Genetically modified rodent for preparing heavy chain antibody and preparation method therefor

Abstract

Disclosed is a genetically modified rodent, having an immunoglobulin heavy chain constant region locus engineered such that a contiguous segment from a CH1 exon to a CH3 exon of endogenous IgHGl remains in the immunoglobulin heavy chain constant region locus of the rodent, but the CH1 exon of the endogenous IgHGl is not expressed. Also provided are a preparation method for the genetically modified rodent and a use thereof.

Description

Genetically modified rodents for preparing heavy chain antibodies and their preparation methods Technical Field

[0001] This invention relates to genetically modified rodents, cells, embryos, and tissues. Specifically, it relates to rodents whose immunoglobulin heavy chain constant region loci have been genetically modified, and methods for preparing them. The invention also relates to the genome of the modified rodent, cells and tissues containing the genome, and methods and applications for preparing heavy chain antibodies using the rodent. Furthermore, the invention relates to rodents with modified loci. Background Technology

[0002] Traditional methods for constructing heavy chain antibody (also known as heavy chain antibody-only) mice often involve transgenic approaches, such as the "Crescendo Mouse," which removes the CH1 sequence of the IgHG1 gene by linking the recombinant variable region sequence of a human heavy chain. However, this method requires constructing a transgenic vector and then randomly integrating it into the mouse chromosome, which is time-consuming and breeding unstable. It may also damage other genes in the mouse, requiring multiple rounds of selection and breeding to obtain mice with effective and stable heavy chain antibody inheritance. Another example is Regeneron's heavy chain antibody mouse, which deletes the CH1 domain (or CH1 domain and hinge region) of the immunoglobulin γ (IgG) gene. Mice obtained using this method may express homozygous heavy chain antibodies lacking both the CH1 domain and the hinge region, thus hindering the formation of bivalent heavy chain antibodies.

[0003] There is still a need in the field for more mice for the preparation of heavy chain antibodies. Summary of the Invention

[0004] One aspect of the present invention provides a method for preparing genetically modified rodents, the method comprising:

[0005] (a) Knock out the contiguous region between the cleavage receptor signaling sequence upstream of the IgHM gene and the cleavage receptor signaling sequence upstream of the CH1 exon of the IgHG1 gene in the immunoglobulin heavy chain constant region locus of the rodents; and

[0006] (b) Knock out the continuous segment from downstream of the IgHG1 gene to the IgHA gene in the immunoglobulin heavy chain constant region locus of the rodents.

[0007] Wherein, after the knockout, the continuous segment between exon CH1 and exon CH3 of endogenous IgHG1 is retained in the immunoglobulin heavy chain constant region locus of the rodent.

[0008] Furthermore, the rodents do not express the CH1 exon of endogenous IgHG1.

[0009] In some embodiments, the Eμ and Sμ ​​sequences upstream of the endogenous IgHM gene are preserved in the immunoglobulin heavy chain constant region locus of the rodent.

[0010] In some embodiments, the downstream sequence of the endogenous IgHA gene is retained in the immunoglobulin heavy chain constant region locus of the rodent.

[0011] In some embodiments, the rodent's immunoglobulin heavy chain constant region locus retains two transmembrane exon sequences from the endogenous IgHG1 gene.

[0012] In some embodiments, the rodent's immunoglobulin heavy chain constant region locus retains: the Eμ and Sμ ​​sequences upstream of the endogenous IgHM gene; and the downstream sequence of the endogenous IgHA gene.

[0013] In some embodiments, the rodent immunoglobulin heavy chain constant region locus retains: the Eμ and Sμ ​​sequences upstream of the endogenous IgHM gene; the downstream sequence of the endogenous IgHA gene; and the continuous segment from the CH1 exon to the transmembrane exon of endogenous IgHG1.

