Attenuated h9n2 avian influenza virus strain, preparation method therefor, and use thereof
By modifying the M2 gene of the H9N2 avian influenza virus, an attenuated strain was constructed, which solved the problems of virus shedding risk and safety of existing vaccines, and achieved a highly efficient and safe immunization effect, making it suitable for the preparation of an attenuated H9N2 avian influenza virus vaccine.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- ZHEJIAN DIFFERENCE BIOLOGICAL TECH CO LTD
- Filing Date
- 2025-12-31
- Publication Date
- 2026-07-30
AI Technical Summary
The existing attenuated H9N2 avian influenza virus vaccines have a risk of virus shedding due to their attenuation mechanism, and their safety needs to be improved. Furthermore, they may cause environmental pollution after immunization.
By modifying the M2 gene, including synonymous mutations in the overlapping genes encoding the M1 and M2 proteins, replacing adjacent genes with those encoding stop codons, and deleting the intracellular domain gene of the M2 protein, an attenuated strain of H9N2 avian influenza virus was constructed.
The attenuated H9N2 avian influenza virus vaccine prepared is attenuated in a manner unaffected by temperature, does not shed the virus after immunization of animals, has high safety, and can induce high levels of hemagglutination-inhibiting antibodies, providing a safe and effective prevention and control strategy.
Smart Images
Figure CN2025147693_30072026_PF_FP_ABST
Abstract
Description
A strain of H9N2 avian influenza virus attenuated, its preparation method and application
[0001] Cross-references to related applications
[0002] This application is based on and claims priority to Chinese Patent Application No. 202510105330.5, filed on January 23, 2025, the entire contents of which are incorporated herein by reference. Technical Field
[0003] This application belongs to the field of virus attenuation technology, and in particular relates to an attenuated strain of H9N2 avian influenza virus, its preparation method and application. Background Technology
[0004] The H9N2 subtype of avian influenza virus is a low-pathogenic avian influenza virus. When chickens are infected with the H9N2 virus, eggs may exhibit irregular shape, thin shells, and embryonic death. In flocks, it can cause weight loss, respiratory distress, diarrhea, and reduced egg production. Furthermore, H9N2 is a zoonotic pathogen; the H9N2 virus can undergo gene rearrangement or recombination with other influenza viruses, increasing the likelihood that avian influenza viruses can cross the species barrier and infect humans and other mammals.
[0005] Vaccination is generally considered the most effective measure for rapidly controlling avian influenza. Live virus vaccines can effectively induce humoral and cellular immunity without adjuvants, and a single dose produces long-lasting immunity. Existing technologies disclose attenuated vaccines of cold-adapted strains of H9N2 subtype avian influenza virus; however, the attenuation method of these vaccines does not completely eliminate viral shedding after immunization of animals, posing a risk of viral shedding into the environment, and their safety needs further improvement.
[0006] Application content
[0007] The purpose of this application is to provide an attenuated strain of H9N2 avian influenza virus, its preparation method and application. The attenuation method of the H9N2 avian influenza virus attenuated vaccine prepared by the attenuated strain of H9N2 avian influenza virus in this application is not affected by temperature, and there is no potential risk of reversion mutation. It does not shed the virus after immunizing animals and has high safety.
[0008] This application provides an attenuated strain of H9N2 avian influenza virus, which is obtained by modifying the M2 gene; the modification includes synonymous mutation of the overlapping gene encoding the M1 protein and the M2 protein, replacing the adjacent gene after the synonymous mutation with the gene encoding the stop codon, and deleting the gene encoding the intracellular domain of the M2 protein.
[0009] Preferably, the modification further includes a deletion mutation in the transmembrane domain gene encoding the M2 protein.
[0010] Preferably, the modification further includes ensuring the integrity and invariance of the M1 amino acid sequence.
[0011] Preferably, the number of bases in the gene with deletion mutation includes 38 bp or 48 bp; the nucleotide sequence of the gene with deletion mutation is shown in SEQ ID NO.1 or SEQ ID NO.2.
[0012] Preferably, the number of bases in the gene with deletion mutation includes 58bp, 68bp, or 88bp; the nucleotide sequence of the gene with deletion mutation is shown in SEQ ID NO.3, SEQ ID NO.4, or SEQ ID NO.5.
