CD180-targeting chimeric antigen receptor and use thereof
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- INST OF HEMATOLOGY & BLOOD DISEASES HOSPITAL CHINESE ACADEMY OF MEDICAL SCI & PEKING UNION MEDICAL COLLEGE
- Filing Date
- 2025-11-10
- Publication Date
- 2026-07-30
Smart Images

Figure PCTCN2025133918-FTAPPB-I100001 
Figure PCTCN2025133918-FTAPPB-I100002 
Figure 00000020_0000
Abstract
Description
Chimeric antigen receptors targeting CD180 and their applications
[0001] Cross-references
[0002] This application claims priority to Chinese Patent Application No. 202510124909.6, filed with the Chinese Patent Office no earlier than January 24, 2025, entitled "Chimeric Antigen Receptor Targeting CD180 and Its Application", the entire contents of which are incorporated herein by reference.
[0003] This application includes a sequence list, which was filed electronically in .XML format on January 24, 2025. The sequence list contained in the .XML file is part of the specification and is hereby incorporated herein by reference in its entirety. Technical Field
[0004] This disclosure relates to the biomedical field, and in particular, to chimeric antigen receptors targeting CD180 and their applications. Background Technology
[0005] Chimeric antigen receptors (CARs) are fusion proteins containing antigen recognition domains coupled to cell activation domains (such as CD3ζ) and co-stimulatory domains (such as CD28 or 4-1BB). Patient-associated T cells modified with CARs can recognize and attack specific tumor antigens, eliminating targeted tumor cells in a non-MHC-restricted manner. The advent of CAR-T cell therapy has revolutionized the treatment of malignant tumors.
[0006] Taking hematological malignancies as an example, leukemia is one of the most common malignant tumors threatening people's health. Acute myeloid leukemia (AML) is the most common type of leukemia in adults, characterized by abnormal proliferation, differentiation arrest, and impaired apoptosis of myeloid progenitor cells, leading to symptoms such as anemia, bleeding, infection, and infiltration of various organs. Treatment for AML primarily involves chemotherapy and bone marrow transplantation. Although the efficacy of AML has improved to some extent in recent years with the clinical application of various targeted drugs, the 5-year survival rate for newly diagnosed AML is still only about 25-40%. For relapsed AML patients, the median survival is only 6 months, and disease relapse and complications are common causes of death in AML patients. Therefore, there is an urgent need for more effective treatment methods to improve the survival rate of AML patients.
[0007] Antibody-based cell immunotherapy has developed rapidly in hematological malignancies, but progress in immunotherapy for AML has been relatively slow. Known AML surface targets include CD123, CD33, Lewis Y, NKG2D, CLL-1, CD44v6, FLT3, FR-β, CD38, PR1, WT1, and CD117. These antigens are not only highly expressed on leukemia cells but also on normal hematopoietic stem / progenitor cells, which may cause off-target effects in vivo, affecting the proliferation and differentiation of normal hematopoietic stem cells and producing significant side effects. Therefore, there is an urgent need to discover new targets and new products for AML immunotherapy to improve the efficacy of AML immunotherapy. Summary of the Invention
[0008] Technical problems to be solved:
[0009] One aspect of this disclosure addresses the lack of ideal cellular immunotherapy for acute myeloid leukemia in the prior art by providing a chimeric antigen receptor targeting CD180 and its application.
[0010] Specifically, the inventors used membrane proteomics technology to explore potential immunotherapeutic targets for AML, discovering that CD180 is highly expressed in primary samples from AML patients and not expressed in normal hematopoietic stem and progenitor cells. The Human Protein Atlas database showed that CD180 is mainly expressed in B cells and monocytes / macrophages, expressed in the spleen and lymph nodes in tissues, but not expressed in any important tissues or organs, indicating good safety. Based on preliminary data and validation, the inventors believe that CD180 can serve as a novel immunotherapeutic target for AML and have developed a chimeric antigen receptor targeting human CD180, thus solving the aforementioned problems.
[0011] Technical solution:
[0012] A chimeric antigen receptor targeting CD180, the chimeric antigen receptor comprising an extracellular region, a transmembrane region, and an intracellular region, the extracellular region comprising a binding domain specifically binding to human CD180 molecules, the binding domain comprising:
[0013] The amino acid sequence of CDRH1 in the heavy chain variable region, as shown in SEQ ID No. 1 or 7;
[0014] The amino acid sequence of CDRH2 in the heavy chain variable region, as shown in SEQ ID No. 2 or 8;
[0015] The amino acid sequence of CDRH3 in the heavy chain variable region, as shown in SEQ ID No. 3 or 9;
[0016] The amino acid sequence of CDRL1 in the light chain variable region, as shown in SEQ ID No. 4 or 10;
[0017] The amino acid sequence of CDRL2 in the light chain variable region, as shown in SEQ ID No. 5 or 11; and
[0018] The amino acid sequence of CDRL3 in the light chain variable region, as shown in SEQ ID No. 6 or 12.
[0019] Or a sequence that has 85% to 99% identity with the amino acid sequence and has the same biological function.
[0020] In some embodiments, the binding domain of the extracellular region of the chimeric antigen receptor targeting CD180 described herein may further include:
[0021] (a) The complementarity-determining region (CDRH) of the heavy chain variable region: selected from at least one of the amino acid sequences shown in SEQ ID No. 1, SEQ ID No. 2, SEQ ID No. 3, SEQ ID No. 7, SEQ ID No. 8 or SEQ ID No. 9; and / or
[0022] (b) The complementarity-determining region (CDRL) of the light chain variable region: selected from at least one of the amino acid sequences shown in SEQ ID No. 4, SEQ ID No. 5, SEQ ID No. 6, SEQ ID No. 10, SEQ ID No. 11, and SEQ ID No. 12.
[0023] Or a sequence that has 85% to 99% identity with the amino acid sequence and has the same biological function.
[0024] Furthermore, in other embodiments, the binding domain of the extracellular region of the chimeric antigen receptor targeting CD180 described herein may further include:
[0025] (c) the heavy chain variable region CDRH1 as shown in SEQ ID No. 1, the heavy chain variable region CDRH2 as shown in SEQ ID No. 2, and the heavy chain variable region CDRH3 as shown in SEQ ID No. 3; and / or
[0026] Light chain variable region CDRL1 as shown in SEQ ID No. 4, light chain variable region CDRL2 as shown in SEQ ID No. 5, and light chain variable region CDRL3 as shown in SEQ ID No. 6; or
[0027] (d) Heavy chain variable region CDRH1 as shown in SEQ ID No. 7, heavy chain variable region CDRH2 as shown in SEQ ID No. 8, and heavy chain variable region CDRH3 as shown in SEQ ID No. 9; and / or
[0028] Light chain variable region CDRL1 as shown in SEQ ID No. 10, light chain variable region CDRL2 as shown in SEQ ID No. 11, and light chain variable region CDRL3 as shown in SEQ ID No. 12,
[0029] Or a sequence that has 85% to 99% identity with the amino acid sequence and has the same biological function.
[0030] In some implementations, the above-mentioned binding domain may include:
[0031] The amino acid sequence of the heavy chain variable region as shown in SEQ ID No. 13 or 15; and
[0032] The amino acid sequence of the light chain variable region, as shown in SEQ ID No. 14 or 16,
[0033] Or a sequence that has 85% to 99% identity with the amino acid sequence and has the same biological function.
[0034] Furthermore, in some embodiments, the aforementioned binding domains may be Fab, Fab', F(ab')2, Fd, FCL, dAb, single-chain antibody scFv, chimeric antibody, humanized antibody, or fully human antibody that specifically binds to human CD180 molecules.
[0035] Preferably, in some embodiments, the binding domain can be a single-chain antibody scFv that specifically binds to human CD180 molecules, wherein the single-chain antibody scFv comprises:
[0036] The amino acid sequence of CDRH1 in the heavy chain variable region, as shown in SEQ ID No. 1 or 7;
[0037] The amino acid sequence of CDRH2 in the heavy chain variable region, as shown in SEQ ID No. 2 or 8;
[0038] The amino acid sequence of CDRH3 in the heavy chain variable region, as shown in SEQ ID No. 3 or 9;
[0039] The amino acid sequence of CDRL1 in the light chain variable region, as shown in SEQ ID No. 4 or 10;
[0040] The amino acid sequence of CDRL2 in the light chain variable region, as shown in SEQ ID No. 5 or 11; and
[0041] The amino acid sequence of CDRL3 in the light chain variable region, as shown in SEQ ID No. 6 or 12.
[0042] Or a sequence that has 85% to 99% identity with the amino acid sequence and has the same biological function.
[0043] In this disclosure, the single-chain antibody scFvs represented by SEQ ID Nos. 1-6 for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 respectively are designated as A24C9; and the single-chain antibody scFvs represented by SEQ ID Nos. 7-12 for CDRH1, CDRH2, CDRH3, CDRL1, CDRL2, and CDRL3 respectively are designated as C12F11.
[0044] In some embodiments, the extracellular region may include at least one of the binding domains, which are operatively linked by a linker. The linker may be selected from peptide linkers, non-peptide linkers, chemical units, hindered crosslinkers, non-hindered crosslinkers, and combinations thereof.