[0014] In some embodiments, the obtained genetically modified rodents have the endogenous immunoglobulin Kappa light chain locus and the Lambda light chain locus knocked out. This can be achieved in various ways, for example, in some embodiments, the obtained genetically modified rodents are further genetically modified to knock out the endogenous immunoglobulin Kappa light chain locus and the Lambda light chain locus; or in other embodiments, the obtained genetically modified rodents are bred with the same species of rodents whose endogenous immunoglobulin Kappa light chain locus and the Lambda light chain locus have been knocked out, and homozygous rodents containing both heavy chain and light chain loci are screened out. The art knows how to knock out the endogenous immunoglobulin Kappa light chain locus and the Lambda light chain locus (e.g., by homologous recombination or gene editing techniques similar to those used in the embodiments of this invention). The same species of rodents whose endogenous immunoglobulin Kappa light chain locus and the Lambda light chain locus have been knocked out are readily available in the art.

[0015] In some embodiments, the obtained endogenous immunoglobulin heavy chain variable region locus of the genetically modified rodent is replaced with the human immunoglobulin heavy chain variable region locus. This can be achieved in various ways, for example, in some embodiments, by further genetically modifying the obtained genetically modified rodent to replace the endogenous immunoglobulin heavy chain variable region locus with the human immunoglobulin heavy chain variable region locus.

[0016] In some embodiments of the present invention, the replacement of the endogenous immunoglobulin heavy chain variable region locus with the human immunoglobulin heavy chain variable region locus may be performed before or after the knockout of the endogenous immunoglobulin Kappa light chain locus and the Lambda light chain locus.

[0017] In some embodiments of the present invention, the step of knocking out the endogenous immunoglobulin Kappa light chain locus and the Lambda light chain locus may be omitted, and the resulting rodents may still express heavy chain antibodies.

[0018] In some embodiments of the present invention, the step of replacing the endogenous immunoglobulin heavy chain variable region locus with the human immunoglobulin heavy chain variable region locus may be omitted, and the resulting rodents can still express heavy chain antibodies.

[0019] Another aspect of the present invention provides a genetically modified rodent genome comprising a modified immunoglobulin heavy chain locus, wherein the rodent's immunoglobulin heavy chain constant region locus lacks a continuous segment from the splice receptor signal sequence upstream of the IgHM gene to the splice receptor signal sequence upstream of the CH1 exon of the IgHG1 gene, and a continuous segment from the downstream of the IgHG1 gene to the IgHA gene, wherein the rodent's immunoglobulin heavy chain constant region locus includes a continuous segment from the CH1 exon to the CH3 exon of endogenous IgHG1; and the rodent does not express the CH1 exon of endogenous IgHG1.

[0020] In some embodiments, the rodent immunoglobulin heavy chain constant region locus contains Eμ and Sμ ​​sequences upstream of the endogenous IgHM gene.

[0021] In some embodiments, the rodent's immunoglobulin heavy chain constant region locus contains a downstream sequence of the endogenous IgHA gene.

[0022] In some embodiments, the rodent immunoglobulin heavy chain constant region locus contains two transmembrane exon sequences from the endogenous IgHG1 gene.

[0023] In some embodiments, the rodent immunoglobulin heavy chain constant region locus includes Eμ and Sμ ​​sequences upstream of the endogenous IgHM gene; and a downstream sequence of the endogenous IgHA gene.

[0024] In some embodiments, the rodent immunoglobulin heavy chain constant region locus includes the Eμ and Sμ ​​sequences upstream of the endogenous IgHM gene; the downstream sequence of the endogenous IgHA gene; and a continuous segment from the CH1 exon to the transmembrane exon of endogenous IgHG1.

[0025] In some embodiments, the rodent genome lacks the endogenous immunoglobulin Kappa light chain locus and the Lambda light chain locus.

[0026] In some embodiments, the rodent genome lacks the endogenous immunoglobulin heavy chain variable region locus and includes the human immunoglobulin heavy chain variable region locus.

[0027] In some embodiments, the rodent genome lacks the endogenous immunoglobulin Kappa light chain locus and the Lambda light chain locus; and the rodent genome lacks the endogenous immunoglobulin heavy chain variable region locus, but includes the human immunoglobulin heavy chain variable region locus.

[0028] Another aspect of the invention provides a cell, tissue, organ, or rodent comprising the above-described rodent genome.

[0029] In some embodiments, the present invention provides cells comprising the above-described rodent genome, said cells being embryonic cells, B cells, or hybridoma cells.

