Chimeric antigen receptor-modified cell drug, preparation method therefor, and use thereof

Abstract

Disclosed are a chimeric antigen receptor-modified cell drug, a preparation method therefor, and use thereof, which belong to the technical field of cell drugs. By means of introducing chimeric antigen receptors targeting B cells and / or plasma cells into ex vivo or in vivo immune cells by means of a gene delivery system, the cell drug is obtained, wherein targets of the targeted B cells and / or plasma cells comprise CD19, BCMA, CD20, CD22, CD38, CD138, GPRC5D, and SLAMF7. The chimeric antigen receptor-modified cell drug, by means of a specific single-chain antibody fragment (scFv), can specifically recognize B cells and / or plasma cells and activate immune cells, and can specifically eliminate B cells in vitro and in vivo, thereby preventing the production of an autoimmune antibody and the formation of an immune complex, achieving the purpose of thoroughly treating a disease, improving the quality of life of patients, and ultimately achieving the cure of the disease, which exhibits great application potential and commercial value.

Description

A chimeric antigen receptor-modified cell drug, its preparation method and application Technical Field

[0001] This invention belongs to the field of cell drug technology, specifically relating to a chimeric antigen receptor modified cell drug, its preparation method, and its application. Background Technology

[0002] The body's immune system is a sophisticated and complex network, comprising immune cells and molecules, that defends against various diseases. Under certain conditions, the homeostasis of the immune system is disrupted, leading to the immune system mistakenly attacking its own normal tissues and organs, thus causing autoimmune diseases (AIDs). The pathogenesis of autoimmune diseases is complex, involving multiple factors such as genetics, environment, and abnormal immune regulation. It is estimated that approximately 5%-10% of the global population is affected by autoimmune diseases, with a significantly higher incidence in women than men, possibly related to differences in sex hormone levels and the immune system. Common autoimmune diseases include systemic lupus erythematosus (SLE), myasthenia gravis (MG), multiple sclerosis (MS), rheumatoid arthritis (RA), and type 1 diabetes. With advancements in diagnostic technology and changes in environmental factors, the incidence of autoimmune diseases is on the rise, placing a significant burden on global public health systems.

[0003] Currently, the treatment of autoimmune diseases mainly relies on immunosuppression and anti-inflammatory therapies to control symptoms and slow disease progression. Commonly used treatments include glucocorticoids, immunosuppressants, and biologics. Glucocorticoids (such as cortisone, prednisone, methylprednisolone, and dexamethasone) have potent anti-inflammatory and immunosuppressive effects and are first-line treatments for many autoimmune diseases. However, long-term use of glucocorticoids can lead to serious side effects, such as changes in body shape, growth retardation in children, osteoporosis, eye damage, cardiovascular disease, metabolic disorders, and increased risk of infection. Immunosuppressants (such as methotrexate, cyclophosphamide, leflunomide, and cyclosporine) reduce the immune response by inhibiting the proliferation and function of immune cells, but their non-specific immunosuppressive effects also cause significant side effects, including bone marrow suppression, liver and kidney damage, and increased risk of infection and tumors. Glucocorticoids and immunosuppressants cause systemic immunosuppression due to their lack of specificity. With the development of biotechnology, drugs are being designed to have higher antigen specificity and reduce adverse reactions. In recent years, biologics (especially monoclonal antibodies) have made significant progress in the treatment of autoimmune diseases. By targeting specific immune molecules or cells, immune responses can be more precisely modulated, improving patients' symptoms and quality of life. Anti-TNF-α drugs (infliximab) have shown good efficacy in rheumatoid arthritis and Crohn's disease. B cells play a crucial role in humoral immunity and have important physiological functions, including antibody production, antigen presentation to T cells, participation in the formation of immune memory, and promotion of immune tolerance. Studies have found that B cells play an important role in the development of autoimmune diseases, and targeting and eliminating B cells can inhibit abnormal immune responses. Various drugs targeting B cells and their activating molecules have been used as treatments for various autoimmune diseases, such as anti-CD20 monoclonal antibodies (rituximab) and B lymphocyte-stimulating factor-specific inhibitors (belimumab). However, biologics cannot restore the patient's immune imbalance and have limitations such as high treatment costs, long-term medication, and potential side effects (e.g., infection, allergic reactions, and immunogenicity), restricting their widespread application. Furthermore, some patients respond poorly to existing treatments or develop drug resistance, making the disease difficult to control.

[0004] Chimeric antigen receptor T cells (CAR-T) are genetically engineered T cells that combine antigen recognition and cell activation domains to form chimeric antigen receptors (CARs). These CARs are then introduced into T cells, enabling them to specifically recognize and bind to specific antigens on the surface of tumor cells. This activates the T cells, triggering an immune response that kills the tumor cells. CAR-T cell therapy targets CD19 and BCMA to eliminate B cells, demonstrating significant efficacy in the clinical treatment of B-cell malignancies (such as ALL, DLBCL, and MCL) and multiple myeloma, with many relapsed / refractory patients achieving long-term remission. Currently, more than 10 CAR-T cell therapies have been approved by the US FDA and China CDE for the treatment of hematological malignancies, transforming the landscape of hematological malignancy treatment.

[0005] In summary, autoimmune diseases are a complex and highly heterogeneous group of conditions, and current treatment methods cannot fully meet clinical needs. Although existing treatments have improved the prognosis of patients with autoimmune diseases to some extent, most of these methods can only alleviate symptoms and cannot cure the disease. Furthermore, long-term use of immunosuppressive drugs and biologics can lead to serious side effects, placing a significant psychological and physical burden on patients. Therefore, developing safe and long-term effective new treatments has become an urgent need in the field of autoimmune disease research. Summary of the Invention

[0006] To address the shortcomings of existing technologies, the present invention aims to propose a chimeric antigen receptor-modified cell drug, its preparation method, and its application. This cell drug can specifically eliminate B cells and / or plasma cells, prevent the production of autoantibodies and the formation of immune complexes, thereby achieving the goal of completely treating diseases.

[0007] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0008] The first aspect of this invention is to provide a method for preparing a chimeric antigen receptor-modified cell drug, comprising the following steps: introducing a chimeric antigen receptor targeting B cells and / or plasma cells into in vitro or in vivo immune cells via a gene delivery system to obtain a cell drug; wherein the targets of the targeted B cells and / or plasma cells include CD19, BCMA, CD20, CD22, CD38, CD138, GPRC5D, and SLAMF7.

[0009] It should be noted that methods for introducing chimeric antigen receptor (CAR) into immune cells in vivo include, but are not limited to, viral vector infection, electroporation transfection (introducing the CAR nucleic acid sequence via an electroporator), transposons, gene knock-in, extracellular vesicles, lipid nanoparticles (LNPs), gold nanoparticles, and chemical reagent transfection. Viral vectors include, but are not limited to, lentiviral vectors, retroviral vectors, adenovirus vectors, and adeno-associated virus vectors. In some embodiments, lentiviral vectors are used, specifically a four-plasmid lentiviral packaging system (lentiviral expression plasmid pRRLSIN-EF1α-CAR 19 carrying the target gene, packaging plasmids pMDLg / pRRE(Kan+) and pRSV-REV(Kan+), and lentiviral envelope plasmid pMD2.G(Kan+) / pCMV-BaEV RLess(Kan+)). In some embodiments, the retroviral vector used is specifically a two-plasmid viral packaging system (a retroviral expression plasmid MSGV-m19BBZ-P2A-EGFP carrying the target gene and a viral packaging plasmid pCL-Eco).