[0045] In some embodiments, the extracellular region may further include a second binding domain that specifically binds to other proteins, the second binding domain specifically binding to the following proteins: CD33, CD123, CLEC12A, ADGRE2, LILRB4, Siglec6, CD47, FLT-3, PDGFR, VEGFR, KIT, IDH1, IDH2, SMO, BCL-2, ALT, c-KIT, CD70, CD38, CD86, CD45, PD-1 / PD-L1, CTLA-4, T IM-3, TLR-2, CD3, CD4, IL-2, CD7, CD19, CD20, BAFF, TLR-4, TLR-7, TLR-8, TNF-α, IL-6, IL-6R, IL10, IL-10R, IL-17A, IL-17RA, IL-12, IL-23, IL-4, α4 integrin, cell adhesion molecules, complement factor D, JAK1, JAK2, JAK3, TYK2, IL-5, URAT1, TSLP, MASP-2, CSF1R or ROCK2.
[0046] In one embodiment, the amino acid sequence of the binding domain is as shown in SEQ ID No. 17 or 18.
[0047] In some embodiments, the extracellular region may further comprise a signal peptide constructed at the amino terminus of the chimeric antigen receptor or a sequence having more than 90% identity with the signal peptide and having the same biological function as it.
[0048] Preferably, in some embodiments, the signal peptide can be a signal peptide sequence in CD8α or GM-CSF; more preferably, in some embodiments, the signal peptide can be a signal peptide as shown in SEQ ID NO.19.
[0049] In some embodiments, the binding domain of the extracellular region can be connected to the transmembrane region via a hinge region.
[0050] The hinge region is preferably a hinge region sequence in CD8α.
[0051] The transmembrane region may be a transmembrane domain selected from the following proteins or a sequence that has more than 90% identity with the protein and has the same biological function: α, β or ζ chains of T cell receptors, CD2, CD3ε, CD4, CD7, CD8α, CD8β, CD11a, CD11b, CD11c, CD11d, CD18, CD19, CD27, CD28, CD29, CD30, CD40, CD48, CD49a, CD49d, CD49f, CD66a, CD66b, CD66c, CD66d, CD66e, CD69, CD79A, CD79B, CD84, CD96, CD100, CD10 3. CD134, CD137, CD150, CD158A, CD158B1, CD158B2, CD158C, CD158D, CD158F1, CD158F2, CD158K, CD160, CD162, CD226, CD229, CD244, CD247, CD258 , CD268, CD270, CD272, CD276, CD279, CD314, CD319, CD335, CD336, CD337, CD352, CD353, CD355, CD357, LFA-1, NKG2C, DAP-10, ICAM-1, NKp80, IL-2R beta, IL-2Rgamma, IL-7R alpha, LFA-1, SLAMF9, LAT, GADS, SLP-76, PAG1 / CBP, CD83 ligand, Fc gamma receptor, integrin, activating NK cell receptor or Toll ligand receptor, or combinations thereof.
[0052] Preferably, in one embodiment, the transmembrane region is a transmembrane region sequence in CD8α.
[0053] In some embodiments, the intracellular region may also include co-stimulatory molecules.
[0054] Preferably, in some embodiments, the co-stimulatory molecule may be one or more functional signaling domains obtained by means of a sequence selected from the following proteins or sequences having more than 90% identity with the proteins and having the same biological function: integrins, BTLA, Toll ligand receptors, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1, 4-1BB, B7-H3, CD278, GITR, BAFFR, LIGHT, HVEM, KIRDS2, SLAMF7, NKp80, NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα, ITGA4, VLA1, CD49α, IA4, CD49D, ITGA6, VLA6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11α, ITGAM, CD11b, ITGAX, CD11c, CD29, ITGB1, ITGB2, CD1 8. ITGB7, NKG2D, NKG2C, TNFR2, CD226, CD84, CD96, CEACAM1, CRTAM, CD229, CD160, PSGL1, CD100, CD69, SLAMF6, SLAM, BLAME, CD162, LTBR, LAT, GADS or SLP-76.
[0055] More preferably, in some embodiments, the co-stimulatory molecule may be CD28 or 4-1BB, or a sequence that has more than 90% identity with and has the same biological function as CD28.
[0056] In some embodiments, the intracellular signal transduction region may be a sequence selected from the following proteins or sequences that have more than 90% identity with the proteins and have the same biological function: 4-1BB, B7-H3, BAFFR, BLAME, BTLA, CD100, CD103, CD160, CD18, CD19, CD19a, CD2, CD247, CD27, CD276, CD28, CD29, CD3ζ, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8alpha, CD8beta, CD96, CDS, CEACAM1, CRTAM, DAP-10, DNAM1, Fc gamma receptor, GADS, GITR, HVEM, IA4, ICAM-1, ICAM-1, Ig alpha, IL2R beta, IL2R gamma, IL7R alpha, integrin, ITGA4, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, KIRDS2, LAT, LFA-1, LFA-1, LIGHT, LIGHT, LTBR, Ly9, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80, OX-40, PAG / Cbp, PD-1, PSGL1, SELPLG, SLAMF4, SLAMF6, SLAMF7, SLP-76, TNFR2, Toll ligand receptor, TRANCE / RANKL, VLA1 or VLA-6, or combinations thereof.
[0057] Preferably, in one embodiment, the intracellular signal transduction region may be CD3ζ.
[0058] In one embodiment, the amino acid sequence of the chimeric antigen receptor may be as shown in SEQ ID NO. 20 or 21, or a sequence that has more than 90% identity with it and has the same biological function.
[0059] Another aspect of this disclosure is to provide an isolated nucleic acid molecule that encodes the amino acid sequence of the chimeric antigen receptor described above.
[0060] Another aspect of this disclosure is to provide a vector containing the sequence of the aforementioned nucleic acid molecule.
[0061] Preferably, in some embodiments, the vector can be a plasmid vector, a lentiviral vector, an adenovirus vector, an adeno-associated virus vector, or a retroviral vector.
[0062] More preferably, in one embodiment, the vector may contain an EF1α promoter sequence.
[0063] Another aspect of this disclosure is to provide an isolated cell containing the chimeric antigen receptor, the nucleic acid molecule, or the carrier described above.
[0064] Preferably, in some embodiments, the cells can be i) immune response cells, preferably T cells, NK cells, NKT cells, macrophages, monocytes, neutrophils or CTL cells, more preferably T cells; or ii) induced pluripotent stem cells (iPSCs).
[0065] Furthermore, in some embodiments, the cells may be autologous or allogeneic T cells.
[0066] Preferably, in one embodiment, the cells can be autologous T cells.
[0067] Furthermore, in some embodiments, the cells may be allogeneic T cells, which are universal chimeric antigen receptor T cells.
[0068] Preferably, in some embodiments, the T cells may lack genes encoding TCR, HLA, CD52, or PD-1.
[0069] Another aspect of this disclosure is the use of the chimeric antigen receptor, the nucleic acid molecule, the carrier, or the cell described above in the preparation of a medicament for treating the following diseases: tumors, autoimmune diseases, graft-versus-host disease, or infections.
[0070] Preferably, in some embodiments, the tumor can be a CD180-positive tumor, which can be selected from breast cancer, neurotumor, melanoma, lung cancer, head and neck cancer, colorectal cancer, pancreatic cancer, gastric cancer, kidney cancer, bladder cancer, prostate cancer, ovarian cancer, cervical cancer, glioblastoma, esophageal cancer, bladder cancer, renal cell carcinoma, endometrial cancer, skin cancer, testicular cancer, thyroid cancer, lymphoma, leukemia, and multiple myeloma.
[0071] More preferably, in one embodiment, the tumor may be acute myeloid leukemia.
[0072] More preferably, in one embodiment, the tumor may be relapsed or refractory acute myeloid leukemia.
[0073] Another aspect of this disclosure is the use of the chimeric antigen receptor, the nucleic acid molecule, the vector, or the cell described above in the preparation of a medicament for treating TLR4-mediated diseases.
[0074] Another aspect of this disclosure is to provide a pharmaceutical composition comprising the chimeric antigen receptor, the nucleic acid molecule, the carrier, or the cell described above. Beneficial effects:
[0075] This invention obtained two CD180 scFv sequences from two mouse hybridoma cell lines (A24C9 and C12F11) containing anti-human CD180 monoclonal antibodies and cloned them into a lentiviral expression vector containing the CD8α-4-1BB-CD3ζ gene, packaging them into a lentiviral vector carrying the CD180 scFv-CD8α-4-1BB-CD3ζ encoding gene. T cells were then infected with the lentivirus to express the two chimeric antigen receptors mentioned above. Flow cytometry, degranulation analysis, and detection of cytokines secreted by T cells demonstrated that T cells modified with the two chimeric antigen receptors exhibited strong killing activity against CD180-expressing acute myeloid leukemia cells, but no killing activity against cells not expressing CD180, effectively preventing off-target effects and not affecting CD34-derived umbilical cord blood. + It exhibits colony-forming ability of hematopoietic stem / progenitor cells and is safe. The chimeric antigen receptor CD180 scFv-CD8α-4-1BB-CD3ζ of this invention can be used for the treatment of CD180-positive hematologic malignancies. Attached Figure Description
[0076] Figure 1 is an electrophoresis diagram of PCR amplification of the mouse anti-human CD180 monoclonal antibody scFv (VL-linker-VH direction) fragment in the embodiments of this disclosure. The left lane is the A24C9-CD180 scFv fragment (729bp), and the right lane is the C12F11-CD180 scFv fragment (726bp).
