Cartilage organoid constructed on basis of DNA-fibroin hybrid hydrogel sustained-release system, method for preparing same, and use thereof

Abstract

The present invention relates to a cartilage organoid constructed on the basis of a DNA-fibroin hybrid hydrogel sustained-release system, a method for preparing same, and use thereof. The DNA-fibroin hybrid hydrogel sustained-release system is a hydrogel system obtained after a pre-mixed solution of the DNA-fibroin hybrid hydrogel sustained-release system is printed by means of a digital light processing system, wherein the pre-mixed solution of the DNA-fibroin hybrid hydrogel sustained-release system comprises DNA, fibroin, an acrylated RGD peptide, an acrylated polyethylene glycol NHS ester, glucosamine, TD-198946, and lithium 2,4,6-trimethylbenzoylphosphate. Compared to the prior art, the glucosamine and TD-198946 introduced into the DNA-fibroin hybrid hydrogel sustained-release system of the present invention can significantly improve the efficiency of promoting the chondrogenic differentiation of bone marrow mesenchymal stem cells. The present invention can be transplanted as a cartilage graft to a cartilage defect site to promote cartilage regeneration and repair.

Description

A cartilage organoid constructed based on a DNA-silk fibroin hybrid hydrogel sustained-release system, its preparation method and application Technical Field

[0001] This invention belongs to the field of biomedical materials technology, and in particular relates to a cartilage organoid constructed based on a DNA-silk fibroin hybrid hydrogel sustained-release system, its preparation method and application. Background Technology

[0002] Osteoarthritis is a common degenerative joint disease characterized by the degeneration of articular cartilage, and is one of the leading causes of disability in adults worldwide. It is estimated that over 500 million people globally suffer from osteoarthritis, imposing a significant economic burden on patients and society. Currently used cartilage repair strategies, including microfractures, autologous cartilage transplantation, and allogeneic cartilage transplantation, while widely applied clinically, all have certain limitations and shortcomings. For example, microfractures may lead to poor defect filling and cartilage fibrosis; autologous cartilage transplantation is limited by donor area and may encounter problems with donor graft incompatibility; allogeneic cartilage transplantation carries risks of immune rejection and infection, and the matching of allogeneic tissue with autologous cartilage is difficult, potentially leading to unbalanced biomechanical load and decreased joint capacity. Therefore, new technologies and methods are urgently needed to solve the challenges of cartilage repair. In recent years, researchers have conducted extensive research on using biomaterials to repair cartilage defects. However, relying solely on biomaterial implantation usually requires a series of processes such as endogenous cell recruitment, proliferation, and matrix secretion, resulting in a long repair cycle. Organoids are derived from stem cells or progenitor cells through directed differentiation. They possess some of the key characteristics, structures, and functions of organs and are capable of self-renewal and self-organization. Compared to biomaterials, cartilage organoids can eliminate the need for endogenous cell recruitment and proliferation in repairing cartilage defects, potentially shortening the cartilage defect repair cycle.

[0003] Currently, the main methods for constructing cartilage organoids include scaffold-free self-organization and co-culture with biomaterials. Compared with scaffold-free self-organization, the addition of biomaterials not only provides a three-dimensional network scaffold similar to the extracellular matrix of chondrocytes, supporting chondrocyte proliferation and maintaining their physiological functions, but also allows for the regulation of organoid structure and size through the design of biomaterials. Previous studies have shown that DNA-silk fibroin hybrid hydrogel microspheres modified with RGD can successfully culture cartilage organoid precursors by loading bone marrow mesenchymal stem cells under 14 days of chondrogenic induction. However, 14 days of induction is insufficient to support the complete synthesis of the extracellular matrix of chondrocytes, making it difficult to form mature cartilage organoids. Furthermore, long-term in vitro culture may lead to gradual dedifferentiation of chondrocytes, exhibiting a fibroblast-like morphology with abnormal ECM deposition, and ultimately developing into a pathological hypertrophic state. Summary of the Invention

[0004] To address the problems existing in the prior art, this invention provides a cartilage organoid constructed based on a DNA-silk fibroin hybrid hydrogel sustained-release system, its preparation method, and its application. The hydrogel sustained-release system can more effectively construct cartilage organoids by continuously supplying drugs that promote the chondrogenic differentiation of bone marrow mesenchymal stem cells over a long period. The cartilage organoids of this invention are prepared by printing bone marrow mesenchymal stem cells using a DNA-silk fibroin hybrid hydrogel sustained-release system and a digital light processing system, followed by in vitro culture for 2-6 weeks.