[0030] In some embodiments, the present invention provides a tissue comprising the above-described rodent genome, said tissue being the white pulp of the spleen or its lymphoid nodules.

[0031] In some embodiments, the present invention provides an organ comprising the above-described rodent genome, said organ being the spleen.

[0032] In some embodiments, the present invention provides rodents comprising the above-described rodent genome.

[0033] Another aspect of the present invention provides a method for preparing a heavy chain antibody or its VHH, the method comprising:

[0034] (a) Immunizing rodents with any of the genomes described in this invention using an antigen;

[0035] (b) Isolating cells from the rodent that contain heavy-chain antibodies against the antigen; and

[0036] (c) Culture the cells to obtain the heavy chain antibody or its VHH.

[0037] In some embodiments, the cells described in step (c) are spleen cells, B cells, or hybridoma cells.

[0038] In some embodiments, the heavy chain antibody has a human heavy chain variable region and does not have a rodent heavy chain variable region. In some embodiments, the heavy chain antibody includes a human heavy chain variable region and a rodent constant region.

[0039] Another aspect of the invention provides the use of any of the cells, tissues, organs or rodents of the invention in the preparation of heavy chain antibodies or their VHHs.

[0040] In some embodiments, the heavy chain antibody has a human heavy chain variable region and does not have a rodent heavy chain variable region. In some embodiments, the heavy chain antibody includes a human heavy chain variable region and a rodent constant region.

[0041] In any of the above embodiments, the rodent may be a rat or a mouse, preferably a mouse.

[0042] This invention knocks out the entire sequence from the SA signal (e.g., 2bp-50bp) upstream of the IGHM gene to the pre-CH1 exon of the IgHG1 gene, and then knocks out the entire sequence downstream of the IgHG1 gene (e.g., from 1bp-2kb to the IgHA gene). This results in the genome retaining the enhancer and switch signals upstream of the IgHM gene but without the SA signal, the complete IgHG1 gene, and all enhancer signals downstream of the IgHA gene. From the 5' end to the 3' end, the genome is sequentially VDJ-IgHG1. After the VDJ rearrangement is completed and it switches to the heavy chain constant region, because the constant region of the IgHG1 gene lacks the SA signal, VDJ directly binds to the hinge region of the IgHG1 gene, thereby producing a heavy chain-only antibody lacking the CH1 structure. This method mimics the way organisms (such as camels) produce nanobodies by not deleting the CH1 structure at the genome but deleting CH1 at the transcriptional level. It can quickly and effectively construct heavy chain antibody rodents (such as mice) by deleting only two fragments. Attached Figure Description

[0043] Figure 1 shows a schematic diagram of the mouse immunoglobulin heavy chain gene locus.

[0044] Figure 2 shows a schematic diagram of the human immunoglobulin heavy chain locus.

[0045] Figure 3 shows a schematic diagram of the heavy chain antibody structure.

[0046] Figure 4 compares the genome splicing of conventional antibodies and heavy chain antibodies in their native state.

[0047] Figure 5 shows the location of each switching signal sequence in the mouse heavy chain constant region locus.

[0048] Figure 6 shows a schematic flowchart of constructing a transgenic mouse according to an embodiment of the present invention.

[0049] Figure 7 shows a PCR diagram for cell identification after electroporation of vector I.

[0050] Figure 8 shows a PCR diagram for cell identification after electroporation of vector II.

[0051] Figure 9 shows the identification map of the F1 generation of mouse 1.

[0052] Figures 10 and 11 show the PCR identification results of the F1 generation of mouse 1.

[0053] Figure 12 shows the normal development of B cells (CD19+) in the spleen tissue of mouse 1.

[0054] Figure 13 shows that the proportion of Igk and Igλ cells in the spleen tissue of mouse 1 is reduced.

[0055] Figure 14 shows that there are almost no IgM type B cells in the spleen tissue of mouse 1.

[0056] Figure 15 shows a comparison photograph of the spleens of mouse 2 and wild-type mouse.

[0057] Figure 16 shows the development of B cells (CD45+CD19+) in the spleen tissue of mouse 2.

[0058] Figure 17 shows that light chains are no longer present in B cells of the spleen tissue of mouse 2.