[0013] Preferably, the HA and NA of the background strain of the attenuated H9N2 avian influenza virus strain are the HA and NA of the S2 strain; the nucleotide sequence of the HA of the S2 strain is shown in SEQ ID NO.31; the nucleotide sequence of the NA of the S2 strain is shown in SEQ ID NO.32.
[0014] This application also provides a method for constructing an attenuated strain of H9N2 avian influenza virus as described above, comprising the following steps: constructing a plasmid containing the modified M2 gene; using a reverse genetics system, mixing a plasmid expressing an avian influenza gene fragment, the plasmid containing the modified M2 gene, and a plasmid expressing the full length of the M2 protein, and then transfecting cells to harvest the virus and obtain an attenuated strain of H9N2 avian influenza virus; preferably, the primer sequences required for constructing the plasmid containing the modified M2 gene are shown in SEQ ID NO. 8-22.
[0015] This application also provides the application of the attenuated H9N2 avian influenza virus strain described in the above scheme or the attenuated H9N2 avian influenza virus strain constructed by the above construction method in the preparation of H9N2 avian influenza virus attenuated vaccine.
[0016] This application also provides an attenuated H9N2 avian influenza virus vaccine, the active ingredient of which comprises the attenuated H9N2 avian influenza virus strain described in the above scheme or the attenuated H9N2 avian influenza virus strain constructed by the construction method described above.
[0017] This application provides an attenuated strain of H9N2 avian influenza virus, obtained by modifying the M2 gene. The modification includes synonymous mutation of overlapping genes encoding the M1 and M2 proteins, replacement of adjacent genes after the synonymous mutation with genes encoding stop codons, and deletion mutation of the intracellular domain gene encoding the M2 protein. The attenuated H9N2 avian influenza virus vaccine prepared from this attenuated strain is not affected by temperature and has no potential risk of reversion mutation, exhibiting high safety. Immunization of chickens with this attenuated H9N2 avian influenza virus vaccine induces high levels of hemagglutination inhibition antibodies, and there is no viral shedding after immunization, demonstrating high safety and no potential environmental harm, providing a new strategy for the prevention and control of H9N2 avian influenza. Attached Figure Description
[0018] To more clearly illustrate the technical solutions in the embodiments of this application or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of this application. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.
[0019] Figure 1 is a schematic diagram of the gene encoding the intracellular domain of the M2 protein of H9N2 avian influenza virus being modified by deletion.
[0020] Figure 2 is a schematic diagram of the modification of the extracellular domain, transmembrane region, and intracellular domain of the M2 protein of H9N2 avian influenza virus through synonymous mutation, addition of stop codon, and deletion mutation.
[0021] Figure 3 shows the growth curve of the attenuated strain of H9N2 avian influenza virus (candidate vaccine strain) on MDCK cells. Detailed Implementation
[0022] This application provides a method for obtaining an attenuated strain of the H9N2 avian influenza virus by modifying the M2 gene; the modification includes synonymous mutation of the overlapping gene encoding the M1 protein and the M2 protein, replacing the adjacent gene after the synonymous mutation with a gene encoding a stop codon, and deleting the intracellular domain gene encoding the M2 protein.
[0023] In the specific implementation of this application, the modification also includes deletion mutation of the transmembrane domain gene encoding the M2 protein.
[0024] The M2 protein is a transmembrane protein with ion channel activity located on the influenza virus envelope. It consists of 97 amino acids, including an N-terminal extracellular domain (M2e), a transmembrane domain, and a C-terminal cytoplasmic tail. The M2 protein plays a crucial role in viral invasion, assembly, and release. It participates in viral budding and is essential for viral particle formation. Furthermore, the tip of the M2 protein also plays a vital role in efficient viral replication. Modifying the M2 protein to alter the virulence of the H9N2 avian influenza virus is of great significance for the development of H9N2 avian influenza vaccines.
[0025] The attenuated strain of H9N2 avian influenza virus disclosed in this application can be used as the active ingredient to prepare an attenuated H9N2 avian influenza virus vaccine. Immunization of chickens with this attenuated H9N2 avian influenza virus vaccine induces high levels of hemagglutination inhibition antibodies, and there is no viral shedding after immunization. The vaccine is highly safe and poses no potential environmental harm, providing a new strategy for the prevention and control of H9N2 avian influenza.
