Method for improving tolerance to citrus canker by using csahl15 gene, and use thereof
By cloning the CsAHL15 gene of citrus and constructing an overexpression vector to transform citrus, CsAHL15 overexpressing transgenic plants were obtained, which solved the problem of poor resistance to citrus canker and achieved a significant reduction in the severity of canker.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- INTEGRATIVE SCIENCE CENTER OF GERMPLASM CREATION IN WESTERN CHINA (CHONGQING) SCIENCE CITY
- Filing Date
- 2025-12-24
- Publication Date
- 2026-07-30
AI Technical Summary
Existing citrus varieties have poor resistance to citrus canker. Chemical control is environmentally unfriendly and costly, while biological control is ineffective. Breeding efficiency is low, and there is a lack of effective genetic engineering methods to improve resistance.
By cloning the CsAHL15 gene of citrus, constructing an overexpression vector and transforming it into citrus, CsAHL15 overexpressing transgenic plants were obtained, which significantly improved the resistance of citrus to citrus canker.
CsAHL15 overexpression transgenic plants can significantly reduce the severity of ulcer disease, with a 40.09% reduction in lesion area, thus alleviating the severity of ulcer disease and providing a new approach for bioengineering breeding.
Smart Images
Figure CN2025145096_30072026_PF_FP_ABST
Abstract
Description
Methods and applications of CsAHL15 gene to enhance resistance to citrus canker Technical Field
[0001] This invention relates to the field of agricultural biogenetics, specifically to a method and application of the CsAHL15 gene to enhance resistance to citrus canker. Background Technology
[0002] Citrus is the largest fruit crop in southern my country and an important economic crop globally. However, citrus canker severely hinders the healthy development of the citrus industry (Hu Junhua et al., 2015). Citrus canker is caused by Xanthomonas citri subsp. citri (Xcc), a pathogenic species of Xanthomonas, originating in India, Java, and other regions (Hu Junhua et al., 2015). Major citrus-producing areas in my country, such as Fujian, Hunan, and Guangdong, are severely affected by citrus canker. The canker pathogen mainly infects citrus leaves, twigs, and fruits, with seedlings and young trees being particularly vulnerable (He Xiuling et al., 2007). Diseased trees exhibit leaf drop, twig dieback, weakened tree vigor, and fruit drop, severely impacting citrus yield and quality. Dozens of Rutaceae species are susceptible to citrus canker, the vast majority of which are commercially cultivated varieties. Studies have found that sweet oranges are most susceptible to disease, followed by sour oranges and grapefruits (Yuan Chengdong et al., 1997; Li Min et al., 2013).
[0003] Currently, the control of citrus canker disease typically employs an integrated management strategy, primarily using chemical control supplemented by biological control. However, chemical control measures are environmentally unfriendly, easily causing pollution and requiring significant human and material resources. Biological control is less effective and more costly. Therefore, there is an urgent need to cultivate new disease-resistant varieties to reduce losses caused by canker (Chen et al., 2008; Zhu et al., 2017). The long cycle of hybridization breeding results in low breeding efficiency. With the rise of molecular biology, researchers have begun to study the pathogen itself and the plant's disease resistance response through genetic engineering. Genetic engineering techniques have also been explored in canker resistance research (Duan et al., 2016; Jia et al., 2017), yielding some transgenic materials resistant to canker. For example, Chen et al. obtained Jincheng, Xinhui, and Navel orange lines resistant to citrus canker by transgenic silkworm antimicrobial peptide D gene (Chen et al., 1996); exogenous genes NLS, chit42, Xa21, and PthA, after being transferred to Bingtang orange, Ponkan, and sweet orange, showed resistance to citrus canker (Mendes et al., 2010; Yang et al., 2011); CsBZIP40 is an important transcription factor responding to citrus canker infection, and it is speculated that it affects the resistance of citrus varieties through the SA pathway (Li et al., 2017); the CsLOB1 gene, as a target protein of the canker pathogen gene PthA, makes citrus more susceptible to canker (Li et al., 2014); targeted knockout of the CsLOB1 promoter, a citrus canker susceptibility gene, by CRISPR / Cas9 can obtain plants with increased resistance to citrus canker (Penget). al., 2017).