[0005] The objective of this invention can be specifically achieved through the following technical solutions:

[0006] In a first aspect, the present invention provides a DNA-silk fibroin hybrid hydrogel sustained-release system, wherein the DNA-silk fibroin hybrid hydrogel sustained-release system is a hydrogel system printed by a digital light processing system from a premixed solution of the DNA-silk fibroin hybrid hydrogel sustained-release system.

[0007] The DNA-silk fibroin hybrid hydrogel sustained-release system premix contains DNA, silk fibroin, acrylamide RGD peptide, acrylamide polyethylene glycol NHS ester, glucosamine, TD-198946, and lithium 2,4,6-trimethylbenzoyl phosphate.

[0008] .

[0009] In one embodiment of the present invention, the DNA exists in the form of a DNA supramolecular network structure in the premix of the DNA-silk fibroin hybrid hydrogel sustained-release system. The DNA is composed of Y-type DNA single strands and L-type DNA single strands. There are three Y-type DNA single strands, namely Y1, Y2, and Y3, and the molar ratio of Y1, Y2, and Y3 is 1:1:1. There are two L-type DNA single strands, namely L1 and L2, and the molar ratio of L1 and L2 is 1:1. The molar ratio of Y-type DNA single strands to L-type DNA single strands is 1:1 to 1:2. Y1, Y2, and Y3 each have three sticky ends, and L1 and L2 each have sticky ends at both ends. The sticky ends of the L-type DNA single strands are completely complementary to those of the Y-type DNA single strands.

[0010] In one embodiment of the present invention, the nucleotide sequences of Y1, Y2, Y3, L1, and L2 are shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively.

[0011] In one embodiment of the present invention, the DNA-silk fibroin hybrid hydrogel sustained-release system premix contains DNA at a concentration of 300,000 nM to 1,000,000 nM, silk fibroin at a concentration of 5 to 20 wt%, acrylated RGD peptide at a concentration of 5 to 10 wt%, acrylated polyethylene glycol NHS ester at a concentration of 4.5 to 10 wt%, glucosamine at a concentration of 10 to 20 mM, TD-198946 at a concentration of 100 to 200 nM, and lithium 2,4,6-trimethylbenzoyl phosphate at a concentration of 0.25 to 1 wt%. In one embodiment of the present invention, preferably, the DNA-silk fibroin hybrid hydrogel sustained-release system premix contains DNA at a concentration of 500,000 nM, silk fibroin at a concentration of 10 wt%, acrylated RGD peptide at a concentration of 5 wt%, acrylated polyethylene glycol NHS ester at a concentration of 4.5 wt%, glucosamine at a concentration of 10 mM, TD-198946 at a concentration of 100 nM, and lithium 2,4,6-trimethylbenzoyl phosphate at a concentration of 0.25 wt%.

[0012] In a second aspect, the present invention provides a method for preparing the DNA-silk fibroin hybrid hydrogel sustained-release system of the present invention, the specific steps of which include:

[0013] Step 1, Construction of DNA supramolecular network: Y-type DNA single strands and L-type DNA single strands are mixed in phosphate buffer solution to obtain DNA solution, and a DNA supramolecular network structure is formed through sticky end base complementary pairing;

[0014] Step 2: Preparation of the DNA-silk fibroin hybrid hydrogel sustained-release system:

[0015] Preparation of premix: Methacrylamide silk fibroin, acrylamide RGD peptide, acrylamide polyethylene glycol NHS ester, glucosamine, TD-198946 and lithium 2,4,6-trimethylbenzoyl phosphate were mixed with the DNA solution in step 1 to obtain the DNA-silk fibroin hybrid hydrogel sustained-release system premix.

[0016] Preparation of hydrogel spheres: Hydrogel spheres are formed under ultraviolet light irradiation using digital light processing system technology, which is the final DNA-silk fibroin hybrid hydrogel sustained-release system.

[0017] In one embodiment of the present invention, the concentration of single-stranded DNA in step 1 is 300,000 nM to 10,000,000 nM, preferably 500,000 nM.

[0018] In one embodiment of the present invention, the concentration of silk fibroin dissolved in the DNA solution in step 2 is 5-20 wt%, the concentration of acryloylated RGD peptide is 5-10 wt%, the concentration of acryloylated polyethylene glycol NHS ester is 4.5-10 wt%, the concentration of glucosamine is 10-20 mM, the concentration of TD-198946 is 100-200 nM, and the concentration of 2,4,6-trimethylbenzoyl phosphate lithium is 0.25-1 wt%; preferably, the concentration of silk fibroin is 10 wt%, the concentration of acryloylated RGD peptide is 5 wt%, the concentration of acryloylated polyethylene glycol NHS ester is 4.5 wt%, the concentration of glucosamine is 10 mM, the concentration of TD-198946 is 100 nM, and the concentration of 2,4,6-trimethylbenzoyl phosphate lithium is 0.25 wt%.