[0026] In the specific implementation of this application, the modification also includes ensuring the integrity and invariance of the M1 amino acid sequence.
[0027] In the specific implementation of this application, synonymous mutations alter the M2 protein sequence, potentially leading to multiple unknown mutations or premature termination, resulting in impaired M2 function. Deleting partial nucleotide sequences from the M2 gene may alter viral nucleic acid function, creating new growth characteristics. Synonymous mutations and / or deletions of multiple nucleotide sequences are generally considered unlikely to result in reversion mutations, thus ensuring strong strain stability. This application involves synonymous mutations of the nucleic acid sequences shared by M1 and M2, or deletions of the M2 gene based on these mutations, causing functional changes at the viral nucleic acid level, forming new viral growth characteristics, and achieving the goal of attenuating the H9N2 avian influenza virus, which can be used for the production of attenuated vaccines.
[0028] In the specific implementation of this application, the number of bases in the gene with deletion mutation includes 38bp or 48bp; the nucleotide sequence of the gene with deletion mutation is shown in SEQ ID NO.1 or SEQ ID NO.2.
[0029] In the specific implementation of this application, the number of bases in the gene with deletion mutation includes 58bp, 68bp, or 88bp; the nucleotide sequence of the gene with deletion mutation is shown in SEQ ID NO.3, SEQ ID NO.4, or SEQ ID NO.5.
[0030] In one embodiment of this application, the synonymous mutation site is 28-72 bp of the M2 protein coding region; the original nucleotide sequence before the synonymous mutation is shown in SEQ ID NO.6, specifically: CCTACCAGAACCGGATGGGAGTGCAACTGCAGCGGTTCAAGTGAC; the nucleotide sequence after the synonymous mutation is shown in SEQ ID NO.7, specifically: CGTATCAAAATAGGATGGGCGTACAGCTACAACGATTTAAATAAC.
[0031] In one embodiment of this application, the number of stop codons is 2; the site of the adjacent gene after the synonymous mutation is the 73rd to 78th bp of the M2 protein coding region; the original nucleotide sequence of the adjacent gene after the synonymous mutation is CCACTC; and the nucleotide sequence of the gene encoding the stop codon is TGATGA.
[0032] In one embodiment of this application, the number of bases in the gene with deletion mutation is 38 bp; the site of the gene with deletion mutation is 152 to 189 bp of the M2 protein coding region; the nucleotide sequence of the gene with deletion mutation is shown in SEQ ID NO.1, specifically: TTTATCGTCGCTTTAAATACGGTTTGAAAAGAGGGCCT.
[0033] In another embodiment of this application, the number of bases in the gene with deletion mutation is 48 bp; the site of the gene with deletion mutation is 142 to 189 bp of the M2 protein coding region; the nucleotide sequence of the gene with deletion mutation is as shown in SEQ ID NO.2, specifically: TTCAAATGCATTTATCGTCGCTTTAAATACGGTTTGAAAAGAGGGCCT.
[0034] In another embodiment of this application, the number of bases in the gene with deletion mutation is 58 bp; the site of the gene with deletion mutation is 132 to 189 bp of the M2 protein coding region; the nucleotide sequence of the gene with deletion mutation is as shown in SEQ ID NO.3, specifically: TCGTCTTTTCTTCAAATGCATTTATCGTCGCTTTAAATACGGTTTGAAAAGAGGGCCT.
[0035] In another embodiment of this application, the number of bases in the gene with deletion mutation is 68 bp; the site of the gene with deletion mutation is 122 to 189 bp of the M2 protein coding region; the nucleotide sequence of the gene with deletion mutation is shown in SEQ ID NO.4, specifically: GGATTCTTGATCGTCTTTTCTTCAAATGCATTTATCGTCGCTTTAAATACGGTTTGAAAAGAGGGCCT.
[0036] In another embodiment of this application, the number of bases in the gene with deletion mutation is 88 bp; the site of the gene with deletion mutation is 102 to 189 bp of the M2 protein coding region; the nucleotide sequence of the gene with deletion mutation is shown in SEQ ID NO.5, specifically: GATATTGCACCTGATATTGTGGATTCTTGATCGTCTTTTCTTCAAATGCATTTATCGTCGCTTTAAATACGGTTTGAAAAGAGGGCCT.