[0004] The AT-hook motif nuclear localization (AHL) gene family is a highly conserved transcription factor crucial for plant growth, development, and stress tolerance (Karami O et al., 2023). For example, overexpression of AtAHL15 in Arabidopsis thaliana inhibits plant maturation and senescence (Rahimi A et al., 2023); BrAHL16 in Chinese cabbage is upregulated for 4 hours under drought stress to improve plant tolerance to drought stress (Zhang X et al., 2023); and AtAHL13 knockout mutants in Arabidopsis thaliana exhibit reduced abilities in pathogen-associated molecular pattern (PAMP)-induced reactive oxygen species production, defense gene expression, and PAMP-induced immunity (Rayapuram Net et al., 2021). Currently, there are no studies or applications using AHL to enhance citrus resistance to citrus canker.
[0005] Based on the above, it is still necessary to specifically explore genes closely related to the citrus canker resistance pathway and conduct in-depth analysis of their functions and molecular mechanisms in order to obtain transgenic citrus lines with significant resistance to canker. Summary of the Invention
[0006] The technical problem to be solved by this invention is that existing citrus fruits have poor resistance to citrus canker. To provide a new option for improving the resistance of citrus fruits to citrus canker, the invention aims to provide a method and application for improving the resistance of citrus fruits to citrus canker by using the CsAHL15 gene. By integrating a citrus transcription factor encoding gene into citrus fruits through an expression vector, the resistance of citrus fruits to citrus canker can be effectively improved. This has significant application value for breeding citrus fruits resistant to citrus canker.
[0007] This invention is achieved through the following technical solution:
[0008] In a first aspect, the present invention provides an application of overexpressing the CsAHL15 gene to improve resistance to citrus canker, wherein the CsAHL15 gene is a transcription factor containing a DNA-binding hook nuclear localization protein.
[0009] As one possible design, the CsAHL15 coding sequence described above is the nucleotide sequence shown in SEQ ID No. 1.
[0010] Secondly, the present invention provides a method for improving resistance to citrus canker using CsAHL15, comprising the following steps:
[0011] (1) Cloning the CsAHL15 coding sequence of citrus, the CsAHL15 coding sequence being shown in SEQ ID No. 1;
[0012] (2) Constructing a CsAHL15 overexpression vector;
[0013] (3) Citrus was transformed with CsAHL15 overexpression vector and transgenic plants with improved resistance to citrus canker were obtained after identification.
[0014] As one possible design, in step (1) above, the cloning method for the citrus CsAHL15 coding sequence is as follows: extract total RNA from citrus, reverse transcribe it into cDNA as a template, use primers OE-CsAHL15-F and OE-CsAHL15-R for PCR amplification and recover the CsAHL15 coding sequence DNA fragment, wherein the primers OE-CsAHL15-F and OE-CsAHL15-R have the nucleotide sequences shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.
[0015] As one possible design, in step (2) above, the CsAHL15 overexpression vector is constructed as follows: the CsAHL15 coding sequence DNA fragment recovered by KpnI and EcoRI enzyme digestion is then ligated into the pLGNe vector recovered by KpnI and EcoRI enzyme digestion to construct the overexpression vector pLGNe-CsAHL15.
[0016] As a possible design, in step (3) above, the method of transforming citrus with the CsAHL15 overexpression vector is as follows: the overexpression vector pLGNe-CsAHL15 is transformed into Agrobacterium tumefaciens by electroporation, and then Agrobacterium tumefaciens is used to mediate the transformation of citrus explants.
[0017] As one possible design, the transformed citrus explant cells were further identified by GUS staining, PCR, qRT-PCR analysis, and CsAHL15 expression level to obtain transgenic plants.
[0018] As one possible design, the primers for the PCR identification of transgenic plants are ID-CsAHL15-F and ID-CsAHL15-R. ID-CsAHL15-F is designed based on the first end sequence of the CsAHL15 gene, and ID-CsAHL15-R is a sequence taken from the CaMV 35S segment on the pLGNe vector. ID-CsAHL15-F and ID-CsAHL15-R are the nucleotide sequences shown in SEQ ID No. 4 and SEQ ID No. 5, respectively.
