Method for cultivating huanglongbing-resistant plant, and use thereof

Abstract

Disclosed are a Citrus gene fragment related to the resistance of plants to Huanglongbing, and the use thereof. The nucleotide sequence of the gene promoter fragment is as shown in SEQ ID NO. 1. The promoter fragment contains a plurality of characteristic motifs that bind to the transcription factor MYC2, which is related to disease resistance. The transcription factor MYC2 can bind to these motifs and exert transcription factor activity so as to transcriptionally activate the expression of Huanglongbing susceptibility gene PUB21 in plants. The present invention identifies a tight gene feedback loop composed of the susceptibility gene PUB21 and a ubiquitination substrate thereof, MYC2 transcription factor, and provides a breeding strategy for enhancing plant disease resistance by means of reducing and / or eliminating the expression level of the susceptibility gene PUB21. The resistance breeding strategy can effectively inhibit the replication and spread of Huanglongbing pathogens, which is of great significance for controlling Huanglongbing in plants.

Description

A method for cultivating plants resistant to Huanglongbing and its application

[0001] Cross-reference to related applications

[0002] This application claims priority to Chinese patent application (application number CN202510122567.4) filed on January 26, 2025, the entire contents of which are incorporated herein by reference. Technical Field

[0003] This invention belongs to the field of biotechnology, specifically relating to a citrus or tobacco gene fragment related to plant resistance to Huanglongbing (HLB) and its application, particularly the identification, functional verification, and application of the promoter region fragment of the plant HLB susceptibility gene PUB21 in regulating plant resistance to HLB. Background Technology

[0004] HLB is primarily caused by the phloem-restricted bacterium *Candidatus Liberibacter asiaticus* (CLas), which has an extremely wide host range. It is mainly transmitted by the insect vector *Diaphorina citri Kuwayama*, but can also survive in the cells of fruit flies and Aedes mosquitoes. The HLB pathogen *CLas* infects plants of the *Citrus* genus and its closely related genera within the Rutaceae family, Citrus subfamily. All commercial citrus varieties are susceptible to HLB. Citrus Huanglongbing, also known as citrus green fruit disease, is currently the most destructive citrus disease, causing severe economic losses to the global citrus industry. Besides *Citrus*, the pathogen has been detected on closely related genera such as *Trifolium repens*, *Citrus aurantium*, *Citrus wort*, *Murraya paniculata*, *Citrus aurantium*, *Prunus armeniaca*, and *Citrus aurantium var. chinensis*. In addition to Rutaceae plants, the HLB bacteria can also be transmitted to non-Rutaceae plants such as periwinkle, tobacco, and tomato via dodder.

[0005] As sessile organisms, plants face a variety of biotic and abiotic stresses throughout their life cycle. Over long periods of evolution, plants have developed complex defense mechanisms to combat pathogen infection. Protein degradation plays a crucial role in plant defense, with the ubiquitin-proteasome system being one of the main mechanisms. E3 ligases are a key component of this system, determining substrate specificity and mediating substrate ubiquitination and degradation. The plant U-box protein (PUB) family, as one of these members, has been reported in recent years to play a crucial role in the interaction between pathogens and various plants, including rice and Arabidopsis. Many pathogens manipulate PUBs to target and degrade disease-resistant proteins, thereby disrupting the host immune system. Some genes encoding plant U-box (PUB)-type E3 proteins are expressed at higher levels in the disease-susceptible *C. sinensis* than in the disease-resistant *C. daoxianensis* and *Microcitrus australasica*. Among these, PUB21 showed the highest upregulation during *C. sinensis* infection, while no significant transcriptional response was observed in the more HLB-resistant *M. australasica*. Therefore, strict regulation of PUB protein expression levels plays an important role in plant resistance to diseases and pests.

[0006] As fundamental components of gene expression, promoters play a crucial role in regulating gene expression levels. Studying promoter regulatory patterns or comparing differences in promoter characteristics to precisely regulate the expression levels of target genes is of great importance in guiding next-generation resistance breeding. Transposon insertions can cause insertion / deletion polymorphisms in promoters, which can induce the expression of PUB proteins and precisely regulate the expression levels of target genes, playing a vital role in guiding next-generation resistance breeding.

[0007] Transposons, also known as transposable elements, are autonomous DNA sequences that can move freely within the host genome. They typically range in length from 100 bp to 10,000 bp, similar to viruses. Currently, transposons are mainly classified into three types based on their replication method: Type I transposons, also known as retrotransposons, are "copy-paste" type; Type II transposons, simply called transposons, are "cut-paste" type; and Helitron transposons, which transpose via "rolling circle" replication, are a novel type of transposon discovered in the last 20 years. Autonomous Helitrons encode the replicase Rep and helicase Hel, expanding within the genome through a rolling circle replication method similar to that of DNA viruses. Helitron transposons have become a popular subject in biological research due to their specific replication characteristics. For example: (i) Helitron can be used to alter gene transcriptional regulatory networks, thereby integrating and amplifying the transcription factor expression regulatory regions and regulating the expression of nearby genes; (ii) Helitron can be used to alter gene epigenetic modifications, and the siRNA produced by Helitron can target donor genes, causing gene epigenetic modifications that inhibit gene expression.

[0008] To date, no effective treatment or resistance gene for HLB has been discovered, making it impossible to prevent the severe economic losses caused by HLB to the global citrus industry. Therefore, identifying and functionally validating the transposon fragments in the promoter region of HLB susceptibility genes, especially their application in regulating HLB resistance in citrus, is a highly valuable research topic.

[0009] Invention Overview

[0010] The technical problem to be solved by this invention is how to improve the resistance of plants to Huanglongbing (HLB) in order to cultivate HLB-resistant plants, plant parts, or plant cells. The technical problem to be solved is not limited to the described technical subject matter; other technical subject matter not mentioned herein will be clearly understood by those skilled in the art through the following description.

[0011] To address the aforementioned technical problems, the present invention first provides a DNA molecule.

[0012] The DNA molecule provided by this invention is a fragment located in the promoter region of the Huanglongbing susceptibility gene PUB21, and is any one of the following a1)-a3):

[0013] a1) The DNA molecule shown in SEQ ID No. 1;

[0014] a2) A DNA molecule with the same function obtained by reducing or eliminating the expression and / or function of the full-length or partial fragment of the DNA molecule defined in a1);

[0015] DNA molecules defined in a3) and a1) are DNA molecules that have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity and have the same function.

[0016] In a2), the full-length or partial fragment of the DNA molecule contains a characteristic motif that binds to the transcription factor MYC2.

[0017] In a2), the reduction or elimination of the expression and / or function of the full-length or partial fragment of the DNA molecule refers to the treatment of the full-length or partial fragment of the DNA molecule with gene knockout technology, gene silencing technology, inactivation mutation technology, PROTAC technology, or small molecule inhibitors.

[0018] In a2), the reduction or elimination of expression and / or function of the full-length or partial fragment of the DNA molecule refers to the substitution and / or insertion and / or deletion of one or more bases in the DNA molecule. The substitution and / or insertion and / or deletion of one or more bases refers to a substitution and / or insertion and / or deletion of no more than 10 bases.

[0019] In a3), the identity refers to the sequence similarity to a natural nucleic acid sequence. Identity can be evaluated visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0020] Those skilled in the art can readily mutate the nucleotide sequence of the DNA molecule of the present invention using known methods, such as directed evolution and point mutation. Artificially modified nucleotides that have 70% or higher identity with the nucleotide sequence of the DNA molecule provided by the present invention, provided they have the same function, are derived from and are equivalent to the nucleotide sequence of the present invention.

[0021] The aforementioned DNA molecules contain multiple characteristic motifs (G-box like: CANNTG) that bind to the transcription factor MYC2. The transcription factor MYC2 can bind to these motifs and exert its transcriptional activity to activate the expression of PUB21, forming a tight feedback loop connecting the PUB21 promoter, PUB21, and MYC2, which participates in regulating resistance to Huanglongbing.

[0022] The present invention also provides a method for preparing the above-mentioned DNA molecules, comprising treating characteristic motifs that bind to transcription factor MYC2 in the full length or part of a majority of DNA molecules using gene knockout technology, gene silencing technology, inactivation mutation technology, PROTAC technology or small molecule inhibitors.

[0023] The method for preparing the above-mentioned DNA molecules includes gene knockout technologies such as zinc finger protein (ZFN) technology, transcription activator-like effector (TALE) technology, CRISPR / Cas technology, or TALE-CRISPR / Cas technology.

[0024] The CRISPR / Cas technology is selected from CRISPR / Cas3, CRISPR / Cas9, CRISPR / Cas12, CRISPR / Cas12a, CRISPR / Cas12b, CRISPR / Cas13, CRISPR / Cas13a, CRISPR / Cas13b, CRISPR / Cas13c, CRISPR / Cas13e, CRISPR / Cas13f, CRISPR / CasX, or the CRISPR / IscB system.

[0025] In one embodiment of the present invention, the gene knockout technology employs a CRISPR / Cas9 gene editing vector. The CRISPR / Cas9 gene editing vector expresses sgRNA and Cas9 protein targeting the full-length or partial fragments of the aforementioned DNA molecule.

[0026] In one embodiment of the present invention, the CRISPR / Cas9 gene editing vector comprises an sgRNA gene expression cassette and a Cas9 gene expression cassette.

[0027] Furthermore, the sgRNA gene expression cassette includes a promoter for initiating sgRNA gene expression. The promoter for initiating sgRNA gene expression is preferably the CsU6 promoter.

[0028] Furthermore, the Cas9 gene expression cassette includes a promoter for initiating Cas9 gene expression. The promoter for initiating Cas9 gene expression is preferably the CmYLCV promoter.

[0029] Furthermore, the target sequence of the sgRNA is shown in positions 1105-1124 of the sequence SEQ ID No. 1.

[0030] The nucleotide sequence of the CsU6 promoter is shown in SEQ ID No. 2.

[0031] The nucleotide sequence of the CmYLCV promoter is shown in SEQ ID No. 3.