[0019] In one embodiment of the present invention, the digital light processing system technology described in step 2 uses ultraviolet light set to a wavelength of 365 nm and a wavelength of 4.0–15.0 mW / cm². -2 The light intensity is such that the particle size of the printed hydrogel spheres is 500–10,000 micrometers.

[0020] More preferably, in the digital light processing system technology described in step 2, the ultraviolet light is set to a wavelength of 365nm and a wavelength of 8.0mW / cm². -2 The light intensity was such that the particle size of the printed hydrogel spheres was 2500 micrometers.

[0021] In a third aspect, this invention provides a cartilage organoid constructed based on a DNA-silk fibroin hybrid hydrogel sustained-release system. The cartilage organoid is prepared by printing the DNA-silk fibroin hybrid hydrogel sustained-release system and bone marrow mesenchymal stem cells using a digital light processing system, followed by in vitro culture for 2-6 weeks. Specific steps include:

[0022] Step 1, Preparation of bio-ink: The premixed solution of the DNA-silk fibroin hybrid hydrogel sustained-release system is mixed with bone marrow mesenchymal stem cells at a ratio of (1-10)×10⁻⁶. 6 Mix the cells / mL solution to obtain the bio-ink;

[0023] Step 2, Preparation of cartilage organoids: Using digital light processing system technology, bio-ink is formed into 3D bioprinted spheres under ultraviolet light irradiation. The 3D bioprinted spheres are continuously cultured in vitro in cartilage induction medium for 2-6 weeks to obtain cartilage organoids.

[0024] Furthermore, in the digital light processing system technology described in step 2, the ultraviolet light is set to a wavelength of 365nm and a wavelength of 4.0–15.0mW / cm². -2 The light intensity is such that the particle size of the printed hydrogel spheres is 500-10000 micrometers.

[0025] More preferably, in step 2, the hydrogel spheres are cultured in vitro for 4 weeks using a cartilage-inducing medium.

[0026] In a fourth aspect, the present invention provides an application of the cartilage organoid constructed based on the DNA-silk fibroin hybrid hydrogel sustained-release system described herein, selected from one of the following applications:

[0027] (1) Used to prepare cartilage tissue repair materials;

[0028] (2) Used for drug screening;

[0029] (3) Used for disease model construction.

[0030] In a fifth aspect, the present invention provides an application of the DNA-silk fibroin hybrid hydrogel sustained-release system described herein, selected from one of the following applications:

[0031] (1) Cell culture;

[0032] (2) Organizational structure construction;

[0033] (3) Organoid construction.

[0034] The DNA-silk fibroin hybrid hydrogel can sustainably promote the chondrogenic differentiation of bone marrow mesenchymal stem cells, enhance the efficiency of extracellular matrix synthesis in chondrocytes, and prevent dedifferentiation and hypertrophy of bone marrow mesenchymal stem cells during long-term differentiation. This technology holds promise for the construction of long-term cultured, mature cartilage organoids.

[0035] This application is based on the above-mentioned inventive concept.

[0036] Glucosamine is a component of the cartilage matrix and a precursor for the synthesis of glycosaminoglycans (such as hyaluronic acid, chondroitin sulfate, and dermatan sulfate) and proteoglycans. It not only stimulates bone marrow mesenchymal stem cells to generate an extracellular matrix more closely resembling natural cartilage but also maintains the stability of chondrocytes and the extracellular matrix within the cartilage cells. In a three-dimensional culture system, with cell proliferation and changes in the matrix, local mechanical tension induces dedifferentiation and hypertrophy of bone marrow mesenchymal stem cells.

[0037] TD-198946, a thienozoazole derivative, is a highly effective chondrogenic agent. Compared to other chondrogenic agents, TD-198946 not only promotes hyaline cartilage differentiation from bone marrow mesenchymal stem cells but also inhibits their hypertrophy and dedifferentiation. However, simply encapsulating the drug in a hydrogel can easily lead to burst release problems. Drug chemografting into hydrogels is a common strategy to avoid burst release. Currently used drug chemografting methods include covalent grafting, molecular imprinting, self-assembly, and click chemistry. Compared to other methods, covalent grafting offers higher stability, targeting, and controlled drug release.