[0019] As one possible design, the primers for the above qRT-PCR analysis of CsAHL15 expression are RT-CsAHL15-F and RT-CsAHL15-R, where RT-CsAHL15-F and RT-CsAHL15-R are the nucleotide sequences shown in SEQ ID No. 6 and SEQ ID No. 7, respectively.
[0020] As a possible design, after obtaining transgenic plants in step (3) above, the transgenic plants are evaluated for resistance, and it is determined that CsAHL15 overexpression improves resistance to citrus canker.
[0021] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0022] This invention involves cloning the CsAHL15 coding sequence of citrus, constructing an overexpression vector, and then transforming citrus plants. The resulting transgenic plants exhibit a reduction in the severity of citrus canker disease to as low as 40.09% of existing citrus varieties, significantly alleviating the disease's severity and reducing lesion area. In conclusion, this invention represents a promising bioengineering technology for enhancing citrus canker resistance and has significant value for molecular breeding of citrus plants resistant to canker disease. Attached Figure Description
[0023] To more clearly illustrate the technical solutions of the exemplary embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly described below. It should be understood that the following drawings only show some embodiments of the present invention and should not be considered as a limitation of the scope. For those skilled in the art, other related drawings can be obtained based on these drawings without creative effort. In the drawings:
[0024] Figure 1 shows the bioinformatics characteristics of CsAHL15 in this invention: A is the chromosomal location of the citrus CsAHL15 gene, where bp represents a base; B is the gene structure of citrus CsAHL15; C is the conserved domain of the citrus CsAHL15 gene, where aa represents an amino acid.
[0025] Figure 2 is a PCR amplification electrophoresis diagram of the CsAHL15 gene clone of the present invention: CDS represents the CsAHL15 coding sequence; M represents the DNA molecular weight standard, the same below.
[0026] Figure 3 is a structural diagram of the CsAHL15 plant overexpression vector of the present invention: GUS represents the β-glucosidase gene; CaMV 35S represents the plant constitutive promoter derived from cauliflower mosaic virus; NOS represents the crown gall synthase gene terminator.
[0027] Figure 4 is a flowchart of the citrus genetic transformation process of the present invention.
[0028] Figure 5 shows the GUS staining diagram of the transgenic plants of this invention: OE-AHL15-2, OE-AHL15-3, and OE-AHL15-4 represent transgenic plants, and WT represents wild-type Late Orange plants, the same below.
[0029] Figure 6 shows the PCR identification diagram of the transgenic plant of the present invention, where + indicates plasmid pLGNe-CsAHL15.
[0030] Figure 7 shows the expression level analysis of CsAHL15 in the transgenic plants of this invention: This indicates a highly significant difference compared to WT (P=0.01). This indicates a highly significant difference compared to WT (P<0.001). This indicates a highly significant difference compared to WT (P<0.0001), and the same applies below.
[0031] Figure 8 shows the phenotypic diagram of the transgenic plant of this invention.
[0032] Figure 9 shows the symptoms of the transgenic plant leaves 10 days after inoculation with ulcer pathogen.
[0033] Figure 10 is a statistical chart of the size of lesions on the leaves of the transgenic plants of this invention 10 days after inoculation with ulcer pathogen.
[0034] Figure 11 is a statistical chart of the disease index of the transgenic plant leaves of the present invention 10 days after inoculation with ulcer pathogen. Detailed Implementation
[0035] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments and accompanying drawings. The illustrative embodiments and descriptions of this invention are for explanation only and are not intended to limit the invention. Unless otherwise specified in the embodiments, conventional conditions or conditions recommended by the manufacturer shall apply. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.
[0036] It should be noted that: the embodiments of the present invention use late-maturing oranges as the test object. In practical applications, this method can also be used to improve the resistance of other citrus varieties to citrus canker.
[0037] The following examples refer to the citrus genetic transformation flowchart in Figure 4.
[0038] Example 1
[0039] Bioinformatics analysis of the citrus CsAHL15 gene
[0040] The citrus CsAHL15 gene is located between 833846 bp and 836675 bp on citrus chromosome 7, which is 2.83 kbp in length. The full-length CDS sequence is 1017 bp and encodes 338 amino acids. Analysis of the protein sequence shows the presence of a distinct PPC structural functional domain (see Figure 1).
