Probiotic intervention method based on baseline abundance of intestinal microbiota

By detecting the abundance of Akkermansia myxophilus in the gut, a personalized probiotic supplementation plan can be developed, which solves the problem of lack of precision in probiotic supplementation in existing technologies and achieves significant metabolic improvement and gut health enhancement.

WO2026156902A1PCT designated stage Publication Date: 2026-07-30SHANGHAI INST FOR ENDOCRINE & METABOLIC DISEASES +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
SHANGHAI INST FOR ENDOCRINE & METABOLIC DISEASES
Filing Date
2025-01-27
Publication Date
2026-07-30

AI Technical Summary

Technical Problem

Existing technologies lack probiotic intervention methods based on the baseline abundance of gut microbiota, making it impossible to implement personalized probiotic supplementation strategies, resulting in a lack of precision and inconsistent effects in probiotic application.

Method used

This invention provides a probiotic intervention method based on the baseline abundance of gut microbiota. By detecting the abundance level of Akkermansia muciniphila in the gastrointestinal tract or feces of subjects, personalized supplemental dosage and administration regimens of Akkermansia muciniphila are formulated according to different disease states and baseline abundance levels, including the administration of solid or liquid dosage forms.

Benefits of technology

It enables precise probiotic supplementation based on the baseline abundance of an individual's gut microbiota, significantly improving metabolic indicators such as lowering blood pressure, blood sugar, blood lipids and BMI, enhancing intestinal barrier function, and reducing inflammatory responses, thus solving the problem of inconsistent probiotic supplementation effects in existing technologies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2025075538-FTAPPB-I100001
    Figure PCTCN2025075538-FTAPPB-I100001
  • Figure PCTCN2025075538-FTAPPB-I100002
    Figure PCTCN2025075538-FTAPPB-I100002
  • Figure PCTCN2025075538-FTAPPB-I100003
    Figure PCTCN2025075538-FTAPPB-I100003
Patent Text Reader

Abstract

Provided is a probiotic intervention method based on the baseline abundance of intestinal microbiota. The method comprises administering to a subject in need thereof a prophylactically and / or therapeutically effective amount of Akkermansia muciniphila, thereby treating and / or preventing obesity, type 2 diabetes, hyperlipidemia, hypertension, or non-alcoholic fatty liver disease. The method solves the problems of significant individual differences in the effects of existing probiotic supplementation and the lack of precise intervention, which can achieve the precise screening of the target population suitable for Akk bacteria supplementation.
Need to check novelty before this filing date? Find Prior Art

Description

A probiotic intervention method based on baseline gut microbiota abundance Technical Field

[0001] This invention relates to the field of precision medicine, specifically to a probiotic intervention method based on the baseline abundance of gut microbiota. Background Technology

[0002] Current research indicates that gut microbiota plays a crucial role in the development and progression of metabolic diseases. Gut microbiota dysbiosis may increase the risk of metabolic diseases such as obesity, type 2 diabetes, and non-alcoholic fatty liver disease. Although probiotic supplementation is widely used to improve gut health and metabolic disorders, current research in the fields of gut microbiota and probiotics has primarily focused on the potential mechanisms and broad applicability of probiotics, lacking a systematic exploration of the relationship between probiotic abundance in the gut and the effectiveness of supplementation. Therefore, research evaluating the efficacy of probiotic interventions based on gut probiotic abundance levels remains incomplete, and this field urgently needs new breakthroughs.

[0003] Akkermansia muciniphila (AkK bacteria) is a bacterium that colonizes the intestinal mucus layer. It utilizes mucus proteins secreted by the host as its sole source of carbon and nitrogen to protect the gut from pathogens. It plays a crucial role in maintaining intestinal homeostasis and health, participating in glucose and lipid metabolism, and immune responses, and is considered a next-generation probiotic with enormous development potential. However, questions remain to be addressed regarding whether patients with metabolic disorders require AkK intervention, and under what circumstances, guided by precision medicine principles, AkK supplementation can better yield metabolic benefits. Summary of the Invention

[0004] To address the aforementioned technical problems, this invention provides a probiotic intervention method based on the baseline abundance of gut microbiota.

[0005] Specifically, the present invention provides a method for preventing and / or treating a disease, the method comprising administering a preventive and / or therapeutically effective amount of Akkermansia muciniphila to a subject in need.

[0006] In some implementations, the disease is at least one of overweight, obesity, abnormal glucose metabolism, type 2 diabetes, dyslipidemia, hypertension, and non-alcoholic fatty liver disease.

[0007] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <2.

[0008] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <1.7.

[0009] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <1.

[0010] In some specific implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA < 0.

[0011] In some specific implementations, the relative quantitative abundance of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is 0 as determined by metagenomic analysis.

[0012] In this disclosure, the abundance levels of Akkermansia muciniphila in the gastrointestinal tract or feces of the subject are Log10 Akk ng / g baseline gastrointestinal contents DNA <2, Log10 Akk ng / g baseline gastrointestinal contents DNA <1.7, Log10 Akk ng / g baseline gastrointestinal contents DNA <1, and Log10 Akk ng / g baseline gastrointestinal contents DNA <0, respectively representing the Akkermansia muciniphila DNA content in the subject's gastrointestinal contents as <100 ng / g, 50 ng / g, 10 ng / g, and 1 ng / g.