[0032] In one embodiment of the present invention, the method for preparing the above-mentioned DNA molecule includes mutating the characteristic motif that binds to the transcription factor MYC2 in the full length or a portion of the DNA molecule, thereby preventing the transcription factor MYC2 from binding to it.

[0033] In one embodiment of the present invention, the mutation may be a deletion mutation and / or an insertion mutation and / or a base substitution.

[0034] To address the aforementioned technical problems, the present invention also provides a gene regulation system. This gene regulation system is used for the preparation of the aforementioned DNA molecules.

[0035] The gene regulation system employs gene knockout, gene silencing, inactivation mutation, PROTAC, or small molecule inhibitors to treat characteristic motifs that bind to transcription factor MYC2 in the full length or partial segments of most DNA molecules.

[0036] The gene regulation system comprises nucleic acid molecules and enzyme proteins, wherein the nucleic acid molecules are sgRNA molecules, and the enzyme proteins are Cas proteins or Cas orthologs. The enzyme protein may be selected from Cas3, Cas9, Cas12a, Cas12b, Cas13a, Cas13b, Cas13c, Cas13e, Cas13f, CasX, or IscB proteins or their orthologs.

[0037] In one embodiment of the present invention, the gene regulation system uses a CRISPR / Cas9 gene editing vector to express sgRNA and Cas9 protein that target the full length or part of the DNA molecule.

[0038] Furthermore, the CRISPR / Cas9 gene editing vector comprises an sgRNA gene expression cassette and a Cas9 gene expression cassette.

[0039] The sgRNA gene expression cassette includes a promoter for initiating sgRNA gene expression. The preferred promoter for initiating sgRNA gene expression is the CsU6 promoter.

[0040] The Cas9 gene expression cassette includes a promoter for initiating Cas9 gene expression. The promoter for initiating Cas9 gene expression is preferably the CmYLCV promoter.

[0041] Furthermore, the target sequence of the sgRNA is shown in positions 1105-1124 of sequence SEQ ID No. 1.

[0042] The nucleotide sequence of the CsU6 promoter is shown in SEQ ID No. 2.

[0043] The nucleotide sequence of the CmYLCV promoter is shown in SEQ ID No. 3.

[0044] To address the aforementioned technical problems, the present invention also provides a kit comprising the above-mentioned gene regulation system.

[0045] The present invention also provides a PUB21 promoter comprising the above-described DNA molecule.

[0046] In one embodiment of the present invention, the PUB21 promoter may be of the Helitron type, such as CsPUB21.

[0047] In another embodiment of the invention, the PUB21 promoter is a non-Helitron type, including CiPUB21, MpPUB21, and BkPUB21, etc.

[0048] To address the aforementioned technical problems, this invention also provides a substance that reduces or eliminates the expression and / or function of the full-length or partial fragments of the aforementioned DNA molecule, or a novel use for the aforementioned gene regulation system or a kit containing the aforementioned gene regulation system. The use is any one of the following A1)-A6):

[0049] A1) Enhance the resistance of plants, plant parts, or plant cells to Huanglongbing (HLB);

[0050] A2) Prepare products that enhance the resistance of plants, plant parts or plant cells to Huanglongbing (HLB);

[0051] A3) Cultivate plants, plant parts, or plant cells resistant to Huanglongbing (HLB);

[0052] A4) Prepare products for cultivating plants, plant parts or plant cells resistant to Huanglongbing (HLB);

[0053] A5) Control of Huanglongbing (HLB) in plants, parts of plants, or plant cells;

[0054] A6) Prepare products for the prevention and control of Huanglongbing (HLB) in plants, plant parts or plant cells.

[0055] To address the aforementioned technical problems, the present invention also provides a method for improving the resistance of plants, plant parts, or plant cells to Huanglongbing (HLB) or for cultivating HLB-resistant plants, plant parts, or plant cells.

[0056] The method provided by the present invention for improving the resistance of plants, plant parts or plant cells to Huanglongbing or for cultivating Huanglongbing-resistant plants, plant parts or plant cells includes applying the gene regulation system or the kit to the recipient plant, plant part or plant cell, such that the expression and / or function of the full-length or partial fragment of the DNA molecule in the promoter of the PUB21 gene in the recipient plant, plant part or plant cell is reduced or eliminated.

[0057] Furthermore, the method for reducing or eliminating the expression and / or function of the full-length or partial fragments of the aforementioned DNA molecule in the recipient plant, plant parts, or plant cells involves introducing a substance that reduces or eliminates the expression and / or function of the full-length or partial fragments of the aforementioned DNA molecule into the recipient plant.

[0058] The method provided by the present invention for improving the resistance of plants, plant parts or plant cells to Huanglongbing or for cultivating Huanglongbing-resistant plants, plant parts or plant cells includes the step of deleting positions 1113-1196 of the PUB21 gene promoter in the genomic DNA of the recipient plant.

[0059] In some embodiments of the present invention, the deletion is a homozygous substitution, that is, the same deletion occurs in homologous chromosomes.

[0060] The sequence of the characteristic motif (G-boxlike) that binds to the transcription factor MYC2 described above is as follows: CANNTG.

[0061] The aforementioned PUB21 gene promoter is a PUB21 gene promoter from the genus Citrus or the genus Nicotiana. The sequences of the PUB21 gene promoters are shown in SEQ ID No. 1, SEQ ID No. 8, and SEQ ID No. 9.

[0062] The transcription factor MYC2 mentioned above is the transcription factor CsMYC2. The amino acid sequence and coding region sequence (CDS) of the transcription factor CsMYC2 are described in the invention patent application document with publication number CN115160421A.

[0063] In any of the above applications or methods, the plant is a monocotyledonous plant or a dicotyledonous plant.

[0064] The dicotyledonous plants are plants of the Rutales order or Solanales order.

[0065] The plants mentioned belong to the Rutaceae family.

[0066] The plants in the order Solanales are plants of the family Solanaceae.

[0067] The plant in question belongs to the genus Citrus.

[0068] The plants mentioned belong to the genus *Nicotiana*.

[0069] The Citrus species mentioned are citrus.

[0070] The plant in question is tobacco.

[0071] In some embodiments of the present invention, the citrus fruit may be at least one of the following varieties: Simons sweet orange (C. sinensis), mandarin orange (C. reticulata), Daoxian wild orange (C. daoxianensis), Linwu mandarin orange (C. linwuensis), Mangshan wild orange (C. mangshanensis), Yichang orange (C. ichangensis), Honghe orange (C. hongheensis), pomelo (C. maxima), citron (C. medica), Fumin trifoliata (P. trifoliata), and Australian lemon (M. australasica).

[0072] This invention employs multiple sequence alignment (MSA) to analyze the genome sequences of susceptible species (Simons sweet orange, mandarin orange), tolerant species (Daoxian wild orange, Linwu orange, Mangshan wild orange, Fumin trifoliate orange, Yichang orange, Honghe orange, pomelo, citron, and Australian lemon), and resistant species (Murraya paniculata and curry). The analysis revealed a 150bp Helitron transposon insertion in the promoter region of the disease-susceptible gene PUB21 in both susceptible and tolerant species. Furthermore, this invention identified multiple DNA motifs (G-box like: CANNTG) that bind to the MYC2 transcription factor in the PUB21 promoter region and its Helitron transposon fragment. MYC2 can bind to these motifs and exert its transcriptional activity to activate the expression of the PUB21 gene, forming a tight feedback loop of PUB21pro-PUB21-MYC2. This invention is the first to identify the presence of a DNA transposon Helitron insertion in the promoter (PUB21pro) of the E3 ubiquitin ligase gene in citrus, clarifying the tight feedback loop composed of PUB21 and its ubiquitination substrate MYC2 transcription factor. This explains the molecular mechanism underlying the different susceptibility of different species to Huanglongbing (HLB) and provides a breeding strategy to enhance citrus resistance by knocking out (deleting) or modifying the promoter region of the susceptible gene PUB21 to reduce its expression level. This resistance breeding strategy can effectively resist the replication and spread of HLB pathogens and has significant potential application value for the control of citrus HLB. Attached Figure Description

[0073] Figure 1 shows the sequence alignment of the PUB21 gene promoter in species with different susceptibility to Huanglongbing (HLB). Figure 1A shows a schematic diagram of Helitron insertion in the PUB21 promoter region of Rutaceae species. The boxes enclosed by rectangles represent the main inserted Helitron, and the dark boxes in the Helitron insertion region represent G-box-like cis-elements. Helitron insertions are present in the PUB21 gene promoter in HLB-susceptible and resistant species (Simons sweet orange, Daoxian wild orange, Mangshan wild orange, Fumin trifoliate orange, etc.), while they are absent in HLB-resistant species (Australian lemon, Murraya paniculata, curry). Figure 1B shows a Helitron insertion in the CsPUB21 promoter of sweet orange. Transposon annotation of the sweet orange genome was performed using the EDTA method. The annotated transposon library was aligned with a 150-bp insertion sequence in the CsPUB21 promoter using the repetition factor method.

[0074] Figure 2 shows that CsMYC2 can bind to the G-box-like motif (CANNTG) in the promoter region of the PUB21 gene and exert transcriptional activation activity to activate the expression of the PUB21 gene. Figure 2A shows the relative expression levels of the CsPUB21 gene in citrus with CsMYC2 silencing and transient overexpression. Values ​​are mean ± SEM (n=3) (**P<0.01, Student's t-test). Figure 2B shows that the CsMYC2 protein directly targets the CsPUB21 gene by binding to its promoter. The relative enrichment folds of CsMYC2 protein with each DNA region of the CsPUB21 promoter (I, II, III, IV) in chromatin immunoprecipitation (ChIP) assay are shown. Data represent mean ± SEM (n=4) (ns indicate no significant difference; *P<0.05, **P<0.01, Student's t-test). Figure 2C shows the electrophoretic mobility shift assay (EMSA) of the binding of CsMYC2 protein to the CsPUB21 promoter DNA region. Figure 2D shows the DNA binding activity of CsMYC2 protein to each G-box like motif in the Helitron transposon. “G” indicates a G-box like motif, and “mG” indicates a mutant G-box like motif.