[0041] The CsAHL15 gene has the nucleotide sequence shown in SEQ ID NO: 1 (CsAHL15 CDS sequence, ATG to stop codon), as follows:
[0042]
[0043] Example 2
[0044] Cloning of the CsAHL15 coding sequence of citrus
[0045] 1. RNA extraction and cDNA synthesis
[0046] Total RNA was extracted from citrus (Late Orange) leaves using a plant total RNA extraction kit (Adley, CAT: RN09). RNA quality was verified by agarose gel electrophoresis, and its concentration was determined using a concentration meter. cDNA was synthesized using a reverse transcription kit PrimeScript RT Master Mix (TaKaRa, CAT: RR036A).
[0047] 2. PCR amplification of the CsAHL15 coding sequence
[0048] A DNA fragment encoding the CsAHL15 gene was amplified from citrus cDNA using primers OE-CsAHL15-F (SEQ ID No. 2), OE-CsAHL15-R (SEQ ID No. 3), and the high-fidelity enzyme PrimeSTARMax DNA Polymerase (TaKaRa, CAT: R045Q). The fragment length was 1017 bp (see Figure 2). The amplified DNA fragment was sequenced and identified as the citrus CsAHL15 gene coding sequence (SEQ ID No. 1). Under UV light, an agarose gel block containing the target fragment was cut with a clean blade, and the DNA fragment was recovered using a kit (BioFlux, CAT: BSC02M1).
[0049] PCR amplification program: 98℃, 5 min; 98℃, 30 s, 56℃, 30 s, 72℃, 1.5 min, 35 cycles; extension at 72℃ for 10 min.
[0050] The nucleotide sequence of primer OE-CsAHL15-F is shown in SEQ ID No. 2 (containing the restriction enzyme site), as follows:
[0051] GGTACCATGGCTAATCGATGGTGGGC
[0052] The nucleotide sequence of primer OE-CsAHL15-R is shown in SEQ ID No. 3 (containing the restriction enzyme site and 3×flag tag sequence), as follows:
[0053] GAATTCTTACTTATCATCATCATCCTTGTAATCCTTATCATCATCCTTGTAATCCTTATCATCATCCTTGTAATCGTTAAACGGAGGTGGTCGAGG
[0054] Example 3
[0055] Construction of CsAHL15 overexpression vector and transformation of Agrobacterium tumefaciens
[0056] 1. Construction of overexpression vectors
[0057] The CsAHL15 coding sequence DNA fragment and the overexpression vector pLGNe were double-digested with restriction endonucleases KpnI and EcoRI (ThermoFisher), then recovered by gel extraction and ligated overnight at 16°C using the T4 DNA Ligase kit (Promega, CAT: M1801). The ligation product was transformed into E. coli DH5α, and plasmids from positive clones were extracted using a plasmid extraction kit (Omega, CAT: D6942) to obtain the CsAHL15 overexpression vector pLGNe-CsAHL15 (see Figure 3).
[0058] 2. Transformation of Agrobacterium with overexpression vector
[0059] The constructed overexpression vector was introduced into Agrobacterium tumefaciens EHA105 using an electroporation method. The method is as follows: Thaw 50 μL of frozen Agrobacterium competent cells EHA105 on ice; add 2 μL of the plasmid of the overexpression vector to the competent cells, mix by pipetting, and place on ice for 5 min; transfer the mixture to the bottom of a pre-dried electroporation cuvette, place the cuvette into the slot and adjust to the correct position, adjust the electroporation device to the "Agr" setting, press the electroporation button, and check the electroporation data to ensure successful electroporation; add 1 mL of LB liquid medium to the electroporation cuvette, mix by pipetting, transfer to a sterile centrifuge tube, and incubate at 260 r / min, 28℃, and shake for 60 min; centrifuge the bacterial culture at 10000 r / min for 1 min, discard the supernatant (leaving approximately 100 μL for resuspending the bacterial cells), resuspend, spread, and incubate in the dark at 28℃ for 2 days; after plaque growth, use primers OE-CsAHL15-F (SEQ ID No. 2) and OE-CsAHL15-R (SEQ ID No. 2) to... PCR verification was performed on single colonies using ID No. 3.