[0010] Preferably, the target of the targeted B cells and / or plasma cells is CD19, BCMA, CD20, or CD22.

[0011] More preferably, the target of the targeted B cells and / or plasma cells is CD19 or BCMA.

[0012] In some embodiments, the chimeric antigen receptor includes a signal peptide, an antigen-binding domain, a hinge region, a transmembrane domain, a co-stimulatory signal transduction region, and a cell activation signal transduction domain.

[0013] The nucleotide sequences of the chimeric antigen receptors are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4, and the amino acid sequences are shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8.

[0014] The nucleotide sequence of the chimeric antigen receptor is a nucleotide sequence having at least 75% homology with the nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4, and the amino acid sequence is an amino acid sequence having at least 75% homology with the amino acid sequences shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8.

[0015] It should be noted that CAR nucleic acid sequences include, but are not limited to, plasmids containing CAR and in vitro transcribed mRNA.

[0016] In some embodiments, the signal peptide includes CD8A, CD4, CD3, CD5, CD19, CD20, CD22, CD28, CD33, CD45, CD80, CD86, GM-CSFR, and PD-L1; wherein the nucleotide sequence of CD8A is shown in SEQ ID NO.9, and the amino acid sequence is shown in SEQ ID NO.10; the nucleotide sequence of GM-CSFR is shown in SEQ ID NO.11, and the amino acid sequence is shown in SEQ ID NO.12.

[0017] Preferably, the signal peptide is CD8A or GM-CSFR.

[0018] In some embodiments, the antigen-binding domain is an antigen-binding fragment Fab, an antigen-binding fragment scFv, a ligand, a receptor, or an antigen that targets B cells and / or plasma cells.

[0019] The antigen-binding fragment Fab or the antigen-binding fragment scFv is selected from at least one of the following: FMC63, HI19α, 4G7, inebilizumab, and tafasitamab targeting CD19; 11D5, FHVH33, 1D12G9, and 19F2 targeting BCMA; rituximab, teimomab, tosimomumab, offatumumab, ozoglucomannan, and atozumab targeting CD20; and epazolizumab, suciraslimab, and RFB4 targeting CD22.

[0020] The nucleotide sequence of the CD19-targeting antigen-binding fragment scFv is as shown in SEQ ID NO.13 or has at least 75% homology with the nucleotide sequence shown in SEQ ID NO.13, and the amino acid sequence is as shown in SEQ ID NO.14 or has at least 75% homology with the amino acid sequence shown in SEQ ID NO.14.

[0021] Preferably, the antigen-binding fragment scFv is composed of VH-Linker-VL or VL-Linker-VH; more preferably, the antigen-binding fragment scFv is composed of VL-Linker-VH.

[0022] In some embodiments, the hinge region is selected from at least one of CD8A, CD28, IgG1, IgG2, and IgG4; wherein the nucleotide sequence of CD8A is shown in SEQ ID NO.15, and its amino acid sequence is shown in SEQ ID NO.16; the nucleotide sequence of CD28 is shown in SEQ ID NO.17, and its amino acid sequence is shown in SEQ ID NO.18.

[0023] In some embodiments, the transmembrane domain is selected from one of CD8A, CD28, CD4, CD3, ICOS, CD5, CD9, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, TCRα, and TCRβ; wherein the nucleotide sequence of CD8A is shown in SEQ ID NO.19, and its amino acid sequence is shown in SEQ ID NO.20; the nucleotide sequence of CD28 is shown in SEQ ID NO.21, and its amino acid sequence is shown in SEQ ID NO.22.

[0024] In some embodiments, the co-stimulatory signal transduction region is the intracellular domain of the co-stimulatory molecule, which is selected from CD27, CD28, 4-1BB (CD137), OX40 (CD134), ICOS (CD278), CD40, lymphocyte function-associated antigen-1 (LFA-1), CD30, CD49a, CD49D, CD49f, CD69, CD84, CD96 (Tactile), CD100 (SEMA4D), CD103, SLAM (SLAMF1, CD150, IPO-3), CD160 (BY5). 5) At least one of the following: SELPLG (CD162), DNAM1 (CD226), Ly9 (CD229), SLAMF4 (CD244, 2B4), CEACAM1, CDS, CRTAM, DAP10, GADS, GITR, HVEM (LIGHTR), IA4, ICAM-1, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, ITGB2, ITGB7, KIRDS2, LAT;

[0025] The nucleotide sequence of 4-1BB is shown in SEQ ID NO.23, and the amino acid sequence is shown in SEQ ID NO.24; the nucleotide sequence of CD28 is shown in SEQ ID NO.25, and the amino acid sequence is shown in SEQ ID NO.26.

[0026] In some embodiments, the cell activation signal transduction domain is selected from at least one of CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d; wherein the nucleotide sequence of CD3ζ is shown in SEQ ID NO.27 and the amino acid sequence is shown in SEQ ID NO.28.

[0027] Preferably, the cell activation signal transduction domain is the intracellular signal transduction domain of CD3, specifically CD3ζ or CD3ε.

[0028] A second aspect of the present invention is to provide a chimeric antigen receptor-modified cell drug, wherein in vivo immune cells include T lymphocytes, NK cells, macrophages, NKT cells, tumor-infiltrating lymphocytes (TILs), lymphokine-activated killer cells (LAKs), and cytokine-induced killer cells (CIKs).

[0029] Preferably, the immune cells in the body are T lymphocytes, NK cells, macrophages, or NKT cells.

[0030] It should be noted that the sources of immune cells in the body include, but are not limited to, peripheral blood, whole blood, apheresis blood, umbilical cord blood, tumor tissue, spleen, bone marrow, monocytes, T lymphocytes, NK cells, NKT lymphocytes, macrophages, induced pluripotent stem cells (iPSCs), hematopoietic stem cells (HPSCs), embryonic stem cells (ESCs), tumor-infiltrating lymphocytes (TILs), lymphokine-activated killer cells (LAKs), and cytokine-induced killer cells (CIKs).

[0031] Among them, T lymphocytes are selected from CD3 + T lymphocytes, CD4 + T cells, CD8 + T cells, naive T cells (TN), stem cell memory T cells (TSCM), effector T cells (TEFF), memory T cells (TM), central memory T cells (TCM), effector memory T cells (TEM), terminally differentiated effector memory T cells (TEMRA), tumor-infiltrating lymphocytes (TIL), iPSC-induced differentiated T cells, immature T cells, mature T cells, helper T cells, cytotoxic T cells, regulatory T cells (Treg), TH1 cells, TH2 cells, TH3 cells, TH17 cells, TH9 cells, TH22 cells, mucosa-associated invariant T cells (MAIT), follicular helper T cells, αβ T cells, γδ T cells; NK cells include, but are not limited to, autologous peripheral blood NK, autologous umbilical cord blood NK, allogeneic peripheral blood NK, allogeneic umbilical cord blood NK, induced pluripotent stem cell (iPS)-induced differentiated NK, NK-92.