[0059] Figure 18 shows the frequency distribution of the V gene in mouse 3.

[0060] Figure 19 shows the frequency distribution of the D gene in mouse 3.

[0061] Figure 20 shows the frequency distribution of the J gene in mouse 3.

[0062] Figure 21 shows that the serum titer of mice after immunization 3 is comparable to that of WT mice.

[0063] Figure 22 shows that mouse 3 can produce human antibodies with rich sequence diversity. Detailed Implementation

[0064] definition

[0065] A “continuous segment” refers to a non-discontinuous nucleotide sequence between two specified endpoint genes, including functional genes, pseudogenes, ORFs, and other nucleotide sequences (e.g., spacer sequences) located between the two endpoint genes. The term “continuous segment between A and B” refers to a continuous gene segment including A, B, and the segment in between. The terms “upstream of gene A” or “downstream of gene A” do not include gene A itself.

[0066] "Immunoglobulin heavy chain constant region loci" refer to the loci in the genome that encode the constant regions of the heavy chains of immunoglobulins. In rodents, taking mice as an example, these are located on chromosome 12, and the genes IgHM, IgHD, IgHG3, IgHG1, IgHG2B, IgHG2C, IgHE, and IgHA are arranged from 5' to 3'. A schematic diagram of mouse immunoglobulin heavy chain loci can be obtained from the IMGT database, as shown in Figure 1, which includes the mouse immunoglobulin heavy chain variable region loci and the mouse immunoglobulin heavy chain constant region loci. A schematic diagram of human immunoglobulin heavy chain loci can be obtained from the IMGT database, as shown in Figure 2, which includes the human immunoglobulin heavy chain variable region loci and the human immunoglobulin heavy chain constant region loci.

[0067] B cells undergo class-switching recombination (CSR) so that each B cell expresses only a single class of antibody (excluding M and D classes) at each time point. Figure 5 shows the switching signal sequences at each heavy chain constant region locus in the mouse, namely Sμ, Sγ3, Sγ1, Sγ2b, Sγ2c, Sε, and Sα. The Cγ1 gene contains exons encoding the CH1, Hinge, CH2, and CH3 domains and two transmembrane domains, labeled CH1, H, CH2, CH3, M1, and M2, respectively.

[0068] All introns in structural genes (i.e., genes encoding polypeptides) in the cell nucleus share the common sequence GT…AG at exon-intron junctions. The junction to the left of the intron is called the donor, and the junction to the right is called the acceptor. The “AG” sequence constitutes the “splicing acceptor” (SA) signal sequence. Figure 4 compares the genome splicing of conventional antibodies and heavy chain antibodies in their native state.

[0069] "Heavy chain antibodies" are monoclonal antibodies lacking the CH1 domains of both the light and heavy chains, and are naturally found in the blood of camels or sharks. Figure 3 shows a schematic diagram of the structure of a heavy chain antibody; its variable region is called VHH, a single-domain antibody, or a nanobody. Examples

[0070] Example 1. Construction of transgenic mice

[0071] Figure 6 shows a schematic flowchart of constructing a transgenic mouse according to an embodiment of the present invention.

[0072] 1. Construct two firing platforms:

[0073] Vector I: Homologous arm sequences: Amplified from the mouse genome the 5' arm sequence (5 kb upstream of the IgHM gene, but excluding the SA signal, corresponding to the genomic position: GRCm38 / mm10:chr12:113,422,732-113,427,744) and the 3' arm sequence (IGHG1 gene, corresponding to the genomic position: GRCm38 / mm10:chr12:113,327,888-113,330,523). The vector I map is shown in Figure 6.

[0074] Finally, the homologous arm sequences of Puro, 5'arm, and 3'arm were ligated into the pUC57 backbone via infusion to obtain vector plasmid I.

[0075] Vector II: Homologous arm sequences: The 5' arm sequence (IGHG1 gene, corresponding to the genomic position: GRCm38 / mm10:chr12:113,322,923-113,328,043) and the 3' arm sequence (downstream of the IGHA gene, corresponding to the genomic position: GRCm38 / mm10:chr12:113,249,579-113,254,756) were amplified from the mouse genome. The vector 2 map is shown in Figure 6.