[0060] PCR reaction conditions: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min.
[0061] Example 4
[0062] CsAHL15 overexpression vector genetically transformed citrus
[0063] Citrus genetic transformation was carried out according to the process shown in Figure 4. The specific operations are as follows:
[0064] 1. Obtaining the hypocotyl from citrus seedlings
[0065] Fresh citrus fruits were washed, surface-sterilized with 70% alcohol, and seeds were extracted under aseptic conditions. The seed coats were peeled off, and the seeds were germinated on seed germination medium. They were then cultured in the dark at 28°C for 2 weeks, followed by 1 week of culture under 16h light / 8h dark conditions. Under aseptic conditions, the epicotyls of the germinated seedlings were cut into 1cm stem segments for Agrobacterium tumefaciens-mediated genetic transformation.
[0066] 2. Preparation of Agrobacterium tumefaciens bacterial suspension
[0067] Before transfection, Agrobacterium for transfection (containing the pLGNe-CsAHL15 vector) was streaked on LB solid medium containing 50 mg / L kanamycin. Single colonies were picked and inoculated into 25 mL of LB liquid medium containing the same antibiotic and cultured overnight at 28°C with shaking. The bacterial culture was diluted to OD=0.1 and cultured until OD=0.5. After centrifugation at 5000 r / min for 10 min, the supernatant was discarded and the culture was resuspended in MS liquid medium at pH 5.4 for transfection.
[0068] 3. Citrus epicotyl transformation
[0069] After soaking the citrus hypocotyl stem segments in Agrobacterium tumefaciens solution for 13 min and drying them, the stem segments were transferred to a co-culture medium and cultured in the dark at 26°C for 2 days. After co-culture, the hypocotyls were transferred to a selection medium and cultured in the dark at 28°C for 7 days. The hypocotyls were cultured at 28°C under 16h light / 8h dark conditions, and subcultured every two weeks. Then, GUS staining was used for identification.
[0070] 4. Seedling culture of transformants
[0071] When the seedlings grow to more than 1cm, they are cut off and grafted onto the late-maturing orange seedlings in sterile test tubes and cultured in the seedling culture medium; when the seedlings grow to about 5cm, they are grafted onto trifoliate orange seedlings and cultured in a greenhouse at 28℃.
[0072] The culture medium used in this embodiment is as follows:
[0073] Seed germination medium: MS + 30 g / L sucrose + 2.5 g / L gelrite, pH 5.8.
[0074] Co-culture medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 1 mg / L 2,4-D + 100 μmol AS + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.
[0075] Screening medium: MS + 2 mg / L BA + 0.5 mg / L IAA + 500 mg / L Cef + 50 mg / L Kan + 30 g / L sucrose + 2.5 g / L Gelrite, pH 5.8.
[0076] Seedling culture medium: MS + 30 g / L sucrose, pH 5.8.
[0077] Example 5
[0078] CsAHL15 overexpression transgenic plants were validated.
[0079] 1. GUS staining identification of transgenic plants
[0080] The leaves of the transgenic plants obtained from the initial screening were cut into leaf discs (7 mm in diameter) and subjected to GUS histochemical staining (24 h). The leaf discs of positive plants showed blue edges, while the leaf discs of WT plants did not show color (see Figure 5).
[0081] 2. PCR identification of transgenic plants
[0082] Genomic DNA was extracted from 100 mg of leaves from transgenic plants using a DNA extraction kit (Adley, CAT: DN15). PCR was used to detect the integration of the CsAHL15 coding sequence into the citrus genome. The detection primers were ID-CsAHL15-F (SEQ ID No. 4) and ID-CsAHL15-R (SEQ ID No. 5). Positive plants yielded a 1051 bp amplified fragment, while WT plants showed no amplification (see Figure 6).
[0083] PCR reaction conditions: 94℃ for 3 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 30 s, 30 cycles; 72℃ for 10 min.
