High-performance and low-allergenicity 3D cell-cultured meat scaffold and preparation method therefor

Abstract

The present invention relates to the field of future food processing technologies, and relates to a high-performance and low-allergenicity 3D cell-cultured meat scaffold and a preparation method therefor. Sodium alginate at different concentrations is used to covalently modify fish gelatin to prepare a fish gelatin sodium alginate-based cell-cultured meat scaffold, which significantly mitigates the problem of instability of a fish gelatin gel at 37°C; the gel strength is increased by about 282.42%, and the hydrophilicity is significantly increased (the contact angle is reduced by about 24°C); meanwhile, the release amount of histamine in plasma of mice in the group intragastrically administered sodium alginate-covalently modified fish gelatin is reduced by about 54.35%, and the release rate of β-hexosaminidase in RBL-2H3 cells is reduced from 27.50% to 11.31%. Fish gelatin, sodium alginate and calcium chloride are used to prepare a high-performance and low-allergenicity cell-cultured meat scaffold, thereby solving the problem of low stability of a pure fish gelatin cell scaffold, and reducing the potential allergenicity risk of a cell-cultured meat scaffold.

Description

A high-performance, low-allergenic 3D cell culture scaffold and its preparation method Technical Field

[0001] This invention belongs to the field of future food technology processing, specifically relating to a high-performance, low-allergenic 3D cell culture meat scaffold and its preparation method. Background Technology

[0002] Faced with continuous technological innovation and a challenging domestic and international environment, especially unpredictable climate change and natural disasters, cultured meat is an important solution. Compared to traditional animal husbandry, cultured meat has a shorter growth cycle, a lower carbon footprint, and consumes fewer natural resources. Furthermore, the production process takes place in a clean and safe laboratory environment, making cultured meat a significant future trend.

[0003] Cultured meat refers to meat products made by obtaining "seed cells" in vitro, culturing and processing these cells on a large scale to obtain muscle, fat, and other tissues, and then processing them using food processing techniques. As a key component of cultured meat, the cell scaffold not only provides crucial physical support for cell adhesion, proliferation, differentiation, and other vital metabolic activities, but also directly determines the three-dimensional structure and texture of the cultured meat. Therefore, the safety and performance of the cell scaffold are of paramount importance.

[0004] In recent years, scholars at home and abroad have conducted systematic research on scaffold materials for cultured meat. They have mainly developed high-performance scaffold materials for cultured meat by optimizing processing techniques and innovating raw materials. Examples include: a method for manufacturing an edible sodium alginate / gelatin 3D gel scaffold coated with tea polyphenols for cultured meat (Publication No.: CN113892643A); a method for continuously preparing edible fibrous scaffolds for cultured meat (Publication No.: CN114622296B); a scaffold for cultured meat and its preparation method; cultured meat and its preparation method and cultured meat products (Publication No.: CN115747134A); an edible 3D cell culture scaffold and its preparation method (Publication No.: CN118421554A); and a method for preparing soybean protein starch-like fiber-cultured meat scaffolds based on the ice template method (Publication No.: CN118620819A).

[0005] Compared to traditional livestock gelatin from pigs and cattle, fish gelatin offers advantages such as wide availability, low cost, and reduced risk of zoonotic diseases. Furthermore, its excellent biodegradability and biocompatibility have made it a superior raw material for meat culture scaffolds. However, fish gelatin has been reported to be an allergen, triggering allergic reactions and harming susceptible individuals. Moreover, current development of fish gelatin-based meat culture scaffolds primarily focuses on their stability and biocompatibility, with limited research on the preparation of low-allergenic scaffolds, especially those that maintain low immunogenicity while ensuring stability and biocompatibility. Additionally, the scaffold preparation methods described in the aforementioned studies require specialized equipment and are cumbersome. Therefore, it is necessary to develop a simple and efficient method for preparing highly stable, low-allergenic meat culture scaffolds. Summary of the Invention