[0013] In some implementations, the disease is at least one of overweight, obesity, type 2 diabetes, dyslipidemia, and hypertension.

[0014] In some implementations, the dyslipidemia is hyperlipidemia.

[0015] In some implementations, the overweight, obesity, and type 2 diabetes meet at least one of the following admission criteria:

[0016] (1) BMI ≥ 24 kg / m 2 ;

[0017] (2) Random blood glucose ≥11.1 mmol / L;

[0018] (3) Fasting blood glucose ≥ 6.1 mmol / L;

[0019] (4) Oral glucose tolerance test (OGTT) 2-hour blood glucose ≥7.8 mmol / L;

[0020] (5) HbA1c ≥ 5.7%.

[0021] In some implementations, the hyperlipidemia meets at least one of the following admission criteria:

[0022] (i) Total cholesterol (TC): ≥6.2 mmol / L;

[0023] (ii) Low-density lipoprotein cholesterol (LDL-C): ≥4.1 mmol / L

[0024] (iii) Triglycerides (TG): ≥2.3mmol / L.

[0025] In some implementations, the hypertension meets at least one of the following admission criteria:

[0026] (I) Systolic blood pressure 130–139 mmHg and / or diastolic blood pressure 80–89 mmHg;

[0027] (II) Systolic blood pressure ≥140 mmHg and / or diastolic blood pressure ≥90 mmHg.

[0028] In some implementations, the disease is at least one of overweight, obesity, and type 2 diabetes.

[0029] In some implementations, the overweight, obesity, and type 2 diabetes meet at least one of the following admission criteria:

[0030] (1) BMI ≥ 24 kg / m 2 ;

[0031] (2) Fasting blood glucose ≥7.0 mmol / L;

[0032] (3) HbA1c ≥ 7.0%.

[0033] In some specific implementations, the overweight, obesity, and type 2 diabetes meet at least one of the following admission criteria:

[0034] (1) 25kg / m 2 ≤BMI≤40.0kg / m 2 ;

[0035] (2) 7.0 mmol / L ≤ fasting blood glucose ≤ 13.3 mmol / L;

[0036] (3) 7.0% ≤ HbA1c ≤ 10.0%.

[0037] In some embodiments, the method includes administering a dose of not less than 1*10^10 CFU of live bacteria per administration.

[0038] In some embodiments, the dosage is not less than 3*10^10 CFU, 4*10^10 CFU, 5*10^10 CFU, 1*10^11 CFU, 1.5*10^11 CFU, 2*10^11 CFU, 5*10^11 CFU, 1*10^12 CFU or 1*10^13 CFU of live bacteria per administration.

[0039] In some specific implementations, the dosage is selected from 3*10^10 CFU to 1.5*10^11 CFU of live bacteria.

[0040] In some embodiments, the method includes administering Akkermansia muciniphila to the patient at dosing intervals of not less than 6 hours.

[0041] In some implementations, the dosing interval is 6h, 7h, 8h, 9h, 10h, 11h, 12h, 18h, 24h, 48h, 72h or 1 week.

[0042] In some implementations, the dosing interval is selected from 8h, 12h, 24h or 48h.

[0043] In some specific implementations, the dosing interval is 24 hours.

[0044] In some embodiments, the formulation of Akkermansia muciniphila described in this disclosure is selected from solid or liquid formulations.

[0045] In some embodiments, the solid dosage form is selected from powders, granules, capsules, wettable powders, and water-dispersible granules.

[0046] In some embodiments, the liquid dosage form is selected from suspensions, dispersible oil suspensions, and oil suspensions.

[0047] In some embodiments, the Akkermansia muciniphila described in this disclosure is formulated as a compound microbial agent, which also includes one or more other probiotics that can be used for metabolic improvement.

[0048] In some specific embodiments, the Akkermansia muciniphila described in this disclosure is administered orally in powder form.

[0049] In some specific implementations, the powder also includes excipients.

[0050] In some specific implementations, the excipients include microcrystalline cellulose and silica.

[0051] In some implementations, the abundance level of Akkermansia muciniphila in the gastrointestinal tract of the subject is detected by PCR.

[0052] In some specific implementations, the PCR detection includes the following steps:

[0053] Add the upstream primer shown in SEQ ID NO:1 and the downstream primer shown in SEQ ID NO:2 to the sample to be tested for PCR amplification.

[0054] In some specific implementations, the PCR detection includes the following steps:

[0055] Add the upstream primer shown in SEQ ID NO:3, the downstream primer shown in SEQ ID NO:4, and the probe shown in SEQ ID NO:5 to the sample to be tested, and perform PCR amplification reaction.

[0056] In some implementations, the sample to be tested is gastrointestinal contents.

[0057] In some implementations, the gastrointestinal contents are selected from feces or contents of the duodenum, jejunum, ileum, or cecum.

[0058] In some specific implementations, the gastrointestinal contents are feces.

[0059] In some implementations, the method also includes lifestyle interventions for the subjects.

[0060] In some specific implementations, the lifestyle interventions include controlling diet and increasing physical activity.

[0061] In some implementations, the method further includes drug intervention and / or metabolic surgery.

