base editor or the cytosine base editor to an upstream open reading frame (uORF) in the PKD1 5’UTR, a microRNA binding motif in the PKD1 3’UTR, and / or the EF-hand in PKD2.

42. The kit of claim 41, wherein at least one of the following applies:(a) the gRNA targets the adenine base editor to change the adenine in the initiation codon in any one of SEQ ID NOs:95-97,(b) the gRNA targets adenine base editor or the cytosine base editor to change one or more adenines and / or one or more cytosines in any one of SEQ ID NOs:98-99,(c) the gRNA targets adenine base editor or the cytosine base editor to replace the codon encoding Thr771 or Glu774 in PKD2 with codons encoding another amino acid residue, (d) the gRNA targets adenine base editor or the cytosine base editor to replace the codon encoding Thr771 in PKD2 with a codon encoding alanine,(e) the gRNA targets adenine base editor or the cytosine base editor to replace the codon encoding Glu774 in PKD2 with a codon encoding lysine or glycine.

43. The kit of any one of claims 41-42, wherein the first viral vector and / or the second viral vector are AAV vectors.

43. The kit of any one of claims 41-43, further comprises an instruction material instructing that the first viral vector and the second vector are to be administered to a subject suffering polycystic kidney disease or polycystic liver disease, wherein the polycystic kidney disease or polycystic liver disease is caused by insufficient dosage and / or activity of PKD1.26357068938 1

Images