Compositions comprising DNA vectors for long-term, in VIVO expression of protein

The method of administering DNA vectors with regulatory sequences and electroporation in skeletal muscle cells addresses the limitations of AAV and RNA vectors, enabling long-term therapeutic protein expression and reducing re-dosing frequency.

WO2026156371A2PCT designated stage Publication Date: 2026-07-23THE WISTAR INST OF ANATOMY & BIOLOGY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
THE WISTAR INST OF ANATOMY & BIOLOGY
Filing Date
2026-01-20
Publication Date
2026-07-23

AI Technical Summary

Technical Problem

Existing gene therapy vectors, such as AAV and RNA vectors, face limitations including autoreactivity in patients, short-term efficacy, and potential liver toxicity, hindering long-term expression and repeated dosing.

Method used

A method involving the administration of a nucleic acid molecule, primarily DNA, with a regulatory sequence, to skeletal muscle cells, followed by electroporation, allowing stable transfection and expression of therapeutic proteins like monoclonal antibodies for up to 96 weeks without re-dosing, using compositions that may include hyaluronidase.

Benefits of technology

Achieves long-term expression of therapeutic proteins in skeletal muscle cells for over 70 weeks with minimal autoreactivity and liver toxicity, maintaining effective serum concentrations and functional activity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2026011866_23072026_PF_FP_ABST
    Figure US2026011866_23072026_PF_FP_ABST
Patent Text Reader

Abstract

The disclosure generally relates to compositions comprising gene therapy vectors and methods for stably expressing the same over a period of at least about 50 weeks.
Need to check novelty before this filing date? Find Prior Art