[0075] Figure 3 shows the expression analysis of CsMYC2 protein transcriptional activation of different PUB21 gene promoters. Figure 3A shows a schematic diagram of the constructs of CsMYC2 as an effector and PUB21pro-LUC as a reporter system. CsPUB21 promoter-luciferase (LUC); CsPUB21 ΔhelPromoter-LUC; MpPUB21 promoter-LUC; BkPUB21 promoter-LUC were used as constructs for the reporter system, respectively. YFP and CsMYC2 driven by the 35S promoter were used as constructs for the effectors. Figure 3B shows the relative luciferase activity intensity of CsMYC2 activating PUB21 promoter activity in tobacco. Data represent mean ± SEM (n = 8). Lowercase letters indicate significant differences between columns according to one-way ANOVA and Duncan's multiple range test (P < 0.05). Figures 3C and 3D show luciferase imaging of the transcriptional activities of YFP and CsMYC2 on different PUB21 promoters in tobacco, showing the different PUB21 promoter activities in a leaf expressing YFP and MYC2. Figures 3E and 3F show β-glucuronidase (GUS) staining of YFP and CsMYC2 on the transcriptional activities of different PUB21 promoters in tobacco, showing the different PUB21 promoter activities in a leaf expressing YFP and MYC2. Figure 3G shows the relative β-glucuronidase activity intensity of CsMYC2 activating different PUB21 promoters in tobacco. Values ​​are mean ± SEM (n = 8). According to one-way ANOVA and Duncan's multiple range test, lowercase letters indicate significant differences between different columns (P < 0.05).

[0076] Figure 4 shows a partial diagram and deletion region analysis of the Helitron region of the PUB21 gene promoter in sweet orange protoplasts edited using the CRISPR-Cas9 system, along with the gene expression level of CsPUB21 after editing and the relative titer of pathogen CLAs in Huanglongbing-infected protoplasts. Figure 4A shows the editing efficiency of the CRISPR-Cas9 system in citrus protoplasts (Cas9-CsPUB21) identified by PCR / RE method. ΔhelPromoter). Band intensity was measured using ImageJ, and editing efficiency was analyzed based on differences in band intensity. Figure 4B shows a partial diagram of the CsPUB21 promoter locus and Helitron design in the Crispr-Cas9 construct, along with illustrations of the edited and deleted sequences. PAM and Crispr-Cas9-recognized cleavage sequences are underlined in black, and G-box-like motifs in Helitron are marked with black boxes. Regions where fragments were deleted during protoplast editing transformation are marked with black "--". Figure 4C shows the gene expression level of CsPUB21 after editing Helitron in citrus protoplasts using the Crispr-Cas9 system. Values ​​are mean ± SEM (n = 3) (*P < 0.05, Student's t-test). Figure 4D shows the relative titers of CLas after editing Helitron in Huanglongbing-positive citrus protoplasts transfected with the Crispr-Cas9 system. Values ​​are mean ± SEM (n = 4) (*P < 0.05, Student's t-test).

[0077] Specific embodiments of the present invention

[0078] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0079] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0080] The pENTR-3C vector used in the following examples is a product of Invitrogen, and the antibiotic used is kanamycin (Kan). The pH7-YFP-DC vector used in the following examples is a product of Invitrogen, and the antibiotic used is spectinomycin (Spe).

[0081] The pBA-DC-myc vector used in the following examples is a product of Invitrogen, and the antibiotic used is spectinomycin (Spe). The pH7GWIWG2(II) vector used in the following examples is a product of Invitrogen, and the antibiotic used is spectinomycin (Spe).

[0082] The pGEX-MBP vector used in the following examples is a product of Invitrogen, and the antibiotic used is ampicillin (Amp).

[0083] The pKGWFS7.0-GUS vector used in the following examples is a product of Invitrogen, and the antibiotic used is spectinomycin (Spe).

[0084] The pGWB435-LUC vector used in the following examples is a product of Invitrogen, and the antibiotic used is spectinomycin (Spe).

[0085] The 35S:YFP control vector in the following examples is the vector obtained by cloning the YFP gene into the pBA-DC-myc vector.

[0086] The CRISPR-Cas9 vector used in the following examples is described in the literature "Yi Zhang, Zhen Liang, Yuan Zong, Yanpeng Wang, Jinxing Liu, Kunling Chen, Jin-Long Qiu, Caixia Gao. Efficient and transgene-free genome editing in wheat through transient expression of CRISPR / Cas9 DNA or RNA. Nat Commun., 2016, 7:12617.", and the antibiotic used is kanamycin (Kan).

[0087] The PE2(V2) vector in the following examples is described in the literature “Zhen Liang, Yuqing Wu, Yingjie Guo, Sha Wei. Addition of the T5 exonuclease increases the prime editing efficiency in plants. Journal of Genetics and Genomics, 2023, 50(8):582-588.” The antibiotic used is kanamycin.

[0088] The following examples used *Citrus maxima*, a Rutaceae plant, which was collected from Danzhou City, Hainan Province; *Citrus sinensis*, *Citrus daoxianensis*, *Microcitrus australiasica*, *Citrus mangshanensis*, *Citrus ichangensis*, *Citrus hongheensis*, *Citrus medica*, and *Murraya koenigii* were all collected from the Citrus Resource Nursery of the Citrus Research Institute of Southwest University, Chongqing; *Poncirus polyandra* was collected from Kunming City, Yunnan Province; and *Murraya paniculata* was collected from Guangzhou City, Guangzhou Province. *Citrus sinensis*, *Citrus maxima*, and *Murraya paniculata* were cultivated in a laboratory greenhouse at a temperature maintained at 27°C and a relative humidity of 50%.

[0089] The main reagents and their sources in the following examples are as follows:

[0090] Reagents used in molecular cloning: EX Taq DNA polymerase and LA Taq DNA polymerase are both products of Takara Bio; restriction endonucleases and T4 DNA ligases are both products of NEB Biotech; homologous recombination ligase Vazyme ClonExpressII One Step Cloning C112 is a product of Novizumab; antibiotics used are products of Inolco Biotech; 1Kb DNA marker and 2000bp DNA marker are both products of Biomed Biotech; and SYBR qPCR Mix is ​​a product of TOYOBO Biotech.

[0091] Reagents used in protein-related experiments: Cocktail protease inhibitor is a product of Roche, IPTG is a product of Inolco, 40% Acrylamide is a product of Sigma, the primary and secondary antibodies are both products of Beijing TransGen Biotech Co., Ltd., and the pre-stained protein molecular weight marker is a product of Bio-Easy Biotech Co., Ltd.

[0092] Reagent kits: The plasmid mini-extraction kit, plasmid large-scale extraction kit, agarose gel DNA recovery kit, and DNA purification and recovery kit were all products of AxyGen. The plant RNA mini-extraction kit was a product of Qiagen. The ECL luminescence solution was a product of GE Healthcare. The reverse transcription kit was a product of Beijing TransGen Biotechnology Co., Ltd. The conventional primers used in the following examples were synthesized by Qingke Biotechnology Co., Ltd., and related sequencing work was performed. The biotin-labeled EMSA primers were synthesized by Tianyi Huiyuan Biotechnology Co., Ltd.

[0093] The nucleotide sequence of the CsPUB21 gene promoter in the following examples is shown in SEQ ID No. 1, and the nucleotide sequence of Helitron is shown in SEQ ID No. 4.

[0094] The nucleotide sequence of the MpPUB21 gene promoter in the following examples is shown in SEQ ID No. 5.

[0095] The nucleotide sequence of the BkPUB21 gene promoter in the following examples is shown in SEQ ID No. 6.

[0096] The amino acid sequence of the CsMYC2 protein and the CsMYC2 gene coding region sequence (CDS) in the following examples are described in the invention patent application document with publication number CN115160421A.

[0097] Example 1: Detection of PUB21 gene promoter sequence in different Rutaceae species

[0098] I. Sequence alignment of the PUB21 gene promoter in different Rutaceae species

[0099] 1. Retrieval of PUB21 starter sequence

[0100] The genome sequences of plants such as *C. sinensis*, *C. reticulata*, *C. daoxianensis*, *C. linwuensis*, *C. mangshanensis*, *P. trifoliata*, *C. maxima*, *C. hongheensis*, *C. ichangensis*, *M. australasica*, *C. medica*, *M. paniculata*, and *B. koenigii* were searched using the CsPUB21 sequence of *C. sinensis*. The most similar PUB21 sequence in other plant genomes was found by comparing the CsPUB21 sequence of *C. sinensis*. Based on the location of the PUB21 sequence in the genome, the promoter sequence upstream of PUB21 was searched for within 3500 bp. The found promoter sequences were saved as text.

[0101] 2. Comparative analysis of PUB21 promoter sequences

[0102] Multiple sequence alignment (MSA) analysis of the promoter nucleotide sequences of different Rutaceae species was performed using DNAMAN sequence analysis software. Sequence difference analysis revealed that a fragment of 87-150 bp was inserted in the PUB21 promoter (841 bp upstream of the transcription start site) of several plants susceptible to and resistant to Huanglongbing (HLB). However, this fragment was not present in the PUB21 promoter of plants with high resistance to HLB, such as Hainan Sanhong Honey Pomelo (C. maxima), Lianjiang Red Orange (C. hongheensis), Yichang Orange (C. ichangensis), Australian Finger Lemon (M. australasica), Citron (C. medica), Murraya paniculata (M. paniculata), and Curry (B. koenigii). Further analysis of the sequence characteristics of the inserted fragment revealed that it is rich in characteristic motifs (G-box like: CANNTG) for binding to transcription factor CsMYC2 (N represents A, T, C, G), indicating that the inserted fragment may be related to further transcriptional activation or inhibition of PUB21 gene expression by binding to transcription factor CsMYC2.

[0103] II. Identification of the DNA fragment inserted into the PUB21 promoter

[0104] Transposon annotation of the Simmons sweet orange genome was performed using the EDTA method. The annotated transposon library was then compared with a 150-bp insertion sequence in the CsPUB21 promoter using the Repeatmaker method. The result showed that this insertion sequence belongs to the class III transposon, Helitron. Helitron transposons are repetitive single-stranded (ssDNA) virus-like DNA transposons that significantly influence genomic variation by capturing and manipulating host genome sequences.