[0077] Figure 2 is a schematic diagram of the A24C9-CD180 scFv-CD8α-4-1BB-CD3ζ lentiviral expression vector in an embodiment of this disclosure, wherein the counterclockwise sequence is the forward gene fragment and the clockwise sequence is the reverse gene fragment;
[0078] Figure 3 is a schematic diagram of the C12F11-CD180 scFv-CD8α-4-1BB-CD3ζ lentiviral expression vector in an embodiment of this disclosure, wherein the counterclockwise sequence is the forward gene fragment and the clockwise sequence is the reverse gene fragment;
[0079] Figure 4 shows the results of flow cytometry analysis of the expression of CAR molecules in T cells modified with A24C9-CD180 scFv-CD8α-4-1BB-CD3ζ (A24C9 CAR-T) and C12F11-CD180 scFv-CD8α-4-1BB-CD3ζ (C12F11 CAR-T) constructed in the embodiments of this disclosure. In the figure, GFP represents the expression of the marker protein carried by the vector, and F(ab)2 represents the expression of goat anti-mouse F(ab)2-labeled CD180 scFv on the surface of T cells.
[0080] Figure 5 shows the results of flow cytometry detection of the expression intensity of CD180 antigen molecules in AML cell lines OCI-AML2, MV4-11, Molm-13, U937 and chronic myeloid leukemia cell line K562 in the embodiments of this disclosure. In Figure 5, A is the peak diagram of CD180 expression intensity, and B is the mean fluorescence intensity (MFI) of CD180 antigen molecule expression.
[0081] Figure 6 shows the results of flow cytometry analysis of the residual tumor cell survival rate after co-culturing T cells and target cells in this embodiment of the present disclosure. A24C9 CAR-T is the experimental group of T cells modified with A24C9-CD180 scFv-CD8α-4-1BB-CD3ζ, C12F11 CAR-T is the experimental group of T cells modified with C12F11 CD180 scFv-CD8α-4-1BB-CD3ζ, and Vector... T represents the control group of T cells transfected with the empty vector. In Figure 6, A, B, C, and D show the survival rates of residual tumor cells after co-culturing CAR-T cells with CD180-positive cell lines OCI-AML2, MV4-11, Molm13, and U937 at effector-to-target ratios of 1:4, 1:2, 1:1, and 2:1 for 24 and 48 hours, respectively. In Figure 6, E shows the survival rates of residual tumor cells after co-culturing CAR-T cells with CD180-negative K562 cell lines at effector-to-target ratios of 1:4, 1:2, 1:1, and 2:1 for 24 and 48 hours.
[0082] Figure 7 shows the degranulation detection results of Vector T and CAR-T cells co-cultured with K562, OCI-AML2, MV4-11, Molm13 and U937 at an effector-target ratio of 1:1 in the embodiments of this disclosure. Among them, the CAR-T cells are A24C9 CAR-T and C12F11 CAR-T, respectively, and Vector T is the control group of T cells transfected with empty vector.
[0083] Figure 8 shows the phenotypic analysis results of Vector T and CAR-T cells in the embodiments of this disclosure. CAR-T cells are A24C9 CAR-T and C12F11 CAR-T, respectively. Vector T is the control group of T cells transfected with an empty vector. Figure 8A shows the statistical results of expression of activation-related receptors CD25 and CD69 in CAR-T and Vector T cells. Figure 8B shows the statistical results of expression of inhibitory receptors PD-1, LAG-3, and TIM-3 in CAR-T and Vector T cells. Figure 8C shows the expression of CD8+ in CAR-T and Vector T cells. + Graph showing the proportions and statistical results of cell clustering;
[0084] Figure 9 shows the levels of cytokines IL-2, TNF-α, and IFN-γ released by Vector T and CAR-T cells after co-culturing with K562, OCI-AML2, MV4-11, Molm13, and U937 cell lines at an effector-target ratio of 1:1 for 48 hours in the embodiments of this disclosure. Among them, CAR-T cells are A24C9 CAR-T and C12F11 CAR-T, respectively, and Vector T is the control group of T cells transfected with empty vector.
[0085] Figure 10 shows the safety verification results of Vector T and CAR-T cells against hematopoietic stem and progenitor cells derived from umbilical cord blood in the embodiments of this disclosure. Flow cytometry was used to detect UCB-CD34. + The expression of CD180 molecules on the cell surface is shown in Figure 10A, UCB-CD34. + Cells were co-cultured with Vector T, A24C9-CD180 CAR-T, or C12F11-CD180 CAR-T at an effector-to-target ratio of 1:1 for 24 hours, after which residual CD3 was observed. + T cells, CD34 + The statistical chart of the proportion of hematopoietic stem and progenitor cells is shown in Figure 10B. CD34 levels were measured after co-culturing with T cells for 24 hours. + The colony-forming ability of hematopoietic stem and progenitor cells was recorded. The colony morphology of different groups is shown in Figure 10C, and the number of different types of colonies is shown in Figure 10D.
[0086] Sequence Description Detailed Implementation
[0087] This invention discloses a chimeric antigen receptor targeting CD180 and its applications. Those skilled in the art can refer to the content of this document and appropriately modify the process parameters to achieve the desired result. It should be particularly noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in this invention. Furthermore, those skilled in the art can clearly modify or appropriately alter and combine the content described herein without departing from the content, spirit, and scope of this invention to realize and apply the technology of this invention.
[0088] In this disclosure, unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Unless otherwise expressly stated, throughout the specification and claims, the term "comprising" or its variations such as "including" or "comprising of," etc., shall be understood to include the stated elements or components without excluding other elements or other components. The term "a," "an," and "the" includes plural indicators. The term "a plurality of" means two or more. The terms "such as," "for example," etc., are intended to refer to exemplary embodiments and are not intended to limit the scope of this disclosure.
[0089] In this disclosure, when a range of values is provided, it should be understood that, unless the context otherwise explicitly indicates otherwise, the range includes endpoints and each intermediate value between the upper and lower limits of the range, as well as any other specified value or intermediate value within the specified range and any value within a smaller range between specified values.
[0090] In this disclosure, the term "about" generally refers to a variation within a range of 0.5% to 10% above or below a specified value, such as a variation within a range of 0.5%, 1%, 1.5%, 2%, 2.5%, 3%, 3.5%, 4%, 4.5%, 5%, 5.5%, 6%, 6.5%, 7%, 7.5%, 8%, 8.5%, 9%, 9.5%, or 10% above or below a specified value.
[0091] In this disclosure, unless otherwise stated, scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Definitions of common molecular biology terms can be found in Lewin's *GENES*, Twelfth Edition, Jocelyn E. Krebs, Elliott S. Goldstein, Stephen T. Kilpatrick, Jones & Bartlett Learning. Definitions of common biochemistry terms can be found in Lehninger's *Principles of Biochemistry*, Eighth Edition, David L. Nelson, Michael M. Cox, WHFreeman. Definitions of common cell biology terms can be found in *Molecular Biology of the Cell*, Sixth Edition, Bruce Alberts, Alexander Johnson, Julian Lewis, David Morgan, Martin Raff, Keith Roberts, Peter Walter, Garland Science. Definitions of common genetics terms can be found in *Genetics: Analysis of Genes and Genomes*, Eighth Edition, Daniel L. Hartl, Maryellen Ruvolo, Jones & Bartlett Learning.
[0092] Unless otherwise specified, the experimental techniques used in this paper employ standard techniques from immunology, biochemistry, chemistry, molecular biology, microbiology, cell biology, genomics, and recombinant DNA, which can be found in standard books such as *Molecular Cloning: A Laboratory Manual* and *Cell Biology: A Laboratory Handbook*.
[0093] definition:
[0094] The term "separated" in this disclosure refers to a substance or entity that has been removed from its natural environment or the environment in which it existed prior to separation and is separate from other components. For example, a separated protein substantially does not originate from cellular material or other proteins derived from the cell or tissue from which it originates. The separation ratio can be, for example, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, or at least 90%. Separated substances may have different levels of purity relative to the substances before their separation.
[0095] Chimeric antigen receptor:
[0096] The term "chimeric antigen receptor" or "CAR" as used in this disclosure refers to a recombinant polypeptide (or artificial fusion protein) that includes at least an antigen-binding domain. This domain is connected to a signal-activating moiety via a hinge and a transmembrane domain. The antigen-binding domain can take many forms; for example, in some embodiments, the antigen-binding domain is Fab, Fab', F(ab')2, Fd, FCL, dAb, a single-chain antibody scFv, a chimeric antibody, a humanized antibody, or a fully human antibody. It can be monovalent or multivalent. Multivalent antibodies in this disclosure include at least two of the antibody or antigen-binding moieties described in this disclosure, which competitively bind to human CD180 molecules and produce effects different from those of monovalent antibodies. The multivalent antibodies can be obtained using, for example, protein fusion, the addition of linkers, covalent or non-covalent methods.
[0097] In some embodiments, the binding domain is a scFv that specifically binds to human CD180. The scFv may typically contain a single or repeated number of VL and VH sequences, which contain the CDRs. In some embodiments, the scFv that specifically binds to the human CD180 molecule is a monovalent antibody. In other embodiments, the number of repeat sequences of the light chain variable region (VL) and heavy chain variable region (VH) may be 2 or 3. When the number of repeat sequences is 2, the scFv that specifically binds to the CD180 molecule forms a bivalent diabody; when the number of repeat sequences is 3, the scFv that specifically binds to the CD180 molecule forms a trivalent diabody.
[0098] Based on the antigen-binding domain of this disclosure, chimeric antigen receptors with various structures can be formed. For example, the first-generation CAR is formed by connecting an antigen-binding domain and a T cell activation domain located in the intracellular region through a transmembrane region; the second-generation CAR adds a co-stimulatory molecule to the first-generation CAR; the third-generation CAR adds two tandem co-stimulatory molecules to the first-generation CAR to enhance T cell proliferation activity, cytotoxicity, and prolong T cell survival time.