[0076] Finally, the Neo, 5'arm, and 3'arm homologous arm sequences were ligated into the pUC57 backbone via infusion to obtain vector plasmid II.

[0077] 2. Electroporation of ES cells using a vector:

[0078] Vector I and Vector II were sequentially electroporated into wild-type ES cells. Different clones were obtained through cell culture and resistance screening. The clones were then selected for culture and sent for PCR genotyping to obtain the final correct positive clones.

[0079] Cell identification after electroporation of vector I:

[0080] Cell clones selected using two primer pairs were amplified by PCR, and clones 2A1 and 2A4 were confirmed as positive clones.

[0081] PCR identification primers:

[0082] F1(SEQ ID NO.1):aggccagaggccacttgtgtag

[0083] R1(SEQ ID NO.2):gcagcgctgtagcacacactg

[0084] Expected PCR Product:

[0085] Wildtype:NA

[0086] Targeted: 3256bp

[0087] F2(SEQ ID NO.3):atctagccctgcctgccttaaga

[0088] R2(SEQ ID NO.4):ggtgccactcccactgtcctttc

[0089] Expected PCR Product:

[0090] Wildtype:NA

[0091] Targeted: 356bp

[0092] The identification results are shown in Figure 7.

[0093] Detection strategy diagram after carrier II electroporation:

[0094] PCR amplification was performed on selected cell clones using two primer pairs. The identified regions are shown in Figure 7 above. A total of five clones, 1E3-1D4, 1E3-1C7, 1E3-1G8, 1E3-1D10, and 1E3-1B11, were confirmed as positive clones.

[0095] PCR identification primers:

[0096] F3(SEQ ID NO.5):gggcccacaacagcaccattg

[0097] R3(SEQ ID NO.6):tagacctgtggtactgttttctttc

[0098] Expected PCR Product:

[0099] Wildtype:NA

[0100] Targeted: 3287bp

[0101] F4(SEQ ID NO.7):cacattgtcctcatactgtccc

[0102] R4(SEQ ID NO.8):ggtgtcattctattctggggg

[0103] Expected PCR Product:

[0104] Wildtype:NA

[0105] Targeted: 356bp

[0106] The identification results are shown in Figure 8.

[0107] 3. The 1E3-1D4 positive cell clone was transplanted into albino B6 surrogate mice. The surrogate mice gave birth to F0 mice 19-21 days later. The F0 mice had black fur and a chimerism rate of 100%, confirming that the mice were positive F0 mice.

[0108] 4. After raising F0 mice to sexual maturity and mating them with wild-type mice, F1 generation mice were born. When the F1 generation mice were 5-7 days old, their claws were clipped and PCR identification was performed to obtain positive F1 mice.

[0109] Five to seven days after birth, paws of F1 mice were harvested for genotyping, and the genotyping profile is shown in Figure 9. PCR amplification was performed on nine F1 mice using two pairs of primers, confirming that four mice (201#, 212#, 215#, and 216#) were heterozygous.

[0110] Primers for KI1 PCR:

[0111] F5(SEQ ID NO.9):5'-atctagccctgcctgccttaag-3'

[0112] R5(SEQ ID NO.10):5'-cagagttccaggtcactgtcactg-3'

[0113] Internal control PCR primer A1 (SEQ ID NO.11):

[0114] 5'-CTATCAGGGATACTCCTCTTTGCC-3'

[0115] Internal control PCR primer A2 (SEQ ID NO.12):

[0116] 5'-GATACAGGAATGACAAGCTCATGGT-3'

[0117] Expected PCR Product:

[0118] Wildtype:NA

[0119] Targeted: 291bp

[0120] Internal control product size:507bp

[0121] The identification results are shown in Figure 10.

[0122] Primers for wildtype PCR:

[0123] F5(SEQ ID NO.13):5'-atctagccctgcctgccttaag-3'

[0124] R6(SEQ ID NO.14):5'-ctcagtgttgggaaggttctgatac-3'

[0125] Internal control PCR primer A1(SEQ ID NO.15):

[0126] 5'-GCAGAAGAGGACAGATACATTCAT-3'

[0127] Internal control PCR primer A2 (SEQ ID NO.16):

[0128] 5'-CCTACTGAAGAATCTATCCCACAG-3'

[0129] Expected PCR Product:

[0130] Wildtype: 311bp

[0131] Targeted:NA

[0132] Internal control product size:689bp

[0133] The identification results are shown in Figure 11.