[0105] Example 2: CsMYC2 binds to G-box-like motifs in the promoter region of the PUB21 gene to regulate PUB21 gene expression.

[0106] I. Construction of vectors for silencing and overexpressing the citrus CsMYC2 gene

[0107] 1. Design primers for gene fragment amplification. The primer sequences are as follows:

[0108] CsMYC2-Fw(KpnI):CAAGGGTACCATGACGGACTACCGGTTACC;

[0109] CsMYC2-Rv(XhoI):CAAGCTCGAGTTATTGGGTATCTCCAACTT;

[0110] CsMYC2-800RNAi-Rv(XhoI):CAAGCTCGAGGGCCAAGTACCAATCTCCAT;

[0111] The underlined nucleotide sequences represent the restriction enzyme recognition sites GGTACC for KpnI and CTCGAG for XhoI.

[0112] 2. Using Simmons orange cDNA as a template, PCR amplification was performed using primers CsMYC2-Fw (KpnI) and CsMYC2-Rv (XhoI) to obtain a gene fragment of 2058 bp.

[0113] Using Simmons orange cDNA as a template, PCR amplification was performed using primers CsMYC2-Fw (KpnI) and CsMYC2-800RNAi-Rv (XhoI) to obtain an 800-bp CsMYC2 gene silencing fragment, the nucleotide sequence of which is shown in SEQ ID No. 7.

[0114] 3. The pENTR-3C vector was double-digested with restriction endonucleases KpnI and XhoI to obtain the backbone vector. Then, the backbone vector was ligated with the 2058-bp CsMYC2 gene and the 800-bp CsMYC2 gene silencing fragment from step 2 using T4 DNA ligase to obtain the intermediate vectors pENTR-3C-CsMYC2 and pENTR-3C-CsMYC2-RNAi, respectively.

[0115] 4. The intermediate vector pENTR-3C-CsMYC2 and the expression vector pH7-YFP-DC were ligated by the LR reaction using the recombinase (Gateway LR Clonase II) to obtain the overexpression vector 35S:YFP-CsMYC2.

[0116] The intermediate vector pENTR-3C-CsMYC2-RNAi and the gene silencing vector pH7GWIWG2(II) were ligated using the recombinase (Gateway LR Clonase II) via the LR reaction to obtain the gene silencing vector CsMYC2-RNAi.

[0117] 5. The overexpression vector 35S:YFP-CsMYC2 and the gene silencing vector CsMYC2-RNAi, as well as the control vector (35S promoter-driven YFP expression vector 35S:YFP) prepared in step 4, were transformed into Agrobacterium GV3101 strain by electroporation.

[0118] II. CsMYC2 gene silencing and overexpression in citrus leaves

[0119] 1. First, spread Xanthomonas citri subsp. citri (Xcc) on antibiotic-free LB agar plates and incubate overnight at 28°C. Collect the bacterial cells with sterile water and adjust the OD. 600nm The value was 0.5. Then, Xcc bacterial solution (which weakens the immunity of citrus and increases the expression of the vector gene in citrus leaves) was injected into the Simmons sweet orange leaves with 1 mL syringe to obtain sweet orange leaves injected with Xcc bacterial solution, and then placed in the greenhouse for further cultivation.

[0120] 2. Agrobacterium GV3101 containing the overexpression vector 35S:YFP-CsMYC2, the gene silencing vector CsMYC2-RNAi, and the control vector were respectively plated on LB agar plates containing kanamycin and rifampicin. The cells were incubated overnight at 28°C. The cells were collected using MMA solution (10 mM MgCl2, 10 mM MES, 150 μM Acetosyringone), and the OD was adjusted. 600nm The value is 1.0, and it should be left to stand at room temperature for more than three hours.

[0121] 3. Six to eight hours after injecting the Xcc bacterial solution into the leaves, the leaves of sweet oranges injected with the Xcc bacterial solution were immersed in the bacterial solution containing the overexpression vector, the gene silencing vector, and the control vector, respectively, using a vacuum injection method. The leaves were then placed in a plant growth chamber and grown for 72 hours.

[0122] III. CsMYC2 can effectively regulate the expression level of the CsPUB21 gene.

[0123] 1. Leaf samples were collected 3 days after growth. RNA was extracted from the samples using an RNA extraction kit, and cDNA was synthesized by reverse transcription. Overexpression and silencing genes were detected by real-time PCR, with COX as the internal reference gene. The quantitative primer sequences are as follows:

[0124] Citrus CsMYC2 gene detection primers CsMYC2-qF: CTACAGCCGACCCCATGAAG;

[0125] Citrus CsMYC2 gene detection primers: CsMYC2-qR: TACCCATCGCCCCATCCTAA;

[0126] Citrus internal reference gene detection primers COX-qF: GTATGCCACGTCGCATTCCAGA;

[0127] Citrus internal reference gene detection primers COX-qR: GCCAAAACTGCTAAGGGCATTC;

[0128] The results are shown in Figure 2A. The results show that the expression level of the CsMYC2 gene in the CsMYC2 overexpressing citrus samples is significantly higher than that in the control samples, while the expression level of the CsMYC2 gene in the CsMYC2 gene silenced citrus samples is significantly lower than that in the control samples. This indicates that the constructed overexpression and silencing vectors can effectively overexpress and silence the expression level of the CsMYC2 gene.

[0129] 2. Simultaneously, using the cDNA samples from step 1, the expression level of the CsPUB21 gene in CsMYC2-overexpressing citrus samples and CsMYC2 gene-silenced citrus samples was detected by real-time quantitative PCR, with COX as the internal reference gene. The quantitative primer sequences are as follows:

[0130] Citrus CsPUB21 gene detection primers CsPUB21-qF: CGTTGGTCGTCGTCTATCGT;

[0131] Citrus CsPUB21 gene detection primers: CsPUB21-qR: AATGGAGACTGCGAACTCCG.

[0132] The results are shown in Figure 1B. The results show that the expression level of CsPUB21 gene in the CsMYC2 gene-silenced citrus samples was significantly lower than that in the control samples, while the expression level of CsPUB21 gene in the CsMYC2-overexpressed citrus samples was significantly higher than that in the control samples, indicating that CsMYC2 can effectively regulate the expression level of CsPUB21 gene.

[0133] IV. Verification of the G-box-like motif in the CsMYC2-binding PUB21 promoter region using chromatin immunoprecipitation (CHIP) technique.

[0134] 1. Synthesis of primers for detecting the PUB21 promoter G-box like motif

[0135] The DNAMAN software was used to predict the CsMYC2 binding G-box-like motif in the CsPUB21 promoter sequence of sweet orange. A total of 14 motifs were predicted, distributed in the pre-, mid-, and post-promoter regions. Based on the distribution location of the motifs, they were divided into segments I, II, III, and IV, each 150 bp in length, containing an indefinite number of G-box-like motifs. The 150 bp segment at the very upstream of the promoter that did not contain a G-box-like motif was selected as the control region. Quantitative detection primers for segments I, II, III, IV, and the control region were synthesized using the NCBI-prime blast website. The quantitative primer sequences are as follows:

[0136] CsPUB21pro-I-qF: AGGAGGAAATATAACTCAAA;

[0137] CsPUB21pro-I-qR:GAATAAATCAAATCAAAGCT;

[0138] CsPUB21pro-Ⅱ-qF: AGGATCAGGCTACGGTGTAA;

[0139] CsPUB21pro-Ⅱ-qR: CACACAATAAATTACGGGGG;

[0140] CsPUB21pro-Ⅲ-qF:GTGACAGTAAATTCAACTCATC;

[0141] CsPUB21pro-Ⅲ-qR: GCTGAGTTCATTAGTTTCAC;

[0142] CsPUB21pro-Ⅳ-qF: CAGTCTAATATGAGCGCCTC;

[0143] CsPUB21pro-IV-qR: GTGCTTTGAGCGTGATTTAA;

[0144] CsPUB21pro-ck-qF:GTCAAGATTAGCATACACACT;

[0145] CsPUB21pro-ck-qR:TATCCAATGGATATACGTGT.

[0146] 2. Construction of MBP-CsMYC2 protein expression and purification vector and protein purification

[0147] (1) Based on the intermediate vector pENTR-3C-CsMYC2 obtained in step one, the intermediate vector pENTR-3C-CsMYC2 and the protein expression purification vector pGEX-MBP were linked by the LR reaction using the recombinase (Gateway LR Clonase II) to obtain the CsMYC2 protein expression purification vector pGEX-CsMYC2-MBP.

[0148] (2) The pGEX-CsMYC2-MBP vector constructed in step (1) above was transformed into BL21(DE3) competent cells for protein induction and purification. The MBP-CsMYC2 fusion protein was obtained by purification with anti-MBP Tag immunomagnetic beads. At the same time, the pGEX-MBP empty vector was transformed into BL21(DE3) competent cells for protein induction and purification. The MBP-tagged protein was obtained by purification with anti-MBP Tag immunomagnetic beads.

[0149] 3. The enrichment fold of CsMYC2 binding to the CsPUB21 promoter was verified using chromatin immunoprecipitation (CHIP).

[0150] The binding ability of MBP-CsMYC2 protein to regions I, II, III, and IV of the PUB21 promoter and the control region was detected in vitro using chromatin immunoprecipitation. The concentrations of regions I, II, III, and IV and the control region after enrichment were detected by quantitative real-time PCR using the final DNA product, with COX as the internal reference gene. The specific primer sequences are described in step 1 above.

[0151] The results are shown in Figure 2C. The results show that compared with the relative enrichment fold of the control region, segments I, II, and III can significantly bind to and enrich MBP-CsMYC2. Among them, MBP-CsMYC2 has the strongest binding ability to segments II and III, which are rich in G-box like motifs, indicating that CsMYC2 can bind to the CsPUB21 promoter by binding to G-box like motifs.