Description

COMPOSITIONS COMPRISING DNA VECTORS FOR LONG-TERM, IN VIVO EXPRESSION OF PROTEINCROSS REFERENCE TO RELATED APPLICATIONSThis application claims the benefit of U.S. provisional application No. 63 / 746,901, which was filed January 17, 2025, entitled "Composition Comprising DNA Vectors for Long-Term, In Vivo Expression of Protein," and U.S. provisional application No. 63 / 761,967, which was filed February 22, 2025, and entitled "Composition Comprising DNA Vectors for Long-Term, In Vivo Expression of Protein," both of which are incorporated by reference in their entireties.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCHThis invention was made with government support under HR0011-21-9-0001 awarded by the Defense Advanced Research Projects Agency (DARPA). The government has certain rights in the invention.SEQUENCE LISTINGThe sequence listing filed herewith, titled "WIST-013-PCT_SL.xml," created on January 16, 2026, and having a file size of 145,725 bytes is incorporated herein by reference in its entirety.FIELD OF THE INVENTIONThe disclosure generally relates to compositions comprising gene therapy vectors and methods of using the same for long-term in vivo expression in subjects. The disclosure provides compositions comprising an expressible nucleic acid sequence comprising a first nucleic acid sequence encoding a monoclonal antibody or a pharmaceutically acceptable salt thereof.BACKGROUNDAdeno-associated virus ("AAV") has been demonstrated as a useful vehicle for human gene therapy, however, autoreactivity of AAV still limits expansive use of the vectors. Between 40% and 60% of human patients who receive AAV gene therapy vectors experience autoreactivity to the vectors. Additionally, only about 30% of patients that receive AAV gene therapy vectors and do not exhibit autoreactivity problems also experience long-term benefit from a single injection. The complications with AAV vectors prevent multiple doses of patients who receive AAV gene therapy.RNA gene therapy vectors also have well-known limitations. While RNA vectors can be formulated with various lipids to protect the nucleic acid from degradation, RNA vectors are still susceptible to significant degradation after transducing target cells, especially over weeks of time. Repeated exposures to RNA vectors have also been known to cause liver toxicity.SUMMARYIn some embodiments, the disclosure relates to a method of stably delivering a nucleic acid sequence to a subject in need thereof. In some embodiments, the method comprises (a) administering to the subject a composition comprising nucleic acid molecule. In some embodiments, the nucleic acid molecule comprises at least one nucleic acid molecule comprising deoxyribonucleic acid, the nuceleic acid molecule comprising: (i) an expressible nucleic acid sequence encoding a therapeutic protein; and (ii) a backbone comprising a regulatory sequence operably linked to the at least one expressible nucleic acid sequence. In some embodiments, the method further comprises (b) allowing a time period sufficient for the nucleic acid molecule to stably transfect one or a plurality of skeletal muscle cell of the subject. In some embodiments, the nucleic acid molecule is a plasmid comprising from about 80% to about 100% deoxyribonucleic acid (DNA). In some embodiments, the nucleic acid molecule is a plasmid is DNA and free of RNA. In some embodiments, the method further comprises performing an electroporating step at the site of administration after or contemporaneously with the step of administering. In some embodiments, the therapeutic protein comprises a monoclonal antibody or functional variant thereof. In some embodiments, the step of administering is performed by intramuscular injection. In some embodiments, the step of administering is performed by intradermal injection. In some embodiments, the mehtod further comprises allowing a time period sufficient for a skeletal muscle cell to become transfected with the nucleic acid molecule after the step of administering. In some embodiments, the method further comprises allowing expression of the therapeutic protein in the skeletal muscle cell for no less than about 70 weeks. In some embodiments, the therapeutic protein in the skeletal muscle occurs for no less than about 96 weeks. In some embodiments, the monoclonal antibody or variant thereof is a humanized monoclonal antibody or functional variant thereof that binds an epitope from a pathogen antigen or a tumor-associated antigen with an IC50 from about 1 nM to about 700 nM. In some embodiments, the composition further comprises hyaluronidase or a functional variant thereof. In some embodiments, the method is free of re-dosing for at least about 70 weeks. In some embodiments, the step of administering comprises administering a pharmaceutically effective dose of the composition. In some embodiments, the pharmaceutically effective dose is from about 200 mg to about 400 mg of nucleic acid molecule. In some embodiments, the composition comprises from about 1 mic+rogram per milliliter of nucleic acid molecule to about 100 micrograms per milliliter of nucleic acid molecule in a liquid formulation. In some embodiments, the step of electroporating comprises exposing the subject to a repeated pattern of from about 1 to about 1000 volts at about 30 microseconds increment over a period of about 4 seconds. In some embodiments, the composition is a liquid dosage form administered by intramuscular or intradermal injection and the hyaluronidase or a functional variant thereof is at a concentration of from about 0.1 micromolar to about 1.0 micormolar.In some embodiments, the disclosure relates to a method of expressing a nucleic acid sequence in a subject for more than about 70 weeks in need thereof. In some embodiments, the method comprises (a) administering to the subject a composition comprising nucleic acid molecule. In some embodiments, the nucleic acid molecule comprises at least one expressible nucleic acid sequence comprising DNA a comprising: (i) a nucleic acid sequence encoding a therapeutic protein and (ii) a backbone comprising a regulatory sequence operably linked to the at least one expressible nucleic acid sequence. In some embodiments, the method also comprises (b) allowing a time period sufficient for the nucleic acid molecule to stably transfect one or a plurality of skeletal muscle cells of the subject. In some embodiments, the method also comprises (c) allowing a time period for expression of the nucleic acid sequence; wherein the time period for expression is no less than about 70 weeks. In some embodiments, the method further comprises performing an electroporating step at the site of administration after or contemporaneously with the step of administering. In some embodiments, the therapeutic protein comprises a monoclonal antibody or functional variant thereof. In some embodiments, the step of administering is performed by intramuscular injection. In some embodiments, the step of administering is performed by intradermal injection. In some embodiments, the method further comprises allowing a time period sufficient for a skeletal muscle cell to become stably transfected with the nucleic acid molecule after the step of administering. In some embodiments, the method is free of integration in endogenous DNA of the skeletal muscle cell. In some embodiments, the expression of the therapeutic protein in the skeletal muscle occurs for no less than about 96 weeks. In some embodiments, the therapeutic protein is a humanized monoclonal antibody or functional variant thereof that binds an epitope from a pathogen antigen or a tumor-associated antigen with an IC50 from about 1 nM to about 700 nM. In some embodiments, the composition further comprises hyaluronidase or a functional variant thereof. In some embodiments, the method is free of any re-dosing or repeatead administratin step for at least about 70 weeks. In some embodiments, the step of administering comprises administering a pharmaceutically effective dose of the composition. In some embodiments, the pharmaceutically effective dose is from about 200 micrograms to about 240 milligrams of the nucleic acid molecule. In some embodiments, the composition comprises from about 1 microgram per milliliter of nucleic acid molecule to about 100 micrograms per milliliter of nucleic acid molecule in a liquid formulation. In some embodiments, the step of electroporating comprises exposing the subject to a repeated pattern of from about 0.5 volts to about 25 volts at about 30 microsecond increments over a period of about 4 seconds. In some embodiments, the composition is a liquid dosage form administered by intramuscular or intradermal injection and the hyaluronidase or a functional variant thereof is at a concentration of from about 0.1 micromolar to about 1.0 micormolar.BRIEF DESCRIPTION OF THE DRAWINGSFIG. 1 illustrate a clinical trial protocol.FIG. 2 illustrates a SARS-CoV-2-dMAB01 Study Design.FIGS. 3A and 3B illustrate SARS-CoV-2-dMAB01 Cohort Al Data (0.5mg) - human serum level data up to week 96. *New samples. 6302-0014 clinical demographic and dosing data were normal. BMI of 25.4. Received flu and COVID vaccine 14 days after DO odosing.FIGS. 4A-4C illustrate SARS-CoV-2-dMAB01 Cohort A2 Data (1.0mg) — Serum level data up to week 96. AZD5396 and AZD8076 detected in all Cohort A2 subjects. MAbs detected 96 weeks post treatment in all three subjects. *New samples.FIGS. 5A-5C illustrate SARS-CoV-2-dMAB01 Cohort B Data (2x 0.5 mg) — Serum level data up to week 72. The box around 6302-0018, 6302-0019, and 6302-0020 indicates profusion needles. ¹Leakage for subject 6302-0011 for Day 3 AZD5396 injection. Participants 6302-0011, 6302-0013 and 6302-0019 selected for Plasma Apheresis. AZD5396 and AZD8076 detected in all Cohort B subjects through week 72.FIGS. 6A-6C illustrate SARS-CoV-2-dMAB01 Cohort C Data (2x 1 mg) — Serum level data up to week 72. ¹6302-0023 did not receive Day 3 dmAb AZD8076 injection. ²D10 and W2 samples could not be identified from each other due to label issues. D10 and W2 Values not shown. ³Leakage observed on both DO and D3 for AZD8076 injection. Participants 6302-0021 and 6302-0023 are selected as backup for Plasma Apheresis. AZD5396 + AZD8076 detected in all six Cohort C subjects.FIGS. 7A-7C illustrate SARS-CoV-2-dMAB01 Cohort D Data (2x 0.25 mg) — Serum level data up to week 72. *New samples. ¹Baseline AZD8076 values of 9.2 and 30.4 for ng / mL are background subtracted from all values for 6302-0032 and 6302-0036, respectively. AZD5396 + AZD8076 detected in all five active Cohort D subjects.FIGS. 8A and 8B illustrate a pseudovirus neutralization assay (Functional activity vs. SARS-CoV-2). FIG. 8A illustrates the assay design and FIG. 8B provides results of the assay. dMAb purified from participants in Cohorts A-D neutralizes in the WT pseudovirus assay.FIGS. 9A-9E illustrate binding and pseudovirus neutralization for Cohort G. Sera from dMAb administered participants in Cohorts G binds WT and Omicron RBDs (Anti-YTE ELISA). dMAb purified from participants in Cohort G neutralizes in the WT pseudovirus assay.FIGS. 10A-10C. Schematic of DNA-encoded monoclonal antibody (DMAb) technology platform. FIG. 10A, Four synthetic DNA constructs were designed for optimal in vivo expression of the heavy (HC) and light chains (LC) of AZD5396 and AZD8076. Designs were based on parental mAb clones COV2-2130 (2130) and COV2-2196 (2196), the precursors of EVUSHELD AZD7442, respectively. pAZD5396 and pAZD8076 LC and HC synthetic DNA construct cocktails were each formulated with the human recombinant hyaluronidase enzyme. FIG. 10B, pAZD5396 and pAZD8076 were separately administered with in vivo EP for the local expression of the transgenes in the deltoid muscle. DMAbs are expressed in the myocytes and secreted into circulation. FIG. 10C, CELLECTRA EP delivery system for enhanced local transgene expression. The EP electrical field parameters and injected fluid distribution have been optimized to align to permit enhanced transgene expression in the muscle (shown as GFP reporter gene expression in NZW rabbit muscle). Expressed transgene, such as DMAbs can be measured in the serum of the recipient.FIG. 11. CONSORT diagram and trial schematic. Upper panel, Study screening / enrollment and cohort descriptions (A-G). Lower panel, Timeline of DMAb dosing and subsequent participant follow-up visits are shown, along with corresponding assessments / analyses conducted.FIGS. 12A-12D. Longitudinal serum concentration of in vivo-expressed DMAbs AZD5396 and AZD8076. Sera collected at the indicated time points post-DMAb administration were analyzed using a qualified quantitative binding assay to determine the serum concentrations (ng / mL) in individual participants that received FIG. 12A, a single dose of 0.5mg or 1 mg on Day 0 (indicated by arrow) FIG. 12B, two doses of 0.25mg, 0.5 mg, 1 mg, or 2 mg on Days 0, 3 (indicated by arrows). FIG. 12C, four doses of 0.5 mg on Days 0, 3, 28, and 31 (indicated by arrows). FIG. 12D, Mean serum concentrations of dose groups / Cohorts. Error bars represent standard error of the mean (SEM).FIGS. 13A-13C. Longitudinal measurement of ADA against DMAbs AZD5396 and AZD8076. Anti-AZD5396 (left) and anti-AZD8076 ADA measurements (right) are shown for individual participants in FIG. 13A, single-dose cohorts (A1 / A2); FIG. 13B, 2-dose cohorts (D, B, C, E) and FIG. 13C, the 4-dose cohort (G). Dotted lines represent the assay minimum titer / limit of detection (LOD) of 40 and 80 for the anti-AZD5396 and anti-AZD8076 assays, respectively.FIGS. 14A-14D. Longitudinal binding and neutralizing activity of in vivo-expressed DMAb against SARS-CoV-2. A DMAb-specific RBD binding assay (left panels) was developed in which an anti-YTE antibody was used to capture DMAb from participant sera followed by probing with biotinylated ancestral Spike RBDs. Graphs are plotted as area under the curve (AUC x 1000) for individual participants within each cohort; group means are shown by long dash-short dash. To evaluate antiviral activity, DMAbs were purified from individual participant sera collected either pre-administration (Day 0) or post-administration (pooled from weeks 12-52) using anti-YTE-coated Dynabeads. Purified samples were run in the pseudovirus neutralization assay (right panels) either unconcentrated or concentrated to be in the range of the assay. Graphs depict the percent (%) neutralization of individual samples at DO (long dash-dot-dot) and post-DMAb delivery (remaining curves) when tested at the indicated dilution. Group means are shown in long dash-dot. RBD binding activity (left) and pseudovirus neutralization (right) are shown for FIG. 14A, single-dose cohorts (A1 / A2); FIG. 14B, 2-dose cohorts (D, B, C, E); FIG. 14C, the 4-dose cohort (G). FIG. 14D, Average IC50 (ng / mL) of purified DMAbs from the indicated cohorts. Calculated as group geometric mean (GM) + 95% confidence interval.FIGS. 15A-15F. Longitudinal serum concentration of in vivo-expressed DMAb AZD5396. Sera collected at the indicated time points post-DMAb administration and were analyzed using a a qualified quantitative binding assay to determine Serum DMAb concentrations (ng / mL). in individual particpants that received FIG. 15A, a single dose of 0.5 mg or 1 mg on D0; FIG. 15B, two doses of 0.25mg, 0.5 mg, 1 mg, or 2mg on D0, 3; FIG. 15C, four doses of 0.5 mg on Days 0, 3, 28, and 31 (indicated by arrows). FIG. 15D, Mean serum concentrations of dose groups / Cohorts. Error bars represent standard error of the means (SEM). FIG. 15E, Maximum DMAb serum concentration by group. Bars represent mean concentrations (+SEM) for each dose group and points indicate Cmax values for individual participants. FIG. 15F, Area under the curve through week 42 by group. Bars represent mean concentrations (+SEM) for each dose group.FIGS. 16A-16D. Longitudinal serum concentration of in vivo-expressed DMAb AZD8076. Serum DMAb concentrations (ng / mL) measured using a qualified quantitative binding assay are shown for study participants receiving FIG. 16A, a single dose of 0.5 mg or 1 mg on D0; FIG. 16B, two doses of 0.25mg, 0.5 mg, 1 mg, or 2mg on D0, 3; or FIG. 16C, four doses of 0.5 mg of SARS-CoV-2 DMAb on D0, 3, 28, 31. Arrows indicate dosing events. FIG. 16D, Mean serum concentrations (+ SEM) for each dose group.FIG. 17. Area under the serum SARS-COV-2 DMAb concentration-time curve for indicated dose groups after 42 weeks from the initial dose. AUC data are shown for AZD5396 (left), AZD8076 (right). Bars represent mean concentrations (+SEM) for each group.FIG. 18. Longitudinal serum concentration of in vivo-expressed DMAb delivered with a modified EP pulse pattern (OpBlock 0070). Serum DMAb concentrations (ng / mL) measured using qualified quantitative binding assays are shown for study participants receiving two doses of 0.5 mg of SARS-CoV-2 DMAb delivered using electroporation with a truncated pulse pattern (OpBlock 0070). Serum concentrations are shown for AZD5396 (left), AZD8076 (middle), and total DMAb (right). Arrows indicate dosing events.FIGS. 19A-19C. Longitudinal binding by dose of in vivo-expressed DMAb against SARS-CoV-2 Delta, Omicron BA.2 and BA.4 / 5 RBDs. An anti-YTE antibody was used to capture DMAb from participant sera. Binding was detected with biotinylated Spike receptor binding domains (RBD). Graphs are plotted as area under the curve (AUC x 1000) for individual participants and the group mean is shown in long dash-short dash.FIG. 20. In vivo-expressed DMAbs delivered with modified EP parameters (OpBlock 0070) bind to SARS-CoV-2 Spike RBDs. An anti-YTE antibody was used to capture DMAb from participant sera. Binding was detected with biotinylated ancestral, Delta, BA.2, or BA.4 / BA.5 Spike RBDs. Graphs are plotted as an area under the curve (AUC x 1000) for individual participants and the group mean is shown in navy blue.FIGS. 21A and 21B. Schematic of pharmacokinetic and anti-drug antibody assays. For all four assays, two assay components consisting of variations of biotinylated or ruthenium labeled reagents (labeled B and C) are combined with DMAb-01 serum (labeled as A) to allow a bridged complex to form. FIG. 21A, AZD5396 PK assay components (left): biotinylated anti-AZD5396 and ruthenium labeled anti-YTE AZD8076. AZD8076 PK assay components (right): biotinylated anti-YTE and ruthenium labeled anti-AZD8076. FIG. 21B, AZD5396 ADA assay components (left): biotinylated AZD106 and ruthenium labeled AZD8076. AZD5396 ADA assay components (right): biotinylated AZD8895 and ruthenium labeled AZD8895. For all four assays, the A+B+C mixture containing the bridged complex is added to a streptavidin plate where the complex is immobilized via the streptavidin-biotin interaction. Light signal is generated via the ruthenium label attached to the bridged complex upon electrical stimulation by an MSD instrument.FIGS. 22A and 