[0099] Modification of chimeric antigen receptor protein molecules:
[0100] In some embodiments, the chimeric antigen receptor protein molecule can be modified with amino acids to produce functionally equivalent variants that do not significantly affect its properties. Examples of such modifications include conserved substitutions of amino acid residues, deletions or additions of one or more amino acids that do not significantly alter the functional activity of the antibody or mature the antibody's affinity for its target antigen. Examples of conserved substitutions of amino acid residues include amino acids from the following group: 1) alanine (A), glycine (G); 2) aspartic acid (D), glutamic acid (E); 3) asparagine (N), glutamine (Q); 4) arginine (R), lysine (K); 5) isoleucine (I), leucine (L), methionine (M), valine (V); 6) phenylalanine (F), tyrosine (Y), tryptophan (W); 7) serine (S), threonine (T); and 8) cysteine (C), methionine (M).
[0101] Multivalent and multispecific single-chain antibodies (extracellular binding domain):
[0102] In some embodiments, the extracellular region may include at least one of the binding domains, which are operatively linked via linkers. This enables competitive binding of human CD180 molecules and produces effects different from those of a single binding domain; for example, by increasing the number of antigen-binding sites, a tighter antigen-antibody complex can be formed, thereby enhancing binding affinity and stability. This enhanced binding affinity helps improve the affinity of anti-human CD180 antibodies for antigens and enhances the interaction between antigens and cell surface receptors or other molecules. The at least one binding domain can be obtained, for example, through protein fusion, the addition of linkers, covalent or non-covalent methods.
[0103] In some embodiments, the extracellular region further includes a second binding domain that specifically binds to other proteins; that is, the extracellular region of this disclosure, in addition to competitively binding to human CD180 molecules, is capable of binding to at least one other different site or target molecule. Non-limiting examples include CD33, CD123, CLEC12A, ADGRE2, LILRB4, Siglec6, CD47, FLT-3, PDGFR, VEGFR, KIT, IDH1, IDH2, SMO, BCL-2, ALT, c-KIT, CD70, CD38, CDC86, CD45, PD-1 / PD-L1, CTLA-4, TIM-3, TLR-2, CD3, CD4, and IL-2. CD7, CD19, CD20, BAFF, TLR-4, TLR-7, TLR-8, TNF-α, IL-6, IL-6R, IL-10, IL-10R, IL-17A, IL-17RA, IL-12, IL-23, IL-4, α4 integrin, cell adhesion molecule, complement factor D, JAK1, JAK2, JAK3, TYK2, IL-5, URAT1, TSLP, MASP-2, CSF1R, ROCK2. The second binding domain can be directly linked or linked together via linkers. The second binding domain can be expressed through recombination. For better therapeutic efficacy, the second binding domain can be monovalent or multivalent.
[0104] Multivalent and multispecific single-chain antibodies against the above-mentioned extracellular regions can be prepared using conventional techniques in the art. For the preparation of engineered antibodies, please refer to, for example, Hantao Lou, Xuetao Cao, Antibody variable region engineering for improving cancer immunotherapy, Cancer Communications. 2022; 42:804–827.
[0105] The term "nucleic acid molecule" in this disclosure may also be used interchangeably with "polynucleotide," referring to a chain of nucleotides of any length, including DNA or RNA. It may include any known nucleotide analogs or modified nucleotides or bases. The preparation of the aforementioned nucleic acid molecules can be based on the base sequences of the aforementioned antigen recognition region, hinge region, transmembrane region, and intracellular signaling region, and can be achieved through known techniques such as chemical synthesis or PCR amplification. Typically, the codons encoding the amino acids of the aforementioned domains can be optimized to optimize their expression in host cells. Information on the aforementioned base sequences can be obtained by searching known literature or databases such as NCBI (https: / / www.ncbi.nlm.nih.gov / ).
[0106] The term "vehicle" (or vector) in this disclosure has a general meaning, referring to a vector capable of introducing the nucleic acid into prokaryotic and / or eukaryotic host cells. In some embodiments, the vector can be a linear vector or a circular vector. It can be a non-viral vector such as a plasmid, a viral vector, or a vector utilizing transposons. The vector may contain regulatory sequences such as promoters and terminators, as well as marker sequences such as drug resistance genes and reporter genes. In addition, the above-mentioned vector may also contain a sequence encoding a suicide gene, which can be used to control the number of CAR-T cells in vivo by administering substances that activate the suicide gene, depending on the treatment process.
[0107] The viral vectors described above can be plasmid vectors, retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus vectors, etc. In some embodiments, lentiviral expression vectors are used.
[0108] T cells:
[0109] In some embodiments, the T cells are human T cells. The T cells can be derived from bodily fluids such as blood and bone marrow, or from tissues such as the spleen, thymus, and lymph nodes, or from cancerous tissues such as primary tumors, metastatic tumors, and malignant ascites, obtained after separation and purification. Preferably, the T cells are autologous T cells. Furthermore, the T cells can be CD4+. + T cells, CD8 + T cells, αβT cells, or γδT cells, or a mixture of the above-mentioned T cells.
[0110] In other embodiments, the cells are allogeneic T cells, which are universal chimeric antigen receptor T cells.
[0111] In order to obtain the universal chimeric antigen receptor T cells, preferably, in some embodiments, the T cells lack genes encoding TCR, HLA, CD52, or PD-1.
[0112] The deletion of the gene can be achieved by suitable methods in the prior art, such as gene knockout.
[0113] Pharmaceutical composition:
[0114] The term "pharmaceutical composition" as used in this disclosure refers to a composition that includes at least one other substance in addition to the chimeric antigen receptor, the nucleic acid molecule, the carrier, and the cell described in this disclosure. In some embodiments, this other substance may be, for example, a pharmaceutically acceptable carrier (a substance that does not affect the function of the mesenchymal stem cells and has no effect on the patient's physical condition, such as physiological saline, cell culture medium, glucose, water for injection, glycerol, ethanol, and combinations thereof), excipients, stabilizers, surfactants, preservatives, isotonic agents, etc. It can also be other therapeutic agents, such as chemotherapy drugs: melphalan, doxorubicin, cyclophosphamide, vincristine, etc.; glucocorticoids: prednisone, dexamethasone, betamethasone, etc.; immunomodulatory drugs: thalidomide, lenalidomide, pomalidomide, etc.; and biologics targeting the following exemplary targets: CD33, CD123, CLEC12A, ADGRE2, LILRB4, Siglec6, CD47, FLT-3, PDGFR, VEGFR, KIT, IDH1, IDH2, SMO, BCL-2, ALT, c-KIT, CD70, CD38, CD86. CD45, PD-1 / PD-L1, CTLA-4, TIM-3, TLR-2, CD3, CD4, IL-2, CD7, CD19, CD20, BAFF, TLR-4, TLR-7, TLR-8, TNF-α, IL-6, IL-6R, IL-10, IL-10R, IL-17A, IL-17RA, IL-12, IL-23, IL-4, α4 integrin, cell adhesion molecule, complement factor D, JAK1, JAK2, JAK3, TYK2, IL-5, URAT1, TSLP, MASP-2, CSF1R, ROCK2. The above biologics can be antibodies, small molecule inhibitors, or agonists targeting this target.
[0115] Indications:
[0116] In some embodiments, the chimeric antigen receptor, the nucleic acid molecule, the carrier, the cell, or the pharmaceutical composition described herein can be used to treat the following diseases: tumors, autoimmune diseases, graft-versus-host disease, or infections.
[0117] Exemplary examples of tumors include breast cancer, neurotumor, melanoma, lung cancer, head and neck cancer, colorectal cancer, pancreatic cancer, stomach cancer, kidney cancer, bladder cancer, prostate cancer, ovarian cancer, cervical cancer, glioblastoma, esophageal cancer, bladder cancer, renal cell carcinoma, endometrial cancer, skin cancer, testicular cancer, thyroid cancer, acute myeloid leukemia, chronic lymphocytic leukemia, and B-cell lymphoma.
[0118] Exemplary examples of autoimmune diseases include, for example, autoimmune hematologic disorders (including, for example, hemolytic anemia, aplastic anemia, simple erythrocytic anemia, and idiopathic thrombocytopenic purpura), systemic lupus erythematosus, polychondritis, scleroderma, Wegener granulomatosis, dermatomyositis, chronic active hepatitis, myasthenia gravis, psoriasis, Steven-Johnson syndrome, idiopathic diarrhea, autoimmune inflammatory bowel disease (including, for example, ulcerative colitis and Crohn's disease), endocrine ophthalmopathy, Graves' disease, sarcoidosis, multiple sclerosis, primary biliary cirrhosis, type I diabetes, uveitis, keratoconjunctivitis sicca and vernal keratoconjunctivitis, interstitial pulmonary fibrosis, psoriatic arthritis, and glomerulonephritis.