[0037] In the specific implementation of this application, the background strain of the attenuated H9N2 avian influenza virus uses H9GD1 as the backbone, and on the basis of the backbone, HA and NA are replaced with HA and NA of the S2 strain, respectively. That is, the HA and NA of the background strain of the attenuated H9N2 avian influenza virus are the HA and NA of the S2 strain.
[0038] In the specific implementation of this application, the nucleotide sequence of the PB1 gene of H9GD1 is shown in SEQ ID NO.25, specifically as follows:
[0039] In the specific implementation of this application, the nucleotide sequence of the H9GD1 PB2 gene is shown in SEQ ID NO.26, specifically as follows:
[0040] In the specific implementation of this application, the nucleotide sequence of the PA gene of H9GD1 is shown in SEQ ID NO.27, specifically as follows:
[0041] In the specific implementation of this application, the nucleotide sequence of the H9GD1 NP gene is shown in SEQ ID NO.28, specifically as follows:
[0042] In the specific implementation of this application, the nucleotide sequence of the H9GD1 NS gene is shown in SEQ ID NO.29, specifically as follows:
[0043] In the specific implementation of this application, the nucleotide sequence of the M gene of H9GD1 is shown in SEQ ID NO.30, specifically as follows:
[0044] In the specific implementation of this application, the nucleotide sequence of the HA gene of S2 is as shown in SEQ ID NO.31, specifically:
[0045] In the specific implementation of this application, the nucleotide sequence of the NA gene of S2 is as shown in SEQ ID NO.32, specifically:
[0046] It should be noted that the nucleic acid and amino acid sequences of the M2 protein of the H9N2 avian influenza virus are highly conserved among different strains and have universality. Therefore, this application does not have any special limitation on the background strain of the attenuated H9N2 avian influenza virus strain, and any conventional H9N2 avian influenza virus in the art can be used.
[0047] This application also provides a method for constructing an attenuated strain of H9N2 avian influenza virus as described above, comprising the following steps: constructing a plasmid containing the modified M2 gene; using a reverse genetics system, mixing a plasmid expressing an avian influenza gene fragment, the plasmid containing the modified M2 gene, and a plasmid expressing the full length of the M2 protein, and then transfecting the cells to harvest the virus and obtain an attenuated strain of H9N2 avian influenza virus;
[0048] In the specific implementation of this application, the primer sequences required to construct the plasmid containing the modified M2 gene are shown in SEQ ID NO. 8 to 22.
[0049] This application also provides the application of the attenuated H9N2 avian influenza virus strain described in the above scheme or the attenuated H9N2 avian influenza virus strain constructed by the above construction method in the preparation of H9N2 avian influenza virus attenuated vaccine.
[0050] This application also provides an attenuated H9N2 avian influenza virus vaccine, the active ingredient of which comprises the attenuated H9N2 avian influenza virus strain described in the above scheme or the attenuated H9N2 avian influenza virus strain constructed by the construction method described above.
[0051] In the specific implementation of this application, the dosage form of the H9N2 avian influenza virus attenuated vaccine includes nasal drops.
[0052] In the specific implementation of this application, the attenuated strain of H9N2 avian influenza virus or the attenuated strain of H9N2 avian influenza virus constructed by the construction method is the only active ingredient of the attenuated H9N2 avian influenza virus vaccine.
[0053] To further illustrate this application, the following detailed description, in conjunction with the accompanying drawings and embodiments, describes an attenuated strain of H9N2 avian influenza virus, its preparation method, and its application. However, these descriptions should not be construed as limiting the scope of protection of this application.