[0038] Acrylated polyethylene glycol (NHS) ester is a bifunctional covalent crosslinking agent for esterification reactions. Its NHS ester functional group can react with the amino groups on glucosamine and TD-198946, while its acrylate group at the other end can react with SilMA. Therefore, covalent grafting of glucosamine and TD-198946 onto a silk fibroin hydrogel network can be achieved using acrylated polyethylene glycol (NHS) ester. Thus, by covalently anchoring glucosamine and TD-198946 to a DNA-silk fibroin hybrid hydrogel using acrylated polyethylene glycol (NHS) ester, continuous nutrient supply can be achieved for the long-term culture of cartilage organoids.

[0039] In this invention, the DNA network in the DNA-silk fibroin hybrid hydrogel sustained-release system is formed by single-stranded DNA through base complementarity pairing. The system primarily uses a DNA-silk fibroin hybrid hydrogel, with two drugs (glucosamine and TD-198946) covalently anchored to the hydrogel network via acrylylated polyethylene glycol NHS ester. The introduction of glucosamine promotes the synthesis of extracellular matrix in chondrocytes, while the introduction of TD-198946 promotes chondrogenic differentiation of bone marrow mesenchymal stem cells (BMSCs). Acrylylated RGD peptide provides cell adhesion sites. This hydrogel sustained-release system enables long-term culture of BMSCs by continuously releasing drugs that support chondrogenic differentiation. Using this system, BMSCs can be cultured in vitro for 2 to 6 weeks to prepare cartilage organoids that can efficiently repair cartilage defects, providing a new therapeutic strategy for cartilage defect repair.

[0040] Compared with the prior art, the present invention has the following advantages:

[0041] Firstly, in the DNA-silk fibroin hybrid hydrogel sustained-release system described in this invention, the NHS ester functional group of acrylamide polyethylene glycol NHS ester can react with the amino groups on glucosamine and TD-198946, while the acrylate group at the other end can react with SilMA, covalently anchoring glucosamine and TD-198946 to the DNA-silk fibroin hybrid hydrogel, thereby achieving continuous nutrient supply.

[0042] Secondly, the glucosamine and TD-198946 introduced into the DNA-silk fibroin hybrid hydrogel sustained-release system described in this invention can significantly improve the efficiency of promoting chondrogenic differentiation of bone marrow mesenchymal stem cells.

[0043] Thirdly, this invention can be used as a cartilage graft to transplant to cartilage defects to promote cartilage regeneration and repair. Attached Figure Description

[0044] Figure 1. Flowchart of the preparation process of the DNA-silk fibroin hybrid hydrogel sustained-release system obtained in Example 1 of the present invention.

[0045] Figure 2. Physical image of the DNA-silk fibroin hybrid hydrogel sustained-release system prepared in Example 1 of the present invention.

[0046] Figure 3. Scanning electron microscope image of the DNA-silk fibroin hybrid hydrogel sustained-release system prepared in Example 2 of the present invention.

[0047] Figure 4. Swelling curve of the DNA-silk fibroin hybrid hydrogel sustained-release system prepared in Example 2 of the present invention in phosphate buffer solution.

[0048] Figure 5. Degradation curve of the DNA-silk fibroin hybrid hydrogel sustained-release system prepared in Example 2 of the present invention in complete cell culture medium.

[0049] Figure 6. Drug release curve of the DNA-silk fibroin hybrid hydrogel sustained-release system prepared in Example 2 of the present invention in phosphate buffer solution.

[0050] Figure 7. Flowchart of the preparation process of the 3D bioprinted spheres obtained in Example 1 of the present invention.

[0051] Figure 8. Cell viability staining results of bone marrow mesenchymal stem cells co-cultured with 3D bioprinted spheres in Example 3 of the present invention.

[0052] Figure 9. Cytoskeleton staining results of bone marrow mesenchymal stem cells in 3D bioprinted spheres in Example 3 of the present invention.

[0053] Figure 10. Alcian blue staining results of bone marrow mesenchymal stem cells co-cultured with 3D bioprinted spheres in Example 3 of the present invention.

[0054] Figure 11. Macroscopic, HE, Alcian Blue, Safranin-Fibrin-Green and immunostaining results of cartilage organoids constructed using the DNA-Silk Fibroin hybrid hydrogel sustained-release system at different culture stages in Example 4 of the present invention.

[0055] Figure 12. Macroscopic observation of the application of DNA-silk fibroin hybrid hydrogel sustained-release system and cartilage repair of cartilage organoids in Example 5 of the present invention. Detailed Implementation

[0056] The present invention will now be described in detail with reference to the accompanying drawings and specific embodiments.