[0119] In some embodiments, the chimeric antigen receptor, the nucleic acid molecule, the carrier, the cell, or the pharmaceutical composition described herein can be used to treat TLR4-mediated diseases. Exemplary examples include, for instance, psoriasis, atopic dermatitis, asthma, COPD, adult respiratory diseases, arthritis, inflammatory bowel disease, Crohn's disease, ulcerative colitis, septic shock, endotoxic shock, Gram-negative sepsis, toxic shock syndrome, stroke, cardiac and renal reperfusion injury, glomerulonephritis, thrombosis, Alzheimer's disease, malaria, acute respiratory distress syndrome, delayed-type hypersensitivity reactions, atherosclerosis, cerebral and cardiac ischemia, osteoarthritis, angiogenesis, osteoporosis, gingivitis, respiratory viruses, herpesviruses, hepatitis viruses, HIV, Kaposi's sarcoma-associated virus, meningitis, cystic fibrosis, preterm birth, cough, pruritus, sprains, strains, contusions, psoriatic arthritis, herpes, encephalitis, central nervous system vasculitis, traumatic brain injury, central nervous system tumors, subarachnoid hemorrhage, and postoperative conditions. Trauma, interstitial pneumonia, hypersensitivity reactions, crystal arthritis, acute and chronic pancreatitis, acute alcoholic hepatitis, necrotizing enterocolitis, chronic sinusitis, vasculogenic eye disease, ocular inflammation, retinopathy of prematurity, diabetic retinopathy, polymyositis, vasculitis, acne, gastric and duodenal ulcers, celiac disease, esophagitis, glossitis, airflow obstruction, airway hyperresponsiveness, bronchiectasis, bronchiolitis, obliterative bronchiolitis, chronic bronchitis, cor pulmonale, cough, dyspnea, emphysema, hypercapnia, hyperinflation, hypoxemia, inflammation caused by hyperoxia, hypoxia, surgical lung reduction, pulmonary fibrosis, pulmonary hypertension, right ventricular hypertrophy, peritonitis associated with continuous ambulatory peritoneal dialysis, granulocytic erythrocyte disease, sarcoidosis, small airway disease, wheezing, common cold, gout, alcoholic liver disease, burn treatment, periodontitis.
[0120] Example:
[0121] To enable those skilled in the art to better understand the technical solutions of the present invention, the present invention will be further described in detail below with reference to specific embodiments.
[0122] Example 1: Preparation and screening of hybridomas containing anti-human CD180 monoclonal antibodies
[0123] Balb / c mice were immunized intraperitoneally with 3T3 cells overexpressing CD180 (3T3-CD180) as antigen cells. Booster immunizations were administered at weeks 2 and 4 after the initial immunization. On day 8 post-booster immunization, 20 μl of tail blood was collected from mice and added to 180 μl of PBS. The mixture was incubated at room temperature for 1 hour, centrifuged at 3,000 rpm for 10 minutes at 4°C, and the tail blood supernatant was collected. The supernatant was diluted with PBS to different concentrations: 1:200, 1:400, 1:800, 1:1600, 1:3200, 1:6400, and 1:12800. 3T3 and K562 cell lines overexpressing CD180 (3T3-CD180 and K562-CD180) were prepared, washed once with PBS, and the cells were counted and adjusted to a density of 1 × 10⁻⁶ cells / mL. 7 / ml, 100μl of serum at different dilutions was added to 100μl of cells. CD180-negative cell line 3T3 and wild-type K562 were used as negative controls. Cells were incubated at 4℃ for 30 min, washed twice with PBS, and then PE-labeled anti-mouse F(ab)2 secondary antibody was added at a ratio of 1:500. Cells were incubated at room temperature in the dark for 30 min, washed twice with PBS, and resuspended in 200μl of PBS. Flow cytometry was used to detect the percentage of antibody binding to different cells and the fluorescence intensity. An effective titer was defined as an average fluorescence intensity of positive cells that was more than twice that of the negative control group. Fusion was only performed when the effective titer was higher than 6400. Three days before fusion, mice that met the titer requirement were given a tail vein injection of antigen cells 3T3-CD180 for shock immunization. Spleen cells from successfully immunized mice were mixed with myeloma SP2 / 0 cells at a ratio of 10:1 and placed in a 37°C water bath. 50% PEG was added to the mixed cell pellet (after centrifugation and supernatant rejection) within 1 minute. The mixture was then incubated at 37°C with shaking for 1.5 minutes, followed by the addition of 10 ml of serum-free 1640 medium within 5 minutes. The mixture was centrifuged at 800 rpm for 5 minutes, the supernatant was discarded, and the cells were resuspended in semi-solid medium containing HAT. The mixture was thoroughly mixed and added to 10 cm Petri dishes (10 ml / plate). The cells were incubated at 37°C with 5% CO2 for 7-10 days. Single colonies were picked and cultured in 96-well plates containing 200 μl of complete medium for 3-4 days. When the colonies in the 96-well plates were sufficiently large, 100 μl of the supernatant from the corresponding well was taken and co-incubated with the test cells (K562-CD180 and K562-WT) using the same method as for titer detection. When the average fluorescence intensity of K562-CD180 is higher than that of K562-WT, the well is considered a positive well and proceeds to the next step of clonal culture. The selected positive hybridoma clones are transferred from the 96-well plate to the 24-well plate and cultured for 3-5 days. The culture supernatant is tested again, and positive clones are then used for the next round of subclonal culture. The remaining cells are cryopreserved. Hybridoma cells are collected from the 24-well plate, counted, and the cell density is adjusted to 10 cells / ml. The cells are then seeded into 96-well plates at 200 μl per well and incubated at 37°C with 5% CO2 for approximately 10 days. Clonal formation is observed. Wells with only a single clone are selected, and 100 μl of the culture supernatant is collected. The positive clones are selected and expanded to the 24-well plate for culture. After another supernatant test, positive clones are selected for a second round of subclonal culture. Multiple rounds of subclonal culture are performed until all test wells are positive, thus obtaining a stable hybridoma cell line. The supernatant of positive hybridoma culture was selected, and the antibody subtype was detected using antibody subtype detection strips. The two monoclonal antibodies in this example were numbered A24C9 and C12F11, respectively. Both were murine IgG1 subtypes, and their light chains were both κ chains.
[0124] Example 2: Cloning of the CD180 scFv antigen recognition region in a chimeric antigen receptor
[0125] 1. Total RNA was extracted from mouse anti-human CD180 monoclonal hybridoma cell lines A24C9 and C12F11 using Trizol reagent, and cDNA was synthesized using reverse transcriptase with RNA as a template.
[0126] 2. PCR amplification of the variable region gene fragments of the mouse anti-human CD180 monoclonal antibody heavy chain (VH) and light chain (VL) using the "Mouse Antibody scFv Gene Amplification Kit" (Public Protein / Plasmid Library):
[0127] Amplification of the VH chain: The PCR reaction mixture (50 μl) was prepared as follows: MVH mix: 45 μl; DNA polymerase: 0.3 μl; cDNA: 500 ng; ddH2O: bring the volume to 50 μl. Reaction conditions: 94℃ pre-denaturation for 3 min; repeat the following cycles 30 times: 94℃ for 30 seconds, 54℃ for 30 seconds, 72℃ for 45 seconds; finally, 72℃ extension for 10 min.
[0128] Amplification of the VL chain: The PCR reaction mixture (50 μl) was prepared as follows: MVL mix: 45 μl; DNA polymerase: 0.3 μl; cDNA: 500 ng; ddH2O: bring the volume to 50 μl. Reaction conditions: 94℃ pre-denaturation for 3 min; repeat the following cycles 30 times: 94℃ for 30 seconds, 54℃ for 30 seconds, 72℃ for 45 seconds; finally, 72℃ extension for 10 min.
[0129] VH and VL fragments were separated and recovered by agarose gel electrophoresis.
[0130] 3. The recovered VH and VL fragments were ligated into the pMD19 T vector using T4 ligase and sequenced. Based on the sequencing results, the heavy and light chain variable region sequences of CD180 monoclonal antibodies A24C9 and C12F11 were preliminarily determined. The backbone region sequences (FR1 and FR4) at both ends of the variable region of the antibody were further determined using a RACE kit (Takara). Finally, the complete VH and VL sequences of the two antibodies were obtained.
[0131] 4. Construct the VL-linker-VH direction CD180 scFv fragment using overlap extension PCR.
[0132] Using correctly sequenced pMD19-A24C9 VL and pMD19-A24C9 VH plasmids as templates, the A24C9-CD180 scFv fragment was amplified by overlap extension PCR.
[0133] P1: 5'CTAGCTAGCGACATCCAGATGACTCAGTCTCCAGCC 3'
[0134] P2: 5'CACCGGAGCCGCCGCCGCCAGAACCACCACCACCCCGTT
[0135] GGCTTTCCAGCTTG 3'
[0136] P3: 5'TGGCGGCGGCGGCTCCGGGTGGTGGTGGTTCTGAGGTCCA
[0137] GCTGCAACAGTCTGGA3'
[0138] P4: 5'CGGAATTCTGAGGAGACTATGAGAGTGGTGCCTTGGCCC
[0139] CA 3'
[0140] Similarly, using the correctly sequenced pMD19-C12F11 VL and pMD19-C12F11 VH plasmids as templates, the C12F11-CD180 scFv fragment was amplified by overlap extension PCR.