[0032] To further explain, the preparation of chimeric antigen receptor-mediated in vivo immune cells (CAR-T cells) includes the following steps:

[0033] S1. Collect peripheral blood from healthy volunteers or patients, centrifuge to obtain autologous plasma and cell pellet; dilute the pelleted cells with physiological saline and add them to centrifuge tubes containing Ficoll solution, separate PBMCs by density gradient centrifugation, and wash the cells twice with physiological saline.

[0034] S2. Take the isolated PBMC cells and add virus solution (MOI of 1-200) and polybrene (final concentration of 1-20 μg / mL);

[0035] S3. Centrifuge for infection and incubate at 37°C in a 5% CO2 incubator. After lentivirus infection, centrifuge and change the medium, resuspend in serum-free cell culture medium, add 1-10% plasma / serum substitute / human AB serum and cytokines (IL-2 and / or IL-15) and continue culture and amplification.

[0036] S2 can be replaced with serum-free cell culture medium containing activators and recombinant cytokines (IL-2 and / or IL-15) to activate PBMCs. Take T cells activated for 24-120h, add virus solution (MOI 1-200) and polybrene (final concentration 1-20μg / mL).

[0037] S2 can also be replaced with serum-free cell culture medium containing activators and recombinant cytokines (IL-2 and / or IL-15) to activate PBMCs. Before infection, cell culture plates are coated with RetroNectin for 2-24 hours, then washed. Virus solution (MOI 1-200) is added, and the cells are centrifuged at 1000-2000×g for 1-2 hours, with or without removing the viral supernatant. T cells activated for 48-96 hours are added to the culture plate along with polybrene (final concentration 0-20 μg / mL).

[0038] Among them, the activators include, but are not limited to, anti-human CD3 / CD28 magnetic beads, anti-human CD3 magnetic beads, anti-human CD3 monoclonal antibody (OKT-3), anti-human CD3 monoclonal antibody and anti-human CD28 monoclonal antibody, and anti-mouse CD3 / CD28 magnetic beads.

[0039] In addition to the above, chimeric antigen receptor-mediated in vivo immune cells (CAR-T cells) can also be prepared by the following steps:

[0040] S1. Collect mouse spleens and isolate splenic cells. Filter the cells using a 100μm cell sieve and lyse erythrocytes. Sort mouse primary T lymphocytes are then isolated using mouse T cell isolation beads (STEMCELL Technologies) and stimulated with CD28 / CD3 beads (Mouse T-activator anti-CD3 / CD28 Dynabeads, Gibco) for 24-96 hours. After centrifugation and washing, the cell density is adjusted to 1-2 × 10⁻⁶ cells / mL. 6 Cells / mL, transferred to 6-well plates, 2 mL / well.

[0041] S2, add the retrovirus MSGV-m19BBZ-P2A-EGFP and the transfection enhancer polybrene (final concentration 0-20 μg / mL).

[0042] S3. Centrifuge for infection at 1500g for 60 min. Incubate at 37℃ in a 5% CO2 incubator. Change the medium 24 h post-infection and incubate the cells at 37℃ in a 5% CO2 incubator.

[0043] To further explain, the preparation of chimeric antigen receptor-mediated in vivo immune cells (CAR-NK cells) includes the following three methods.

[0044] Method 1: Coat culture flasks overnight. Collect peripheral blood from healthy volunteers or patients, centrifuge to obtain autologous plasma and cell pellet; dilute the pelleted cells with physiological saline and add them to centrifuge tubes containing Ficoll solution, separate PBMCs using density gradient centrifugation, and wash the cells twice with physiological saline. Collect monocytes and enrich CD56 using CD56 magnetic beads. + Cells, adjust cell density to 0.5-4×10⁻⁶ 6 NK cells were inoculated into coated culture flasks using a medium containing IL-2, IL-7, IL-15, IL-21, and 1-10% plasma / serum substitute / human AB serum, and cultured at 37°C in a 5% CO2 incubator. After 24-96 hours of culture, NK cells were collected, washed twice, counted, and the cell density was adjusted to 1-2 × 10⁶ cells / mL. 6 Cells / mL were added, along with lentivirus and the transfection enhancer polybrene (final concentration 0-20 μg / mL). Infection was performed by centrifugation at 500-2000g for 60 min. Cells were then incubated at 37°C in a 5% CO2 incubator. The medium was changed 24 h post-infection, and the cells were then incubated at 37°C in a 5% CO2 incubator.

[0045] Method 2: Coat culture flasks overnight in advance. Collect umbilical cord blood, centrifuge to obtain plasma and cell pellet; dilute the pelleted cells with physiological saline and add them to centrifuge tubes containing Ficoll solution, separate CBMCs by density gradient centrifugation, and wash the cells twice with physiological saline. Collect monocytes and enrich CD56 using CD56 magnetic beads. + Cells, adjust cell density to 0.5-4×10⁻⁶ 6 Using a medium containing IL-2, IL-7, IL-15, IL-21, and 1-10% plasma / serum substitute / human AB serum, inoculate into coated culture flasks and incubate at 37°C in a 5% CO2 incubator. Before infection, coat cell culture plates with RetroNectin for 2-24 hours, then wash the plates. Add purified lentiviral solution (MOI 1-200), centrifuge at 500-2000g for 1-2 hours, and remove or leave the viral supernatant. Take NK cells cultured for 48-120 hours and add them to the culture plate, along with polybrene (final concentration 0-20 μg / mL). Incubate at 37°C in a 5% CO2 incubator. 24 hours after lentiviral infection, centrifuge, change the medium, resuspend in serum-free cell culture medium, add 1-10% plasma / serum substitute / human AB serum and cytokines (IL-2 and / or IL-15), and continue culture and amplification.

[0046] Method 3: Coat culture flasks overnight. Collect umbilical cord blood or peripheral blood, centrifuge to obtain plasma and cell pellet; dilute the pelleted cells with physiological saline and add them to centrifuge tubes containing Ficoll solution, then separate mononuclear cells using density gradient centrifugation, washing the cells twice with physiological saline. Collect the mononuclear cells and enrich CD3 using CD3 and CD56 magnetic beads. - CD56 + Cells, adjust cell density to 0.5-4×10⁻⁶ 6 Using a medium containing IL-2, IL-7, IL-15, IL-21, and 1-10% plasma / serum substitute / human AB serum, inoculate into coated culture flasks and incubate at 37°C in a 5% CO2 incubator. Before infection, coat cell culture plates with RetroNectin for 2-24 hours, then wash the plates. Add retroviral solution, centrifuge at 500-2000g for 1-2 hours, and remove or leave the viral supernatant. Take NK cells cultured for 48-120 hours and add them to the culture plate, along with polybrene (final concentration 0-20 μg / mL). Incubate at 37°C in a 5% CO2 incubator. 24 hours after lentiviral infection, centrifuge, change the medium, resuspend in serum-free cell culture medium, add 1-10% plasma / serum substitute / human AB serum and cytokines (IL-2 and / or IL-15), and continue culture and amplification.