[0084] 3. qRT-PCR analysis of transgenic plants
[0085] Total RNA (Adelaide, CAT No: RN09) was extracted from leaves of transgenic plants and cDNA was synthesized using the PrimeScript RT Master Mix reverse transcription kit (TaKaRa, CAT: RR036A). The expression level of the target gene was detected by qRT-PCR. The detection primers were RT-CsAHL15-F (SEQ ID No. 6) and RT-CsAHL15-R (SEQ ID No. 7). Two... -△△Ct The relative expression level of the CsAHL15 gene in transgenic plants was calculated as follows: The water-treated sample was defined as the reference factor, with a CsAHL15 expression level of 1. The fold increase in gene expression relative to the reference factor in transgenic citrus was then calculated as 2. -△△Ct The relative expression level was calculated. The results showed that the CsAHL15 gene was highly expressed in transgenic plants compared to wild-type plants (at least 143 times that of the control) (see Figure 7).
[0086] qRT-PCR reaction conditions: 95℃ for 3 min, 94℃ for 10 s; 56℃ for 10 s, 72℃ for 10 s, 40 cycles; 72℃ for 10 min.
[0087] 4. Phenotypic observation of transgenic plants
[0088] Observation and analysis of the phenotype of the three transgenic plants revealed no obvious abnormalities in appearance or growth (see Figure 8). This indicates that overexpression of the CsAHL15 gene did not have a significant impact on the phenotype and development of the plants.
[0089] The nucleotide sequence of primer ID-CsAHL15-F is shown in SEQ ID No. 4 (primer ID-CsAHL15-F designed in CDS before PCR identification of transgenic plants), as follows:
[0090] GGTGGGCTGGAAATATAGCAATG
[0091] The nucleotide sequence of primer ID-CsAHL15-R is shown in SEQ ID No. 5 (Primer ID-CsAHL15-R designed after CaMV 35S for PCR identification of transgenic plants), as follows:
[0092] TCATAGGCGTCTCGCATATCTCATT
[0093] The nucleotide sequence of primer RT-CsAHL15-F is shown in SEQ ID No. 6 (Primer RT-CsAHL15-F for RT-PCR identification of transgenic plants, designed in CDS), as follows:
[0094] ACCGCCACTCACCAAAATCA
[0095] The nucleotide sequence of primer RT-CsAHL15-R is shown in SEQ ID No. 7 (Primer RT-CsAHL15-R for RT-PCR identification of transgenic plants, designed in CDS), as follows:
[0096] TTGGCAATGCTCTCGACGAT
[0097] Example 6
[0098] Evaluation of resistance in CsAHL15 overexpressing transgenic plants
[0099] Mature leaves of transgenic plants were washed, disinfected with 75% alcohol, and rinsed with sterile water before being placed in a clean bench. Acupuncture was performed around the leaf veins, and 1 μL (1 x 10⁻⁶) of ulcer bacteria solution was pipetted into each well. 5 CFU / mL); cultured in a constant temperature and light incubator at 28℃ (16h light / 8h darkness); photographed leaves 10 days after inoculation, and the area of lesions was counted using ImageJ V1.47 software.
[0100] The disease is classified into grades 0-7 based on the area of the lesions, with the letter R representing the lesion area, grade 0 (R ≤ 0.25 mm). 2 Level 1 (0.25 mm) 2 <R≤0.5 mm 2 Level 2 (0.5 mm) 2 <R≤0.75 mm 2 Level 3 (0.75 mm) 2 <R≤1 mm 2 Level 4 (1.0 mm) 2 <R≤1.25 mm 2 Level 5 (1.25 mm) 2 <R≤1.5 mm 2 Level 6 (1.5 mm) 2 <R≤ 1.75 mm 2 Level 7 (R > 1.75 mm) 2 The disease index is calculated according to the formula: DI = 100 X Σ [number of lesions at each level X corresponding level value] / (total number of lesions X maximum level).
[0101] The results showed that 10 days after inoculation with *C. canker*, both the overexpressing plants and the WT plants grafted at the same time exhibited varying degrees of disease, with differences in lesion size (see Figure 9). Statistical analysis revealed that the lesion area of the transgenic plants was significantly smaller than that of the wild-type control, ranging from 40.09% to 46.64% (see Figure 10). The disease index of the transgenic plants was significantly lower than that of the wild-type control, ranging from 37.08% to 46.25% (see Figure 11). Therefore, CsAHL15 overexpression can significantly reduce the lesion area of citrus bacterial canker and alleviate the severity of the disease.