[0141] P1: 5'CTAGCTAGCGAAACAACTGTGACCCAGTCTCCAGCATCC
[0142] CTG 3'
[0143] P2: 5'ACCACCGGAGCCGCCGCCGCCAGAACCACCACCACCCC
[0144] GTTTCAGCTCCAGCTTG 3'
[0145] P3: 5'GCGGCGGCGGCTCCGGTGGTGGTGGTTCTGAAGTGCAG
[0146] CTGGTGGAGTCTGGGGGAG 3'
[0147] P4: 5'CGGAATTCTGAGGAGACTGTGAGAGTGGTGCCTCGGC 3'
[0148] Prepare the first-round PCR reaction system to obtain the NheⅠ-VL-linker fragment (50 μl): 2×Pfu PCR Master Mix (TIANGEN): 25 μl; 10 μM P1+P2: 2 μl; pMD19-VL plasmid: 100 ng; ddH2O: bring to 50 μl. Reaction conditions: 94℃ pre-denaturation for 5 min; repeat the following cycle 30 times: 94℃ for 30 seconds, 60℃ for 30 seconds, 72℃ for 45 seconds; finally, 72℃ extension for 10 min;
[0149] Prepare the first-round PCR reaction system to obtain the linker-VH-EcoRI fragment (50 μl): 2×Pfu PCR Master Mix (TIANGEN): 25 μl; 10 μM P3+P4: 2 μl; pMD19-VH plasmid: 100 ng; ddH2O: bring to 50 μl. Reaction conditions: 94℃ pre-denaturation for 5 min; repeat the following cycle 30 times: 94℃ for 30 seconds, 60℃ for 30 seconds, 72℃ for 45 seconds; finally, 72℃ extension for 10 min.
[0150] Agarose gel electrophoresis was used to separate and recover the NheⅠ-VL-linker and linker-VH-EcoRⅠ fragments, respectively.
[0151] Prepare the second-round PCR reaction system to obtain the CD180 scFv (VL-linker-VH direction) fragment (50 μl): 2×Pfu PCR Master Mix (TIANGEN): 25 μl; 10 μM P1+P4: 2 μl; NheⅠ-VL-linker fragment: 100 ng; linker-VH-EcoRⅠ fragment: 100 ng; ddH2O: bring to 50 μl. Reaction conditions: 94℃ pre-denaturation for 5 min; repeat the following cycle 30 times: 94℃ for 30 seconds, 60℃ for 30 seconds, 72℃ for 60 seconds; finally, 72℃ extension for 10 min.
[0152] The A24C9-CD180 scFv and C12F11-CD180 scFv fragments were separated and recovered by agarose gel electrophoresis, and the results are shown in Figure 1.
[0153] In addition to the above methods, other suitable methods in the prior art can also be used to synthesize the antigen recognition region CD180 scFv according to the sequence shown in SEQ ID No. 1-18.
[0154] Example 3: Construction of a chimeric antigen receptor vector
[0155] 1. The plasmid containing the CD8α-4-1BB-CD3ζ fragment was digested with Nhe I and EcoRI restriction enzymes to obtain the CD8α-4-1BB-CD3ζ fragment, the amino acid sequence of which is shown in SEQ ID NO.22. The plasmid containing the CD8α-4-1BB-CD3ζ fragment can be prepared by any suitable method in the prior art.
[0156] 2. The A24C9-CD180 scFv and C12F11-CD180 scFv fragments obtained in Example 2 were ligated to the target vector, respectively. Sequencing confirmed that the vector construction was successful and the sequence was correct. Schematic diagrams of the vector are shown in Figures 2 and 3.
[0157] Example 4: Preparation of chimeric antigen receptor CD180 scFv-CD8α-4-1BB-CD3ζ modified T cells
[0158] 1. Plasmid extraction: Expression plasmids A24C9-CD180 scFv-CD8α-4-1BB-CD3ζ and C12F11-CD180 scFv-CD8α-4-1BB-CD3ζ were extracted using an endotoxin-free plasmid mini-extraction kit (TIANGEN DP118). The plasmid solutions were stored at -20°C for subsequent transfection.
[0159] 2. Lentiviral preparation and concentration:
[0160] 1) Trypsin digests 293T cells in the logarithmic growth phase, using 5 × 10⁻⁶ cells. 6 One HEK293T cell was seeded into a 10cm cell culture dish, with a total volume of 10ml. The cell culture dish was incubated at 37℃ and 5% CO2 for 24-36 hours. Transfection was performed when the cell confluence reached 80-90%.
[0161] 2) The transfection system is as follows:
[0162] After mixing the transfection system, let it stand for 15 minutes, then slowly add it dropwise to a 293T culture dish and incubate it in a 37℃, 5% CO2 incubator. Replace the culture medium with a fresh one after 12 hours.
[0163] 3) Collect the virus stock solution 48 hours after the fluid change, filter it through a 0.45μm filter, and centrifuge it at 4℃, 50000g, for 2.5 hours. After centrifugation, concentrate it 10 times, aliquot it, and store it at -80℃ for later use.
[0164] 3. Preparation of T cells:
[0165] Take 10ml of fresh peripheral blood from healthy individuals and extract T cells using RosetteSep T cell enrichment Cocktail (STEMCELL) and Ficoll-Paque lymphocyte separation medium (follow the RosetteSep T cell enrichment Cocktail instructions). Add anti-CD3 / CD28 magnetic beads (Gibco) at a cell:bead ratio of 1:1 and culture for 24 hours to obtain pre-transfection T cells.
[0166] 4. Lentiviral infection of T cells and culture of infected T cells:
[0167] Remove the viral supernatant at -80℃, and administer at a rate of 1×10⁻⁶. 6 Add 100 μl of viral supernatant to T cells, add Polybrene to a final concentration of 8 μg / ml, centrifuge at 32°C, 1800 rpm for 1.5 hours, and then transfer to a 37°C, 5% CO2 incubator for culture.
[0168] 5. Flow cytometry detection of the positive rate of CAR-modified T cells:
[0169] Cells were collected, labeled with goat anti-mouse IgG F(ab')2 antibody, and the expression of F(ab')2 and GFP in T cells was analyzed by flow cytometry. The results are shown in Figure 4, with positive rates of 69.46% and 68.92% for A24C9- and C12F11-CD180 CAR-T cells, respectively.
[0170] Example 5: Killing effect of chimeric antigen receptor CD180 scFv-CD8α-4-1BB-CD3ζ modified T cells on leukemia cells
[0171] 1. Expression level of CD180 in leukemia cell lines:
[0172] OCI-AML2, MV4-11, Molm13, U937, and K562 cell lines were all purchased from ATCC in the United States. After culture, 5 × 10⁶ cells were harvested from each cell line. 5Cells were washed twice with PBS and then labeled with PE anti-human CD180 antibody (Biolegend). A PE-isotype labeling control was used. Cells were incubated at 4°C for 30 min, and the expression levels of CD180 in various cell lines were detected by flow cytometry. The histograms of CD180 expression in the OCI-AML2, MV4-11, Molm13, U937, and K562 cell lines and their corresponding isotype controls are shown in Figure 5A. The mean fluorescence intensity (MFI) results are shown in Figure 5B. The results indicate that the acute myeloid leukemia cell lines OCI-AML2, MV4-11, Molm13, and U937 used in this experiment all express CD180, while K562 does not express CD180.
[0173] 2. Flow cytometry analysis of residual tumor cells after co-culturing chimeric antigen receptor-modified T cells with OCI-AML2, MV4-11, Molm13, U937, and K562 cell lines:
[0174] The above cells were divided into 1×10 5 Cells were seeded into 24-well culture plates, with 2.5 × 10⁶ cells added to each well. 4 (E:T = 1:4), 5 × 10 4 (E:T = 1:2), 1×10 5 (E:T = 1:1), 2 × 10 5 CAR-modified T cells (E:T = 2:1) were used as a control group, and empty vector T cells without CAR were co-cultured in an incubator for 24 h and 48 h. Tumor cell lines were labeled with PE anti-human CD33 antibody (Biolegend), and T cells were labeled with APC anti-human CD3 antibody (Biolegend). Residual tumor cells were detected by flow cytometry, and the in vitro co-culture killing experiment was repeated with T cells from three different donors.
[0175] The results are summarized in Figure 6. 1) Compared with Vector T, both A24C9-CD180 CAR-T and C12F11-CD180 CAR-T significantly killed CD180-positive target cells OCI-AML2, MV4-11, Molm13, and U937, with zero residual target cells after 48 hours of co-culturing at an effector-to-target ratio of 1:1; 2) Compared with Vector T, A24C9-CD180 CAR-T and C12F11-CD180 CAR-T had no killing effect on CD180-negative target cells K562. These results confirm that A24C9-CD180 CAR-T and C12F11-CD180 CAR-T have highly efficient and specific killing effects on CD180-positive target cells, while exhibiting no off-target effects on target cells that do not express CD180.
[0176] 3. Degranulation assay to analyze the activation of CAR-modified T cells:
[0177] Two types of CD180 CAR-T and Vector T cells were co-cultured with K562, OCI-AML2, MV4-11, Molm-13 and U937 cells at an effector-target ratio of 1:1. PE-cy7 CD107a antibody and monensin were added to the co-culture system. GFP was detected by flow cytometry after 6 hours. + The expression level of CD107a on the surface of CAR-T cells was measured. The results are shown in Figure 7. In the co-culture systems of A24C9-CD180 CAR-T and C12F11-CD180 CAR-T with OCI-AML2, MV4-11, Molm-13, and U937 cells, the T cell activation percentage was above 40%. In the co-culture system of Vector T with OCI-AML2, MV4-11, Molm-13, and U937 cells, the T cell activation percentage was <10%. There was a significant difference in degranulation levels between CD180 CAR-T and Vector T (P<0.0001), while there was no significant difference between the two CAR-T groups. The activation level of CD180 CAR-T co-cultured with CD180-negative K562 cells was significantly lower than that co-cultured with CD180-positive OCI-AML2, MV4-11, Molm-13, and U937 cells (P<0.0001). The results above indicate that both CD180 CAR-T cells can be specifically activated by CD180-expressing tumor cells, suggesting that they have target-specific killing effects.