[0057] The following embodiments will help those skilled in the art to further understand the present invention, but do not limit the invention in any way. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention. These all fall within the scope of protection of the present invention.

[0058] To accomplish the purpose of this invention, the experimental reagents, materials, or instruments used in the embodiments were all purchased from commercially available products unless otherwise specified.

[0059] Example 1

[0060] The preparation of the DNA-silk fibroin hybrid hydrogel sustained-release system includes the following steps:

[0061] Step 1, Construction of DNA supramolecular network:

[0062] Mixed DNA single strands: Y-type DNA single strands and L-type DNA single strands are mixed in a pH 7.4 phosphate buffer solution at 37°C. The total molar concentration of Y-type DNA single strands and L-type DNA single strands is 500,000 nM to obtain a DNA solution in which the Y-type DNA single strands and L-type DNA single strands form a DNA supramolecular network structure through complementary base pairing at sticky ends.

[0063] There are three Y-type DNA single strands, namely Y1, Y2, and Y3, and the molar ratio of Y1, Y2, and Y3 is 1:1:1; there are two L-type DNA single strands, namely L1 and L2, and the molar ratio of L1 and L2 is 1:1; in this embodiment, the molar ratio of Y-type DNA single strands to L-type DNA single strands is 1:1.

[0064] The nucleotide sequences of Y1, Y2, Y3, L1, and L2 are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively.

[0065] The nucleotide sequences of the Y-type and L-type DNA single strands are as follows:

[0066] Single-stranded ssDNA sequence (5' to 3') length (nt)

[0067] Y1 CTTACGACGCACAAGGAGATCATGAGTAACTGGACACTT(SEQ ID NO.1)

[0068] Y2 CTTACGACGCACAAGGAGATCATGAGTAACTGGACACTT(SEQ ID NO.2)

[0069] Y3 CTCATGATCTCCTTTAGGCAGACAGGTAACTGGACACTT(SEQ ID NO.3)

[0070] L1 CTACGGTGAATGGAATTCTCATGCGAATAGAAAGTGTCCAGTTA

[0071] (SEQ ID NO.4)

[0072] L2 TCTATTCGCATGAGAATTCCATTCACCGTAGAAGTGTCCAGTTA

[0073] (SEQ ID NO.5)

[0074] Step 2, Preparation of DNA-Silk Fibroin Hybrid Hydrogel Sustained-Release System and 3D Bioprinted Spheres

[0075] (1) Preparation of premix: Silk fibroin (methacrylamide silk fibroin, SilMA), acrylamide RGD peptide (Pep-RGDfKAC), acrylamide polyethylene glycol NHS ester (AC-PEG-NHS), glucosamine, TD-198946, lithium 2,4,6-trimethylbenzoyl phosphate and the DNA solution in step 1 were mixed to obtain the DNA-silk fibroin hybrid hydrogel sustained release system premix. The concentrations of each substance in the DNA-silk fibroin hybrid hydrogel sustained release system premix were: 10 wt% silk fibroin, 5 wt% acrylamide RGD peptide, 4.5 wt% acrylamide polyethylene glycol NHS ester, 10 mM glucosamine, 100 nM TD-198946, and 0.25 wt% lithium 2,4,6-trimethylbenzoyl phosphate.

[0076] (2) Preparation of the DNA-silk fibroin hybrid hydrogel sustained-release system: A digital light processing system (existing technology; in this embodiment, the EFL-BP8601Pro is used. The specific processing method involves adding the premixed solution to the machine tank and printing according to the parameters set below) was employed. For the DNA-silk fibroin hybrid hydrogel sustained-release system premixed solution obtained in the above steps, the ultraviolet light was set to a wavelength of 365 nm and a wavelength of 8.0 mW cm⁻¹. -2 The light intensity was such that the particle size of the printed hydrogel spheres was 2500 micrometers.

[0077] (3) Construction of 3D bioprinted spheres: Based on the DNA-silk fibroin hybrid hydrogel sustained-release system premix obtained in Example 1, bone marrow mesenchymal stem cells were printed at a concentration of 1×10⁻⁶. 6Cells / mL were mixed with the premixed solution of the DNA-silk fibroin hybrid hydrogel sustained-release system, and the ultraviolet light was set to 365nm wavelength and 8.0mW cm⁻¹ using a digital light processing system. -2 The light intensity is such that the particle size of the 3D bioprinted spheres is 2500 micrometers.