[0047] The third aspect of this invention relates to the application of a chimeric antigen receptor-modified cell drug in the preparation of drugs for treating autoimmune diseases, including systemic lupus erythematosus (SLE), lupus nephritis, IgA nephropathy, myasthenia gravis (MG), multiple sclerosis (MS), idiopathic thrombocytopenic purpura (ITP), neuromyelitis optica spectrum disorder (NMOSD), pulmonary alveolar proteinosis (PAP), idiopathic inflammatory myopathy, anti-N-methyl-D-aspartate receptor encephalitis (NMDAR encephalitis), systemic sclerosis, and primary Sjögren's syndrome. Syndrome (pSS), rheumatoid arthritis (RA), granulomatosis with polyangiitis, pemphigus vulgaris, primary sclerosing cholangitis, inflammatory bowel disease (IBD), ankylosing spondylitis (AS), psoriasis, type 1 diabetes, and Crohn's disease.

[0048] The present invention has the following beneficial effects:

[0049] 1. The chimeric antigen receptor-modified cell drug provided by the present invention can specifically recognize B cells and / or plasma cells and activate immune cells through specific single-chain antibody fragments (scFv). It can specifically eliminate B cells in vitro and in vivo, thereby preventing the production of autoantibodies and the formation of immune complexes, and achieving the purpose of completely treating the disease.

[0050] 2. Among the chimeric antigen receptor-modified cell drugs provided by this invention, CAR-T cells can kill B cells of MRL-lpr mice with systemic lupus erythematosus and the Dakiki IgA nephropathy model cell line; CAR-NK cells can specifically eliminate the Dakiki IgA nephropathy model cell line, and the effect is more pronounced than that of CAR-T. NK cells hardly secrete inflammatory factors that cause cytokine release syndrome, thus improving safety. Allogeneic reinfusion does not cause immune rejection and can be performed. It can be developed into a ready-to-use cell injection solution, which improves drug accessibility and is expected to reduce costs.

[0051] 3. The chimeric antigen receptor-modified cell drug provided by this invention can be used in the preparation of drugs for treating autoimmune diseases. It can target and eliminate B cells and / or plasma cells that have a significant impact on the occurrence and development of autoimmune diseases, providing a new strategy for autoimmune diseases. It is expected to provide more effective treatment methods for patients with autoimmune diseases, improve their quality of life and ultimately achieve a cure for the disease. Moreover, it has a wide range of indications and has great application potential and commercial value. Attached Figure Description

[0052] Figure 1 shows the construction of the retrovirus MSGV-m19BBZ-P2A-EGFP as detected by agarose gel electrophoresis;

[0053] Figure 2 shows the plasmid map of the retroviral expression vector MSGV-m19BBZ-P2A-EGFP;

[0054] Figure 3 shows the construction of lentivirus pRRLSIN-EF1α-CAR 19 as detected by agarose gel electrophoresis;

[0055] Figure 4 shows the plasmid map of the lentiviral expression vector pRRLSIN-EF1α-CAR 19;

[0056] Figure 5 shows the CAR positivity rate of mouse CAR-T cells targeting mouse mCD19 as detected by flow cytometry;

[0057] Figure 6 shows the in vitro killing effect of mouse CAR-T cells on B cells of MRL-lpr mice in systemic lupus erythematosus mice as detected by flow cytometry.

[0058] Figure 7 shows the effect of mouse CAR-T cells on the elimination of B cells in MRL-lpr mice of systemic lupus erythematosus as detected by flow cytometry.

[0059] Figure 8 shows the CAR positivity rate and NK phenotype of CAR gene-modified human immune cells CAR-T and CAR-NK as detected by flow cytometry.

[0060] Figure 9 shows the in vitro killing effect of CAR gene-modified human immune cells CAR-T and CAR-NK on human peripheral blood B cells as detected by flow cytometry.

[0061] Figure 10 shows the in vitro killing effect of CAR gene-modified human immune cells CAR-T and CAR-NK on the Dakiki B cell line (IgA nephropathy model cell line) as detected by LDH. Detailed Implementation

[0062] The present invention will now be described in further detail with reference to the accompanying drawings. The embodiments described with reference to the drawings are exemplary and intended to explain the present invention, but should not be construed as limiting the present invention.

[0063] Example 1: Production of retrovirus MSGV-m19BBZ-P2A-EGFP and preparation of mouse CAR-T cells targeting mouse mCD19

[0064] 1. Constructing the retroviral expression vector MSGV-m19BBZ-P2A-EGFP

[0065] The chimeric antigen receptor CAR (m19BBZ) targeting mouse mCD19 consists of a signal peptide, an antigen-binding domain, a hinge region, a transmembrane domain, a co-stimulatory signal transduction region, and a CD3 signal transduction domain linked together. The nucleotide sequence of the CAR is shown in SEQ ID NO.3. It was artificially synthesized by General Biotechnology (Anhui) Co., Ltd., and cloned into... -4Z-64A (in) The recombinant vector pGEM-m19BBZ-64A was constructed by inserting 64 XbaI and EcoRI restriction sites between the EcoRI and NarI restriction sites of -4Z. Using pGEM-m19BBZ-64A as a template and HindIII-m19BBZ-F / SalI-m19BBZ-R as primers (HindIII-m19BBZ-F sequence: CCCAAGCTTGCCACCATGGGTGTCCCTA; SalI-m19BBZ-R sequence: TGCGGTCGACGCGAGGGGCCAGGGTCT), the m19BBZ gene fragment was amplified by PCR. The results are shown in Figure 1A, where lanes 1 and 2 contain the HindIII-m19BBZ-SalI fragment (1450 bp), which is the expected size. The target fragment HindIII-m19BBZ-SalI and the vector MSGV-1D3-28ZAll ITAMs intact-P2A-EGFP (preserved by Guangzhou Anjie Biomedical Technology Co., Ltd.) were digested with HindIII and SalI. The HindIII-m19BBZ-SalI digestion product was directly recovered using a DNA gel extraction kit (US Everbright). The vector MSGV-1D3-28ZAll ITAMs intact-P2A-EGFP digestion product was extracted and recovered after agarose gel electrophoresis. The results are shown in Figure 1B, where lane 1 shows the vector digestion pattern. Two fragments were generated after digestion, with sizes of 6286 bp and 1437 bp, respectively. The band sizes were as expected. The larger band was extracted and recovered using a DNA gel extraction kit (US Everbright). The recovered digestion products were ligated, and the ligation products were transformed into TransStbl3 chemocompetent cells (Beijing TransGen Biotech Co., Ltd.). Ten single colonies were selected and identified by colony PCR (using HindIII-m19BBZ-F / mCD8 Hinge-R as primers; HindIII-m19BBZ-F sequence: CCCAAGCTTGCCACCATGGGTGTCCCTA; mCD8 Hinge-R sequence: AGTTCGCAGCACTGGCTTGGTA). The results are shown in Figure 1C. Clones 1-10 amplified the target bands clearly, indicating they were likely positive clones. After shaking the culture of clone 10, the plasmid was extracted and sequenced, confirming the correct sequence. The retroviral expression vector MSGV-m19BBZ-P2A-EGFP was obtained, and the plasmid map is shown in Figure 2. Plasmid extraction was performed using an endotoxin-free plasmid maxi kit (Omega).The concentration and purity of the extracted plasmid were detected by a UV spectrophotometer and then stored in a -20°C freezer for subsequent retrovirus packaging.