[0062] In some embodiments, the drug includes one or more of the following: GLP-1 receptor agonists, sulfonylureas, meglitinides, alpha-glucosidase inhibitors, DPP-4 inhibitors, SGLT2 inhibitors, and hormones.

[0063] In some specific implementations, the GLP-1 receptor agonist is selected from smegglutinin and telpogglutinin.

[0064] In some specific implementations, the hormone is insulin.

[0065] In some implementations, the gastrointestinal contents are selected from feces or contents of the duodenum, jejunum, ileum, or cecum.

[0066] In some specific implementations, the gastrointestinal contents are feces.

[0067] This invention also provides a method for detecting the abundance of Akkermansia muciniphila, the method comprising the following steps:

[0068] a) Add the upstream primer shown in SEQ ID NO:3, the downstream primer shown in SEQ ID NO:4, and the probe shown in SEQ ID NO:5 to the sample to be tested, and add PCR amplification reaction solution, and place it in a real-time PCR instrument for PCR amplification reaction;

[0069] b) Perform fluorescence detection on the amplification products and interpret the results based on the fluorescence curve and the abundance of bacterial species in the sample to be tested.

[0070] The PCR amplification reaction solution includes one or more of Taq enzyme, buffer, dNTP, UDG enzyme, and sterile water.

[0071] In some specific implementations, the PCR amplification reaction solution includes Probe qPCR Mix reagent.

[0072] In some implementations, the sample to be tested is gastrointestinal contents.

[0073] In some embodiments, the gastrointestinal contents are selected from feces or contents of the duodenum, jejunum, ileum, or cecum;

[0074] In some specific implementations, the gastrointestinal contents are feces.

[0075] In some specific implementation schemes, the conditions for the PCR amplification reaction in step a) are as follows:

[0076] Hold at 50℃ for 2 min; pre-deform at 95℃ for 2 min; denature at 95℃ for 10 s; anneal at 60-65℃ for 60 s; repeat 45 times.

[0077] The present invention also provides a method for lowering blood pressure, the method comprising administering a therapeutically effective amount of Akkermansia muciniphila to a subject in need.

[0078] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <2.

[0079] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <1.7.

[0080] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <1.

[0081] In some specific implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA < 0.

[0082] In some specific implementations, the relative quantitative abundance of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is 0 as determined by metagenomic analysis.

[0083] In some specific implementation schemes, the subjects meet at least one of the following admission criteria:

[0084] (I) Systolic blood pressure 130–139 mmHg and / or diastolic blood pressure 80–89 mmHg;

[0085] (II) Systolic blood pressure ≥140 mmHg and / or diastolic blood pressure ≥90 mmHg.

[0086] The present invention also provides a method for lowering blood glucose, the method comprising administering a therapeutically effective amount of Akkermansia muciniphila to a subject in need.

[0087] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <2.

[0088] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <1.7.

[0089] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <1.

[0090] In some specific implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA < 0.

[0091] In some specific implementations, the relative quantitative abundance of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is 0 as determined by metagenomic analysis.

[0092] In some implementations, the subject meets at least one of the following admission criteria:

[0093] (1) Random blood glucose ≥11.1 mmol / L;

[0094] (2) Fasting blood glucose ≥ 6.1 mmol / L;

[0095] (3) Oral glucose tolerance test (OGTT) 2-hour blood glucose ≥7.8mmol / L;

[0096] (4) HbA1c ≥ 5.7%.

[0097] In some implementations, the subject meets at least one of the following admission criteria:

[0098] (1) BMI ≥ 24 kg / m 2 ;

[0099] (2) Fasting blood glucose ≥7.0 mmol / L;

[0100] (3) HbA1c ≥ 7.0%.

[0101] In some specific implementation schemes, the subjects meet at least one of the following admission criteria:

[0102] (1) 25kg / m 2 ≤BMI≤40.0kg / m 2 ;

[0103] (2) 7.0 mmol / L ≤ fasting blood glucose ≤ 13.3 mmol / L;

[0104] (3) 7.0% ≤ HbA1c ≤ 10.0%.

[0105] The present invention also provides a method for lowering blood lipids, the method comprising administering a therapeutically effective amount of Akkermansia muciniphila to a subject in need.

[0106] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <2.

[0107] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <1.7.

[0108] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <1.

[0109] In some specific implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA < 0.

[0110] In some specific implementations, the relative quantitative abundance of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is 0 as determined by metagenomic analysis.

[0111] In some specific implementation schemes, the subjects meet at least one of the following admission criteria:

[0112] (1) Total cholesterol (TC): ≥6.2 mmol / L;

[0113] (2) Low-density lipoprotein cholesterol (LDL-C): ≥4.1mmol / L

[0114] (3) Triglycerides (TG): ≥2.3mmol / L.

[0115] The present invention also provides a method for reducing BMI, characterized in that the method for reducing BMI includes administering a therapeutically effective amount of Akkermansia muciniphila to a subject in need.

[0116] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <2.

[0117] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <1.7.

[0118] In some implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA <1.

[0119] In some specific implementations, the abundance level of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is Log10 Akk ng / g baseline gastrointestinal contents DNA < 0.

[0120] In some specific implementations, the relative quantitative abundance of Akkermansia muciniphila in the subject's gastrointestinal tract or feces is 0 as determined by metagenomic analysis.