[0134] 5. After obtaining heterozygous F1 mice, the heterozygous mice were crossbred to generate homozygous mice (mouse 1). The heavy chain constant region of this mouse was modified to carry only the complete IgHG1 gene (but because the SA splicing signal is lacking before the CH1 domain, CH1 is missing at the RNA level), while the mouse light chain was still present.

[0135] Example 2. Immunophenotypic Analysis

[0136] Spleens were collected from naive mice (model 1). Cells were incubated in a solution containing blocking antibodies (such as Fc Block) to prevent non-specific binding. Fluorescently labeled antibodies were added at the concentration recommended in the antibody manufacturer's instructions. The cells were incubated on ice for 20-30 minutes, avoiding light exposure. Cells were then washed with PBS buffer to remove unbound antibodies. Laser and filter parameters were set to ensure matching with antibody fluorescence. The stained cell samples were then loaded onto the flow cytometer, and fluorescence signals were detected according to the set parameters. Data were acquired using flow cytometry software and saved for analysis.

[0137] Representative flow cytometry immunophenotypic analysis and statistical comparison of B cell classification were performed, and the results are shown in Figures 12, 13, and 14. The results showed that, compared with wild-type WT mice (left figure), B cells (CD19+) in the spleen tissue of homozygous mouse 1 (right figure) developed normally (Figure 12).

[0138] The test results showed that, compared with wild-type WT mice (left figure), the proportion of Igk and Igλ cells in the spleen tissue of homozygous mice 1 (right figure) was reduced, indicating that very few of the B cells that formed antibodies had light chains, that is, most B cells produced antibody structures with only heavy chains (Figure 13).

[0139] The test results showed that, compared with wild-type WT mice (left figure), homozygous mice 1 (right figure) had almost no IgM type B cells in their spleen tissue B cells, and the modified mice no longer produced IgM type antibodies (Figure 14).

[0140] Example 3. Light chain knockout mice and their immunophenotype analysis

[0141] Heavy chain-modified homozygous mice 1 were bred with mice that had their Kappa light chain and Lambda light chain knocked out to generate trigene heterozygous and trigene homozygous mice (mice 2) in turn.

[0142] The spleens of naive mice (2) were collected and photographed, as shown in Figure 15. Comparative observation revealed that the spleens of these mice did not differ significantly in appearance from those of wild-type mice (WT).

[0143] Splenic cells were incubated in a solution containing blocking antibodies (such as Fc Block) to prevent non-specific binding. Fluorescently labeled antibodies were added at the concentration recommended in the antibody's instructions. The cells were incubated on ice for 20-30 minutes, avoiding light exposure. The cells were then washed with PBS buffer to remove unbound antibodies. The laser and filter parameters were set to ensure they matched the antibody fluorescence. The stained cell samples were then loaded onto the flow cytometer, and the fluorescence signal was detected according to the set parameters. Data was acquired using flow cytometry software and saved for analysis.

[0144] Representative flow cytometry immunophenotypic analysis and statistical comparison of B cell classification were performed, and the results are shown in Figures 16 and 17.

[0145] The test results showed that, compared with wild-type WT mice (left figure), B cells (CD45+CD19+) could develop in the spleen tissue of homozygous mice 2 (right figure), but the proportion of B cells was reduced (Figure 16).

[0146] The test results showed that, compared with wild-type WT mice (left figure), the B cells of homozygous mice 2 (right figure) no longer had light chains (Igk positive cells and Igλ cells were missing), which means that the B cells of this mouse only produced heavy chain antibodies (Figure 17).

[0147] Example 4. Construction and characterization of heavy chain humanized mice

[0148] The heavy chain variable region sequence of mouse 2 was replaced with a human variable region sequence, and the mouse heavy chain could generate a humanized variable region sequence, thus obtaining mouse 3: the heavy chain variable region was humanized, the constant region contained only the IgHG1 gene, and the light chain was missing.