[0066] 2. Production of retrovirus MSGV-m19BBZ-P2A-EGFP

[0067] (1) Resuscitate frozen HEK293T cells and passage them in DMEM complete medium (DMEM medium + 10% FBS). Culture HEK293T cells at a rate of 2.2 × 10⁻⁶ cells / year. 7 Cells were seeded at a density of 15cm in 15cm culture dishes, DMEM complete medium was added, and the cells were cultured overnight to achieve 80-90% confluence before plasmid transfection.

[0068] (2) Add the retroviral packaging plasmids (expression plasmid MSGV-m19BBZ-P2A-EGFP, viral packaging plasmid pCL-Eco) and PEI (polysciences) to serum-free DMEM, mix well, and let stand for 5 min. Add the latter to the former, mix thoroughly, and let stand for 20 min to form a DNA-PEI complex.

[0069] (3) Add the DNA-PEI complex to DMEM medium containing 5% FBS, mix thoroughly, replace the culture medium in the cell culture dish, and incubate at 37°C and 5% CO2.

[0070] (4) 20 h after transfection, discard the cell culture supernatant and add 20 mL of culture medium containing 5% FBSDMEM. Collect the culture supernatant 48 h after transfection, for a total of ~200 mL.

[0071] (5) Filter the collected viral supernatant through a 0.45 μm filter, add 40% PEG8000 solution to a final concentration of 10%, incubate on ice for 3 hours (mixing several times during this period), and centrifuge (4℃, 2000g, 30 min). Resuspend the precipitate in 2 mL of DMEM medium containing 10% FBS. Aliquot and store at -80℃, designated as retrovirus MSGV-m19BBZ-P2A-EGFP.

[0072] 3. Preparation of mouse CAR-T cells targeting mouse mCD19

[0073] (1) Spleen cells were isolated from the spleen of MRL-lpr mice, filtered using a 100μm cell sieve, and erythrocytes were lysed.

[0074] (2) Primary mouse T lymphocytes were sorted using mouse T cell isolation beads (STEMCELL Technologies) and stimulated with CD28 / CD3 beads (Mouse T-activator anti-CD3 / CD28 Dynabeads, Gibco) for 24-96 hours. Cells were then centrifuged, washed, and the cell density adjusted to 1×10⁻⁶. 6 Cells / mL, transferred to 6-well plates, 2 mL / well.

[0075] (3) Add the retrovirus MSGV-m19BBZ-P2A-EGFP and the transfection enhancer polybrene (8 μg / mL). A control group without retrovirus was also set up. Infection was performed by centrifugation at 1500g for 60 min. The cells were then incubated at 37℃ in a 5% CO2 incubator.

[0076] (4) The medium was changed 24 hours after infection, and the cells were cultured in a 37°C, 5% CO2 incubator. CAR expression was detected by flow cytometry 3 days after infection. The results are shown in Figure 5. After retroviral infection of MRL-lpr mouse spleen T cells, CAR expression could be detected by flow cytometry, with a transduction efficiency of approximately 80%.

[0077] Example 2: Production of lentivirus pRRLSIN-EF1α-CAR 19 and preparation of CAR-T and CAR-NK cells targeting human CD19

[0078] 1. Construction of the lentiviral expression vector pRRLSIN-EF1α-CAR 19

[0079] The structure of the chimeric antigen receptor CAR (CAR 19) targeting human CD19 is composed of a signal peptide, an antigen-binding domain, a hinge region, a transmembrane domain, a co-stimulatory signal transduction region, and a CD3 signal transduction domain connected in series. Its nucleotide sequence is shown in SEQ ID NO.1 as the most preferred embodiment. The CAR 19 fragment was transferred between the EcoRI and MIuI restriction sites of the pLVX-EF1α-IRES-puro vector through PCR amplification, restriction enzyme digestion, ligation, transformation, and positive clone screening. Then, EF1α-CAR 19 was cloned between the NheI and MIuI restriction sites of the pRRLSIN vector through PCR amplification, restriction enzyme digestion, ligation, transformation, and positive clone screening to construct pRRLSIN-EF1α-CAR 19. The specific process is as follows: Using pLVX-CMV-CAR 19-T2A-GFP (preserved by Guangzhou Anjie Biomedical Technology Co., Ltd.) as a template, the EcoRI-CAR 19-MIuI fragment was amplified using EcoRI-SP-F / MIuI-CD3-R primers (EcoRI-SP-F sequence: GGAATTCATGGCCTTACCAGTGACC; MIuI-CD3-R sequence: CGACGCGTTTAGCGAGGGGGCAGGGC). The results are shown in Figure 3A, where lane... 1 represents the EcoRI-CAR 19-MIuI fragment. The target fragment EcoRI-CAR 19-MIuI and the vector pLVX-EF1α-CAR(5E5) (preserved by Guangzhou Anjie Biomedical Technology Co., Ltd.) were digested with EcoRI and MIuI enzymes, respectively. The EcoRI-CAR 19-MIuI digestion product was directly recovered, while the pLVX-EF1α-CAR(5E5) digestion product was recovered after agarose gel electrophoresis. The results are shown in Figure 3B, where lane 1 represents the vector digestion pattern. Two fragments were generated after digestion, and the band sizes were as expected. The larger band was extracted and recovered using a DNA gel extraction kit (US Everbright). The recovered digestion products were ligated, and the ligation products were transformed into TransStbl3 chemocompetent cells (Beijing TransGen Biotech Co., Ltd.). Ten single colonies were selected for identification by colony PCR (using CAR 19-F and MIuI-CD3-R as primers; CAR 19-F sequence: AGGAGTCCCATCAAGGTTC; MIuI-CD3-R sequence: CGACGCGTTTAGCGAGGGGGCAGGGC). The results are shown in Figure 3C. Clones 1-10 amplified the target bands and the bands were obvious, indicating that they were likely positive clones. After shaking the culture of clone 1, the plasmid was extracted and sequenced. The sequence was found to be correct, and the pLVX-EF1α-CAR 19 plasmid was obtained.Using pLVX-EF1α-CAR 19 as a template and NheI-EF1α-F / MIuI-CD3-R as primers (NheI-EF1α-F sequence: CTAGCTAGCGCTCCGGTGCCCGTCAGT; MIuI-CD3-R sequence: CGACGCGTTTAGCGAGGGGGCAGGGC), the NheI-EF1α-CAR 19-MIuI fragment was amplified. The results are shown in Figure 3D, where lane 1 is the NheI-EF1α-CAR 19-MIuI fragment. The target fragment NheI-EF1α-CAR 19-MIuI and the vector pRRLSIN-EF1α-CAR(5E5) (preserved by Guangzhou Anjie Biomedical Technology Co., Ltd.) were digested with NheI and MIuI, respectively. The NheI-EF1α-CAR 19-MIuI digestion product was directly recovered, while the pRRLSIN-EF1α-CAR(5E5) digestion product was recovered after agarose gel electrophoresis. The results are shown in Figure 3E, where lane 1 shows the restriction enzyme pattern of the pRRLSIN-EF1α-CAR(5E5) vector. Two fragments were generated after digestion, and the band sizes were as expected. The larger band was extracted and recovered using a DNA gel extraction kit (US Everbright). The recovered digestion products were ligated, and the ligation products were transformed into TransStbl3 chemocompetent cells (Beijing TransGen Biotech Co., Ltd.). Ten single colonies were selected and identified by colony PCR (using CAR 19-F and MIuI-CD3-R as primers; CAR 19F sequence: AGGAGTCCCATCAAGGTTC; MIuI-CD3-R sequence: CGACGCGTTTAGC GAGGGGGCAGGGC). The results are shown in Figure 3F. Clones 1-10 amplified the target bands clearly, indicating they were likely positive clones. After shaking the culture of clone 1, the plasmid was extracted and sequenced, confirming the correct sequence, yielding the pRRLSIN-EF1α-CAR 19 plasmid. The plasmid map is shown in Figure 4. Plasmid extraction was performed using an endotoxin-free plasmid maxi kit (Omega). The concentration and purity of the extracted plasmid were measured using a UV spectrophotometer, and then stored at -20°C for subsequent lentivirus packaging.