[0152] V. Verification of CsMYC2 binding to G-box-like motifs in Helitron using electrophoretic mobility analysis (EMSA)

[0153] 1. Synthesis of biotin-tagged primers for the CsPUB21 promoter EMSA

[0154] Based on the division of the CsPUB21 promoter into G-box-like motif-rich regions I, II, and III in step four above, biomarker-encapsulated EMSA detection primers for regions I, II, III, and the control region were designed and synthesized. The primer sequences are as follows:

[0155] CsPUB21pro-I-Fw:AGGAGGAAATATAACTCAAA;

[0156] CsPUB21pro-I-Rv:GAATAAATCAAATCAAAGCT;

[0157] CsPUB21pro-II-Fw:AGGATCAGGCTACGGTGTAA;

[0158] CsPUB21pro-II-Rv:CACACAATAAATTACGGGGG;

[0159] CsPUB21pro-III-Fw:GTGACAGTAAATTCAACTCATC;

[0160] CsPUB21pro-III-Rv: GCTGAGTTCATTAGTTTCAC;

[0161] Separate EMSA detection primers and mutation detection primers were designed for the G-box-like motif-rich region II of the Helitron insertion. The primer sequences are as follows:

[0162] CsPUB21pro-H123-Fw: CCGTACTACAGTTGCATCCAGCTGTTGGATGCACTTGGATTAGTG;

[0163] CsPUB21pro-H123-Rv:CACTAATCCAAGTGCATCCAACAGCTGGATGCAACTGTAGTACGG;

[0164] CsPUB21pro-Hm123-Fw: CCGTACTATTGTAACATCCAGCTGTTGGATGCACTTGGATTAGTG;

[0165] CsPUB21pro-Hm123-Rv:CACTAATCCAAGTGCATCCAACAGCTGGATGTTACAATAGTACGG;

[0166] CsPUB21pro-Hm1m23-Fw:CCGTACTATTGTAACATCTTGCAATTGGATGCACTTGGATTAGTG;

[0167] CsPUB21pro-Hm1m23-Rv:CACTAATCCAAGTGCATCCAATTGCAAGATGTTACAATAGTACGG;

[0168] CsPUB21pro-Hm12m3-Fw:CCGTACTATTGTAACATCCAGCTGTTGGATGTTCTAAGATTAGTG;

[0169] CsPUB21pro-Hm12m3-Rv:CACTAATCTTAGAACATCCAACAGCTGGATGTTACAATAGTACGG;

[0170] CsPUB21pro-Hm1m2m3-Fw:CCGTACTATTGTAACATCTTGCAATTGGATGTTCTAAGATTAGTG;

[0171] CsPUB21pro-Hm1m2m3-Rv:CACTAATCTTAGAACATCCAATTGCAAGATGTTACAATAGTACGG;

[0172] CsPUB21pro-H12m3-Fw:CCGTACTACAGTTGCATCTTGCAATTGGATGCACTTGGATTAGTG;

[0173] CsPUB21pro-H12m3-Rv:CACTAATCCAAGTGCATCCAATTGCAAGATGCAACTGTAGTACGG;

[0174] CsPUB21pro-Hm45-Fw:GCTTGATGTTACAATAACACAGTACCACAGTTGCACCAT;CsPUB21pro-Hm45-Rv:ATGGTGCAACTGTGGTACTGTGTTATTGTAACATCAAGC;

[0175] CsPUB21pro-H4m5-Fw: GCTTGATGCAACTGTAACACAGTACCATTGTAACACCAT; CsPUB21pro-H4m5-Rv: ATGGTGTTACAATGGTACTGTGTTACAGTTGCATCAAGC;

[0176] CsPUB21pro-H45-Fw:GCTTGATGCAACTGTAACACAGTACCACAGTTGCACCAT;

[0177] CsPUB21pro-H45-Rv: ATGGTGCAACTGTGGTACTGTGTTACAGTTGCATCAAGC.

[0178] The synthesized primers were mixed in a 1:1 molar ratio and added to the annealing solution. The mixture was annealed at 75°C for 30 min to form DNA dimers. The mixture was then allowed to cool naturally to room temperature and kept at -20°C.

[0179] 2. Electrophoretic mobility analysis (EMSA) was used to verify the binding ability of CsMYC2 to G-box-like motifs in Helitron.

[0180] The binding affinity of MBP-CsMYC2 protein to regions I, II, and III of the CsPUB21 promoter was determined in vitro using electrophoretic mobility assay. The binding affinity of MBP-CsMYC2 to G-box-like motifs in the Helitron region of CsPUB21 promoter regions I, II, and III was assessed using electrophoretic mobility assay, with MBP-tagged proteins serving as controls.

[0181] The results are shown in Figure 2C. The results show that, compared with the control tag protein MBP, which does not form a CsMYC2-DNA complex with the DNA dimers in regions I, II, and III of the CsPUB21 promoter, the MBP-CsMYC2 protein can significantly bind to the DNA dimers in regions I, II, and III of the CsPUB21 promoter to form a CsMYC2-DNA complex. This results in a decrease in the electrophoretic mobility of the DNA dimer and the formation of a clear CsMYC2-DNA complex binding band.

[0182] Further analysis of the binding ability of CsMYC2 to each G-box like motif in Helitron was conducted, and the results are shown in Figure 2D. The results showed that the MBP-CsMYC2 protein could significantly bind to each G-box like motif in Helitron and form a CsMYC2-DNA complex. However, when a completely mutated G-box like motif was used, this binding ability disappeared, and no CsMYC2-DNA complex was formed. This indicates that CsMYC2 can bind to the CsPUB21 promoter by binding to G-box like motifs. The inserted Helitron is rich in G-box like motifs, which can significantly enhance the binding ability of CsMYC2 to the CsPUB21 promoter and thus promote the expression of the disease-susceptibility gene CsPUB21.

[0183] Example 3: CsMYC2 protein transcriptional activation of PUB21 gene expression

[0184] I. Construction of the PUB21 promoter activity reporter system (LUC / GUS) vector

[0185] 1. Design primers for promoter fragment amplification. The primer sequences are as follows:

[0186] CsPUB21pro-Fw(BamHI):CCAATTCAGTCGACTGGATCCTCACGCTCAAAGCACTACGA;

[0187] CsPUB21pro-Rv(XhoI): GCTGGTCTAGATATCGAGGCAAGCCAGCAGTATGCAAG;

[0188] MpPUB21pro-Fw(BamHI):CCAATTCAGTCGACTGGATCCGTGGTCTAATATGAACGCCTC;

[0189] MpPUB21pro-Rv(XhoI):GCTGGGTCTAGATATCTCGAGGCAAGCCAGCAATACGCAAG;

[0190] BkPUB21pro-Fw(BamHI):CCAATTCAGTCGACTGGATCCTCGAATGCCTGGCCGATTTT;

[0191] BkPUB21pro-Rv(XhoI):GCTGGGTCTAGATATCTCGAGCCTTGAACAAAAGAAGCAGGCC;

[0192] CsPUB21 ΔHel pro-Fw:CATTTAGATACATGAAATTTATTGTGTGTTTTCAATTAAGG;

[0193] CsPUB21 ΔHel pro-Rv:AACACACAATAAATTCATGTATCTAAATGTTATTATCGCG;

[0194] Cl148pro-Fw:CTCAGCAACATATTCGGTCAAGAATTTAGGATCGTTATACAAG

[0195] Cl148pro-Rv:AGTTGGTTAAACTTGTGGACACGGGGGAAATTTGTGGTCT

[0196] Cm87pro-Fw: CTCAGCAACATATTCGGTCAAGAATTTAGGATCAAACTAC

[0197] Cm87pro-Rv: AGTTGGTTAAACTTGTGGACACGGGAGAAATGCATGTGAT

[0198] The underlined nucleotide sequences are homologous arm sequences with BamHI restriction site recognition sites and XhoI restriction site recognition sites.

[0199] 2. Using Simmons orange DNA as a template, PCR amplification was performed using primers CsPUB21pro-Fw (BamHI) and CsPUB21pro-Rv (XhoI) to obtain a CsPUB21pro gene fragment of 2059 bp (sequence SEQ ID No.1).

[0200] Using Murraya paniculata DNA as a template, PCR amplification was performed using primers MpPUB21pro-Fw (BamHI) and MpPUB21pro-Rv (XhoI) to obtain a 1949bp MpPUB21pro gene fragment (sequence SEQ ID No. 5).

[0201] Using curry DNA as a template, PCR amplification was performed using primers BkPUB21pro-Fw (BamHI) and BkPUB21pro-Rv (XhoI) to obtain a 1758bp BkPUB21pro gene fragment (sequence SEQ ID No. 6).

[0202] Using DNA from Linwu orange as a template, PCR amplification was performed using primers Cl148pro-Fw and Cl148pro-Rv to obtain a 148bp Cl148pro gene fragment (sequence SEQ ID No. 8).

[0203] Using the DNA of wild orange from Mangshan as a template, PCR amplification was performed using primers Cm87pro-Fw and Cm87pro-Rv to obtain a Cm87pro gene fragment of 87 bp (sequence SEQ ID No. 9).

[0204] Using the CsPUB21pro gene fragment as a template, primers CsPUB21pro-Fw(BamHI) and CsPUB21 were used respectively. Δ Hel pro-Rv and primer CsPUB21 ΔHel PCR amplification was performed using pro-Fw and CsPUB21pro-Rv(XhoI) to obtain gene fragments of 1068 bp and 841 bp, respectively. 100 ng of each fragment was then used for PCR with primers CsPUB21pro-Fw(BamHI) and CsPUB21pro-Rv(XhoI) to splice them together, resulting in a 1909 bp CsPUB21pro gene fragment lacking Helitron, which was designated CsPUB21. ΔHel pro gene fragment. CsPUB21 ΔHel The pro gene fragment is obtained by deleting positions 1069-1218 of sequence SEQ ID No.2.