[0178] 4. Phenotypic detection of CAR-modified T cells
[0179] On days 7–9 of culture of A24C9-CD180 CAR-T, C12F11-CD180 CAR-T, and Vector T cells, 1×10⁻⁶ cells were harvested respectively. 5 Cells / tubes were subjected to the following phenotypic analysis by flow cytometry:
[0180] 1) Detection of T cell activation receptor expression: Cells were collected and labeled with flow cytometry antibodies against human PE / Cy7 CD25 (a marker of late T cell activation) and human APC CD69 (a marker of early T cell activation). Cells were incubated at room temperature for 15 min, washed once with PBS, resuspended, and analyzed by flow cytometry. As shown in Figure 8A, there was no significant difference in the expression of CD25 and CD69 activation-related receptors between A24C9-CD180 CAR-T and Vector T. C12F11-CD180 CAR-T showed slightly higher expression of activation-related receptors CD25 and CD69 than Vector T, suggesting a slightly higher level of self-activation in C12F11-CD180 CAR-T.
[0181] 2) Detection of T cell inhibitory receptor expression: Cells were collected and labeled with flow cytometry antibodies against human APC / Cy7 PD-1, human PE / Cy7 LAG3, and human PE TIM3. Cells were incubated at room temperature for 15 min, washed once with PBS, resuspended, and analyzed by flow cytometry. As shown in Figure 8B, the positive expression rate of the inhibitory receptor PD-1 showed no statistically significant difference between the two CD180 CAR-T groups and Vector T, while the positive expression rates of inhibitory receptors LAG3 and TIM3 were higher in the C12F11-CD180 CAR-T group.
[0182] 3) Detection of CD8 positivity rate and CD45RA / CCR7 cell populations in T cells: Cells were collected and labeled with anti-human PerCP CD8, anti-human APC / Cy7 CD45RA, and anti-human PE CCR7 flow cytometry antibodies. Cells were incubated at room temperature for 15 min, washed once with PBS, resuspended, and analyzed by flow cytometry. The results are shown in Figure 8C. The CD8 positivity rate varied among the A24C9-CD180 CAR-T, C12F11-CD180 CAR-T, and Vector T groups. + The proportion of T cells showed no significant difference. Cell population analysis using CD45RA and CCR7 markers showed that CD45RA... + CCR7 + Stem cell-like memory T cells SCM CD45RA - CCR7 + Central memory T cells CM CD45RA -CCR7 - Effector memory T cells EM ) and CD45RA + CCR7 - Terminal differentiation effector T cells (CD45RA) + effector memory, T EMRA There were no significant differences between the subgroups.
[0183] 5. Immunofluorescence assay was used to detect the levels of cytokines IL-2, TNF-α, and IFN-γ in the supernatant of leukemia cell lines co-cultured with CAR-T cells:
[0184] K562, OCI-AML2, MV4-11, Molm13, and U937 cell lines were respectively divided into groups of 1×10⁻⁶. 5 Cells / well seeded in 24-well plates at 1×10⁶ cells / well 5 Cells were added to wells with A24C9-CD180 CAR-T, C12F11-CD180 CAR-T, and Vector T cells at an effector-to-target ratio of 1:1. Culture medium was added to 1 ml, and the cells were co-cultured for 48 hours. The supernatant was collected by centrifugation. The levels of various cytokines in the co-culture supernatant were detected using a cytokine co-detection kit (Hangzhou Saiji Biotechnology) (see the cytokine co-detection kit instructions for specific steps). The results are shown in Figure 9. The levels of IL-2, TNF-α, and IFN-γ cytokines in the supernatant co-cultured with the two CD180 CAR-T cells and CD180-positive AML cell lines OCI-AML2, MV4-11, Molm13, and U937 were significantly higher than those in the Vector T group. However, the levels of IL-2, TNF-α, and IFN-γ in the supernatant co-cultured with CAR-T cells and Vector T cells and CD180-negative K562 cells were lower. The results showed that A24C9-CD180CAR-T and C12F11-CD180CAR-T were able to significantly secrete Th1 cytokines when stimulated by CD180-expressing tumor cells.
[0185] Example 6: Safety verification of chimeric antigen receptor CD180 scFv-CD8α-4-1BB-CD3ζ modified T cells on umbilical cord blood-derived hematopoietic stem and progenitor cells
[0186] 1. Separation of umbilical cord blood from normal human CD34 + cell
[0187] Umbilical cord blood red blood cells were precipitated by mixing hydroxyethyl starch with umbilical cord blood at a 1:5 ratio. The supernatant was then collected, and umbilical cord blood mononuclear cells were obtained using Ficoll-Paque lymphocyte separation medium. CD34 levels from normal individuals derived from umbilical cord blood were obtained by sorting using magnetic beads in a CD34 Microbeads Kit (Miltenyi). + Hematopoietic stem cells (UCB-CD34) + cell).
[0188] 2. Detection of CD180 CAR-T against UCB-CD34 + Does the cell have a killing effect?
[0189] 1) Flow cytometry detection of UCB-CD34 + The expression of CD180 on the cell surface is shown in Figure 10A, UCB-CD34. + The absence of CD180 molecules on the cell surface suggests that CD180 CAR-T may not affect normal hematopoietic stem and progenitor cells, and CD180 may serve as a new target for immunotherapy with relatively high safety.
[0190] 2) The separated UCB-CD34 + Cells were cultured in SFEM stem cell culture medium at 5 × 10⁻⁶ m². 4 Cells were seeded into 48-well culture plates, and 5 × 10⁵ cells were added to each well at an effector-to-target ratio of 1:1. 4 Vector T, A24C9-CD180CAR-T, or C12F11-CD180CAR-T were co-cultured in an incubator for 24 hours, and then CD3 was detected by flow cytometry. + T cells and CD34 + The proportion of hematopoietic stem and progenitor cells is shown in Figure 10B. Compared with Vector T, the two CD180 CAR-T cells and UCB-CD34... + The proportions of hematopoietic stem and progenitor cells showed no significant difference after cell co-culture, suggesting that A24C9-CD180 CAR-T and C12F11-CD180 CAR-T cells have a positive effect on UCB-CD34. + The cells did not show any obvious killing effect.
[0191] 3. Detection of CD180 CAR-T against UCB-CD34 + Effects on cell colony-forming ability:
[0192] 1) Collect the cells remaining after co-culturing with CD180 CAR-T or Vector T for 24 hours, centrifuge and count them, resuspend them in stem cell culture medium, and adjust the UCB-CD34 ratio. +Cell density: Four groups were set up: untreated UCB34, Vector T, A24C9-CD180 CAR-T, and C12F11-CD180 CAR-T. Each group had 3 accessory wells, with approximately 500 UCB-CD34 cells per well. + Cells were seeded in 300 μl / well of methylcellulose semi-solid medium (STEMCELL H4434), vortexed thoroughly, and slowly added to 24-well plates using a 5 ml syringe, avoiding the generation of air bubbles.
[0193] 2) Add sterile ddH2O around the 24-well plate containing the colony and incubate at 37°C and 5% CO2 for about 14 days.
[0194] 3) The overall morphology of the colonies was captured using a high-content imaging system, and the number of different types of colonies was counted under a microscope. As shown in Figures 10C and D, after co-culturing with CAR-T and Vecto T, respectively, the number of UCB-CD34 colonies in each group... + There was no significant difference in the number of BFU-E, CFU-GM, and CFU-GEMM colonies formed by cells, suggesting that A24C9-CD180 CAR-T and C12F11-CD180 CAR-T do not affect UCB-CD34. + The colony-forming ability of cells, namely CD180 CAR-T, demonstrates safety for hematopoietic stem and progenitor cells.
[0195] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. A chimeric antigen receptor targeting CD180, said chimeric antigen receptor comprising an extracellular region, a transmembrane region, and an intracellular region, characterized in that, The extracellular region contains a binding domain that specifically binds to human CD180 molecules, and the binding domain includes: The amino acid sequence of CDRH1 in the heavy chain variable region, as shown in SEQ ID No. 1 or 7; The amino acid sequence of CDRH2 in the heavy chain variable region, as shown in SEQ ID No. 2 or 8; The amino acid sequence of CDRH3 in the heavy chain variable region, as shown in SEQ ID No. 3 or 9; The amino acid sequence of CDRL1 in the light chain variable region, as shown in SEQ ID No. 4 or 10; The amino acid sequence of CDRL2 in the light chain variable region, as shown in SEQ ID No. 5 or 11; and The amino acid sequence of CDRL3 in the light chain variable region, as shown in SEQ ID No. 6 or 12. Or a sequence that has 85% to 99% identity with the amino acid sequence and has the same biological function.
2. The chimeric antigen receptor according to claim 1, characterized in that, The combined structural domain includes: The amino acid sequence of the heavy chain variable region as shown in SEQ ID No. 13 or 15; and The amino acid sequence of the light chain variable region, as shown in SEQ ID No. 14 or 16, Or a sequence that has 85% to 99% identity with the amino acid sequence and has the same biological function.