[0080] 2. Packaging and purification of lentivirus pRRLSIN-EF1α-CAR 19

[0081] (1) Resuscitate frozen HEK293T cells and passage them in DMEM complete medium (DMEM medium + 10% FBS). Seed HEK293T cells into a 10-layer cell factory, add DMEM complete medium, and culture overnight to allow the cells to reach 80-90% confluence before plasmid transfection.

[0082] (2) Lentiviral packaging plasmids (expression plasmid pRRLSIN-EF1α-CAR 19, lentiviral packaging plasmids pMDLg / pRRE(Kan+) and pRSV-REV(Kan+), lentiviral envelope plasmid pMD2.G(Kan+)) and PEI (polysciences) were added to serum-free DMEM, mixed, and incubated for 5 min. The latter was then added to the former, mixed thoroughly, and incubated for 20 min to form a DNA-PEI complex.

[0083] (3) Add the DNA-PEI complex to 1L of DMEM medium containing 5% FBS, mix thoroughly, replace the culture medium in the 10-layer cell factory, and incubate at 37℃ and 5% CO2.

[0084] (4) Collect the culture supernatant 48h and 72h after transfection and store it in a refrigerator at 2-8℃.

[0085] (5) Mix the collected culture supernatant and remove cells and cell debris using a capsule filter (Sartorius). Pass the clarified lentiviral supernatant through a Spitepure tangential flow filtration system (…). KR2I was concentrated 10–15 times. After filtration through a 0.45 μm filter membrane, it was purified by chromatography.

[0086] (6) The purified lentivirus was sterilized by filtering through a 0.22μm filter (Sartorius), aliquoted, and stored at -80℃. It was named pRRLSIN-EF1α-CAR 19 lentivirus.

[0087] 3. Preparation of CAR-T cells targeting human CD19

[0088] (1) Collect umbilical cord blood or peripheral blood and separate mononuclear cells by density gradient centrifugation.

[0089] (2) Take mononuclear cells and adjust the cell density to 1.5 × 10⁻⁶. 6 The samples were cultured in KBM581 medium containing 1000 IU / mL IL2 and 5-10% plasma, with CD3 / CD28 magnetic beads added for activation, and then incubated at 37°C in a 5% CO2 incubator.

[0090] (3) After 24-96 hours of activation, T cells were collected, washed twice, counted, and the cell density was adjusted to 1×10⁻⁶.6 Cells / mL were added to the culture medium containing lentivirus pRRLSIN-EF1α-CAR 19 and the transfection enhancer polybrene (8 μg / mL). The cells were centrifuged at 500g for 60 min. The cells were then incubated at 37°C in a 5% CO2 incubator.

[0091] (4) Change the medium 24 hours after infection and place the cells in a 37°C, 5% CO2 incubator.

[0092] Meanwhile, a group without lentivirus was set up as a T-cell control group.

[0093] 4. Preparation of CAR-NK cells targeting human CD19

[0094] (1) Collect umbilical cord blood or peripheral blood and separate mononuclear cells by density gradient centrifugation. Coat the culture flasks overnight in advance.

[0095] (2) CD56 was enriched in mononuclear cells by sorting with CD56 magnetic beads. + Cells, adjust cell density to 1.5 × 10⁻⁶ 6 The cells were inoculated into coated culture flasks using KBM581 medium containing 1000 IU / mL IL-2, IL-7, IL-15, IL-21, and 5-10% plasma, and then incubated at 37°C in a 5% CO2 incubator.

[0096] (3) Culture for 24-96 hours, collect NK cells, wash the cells twice and count them, and adjust the cell density to 1×10⁶. 6 The cells / mL were increased with lentivirus pRRLSIN-EF1α-CAR 19 and transfection enhancer polybrene (8 μg / mL).

[0097] (4) Centrifuge infection, 500g, 60min. Incubate at 37℃ in a 5% CO2 incubator.

[0098] (5) Change the medium 24 hours after infection and incubate the cells in a 37°C, 5% CO2 incubator.

[0099] Meanwhile, a control group without lentivirus was set up as the NK cell control group.

[0100] NK cell purity and CAR positivity were detected by flow cytometry on days 3-7 post-infection. The results are shown in the figure. CD3+ in cultured CAR-NK cells... - CD56 +The cell proportion reached ~95% (Figure 8A). After lentivirus infection of human T / NK cells, CAR expression could be detected by flow cytometry with a positive rate of about ~50% (Figure 8A and Figure 8B), indicating that CAR-T cells and CAR-NK cells modified with the CAR gene targeting human CD19 were successfully prepared.

[0101] Experiment 1 examines the in vitro killing effect of mouse CAR-T cells on B cells of systemic lupus erythematosus MRL-lpr and their in vivo clearance effect on B cells.

[0102] 1. In vitro killing effect of mouse CAR-T cells on B cells of systemic lupus erythematosus MRL-lpr

[0103] (1) Spleen cells were isolated from the spleen of MRL-lpr mice, filtered using a 100μm cell sieve, and erythrocytes were lysed. Single-cell suspensions of spleen cells were collected as target cells, and the cells were washed three times by centrifugation with RPMI 1640 medium (serum-free) at 300g for 5min.

[0104] (2) Take some cells and resuspend them in 4 mL of RPMI1640 containing a final concentration of 2 μM CFSE. Incubate at room temperature in the dark for 10 min. Wash the cells three times with RPMI1640 culture medium containing 10% FBS by centrifugation for 5 min at 300 g.