[0006] To address the aforementioned problems, this invention provides a method for preparing a high-performance, low-allergenic 3D cell culture meat scaffold. This invention utilizes environmentally friendly marine-derived food raw materials, fish gelatin and sodium alginate, and is simple and convenient to operate without requiring volatile or other hazardous reagents. Overcoming the limitations of traditional preparation methods, it achieves high performance and excellent biocompatibility in cell culture meat scaffolds while simultaneously preparing a low-allergenic fish gelatin-based cell culture meat scaffold material for the first time. This invention provides new technical means and ideas for the development of high-performance, low-allergenic, or non-allergenic cell culture meat scaffolds, which is conducive to ensuring the high-quality and rapid development of the cell culture meat industry.

[0007] This invention provides a method for preparing a high-performance, low-allergenic cell culture scaffold, comprising the following steps:

[0008] (1) Dissolve fish gelatin at 40-70℃ to obtain a fish gelatin solution;

[0009] (2) The fish gelatin solution obtained in step (1) is mixed with sodium alginate to obtain a mixed solution. After stirring and mixing thoroughly, the sodium alginate and fish gelatin covalent complex is prepared by reacting at high temperature for 20-60 min.

[0010] (3) The sodium alginate and fish gelatin covalent complex obtained in step (2) is cooled and shaped, and then calcium chloride solution with a mass concentration of 1-3% is added for low-temperature solidification to obtain a cell culture meat scaffold.

[0011] In one embodiment of the present invention, in step (1), the fish gelatin solution is a transparent and colorless liquid.

[0012] In one embodiment of the present invention, in step (1), the fish gelatin is more likely to dissolve fully at 40-70°C, and at the same time, the structure of the fish gelatin is expanded, which is conducive to the covalent modification of it by sodium alginate.

[0013] In one embodiment of the present invention, in step (1), the mass concentration of the fish gelatin solution is 6-15%.

[0014] In one embodiment of the present invention, in step (2), the mass concentration of sodium alginate in the mixed solution is 0.25-4.00%, more preferably 1.00-2.00%.

[0015] In one embodiment of the present invention, in step (2), the fish gelatin solution is mixed with sodium alginate and then heated at 90°C for 20 to 60 minutes.

[0016] In one embodiment of the present invention, in step (3), the cooling molding and low-temperature curing refer to the conditions of an ice-water bath at 4°C.

[0017] In one embodiment of the present invention, in step (3), the volume of calcium chloride solution added is 3 to 6 times the volume of the covalent complex, to ensure that calcium chloride can be fully crosslinked with sodium alginate.

[0018] In one embodiment of the present invention, in step (3), the cooling molding refers to the sodium alginate and fish gelatin covalent complex being in a non-flowing solid state.

[0019] The present invention provides a cell culture meat scaffold prepared by the method described above.

[0020] The present invention provides a cultured meat comprising the cultured meat scaffold described above and cells attached thereto.

[0021] In one embodiment of the present invention, the cell is an animal cell, specifically one or more of muscle cells, adipocytes, fibroblasts, mesenchymal stem cells, and pluripotent stem cells, such as muscle satellite cells and adipose-derived stem cells.

[0022] This invention provides a method for preparing cell-cultured meat, specifically including the following steps:

[0023] (1) The cell culture meat scaffold described above is sterilized by high temperature and high pressure to obtain a sterile cell culture meat scaffold.

[0024] (2) Add high-glucose DMEM medium to the sterile cell culture scaffold to swell, and aspirate the medium after swelling equilibrium.

[0025] (3) Take cells and seed them on a cell culture meat scaffold. In a 37°C, 5% carbon dioxide environment, perform cell adhesion, proliferation and differentiation treatment to prepare cell culture meat.

[0026] In one embodiment of the present invention, in step (1), high-pressure sterilization refers to placing the cell culture meat scaffold in an autoclave at 121°C and 0.1MPa for 20 minutes to kill microorganisms that affect cell growth.