[0205] Using the CsPUB21pro gene fragment as a template, primers CsPUB21pro-Fw(BamHI) and CsPUB21 were used respectively. Δ Hel pro-Rv and primer CsPUB21 ΔHel PCR amplification was performed using pro-Fw and CsPUB21pro-Rv(XhoI) to obtain gene fragments of 1068 bp and 841 bp, respectively. 100 ng of each of the Cl148pro gene fragment and the two 1068 bp and 841 bp fragments were then subjected to PCR using primers CsPUB21pro-Fw(BamHI) and CsPUB21pro-Rv(XhoI) to splice them together, resulting in a 2057 bp CsPUB21ΔHel+cl148pro gene fragment added to Cl148pro, which was designated as CsPUB21. Δ Hel+cl148 pro gene fragment (sequence SEQ ID No. 10).

[0206] Using the CsPUB21pro gene fragment as a template, primers CsPUB21pro-Fw(BamHI) and CsPUB21 were used respectively. Δ Hel pro-Rv and primer CsPUB21 ΔHel PCR amplification was performed using pro-Fw and CsPUB21pro-Rv(XhoI) to obtain gene fragments of 1068 bp and 841 bp, respectively. 100 ng of each of the Cm87pro gene fragment and the two 1068 bp and 841 bp fragments were then subjected to PCR using primers CsPUB21pro-Fw(BamHI) and CsPUB21pro-Rv(XhoI) to splice them together, resulting in a 1996 bp CsPUB21 gene fragment added to Cm87pro. ΔHel+cm87 The pro gene fragment was designated CsPUB21. Δ Hel+cm87 pro gene fragment (sequence SEQ ID No. 11).

[0207] 3. The pENTR-3C vector was double-digested with restriction endonucleases BamHI and XhoI to obtain the backbone vector; then, the backbone vector was ligated with the six fragments from step 2 (CsPUB21pro gene fragment, MpPUB21pro gene fragment, BkPUB21pro gene fragment, CsPUB21...) using T4 DNA ligase. ΔHel pro gene fragment, CsPUB21 Δ Hel+cl148 pro gene fragment or CsPUB21 ΔHel+cm87 The pro gene fragment was ligated to obtain the intermediate vectors pENTR-3C-CsPUB21pro, pENTR-3C-MpPUB21pro, pENTR-3C-BkPUB21pro, and pENTR-3C-CsPUB21, respectively. ΔHel pro, pENTR-3C-CsPUB21ΔHel+cl148pro and pENTR-3C-CsPUB21 Δ Hel+cm87 pro.

[0208] 4. Using the recombinase (Gateway LR Clonase II), the intermediate vectors pENTR-3C-CsPUB21pro, pENTR-3C-MpPUB21pro, pENTR-3C-BkPUB21pro, and pENTR-3C-CsPUB21 were respectively... ΔHelpro, pENTR-3C-CsPUB21ΔHel+cl148pro and pENTR-3C-CsPUB21 ΔHel+cm87 The pro expression vector pKGWFS7.0-GUS was ligated to the expression vector pKGWFS7.0-GUS via a LR reaction, yielding the recombinant vectors pKGWFS7.0-CsPUB21pro-GUS, pKGWFS7.0-MpPUB21pro-GUS, pKGWFS7.0-BkPUB21pro-GUS, and pKGWFS7.0-CsPUB21, respectively. Δ Hel pro-GUS, pKGWFS7.0-CsPUB21ΔHel+cl148pro-GUS and pKGWFS7.0-CsPUB21 Δ Hel+cm87 pro-GUS.

[0209] Using the recombinase (Gateway LR Clonase II), the intermediate vectors pENTR-3C-CsPUB21pro, pENTR-3C-MpPUB21pro, pENTR-3C-BkPUB21pro, and pENTR-3C-CsPUB21 were respectively transfected. ΔHel pro, pKGWFS7.0-CsPUB21ΔHel+cl148pro-GUS and pKGWFS7.0-CsPUB21 ΔHel+cm87 pro-GUS was ligated to the expression vector pGWB435-LUC via an LR reaction to obtain the recombinant vectors pGWB435-CsPUB21pro-LUC, pGWB435-MpPUB21pro-LUC, pGWB435-BkPUB21pro-LUC, and pGWB435-CsPUB21, respectively. Δ Hel pro-LUC, pGWB435-CsPUB21ΔHel+cl148pro-LUC and pGWB435-CsPUB21 ΔHel+cm87 The structural diagrams of each recombinant vector are shown in Figure 3A.

[0210] 5. The recombinant vectors prepared in step 4 were transformed into Agrobacterium GV3101 strain by electroporation.

[0211] II. Validation of the reporter system for CsMYC2 transcriptional activation of PUB21-LUC in tobacco leaves

[0212] 1. Agrobacterium GV3101 containing the overexpression vector 35S:YFP-CsMYC2 or the control vector 35S:YFP, and the LUC reporter system vectors pGWB435-CsPUB21pro-LUC, pGWB435-MpPUB21pro-LUC, pGWB435-BkPUB21pro-LUC, and pGWB435-CsPUB21... ΔHel pro-LUC, pGWB435-CsPUB21 Δ Hel+cl148 pro-LUC and pGWB435-CsPUB21 ΔHel+cm87 Agrobacterium GV3101 pro-LUC was plated on LB agar plates containing spectinomycin and rifampicin, incubated overnight at 28°C, and the bacterial cells were collected with MMA solution. OD was adjusted. 600nm The value is 1.0, and it should be left to stand at room temperature for more than three hours.

[0213] 2. According to the combination shown in Figure 3C, mix the bacterial solution at a volume ratio of 1:1, inject the mixed bacterial solution into the tobacco leaves using a 1mL syringe, and continue to cultivate it in the greenhouse for 48 hours.

[0214] 3. The effect of CsMYC2-YFP on the transcriptional activity of different PUB21 promoters was observed using cryo-fluorescence imaging.

[0215] The results are shown in Figures 3B, 3C, and 3D. Figure 3B shows that, compared to the control YFP, CsMYC2-YFP can activate the PUB21 promoter and exhibit luciferase activity; among them, CsMYC2-YFP has the strongest ability to activate the CsPUB21 promoter, showing the most significant luciferase activity intensity, and the degree of deletion of the full-length or fragment of Helitron is directly correlated with the relative LUC activity intensity. Specifically, compared to the CsPUB21 promoter, CsPUB21 lacking the full-length Helitron... ΔHel The activity intensity of proluciferase decreased by more than 72%, while two MYC2 cis-elements from intermediate citrus, namely 148 bp (cl148) of C. linwuensis or 87 bp (cm87) of C. mangshanensis, were inserted into CsPUB21. Δhel In the process, the generated cis-element exchange mutants CsPUB21ΔHel+cl148pro and CsPUB21 ΔHel+cm87The activity of pro-luciferase decreased by more than 30% and 45%, respectively. For the MpPUB21 promoter and BkPUB21 promoter, which naturally lack the Helitron insertion, the activity of their luciferase is approximately 16% to 20% of that of the CsPUB21 promoter.

[0216] Figures 3C and 3D visually demonstrate the luciferase imaging of the transcriptional activities of YFP and CSMYC2 on different PUB21 promoters in tobacco. CsMYC2-YFP showed the strongest activation ability of the CsPUB21 promoter, exhibiting the most significant luciferase activity, while the CsPUB21 promoter lacking Helitron showed the weakest activation. ΔHel The activity of pro-luciferase was significantly weakened, and the activity of luciferase was even lower in the MpPUB21 promoter and BkPUB21 promoter lacking Helitron insertion. These results indicate that the transcriptional activation of PUB21 gene expression by the CsMYC2 transcription factor mainly functions through the Helitron insertion in the promoter region.

[0217] III. Validation of the PUB21-GUS reporter system for CsMYC2 transcriptional activation in tobacco leaves

[0218] 1. Agrobacterium GV3101 expressing the overexpression vector 35S:YFP-CsMYC2 or the control vector 35S:YFP, and containing the GUS reporter system vectors pKGWFS7.0-CsPUB21pro-GUS, pKGWFS7.0-MpPUB21pro-GUS, pKGWFS7.0-BkPUB21pro-GUS, and pKGWFS7.0-CsPUB21... ΔHel pro-GUS, pKGWFS7.0-CsPUB21ΔHel+cl148pro-GUS and pKGWFS7.0-CsPUB21 ΔHel+cm87 Agrobacterium GV3101 pro-GUS was plated on LB agar plates containing spectinomycin and rifampicin, incubated overnight at 28°C, and the bacterial cells were collected with MMA solution. OD was adjusted. 600nm The value is 1.0, and it should be left to stand at room temperature for more than three hours.

[0219] 2. According to the combination shown in Figure 3F, mix the bacterial solution at a volume ratio of 1:1, inject the mixed bacterial solution into the tobacco leaves using a 1mL syringe, and continue to cultivate it in the greenhouse for 48 hours.

[0220] 3. The effect of CsMYC2-YFP on the transcriptional activity of different PUB21 promoters was observed using β-glucuronidase (GUS) staining.

[0221] The results are shown in Figures 3E, 3F, and 3G. Figures 3E and 3F show the results on the same leaf. Compared to the control YFP, CsMYC2-YFP significantly activated the PUB21 promoter, exhibiting a significant GUS staining response; among them, CsMYC2-YFP showed the strongest activation ability of the CsPUB21 promoter, exhibiting the most significant relative GUS activity intensity. Δ Hel+cl148 pro and CsPUB21 ΔHel+cm87 The activity intensity of proluciferase was weakened, while CsPUB21 lacking Helitron was also weakened. ΔHel The activity of proluciferase was significantly reduced, and the relative GUS activity of the MpPUB21 promoter lacking the Helitron insertion was even lower, verifying that the inserted Helitron transposon plays a major role in the transcriptional activation of PUB21 expression by the CsMYC2 transcription factor.

[0222] Figure 3G further illustrates the varying degrees of relative GUS activity intensity exhibited by CSMYC2-YFP activation of different PUB21 promoters. The degree of deletion of the full-length or fragmented Helitron is directly correlated with relative GUS activity intensity. Compared to the CsPUB21 promoter, the cis-element exchange mutant CsPUB21ΔHel+cl148pro luciferase activity intensity decreases by approximately 35%. ΔHel+cm87 The activity intensity of proluciferase decreased by more than 67%, while the full-length CsPUB21 lacking Helitron was also reduced. ΔHel The activity intensity of proluciferase decreased by more than 84%, almost equivalent to the activity intensity of luciferase with the MpPUB21 promoter lacking the Helitron insertion.