[0121] In some implementations, the subject's BMI is ≥24 kg / m². 2 .

[0122] In some specific implementation schemes, the subject's BMI meets the following requirement: 25 kg / m² 2 ≤BMI≤40.0kg / m 2 .

[0123] The methods for preventing and / or treating diseases, lowering blood pressure, lowering blood sugar, lowering blood lipids, and lowering BMI provided in this disclosure are interchangeable in terms of dosage form, administration method, dosing interval, and dosage for Akkermansia muciniphila.

[0124] The present invention also provides Akkermansia muciniphila for the prevention and / or treatment of diseases in subjects, wherein the subjects and diseases are as defined in any embodiment of this disclosure.

[0125] The present invention also provides the use of Akkermansia muciniphila in the preparation of a treatment for the prevention and / or treatment of a disease in a subject, wherein the subject and the disease are as defined in any embodiment of this disclosure.

[0126] In some specific embodiments, the Akkermansia muciniphila strain described in this disclosure is AKK-WST01, with the strain preservation number CGMCC 14764.

[0127] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0128] The reagents and raw materials used in this invention are all commercially available.

[0129] The positive and progressive effects of this invention are as follows:

[0130] 1. Implement personalized probiotic supplementation strategies, breaking through the traditional "one-size-fits-all" approach to probiotic use.

[0131] This discovery breaks with previous probiotic supplementation strategies that did not differentiate between individual gut microbiota, emphasizing the importance of personalized probiotic supplementation programs. It proposes a novel finding that the effectiveness of Akkermansia myxophilus (Akk bacteria) supplementation is closely related to baseline gut microbiota levels. In individuals with low baseline Akk bacteria levels, Akk supplementation significantly improved multiple metabolic indicators. Germ-free mouse transplantation experiments confirmed the decisive influence of baseline Akk bacteria levels on probiotic colonization efficiency and metabolic improvement. This addresses the problems of significant individual variability in the effectiveness of current probiotic supplementation and the lack of precise intervention guidance. By detecting baseline Akk bacteria abundance, it is possible to accurately screen target populations suitable for Akk supplementation, providing a new technological pathway for precision medicine based on the gut microbiota.

[0132] Compared to existing technologies, which fail to consider the impact of baseline host microbiota levels on the effectiveness of probiotic supplementation, resulting in a lack of personalization in probiotic application, this invention is the first to propose a correlation between baseline microbiota levels and intervention effects, opening up a new direction for precise probiotic intervention.

[0133] 2. A comprehensive technological system from basic research to applications

[0134] This invention establishes a complete technical system covering baseline microbiota detection, precise screening (grouping by baseline Akk bacteria abundance), intervention implementation (precise use of Akk bacteria supplements), and efficacy verification (multi-dimensional assessment of metabolic indicators, intestinal barrier function, and inflammation). Attached Figure Description

[0135] Figure 1 shows the results of Akk bacteria abundance in feces of overweight or obese type 2 diabetic patients with different baseline Akk bacteria levels after Akk bacteria supplementation intervention.

[0136] Figure 2 shows the clinical indicators observed after Akk bacteria supplementation intervention in overweight or obese type 2 diabetes patients with different baseline Akk bacteria levels.

[0137] Figure 3 shows the results of metabolic homeostasis improvement in mice with low Akk abundance after Akk supplementation.

[0138] Figure 4 shows that supplementing with Akk bacteria can enhance intestinal barrier function and reduce inflammation in mice in the low-abundance Akk bacteria group.

[0139] Figure 5 shows the standard curve (60℃ TE dissolution) for the qPCR detection of Akkermansia_muciniphila.

[0140] Figure 6 shows the standard curve (60℃ DNA background) for qPCR detection of Akkermansia_muciniphila. Detailed Implementation

[0141] the term

[0142] "Treatment" means administering an oral or topical therapeutic agent, such as Akkermansia muciniphila containing the present disclosure or a therapeutic agent containing it, to a patient who has symptoms of one or more diseases, and the therapeutic agent is known to have a therapeutic effect on these symptoms. Typically, a therapeutic agent is administered in a treated patient or population in an amount that effectively relieves symptoms of one or more diseases to induce regression of such symptoms or inhibit the progression of such symptoms to any clinically measurable degree. The amount of a therapeutic agent that effectively relieves any specific disease symptom (also referred to as a "therapeuticly effective amount") can vary depending on a variety of factors, such as the patient's disease state, age, and weight, and the drug's ability to produce the desired therapeutic effect in the patient. Whether the disease symptoms have been relieved can be evaluated using any clinical test method commonly used by a physician or other healthcare professional to assess the severity or progression of the symptoms. Although the embodiments of this disclosure (e.g., treatment methods or products) may be ineffective in alleviating symptoms of each target disease, they should reduce symptoms of the target disease in a statistically significant number of patients, as determined by any statistical test known in the art, such as the Student t-test, chi-square test, U-test according to Mann and Whitney, Kruskal-Wallis test (H-test), Jonckheere-Terpstra test, and Wilcoxon test.