[0054] Example 1: Construction of an attenuated strain of H9N2 avian influenza virus modified with the M gene
[0055] The background strain for the attenuated strain constructed in this embodiment uses H9GD1 as the backbone, with HA and NA replaced by those of the S2 strain. The nucleotide sequence of the PB1 gene of H9GD1 is shown in SEQ ID NO. 25. The nucleotide sequence of the PB2 gene of H9GD1 is shown in SEQ ID NO. 26. The nucleotide sequence of the PA gene of H9GD1 is shown in SEQ ID NO. 27. The nucleotide sequence of the NP gene of H9GD1 is shown in SEQ ID NO. 28. The nucleotide sequence of the NS gene of H9GD1 is shown in SEQ ID NO. 29. The nucleotide sequence of the M gene of H9GD1 is shown in SEQ ID NO. 30. The nucleotide sequence of the HA gene of S2 is shown in SEQ ID NO. 31. The nucleotide sequence of the NA gene of S2 is shown in SEQ ID NO. 32.
[0056] The molecular construction types are shown in Table 1, mainly divided into two categories: ① Gene modification of the intracellular domain encoding the M2 protein. A series of deletion mutations of different lengths are performed after a 38-base deletion in the M2 gene, as shown in Figure 1; ② Simultaneous gene modification of the extracellular domain, transmembrane region, and intracellular domain encoding the M2 protein. Synonymous mutations are performed on the overlapping region of M1 and M2, and the subsequent two amino acids (6 bases) are mutated into stop codons. A series of deletion mutations of different lengths are then performed before the 38-base deletion in the M2 gene, as shown in Figure 2.
[0057] Table 1. Molecular construction of attenuated strains of H9N2 avian influenza.
[0058] Plasmid construction:
[0059] Plasmids expressing the M gene of H9GD1 avian influenza virus were extracted and amplified by PCR using a series of primers (primer sequences are shown in Table 2). For plasmids with partial deletions in the intracellular domain of the M2 protein, plasmids with complete M gene deletions were constructed using PCR primers (SEQ ID NO. 8–14). For plasmids with modified M2 protein extracellular domain, transmembrane region, and intracellular domain genes, plasmids with M1 synonymous mutations and two stop codon mutations were first constructed using PCR primers. These plasmids were then used as templates to construct other deletion / mutation plasmids. After PCR, agarose gel electrophoresis was performed for identification. The correct bands were selected based on molecular weight for gel recovery, and the recovered products were recombined at 50°C for 15 min. The recombinant products were transformed into competent E. coli cells, colonies were picked, and sequencing was performed to verify correctness. The modified plasmids of each series were successfully prepared using an endotoxin-free mini-prep kit.
[0060] Table 2 Amplification Primer Sequences
[0061] Example 2: Virus rescue of attenuated strains of H9N2 avian influenza virus
[0062] HEK293T cells were evenly seeded into 6-well cells and cultured in a cell culture incubator at 37°C with 5% CO2. Transfection was performed when the cell density reached 70%–80%. Plasmids expressing seven avian influenza gene fragments (PA, PB1, PB2, NP, NS, HA, NA), along with the various M2 modified plasmids constructed in Example 1 and plasmids expressing the full length of the M2 protein, were mixed together in a specific ratio and analyzed using Lipofectamine. TM Transfection was performed using the LTX transfection kit. Fresh culture medium was added 6–8 hours after transfection. 48 hours after transfection, the cell plate was repeatedly frozen and thawed three times, and the supernatant was collected by centrifugation. The harvested virus was co-transfected with the M2 expression plasmid, and cytopathic effects were observed. Viruses exhibiting cytopathic effects were then inoculated into chicken embryos for amplification. The virus was harvested after 72 hours, and its hemagglutination titer was measured using chicken erythrocytes. RNA was extracted from the successfully harvested virus from the chicken embryos and reverse transcribed into cDNA. Amplification was performed using universal PCR primers, followed by sequencing for identification. The universal PCR primers were as follows: F primer: CCGAAGTTGGGGGGGagcaaaagcaggtagatg (SEQ ID NO.23); R primer: CCGCCGGGTTATTAGtagaaacaaggtagttttttac (SEQ ID NO.24). Viruses with correctly identified sequences were considered successfully rescued. The virus rescue results are shown in Table 3, with a total of 9 virus strains rescued.
[0063] Table 3 Virus rescue results
[0064] Example 3: Verification of the attenuation efficacy of the H9N2 avian influenza virus strain.