[0105] (3) Collect mouse T cells and CAR-T cells prepared in Example 1 as effector cells. Wash the cells three times with RPMI 1640 medium, 300g, for 5 min. Resuspend the effector cells and target cells, count the number of effector cells and target cells respectively, and prepare co-incubation wells: target cells number 5 × 10⁶. 5 Cells / well, with effector-to-target ratios of 0.4:1 and 1:1, and target cell control wells (NC) were also included.

[0106] (4) The following wells were additionally set up for adjustment and compensation: blank target cells (unstained), isotype control target cells, CFSE-stained target cells, 7-AAD-stained target cells, CD45-stained target cells, CD19-stained target cells, and multi-stained target cells. The cell culture plate was gently tapped to mix and incubated at 37°C in a 5% CO2 incubator. After 15 hours, the cell culture plate was removed from the incubator, and cells from each well were collected to prepare a single-cell suspension. The cells from each well were washed three times with PBS by centrifugation at 300g for 5 minutes.

[0107] (5) Add 7-AAD to the target cells single staining well, target cells multiple staining well, and co-incubation well and incubate at room temperature in the dark for 5 min.

[0108] CD19 levels in each group were detected by flow cytometry. +B cell remnants (i.e., CFSE) + 7-AAD - CD19 in cells + / CD45 + (Cell ratio). The lethality was calculated using the following formula: Lethality (%) = (NC group CD19) / (NC group CD19) + (%) - Experimental group CD19 + (%) / NC group CD19 + (%) × 100%. Results showed that, compared to the NC group and the T cell group, the CAR-T cell group had a higher CD19 content (%). + / CD45 + The cell proportion decreased, and CD19 showed a higher effector-to-target ratio. + / CD45 + The cell ratio decreased more significantly (Figure 6A). At effector-to-target ratios of 0.4 and 1, CAR-T cells showed significantly higher killing efficiency against spleen B cells than T cells. Furthermore, the killing efficiency of the CAR-T group increased with the increase of the effector-to-target ratio (Figure 6B), indicating that mouse CAR-T cells targeting mCD19 can effectively clear B cells from the spleen in vitro in a dose-dependent manner.

[0109] 2. The in vivo B-cell clearance effect of MRL-lpr in systemic lupus erythematosus mice.

[0110] MRL-lpr is an experimental animal model of systemic lupus erythematosus (SLE) and lupus nephritis.

[0111] The mouse T cells and CAR-T cells prepared in Example 1 were injected into MRL-lpr mice via the tail vein, 1×10⁻⁶. 6 Cells / mouse. Blood was collected from the orbital cavity of the mice 7 days later, and the mice were euthanized.

[0112] Detection of CD19 in blood by flow cytometry + B cells were analyzed, and the results showed that, compared with the T cell group, the CAR-T cell group significantly reduced CD19 levels in the blood. + B cells (Figures 7A and 7B) demonstrate that CAR gene-modified T cells targeting mCD19 can significantly eliminate CD19+ B cells in mice.

[0113] Experiment 2 verifies the in vitro cytotoxic effect of CAR gene-modified human immune cells on human B cells.

[0114] 1. CAR gene-modified human immune cells' effect on human peripheral blood CD19 + In vitro cytotoxic effects of B cells

[0115] (1) Human peripheral blood was collected and PBMCs were separated as target cells by density gradient centrifugation. The cells were washed three times with RPMI 1640 medium (serum-free) by centrifugation at 300g for 5 min. A portion of the cells were resuspended in RPMI 1640 medium containing a final concentration of 2 μM CFSE, incubated at room temperature in the dark for 10 min, and then washed three times with RPMI 1640 medium containing 10% FBS by centrifugation at 300g for 5 min.

[0116] (2) Collect human T cells, CAR-T cells, NK cells, and CAR-NK cells prepared in Example 2 as effector cells. Wash the cells three times with RPMI 1640 culture medium, 300g, for 5min. Resuspend the effector cells and target cells, count them separately, and prepare co-incubation wells with effector-to-target ratios of 5, 10, and 20.

[0117] (3) The following wells were also set up for adjustment and compensation: blank target cells (unstained), isotype control target cells, CFSE-stained target cells, 7-AAD-stained target cells, CD45-stained target cells, CD19-stained target cells, and multi-stained target cells. The cell culture plate was gently tapped to mix, and then incubated at 37°C in a 5% CO2 incubator. After 15 hours, the cell culture plate was removed from the incubator, and the cells from each well were collected to prepare a single-cell suspension.

[0118] (3) Wash the cells in each well three times with PBS by centrifugation at 300g for 5 min. Add 7-AAD to the target cell single staining well, target cell multi-staining well, and co-incubation well and incubate at room temperature in the dark for 5 min.

[0119] CD19 levels in each group were detected by flow cytometry. + B cell remnants (i.e., CFSE) + 7-AAD - CD19 in cells + / CD45 + (Cell ratio). The results are shown in Figures 9A and 9B. Compared with the T and NK cell groups, the CD19 ratio in the CAR-T and CAR-NK cell groups was higher. + / CD45 + The significant decrease in the proportion of cells indicates that CAR gene modification of T and NK cells targeting CD19 can effectively eliminate human CD19. + B cells.

[0120] 2. In vitro cytotoxic effect of CAR gene-modified human immune cells on the human B cell line Dakiki

[0121] DAKiKi cells are human B lymphocytes with surface IgA positive cells selected from African nasopharyngeal carcinoma patients and obtained through EBV transformation. They are a model cell line for IgA nephropathy. Using the DakiKi B cell line as the target cell, human T cells, CAR-T cells, NK cells, and CAR-NK cells prepared in Example 2 were used as effector cells. The in vitro cell killing efficiency was detected by the LDH method.

[0122] (1) Effector cells were co-incubated with Dakiki at different effector-to-target ratios (2, 5, 10, 20). Simultaneously, wells were set up for spontaneous LDH release from effector cells, spontaneous LDH release from target cells, maximum LDH release from target cells, volume correction control wells, and culture medium background control wells. All groups were replicated in triplicate, with three replicates per replicate. After centrifuging the culture plates at 300g for 4 min, they were incubated at 37℃ in a 5% CO2 incubator for 6 h.

[0123] (2) Add 10 μL of Lysis Solution (10×) to the target cell maximum LDH release well and the volume correction control well, and incubate for 45 min. Centrifuge the culture plate at 300 g for 4 min.

[0124] (3) Transfer 50 μL of supernatant from each well to a new microplate. Add 50 μL of supernatant to each well. Reagent, incubate at room temperature in the dark for 30 min. Add 50 μL of Stop Solution to each well; puncture large air bubbles with a syringe needle, and measure absorbance at 490 nm or 492 nm within 1 h after adding Stop Solution.