22B. Correlation between MSD PK and anti-YTE RBD ELISAS. FIG. 22A, schematic of anti-YTE RBD binding ELISAs. FIG. 22B, Correlation between DMAb quantification assay (MSD PK; ng / mL) and degree of binding to Ancestral, BA.2 and BA.4 / 5 Spike RBDs as detected in the anti-YTE RBD ELISAS.FIGS. 23A and 23B. Anti-YTE bead purification of the (YTE-encoding) DMAb cocktail from participant sera. FIG. 23A, Overview of bead purification protocol. FIG. 23B, Detection and confirmation of successful elution and purification of anti-YTE containing DMAbs by ELISA using anti-idiotypes antibodies. Purified DMAbs were quantified (ng / mL) before (top) and after (bottom). further concentration as needed.FIG. 24 illustrates optimized delivery with SidePort needle: Principles of electric field and fluid distribution.FIGS. 25 A and 25B illustrate preclinical in situ fluid dispersion and gene expression.FIGS. 26A through 26C illustrate Long-term pharmacokinetic (PK) profiles of DNA-encoded, in vivo-expressed biologics targeting diverse influenza virus subtypes. A. Serum titers (ug / mL) of Anti-Influenza virus mAb Iv2-12C (HA Head), delivered to mice (5 / group) via DN / EP (triangles) or as recombinant protein (squares). B. Serum titers (ng / mL) of pan Anti-Influenza virus A mAb IvFI6v3 (HA Stalk), delivered to mice (5 / group) via DNA / EP. C. Serum titers (ug / mL) of pan Anti-Influenza viruses A / B mAb IvCR9114 (HA Stalk), delivered to mice (5 / group) via DNA / EP. Data for two different construct designs are displayed.FIGS. 27A through 27C illustrate Long-term pharmacokinetic (PK) profiles of DNA-encoded, in vivo-expressed biologics developed against numerous bacterial pathogens. A. Serum titers (ug / mL) of Anti-Pseudomonas aeruginosa mAb PsV2L2 (PcrV), delivered to mice (5 / group) via DN / EP. B. Serum titers (ug / mL) of Anti-Streptococcus pneumoniae mAb Ng2C7 (LOS), delivered to mice (5 / group) via DN / EP. Data for four different construct designs are displayed. C. Serum titers (ug / mL) of Anti-Neisseria gonorrhoeae mAb Ng2C7 (LOS), delivered to mice (5 / group) via DN / EP. Data for four different construct designs are displayed.DETAILED DESCRIPTION OF EMBODIMENTSThe disclosed method and compositions may be understood more readily by reference to the following detailed description of particular embodiments and the examples included therein and to the figures and their previous and following description.It is to be understood that the disclosed method and compositions are not limited to specific synthetic methods, specific analytical techniques, or to particular reagents unless otherwise specified, and, as such, may vary. It is understood that the disclosed method and compositions are not limited to the particular methodology, protocols, and reagents described as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.DefinitionsIt must be noted that as used herein and in the appended claims, the singular forms "a", "an," and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to "a nucleic acid sequence" includes a plurality of nucleotides that are formed, reference to "the nucleic acid sequence" is a reference to one or more nucleic acid sequences and equivalents thereof known to those skilled in the art, and so forth.Ranges may be expressed herein as from "about" one particular value, and / or to "about" another particular value. When such a range is expressed, also specifically contemplated and considered disclosed is the range from the one particular value and / or to the other particular value unless the context specifically indicates otherwise. Similarly, when values are expressed as approximations, by use of the antecedent "about," it will be understood that the particular value forms another, specifically contemplated embodiment that should be considered disclosed unless the context specifically indicates otherwise. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint unless the context specifically indicates otherwise. The term "about" as used herein when referring to a measurable value such as an amount, a temporal duration, and the like, is meant to encompass variations of ±20%, ±10%, ±5%, ±1%, ±0.5%, or ±0.1% from the specified value, as such variations are appropriate to perform the disclosed methods.As used herein, the terms "activate," "stimulate," "enhance" "increase" and / or "induce" (and like terms) are used interchangeably to generally refer to the act of improving or increasing, either directly or indirectly, a concentration, level, function, activity, or behavior relative to the natural, expected, or average, or relative to a control condition. "Activate" in context of gene therapy refers to a therpauetic response induced by ligation, binding or association of a biologic to a target protein on the cell surface. For example, in the context of receptors, stimulation with a thereapeutic protein such as a DNA-encoded monoclonal antibody entails the association of a receptor with the monoclonal antibody which can sterically hinder normal receptor ligands from binding and also tag the cell for clearance by the subject's own immune system. In some embodiments, the stimulation event may activate an immune cell to initiate an immune reaction against the tagged cell and / or upregulate or downregulate expression or secretion of a molecule. Thus, indirect or direct ligation of cell surface moieties, even in the absence of a direct signal transduction event, may result in the reorganization of cytoskeletal structures, or in the coalescing of cell surface moieties, each of which could serve to enhance, modify, or alter subsequent cellular responses.The term "combination therapy" as used herein is meant to refer to administration of one or more therapeutic agents in a sequential manner, that is, wherein each therapeutic agent is administered at a different time, as well as administration of these therapeutic agents, or at least two of the therapeutic agents, in a substantially simultaneous manner. Substantially simultaneous administration can be accomplished, for example, by administering to the subject a single dose having a fixed ratio of each therapeutic agent or in multiple, individual doses for each of the therapeutic agents. For example, one combination of the present disclosure may comprise a pooled sample of one or more nucleic acid molecules comprising one or a plurality of expressible nucleic acid sequences and an adjuvant and / or an anti-viral agent administered at the same or different times. In some embodiments, the pharmaceutical composition of the disclosure can be formulated as a single, co-formulated pharmaceutical composition comprising one or more nucleic acid molecules comprising one or a plurality of expressible nucleic acid sequences and one or more adjuvants and / or one or more anti-viral agents. As another example, a combination of the present disclosure (e.g., dMAb and anti-viral agent) may be formulated as separate pharmaceutical compositions that can be administered at the same or different time. As used herein, the term "simultaneously" is meant to refer to administration of one or more agents at the same time. For example, in certain embodiments, antiviral antibodies or fragments thereof in a composition and different antiviral agents in another composition are administered simultaneously). Simultaneously includes administration contemporaneously or immediately sequentially, that is during the same period of time. In certain embodiments, the one or more agents are administered simultaneously within the same hour, or simultaneously in the same day. Sequential or substantially simultaneous administration of each therapeutic agent can be effected by any appropriate route including, but not limited to intramuscular routes, direct absorption through mucous membrane tissues (e.g., nasal, mouth, vaginal, and rectal), and intradermal routes. The therapeutic agents can be administered by the same route or by different routes. For example, one component of a particular combination may be administered by intramuscular injection while the other component(s) of the combination may be administered intramuscularly only. The components may be administered in any therapeutically effective sequence. A "combination" embraces groups of compounds or non-small chemical compound therapies useful as part of a combination therapy. In some embodiments, the therapeutic agent is an anti-retroviral therapy, (such as one or a combination of efavirenz, lamivudine and tenofovir disoproxil fumarate) or anti-flu therapy (such as TamiFlu®). In some embodiments, the therapeutic agent is one or a combiantion of: abacavir / dolutegravir / lamivudine (Triumeq), dolutegravir / rilpivirine (Juluca), elvitegravir / cobicistat / emtricitabine / tenofovir disoproxil fumarate (Stribild), elvitegravir / cobicistat / emtricitabine / tenofovir alafenamide (Genvoya), efavirenz / emtricitabine / tenofovir disoproxil fumarate (Atripla), emtricitabine / rilpivirine / tenofovir disoproxil fumarate (Complera), emtricitabine / rilpivirine / tenofovir alafenamide (Odefsey), bictegravir, emtricitabine, and tenofovir alafenamide (Biktarvy). In some embodiments, the therapeutic agent is one or a combination of a reverse transcrioptase inhibitor of a retrovirus such as: efavirenz (Sustiva), etravirine (Intelence), nevirapine (Viramune), nevirapine extended-release (Viramune XR), rilpivirine (Edurant), delavirdine mesylate (Rescriptor). In some embodiments, the therapeutic agent is one or a combination of a protease inhibitor of a retrovirus, such as: atazanavir / cobicistat (Evotaz), darunavir / cobicistat (Prezcobix), lopinavir / ritonavir (Kaletra), ritonavir (Norvir), atazanavir (Reyataz), darunavir (Prezista), fosamprenavir (Lexiva), tipranavir (Aptivus).As used herein, "expression" refers to the process by which a polynucleotide is transcribed from a DNA template (such as into and mRNA or other RNA transcript) and / or the process by which a transcribed mRNA (or administered mRNA) is translated into peptides, polypeptides, or proteins. Transcripts and encoded polypeptides may be collectively referred to as "gene product." If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. In some embodiments, the at least first expressible nucleic acid sequence comprises only DNA nucleotides, both RNA and DNA nucleotides. In some embodiments, the at least first expressible nucleic acid consists of DNA.The term "functional variant thereof" refers to a peptide varying from the reference sequence but retaining biological activity compared to a peptide having the reference sequence. In some embodiments, the biological activity is measured by a functional assay disclosed herein. In some embodiments, a "functional variant thereof" has at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity, or a sequence identify from about any two of 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%, or a sequence identity of about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% to a stated reference sequence. In some embodiments, a functional variant of an amino acid sequence herein retains at least about 10, about 15, about 20, about 25, about 30, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 91, about 92, about 93, about 94, about 95, about 96, about 97, about 98, about 99, or about 100% of the biological activity of the reference sequence from which it is a variant."Variants" are intended to mean similar sequences, and any solvates, salts, or mutants of a wild-type or reference sequence upon which the variant is based. For nucleic acid molecules, a variant comprises a nucleic acid molecule having deletions (i.e., truncations) at the 5' and / or 3' end; deletion and / or addition of one or more nucleotides at one or more intemal sites in the native polynucleotide and / or substitution of one or more nucleotides at one or more sites in the native polynucleotide. For amino acid sequences, the variant is any mutant sequence of a reference sequence including any one or combination of an amino acid sequence: that is a truncation mutant, that has an addition, that has a deletion. As used herein, a "native" nucleic acid molecule or polypeptide sequence comprises a naturally occurring or endogenous nucleotide sequence or amino acid sequence, respectively. For nucleic acid molecules, conservative variants include those sequences that, because of the degeneracy of the genetic code, encode the amino acid sequence of one of the polypeptides of the disclosure. Variant nucleic acid molecules and amino acid sequences also include synthetically derived nucleic acid molecules, such as those generated, for example, by using site-directed mutagenesis but which still encode a protein of the disclosure. Generally, variants of a particular nucleic acid molecule of the disclosure will have at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% sequence identity to an amino acid sequence disclosed herein. Variants of a particular nucleic acid molecule of the disclosure (i.e., the reference DNA sequence) can also be evaluated by comparison of the percent sequence identity between the amino acid sequence encoded by a variant nucleic acid molecule and the amino acid sequence encoded by the reference nucleic acid molecule. Percent sequence identity between any two amino acid sequences can be calculated using sequence alignment programs and parameters described elsewhere herein. In some embodiments, the term "variant" amino acid sequence is intended to mean an amino acid sequence derived from the native amino acid sequence by deletion (so-called truncation) of one or more amino acids at the N-terminal and / or C-terminal end of the native amino acid sequence; deletion and / or addition of one or more amino acids at one or more internal sites in the native amino acid sequence; or substitution of one or more amino acids at one or more sites in the native amino acid sequence. Amino acid sequences encompassed by the present disclosure are biologically active, that is they are functional variants, as above, and continue to possess the desired biological activity of the native amino acid sequences as described herein. Biologically active variant is synonymous with functional variant herein. Such variants may result from, for example, genetic polymorphism or from human manipulation. In some embodiments, functional variants of an amino acid sequence of the disclosure will have at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or more sequence identity to the amino acid sequence for the native amino acid sequence as determined by sequence alignment programs and parameters described elsewhere herein. A biologically active variant of an amino acid sequence of the disclosure may differ from that amino acid sequence by from about 1 to about 10 amino acid residues, as few as about 1 to about 15, for example from about 6 to about 10, as few as about 5, as few as about 4, 3, 2, or even 1 amino acid residue. The amino acid sequences of the disclosure may be altered in various ways including amino acid substitutions, deletions, truncations, and insertions. Methods for such manipulations are generally known in the art. For example, amino acid sequence variants and fragments of the proteins or amino acid sequences can be prepared by mutations in the nucleic acid sequences that encode the proteins or amino acid sequences recombinantly.Percent identity refers to the number of aligned positions between a sequence and a reference sequence where the matching characters (e.g., amino acids in proteins or nucleotides in nucleic acids) are identical divided by the length of the reference sequence, and where the quotient is then multiplied by one hundred. The "percent identity" of two polynucleotide or two amino acid sequences is determined by comparing the sequences using the GAP computer program (a part of the GCG Wisconsin Package, version 10.3 (Accelrys, San Diego, Calif.)) using its default parameters. "Identical" or "identity" as used herein in the context of two or more nucleic acids or amino acid sequences, may mean that the sequences have a specified percentage of residues that are the same over a specified region. The percentage may be calculated by optimally aligning the two sequences, comparing the two sequences over the specified region, determining the number of positions at which the identical residue occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the specified region, and multiplying the result by 100 to yield the percentage of sequence identity. In cases where the two sequences are of different lengths or the alignment produces one or more staggered ends and the specified region of comparison includes only a single sequence, the residues of single sequence are included in the denominator but not the numerator of the calculation. When comparing DNA and RNA, thymine (T) and uracil (U) may be considered equivalent. Identity may be performed manually or by using a computer sequence algorithm such as BLAST or BLAST 2.0. Briefly, the BLAST algorithm, which stands for Basic Local Alignment Search Tool is suitable for determining sequence similarity. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (ncbi.nlm.nih.gov). This algorithm involves first identifying high scoring sequence pair (HSPs) by identifying short words of length Win the query sequence that either match or satisfy some positive-valued threshold score T when aligned with a word of the same length in a database sequence. Score T is referred to as the neighborhood word score threshold (Altschul et al., supra). These initial neighborhood word hits act as seeds for initiating searches to find HSPs containing them. The word hits are extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension for the word hits in each direction are halted when: 1) the cumulative alignment score falls off by the quantity X from its maximum achieved value; 2) the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or 3) the end of either sequence is reached. The Blast algorithm parameters W, T and X determine the sensitivity and speed of the alignment. The Blast program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff et al., Proc. Natl. Acad. Sci. USA, 1992, 89, 10915-10919, which is incorporated herein by reference in its entirety) alignments (B) of 50, expectation (E) of 10, M=5, N=4, and a comparison of both strands. The BLAST algorithm (Karlin et al., Proc. Natl. Acad. Sci. USA, 1993, 90, 5873-5787, which is incorporated herein by reference in its entirety) and Gapped BLAST perform a statistical analysis of the similarity between two sequences. One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two sequences would occur by chance. For example, a nucleic acid is considered similar to another if the smallest sum probability in comparison of the test nucleic acid to the other nucleic acid is less than about 1, less than about 0.1, less than about 0.01, and less than about 0.001. Two single-stranded polynucleotides are "the complement" of each other if their sequences can be aligned in an anti-parallel orientation such that every nucleotide in one polynucleotide is opposite its complementary nucleotide in the other polynucleotide, without the introduction of gaps, and without unpaired nucleotides at the 5' or the 3' end of either sequence. A polynucleotide is "complementary" to another polynucleotide if the two polynucleotides can hybridize to one another under moderately stringent conditions. Thus, a polynucleotide can be complementary to another polynucleotide without being its complement.By "fragment" is meant a portion of a polypeptide or nucleic acid molecule. This portion contains, preferably, at least about 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, or about 90% of the entire length of the reference nucleic acid molecule or polypeptide."Optional" or "optionally" means that the subsequently described event, circumstance, or material may or may not occur or be present, and that the description includes instances where the event, circumstance, or material occurs or is present and instances where it does not occur or is not present.The phrase "and / or," as used herein in the specification and in the claims, should be understood to mean "either or both" of the elements so conjoined, i.e., elements that are conjunctively present in some cases and disjunctively present in other cases. Other elements may optionally be present other than the elements specifically identified by the "and / or" clause, whether related or unrelated to those elements specifically identified unless clearly indicated to the contrary. Thus, as a non-limiting example, a reference to "A and / or B," when used in conjunction with open-ended language such as "comprising" can refer, in some embodiments, to A without B (optionally including elements other than B); in another embodiments, to B without A (optionally including elements other than A), in yet another embodiments, to both A and B (optionally including other elements); etc.As used herein in the specification and in the claims, "or" should he understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" shall be interpreted as being inclusive, i.e., the inclusion of at least one, but also including more than one, of a number or list of elements, and, optionally, additional unlisted items. Only terms clearly indicated to the contrary, such as "only one of" or "exactly one of," or, when used in the claims, "consisting of," will refer to the inclusion of exactly one element of a number or list of elements. In general, the term "or" as used herein shall only be interpreted as indicating exclusive alternatives (i.e. "one or the other but not both") when preceded by terms of exclusivity, "either," "one of," "only one of," or "exactly one of." "Consisting essentially of," when used in the claims, shall have its ordinary meaning as used in the field of patent law.As used herein an "antigen" is meant to refer to any substance that elicits an immune response.The term "antibody" as used herein refers to a polypeptide or group of polypeptides that are comprised of at least one binding domain that is formed from the folding of polypeptide chains having three-dimensional binding spaces with internal surface shapes and charge distributions complementary to the characteristics of an antigenic determinant of an antigen or epitope. The term "antibody" is synonymous with immunoglobulin (Ig) and is to be understood as commonly known in the art. The basic antibody structural unit is a tetramer. Each tetramer is composed of two identical pairs of polypeptide chains, each pair having one "light" (about 25 kDa) and one heavy" chain (about 50-70 kDa). Generally, the amino-terminal portion of each antibody chain includes a variable region that is primarily responsible for antigen recognition. The carboxy-terminal portion of each chain defines a constant region, eg, responsible for effector function. Human light chains are classified as kappa or lambda light chains. Heavy chains are classified as mu, delta, gamma, alpha, or epsilon, and define the antibody's isotype as IgM, IgD, IgG, IgA, and IgE, respectively. Within light and heavy chains, the variable and constant regions are joined by a "J" region of about 12 or more amino acids, with the heavy chain also including a "D" region of about 3 or more amino acids. The term antibody may mean an antibody of classes IgG, IgM, IgA, IgD or IgE, or fragments, binding fragments or derivatives thereof, including Fab, F(ab')2, Fd, and single chain antibodies, diabodies, bispecific antibodies, bifunctional antibodies, antigen binding proteins thereof and derivatives thereof The antibody may be an antibody isolated from the serum sample of mammal, a polyclonal antibody, affinity purified antibody, or mixtures thereof which exhibits sufficient binding specificity to a desired epitope or a sequence derived therefrom. The variable regions of each heavy / light chain pair (VH / VL), respectively, form the antigen binding site. The variable regions of antibody heavy and light chains (VH / VL) exhibit the same general structure of relatively conserved framework regions (FR) joined by three hypervariable regions, also called complementarity determining regions or CDRs. From N-terminus to C-terminus, both light and heavy chains comprise the domains FR1, CDR1, FR2, CDR2, FR3, CDR3 and FR4. The assignment of amino acids to each domain is known in the art, including, for example, definitions as described in Kabat et al. in Sequences of Proteins of Immunological Interest, 5th Ed., US Dept. of Health and Human Services, PHS, NIH, NIH Publication no. 91-3242, 1991 (herein referred to as "Kabat numbering"). For example, the CDR regions of an antibody can be determined according to Kabat numbering. The terms "intact antibody" or "full length antibody" refer to an antibody composed of two identical antibody light chains and two identical antibody heavy chains that each contain an Fc region.An "antigen binding domain," "antigen binding region," or "antigen binding site" is a portion of an antigen binding protein that contains amino acid residues (or other moieties) that interact with an antigen and contribute to the antigen binding protein's specificity and affinity for the antigen. For an antibody that specifically binds to its antigen, this will include at least part of at least one of its CDR domains.An "epitope" is the portion of a molecule that is bound by an antigen binding protein (eg, by an antibody). An epitope can comprise non-contiguous portions of the molecule (eg, in a polypeptide, amino acid residues that are not contiguous in the polypeptide's primary sequence but that, in the context of the polypeptide's tertiary and quaternary structure, are near enough to each other to be bound by an antigen binding protein). Generally the variable regions, particularly the CDRs, of an antibody interact with the epitope.It should be understood that the antibodies or any functional fragments described herein are intended to include amino acid sequences comprising polypeptides bearing one or more insertions, deletions, or substitutions, or any combination thereof, of amino acid residues as well as modifications other than insertions, deletions, or substitutions of amino acid residues, such as but not limited to conservative amino acid substitutions,As used herein, "specific for" or "specifically binds to" means that the binding affinity of a substrate to a specified target nucleic acid or amino acid sequence, is statistically higher than the binding affinity of the same substrate to a generally comparable, but non-target nucleic acid or amino acid sequence. Normally, the binding affinity of a substrate to a specified target nucleic acid or amino acid sequence is at least 1.5 fold, and preferably 2 fold or 5 fold, of the binding affinity of the same substrate to a non-target nucleic acid or amino acid sequence. It also refers to binding of a substrate to a specified nucleic acid or amino acid target sequence to a detectably greater degree, eg, at least 1.5-fold over background, than its binding to non-target nucleic acid or amino acid sequences and to the substantial exclusion of non-target nucleic acids or amino acids. The substrate's Kd to each nucleotide or amino acid sequence can be compared to assess the binding specificity of the substrate to a particular target nucleotide or amino acid sequence.The terms "specific binding", "specifically binds" or "specifically binding", as used herein in the context of an antibody, refer to non-covalent or covalent preferential binding of an antibody to an antigen relative to other molecules or moieties (eg, an antibody specifically binds to a particular antigen relative to other available antigens). In some embodiments, an antibody specifically binds to an antigen (eg, a tumor or viral antigen) if it binds with a dissociation constant KD of from about 1 pM to about 500 niM, In some embodiments, the antibody or antigen binding protein has a dissociation constant KD in a range from about 1 pM to about 1000 nM. In some embodiments, the antibody or antigen binding protein has a dissociation constant KD in a range from about 1 pM to about 500 nM. In some embodiments, the antibody or antigen binding protein has a dissociation constant KD in a range from about 1 PM to about 250 nM. In some embodiments, the antibody or antigen binding protein has a dissociation constant KD in a range from about 1 pM to about 100 nM. In some embodiments, the antibody or antigen binding protein has a dissociation constant KD in a range from about 1 pM to about 10 nM. In some embodiments, the antibody or antigen binding protein has a dissociation constant Kp in a range from about 1 pM to about 1 nM. In some embodiments, the antibody or antigen binding protein has a dissociation constant K D in a range from about 1 pM to about 750 pM, In some embodiments, the antibody or antigen binding protein has a dissociation constant KD in a range from about 1 PM to about 500 pM. In some embodiments, the antibody or binding protein has a dissociation constant K, in a range from about 1 nM to about 100 nM.The term "human antibody", as used herein, refers to an antibody, or an antigen binding fragment of an antibody, including heavy and light chains derived from human immunoglobulin sequences. Human antibodies may be identified in a variety of ways, examples of which are described below, including through the immunization with an antigen of interest of a mouse that is genetically modified to express antibodies derived from human heavy and / or light chain-encoding genes. In some embodiments, a human antibody is made using recombinant methods such that the glycosylation pattern of the antibody is different than an antibody having the same sequence if it were to exist in nature.The term "chimeric antibody" refers to an antibody that contains one or more regions derived from a particular source or species, and one or more regions derived from a different source or species."Humanized" forms of non-human (eg, murine) antibodies are chimeric immunoglobulins, immunoglobulin chains or fragments thereof (such as Fv, Fab, Fab', F(ab')2 or other antigen-binding sequences of antibodies) which contain minimal sequence derived from non-human immunoglobulin. For the most part, humanized antibodies and antibody fragments thereof are human immunoglobulins (recipient antibody or antibody fragment) in which residues from a complementary-determining region (CDR) of the recipient are replaced by residues from a CDR of a non-human species (donor antibody) such as mouse, rat or rabbit having the desired specificity, affinity, and capacity. In some instances, Fv framework region (FR) residues of the human immunoglobulin are replaced by corresponding non-human residues. Furthermore, a humanized antibody / antibody fragment can include residues which are found neither in the recipient antibody nor in the imported CDR or framework sequences. These modifications can further refine and optimize antibody or antibody fragment performance. In general, the humanized antibody or antibody fragment thereof will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the CDR regions correspond to those of a non-human immunoglobulin and all or a significant portion of the FR regions are those of a human immunoglobulin sequence. The humanized antibody or antibody fragment can also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., Nature, 321: 522-525, 1986; Reichmann et al., Nature, 332: 323-329, 1988; Presta, Curr. Op. Struct. Biol., 2: 593-596, 1992, whichare incorporated by reference in their entireties,An "antibody fragment", "antibody portion", "antigen-binding fragment of an antibody", or "antigen-binding portion of an antibody" refers to a molecule other than an intact antibody that comprises a portion of an intact antibody that binds the antigen to which the intact antibody binds. Examples of antibody fragments include, but are not limited to, Fv, Fab, Fab', Fab-SH, F(ab'), Fd, and Fv fragments, plus dAb, diabodies; linear antibodies; single-chain antibody molecules (eg scFv); polypeptides that contain at least a portion of an antibody that is sufficient to confer specific antigen binding to the polypeptide. Antigen binding portions of an antibody may be produced by recombinant DNA techniques or by enzymatic or chemical cleavage of intact antibodies. Antigen binding portions include, inter alia, Fab, Fab', F(ab')2, Fv, domain antibodies (dAbs), DNA-encoded monoclonal antibodies (dMabs) and complementarity determining region (CDR) fragments, chimeric antibodies, diabodies, triabodies, tetrabodies, and the like. In some embodiments, the antibody fragment is an scFv. A single-chain antibody (scFv) is an antibody in which a Vand a V region are joined via a linker (eg, a synthetic sequence of amino acid residues) to form a continuous protein chain (see eg, Bird et al (1988) Science 242:423-426. A Fab fragment is a monovalent fragment having the VL, VH, CL and CH domains; a F(ab)2 fragment is a bivalent fragment having two Fab fragments linked by a disulfide bridge at the hinge region; a Fd fragment has the V and C domains; an Fv fragment has the V and Vdomains of a single arm of an antibody, and a dAb fragment has a V domain, a V domain, or an antigen-binding fragment of a Vor V domain (US Patents 6,846,634, 6,696,245, US App Pub 20 / 0202512, 2004 / 0202995; 2004 / 0038291; 2004 / 0009507; 2003 / 0039958, and Ward et al., Nature 341:544-546, 1989)."Binding fragments" of an antibody are produced by recombinant DNA techniques, or by enzymatic or chemical cleavage of intact antibodies. Binding fragments include Fab, Fab', F(ab')2, Fv, and single-chain antibodies. An antibody other than a "bi specific" or "bifunctional" antibody is understood to have each of its binding sites identical. An antibody substantially inhibits adhesion of a receptor to a counter-receptor when an excess of antibody reduces the quantity of receptor bound to counter-receptor by at least about 20%, 40%, 60% or 80%, and more usually greater than about 85% (as measured in an in vitro competitive binding assay). An antibody may be oligoclonal, a polyclonal antibody, a monoclonal antibody, a chimeric antibody, a CDR-grafted antibody, a multi-specific antibody, a bi-specific antibody, a catalytic antibody, a chimeric antibody, a humanized antibody, a fully human antibody, an anti-idiotypic antibody and antibodies that can be labeled in soluble or bound form as well as fragments, variants or derivatives thereof, either alone or in combination with other amino acid sequences provided by known techniques. An antibody may be from any species. The term antibody also includes binding fragments of the antibodies of the invention; exemplary fragments include Fv, Fab, Fab', single stranded antibody (svFC), dimeric variable region (Diabody) and disulphide stabilized variable region (dsFv). As discussed herein, minor variations in the amino acid sequences of antibodies or immunoglobulin molecules are contemplated as being encompassed by the present invention, providing that the variations in the amino acid sequence maintain at least about 75%, more preferably at least about 80%, about 90%, about 95%, and about 99% sequence identity to the antibodies or immunoglobulin molecules described herein. In particular, conservative amino acid replacements are contemplated. Conservative replacements are those that take place within a family of amino acids that have related side chains. Genetically encoded amino acids are generally divided into families: (1) acidic aspartate, glutamate; (2) basic=lysine, arginine, histidine; (3) non-polar=alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar-glycine, asparagine, glutamine, cysteine, serine, threonine, tyrosine. More preferred families are: serine and threonine are an aliphatic-hydroxy family; asparagine and glutamine are an amide-containing family; alanine, valine, leucine and isoleucine are an aliphatic family; and phenylalanine, tryptophan, and tyrosine are an aromatic family. In some embodiments, the present disclosure relates to one or a plurality of modified cells, such as T cells, that are isolated from a subject and then modified to express one or a plurality of antibodies, antibody binding fragments or salts thereof.As used herein, the term "genetic construct" refers to the DNA or RNA molecules that comprise a nucleotide sequence which encodes an amino acid sequence or immunomodulating protein. The coding sequence includes initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of the individual to whom the nucleic acid molecule is administered.As used herein, the term "therapeutic protein" refers to any protein that can be expressed in any of the constructs disclosed herein. In some embodiments, the "therapeutic protein" is an antibody or antibody fragment thereof.As used herein, the term "electroporation," "electro-permeabilization," or "electro-kinetic enhancement" ("EP"), are used interchangeably and are meant to refer to the use of a transmembrane electric field pulse to induce microscopic pathways (pores) in a bio-membrane; their presence allows biomolecules such as plasmids, oligonucleotides, siRNA, drugs, ions, and / or water to pass from one side of the cellular membrane to the other. In some of the disclosed methods of treatment or prevention, the method comprises a step of electroporation of a subject's tissue for a sufficient time and with a sufficient electrical field capable of inducing uptake of the pharmaceutical compositions disclosed herein into the antigen-presenting cells. In some embodiments, the cells are antigen presenting cells.The term "pharmaceutically acceptable excipient," "pharmaceutically acceptable carrier" or "pharmaceutically acceptable diluent" as used herein