[0143] An "effective amount" includes the amount sufficient to improve or prevent the symptoms or condition of a medically diagnosed disease. An effective amount also means the amount sufficient to allow or facilitate diagnosis. The effective amount for a particular patient or veterinary subject can vary depending on factors such as the condition to be treated, the patient's overall health, the route and dosage of administration, and the severity of side effects. An effective amount can be the maximum dose or administration regimen that avoids significant side effects or toxicity.

[0144] The present invention will be further illustrated by way of embodiments below, but the present invention is not limited to the scope of the embodiments.

[0145] Example 1

[0146] This study investigated an Akk bacteria supplementation intervention in 58 overweight or obese patients with type 2 diabetes (T2D) with varying baseline Akk bacteria levels (detected by conventional PCR methods, using the upstream primer CAGCACGTGAAGGTGGGGAC (SEQ ID NO:1) and the downstream primer CCTTGCGGTTGGCTTCAGAT (SEQ ID NO:2)). The intervention was based on lifestyle guidance (including guidance on regular diet and exercise). Subgroup analyses were also conducted. T2D patients met the following inclusion criteria: age 18 ≤ age ≤ 60 years, regardless of gender; BMI between 24.0 and 40.0 kg / m².2 Between; glycated hemoglobin (HbA1c) ≥7.0% and ≤10.0%, fasting blood glucose ≥7.0 mmol / L and ≤13.3 mmol / L.

[0147] Subjects were randomly assigned to either an Akk bacteria supplement group (AKK-WST01 strain product, strain preservation number CGMCC 14764) (composed of Akk bacteria powder and excipients, with each gram of Akk bacteria supplement containing 1-5*10^10 CFU of live Akk bacteria) or a placebo group (the placebo consisted only of excipients, mainly microcrystalline cellulose and silica). There were no significant differences in baseline clinical characteristics between the two groups. Subjects were administered the supplement orally once daily at a dose of 3g, approximately half an hour after breakfast, for 12 weeks.

[0148] As shown in Figure 1, the abundance of Akk bacteria in participants' feces was measured at baseline and 12 weeks after the intervention. Participants were further divided into low-abundance and high-abundance groups based on the baseline abundance level of Akk bacteria in feces (Log10 Akk ng / g baseline fecal DNA <0 was considered low abundance, and Log10 Akk ng / g baseline fecal DNA ≥0 was considered high abundance). The results showed that in the Akk supplementation group, the abundance of Akk bacteria in feces significantly increased after 12 weeks of follow-up; while no significant change was observed in the placebo group at baseline and at the end of the 12-week follow-up. This indicates that Akk supplementation can significantly increase the abundance of Akk bacteria in the gut.

[0149] Example 2

[0150] As shown in Figure 2, after 12 weeks of treatment, participants with lower baseline Akkella abundance showed significant reductions in the following parameters after Akkella supplementation: weight (mean change from baseline -1.20 kg; 95% CI, -2.25 to -0.15 kg), BMI (-0.43 kg / m²; -0.79 to -0.07 kg / m²), fat mass (-0.91 kg; -1.75 to -0.06 kg), visceral fat mass (-0.13 kg; -0.21 to -0.04 kg), HbA1c (-0.57%; -1.07 to -0.07%), LDL cholesterol (-0.22 mmol / L; -0.44 to 0.00 mmol / L), and diastolic blood pressure (-5.28 mmHg; -8.99 to -1.56 mmHg). However, none of these parameters changed significantly in the placebo group. In the subgroup with high baseline Akkella abundance, only the placebo group showed significant reductions in metabolic parameters such as weight and BMI. This is likely due to the metabolic benefits derived from basic lifestyle guidance. The Akkella supplementation group did not show similar metabolic benefits, suggesting that in patients with high baseline Akkella abundance, further Akkella supplementation may actually diminish the benefits of lifestyle guidance. This indicates that the effectiveness of Akkella supplementation is closely related to baseline Akkella abundance, especially in subjects with low baseline abundance, where Akkella supplementation exhibits a more significant metabolic improvement.

[0151] Example 3

[0152] As shown in Figure 3, one participant each from the high-background and low-background Akk bacteria groups were selected from sex-, age-, and BMI-matched subjects. Their feces were used to perform fecal microbiota transplantation (FMT) on germ-free mice (C57BL / 6J, purchased from Cyagen (Suzhou) Biotechnology Co., Ltd.) to simulate the high and low Akk abundance states in humans. The experiment was divided into four groups: low-background Akk + PBS group, low-background Akk + Akk bacteria group, high-background Akk + PBS group, and high-background Akk + Akk bacteria group. Mice received either PBS or Akk bacteria via gavage for 5 weeks. Two weeks after Akk bacteria gavage, the results showed that Akk bacteria abundance significantly increased in the low-background Akk group, while no significant change was observed in the high-background Akk group. This indicates that Akk bacteria have higher intestinal colonization efficiency when baseline abundance is low. With efficient colonization of Akk bacteria, Akk supplementation significantly alleviated high-fat diet-induced weight gain, reduced fasting blood glucose levels, and improved obesity-related indicators in the low-base Akk group. However, no similar metabolic improvements were observed in the high-base Akk group. Furthermore, Akk supplementation significantly increased energy expenditure in mice in the low-base Akk group, but no significant change was observed in the high-base Akk group.