[0149] The obtained trigenic mice were euthanized, and their spleens were dissected and RNA was extracted. After the total RNA extracted from the samples passed the test, a library was constructed, followed by immunohisto-seq (immunohisto-seq is a technique that uses B / T lymphocytes as the research target, specifically amplifying the variable region (V region) that determines the diversity of B cell receptor (BCR) or T cell receptor (TCR) using 5' RACE or multiplex PCR technology, combined with high-throughput sequencing technology to comprehensively assess the diversity of the immune system). The sequenced sequences were quality controlled and the sequencing background was filtered using quality control software. Then, they were compared with the V, D, and J genes in the IMGT immune cell receptor library to search for corresponding gene fragments, find the precise V, D, and J gene fragments and sequence sites, and statistically analyze the V, D, and J gene frequencies, clonal frequency distribution, number of polypeptide sequences, and other information. Based on the obtained gene usage frequency data, a gene usage frequency distribution map at the read level was plotted, and the results are shown in Figures 18, 19, and 20.

[0150] The results showed that IgHV43-34 was the most frequently used in reads in unimmunized trigene homozygous mice, followed by IgHV6-1, with the remaining genes decreasing in that order (Figure 18).

[0151] The results showed that in unimmunized homozygous mice, IGHD3-10 had the highest frequency of use at the read level, followed by IGHD1-26, and then IGHD6-19, IGHD3-9, and IGHD6-13, which decreased in that order (Figure 19).

[0152] The results showed that in unimmunized homozygous mice, IGHJ4 had the highest frequency of use at the read level, followed by IGHJ6, and then IGHJ3, IGHJ5, IGHJ2, and IGHJ1 in descending order (Figure 20).

[0153] Example 5. Immunization of mice with fully human heavy chain-only antibodies

[0154] To induce a humoral immune response against PD-L1 in fully human heavy chain antibody-only mice (hereinafter referred to as mice 3), five mice were immunized: HUGO-N87, HUGO-N90, HUGO-N91, HUGO-N92, and HUGO-N94. Three C57BL / 6N wild-type mice served as controls. For the first immunization, mice were subcutaneously injected with a mixture of Freund's complete adjuvant (CFA) and 0.1 mg of Human PD-L1 His protein. Subsequent immunizations were administered subcutaneously with a mixture of Freund's incomplete adjuvant (IFA) and 0.05 mg of PD-L1 His protein. Immunizations were repeated every two weeks for a total of four immunizations, resulting in antigen-specific antibodies in the fully human antibody-only mice. The immunization schedule is shown in the table below. Immunization Schedule

[0155] Serum from mice after the second, third, and fourth immunizations was collected for serum titer monitoring.

[0156] The antigen was coated overnight with CBS (carbonate buffer). After washing with PBST (phosphate-buffered saline), 1% BSA was added to PBS and the mixture was blocked at 37°C for 2 h. After washing with PBST, serum dilution buffer (1:100, 3-fold dilution, 11 gradients) was added and the mixture was reacted at 37°C for 1 h. After washing with PBST, horseradish peroxidase-labeled goat anti-mouse secondary antibody (diluted 1% BSA in PBS at a ratio of 1:10000) was added and the mixture was incubated at 37°C for 0.5 h. After washing with PBST, TMB chromogenic solution (Beyotime, PO209-500 ml) was added for color development at 25°C for 5-10 min. The reaction was terminated by adding stop solution, and the serum titer was detected by optical density measurement at 450 nm. The results are shown in Figure 21. All five mice produced serum titers comparable to those of WT mice.

[0157] HUGO-N90, HUGO-N91, and HUGO-N92 mice with high titers were selected for phage library construction, phage library establishment, and sequence analysis.

[0158] Spleens from mice with the highest titers in the four-immune serum were collected, ground, and the cells were collected. Total RNA was extracted from spleen cells using an RNA extraction kit (Fuji Biotechnology, RE-03011). cDNA was synthesized, and the VHH antibody sequence was amplified using nested PCR. The vector pComb3XSS (Aidi Gene, 63890) and the target fragment were digested and recovered using SfiI enzymes, respectively. The ligation products were electroporated into TG1 competent cells to construct a PD-L1 VHH antibody library. Clones were randomly picked from transformant titer plates for sequencing identification.