[0223] Example 4: Effective CLAs resistance by knocking out the CsPUB21 promoter fragment using the CRISPR-Cas9 editor.

[0224] To further confirm the effect of the number of G-box-like motifs in the PUB21 promoter on the pathogenic mechanism of the Huanglongbing susceptibility gene PUB21 itself, this invention uses the CRISPR-Cas9 editing system to delete and edit the Heliton insertion fragment G-box-like motif in the protoplasts of susceptible citrus fruits to observe the resistance to Huanglongbing fungus. The specific steps are as follows:

[0225] I. Optimization of the CRISPR-Cas9 editing system starter

[0226] Since the initiating sgRNA and Cas9 promoters in the original CRISPR-Cas9 editing system are derived from OsU3 and MaUbi from rice and maize, the editing efficiency in citrus is low. Therefore, this invention optimizes the promoters in the CRISPR-Cas9 editing system.

[0227] 1. Design promoter amplification primers. The primer sequences are as follows:

[0228] CsU6-Cas9-Fw:AAAACGACGGCCAGTGCCAAGCTTGCGCTCAGGAGCCGGTTGAA;

[0229] CsU6-Cas9-Rv: GCTATTTCTAGCTCTAAAACCGAGACCTTGTGTTGGTCTCG;

[0230] CmYLCV-Cas9-Fw: TACTGCTTGCTGCTAAGCTTTGGCAGACATACTGTCCCAC;

[0231] CmYLCV-Cas9-Rv:GATCCGTCGACAAGCTCCTAGGAAGCTTAGCTCTTACCTGTTTTCG;

[0232] The underlined nucleotide sequences are the homologous arm sequences at both ends of the original promoter of the CRISPR-Cas9 editing system. Using Simmons orange DNA as a template, PCR amplification was performed using primers CsU6-Cas9-Fw and CsU6-Cas9-Rv to obtain a 665 bp CsU6 promoter gene fragment containing homologous arms, the nucleotide sequence of which is shown in SEQ ID No. 2. Based on the CmYLCV promoter sequence downloaded from NCBI, a commercially synthesized CmYLCV promoter gene fragment containing a 465 bp homologous arm was obtained at Qingke Biotechnology Co., Ltd., the nucleotide sequence of which is shown in SEQ ID No. 3.

[0233] 2. Design primers for amplifying the intermediate fragment. The primer sequences are as follows:

[0234] Gap-sgRNA-Cas9-Fw:CGAGACCAACACAAGGTCTCGGTTTTAGAGCTAGAAATAGC;

[0235] Gap-sgRNA-Cas9-Fw: GTGGGACAGTATGTCTGCCAAAGCTTAGCAGCAAGCAGTA;

[0236] The underlined nucleotide sequences are the homologous arm sequences at both ends of the intermediate fragment of the CRISPR-Cas9 editing system.

[0237] Using the guide editing vector PE2(V2) as a template, PCR amplification was performed using primers Gap-sgRNA-Cas9-Fw and Gap-sgRNA-Cas9-Fw to obtain a 414bp intermediate fragment sequence of Gap-sgRNA containing homologous arms. Its nucleotide sequence is shown in SEQ ID No. 12.

[0238] 3. The CRISPR-Cas9 vector was digested with restriction endonuclease HindIII to obtain a 16657 bp backbone vector fragment and a 2033 bp fragment. The 16657 bp backbone vector fragment was recovered. The recovered 16657 bp backbone vector fragment was then digested again with restriction endonuclease AvrII to obtain a 14696 bp backbone vector fragment and a 2000 bp fragment. The 14696 bp backbone vector fragment was recovered.

[0239] 4. Take 100 ng of each of the CsU6 promoter, Gap-sgRNA and CmYLCV promoter fragments obtained by PCR in steps 1 and 2 and perform PCR using primers CsU6-Cas9-Fw and CmYLCV-Cas9-Rv to splice a fusion gene fragment of 1550 bp in size. Its nucleotide sequence is shown in SEQ ID No. 13.

[0240] 5. Finally, the fusion fragment of 1652 bp from step 4 was recombined with the backbone vector of 14696 bp obtained in step 3 using C112 homologous recombinase. After ligation, transformation and identification, the promoter-optimized editing vector PHUE-CsU6-Gap-CmYLCV-Cas9 was obtained.

[0241] II. Construction of the Cas9-PUB21pro editing platform

[0242] 1. Design primers for Cas9-CsPUB21 pro-sgRNA amplification. The primer sequences are as follows:

[0243] Cas9-CsPUB21pro-sgRNA-Fw: GTTGAGCTGGATGCAACTGTAGTA;

[0244] Cas9-CsPUB21pro-sgRNA-Rv: AAACTACTACAGTTGCATCCAGCT;

[0245] The underlined nucleotide sequences are the sticky ends at both ends of the original gap region of the optimized editing vector PHUE-CsU6-Gap-CmYLCV-Cas9.

[0246] The primers Cas9-CsPUB21pro-sgRNA-Fw and Cas9-CsPUB21pro-sgRNA-Rv were mixed in a volume ratio of 1:1, treated at 95°C for 5 min, and then allowed to cool naturally at room temperature to form double-stranded DNA with sticky ends.

[0247] 2. The PHUE-CsU6-Gap-CmYLCV-Cas9 vector was digested with restriction endonuclease BsaI to obtain a linear backbone vector; then, the linear backbone vector was ligated with the double-stranded DNA fragment with sticky ends obtained in step 1 using C112 homologous recombinase to obtain the CRISPR-Cas9 editing vector PHUE-CsU6-CsPUB21pro-CmYLCV-Cas9.

[0248] The Crispr-Cas9 editing vector PHUE-CsU6-CsPUB21pro-CmYLCV-Cas9 contains an sgRNA gene expression cassette and a Cas9 gene expression cassette, expressing sgRNA and Cas9 protein targeting the Heliton region of the CsPUB21 promoter. Specifically, in the sgRNA gene expression cassette, the target sequence of the sgRNA is positions 1105-1124 of sequence SEQ ID No. 1, and the promoter used to initiate sgRNA gene expression is the CsU6 promoter; in the Cas9 gene expression cassette, the promoter used to initiate Cas9 gene expression is the CmYLCV promoter.

[0249] III. CRISPR-Cas9 editing and knocking out the CsPUB21 promoter containing a G-box-like motif can reduce CLas titers in protoplasts of susceptible leaves.

[0250] 1. Large-scale extraction of the PHUE-CsU6-CsPUB21pro-CmYLCV-Cas9 recombinant plasmid

[0251] PHUE-CsU6-CsPUB21pro-CmYLCV-Cas9 was transferred into DH5α competent cells, streaked overnight on a solid LB agar plate containing Kan antibiotic, single colonies were picked and cultured overnight in 10 mL liquid LB agar containing Kan antibiotic, the bacterial culture was transferred to 200 mL liquid LB agar containing Kan antibiotic and cultured for 12 hours, the bacterial cells were collected and plasmids were extracted using the Tiangen (endotoxin-free) plasmid extraction kit.

[0252] 2. The plasmid extracted in step 1 was transformed into citrus protoplasts. First, infected young citrus (sweet orange) leaves were collected (infected citrus trees were grown in a laboratory greenhouse; infection was determined before the experiment by detecting the amount of the pathogen CLAs). The veins were removed, and the leaves were cut into thin strips. The strips were soaked in citrus leaf enzymatic hydrolysate and shaken in the dark for 5 hours. The hydrolysate was filtered through gauze, and after two washings, the protoplast precipitate was collected and placed on ice for about 30 minutes. Protoplast transformation was then performed using PEG4000-mediated transformation. The PHUE-CsU6-CsPUB21pro-CmYLCV-Cas9 recombinant plasmid was transformed in a 37℃ water bath for 30 minutes. After transformation, the supernatant was briefly removed by centrifugation, and protoplast culture medium was added and cultured in the dark for 48 hours. Simultaneously, the PHUE-CsU6-Gap-CmYLCV-Cas9 vector was used as a control.

[0253] 3. After culturing protoplasts for 48 hours, samples were collected, and protoplast DNA was extracted using the CTAB method. Primers for editing site enrichment and specific detection were synthesized. The primer sequences are as follows:

[0254] CsPUB21pro-Id-Fw:GTAAAAAAATGCACGGCC;

[0255] CsPUB21pro-Id-Rv:TTACTATCATTTCTTCTAACC.

[0256] Using extracted protoplast DNA as a template, PCR amplification was performed using the editing identification primers CsPUB21pro-Id-Fw and CsPUB21pro-Id-Rv to obtain a 491 bp CsPUB21pro-Id gene fragment. The PCR product was treated with the SfcI restriction endonuclease contained in the CsPUB21pro-sgRNA sequence. The editing efficiency of the digested PCR product was detected by agarose gel electrophoresis, with the amplified product of the wild-type genome without editing serving as a control. If editing occurred, a band of the same size as the amplified fragment could be detected.

[0257] The results are shown in Figure 4A. The results show that, compared with the undigested and digested wild-type CsPUB21pro-Id fragments, the CsPUB21pro-Id edited group after enzyme digestion has a 491bp band of the same size as the amplified fragment. The band intensity was measured using ImageJ, and the measured band intensity showed an editing efficiency of 10%.

[0258] Simultaneously, the amplified 491bp CsPUB21pro-Id gene fragment was ligated into a TA clone and single-colony sequencing was performed.

[0259] The results are shown in Figure 4B. The results show that the CRISPR-Cas9 editing system can effectively cleave the sgRNA-PAM recognition site 8nt downstream of the Heliton region of the CsPUB21 promoter in citrus protoplasts, successfully deleting an 84bp fragment located at positions 1113-1196 of SEQ ID No. 1, with an editing efficiency of 10%.

[0260] The expression level of the CsPUB21 gene in citrus protoplasts edited with Cas9-CsPUB21pro was detected by real-time PCR, following the steps in step three of Example 2.