[0027] In one embodiment of the present invention, in step (2), the volume ratio of high-sugar DMEM culture medium to scaffold is 3 to 6:1 until the color of the hydrogel scaffold is close to the color of the culture medium.

[0028] In one embodiment of the present invention, in step (3), the seeding cell density is 2 × 10⁻⁶. 5 ~1×10 6 The cell / mL ratio was adjusted proportionally to the size of the wells, with 2 mL of cells added to a 6-well plate as a reference.

[0029] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0030] (1) This invention prepares a sodium alginate-fish gelatin covalent complex by mixing sodium alginate at different concentrations with fish gelatin solution, and then performs covalent modification under high temperature (90℃) to prepare a fish gelatin-sodium alginate cell culture scaffold. The raw materials required for the preparation of this scaffold are green and environmentally friendly, and do not require cross-linking with volatile organic reagents such as glutaraldehyde. This invention prepares a low-allergenic cell culture scaffold for the first time while ensuring stability and biocompatibility. Unlike existing reports, this invention prepares a low-allergenic cell culture scaffold for the first time while ensuring high stability and excellent biocompatibility. The preparation method is simple and quick and can be achieved without expensive instruments and equipment. Unlike the prior art (CN113892643A), CN113892643A mainly obtains the complex by stirring the reaction at room temperature for more than 2 hours. It mainly prepares a porous scaffold material by cross-linking sodium alginate and gelatin through electrostatic interaction. The interaction between sodium alginate and gelatin is mainly non-covalent and cannot block allergen epitopes. Therefore, it cannot reduce allergenicity by blocking allergen epitopes.

[0031] (2) The sodium alginate fish gelatin cell culture scaffold prepared by the present invention has higher stability and biocompatibility than the cell culture scaffold of fish gelatin alone. Fish gelatin alone is in a liquid state at 37°C and is insufficient to provide support for cells. After sodium alginate and fish gelatin are covalently cross-linked, they are solidified with calcium ions, making the gel an irreversible gel.

[0032] (3) The gel strength of fish gelatin alone was 314.96 g, while the gel strength of the cell culture meat scaffold based on fish gelatin after sodium alginate covalent modification was about 889.50 g, which increased the gel strength by about 282.42%.

[0033] (4) Sodium alginate covalent modification significantly improved the hydrophilicity of the cell culture scaffold material, reducing the contact angle from 74.64° to 50.17°, which is more conducive to improving the adhesion of C2C12 cells on the scaffold.

[0034] (5) The gelatin-based cell culture scaffold after sodium alginate covalent modification can ensure sufficient stability and excellent biocompatibility, providing a growth and metabolic environment for the normal adhesion, proliferation and differentiation of C2C12 cells.

[0035] (6) Sodium alginate covalent modification can significantly reduce the sensitization of fish gelatin while ensuring the performance of the scaffold, including clinical allergy symptoms, specific IgE binding capacity and histamine release level.

[0036] (7) Sodium alginate covalent modification can protect the intestinal barrier function of mice and thus reduce the risk of allergies caused by fish gelatin.

[0037] (8) Sodium alginate covalent modification can reduce sensitization by regulating the balance of Th1 and Th2 cytokines.

[0038] (9) The marker of low allergenicity of cell culture meat scaffolds was further verified based on the RBL-2H3 cell degranulation model.

[0039] (10) The raw materials required for cell culture meat scaffolds are environmentally friendly, low in cost, and simple to operate without special instruments and equipment. It can realize the preparation of highly stable and low-allergenic cell culture meat scaffolds. This invention is conducive to ensuring the high-quality development of the cell culture meat industry. Its market is considerable and has great potential. Attached Figure Description

[0040] Figure 1 shows the physical images, gel strength, and contact angle results of sodium alginate fish gelatin hydrogels from Examples 1-5 and Comparative Example 1.