[0065] The virus successfully rescued in Example 2 was amplified by inoculating chicken embryos. The amplified virus was then used to immunize SPF chickens via intranasal drip, with each chicken receiving 100 μL of the virus at a dose of 6 lgEID. 50 Pharyngeal swabs were collected from chickens three days after immunization. The collected swabs were dissolved in PBS, filtered through a 0.22 μm filter, and then inoculated into SPF chicken embryos. Hemagglutination in the chicken embryos was assessed three days later. The results are shown in Table 4. For the genetically modified intracellular domain of the M2 protein, except for H9-Mdel41, different viral titers were detected in all other groups. Although H9-Mdel41 did not shed the virus, its subculture titer in chicken embryos was low, which did not meet production requirements. For the genetically modified strains of the extracellular, transmembrane, and intracellular domains of the M2 protein, no viral titers were detected in any of the immunized groups, indicating that the attenuated strains produced by this genetic modification method have a good attenuation effect.
[0066] Table 4. Virus shedding in animals immunized with attenuated strains of H9N2 avian influenza virus.
[0067] Example 4: Hemagglutination inhibition (HI) antibody levels after immunization with attenuated strains of H9N2 avian influenza virus
[0068] Serum from chickens immunized with the attenuated strain from Example 3 on day 14 was collected, including the H9-M2+38, H9-M2+48, H9-M2+58, H9-M2+68, and H9-M2+88 immunization groups. The level of antibodies against H9N2 avian influenza virus in the serum was detected. The specific detection steps are as follows:
[0069] 1. Based on the hemagglutination titer of the antigen to be measured, prepare four units of antigen and verify them;
[0070] 2. Serum serial dilution: The serum to be tested was inactivated at 56°C for 30 min in advance. PBS was added to the 96-well hemagglutination plate, and then the serum to be tested, the standard negative serum and the positive serum were diluted according to the 2-fold serial dilution method.
[0071] 3. Add antigen: Add an equal volume of the validated four-unit antigen solution to the diluted serum, and allow the antibodies in the serum to react with the antigen at room temperature for 30 minutes;
[0072] 4. Add red blood cells: Add an equal volume of 1% chicken red blood cells to each reaction well, let stand at room temperature for 30 minutes, and observe the binding of red blood cells with unbound antigens.
[0073] 5. Result Interpretation: Tilt the blood coagulation plate at 45° and read the value on the back. The well from which red blood cells can flow completely is taken as the HI titer of the serum. This requires that negative and positive sera be valid, i.e., complete agglutination is observed in the negative serum well, and the positive serum titer differs from the labeled titer by no more than one titer.
[0074] The specific results of hemagglutination inhibition antibody levels are shown in Table 5. Immunization of chickens with attenuated viral strains induced high levels of hemagglutination inhibition antibodies (HI hemagglutination titer > 2). 4 Among them, the H9-M2+48HI antibody level was the highest at 2. 7.22 This indicates that these attenuated strains can stimulate high antibody levels and have good immunogenicity.
[0075] Table 5. Hemagglutination inhibition antibody levels in animals immunized with attenuated strains of H9N2 avian influenza virus.
[0076] Example 5: Virus shedding in various tissues and organs after immunization with a weakened strain of H9N2 avian influenza virus.
[0077] On day 2 post-immunization, for the H9-M2+38, H9-M2+48, H9-M2+58, H9-M2+68, and H9-M2+88 immunization groups, two chickens from each group were randomly selected to collect tissues and organs, including the respiratory tract, lungs, heart, liver, and digestive tract. 0.1g of each tissue / organ was collected, added to 900μl of sterile PBS, and homogenized. The homogenate was filtered through a 0.22μm filter and inoculated into chicken embryos. Hemagglutination in the embryos was assessed 3 days later. The results are shown in Table 6. No viral replication was detected in any tissue or organ in any immunization group. This indicates that the attenuated strain produced by this method will not pose a potential environmental hazard due to viral shedding after animal immunization.
[0078] Table 6. Virus titers in various tissues of animals immunized with attenuated strains of H9N2 avian influenza virus.
[0079] Example 6: Genetic stability of attenuated strains of H9N2 avian influenza virus
[0080] The genetic stability test results of the attenuated strain of H9N2 avian influenza virus (candidate vaccine strain) are shown in Table 7. As can be seen from Table 7, the candidate vaccine strain has good stability, and the M2 sequence of the passaged strain is consistent with the constructed sequence.