[0125] The killing efficiency was calculated using the following formulas: the accurate values ​​for spontaneous LDH release from effector cells, spontaneous LDH release from target cells, and the experimental group should be the readings minus the background readings in the culture medium; maximum target cell release = maximum LDH release well of target cells - volume correction control well; specific killing efficiency (%) = (experimental group - spontaneous effector cell release - spontaneous target cell release) / (maximum target cell release - spontaneous target cell release). The results are shown in Figure 10. At different effector-to-target ratios, CAR gene modification targeting CD19 enhanced the killing effect of T cells and NK cells on the Dakiki B cell line. At high effector-to-target ratios (10 and 20), CAR-NK cells significantly outperformed CAR-T cells in killing Dakiki cells. At low effector-to-target ratios (2 and 5), CAR-NK cells significantly outperformed NK cells in killing Dakiki cells. However, there was no significant difference in the killing effect of CAR-T and T cells on Dakiki cells. These results indicate that CAR gene modification targeting CD19 can enhance the killing effect of T and NK cells on CD19. + B cells have specific killing effects, and the specific killing effect of CAR-NK is even more pronounced.

[0126] In summary, CAR-T and CAR-NK targeting CD19 can significantly clear CD19 both in vivo and in vitro. + B cells therefore hold promise as a novel treatment strategy for autoimmune diseases such as systemic lupus erythematosus (SLE), lupus nephritis, and IgA nephropathy.

[0127] The above descriptions are merely some embodiments of the present invention. Those skilled in the art can make various modifications and improvements without departing from the inventive concept of the present invention, and these all fall within the scope of protection of the present invention.

Claims

1. A method for preparing a chimeric antigen receptor-modified cell drug, characterized in that, The procedure includes the following steps: introducing chimeric antigen receptors targeting B cells and / or plasma cells into in vitro or in vivo immune cells via a gene delivery system to obtain cellular drugs; wherein the targets of the targeted B cells and / or plasma cells include CD19, BCMA, CD20, CD22, CD38, CD138, GPRC5D, and SLAMF7.

2. The preparation method according to claim 1, characterized in that, The chimeric antigen receptor includes a signal peptide, an antigen-binding domain, a hinge region, a transmembrane domain, a co-stimulatory signal transduction region, and a cell activation signal transduction domain. The nucleotide sequence of the chimeric antigen receptor is shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4, and the amino acid sequence is shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.8; The chimeric antigen receptor has a nucleotide sequence having at least 75% homology with the nucleotide sequences shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3 or SEQ ID NO.4, and an amino acid sequence having at least 75% homology with the amino acid sequences shown in SEQ ID NO.5, SEQ ID NO.6, SEQ ID NO.7 or SEQ ID NO.

8.

3. The preparation method according to claim 2, characterized in that, The signal peptides include CD8A, CD4, CD3, CD5, CD19, CD20, CD22, CD28, CD33, CD45, CD80, CD86, GM-CSFR, and PD-L1; wherein the nucleotide sequence of CD8A is shown in SEQ ID NO.9, and the amino acid sequence is shown in SEQ ID NO.10; the nucleotide sequence of GM-CSFR is shown in SEQ ID NO.11, and the amino acid sequence is shown in SEQ ID NO.

12.

4. The preparation method according to claim 2, characterized in that, The antigen-binding domain is an antigen-binding fragment Fab, an antigen-binding fragment scFv, a ligand, a receptor, or an antigen that targets B cells and / or plasma cells. The antigen-binding fragment Fab or the antigen-binding fragment scFv is selected from at least one of the following: FMC63, HI19α, 4G7, inelizumab, tancituzumab targeting CD19; 11D5, FHVH33, 1D12G9, 19F2 targeting BCMA; rituximab, teimomab, tosimob, ofamumab, ozoglucomancil, atozumab targeting CD20; and epazolizumab, suxilizumab, and RFB4 targeting CD22. The nucleotide sequence of the CD19-targeting antigen-binding fragment scFv is as shown in SEQ ID NO.13 or has at least 75% homology with the nucleotide sequence shown in SEQ ID NO.13, and the amino acid sequence is as shown in SEQ ID NO.14 or has at least 75% homology with the amino acid sequence shown in SEQ ID NO.

14.

5. The preparation method according to claim 2, characterized in that, The hinge region is selected from at least one of CD8A, CD28, IgG1, IgG2, and IgG4; wherein the nucleotide sequence of CD8A is shown in SEQ ID NO.15, and its amino acid sequence is shown in SEQ ID NO.16; the nucleotide sequence of CD28 is shown in SEQ ID NO.17, and its amino acid sequence is shown in SEQ ID NO.

18.

6. The preparation method according to claim 2, characterized in that, The transmembrane domain is selected from one of CD8A, CD28, CD4, CD3, ICOS, CD5, CD9, CD16, CD22, CD33, CD37, CD45, CD64, CD80, CD86, CD134, CD137, CD154, TCRα, and TCRβ; wherein the nucleotide sequence of CD8A is shown in SEQ ID NO.19, and its amino acid sequence is shown in SEQ ID NO.20; the nucleotide sequence of CD28 is shown in SEQ ID NO.21, and its amino acid sequence is shown in SEQ ID NO.

22.

7. The preparation method according to claim 2, characterized in that, The co-stimulatory signal transduction region is the intracellular domain of the co-stimulatory molecule, which is selected from at least one of CD27, CD28, 4-1BB, OX40, ICOS, CD40, lymphocyte function-associated antigen-1, CD30, CD49a, CD49D, CD49f, CD69, CD84, CD96, CD100, CD103, SLAM, CD160, SELPLG, DNAM1, Ly9, SLAMF4, CEACAM1, CDS, CRTAM, DAP10, GADS, GITR, HVEM, IA4, ICAM-1, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB1, ITGB2, ITGB7, KIRDS2, and LAT. The nucleotide sequence of 4-1BB is shown in SEQ ID NO.23, and the amino acid sequence is shown in SEQ ID NO.24; the nucleotide sequence of CD28 is shown in SEQ ID NO.25, and the amino acid sequence is shown in SEQ ID NO.

26.

8. The preparation method according to claim 2, characterized in that, The cell activation signal transduction domain is selected from at least one of CD3ζ, FcRγ, FcRβ, CD3γ, CD3δ, CD3ε, CD5, CD22, CD79a, CD79b, and CD66d; The nucleotide sequence of CD3ζ is shown in SEQ ID NO.27, and the amino acid sequence is shown in SEQ ID NO.

28.

9. A chimeric antigen receptor-modified cell drug prepared by the method according to any one of claims 1-8, characterized in that, The in vivo immune cells include T lymphocytes, NK cells, macrophages, NKT cells, tumor-infiltrating lymphocytes, lymphokine-activated killer cells, and cytokine-induced killer cells.

10. The use of the cell-based drug of claim 9 in the preparation of a drug for treating autoimmune diseases, characterized in that, The autoimmune diseases mentioned include systemic lupus erythematosus, lupus nephritis, IgA nephropathy, myasthenia gravis, multiple sclerosis, idiopathic thrombocytopenic purpura, neuromyelitis optica spectrum disorder, pulmonary alveolar proteinosis, idiopathic inflammatory myopathy, anti-N-methyl-D-aspartate receptor encephalitis, systemic sclerosis, primary Sjögren's syndrome, rheumatoid arthritis, granulomatous polyangiitis, pemphigus vulgaris, primary sclerosing cholangitis, inflammatory bowel disease, ankylosing spondylitis, psoriasis, type 1 diabetes, and Crohn's disease.

Images