[0102] Therefore, CsAHL15 overexpression can significantly reduce the lesion area of citrus canker and alleviate the severity of the disease. This gene can be used independently for molecular breeding of disease resistance, or it can be used in conjunction with other disease resistance or susceptibility genes for molecular breeding of citrus canker resistance.
[0103] The specific embodiments described above further illustrate the purpose, technical solution, and beneficial effects of the present invention. It should be understood that the above description is only a specific embodiment of the present invention and is not intended to limit the scope of protection of the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the scope of protection of the present invention.
Claims
1. Application of overexpression of CsAHL15 gene to enhance resistance to citrus canker, characterized in that, The CsAHL15 gene is a transcription factor containing a DNA-binding hook nuclear localization protein.
2. The application of overexpression of the CsAHL15 gene to enhance resistance to citrus canker according to claim 1, characterized in that, The CsAHL15 coding sequence is the nucleotide sequence shown in SEQ ID No.
1.
3. A method for improving resistance to citrus canker using CsAHL15, characterized in that, Includes the following steps: (1) Cloning the CsAHL15 coding sequence of citrus, the CsAHL15 coding sequence being shown in SEQ ID No. 1; (2) Constructing a CsAHL15 overexpression vector; (3) Citrus was transformed with CsAHL15 overexpression vector and transgenic plants with improved resistance to citrus canker were obtained after identification.
4. The method for improving citrus canker resistance using CsAHL15 according to claim 3, characterized in that, In step (1), the cloning method for the citrus CsAHL15 coding sequence is as follows: extract total RNA from citrus, reverse transcribe it into cDNA as a template, use primers OE-CsAHL15-F and OE-CsAHL15-R for PCR amplification and recover the CsAHL15 coding sequence DNA fragment, wherein the nucleotide sequences of primers OE-CsAHL15-F and OE-CsAHL15-R are as shown in SEQ ID No. 2 and SEQ ID No. 3, respectively.
5. The method for improving citrus canker resistance using CsAHL15 according to claim 3, characterized in that, In step (2), the CsAHL15 overexpression vector is constructed as follows: the CsAHL15 coding sequence DNA fragment recovered by KpnI and EcoRI enzyme digestion is then ligated into the pLGNe vector recovered by KpnI and EcoRI enzyme digestion to construct the overexpression vector pLGNe-CsAHL15.
6. The method for improving citrus canker resistance using CsAHL15 according to claim 3, characterized in that, In step (3), the method for transforming citrus with the CsAHL15 overexpression vector is as follows: the overexpression vector pLGNe-CsAHL15 is transformed into Agrobacterium tumefaciens by electroporation, and then Agrobacterium tumefaciens is used to mediate the transformation of citrus explants.
7. The method for improving citrus canker resistance using CsAHL15 according to claim 6, characterized in that, The transformed citrus explant cells were further identified by GUS staining, PCR, qRT-PCR analysis, and CsAHL15 expression level to obtain transgenic plants.
8. The method for improving citrus canker resistance using CsAHL15 according to claim 7, characterized in that, The primers used for PCR identification of transgenic plants are ID-CsAHL15-F and ID-CsAHL15-R. ID-CsAHL15-F is designed based on the first end sequence of the CsAHL15 gene, and ID-CsAHL15-R is a sequence taken from the CaMV 35S segment on the pLGNe vector. ID-CsAHL15-F and ID-CsAHL15-R are the nucleotide sequences shown in SEQ ID No. 4 and SEQ ID No. 5, respectively.
9. The method for improving citrus canker resistance using CsAHL15 according to claim 7, characterized in that, The primers used for qRT-PCR analysis of CsAHL15 expression levels are RT-CsAHL15-F and RT-CsAHL15-R, where RT-CsAHL15-F and RT-CsAHL15-R are the nucleotide sequences shown in SEQ ID No. 6 and SEQ ID No. 7, respectively.
10. The method for improving citrus canker resistance using CsAHL15 according to claim 3, characterized in that, After obtaining the transgenic plants in step (3), the transgenic plants were evaluated for resistance, and it was determined that CsAHL15 overexpression improved the resistance to citrus canker.