[0078] The flowchart for preparing the DNA-silk fibroin hybrid hydrogel sustained-release system in this embodiment is shown in Figure 1. In Figure 1, the Y-scaffold is a Y-type DNA single strand, and the Linker is an L-type DNA single strand. The physical image of the DNA-silk fibroin hybrid hydrogel sustained-release system is shown in Figure 2. As can be seen from the figure, the DNA-silk fibroin hybrid hydrogel sustained-release system printed by the digital light processing system has a smooth surface and a complete shape.

[0079] Example 2

[0080] This embodiment primarily examines whether the material properties of the DNA-silk fibroin hybrid hydrogel sustained-release system can support the long-term culture of cartilage organoids.

[0081] The hydrogel spheres obtained in step (2) of Example 1 above were used as the DNA-silk fibroin hybrid hydrogel sustained-release system in this example. Figure 3 is a scanning electron microscope image of the DNA-silk fibroin hybrid hydrogel sustained-release system of Example 2. It can be seen from the figure that it has a porous structure, which is conducive to the transport of cellular nutrients and the discharge of metabolic waste, as well as cell adhesion.

[0082] Figure 4 shows the swelling curve of the DNA-silk fibroin hybrid hydrogel sustained-release system, which demonstrates its good swelling properties and suitability for long-term 3D cell culture.

[0083] Figure 5 shows the degradation curve of the DNA-silk fibroin hybrid hydrogel sustained-release system in complete cell culture medium. The figure shows that after 6 weeks, more than 40% of the DNA-silk fibroin hybrid hydrogel sustained-release system remained. This moderate degradation rate provides favorable conditions for the growth of cartilage organoids, ensuring that the hydrogel can support cell growth and tissue construction during cell expansion while gradually degrading during long-term culture without affecting cartilage tissue growth.

[0084] Figure 6 shows the drug release curves of glucosamine and TD-198946 in the DNA-silk fibroin hybrid hydrogel sustained-release system. As can be seen from the figure, the DNA-silk fibroin hybrid hydrogel sustained-release system can support the continuous release of drugs for up to 4 weeks.

[0085] Example 3

[0086] The 3D bioprinted sphere obtained in step (3) of Example 1 is used as the research object of this example.

[0087] Figure 7 is a flowchart of step 2 (3) of Example 1, which involves the preparation of 3D bioprinted spheres. To investigate the effect of the DNA-silk fibroin hybrid hydrogel sustained-release system on the behavior of bone marrow mesenchymal stem cells, the obtained 3D bioprinted spheres and the cells co-cultured with them were incubated at 37°C in the dark for 15 minutes using a cell live / dead staining kit, where green represents live cells and red represents dead cells. The experimental results are shown in Figure 8. As can be seen from Figure 8, the DNA-silk fibroin hybrid hydrogel sustained-release system has good cell compatibility.

[0088] Bone marrow mesenchymal stem cells (BMSCs) cultured in 3D bioprinted spheres were fixed with a universal tissue fixative one day after culture. The cells were then stained using a microfilament scaffold staining reagent labeled with phalloidin at room temperature in the dark for 30 minutes. The results are shown in Figure 9, indicating that BMSCs exhibited good spreading performance in the DNA-silk fibroin hybrid hydrogel sustained-release system. The 3D bioprinted spheres containing BMSCs were co-cultured for chondrogenesis induction for 7 days (7D) and 14 days (14D). The cells were then fixed with a universal tissue fixative and stained with Alixin Blue dye for 30 minutes. The results are shown in Figure 10, indicating a significant positive staining signal, demonstrating that the DNA-silk fibroin hybrid hydrogel sustained-release system significantly promotes chondrogenesis differentiation of BMSCs.

[0089] Example 4

[0090] The 3D bioprinted sphere obtained in step (3) of Example 1 is used as the research object of this example.