is meant to refer to an excipient, carrier or diluent that can be administered to a subject, together with an agent or the pharmaceutical compositions disclosed herein, and which is inert or fails to eliminate the pharmacological activity of the active agent of the pharmaceutical composition. In some embodiments, the pharmaceutically acceptable carrier does fails to destroy or is incapable of eliminating the pharmacological activity of a nucleic acid molecule or proteins encoded by the same and is nontoxic when administered in doses sufficient to deliver a therapeutic amount of the active agent. The term "pharmaceutically acceptable salt" of nucleic acids as used herein may be an acid or base salt that is generally considered in the art to be suitable for use in contact with the tissues of human beings or animals without excessive toxicity, irritation, allergic response, or other problem or complication. Such salts include mineral and organic acid salts of basic residues such as amines, as well as alkali or organic salts of acidic residues such as carboxylic acids. Specific pharmaceutical salts include, but are not limited to, salts of acids such as hydrochloric, phosphoric, hydrobromic, malic, glycolic, fumaric, sulfuric, sulfamic, suifanilic, formic, toluenesulfonie, methanesulfonic, benzene sulfonic, ethane disulfonic, 2- hydroxyethyl sulfonic, nitric, benzoic, 2-acetoxybenzoic, citric, tartaric, lactic, stearic, salicylic, glutamic, ascorbic, pamoic, succinic, fumaric, maleic, propionic, hydroxymaleic, hydroiodic, phenyiacetic, alkanoic such as acetic, HOOC-(CH2)n-COOH where n is 0-4, and the like. Similarly, pharmaceutically acceptable cations include, but are not limited to sodium, potassium, calcium, aluminum, lithium and ammonium. Those of ordinary skill in the art will recognize from this disclosure and the knowledge in the art that further pharmaceutically acceptable salts for the pooled viral specific antigens or polynucleotides provided herein, including those listed by Remington's Pharmaceutical Sciences, 17th ed., Mack Publishing Company, Easton, PA, p. 1418 (1985). In general, a pharmaceutically acceptable acid or base salt can be synthesized from a parent compound that contains a basic or acidic moiety by any conventional chemical method. Briefly, such salts can be prepared by reacting the free acid or base forms of these compounds with a stoichiometric amount of the appropriate base or acid in an appropriate solvent.As used herein, the terms "prevent," "preventing," "prevention," "prophylactic treatment," and the like, are meant to refer to reducing the probability of developing a disease or condition in a subject, who does not have, but is at risk of or susceptible to developing a disease or condition.As used herein, the term "purified" means that the polynucleotide or polypeptide or fragment, variant, or derivative thereof is substantially free of other biological material with which it is naturally associated, or free from other biological materials derived, e.g., from a recombinant host cell that has been genetically engineered to express the polypeptide of the present disclosure. That is, e.g., a purified polypeptide of the present disclosure is a polypeptide that is at least from about 70 to 100% pure, i.e., the polypeptide is present in a composition wherein the polypeptide constitutes from about 70 to about 100% by weight of the total composition. In some embodiments, the purified polypeptide of the present disclosure is from about 75% to about 99% by weight pure, from about 80% to about 99% by weight pure, from about 90 to about 99% by weight pure, or from about 95% to about 99% by weight pure.As used herein, the terms "subject," "individual," "host," and "patient," are used interchangeably herein and refer to a vertebrate individual, including but not limited to a mammal or human, for whom diagnosis, treatment or therapy is desired, particularly humans. Mammals include, but are not limited to, murines, simians, humans, farm animals, cows, pigs, goats, sheep, horses, dogs, sport animals, and pets. Tissues, cells and their progeny obtained in vivo or cultured in vitro are also encompassed by the definition of the term "subject." The methods described herein are applicable to both human therapy and veterinary applications. In some instances in the description of the present disclosure, the term "patient" refers to human patients suffering from a particular disease or disorder. In some embodiments, the subject may be a human suspected of having or being identified as at risk to develop a viral infection. In some embodiments, the subject may be diagnosed as having a viral infection, cancer or a hyperproliferative disorder, of a genetic disorder that results in a deficiency of production of wild-type protein. In some embodiments, the viral infection is an infection of human immunodeficiency virus-1 (HIV-1) and of having or being identified as at risk to develop autoimmune deficiency syndrome or AIDS. In some embodiments, the subject is a mammal, and, in other embodiments, the subject is a human.The term "therapeutic effect" as used herein is meant to refer to some extent of relief of one or more of the symptoms of a disorder or its associated pathology. A "therapeutically effective amount" as used herein is meant to refer to an amount of an agent which is effective, upon single or multiple dose administration (such as a first, second and / or third booster) to the cell or subject, in prolonging the survivability of the patient with such a disorder, reducing one or more signs or symptoms of the disorder, preventing or delaying, and the like beyond that expected in the absence of such treatment. A "therapeutically effective amount" is intended to qualify the amount required to achieve a therapeutic effect. A physician or veterinarian having ordinary skill in the art can readily determine and prescribe the "therapeutically effective amount" (e.g., such as an ED50) of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds of the present disclosure employed in a pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.The terms "treat," "treated," "treating," "treatment," and the like as used herein are meant to refer to reducing or ameliorating a disorder and / or symptoms associated therewith (e.g., a viral infecrtion or gene therapy). "Treating" can refer to administration of the DNA vaccines described herein to a subject after the onset, or suspected onset, of a viral infection. "Treating" includes the concepts of "alleviating," which refers to lessening the frequency of occurrence or recurrence, or the severity, of any symptoms or other ill effects related to a virus and / or the side effects associated with viral therapy. The term "treating" also encompasses the concept of "managing" which refers to reducing the severity of a particular disease or disorder in a patient or delaying its recurrence, e.g., lengthening the period of remission in a patient who had suffered from the disease. It is appreciated that, although not precluded, treating a disorder or condition does not require that the disorder, condition, or symptoms associated therewith be completely eliminated.For any therapeutic agent described herein the therapeutically effective amount may be initially determined from preliminary in vitro studies and / or animal models. A therapeutically effective dose may also be determined from human data. The applied dose can be adjusted based on the relative bioavailability and potency of the administered agent. Adjusting the dose to achieve maximal efficacy based on the methods described above and other well-known methods is within the capabilities of the ordinarily skilled artisan. General principles for determining therapeutic effectiveness, which may be found in Chapter 1 of Goodman and Gilman's The Pharmacological Basis of Therapeutics, 10th Edition, McGraw-Hill (New York) (2001), incorporated herein by reference, are summarized below. Pharmacokinetic principles provide a basis for modifying a dosage regimen to obtain a desired degree of therapeutic efficacy with a minimum of unacceptable adverse effects. In situations where the drug's plasma concentration can be measured and related to the therapeutic window, additional guidance for dosage modification can be obtained. Drug products are considered to be pharmaceutical equivalents if they contain the same active ingredients and are identical in strength or concentration, dosage form, and route of administration. Two pharmaceutically equivalent drug products are considered to be bioequivalent when the rates and extents of bioavailability of the active ingredient in the two products are not significantly different under suitable test conditions.The terms "polynucleotide," "oligonucleotide" and "nucleic acid" are used interchangeably throughout and include DNA molecules (e.g., cDNA or genomic DNA), RNA molecules (e.g., mRNA), analogs of the DNA or RNA generated using nucleotide analogs (e.g., peptide nucleic acids and non-naturally occurring nucleotide analogs), and hybrids thereof. Thus, the term "expressible nucleic acid" or "expressible nucleic acid sequence" as used herein refers to expressible DNA or RNA molecules and expressible DNA or RNA sequences.The nucleic acid molecule and / or sequences of each embodiment can be single-stranded or double-stranded. In some embodiments, the nucleic acid molecules of the disclosure comprise a contiguous open reading frame encoding an antibody, or a fragment thereof, as described herein. "Nucleic acid" or "oligonucleotide" or "polynucleotide" as used herein may mean at least two nucleotides covalently linked together. The depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. Many variants of a nucleic acid may he used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof. A single strand provides a probe that may hybridize to a target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions. Nucleic acids may be single stranded or double stranded, or may contain portions of both double stranded and single stranded sequence. The nucleic acid may be DNA, both genomic and cDNA, or a DNA-RNA hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids may be obtained by chemical synthesis methods or by recombinant methods. A nucleic acid will generally contain phosphodiester bonds, although nucleic acid analogs maybe included that may have at least one different linkage, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or o-methylphosphoroamidite linkages and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positive backbones; non-ionic backbones, and non-ribose backbones, including those described in U.S. Pat. Nos. 5,235,033 and 5,034,506, which are incorporated by reference in their entireties. Nucleic acids containing one or more non-naturally occurring or modified nucleotides are also included within one definition of nucleic acids. The modified nucleotide analog may be located for example at the 5'-end and / or the 3'-end of the nucleic acid molecule. Representative examples of nucleotide analogs may be selected from sugar-or backbone-modified ribonucleotides. It should be noted, however, that also nucleobase-modified ribonucleotides, i.e. ribonucleotides, containing a non-naturally occurring nucleobase instead of a naturally occurring nucleobase such as uridines or cytidines modified at the 5-position, e.g. 5-(2-amino)propyl uridine, 5-bromo uridine; adenosines and guanosines modified at the 8-position, e.g. 8-bromo guanosine; deaza nucleotides, e.g. 7-deaza-adenosine; 0- and N-alkylated nucleotides, e.g. N6-methyl adenosine are suitable. The 2-OH-group may be replaced by a group selected from H, OR, R, halo, SH, SR, NH2, NHR, N2 or CN, wherein R is C1-C6 alkyl, alkenyl or alkynyl and halo is F, Cl, Br or I. Modified nucleotides also include nucleotides conjugated with cholesterol through, e.g., a hydroxyprolinol linkage as described in Krutzfeldt et al., Nature (Oct. 30, 2005), Soutschek et al., Nature 432:173-178 (2004), and U.S. Patent Publication No. 20050107325, which are incorporated herein by reference in their entireties. Modified nucleotides and nucleic acids may also include locked nucleic acids (LNA), as described in U.S. Patent No. 20020115080, which is incorporated herein by reference. Additional modified nucleotides and nucleic acids are described in U.S. Patent Publication No. 20050182005, which is incorporated herein by reference in its entirety. Modifications of the ribose-phosphate backbone may be done for a variety of reasons, e.g., to increase the stability and half-life of such molecules in physiological environments, to enhance diffusion across cell membranes, or as probes on a biochip. Mixtures of naturally occurring nucleic acids and analogs may be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made. In some embodiments, the expressible nucleic acid sequence is in the form of DNA. In some embodiments, the expressible nucleic acid is in the form of RNA with a sequence that encodes the polypeptide sequences disclosed herein and, in some embodiments, the expressible nucleic acid sequence is an RNA / DNA hybrid molecule that encodes any one or plurality of polypeptide sequences disclosed herein.As used herein, the term "nucleic acid molecule" is a molecule that comprises one or more nucleotide sequences that encode one or more proteins. In some embodiments, a nucleic acid molecule comprises initiation and termination signals operably linked to regulatory elements including a promoter and polyadenylation signal capable of directing expression in the cells of the individual to whom the nucleic acid molecule is administered. In some embodiments, the nucleic acid molecule also includes a plasmid containing one or more nucleotide sequences that encode one or a plurality of viral antigens. In some embodiments, the disclosure relates to a pharmaceutical composition comprising a first, second, third or more nucleic acid molecule, each of which encodes one or a plurality of viral antigens and at least one of each plasmid comprising one or more of the compositions disclosed herein. In some embodiments, the compositions can comprise a nucleic acid molecule that comprises a first, second, third or more expressible nucleic acid sequences, wherein at least one of the first, second or third expressible nucleic acid sequences comprise the domains disclosed herein.The terms "polypeptide," "peptide" and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer may be linear or branched, it may comprise modified amino acids, and it may be interrupted by non-natural amino acids or chemical groups that are not amino acids. The terms also encompass an amino acid polymer that has been modified, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation, such as conjugation with a labeling component. As used herein the term "amino acid" includes natural and / or unnatural or synthetic amino acids, including glycine and both the D or L optical isomers, and amino acid analogs and peptidomimetics.The term "hybridization" or "hybridizes" as used herein refers to the formation of a duplex between nucleotide sequences that are sufficiently complementary to form duplexes via Watson-Crick base pairing. Two nucleotide sequences are "complementary" to one another when those molecules share base pair organization homology. "Complementary" nucleotide sequences will combine with specificity to form a stable duplex under appropriate hybridization conditions. For instance, two sequences are complementary when a section of a first sequence can bind to a section of a second sequence in an anti-parallel sense wherein the 3'-end of each sequence binds to the 5'-end of the other sequence and each A, T(U), G and C of one sequence is then aligned with a T(U), A, C and G, respectively, of the other sequence. RNA sequences can also include complementary G=U or U=G base pairs. Thus, two sequences need not have perfect homology to be "complementary." Usually two sequences are sufficiently complementary when at least about 90% (preferably at least about 95%) of the nucleotides share base pair organization over a defined length of the molecule.By "substantially identical" is meant nucleic acid molecule (or polypeptide) exhibiting at least about 50% identity to a reference amino acid sequence (for example, any one of the amino acid sequences described herein) or nucleic acid sequence (for example, any one of the nucleic acid sequences described herein). Preferably, such a sequence is at least about 60%, more preferably about 80% or 85%, and more preferably about 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or even 99% identical at the amino acid level or nucleic acid level to the sequence used for comparison.The term "operably linked" or "transcriptional control" refers to functional linkage between a regulatory sequence and a heterologous nucleic acid sequence resulting in expression of the latter. For example, a first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Operably linked DNA sequences can be contiguous with each other and, eg, where necessary to join two protein coding regions, are in the same reading frame. A nucleotide sequence is "operably linked" to a regulatory sequence if the regulatory sequence affects the expression (eg, the level, timing, or location of expression) of the nucleotide sequence. A "regulatory sequence" is a nucleic acid that affects the expression (eg, thelevel, timing, or location of expression) of a nucleic acid to which it is operably linked. The regulatory sequence can, for example, exert its effects directly on the regulated nucleic acid, or through the action of one or more other molecules (eg, polypeptides that bind to the regulatory sequence and / or the nucleic acid). Examples of regulatory sequences include promoters, enhancers and other expression control elements (eg, polyadenylation signals). Further examples of regulatory sequences are described in, for example, Goeddel, 1990, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif, and Baron et al., 1995, Nucleic Acids Res. 23:3605-06.A "host cell" is a cell that can be used to express a nucleic acid, eg, a nucleic acid of the disclosure, can be, but is not limited to, a eukaryotic cell, a bacterial cell, an insect cell , or a human cell. Suitable eukaryotic cells include, but are not limited to, Vero cells, HeLa cells, COS cells, CHO cells, HEK.293 cells, BHK cells and MDCKII cells. Suitable insect cells include, but are not limited to, Sf9 cells. The phrase "recombinant host cell" can be used to denote a host cell that has been transformed or transfected / transduced with a nucleic acid to be expressed. A host cell also can be a cell that comprises the nucleic acid but does not express it at a desired level unless a regulatory sequence is introduced into the host cell such that it becomes operably linked with the nucleic acid. It is understood that the term host cell refers not only to the particular subject cell but also to the progeny or potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to, eg, mutation or environmental influence, such progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term as used herein.The term "recombinant antibody" refers to an antibody that is expressed from a cell (or cell line) transfected / transduced with an expression vector (or possibly more than one expression vector) comprising the coding sequence of the antibody, or a portion thereof (eg, a DNA sequence encoding a heavy chain or a light chain variable region as described herein). In some embodiments, said coding sequence is not naturally associated with the cell. In some embodiments, a recombinant antibody has a glycosylation pattern that is different than the glycosylation pattern of an antibody having the same sequence if it were to exist in nature. In some embodiments, a recombinant antibody is expressed in a mammalian host cell which is not a human host cell. Notably, individual mammalian host cells have unique glycosylation patterns.The term "isolated" refers to a protein (eg, an antibody) that is substantially free of other cellular material. In some embodiments, an isolated antibody is substantially free of other proteins from the same species. In some embodiments, an isolated antibody is expressed by a cell from a different species and is substantially free of other proteins from the different species. A protein may be rendered substantially free of naturally associated components (or components associated with the cellular expression system used to produce the antibody) by isolation, using protein purification techniques well known in the art. In some embodiments, the antibodies, or antigen binding fragments, of the disclosure are isolated.A "vector" is a protein, nucleic acid or group of proteins and / or nucleic acids that can be used as a vehicle to introduce another nucleic acid sequence into a cell. One type of vector is a "plasmid," which refers to a linear or circular double stranded DNA molecule into which additional nucleic acid segments can be ligated. Another type of vector is a viral vector (e.g., replication defective retroviruses, adenoviruses and adeno-associated viruses, or the genomic nucleic acid contained therein), comprising additional, exogenous DNA, RNA ог hybrid DNA or RNA molecules that can be introduced into a genome within a transduced cell. Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., bacterial vectors comprising a bacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., non-episomal mammalian vectors) are integrated into the genome of a host cell upon introduction into the host cell, and thereby are replicated along with the host genome. An "expression vector" is a type of vector that can direct the expression of a chosen polynucleotide. The disclosure relates to any one or plurality of vectors that comprise nucleic acid sequences encoding any one or plurality of amino acid sequence disclosed herein. In some embodiments, the expression vector includes from about 30 to about 100,000 nucleotides (e.g., from about 30 to about 50, from about 30 to about 100, from about 30 to about 250, from about 30 to about 500, from about 30 to about 1,000, from about 30 to about 1,500, from about 30 to about 3,000, from about 30 to about 5,000, from about 30 to about 7,000, from about 30 to about 10,000, from about 30 to about 25,000, from about 30 to about 50,000, from about 30 to about 70,000, from about 100 to about 250, from about 100 to about 500, from about 100 to about 1,000, from about 100 to about 1,500, from about 100 to about 3,000, from about 100 to about 5,000, from about 100 to about 7,000, from about 100 to about 10,000, from about 100 to about 25,000, from about 100 to about 50,000, from about 100 to about 70,000, from about 100 to about 100,000, from about 500 to about 1,000, from about 500 to about 1,500, from about 500 to about 2,000, from about 500 to about 3,000, from about 500 to about 5,000, from about 500 to about 7,000, from about 500 to about 10,000, from about 500 to about 25,000, from about 500 to about 50,000, from about 500 to about 70,000, from about 500 to about 100,000, from about 1,000 to about 1,500, from about 1,000 to about 2,000, from about 1,000 to about 3,000, from about 1,000 to about 5,000, from about 1,000 to about 7,000, from about 1,000 to about 10,000, from about 1,000 to about 25,000, from about 1,000 to about 50,000, from about 1,000 to about 70,000, from about 1,000 to about 100,000, from about 1,500 to about 3,000, from about 1,500 to about 5,000, from about 1,500 to 7,000, from about 1,500 to about 10,000, from about 1,500 to about 25,000, from about 1,500 to about 50,000, from about 1,500 to about 70,000, from about 1,500 to about 100,000, from about 2,000 to about 3,000, from about 2,000 to about 5,000, from about 2,000 to about 7,000, from about 2,000 to about 10,000, from about 2,000 to about 25,000, from about 2,000 to about 50,000, from about 2,000 to about 70,000, and from about 2,000 to about 100,000).Finally, it should be understood that all of the individual values and sub-ranges of values contained within an explicitly disclosed range are also specifically contemplated and should be considered disclosed unless the context specifically indicates otherwise. The foregoing applies regardless of whether in particular cases some or all of these embodiments are explicitly disclosed.Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed method and compositions belong. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present method and compositions, the particularly useful methods, devices, and materials are as described. Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference. Nothing herein is to be construed as an admission that the present disclosure is not entitled to antedate such disclosure by virtue of prior disclosure. No admission is made that any reference constitutes prior art. The discussion of references states what their authors assert, and applicants reserve the right to challenge the accuracy and pertinency of the cited documents. It will be clearly understood that, although a number of publications are referred to herein, such reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.Throughout the description and claims of this specification, the word "comprise" and variations of the word, such as "comprising" and "comprises," means "including but not limited to," and is not intended to exclude, for example, other additives, components, integers or steps. In particular, in methods stated as comprising one or more steps or operations it is specifically contemplated that each step comprises what is listed (unless that step includes a limiting term such as "consisting of"), meaning that each step is not intended to exclude, for example, other additives, components, integers or steps that are not listed in the step.A. Nucleic Acid Compositions1. Leader SequenceThe expressible nucleic acid sequence of the present disclosure is optionally free of a nucleic acid sequence encoding a leader sequence. A "leader sequence" may be from time to time refers to a "signal peptide" and thus, the terms "leader sequence" and "signal peptide" are used interchangeably herein and refer to an amino acid sequence that can be linked at the amino terminus of a protein set forth herein. Signal peptides / leader sequences typically direct localization of a protein. Signal peptides / leader sequences used herein preferably facilitate secretion of the protein from the cell in which it is produced. Signal peptides / leader sequences are often cleaved from the remainder of the protein, often referred to as the mature protein, upon secretion from the cell. Signal peptides / leader sequences, when present in some embodiments, are linked at the N terminus of the protein.Although the expressible nucleic acid sequence of the present disclosure is optionally free of a nucleic acid sequence encoding a leader sequence, if the presence of such a leader sequence is required for proper secretion of the protein produced by the cell, it may nonetheless be included in the polypeptide encoded by the expressible nucleic acid sequence of the present disclosure.A non-limiting example of the leader sequence is the amino acid sequence of MDWTWILFLVAAATRVHS (SEQ ID NO: 6) encoded by the nucleic acid sequence of atggactggacctggattctgttcctggtggccgccgccacaagggtgcacage (SEQ ID NO: 1).Another non-limiting example of the leader sequence is the amino acid sequence of MDWTWRILFLVAAATGTHA (SEQ ID NO: 40) encoded by the nucleic acid sequence of atggactggacctggagaatcctgttcctggtggccgccgccaccggcacacacgccgatacacacttccccatctgcatcttttg ctgtggctgttgccataggtccaagtgtgggatgtgctgcaaaact (SEQ ID NO: 39).A yet another non-limiting example of the leader sequence is the amino acid sequence of MRRMQLLLLIALSLALVTNS (SEQ ID NO: 101). In some embodiments when the leader sequence is present, the leader sequence may comprise at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 6, SEQ ID NO: 40, or SEQ ID NO: 101, or a functional variant thereof. In some embodiments when the leader sequence is present, the leader sequence may comprise the amino acid sequence of SEQ ID NO: 6, SEQ ID NO: 40, or SEQ ID NO: 101, or a functional variant thereof. In some embodiments when the leader sequence is present, the leader sequence may be encoded by a nucleic acid sequence comprising at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 1 or SEQ ID NO: 39, or a functional variant thereof. In some embodiments when the leader sequence is present, the leader sequence may be encoded by the nucleic acid sequence of SEQ ID NO: 1 or SEQ ID NO: 39, or a functional variant thereof. In other embodiments when the leader sequence is present, the leader sequence may be encoded by a nucleic acid sequence comprising at least about 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to a nucleic acid sequence that is complementary to SEQ ID NO: 1 or SEQ ID NO: 39, or a functional variant thereof. In some embodiments when the leader sequence is present, the leader sequence may be encoded by a nucleic acid sequence that is complementary to SEQ ID NO: 1 or SEQ ID NO: 39, or a functional variant thereof.2. Regulatory SequencesIn some embodiments, the expressible nucleic acid sequence can be operably linked to one or a plurality of regulatory sequences. Examples of regulatory sequences include, but not limited to, promoters, enhancers and other expression control elements (e.g., polyadenylation signals). Further examples of regulatory sequences are described in, for example, Goeddel, 1990, Gene Expression Technology: Methods in Enzymology 185, Academic Press, San Diego, Calif. and Baron et al., 1995, Nucleic Acids Res. 23:3605-06. In some embodiments, the one or a plurality of regulatory sequences herein comprise one or more of an hU6 promoter, an mU6 promoter, an EFla promoter, a CMV promoter, an SSFV promoter, a CbH promoter, an RSV promoter, and an MSCV promoter.3. Expressible DNA SequencesIn some embodiments, the expressible nucleic acid sequence is any disclosed herein. In some embodiments, the expressible nucleic acid sequence encodes any amino acid sequence herein. In some embodiments, the expressible nucleic acid sequence encodes any antibody or fragment thereof herein. In some embodiments, the expressible nucleic acid sequence encodes one or more amino acid sequence or functional variant thereof of Tables 13, 14, 15, 16, or 17. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 2. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 3. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 4. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 5. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 7. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 8. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 9. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 10. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 11. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 12, In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 13. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 14. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 15. In some embodiments the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 16. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 17. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 18. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 19. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 20. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 21. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 22. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 23. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 24. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 25. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 26. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 27. In some embodiments the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 28. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 29. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 30. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 31. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 32. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 33. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 34. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 35. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 36. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 37. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 38. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 41. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 42. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 43. In some embodiments the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 44. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 45. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 46. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 47. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 48. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 49. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 50. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 51. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 52. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 53. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 54. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 55. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 56. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 57. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 58. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 59. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 60. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 61. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 62. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 63. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 64. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 65. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 66. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 67. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 68. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 69. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 70. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 71. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 72. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 73. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 74. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 75. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 102. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 103. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 104. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 105. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 106. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 107. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 108. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 109. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 110. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 111. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 112. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 113. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 114. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 115. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 116. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 117. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 118. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 119. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 120. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 121. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 122. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 123. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 124. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 125. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 126. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 127. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 128. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 129. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 130. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 131. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 132. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 133. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 134. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 135. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 136. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 137. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 138. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 139. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 140. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 141. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 142. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 143. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 144. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 145. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 146. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 147. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 148. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 149. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 150. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 151. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 152. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 153. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 154. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 155. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 156. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 157. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 158. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 159. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 160. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 170. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 171. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 172. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 173. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 174. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 175. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 176. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 177. In some embodiments, the expressible nucleic acid sequence comprises a nucleic acid sequence encoding an amino acid sequence comprising at least about 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to SEQ ID NO: 178. In some embodiments, the disclosure relates to a DNA vector pVAX1 comprising any one or more of the expressible nucliec acid sequences disclosed herein or a composition comprising an RNA transcript thereof. In some embodiments, the disclosure relates to a pharmaceuical composition comprising a nucleic acid seqeunce that includes one or a plurality of expressible nucleic acid sequences discloed herein or an RNA transcript thereof; and a pharmaceutically acceptable carrier. The pVAX1 (SEQ ID NO: 5) backbone sequence is: gactcttcgcgatgtacgggccagatatacgcgttgacattgattattgactagttattaatagtaatcaattacggggtcattagttcatag cccatatatggagttccgcgttacataacttacggtaaatggcccgcctggctgaccgcccaacgacccccgcccattgacgtcaataa tgacgtatgttcccatagtaacgccaatagggactttccattgacgtcaatgggtggactatttacggtaaactgcccacttggcagtaca tcaagtgtatcatatgccaagtacgccccctattgacgtcaatgacggtaaatggcccgcctggcattatgcccagtacatgaccttatg ggactttcctacttggcagtacatctacgtattagtcatcgetattaccatggtgatgcggttttggcagtacatcaatgggcgtggatage ggtttgactcacggggatttccaagtctccaccccattgacgtcaatgggagtttgttttggcaccaaaatcaacgggactttccaaaatg tcgtaacaactccgccccattgacgcaaatgggcggtaggcgtgtacggtgggaggtctatataagcagagctctctggctaactaga gaacccactgettactggcttatcgaaattaatacgactcactatagggagacccaagctggctagcgtttaaacttaagcttggtaccg agctcggatccactagtccagtgtggtggaattctgcagatatccagcacagtggcggccgctcgagtctagagggcccgtttaaacc cgctgatcagcctcgactgtgccttctagttgccagccatctgttgtttgcccctcccccgtgccttccttgaccctggaaggtgccactc ccactgtcctttcctaataaaatgaggaaattgcatcgcattgtctgagtaggtgtcattctattctggggggtggggtggggcaggaca gcaagggggaggattgggaagacaatagcaggcatgctggggatgcggtgggctctatggcttctactgggcggttttatggacagc aagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttctcgccgccaag gatctgatggcgcaggggatcaagctctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggt tctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgt cagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaalgaactgcaagacgaggcagcgcggctategt ggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgc cggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgat ccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggat gatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgagcatgcccgacggcgaggatctcg tcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtgg cggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttac ggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctgaattattaacgcttacaatttcctgatgcgg tattttctccttacgcatctgtgcggtatttcacaccgcatacaggtggcacttttcggggaaatgtgcgcggaacccctatttgtttatttttc taaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatagcacgtgctaaaacttcatttttaatttaaaa ggatctaggtgaagatcctttttgataatctcatgaccaaaatcccttaacgtgagttttcgttccactgagcgtcagaccccgtagaaaag atcaaaggatcttcttgagatcctttttttctgcgcgtaatctgctgcttgcaaacaaaaaaaccaccgctaccagcggtggtttgtttgccg gatcaagagctaccaactctttttccgaaggtaactggcttcagcagagcgcagataccaaatactgtccttctagtgtagccgtagttag gccaccacttcaagaactcigtagcaccgcclacatacctcgctctgctaatcctgttaccagtggctgctgccagtggcgataagtcgt gtcttaccgggttggactcaagacgatagttaccggataaggcgcagcggtcgggctgaacggggggttcgtgcacacagcccage ttggagcgaacgacctacaccgaactgagatacctacagcgtgagctatgagaaagcgccacgcttcccgaagggagaaaggcgg acaggtatccggtaagcggcagggtcggaacaggagagcgcacgagggagcttccagggggaaacgcctggtatctttatagtect gtcgggtttcgccacctctgacttgagcgtcgatttttgtgatgctcgtcaggggggcggagcctatggaaaaacgccagcaacgcgg cctttttacggttcctgggcttttgctggccttttgctcacatgttcttIn some embodiments, a nucleic acid molecule comprises at least about 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99% or 100% sequence identity to pVAX1 backbone or a functional variant thereof and the nucleic acid sequence further comprises an expressible nucleic acid sequence within the multiple cloning site.The disclosure relates to a nucleic acid sequence encoding a monoclonal antibody. In some embodiments, the disclosure relates to a composition or pharmaceutical composition comprising a nucleic acid molecule, such as PVAX1 plasmid comprising an expressible nucleic acid sequence or multiple expressible nucleic acid sequences, at least one of the nucleic acid sequences operably linked to a regulatory sequence and encoding a therapeutic agent, such as a dMAb or dMab fragment. In some embodiments, the at least one nucleic acid sequence encodes a polypeptide comprising a leader sequence and a dMab sequence. In some embodiments, the leader sequence is an Ig leader sequence, and, in some embodiments, the Ig sequence is an IgG or IgE leader sequence.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding SEQ ID NO:2: MFVFLVLLPL VSSQCVNLTT RTOLPPAYTN SETRGVZYPD KVERSSVLES TOOLFLPFES NVTWFHATHV SOTNGTERED NPVLPFNDGV YFASTEKSNT IRGWIFGTTL DSKTQSLLIV NNATNVVIKV CEFOFCONDPF LGVYTHKNNK SWMESEFRVY SSANNCTFEY VSOPFLMULE GKQGNFKNER EFVEKNIDGY FKLYSKHTPI NLVEDLPQGF SALEPLVDLP IGINTTREQT LLALERSYLT PGDSSSGWTA GAAAYYVGYL OPSTELLKYN ENGTITDAVD CALDPLSETK CTLKSFTVEK GIYOTSNFRV OPTESIVRFF NITNLCPFGE VENATREASV YAWNRKRISN CVADYSVLYN SASISTEKCY GVSPTELNDL CETNVYADSE VIRGDEVROI AFGQTGETAD YNYKLPEDFT GOVIAWNSNN LDSKVGGNYN YLYRLFRKSN LKPFERDIST EIYQAGSTPC NGVEGENCYF PLOSYGFQPT NGVGYQPYRV VVLSTELIRA PATVCGPKKS TNLVKNKCVN ENENGLTGTG VLTESNKKFL PROOFGRDIA DIIDAVRDPQ TLETLDITEC SFGGVSVITP GTNTSNOVAV LYODVNCTEV PVATHADOLT PTWEVYSTOS NVFOTRAGCL IGAEHVNNST ECDIPIGAGI CASYQTOTNS PRRARSVASO SIIAYTMSLG AENSVAYSNN SIAIPTNETI SVTTELLPVS MIKTSVDCTM YICGDSTECS NLLLQYGSEC TOLINRALTGI AVEQDANTQB VFAQVKOTYK TPPIEDFGGE NESQILPDPS KPSKRSFIED LLENAVTLAD AGFIRQYGOC LGDIAARDLI CAQKENGLTV LPPLLTDEMI AQYTSALLAG TITSGWTFGA GAALQIPFAM QMAYRENGIG VIONVLYENQ KLIANOENSA IGKIOUSISS TASALGKLOD VVNONAQALN TLVKOLSSHF GAISSVINDI LSPLDKVEAR VOIDRLITGR LOSLOTYVTO QLIRAAEIRA SANLAATKMS ECVLGOSKRV DECGKGYHLM SFPOSAPHGV VELEVTIVPA QEKNETTAPA ICROGKAHFP REGVFVSNGT HWFVTORNEY SPOLITIENT FVSGNCDVVI GIVNNTVYOP LOPÆLDSEKE ELDKYFENHT SPOVDIGDIS GINASVVNIQ KEIDRINEVA KNLNESLIDL QELGKYEQYT KWPWYIWLGE TAGLIAIVMV TIML.COMTSC CSCLKGCCSC GSCCKFDEODIn some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:3: TSAVQ or a functional variant comprising at least about 80% sequence identity to SEQ ID NO:3.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:4: WIAVGSGNTN YAQKFQD or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:4.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:7: PHCDRTSCHD GFDI or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:7.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:8: RASQSVRSSY LA or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:8.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:9: GASRRGT or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:9.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:11: QQYGSSPWT or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:11.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:12: TYVFT or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:12.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:13: GIIPFFGTAD YAQKFQG or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:13.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:14: LSQWDLLPM or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:14.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:15: RASQSFTSSY LA or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:15.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:16: QQYGTSPRMY T or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:16.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:17: SSNHYWV or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:17.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:18: SMYYSGSTAY NPSLTN or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:18.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:19: QIGPKRPSQV ADWFDP or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:19.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:20: RASQGISSYL A or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:20.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:21: AASTLQS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:21.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:22: QQLNSYPLT or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:22.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:23: QIGPKRPSQV ADWFEP or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:23.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:24: SYAIN or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:24.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:25: GIIPIFRTPΗ YAQKFQG or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:25.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:26: PSCGGDCPQY LKSSKLDWYF DL or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:26.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:27: RASQSVSSTY LA or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:27.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:28: QHYGSSPLT or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:28.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:29: RNYMS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:29.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:30: VIYSGGSTFY ADSVKG or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:30.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:31: DLDVVGGTDY or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:31.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:32: RASQSVSSSY LA or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:32.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:33: QQYGSSPGYT or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:33.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:34: DLEVVGGTDY or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:34.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:35: DYAIH or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:35.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:36: SISWDSGSIG YADSVKG or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:36.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:37: GAFPGYSSGW YYGLDV or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:37.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:38: TGTSSDVGGY NYVS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:38.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:41: EVSKRPS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:41.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:42: TGTSSDVGGY NYVS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:42.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:43: SSYAGNKGV or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:43.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:44: GAFPGYSSGW YYGLEV or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:44.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:45: QVQLVESGPE MKKPGTSVKV SCKASGFTFI TSAVQWVRQA RGQRLEWMGW IAVGSGNTNYAQKFQDRVTI NRDMSTSTAY MELSSLRSED TAVYYCAAPH CDRTSCHDGF DIWGQGTMVTVSS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:45.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:46: DIVMTQSPGT LSLSPGERAT LSCRASQSVR SSYLAWYQQK PGQAPRLLIY GASRRGTGIPDRFSGSGSGT DFTLTISRLE PEDFAVYYCQ QYGSSPWTFG QGTKVEIK or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:46.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:47: QVQLVQSGPE VKKPGTSVKV SCKASGFTFI TSAVQWVRQA RGQRLEWMGW IAVGSGNTNYAQKFQDRVTI TRDMSTSTAY MELSSLRSED TAVYYCAAPH CDRTSCHDGF DIWGQGTMVTVSS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:47.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:48: EIVMTQSPGT LSLSPGERAT LSCRASQSVR SSYLAWYQQK PGQAPRLLIY GASRRGTGIPDRFSGSGSGT DFTLTISRLE PEDFAVYYCQ QYGSSPWTFG GGTKVEIK or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:48.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:49: EVQLVQSGAE VKKPGSSVKV SCKASRGTFN TYVFTWVRQA PGQGLEWMGG IIPFFGTADYAQKFQGRVTI TADDSTSTAY MELSSLRSED TAVYYCSRLS QWDLLPMWGQ GTLVTVSS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:49.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:50: EIVMTQSPGT LSLSPGERAT LSCRASQSFT SSYLAWYQQK PGQAPRLLIY GASSRATGIPDRFSGSGSGT DFTLTISRLE PEDFAVYYCQ QYGTSPRMYT FGQGTKLEIK or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:50.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:51: QVQLQESGPG LVKPSETLSL TCTVFGGSIT SSNHYWVWIR QPPGKGLEWI GSMYYSGSTAYNPSLTNRVT ISVDTSKNQF SLKLSSVTAA DTAVYYCARQ IGPKRPSQVA DWFDPWGQGTLVTVSS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:51.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:52: DIQLTQSPSF LSASVGDRVT ITCRASQGIS SYLAWYQQKP GKAPKLLIYA ASTLQSGVPSRFSGSGSGTE FTLTISSLQP EDFATYYCQQ LNSYPLTFGG GTKVEIK or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:52.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:53: QVQLQESGPG LVKPSETLSL TCTVSGGSIT SSNHYWVWIR QPPGKGLEWI GSMYYSGSTAYNPSLTNRVT ISVDTSKNQF SLKLSSVTAA DTAVYYCARQ IGPKRPSQVA DWFDPWGQGTLVTVSS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:53.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:54: QVQLQESGPG LVKPSETLSL TCTVSGGSIT SSNHYWVWIR QPPGKGLEWI GSMYYSGSTAYNPSLTNRVT ISVDTSKNQF SLKLSSVTAA DTAVYYCARQ IGPKRPSQVA DWFEPWGQGTLVTVSS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:54.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:55: EVQLVESGAE VKKPGSSVKV SCKASGGTFS SYAINWVRQA PGQGLEWMGG IIPIFRTPHY AQKFQGRVTI TADESTGTAY MELSSLRSED TAVYYCASPS CGGDCPQYLK SSKLDWYFDLWGRGTLVTVS S or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:55.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:56: VIWMTQSPGT LSLSPGERAT LSCRASQSVS STYLAWYQQK PGQAPRLLIY GASSRATGIPDRFSGSGSGT DFTLTISRLE PEDFAVYYCQ HYGSSPLTFG QGTRLEIK or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:56.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:57: QVQLVQSGAE VKKPGSSVKV SCKASGGTFS SYAINWVRQA PGQGLEWMGG IIPIFRTPHYAQKFQGRVTI TADESTSTAY MELSSLRSED TAVYYCASPS CGGDCPQYLK SSKLDWYFDLWGRGTLVTVS S or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:57.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:58: EIVMTQSPGT LSLSPGERAT LSCRASQSVS STYLAWYQQK PGQAPRLLIY GASSRATGIPDRFSGSGSGT DFTLTISRLE PEDFAVYYCQ HYGSSPLTFG QGTRLEIK or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:58.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:59: EVQLVESGGG LIQPGGSLRL SCAASEIIVS RNYMSWVRQA PGKGLEWVSV IYSGGSTFYADSVKGRFTIS RDNSKNTLYL QMNSLRAEDT AVYYCARDLD VVGGTDYWGQ GTLVTVSS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:59.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:60: GASSRAT or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:60.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:61: GFTFMSSA or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:61.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:62: IVIGSGNT or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:62.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:63: AAPYCSSISC NDGFDI or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:63.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:64: QSVSSSY or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:64.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:65: SISWDSGSIG YADSVKG or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:65.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:66: QHYGSSRGWT or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:66.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:67: TGTSSDVGGY NYVS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:67.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:68: SYNAVWN or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:68.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:69: RTYYRSGWYN DYAESVKS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:69.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:70: SGHITVFGVN VDAFDM or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:70.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:71: RTSQSLSSYT Hor a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:71.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:72: AASSRGS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:72.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a CDR comprising SEQ ID NO:73: QQSRT or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:73.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a variable chain comprising SEQ ID NO:74: QVQLQQSGPG LVKPSQTLSL TCAISGDSVS SYNAVWNWIR QSPSRGLEWL GRTYYRSGWYNDYAESVKSR ITINPDTSKN QFSLQLNSVT PEDTAVYYCA RSGHITVFGV NVDAFDMWGQGTMVTVSS or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:74.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a light chain comprising SEQ ID NO:75: DIQMTQSPSS LSASVGDRVT ITCRTSQSLS SYTHWYQQKP GKAPKLLIYA ASSRGSGVPSRFSGSGSGTD FTLTISSLQP EDFATYYCQQ SRTFGQGTKV EIK or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:75.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a heavy chain comprising SEQ ID NO:76: QVQLQQSGPG LVKPSQTLSL TCAISGDSVS SYNAVWNWIR QSPSRGLEWL GRTYYRSGWYNDYAESVKSR ITINPDTSKN QFSLQLNSVT PEDTAVYYCA RSGHITVFGV NVDAFDMWGQGTMVTVSSAS TKGPSVFPLA PSSKSTSGGT AALGCLVKDY FPEPVTVSWN SGALTSGVHTFPAVLQSSGL YSLSSVVTVP SSSLGTQTYI CNVNHKPSNT KVDKRVEPKS CDKTHTCPPCPAPELLAGPS VFLFPPKPKD TLMISRTPEV TCVVVDVSHE DPEVKFNWYV DGVEVHNAKTKPREEQYNST YRVVSVLTVL HQDWLNGKEY KCKVSNKALP LPEEKTISKA KGQPREPQVYTLPPSREEMT KNQVSLTCLV KGFYPSDIAV EWESNGQPEN NYKTTPPVLD SDGSFFLYSKLTVDKSRWQQ GNVFSCSVMH EALHNHYTQK SLSLSPGK or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:76.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding a heavy chain comprising SEQ ID NO:77 or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:77.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding SEQ ID NO:101 or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:101.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding SEQ ID NO: 102 or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:102.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding SEQ ID NO:103 or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:103.In some embodiments, the nucleic acid molecules of the disclosure comprise an expressible nucleic acid sequence encoding SEQ ID NO:104 or a functional variant comprising at least about 75% or 80% sequence identity to SEQ ID NO:104.