[0153] Example 4

[0154] As shown in Figure 4, the expression levels of intestinal barrier-related genes (Tjp1, Occludin, Claudin1-5, and Muc2) in the colonic tissue of four groups of mice were examined. The results showed that after supplementation with Akk bacteria in the low-background Akk group, the mRNA expression of these genes was significantly upregulated, and the thickness of the colonic mucus layer also increased significantly. No similar changes were observed in the high-background Akk group. This indicates that Akk bacteria supplementation significantly enhanced the intestinal barrier function of mice in the low-background Akk group. Further analysis revealed that after Akk bacteria supplementation, the plasma FITC-glucan level in mice in the low-background Akk group was significantly reduced, indicating improved intestinal permeability. Furthermore, compared with the control group, the circulating lipopolysaccharide (LPS) level in Akk bacteria-treated mice was also significantly decreased. Analysis of inflammation-related gene expression results showed that in the low-baseline Akk group, Akk supplementation significantly reduced the expression levels of pro-inflammatory genes (such as IL-1β and IL-6) and significantly increased the expression of anti-inflammatory genes (such as IL-10 and Reg3g). Simultaneously, the levels of pro-inflammatory factors (such as TNF-α and IL-12p70) were also significantly reduced. In conclusion, Akk supplementation significantly improved metabolic homeostasis, enhanced intestinal barrier function, and effectively reduced inflammatory responses in mice with low Akk baseline. These results further support the significant intervention effect of Akk as a targeted probiotic in individuals with low Akk abundance.

[0155] Example 5

[0156] To design specific real-time PCR primers for Akkermansia_muciniphila, we first used a self-developed program to perform bioinformatics analysis on the genomes of 1655 bacterial species in the NCBI database to search for the specific gene sequence of this bacterial species (compared with the NCBI database; the sequence was not found in other bacterial species in the NCBI Nucleotide Sequence Database and the Representative Genomes database).

[0157] Table 1. Preferred primer and probe combinations for detecting Akkermansia muciniphila.

[0158] Example 6

[0159] The Taqman qPCR detection method based on the primers and probes described in Example 5 is as follows:

[0160] (1) Construct the Akkermansia_muciniphila standard plasmid. The peak performance and amplification efficiency of the standard plasmid were tested under different background conditions (diluted with TE buffer and DNA background solution) and at different annealing temperatures. qPCR reactions were performed in dedicated PCR eight-tube (Axygen, USA) systems, 20 μL each. One replicate of the standard plasmid was performed using… Quantification was performed using Probe qPCR Mix (UDG) reagent. Primers and TaqMan probes were synthesized by Microbase Biotechnology (Shanghai) Co., Ltd., and all sequencing work was performed by Microbase Biotechnology (Shanghai) Co., Ltd.

[0161] (2) Use qPCR primers and their corresponding probes for detection. Using the standard plasmid in (1) as a template, qPCR amplification was performed using the primers and probes described in Example 1, and fluorescence signals were collected.

[0162] The qPCR reaction system is 10 μL 2×qPCR Mix ( The Probe qPCR Mix (UDG) reagent was prepared with 0.5 μL each of F1, R1 and UP1 at an initial concentration of 10 μmol / L, 2 μL of template, and then the total volume was made up to 20 μL using dd water.

[0163] (3) The qPCR amplification reaction program was as follows: incubation at 50℃ for 2 min, pre-denaturation at 95℃ for 2 min, denaturation at 95℃ for 10 s, annealing at 60℃ for 60 s, for 45 cycles. Fluorescence data acquisition was performed during the annealing extension. Real-time quantitative PCR was performed using a Bori FQD-96A fluorescence quantitative PCR instrument. The fluorescence channel of the qPCR instrument was set to CY5.

[0164] (4) Read the detection results and amplification curve.

[0165] The detection standard curves are shown in Figures 5 and 6. Tests were conducted under both TE and DNA backgrounds. The sample peaks and amplification efficiency were normal, and the peaks were relatively consistent, which can achieve accurate detection of the bacterial species.

[0166] Akkermansia_muciniphila standard plasmid sequence: ATGAAGACCCACGTGAAAAAAGGTGATGAAGTGGAAATCATCGCCGGACGTAACCACAAGGGCAAGCGCGGCACCGTTCTCGCCGTGAATGCTTCCAAAGG TACTGTCATCGTAGAAGGCGCCCGCACCCTGAAAAAGGCTGTGCGCCCGACCGAACAGAACCCGGAAGGCGGCATTCAGGAAATCAACGGCCCGATTCACATCTCCAACGTGAAAAAAGTAGGCTAG(SEQ ID NO:6)

[0167] Example 7

[0168] The abundance of Akkermansia muciniphila in human fecal samples was detected using the Taqman qPCR detection method based on the primers and probes described in Example 5. The specific steps are as follows:

[0169] (1) Extraction of human fecal DNA (QIAamp PowerFecal pro DNA kit, Qiagen).

[0170] (2) Use qPCR primers and their corresponding probes for detection. Using the standard plasmid in (1) as a template, qPCR amplification was performed using the primers and probes described in Example 1, and fluorescence signals were collected.