[0091] 3D bioprinted spheres were cultured in cartilage-inducing medium for up to 6 weeks to construct cartilage organoids. The cartilage organoids at different culture time points were photographed to observe their macroscopic morphology. The cartilage organoids at different culture time points were then paraffin-embedded and sectioned, and stained with hematoxylin and eosin (HE), safranin-fast green, and alicin blue. Finally, the cartilage organoids at different culture time points were fixed using a universal tissue fixative, permeabilized with rapid permeabilization solution for 10 minutes, blocked with 10% normal goat serum at room temperature for 2 hours, and incubated overnight at 4°C with primary antibody solutions diluted 1:200–1:1000. The next day, the primary antibody was washed off, and secondary antibody solutions diluted 1:500 and microfilament backbone staining reagent labeled with phalloidin were added. The mixture was incubated at room temperature in the dark for 1 hour. Finally, a DAPI-containing anti-fluorescence quenching mounting medium was added for immunofluorescence staining of ACAN, COL II (cartilage marker), COL I (fibrosis marker), and COL X (hypertrophy marker). The experimental results are shown in Figure 11. HE staining results indicate that bone marrow mesenchymal stem cells formed tissue-like structures in the hydrogel at weeks 2 and 4. However, by week 6, vacuoles caused by partial cell apoptosis appeared inside the hydrogel. Alixin blue staining results showed that the staining signal of the cartilage organoids cultured for 4 weeks was the strongest compared to weeks 2 and 6, indicating that the glycosaminoglycan content in the cartilage organoids cultured for 4 weeks was the highest. Safranin-Fix-Green staining results showed that the cartilage organoids cultured for 2, 4, and 6 weeks all exhibited the characteristic red staining of cartilage, further confirming the effective formation of cartilage organoids. Compared to weeks 2 and 6, the staining signal was strongest at week 4, further indicating that the phenotype of the cartilage organoids at week 4 was closest to that of natural cartilage. Immunofluorescence staining results showed that the cartilage indices of the cartilage organoids cultured for 4 weeks were highly expressed while maintaining low fibrosis and hypertrophy indices. This suggests that the 4-week culture period may be the optimal period for cartilage organoid development, exhibiting the most promising cartilage phenotype.

[0092] Example 5

[0093] (1) Construction of a rat cartilage defect model: SD male rats aged 6-7 weeks (weighing about 200g) were taken, and after general anesthesia, the joint capsule was cut to expose the intercondylar fossa of the distal femur. A cartilage defect with a diameter of 2mm and a depth of 1.5mm was constructed in the center using a punch.

[0094] (2) Repair of cartilage defects using a DNA-silk fibroin hybrid hydrogel sustained-release system (DSRGT, i.e., the hydrogel spheres without bone marrow mesenchymal stem cells obtained in step (2) of Example 1) and cartilage organoids cultured for 4 weeks (Or, i.e., 3D bioprinted spheres containing bone marrow mesenchymal stem cells obtained in step (3) of Example 1, cultured in cartilage induction medium for 4 weeks): The above materials were transplanted into the cartilage defects, the surface was sprayed with fibrin glue for fixation, and then the rats were sutured layer by layer. The Sham group was the sham surgery group, and the Control group was the group that did not receive treatment. The rats were fed normally after surgery, and the rats were sacrificed after 8 weeks to analyze the repair effect.

[0095] This embodiment mainly investigates the repair effect of DNA-silk fibroin hybrid hydrogel sustained-release system and cartilage organoids on cartilage defects. Figure 12 shows the gross observation of femurs in each group of animals at week 8 of the experiment. Compared with the control group and the DNA-silk fibroin hybrid hydrogel sustained-release system group, the cartilage organoid group showed almost no cartilage defects, which was closest to the sham surgery group. The results show that cartilage organoids can promote rapid regeneration and repair of cartilage.

[0096] The above description of the embodiments is provided to enable those skilled in the art to understand and use the invention. It will be apparent to those skilled in the art that various modifications can be made to these embodiments, and the general principles described herein can be applied to other embodiments without inventive effort. Therefore, the present invention is not limited to the above embodiments, and any improvements and modifications made by those skilled in the art based on the disclosure of the present invention without departing from the scope of the invention should be within the protection scope of the present invention.

Claims

1. A DNA-silk fibroin hybrid hydrogel sustained-release system, characterized in that, The DNA-silk fibroin hybrid hydrogel sustained-release system is a hydrogel system printed by a digital light processing system from a premixed solution of the DNA-silk fibroin hybrid hydrogel sustained-release system. The DNA-silk fibroin hybrid hydrogel sustained-release system premix contains DNA, silk fibroin, acrylamide RGD peptide, acrylamide polyethylene glycol NHS ester, glucosamine, TD-198946, and lithium 2,4,6-trimethylbenzoyl phosphate.