[0041] Figure 2 shows the adhesion and proliferation behavior of C2C12 cells in Examples 1-5 on the hydrogel scaffold;

[0042] Figure 3 shows the differentiation behavior of C2C12 cells in Examples 1-5 on a hydrogel scaffold;

[0043] Figure 4 shows the morphology of the printed scaffolds prepared by the fish gelatin-sodium alginate covalent complex in Examples 1-5;

[0044] Figure 5 is a laser confocal microscope image of the cytoskeleton of the 3D-printed scaffold prepared by the fish gelatin-sodium alginate covalent complex in Example 1 after cell seeding;

[0045] Figure 6 is a diagram illustrating the process of establishing the BALB / c mouse sensitization model;

[0046] Figure 7 shows the effect of sodium alginate covalent modification in Examples 1-5 on the IgE binding capacity of fish gelatin-based cell culture scaffolds.

[0047] Figure 8 shows the effect of sodium alginate covalent modification in Examples 1-5 on histamine release in mice;

[0048] Figure 9 shows the effect of sodium alginate covalent modification in Examples 1-5 on the balance of Th1 and Th2 cytokines in mouse spleen;

[0049] Figure 10 shows the effects of sodium alginate covalently modified fish gelatin in Examples 1-5 on intestinal barrier function in mice.

[0050] Figure 11 shows the effect of sodium alginate covalent modification in Examples 1-5 on the release rate of β-aminohexosidase in RBL-2H3 cells;

[0051] Figure 12 shows the covalent modification sites and allergen epitope masking of the main allergen, Fibrillar collagen NC1 domain-containing protein, in fish gelatin in Examples 1-5. Detailed Implementation

[0052] To better understand the present invention, the high performance and low allergenicity characteristics of the present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto.

[0053] Fish gelatin was purchased from Shanghai Yuanye Biotechnology Co., Ltd., sodium alginate was purchased from Aladdin Biochemical Technology Co., Ltd., C2C12 cells were purchased from Pronosei Life Technology Co., Ltd., high glucose DMEM culture medium, fetal bovine serum, and double antibodies were purchased from Wuhan Sewell Biotechnology Co., Ltd., and BALB / c mice were purchased from Liaoning Changsheng Biotechnology Co., Ltd.

[0054] Example 1: Preparation and physical property characterization of fish gelatin-based cell culture scaffold

[0055] (1) Preparation of gelatin solution: Using fish gelatin as raw material, weigh an appropriate amount of fish gelatin and dissolve it in deionized water. Heat the solution at 70°C for 20-60 minutes to make the gelatin solution a transparent and clear liquid. The mass concentration of the fish gelatin solution obtained is 12%.

[0056] (2) Add 1 wt% sodium alginate powder to the fish gelatin solution, dissolve and mix well, and heat at 90°C for 30 min to obtain the fish gelatin sodium alginate covalent complex.

[0057] (3) The fish gelatin sodium alginate covalent complex was poured into a mold and cooled and shaped under an ice-water bath at 4°C. Then, 2% pre-cooled calcium chloride solution was added for solidification. The calcium chloride solution was 3 to 6 times the volume of the covalent complex to obtain a sodium alginate fish gelatin cell culture meat scaffold.

[0058] Example 2

[0059] The preparation method is the same as in Example 1, except that the amount of sodium alginate added is 0.25 wt%.

[0060] Example 3

[0061] The preparation method is the same as in Example 1, except that the amount of sodium alginate added is 0.50 wt%.

[0062] Example 4

[0063] The preparation method is the same as in Example 1, except that the amount of sodium alginate added is 2.00 wt%.

[0064] Example 5

[0065] The preparation method is the same as in Example 1, except that the amount of sodium alginate added is 4.00 wt%.

[0066] Comparative Example 1

[0067] The preparation method is the same as in Example 1, except that the amount of sodium alginate added is 0%.