[0171] The qPCR reaction system is 10 μL 2×qPCR Mix ( The Probe qPCR Mix (UDG) reagent was prepared with 0.5 μL each of F1, R1 and UP1 at an initial concentration of 10 μmol / L, 2 μL of template, and then the total volume was made up to 20 μL using dd water.

[0172] (3) The qPCR amplification reaction program was as follows: incubation at 50℃ for 2 min, pre-denaturation at 95℃ for 2 min, denaturation at 95℃ for 10 s, annealing at 60℃ for 60 s, for 45 cycles. Fluorescence data acquisition was performed during the annealing extension. Real-time quantitative PCR was performed using a Bori FQD-96A fluorescence quantitative PCR instrument. The fluorescence channel of the qPCR instrument was set to CY5.

[0173] (4) Read the test results. Fecal samples from 8 subjects were tested, with values ​​of 7,364,786.70, 574,896.04, 99.72, 29.80, 1,140,267.18, 160.18, 32.85, and 54,043.59 respectively. The unit is Akkermansia_muciniphila ng / g fecal DNA.

[0174] While specific embodiments of the present invention have been described above, those skilled in the art should understand that these are merely illustrative examples, and various changes or modifications can be made to these embodiments without departing from the principles and essence of the present invention. Therefore, the scope of protection of the present invention is defined by the appended claims.

Claims

1. A method for preventing and / or treating a disease, characterized in that, The method includes administering a prophylactic and / or therapeutically effective amount of Akkermansia muciniphila to subjects in need. The disease is at least one of overweight, obesity, abnormal glucose metabolism, type 2 diabetes, dyslipidemia, hypertension, and non-alcoholic fatty liver disease; the abundance level of Akkermansia muciniphila in the gastrointestinal tract of the subject is Log10 Akk ng / g baseline gastrointestinal contents DNA <1.7; preferably <1; more preferably <0.

2. The method as described in claim 1, characterized in that, The disease is at least one of overweight, obesity, type 2 diabetes, dyslipidemia, and hypertension; the dyslipidemia is hyperlipidemia. The overweight, obesity, and type 2 diabetes must meet at least one of the following inclusion criteria: (1)BMI≥24kg / m 2 ; (2) Random blood glucose ≥11.1 mmol / L; (3) Fasting blood glucose ≥ 6.1 mmol / L; (4) Oral glucose tolerance test (OGTT) 2-hour blood glucose ≥7.8 mmol / L; (5) HbA1c ≥ 5.7%; The hyperlipidemia must meet at least one of the following admission criteria: (i) Total cholesterol (TC): ≥6.2 mmol / L; (ii) Low-density lipoprotein cholesterol (LDL-C): ≥4.1 mmol / L (iii) Triglycerides (TG): ≥2.3 mmol / L; The hypertension must meet at least one of the following admission criteria: (I) Systolic blood pressure 130–139 mmHg and / or diastolic blood pressure 80–89 mmHg; (II) Systolic blood pressure ≥140 mmHg and / or diastolic blood pressure ≥90 mmHg.

3. The method as described in claim 1 or 2, characterized in that, The disease is at least one of overweight, obesity, and type 2 diabetes; The overweight, obesity, and type 2 diabetes conditions must meet at least one of the following inclusion criteria: (1)BMI≥24kg / m 2 ; (2) Fasting blood glucose ≥7.0 mmol / L; (3) HbA1c ≥ 7.0%.

4. The method as described in claim 3, characterized in that, The overweight, obesity, and type 2 diabetes conditions must meet at least one of the following inclusion criteria: (1)25kg / m 2 ≤BMI≤40.0kg / m 2 ; (2) 7.0 mmol / L ≤ fasting blood glucose ≤ 13.3 mmol / L; (3) 7.0% ≤ HbA1c ≤ 10.0%.

5. The method according to any one of claims 1-4, characterized in that, The method includes administering Akkermansia muciniphila to the patient at a dose of not less than 1*10^10 CFU of live bacteria per administration at an interval of not less than 6 hours. Preferably, the dosage is not less than 3*10^10 CFU, 4*10^10 CFU, 5*10^10 CFU, 1*10^11 CFU, 1.5*10^11 CFU, 2*10^11 CFU, 5*10^11 CFU, 1*10^12 CFU or 1*10^13 CFU of live bacteria per administration; and / or, the administration interval is 6h, 7h, 8h, 9h, 10h, 11h, 12h, 18h, 24h, 48h, 72h or 1 week.

6. The method as described in claim 5, characterized in that, The dosage is selected from 3*10^10 CFU to 1.5*10^11 CFU of live bacteria; the dosing interval is selected from 8h, 12h, 24h or 48h, preferably 24h.

7. The method according to any one of claims 1-6, characterized in that, The Akkermansia muciniphila strain is administered orally in powder form. Preferably, the powder further includes excipients, which preferably include microcrystalline cellulose and silica.

8. The method according to any one of claims 1-7, characterized in that, The abundance level of Akkermansia muciniphila in the gastrointestinal tract of the subjects was detected by PCR. Preferably, the PCR detection includes the following steps: Add the upstream primer shown in SEQ ID NO:1 and the downstream primer shown in SEQ ID NO:2 to the sample to be tested for PCR amplification reaction; Alternatively, add the upstream primer shown in SEQ ID NO:3, the downstream primer shown in SEQ ID NO:4, and the probe shown in SEQ ID NO:5 to the sample to be tested, and perform a PCR amplification reaction; The sample to be tested is gastrointestinal contents; the gastrointestinal contents are selected from feces or contents of the duodenum, jejunum, ileum, or cecum; the gastrointestinal contents are preferably feces.