2. The DNA-silk fibroin hybrid hydrogel sustained-release system according to claim 1, characterized in that, The DNA exists in the form of a DNA supramolecular network structure in the premix of the DNA-silk fibroin hybrid hydrogel sustained-release system. The DNA consists of Y-type DNA single strands and L-type DNA single strands. There are three Y-type DNA single strands, namely Y1, Y2, and Y3, and the molar ratio of Y1, Y2, and Y3 is 1:1:

1. There are two L-type DNA single strands, namely L1 and L2, and the molar ratio of L1 and L2 is 1:

1. The molar ratio of Y-type DNA single strands to L-type DNA single strands is 1:1 to 1:

2. Y1, Y2, and Y3 each have three sticky ends, and L1 and L2 each have sticky ends at both ends. The sticky ends of the L-type DNA single strands are completely complementary to those of the Y-type DNA single strands. The nucleotide sequences of Y1, Y2, Y3, L1, and L2 are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively.

3. The DNA-silk fibroin hybrid hydrogel sustained-release system according to claim 1, characterized in that, The premix of the DNA-silk fibroin hybrid hydrogel sustained-release system contains DNA at a concentration of 300,000 nM to 1,000,000 nM, silk fibroin at a concentration of 5 to 20 wt%, acrylated RGD peptide at a concentration of 5 to 10 wt%, acrylated polyethylene glycol NHS ester at a concentration of 4.5 to 10 wt%, glucosamine at a concentration of 10 to 20 mM, TD-198946 at a concentration of 100 to 200 nM, and lithium 2,4,6-trimethylbenzoyl phosphate at a concentration of 0.25 to 1 wt%.

4. The method for preparing the DNA-silk fibroin hybrid hydrogel sustained-release system according to any one of claims 1-3, characterized in that, The specific steps include: Step 1, Construction of DNA supramolecular network: Y-type DNA single strands and L-type DNA single strands are mixed in phosphate buffer solution to obtain DNA solution, and a DNA supramolecular network structure is formed through sticky end base complementary pairing; Step 2: Preparation of the DNA-silk fibroin hybrid hydrogel sustained-release system: Preparation of premix: Methacrylamide silk fibroin, acrylamide RGD peptide, acrylamide polyethylene glycol NHS ester, glucosamine, TD-198946 and lithium 2,4,6-trimethylbenzoyl phosphate were mixed with the DNA solution in step 1 to obtain the DNA-silk fibroin hybrid hydrogel sustained-release system premix. Preparation of hydrogel spheres: Hydrogel spheres are formed under ultraviolet light irradiation using digital light processing system technology, which is the final DNA-silk fibroin hybrid hydrogel sustained-release system.

5. The method for preparing the DNA-silk fibroin hybrid hydrogel sustained-release system according to claim 4, characterized in that, The digital light processing system technology described in step 2 uses ultraviolet light set to a wavelength of 365nm and a wavelength of 4.0–15.0mW / cm². -2 The light intensity is such that the particle size of the printed hydrogel spheres is 500-10000 micrometers.

6. A cartilaginous organoid constructed based on a DNA-silk fibroin hybrid hydrogel sustained-release system, characterized in that, The cartilage organoids are prepared by printing the DNA-silk fibroin hybrid hydrogel sustained-release system and bone marrow mesenchymal stem cells described in any one of claims 1-3 using a digital light processing system, followed by in vitro culture for 2-6 weeks, comprising the following steps: Step 1, Preparation of bio-ink: The premixed solution of the DNA-silk fibroin hybrid hydrogel sustained-release system is mixed with bone marrow mesenchymal stem cells at a ratio of (1-10)×10⁻⁶. 6 Mix the cells / mL solution to obtain the bio-ink; Step 2, Preparation of cartilage organoids: Using digital light processing system technology, bio-ink is formed into 3D bioprinted spheres under ultraviolet light irradiation. The 3D bioprinted spheres are continuously cultured in vitro in cartilage induction medium for 2-6 weeks to obtain cartilage organoids.

7. The cartilaginous organoid according to claim 6, characterized in that, The digital light processing system technology described in step 2 uses ultraviolet light set to a wavelength of 365nm and a wavelength of 4.0–15.0mW / cm². -2 The light intensity is such that the particle size of the printed hydrogel spheres is 500-10000 micrometers.

8. The method for preparing the DNA-silk fibroin hybrid hydrogel sustained-release system according to claim 4, characterized in that, In step 2, the hydrogel spheres are cultured in vitro for 4 weeks using cartilage induction medium.

9. The application of the cartilaginous organoid according to claim 6, characterized in that, Choose from one of the following applications: (1) Used to prepare cartilage tissue repair materials; (2) Used for drug screening; (3) Used for disease model construction.

10. The application of the DNA-silk fibroin hybrid hydrogel sustained-release system according to any one of claims 1-3, characterized in that, Choose from one of the following applications: (1) Cell culture; (2) Organizational structure construction; (3) Organoid construction.

Images