Claims

1. A method of stably delivering a nucleic acid sequence in a subject in need thereof comprising:(a) administering to the subject a composition comprising nucleic acid molecule that comprises: (i) at least one expressible nucleic acid sequence encoding a therapeutic protein; and (ii) a backbone comprising a regulatory sequence operably linked to the at least one expressible nucleic acid sequence;(b) allowing a time period sufficient for the nucleic acid molecule to stably transfect one or a plurality of skeletal muscle cell of the subject;wherein the nucleic acid molecule is a plasmid comprising from about 80% to about 100% deoxyribonucleic acid.

2. The method of claim 1 further comprising performing an electroporating step at the site of administration after or contemporaneously with the step of administering.

3. The method of any of claims 1 or 2, wherein the therapeutic protein comprises a monoclonal antibody or functional variant thereof.

4. The method of any of claims 1 through 3, wherein the step of administering is performed by intramuscular injection.

5. The method of any of claims 1 through 3, wherein the step of administering is performed by intradermal injection.

6. The method of any of claims 1 through 5, wherein further comprising allowing a time period sufficient for a skeletal muscle cell to become transfected with the nucleic acid molecule after the step of administering.

7. The method of any of claims 1 through 6, further comprising allowing expression of the therapeutic protein in the skeletal muscle cell for no less than about 70 weeks.

8. The method of claim 7, wherein expression of the therapeutic protein in the skeletal muscle occurs for no less than about 96 weeks.

9. The method of claim 3, wherein the monoclonal antibody or variant thereof is a humanized monoclonal antibody or functional variant thereof that binds an epitope from a pathogen antigen or a tumor-associated antigen with an IC50 from about 1 nM to about 700 nM.

10. The method of any of claims 1 through 9, wherein the composition further comprises hyaluronidase or a functional variant thereof.

11. The method of any of claims 1 through 10, wherein the method is free of re-dosing for at least about 70 weeks.

12. The method of any of claims 1 through 11, wherein the step of administering comprises administering a pharmaceutically effective dose of the composition.

13. The method of claim 12, wherein the pharmaceutically effective dose is from about 200 mg to about 400 mg of nucleic acid molecule.

14. The method of any of claims 1 through 12, wherein the composition comprises from about 1 microgram per milliliter of nucleic acid molecule to about 100 micrograms per milliliter of nucleic acid molecule in a liquid formulation.

15. The method of claim 2, wherein the step of electroporating comprises exposing the subject to a repeated pattern of from about 10 to about 1,000 volts at about a 10, 20, 30, or about 40 microsecond increments over a period of from about 1 to about 10 seconds.

16. The method of claim 10, wherein the composition is a liquid dosage form administered by intramuscular or intradermal injection and the hyaluronidase or a functional variant thereof is at a concentration of from about 0.1 micromolar to about 1.0 micormolar.

17. A method of expressing a nucleic acid sequence in a subject for more than about 70 weeks in need thereof comprising:(a) administering to the subject a composition comprising nucleic acid molecule that comprises: (i) at least one nucleic acid sequence encoding a therapeutic protein; and (ii) a backbone comprising a regulatory sequence operably linked to the at least one expressible nucleic acid sequence;(b) allowing a time period sufficient for the nucleic acid molecule to stably transfect one or a plurality of skeletal muscle cells of the subject;(c) allowing a time period for expression of the nucleic acid sequence; wherein the time period for expression is no less than about 70 weeks.

18. The method of claim 17 further comprising performing an electroporating step at the site of administration after or contemporaneously with the step of administering.

19. The method of any of claims 17 or 18, wherein the therapeutic protein comprises a monoclonal antibody or functional variant thereof.

20. The method of any of claims 17 through 19, wherein the step of administering is performed by intramuscular injection.

21. The method of any of claims 17 through 19, wherein the step of administering is performed by intradermal injection.

22. The method of any of claims 17 through 21, wherein further comprising allowing a time period sufficient for a skeletal muscle cell to become stably transfected with the nucleic acid molecule after the step of administering.

23. The method of any of claims 17 through 22, wherein the method is free of integration in endogenous DNA of the skeletal muscle cell.

24. The method of claim 17, wherein expression of the therapeutic protein in the skeletal muscle occurs for no less than about 96 weeks.

25. The method of claim 17 through 24, wherein the therapeutic protein is a humanized monoclonal antibody or functional variant thereof that binds an epitope from a pathogen antigen or a tumor-associated antigen with an IC50 from about 1 nM to about 700 nM.

26. The method of any of claims 17 through 25, wherein the composition further comprises hyaluronidase or a functional variant thereof.

27. The method of any of claims 17 through 26, wherein the method is free of any re-dosing or repeatead administratin step for at least about 70 weeks.

28. The method of any of claims 17 through 27, wherein the step of administering comprises administering a pharmaceutically effective dose of the composition.

29. The method of claim 28, wherein the pharmaceutically effective dose is from about 200 micrograms to about 240 milligrams of the nucleic acid molecule.

30. The method of any of claims 17 through 29, wherein the composition comprises from about 1 microgram per milliliter of nucleic acid molecule to about 100 micrograms per milliliter of nucleic acid molecule in a liquid formulation.

31. The method of claim 18, wherein the step of electroporating comprises exposing the subject to a repeated pattern of from about 1 to about 1000 volts at about 10, 20, 30 or about 40 microsecond increments over a period of from about 1 second to about 10 seconds.

32. The method of claim 17, wherein the composition is a liquid dosage form administered by intramuscular or intradermal injection and the hyaluronidase or a functional variant thereof is at a concentration of from about 0.1 micromolar to about 1.0 micormolar.

33. A composition comprising:(i) a nucleic acid molecule comprising an expressible nucleic acid sequence encoding a humanized monoclonal antibody or antbody fragment specific for a viral antigen or a cancer-associated antigen; wherein the humanized monoclonal antibody comprises a CDR disclosed herein or a CDR comprising about 90% sequence identity to a CDR disclosed hererin; and, optionally,(ii) hyluronidase.

34. A pharmaceutical composition comprising (i) the composition of claim 33, and (ii) a pharmaceutically acceptable carrier.

35. A method of treating a disorder in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the composition of claim 33, wherein the administering is accomplished by transdermal administration or intramuscular administration.

36. The method of claim 35, wherein the therapeutically effective amount is from about 20 to about 2000 micrograms of the expressible nucleic acid sequence.

37. The method of any of claims 35 through 36, wherein the subject is a human and the administering comprises using a side-port device with adaptive electroporation.

38. The method of any of claims 35 through 37, wherein the therapeutically effective dose is from about 0.3 micrograms of the composition per kilogram of subject to about 30 micrograms per kilogram of subject.

39. The method of any of claims 35 through 38, further comprising allowing a time period sufficient for a skeletal muscle cell to become stably transfected with the nucleic acid molecule after the step of administering.

40. The method of any of claims 1, 17, or 35 through 39, wherein the method is free of integration in endogenous DNA of the skeletal muscle cell.

41. The method of any of claims 35 through 40, further comprising allowing a time period sufficient for a skeletal muscle cell to become stably transfected with the nucleic acid molecule after the step of administering.

42. The method of any of claims 35 through 41, wherein the method is free of integration in endogenous DNA of the skeletal muscle cell.

43. The method of any of claims 35 through 42, wherein the disorder is hemophilia.

44. The method of any of claims 35 through 42, wherein the disorder is a pathogen infection and wherein the humanized antibody or antibody fragment thereof is capable of binding a pathogen antigen from the pathogen at an IC50 of from about 1 nM to about 700 nM.

45. The method of claim 44, wherein the pathogen infection is an HIV-1 infection, West Nile Virus infection, Marburgvirus infection, RSV infection, Nipah virus infection, influenza, Coronavirus infection, filovirus infection, or ebola infection.