9. The method according to any one of claims 1-8, characterized in that, The method also includes lifestyle interventions for the subjects; preferably, the lifestyle interventions include dietary control and increased physical activity. And / or, the method further includes performing drug intervention and / or metabolic surgery; the drugs include one or more of GLP-1 receptor agonists, sulfonylureas, meglitinides, α-glucosidase inhibitors, DPP-4 inhibitors, SGLT2 inhibitors, and hormones; the GLP-1 receptor agonists are preferably semaglutide and telpolide; the hormones are preferably insulin.

10. The method according to any one of claims 1-9, characterized in that, The gastrointestinal contents are selected from feces or contents of the duodenum, jejunum, ileum, or cecum; the gastrointestinal contents are preferably feces.

11. A method for detecting the abundance of Akkermansia muciniphila, characterized in that, The detection method includes the following steps: a) Add the upstream primer shown in SEQ ID NO:3, the downstream primer shown in SEQ ID NO:4, and the probe shown in SEQ ID NO:5 to the sample to be tested, and add PCR amplification reaction solution, and place it in a real-time PCR instrument for PCR amplification reaction; b) Perform fluorescence detection on the amplification products and interpret the results based on the fluorescence curve and the abundance of bacterial species in the sample to be tested. The PCR amplification reaction solution includes one or more of Taq enzyme, buffer, dNTP, UDG enzyme, and sterile water. Preferably, the PCR amplification reaction solution includes qPCR Mix reagent.

12. The detection method as described in claim 11, characterized in that, The sample to be tested was gastrointestinal contents; Preferably, the gastrointestinal contents are selected from feces or contents of the duodenum, jejunum, ileum, or cecum; More preferably, the gastrointestinal contents are feces.

13. The method as described in claim 11 or 12, characterized in that, The conditions for the PCR amplification reaction in step a) are as follows: Hold at 50℃ for 2 min; pre-deform at 95℃ for 2 min; denature at 95℃ for 10 s; anneal at 60-65℃ for 60 s; repeat 45 times.

14. A method for lowering blood pressure, characterized in that, The method of lowering blood pressure includes administering a therapeutically effective dose of Akkermansia muciniphila to subjects in need. The subjects must meet at least one of the following admission criteria: (I) Systolic blood pressure 130–139 mmHg and / or diastolic blood pressure 80–89 mmHg; (II) Systolic blood pressure ≥140 mmHg and / or diastolic blood pressure ≥90 mmHg; The abundance level of Akkermansia muciniphila in the gastrointestinal tract of the subjects was Log10 Akk ng / g baseline gastrointestinal contents DNA <1.7; preferably <1; more preferably <0.

15. A method for lowering blood sugar, characterized in that, The method of lowering blood glucose includes administering a therapeutically effective dose of Akkermansia muciniphila to subjects in need. The abundance level of Akkermansia muciniphila in the gastrointestinal tract of the subjects was Log10 Akk ng / g baseline gastrointestinal contents DNA <1.7; preferably <1; more preferably <0; The subjects must meet at least one of the following admission criteria: (1) Random blood glucose ≥11.1 mmol / L; (2) Fasting blood glucose ≥ 6.1 mmol / L; (3) Oral glucose tolerance test (OGTT) 2-hour blood glucose ≥7.8mmol / L; (4) HbA1c ≥ 5.7%; Preferably, the subject meets at least one of the following admission criteria: (1)BMI≥24kg / m 2 ; (2) Fasting blood glucose ≥7.0 mmol / L; (3) HbA1c ≥ 7.0%; More preferably, the subject meets at least one of the following admission criteria: (1)25kg / m 2 ≤BMI≤40.0kg / m 2 ; (2) 7.0 mmol / L ≤ fasting blood glucose ≤ 13.3 mmol / L; (3) 7.0% ≤ HbA1c ≤ 10.0%.

16. A method for lowering blood lipids, characterized in that, The method for lowering blood lipids includes administering a therapeutically effective dose of Akkermansia muciniphila to subjects in need. The abundance level of Akkermansia muciniphila in the gastrointestinal tract of the subjects was Log10 Akk ng / g baseline gastrointestinal contents DNA <1.7; preferably <1; more preferably <0; The subjects must meet at least one of the following admission criteria: (1) Total cholesterol (TC): ≥6.2 mmol / L; (2) Low-density lipoprotein cholesterol (LDL-C): ≥4.1mmol / L (3) Triglycerides (TG): ≥2.3mmol / L.

17. A method for reducing BMI, characterized in that, The method for reducing BMI includes administering a therapeutically effective dose of Akkermansia muciniphila to subjects in need. The abundance level of Akkermansia muciniphila in the gastrointestinal tract of the subjects was Log10 Akk ng / g baseline gastrointestinal contents DNA <1.7; preferably <1; more preferably <0; The subjects' BMI ≥ 24 kg / m² 2 ; Preferably, the subject's BMI is 25 kg / m². 2 ≤BMI≤40.0kg / m 2 .