[0081] Table 7. Results of genetic stability study of candidate vaccine strains (M2 sequence is consistent with the constructed sequence)
[0082] Example 7 Growth characteristics of attenuated strains of H9N2 avian influenza virus on MDCK cells
[0083] To verify the replication kinetics of the attenuated strain of H9N2 avian influenza virus (candidate vaccine strain) in cells, virus growth curves were established on MDCK cells.
[0084] The specific steps are as follows: Attenuated viral strains were inoculated into 12-well MDCK monolayer cells at an MOI of 0.01. After infection, the cells were cultured at 33°C. The cells were then subjected to a freeze-thaw cycle at 24, 48, 72, and 96 hours post-infection, and the viral load was collected. The cells were then stored at -80°C. The viral loads at each time point were serially diluted 10-fold and inoculated into 96-well MDCK cells. The TCID of the virus was calculated using the Reed-Muench method. 50 Growth curves of each attenuated strain were plotted with time on the horizontal axis and viral titer on the vertical axis. Figure 3 shows the growth kinetic curves of each attenuated strain on MDCK cells. It can be seen that, compared with the unmodified wild-type M2 strain, the replication capacity of each attenuated strain was significantly reduced.
[0085] Although the above embodiments have provided a detailed description of this application, they are only some embodiments of this application, not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of this application.
Claims
1. A weakened strain of H9N2 avian influenza virus, characterized in that, The attenuated strain of the H9N2 avian influenza virus was obtained by modifying the M2 gene; the modification included synonymous mutation of the overlapping gene encoding the M1 protein and the M2 protein, replacing the adjacent gene after the synonymous mutation with the gene encoding the stop codon, and deleting the gene encoding the intracellular domain of the M2 protein.
2. The attenuated strain of H9N2 avian influenza virus according to claim 1, characterized in that, The modification also includes deletion mutations in the transmembrane domain gene encoding the M2 protein.
3. The attenuated strain of H9N2 avian influenza virus according to claim 1, characterized in that, The modification also includes ensuring the integrity and invariance of the M1 amino acid sequence.
4. The attenuated strain of H9N2 avian influenza virus according to claim 1, characterized in that, The number of bases in the gene with the deletion mutation includes 38 bp or 48 bp; the nucleotide sequence of the gene with the deletion mutation is shown in SEQ ID NO.1 or SEQ ID NO.
2.
5. The attenuated strain of H9N2 avian influenza virus according to claim 2, characterized in that, The number of bases in the gene with the deletion mutation includes 58bp, 68bp, or 88bp; the nucleotide sequence of the gene with the deletion mutation is shown in SEQ ID NO.3, SEQ ID NO.4, or SEQ ID NO.
5.
6. The attenuated strain of H9N2 avian influenza virus according to claim 1, characterized in that, The HA and NA of the background strain of the attenuated H9N2 avian influenza virus are the HA and NA of the S2 strain; the nucleotide sequence of the HA of the S2 strain is shown in SEQ ID NO.31; the nucleotide sequence of the NA of the S2 strain is shown in SEQ ID NO.
32.
7. The method for constructing an attenuated strain of H9N2 avian influenza virus according to any one of claims 1 to 6, characterized in that, Includes the following steps: Construct a plasmid containing the modified M2 gene; Using a reverse genetics system, a plasmid expressing an avian influenza gene fragment, a plasmid containing the modified M2 gene, and a plasmid expressing the full length of the M2 protein were mixed and transfected into cells. The virus was then harvested to obtain an attenuated strain of H9N2 avian influenza virus.
8. The construction method according to claim 7, characterized in that, The primer sequences required to construct the plasmid containing the modified M2 gene are shown in SEQ ID NO. 8-22.
9. The use of the attenuated strain of H9N2 avian influenza virus according to any one of claims 1 to 6 or the attenuated strain of H9N2 avian influenza virus constructed by the construction method according to claim 7 or 8 in the preparation of an attenuated H9N2 avian influenza virus vaccine.
10. An attenuated vaccine of H9N2 avian influenza virus, characterized in that, The active ingredient comprises the attenuated strain of H9N2 avian influenza virus as described in any one of claims 1 to 6, or the attenuated strain of H9N2 avian influenza virus constructed by the construction method described in claim 7 or 8.