3. The chimeric antigen receptor according to claim 1 or 2, characterized in that, The binding domain is Fab, Fab', F(ab')2, Fd, FCL, dAb, single-chain antibody scFv, chimeric antibody, humanized antibody, or fully human antibody that specifically binds to human CD180 molecules. Preferably, the binding domain is a single-chain antibody scFv that specifically binds to human CD180 molecules, and the single-chain antibody scFv comprises: The amino acid sequence of CDRH1 in the heavy chain variable region, as shown in SEQ ID No. 1 or 7; The amino acid sequence of CDRH2 in the heavy chain variable region, as shown in SEQ ID No. 2 or 8; The amino acid sequence of CDRH3 in the heavy chain variable region, as shown in SEQ ID No. 3 or 9; The amino acid sequence of CDRL1 in the light chain variable region, as shown in SEQ ID No. 4 or 10; The amino acid sequence of CDRL2 in the light chain variable region, as shown in SEQ ID No. 5 or 11; and The amino acid sequence of CDRL3 in the light chain variable region, as shown in SEQ ID No. 6 or 12. Or a sequence that has 85% to 99% identity with the amino acid sequence and has the same biological function.
4. The chimeric antigen receptor according to claim 1 or 2, characterized in that, The extracellular region includes at least one of the binding domains, which are operatively connected by a linker.
5. The chimeric antigen receptor according to claim 4, characterized in that, The extracellular region also includes a second binding domain that specifically binds to other proteins, specifically the following proteins: CD33, CD123, CLEC12A, ADGRE2, LILRB4, Siglec6, CD47, FLT-3, PDGFR, VEGFR, KIT, IDH1, IDH2, SMO, BCL-2, ALT, c-KIT, CD70, CD38, CD86, CD45, PD-1 / PD-L1, CTLA-4, TIM-3, and T. LR-2, CD3, CD4, IL-2, CD7, CD19, CD20, BAFF, TLR-4, TLR-7, TLR-8, TNF-α, IL-6, IL-6R, IL-10, IL-10R, IL-17A, IL-17RA, IL-12, IL-23, IL-4, α4 integrin, cell adhesion molecules, complement factor D, JAK1, JAK2, JAK3, TYK2, IL-5, URAT1, TSLP, MASP-2, CSF1R or ROCK2.
6. The chimeric antigen receptor according to claim 1 or 2, characterized in that, The amino acid sequence of the binding domain is shown in SEQ ID No. 17 or 18.
7. The chimeric antigen receptor according to claim 1 or 2, characterized in that, The extracellular region also includes a signal peptide constructed at the amino terminus of the chimeric antigen receptor or a sequence that has more than 90% identity with the signal peptide and has the same biological function as it. Preferably, the signal peptide is a signal peptide sequence in CD8α or GM-CSF; More preferably, the signal peptide is the signal peptide shown in SEQ ID NO.
19.
8. The chimeric antigen receptor according to claim 1 or 2, characterized in that, The binding domain of the extracellular region is connected to the transmembrane region via a hinge region; The hinge region is preferably a hinge region sequence in CD8α; The transmembrane region is a transmembrane domain selected from the following proteins or sequences that have more than 90% identity with the proteins and have the same biological function: α, β or ζ chains of T cell receptors, CD2, CD3ε, CD4, CD7, CD8α, CD8β, CD11a, CD11b, CD11c, CD11d, CD18, CD19, CD27, CD28, CD29, CD30, CD40, CD48, CD49a, CD49d, CD49f, CD66a, CD66b, CD66c, CD66d, CD66e, CD69, CD79A, CD79B, CD84, CD96, CD100, CD103 , CD134, CD137, CD150, CD158A, CD158B1, CD158B2, CD158C, CD158D, CD158F1, CD158F2, CD158K, CD160, CD162, CD226, CD229, CD244, CD247, CD258, CD268, CD270, CD272, CD276, CD279, CD314, CD319, CD335, CD336, CD337, CD352, CD353, CD355, CD357, LFA-1, NKG2C, DAP-10, ICAM-1, NKp80, IL-2R beta, IL-2R gamma, IL-7R alpha, LFA-1, SLAMF9, LAT, GADS, SLP-76, PAG1 / CBP, CD83 ligand, Fc gamma receptor, integrin, activating NK cell receptor or Toll ligand receptor, or combinations thereof. Preferably, the transmembrane region is a transmembrane region sequence in CD8α.
9. The chimeric antigen receptor according to claim 1, characterized in that, The intracellular region also contains co-stimulatory molecules; Preferably, the co-stimulatory molecule is one or more functional signaling domains obtained by means of proteins selected from or having a sequence that is more than 90% identical to the protein and has the same biological function: integrin, BTLA, Toll ligand receptor, OX40, CD2, CD7, CD27, CD28, CD30, CD40, CDS, ICAM-1, LFA-1, 4-1BB, B7-H3, CD278, GITR, BAFFR, LIGHT, HVEM, KIRDS2, SLAMF7, NKp80, NKp44, NKp30, NKp46, CD19, CD4, CD8α, CD8β, IL2Rβ, IL2Rγ, IL7Rα , ITGA4, VLA1, CD49α, IA4, CD49D, ITGA6, VLA6, CD49f, ITGAD, CD11d, ITGAE, CD103, ITGAL, CD11α, ITGAM, CD11b, ITGAX, CD11c, CD29, ITGB1, ITGB2, CD18, ITGB7, NKG2D, NKG2C, TNFR2, CD226, CD84, CD96, CEACAM1, CRTAM, CD229, CD160, PSGL1, CD100, CD69, SLAMF6, SLAM, BLAME, CD162, LTBR, LAT, GADS or SLP-76; More preferably, the co-stimulatory molecule is CD28 or 4-1BB, or a sequence that has more than 90% identity with it and has the same biological function.
10. The chimeric antigen receptor according to claim 1 or 2, characterized in that, The intracellular region includes an intracellular signal transduction region, which is a sequence selected from the following proteins or sequences that have more than 90% identity with the proteins and have the same biological function: 4-1BB, B7-H3, BAFFR, BLAME, BTLA, CD100, CD103, CD160, CD18, CD19, CD19a, CD2, CD247, CD27, CD276, CD28, CD29, CD3ζ, CD30, CD4, CD40, CD49a, CD49D, CD49f, CD69, CD7, CD84, CD8alpha, CD8beta, CD96, CDS, CEACAM1, CRTAM, DAP-10, DNAM1, Fc gamma receptor, GADS, GITR, HVEM, IA4, ICAM-1, ICAM-1, Ig alpha, IL2R beta, IL2R gamma, IL7R alpha, integrin, ITGA4, ITGA4, ITGA6, ITGAD, ITGAE, ITGAL, ITGAM, ITGAX, ITGB2, ITGB7, KIRDS2, LAT, LFA-1, LFA-1, LIGHT, LIGHT, LTBR, Ly9, NKG2C, NKG2D, NKp30, NKp44, NKp46, NKp80, OX-40, PAG / Cbp, PD-1, PSGL1, SELPLG, SLAMF4, SLAMF6, SLAMF7, SLP-76, TNFR2, Toll ligand receptor, TRANCE / RANKL, VLA1 or VLA-6, or combinations thereof; Preferably, the intracellular signal transduction region is CD3ζ.
11. The chimeric antigen receptor according to claim 1 or 2, characterized in that, The amino acid sequence of the chimeric antigen receptor is as shown in SEQ ID NO. 20 or 21, or a sequence that has more than 90% identity with it and has the same biological function.
12. An isolated nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the amino acid sequence of the chimeric antigen receptor as described in any one of claims 1 to 11.
13. A carrier, characterized in that, The vector contains the sequence of the nucleic acid molecule as described in claim 12; Preferably, the vector is a plasmid vector, lentiviral vector, adenovirus vector, adeno-associated virus vector, or retroviral vector; More preferably, the vector contains an EF1α promoter sequence.
14. An isolated cell, characterized in that, The cell contains the chimeric antigen receptor as described in any one of claims 1 to 11, the nucleic acid molecule as described in claim 12, or the vector as described in claim 13; Preferably, the cells are i) immune response cells, preferably T cells, NK cells, NKT cells, macrophages, monocytes, neutrophils or CTL cells, more preferably T cells; or ii) induced pluripotent stem cells (iPSCs). More preferably, the cells are autologous or allogeneic T cells; More preferably, the cells are autologous T cells.
15. The isolated cells according to claim 14, characterized in that, The cells are allogeneic T cells, and the T cells are universal chimeric antigen receptor T cells; Preferably, the T cells lack genes encoding TCR, HLA, CD52, or PD-1.
16. The use of the chimeric antigen receptor as described in any one of claims 1 to 11, the nucleic acid molecule as described in claim 12, the vector as described in claim 13, and the cell as described in claim 14 or 15 in the preparation of a medicament for treating the following diseases: tumors, autoimmune diseases, graft-versus-host disease, or infections; Preferably, the tumor is a CD180-positive tumor, and the CD180-positive tumor is selected from breast cancer, neurotumor, melanoma, lung cancer, head and neck cancer, colorectal cancer, pancreatic cancer, gastric cancer, kidney cancer, bladder cancer, prostate cancer, ovarian cancer, cervical cancer, glioblastoma, esophageal cancer, bladder cancer, renal cell carcinoma, endometrial cancer, skin cancer, testicular cancer, thyroid cancer, lymphoma, leukemia, and multiple myeloma. More preferably, the tumor is acute myeloid leukemia; More preferably, the tumor is relapsed or refractory acute myeloid leukemia.
17. The use of the chimeric antigen receptor as described in any one of claims 1 to 11, the nucleic acid molecule as described in claim 12, the vector as described in claim 13, or the cell as described in claim 14 or 15 in the preparation of a medicament for treating TLR4-mediated diseases.
18. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the chimeric antigen receptor as described in any one of claims 1 to 11, the nucleic acid molecule as described in claim 12, the carrier as described in claim 13, and the cell as described in claim 14 or 15.