[0261] The results, shown in Figure 4C, indicate that compared to the control group transformed with the empty vector, Cas9-CsPUB21pro editing significantly reduced the expression level of the CsPUB21 gene. This demonstrates that successful knockout of the Heliton region of the CsPUB21 promoter by CRISPR-Cas9 editing can significantly reduce the expression level of the disease-susceptibility gene CsPUB21.

[0262] 4. Using the protoplast DNA extracted in step 3 as a template, the concentration of pathogenic bacteria CLas in citrus protoplasts edited with Cas9-CsPUB21pro was detected by real-time quantitative PCR, with COX as an internal reference gene. The quantitative primer sequences are as follows:

[0263] HLBas primers for specific detection of Huanglongbing pathogen CLAs: GTCGAGCGCGTATGCAATACG;

[0264] HLBr primers for specific detection of CLas, the pathogen of Huanglongbing (HLB): GCGTTATCCCGTAGAAAAAGGTAG;

[0265] Citrus internal reference gene detection primers COXf: GGTATGCCACGTCGCATTCCAGA;

[0266] Citrus internal reference gene detection primer COXr: GCCAAAACTGCTAAGGGCATTC.

[0267] The results are shown in Figure 4D. The results show that Cas9-CsPUB21pro editing significantly reduced the concentration of CLAs in the susceptible protoplasts, and the concentration of CLAs in the control transformed empty vector group was significantly different. This indicates that CRISpr-Cas9 editing and knocking out the Heliton region of the CsPUB21 promoter can enhance the resistance of citrus to Huanglongbing fungus and show an effective anti-CLAs effect.

[0268] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims. Industrial applicability

[0269] This invention identifies a citrus or tobacco gene fragment capable of regulating resistance to Huanglongbing (HLB) in plants, and the mechanism by which this fragment directly interacts with the PUB21 promoter-MYC2 susceptibility gene, enhancing resistance. This provides an effective gene resource for resisting the replication and spread of the HLB21 pathogen. In practical applications, editing the promoter region of the PUB21 susceptibility gene can reduce its binding region to the MYC2 transcription gene, thereby lowering and / or eliminating the expression of the PUB21 susceptibility gene, thus improving the resistance of recipient plants to HLB21 and its vector, the Asian citrus psyllid, and ultimately leading to the breeding of HLB21-resistant plant varieties. This invention is of great significance for the control of HLB21 in plants.

Claims

A DNA molecule, wherein the DNA molecule is any one of the following a1)-a3): a1) A DNA molecule with the sequence shown in SEQ ID No. 1; a2) A DNA molecule with the same function obtained by substituting and / or inserting and / or deleting one or more bases into the DNA molecule defined in a1). DNA molecules defined in a3) and a1) are DNA molecules that have at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identity and have the same function. DNA molecule according to claim 1, characterized in that The substitution and / or insertion and / or deletion of one or more bases is a substitution and / or insertion and / or deletion of no more than 10 bases. A biomaterial, characterized in that: The substance obtained by reducing or eliminating the expression and / or function of a full-length or partial fragment of a DNA molecule according to claim 1 or 2, wherein the full-length or partial fragment of the DNA molecule contains a characteristic motif that binds to the transcription factor MYC2. The biomaterial according to claim 3, characterized in that: The reduction or elimination of the expression and / or function of the full-length or partial fragments of the DNA molecule refers to the treatment of the full-length or partial fragments of the DNA molecule using gene knockout technology, gene silencing technology, inactivation mutation technology, PROTAC technology, or small molecule inhibitors. A method for preparing the biomaterial as described in claim 3 or 4, comprising treating a characteristic motif that binds to the transcription factor MYC2 in the full-length or partial fragment of the DNA molecule as described in claim 1 or 2 using gene knockout technology, gene silencing technology, inactivation mutation technology, PROTAC technology, or small molecule inhibitors. The method according to claim 5, characterized in that The gene knockout technologies include zinc finger protein (ZFN) technology, transcription activator-like effector (TALE) technology, CRISPR / Cas technology, or TALE-CRISPR / Cas technology. The method according to claim 5 or 6, characterized in that The gene knockout technology employs a CRISPR / Cas9 gene editing vector, which expresses sgRNA and Cas9 protein targeting the full-length or partial fragment of the DNA molecule described in claim 1 or 2. The method according to claim 7, characterized in that The target sequence of the sgRNA is shown in positions 1105-1124 of sequence SEQ ID No.

1. The method according to claim 5, characterized in that The inactivation mutation technique includes mutating the characteristic motif that binds to transcription factor MYC2 in the full-length or partial fragment of the DNA molecule as described in claim 1 or 2, thereby preventing transcription factor MYC2 from binding to it. The mutation may be a deletion mutation and / or an insertion mutation and / or a base substitution. The use of the biomaterial according to claim 3 or 4 in any of the following A1)-A6): A1) Enhance the resistance of plants, plant parts, or plant cells to Huanglongbing (HLB); A2) Prepare products that enhance the resistance of plants, plant parts or plant cells to Huanglongbing (HLB); A3) Cultivate plants, plant parts, or plant cells resistant to Huanglongbing (HLB); A4) Prepare products for cultivating plants, plant parts or plant cells resistant to Huanglongbing (HLB); A5) Control of Huanglongbing (HLB) in plants, parts of plants, or plant cells; A6) Prepare products for the prevention and control of Huanglongbing (HLB) in plants, plant parts or plant cells. A gene regulation system for the preparation of the biomaterial as described in claim 3 or 4. A gene regulation system according to claim 11 characterised in that: The gene regulation system employs gene knockout technology, gene silencing technology, inactivation mutation technology, PROTAC technology, or small molecule inhibitors to treat characteristic motifs that bind to transcription factor MYC2 in the full-length or partial segments of the DNA molecule as described in claim 1 or 2. The gene regulation system according to claim 12, characterized in that The gene regulation system comprises nucleic acid molecules and enzyme proteins, wherein the nucleic acid molecules are sgRNA molecules and the enzyme proteins are Cas proteins or Cas orthologs. A gene regulation system according to claim 13, characterised in that: The enzyme protein may be selected from Cas3, Cas9, Cas12a, Cas12b, Cas13a, Cas13b, Cas13c, Cas13e, Cas13f, CasX or IscB protein or their orthologs. Gene regulation system according to claim 13 or 14, characterized in that The gene regulation system uses a CRISPR / Cas9 gene editing vector. Express sgRNA and Cas9 protein targeting the full length or a portion of the DNA molecule as described in claim 1 or 2. Application of the gene regulation system according to claims 11 to 15 in any of the following A1)-A6): A1) Enhance the resistance of plants, plant parts, or plant cells to Huanglongbing (HLB); A2) Prepare products that enhance the resistance of plants, plant parts or plant cells to Huanglongbing (HLB); A3) Cultivate plants, plant parts, or plant cells resistant to Huanglongbing (HLB); A4) Prepare products for cultivating plants, plant parts or plant cells resistant to Huanglongbing (HLB); A5) Control of Huanglongbing (HLB) in plants, parts of plants, or plant cells; A6) Prepare products for the prevention and control of Huanglongbing (HLB) in plants, plant parts or plant cells. A kit comprising the gene regulation system as described in claims 11 to 15. Use of the kit according to claim 17 in any of the following A1)-A6): A1) Enhance the resistance of plants, plant parts, or plant cells to Huanglongbing (HLB); A2) Prepare products that enhance the resistance of plants, plant parts or plant cells to Huanglongbing (HLB); A3) Cultivate plants, plant parts, or plant cells resistant to Huanglongbing (HLB); A4) Prepare products for cultivating plants, plant parts or plant cells resistant to Huanglongbing (HLB); A5) Control of Huanglongbing (HLB) in plants, parts of plants, or plant cells; A6) Prepare products for the prevention and control of Huanglongbing (HLB) in plants, plant parts or plant cells. Use according to claim 10, 16 or 18, characterized in that The plant is any one of the following P1)-P8): P1) Monocotyledonous or dicotyledonous plants; P2) The dicotyledonous plants mentioned are plants of the Rutales order or Solanales order; P3) The plants in the Rutales order are plants of the Rutaceae family; P4) The plants in the Solanales order are plants of the Solanaceae family; P5) The Rutaceae plant mentioned is a Citrus genus plant; P6) The plants in the Solanaceae family mentioned are plants of the genus Nicotiana. P7) The Citrus species mentioned are citrus fruits; The plant species mentioned in P8) is tobacco. A PUB21 promoter comprising the DNA molecule as described in claims 1 to 2. A method for enhancing resistance to Huanglongbing (HLB) in plants, plant parts, or plant cells, or for cultivating HLB-resistant plants, plant parts, or plant cells, comprising administering to a recipient plant, plant part, or plant cell the gene regulation system as described in claims 11 to 15 or the kit as described in claim 17, such that the expression and / or function of the full-length or partial fragment of the DNA molecule as described in claim 1 or 2 in the promoter of the PUB21 gene in the recipient plant, plant part, or plant cell is reduced or eliminated. The step of deleting the PUB21 gene promoter fragment from the recipient plant genomic DNA according to claim 21. A method for improving the resistance of plants, plant parts or plant cells to Huanglongbing or for cultivating Huanglongbing-resistant plants, plant parts or plant cells, comprising the step of applying the biomaterials as described in claims 3 to 4 to the recipient plant, plant part or plant cell. The method according to any one of claims 21 to 23, characterized in that The plant is any one of the following P1)-P8): P1) Monocotyledonous or dicotyledonous plants; P2) The dicotyledonous plants mentioned are plants of the Rutales order or Solanales order; P3) The plants in the Rutales order are plants of the Rutaceae family; P4) The plants in the Solanales order are plants of the Solanaceae family; P5) The Rutaceae plant mentioned is a Citrus genus plant; P6) The plants in the Solanaceae family mentioned are plants of the genus Nicotiana. P7) The Citrus species mentioned are citrus fruits; The plant species mentioned in P8) is tobacco. Plants, plant parts or plant cells resistant to Huanglongbing produced by the method according to any one of claims 21 to 24.

Images