[0159] The results, as shown in Figure 22, indicate that the mouse can produce human antibody sequences with rich sequence diversity.

Claims

1. A method for preparing genetically modified rodents, comprising: (a) Knock out the contiguous region between the cleavage receptor signaling sequence upstream of the IgHM gene and the cleavage receptor signaling sequence upstream of the CH1 exon of the IgHG1 gene in the immunoglobulin heavy chain constant region locus of the rodents; and (b) Knock out the continuous segment from downstream of the IgHG1 gene to the IgHA gene in the immunoglobulin heavy chain constant region locus of the rodents. Wherein, after the knockout, the continuous segment between exon CH1 and exon CH3 of endogenous IgHG1 is retained in the immunoglobulin heavy chain constant region locus of the rodent. Furthermore, the rodents do not express the CH1 exon of endogenous IgHG1.

2. The method according to claim 1, wherein the immunoglobulin heavy chain constant region locus of the rodent: (i) Preserve the Eμ and Sμ ​​sequences upstream of the endogenous IgHM gene; and / or (ii) Preserve the downstream sequence of the endogenous IgHA gene; and / or (iii) The two transmembrane exon sequences in the endogenous IgHG1 gene are preserved.

3. The method according to claim 1 or 2, wherein the obtained genetically modified rodent: (i) Knockout of the endogenous immunoglobulin Kappa light chain locus and the Lambda light chain locus; and / or (ii) Replace the endogenous immunoglobulin heavy chain variable region locus with the human immunoglobulin heavy chain variable region locus.

4. The method according to any one of claims 1 to 3, wherein the rodent is a rat or a mouse.

5. A genetically modified rodent genome comprising a modified immunoglobulin heavy chain locus, wherein the rodent's immunoglobulin heavy chain constant region locus lacks a continuous segment from the splice receptor signal sequence upstream of the IgHM gene to the splice receptor signal sequence upstream of the CH1 exon of the IgHG1 gene, and a continuous segment from the IgHG1 gene downstream to the IgHA gene, wherein the rodent's immunoglobulin heavy chain constant region locus includes a continuous segment from the CH1 exon to the CH3 exon of endogenous IgHG1; and the rodent does not express the CH1 exon of endogenous IgHG1.

6. The rodent genome of claim 5, wherein the immunoglobulin heavy chain constant region locus of the rodent comprises: (i) Eμ and Sμ ​​sequences upstream of the endogenous IgHM gene; and / or (ii) Downstream sequences of the endogenous IgHA gene; and / or (iii) Two transmembrane exon sequences in the endogenous IgHG1 gene.

7. The rodent genome according to claim 5 or 6, wherein the rodent genome: (i) Deletion of the endogenous immunoglobulin Kappa light chain locus and the Lambda light chain locus; (ii) The endogenous immunoglobulin heavy chain variable region locus is missing, but the human immunoglobulin heavy chain variable region locus is included.

8. The rodent genome according to any one of claims 5 to 7, wherein the rodent is a rat or a mouse.

9. A cell, tissue, organ, or rodent comprising the rodent genome of any one of claims 5 to 8; preferably, the cell is an embryonic cell, a B cell, or a hybridoma cell; preferably, the tissue is the white pulp of the spleen or its lymph nodes; preferably, the organ is the spleen.

10. A method for preparing a heavy chain antibody or its VHH, comprising: (a) Immunizing a rodent having the genome of any one of claims 5 to 8 with an antigen; (b) Isolating cells from the rodent containing heavy-chain antibodies against the antigen; and (c) Culture the cells to obtain the heavy chain antibody or its VHH; Preferably, the cells are spleen cells, B cells, or hybridoma cells.

11. The use of the cell, tissue, organ, or rodent of claim 9 in the preparation of a heavy chain antibody or its VHH; preferably, the heavy chain antibody has a human heavy chain variable region and does not have a rodent heavy chain variable region; preferably, the heavy chain antibody has a human heavy chain variable region and a rodent constant region.

Images