[0068] Comparative Example 2

[0069] Fish gelatin is used as raw material. The fish gelatin is weighed and dissolved in deionized water, and heated at 70°C for 20-60 minutes to dissolve it, so that the gelatin solution becomes a transparent and clear liquid. After cooling, gel (FG) is obtained.

[0070] The gel strength of the cell culture scaffold was tested using the TA.XT.PLUS physical property analyzer. A p / 0.5 probe was selected, the test speed was 1 mm / s, the compression ratio was 50%, and the trigger force was 5 g.

[0071] The prepared cell culture meat scaffold was subjected to vacuum freeze-drying, ground into powder using a pulverizer, and then prepared into round tablets with a diameter of 1 cm and a thickness of 2 mm using a tablet press. The tablets were gently placed on the sample stage, and 2 μL of water was deposited on the surface of the tablets using a high-precision syringe. After equilibration for 10 seconds, the contact angle of the cell culture meat scaffold sample was automatically obtained using an optical contact angle measurement profile analysis system (SCA20, DataPhysics Instruments, Germany).

[0072] The appearance of the fish gelatin-based hydrogel cell culture scaffold is shown in Figure 1a, and the gel strength of the hydrogel scaffold is shown in Figure 1b. It can be seen that the gel strength of the fish gelatin-based cell culture scaffold alone is 314.96 g, while the gel strength of the fish gelatin-based cell culture scaffold after sodium alginate covalent modification reaches 889.50 g, an increase of approximately 282.42%. This demonstrates that sodium alginate covalent modification can significantly improve the mechanical strength and stability of the cell culture scaffold. To further analyze the effect of sodium alginate covalent modification on the cell adhesion properties of the fish gelatin-based cell culture scaffold, the contact angle results are shown in Figures 1c and 1d. It can be seen that the contact angle of all samples is less than 90°, indicating that it is a hydrophilic material that can provide hydrophilic targets for cell adhesion. Simultaneously, sodium alginate covalent modification significantly reduces the contact angle of the cell culture scaffold, increasing its hydrophilicity and further promoting cell adhesion and proliferation. Example 1 confirms that sodium alginate covalent modification is an effective means to improve the performance of fish gelatin-based cell culture scaffolds.

[0073] Example 6: Biocompatibility Evaluation of Fish Gelatin-Based Cell Culture Meat Scaffold

[0074] (1) The scaffolds prepared in Examples 1-5 and Comparative Example 1 were placed in an autoclave and sterilized at 121°C and 0.1MPa for 20 minutes to obtain sterile cell culture meat scaffolds.

[0075] (2) Add high-glucose DMEM medium to the sterile cell culture meat scaffold obtained in step (1) to swell. Add more than three times the volume of high-glucose DMEM medium to the cell culture meat scaffold to swell. After swelling is balanced, remove the medium.

[0076] (3) The hydrogel scaffold was prepared in a well plate, and C2C12 cells in the logarithmic growth phase were seeded on the scaffold. After 24 hours, the cell viability was measured using the CCK-8 kit.

[0077] (4) Place the hydrogel scaffold in a sterile environment and place C2C12 cells in the logarithmic growth phase at a density of 2×10⁻⁶. 5 ~1×10 6 Cells / mL were seeded onto a cell culture scaffold and cultured in proliferation medium (10% fetal bovine serum + 1% antibiotics + 89% DMEM high glucose medium) for adhesion and proliferation. The medium was changed every 24 hours and the culture environment was 37℃ and 5% carbon dioxide.

[0078] When the confluence of C2C12 cells on the scaffold reached approximately 80%, Trizol lysis buffer was added, and total mRNA was extracted according to the reagent instructions. The mRNA concentration was measured using NanoDrop (Thermo Fisher Scientific), and the concentration was adjusted to be consistent using sterile, enzyme-free water. Reverse transcription and amplification were performed according to the instructions of the Evo M-MLV Reverse Transcription Kit II and the SYBR Green Pro Taq HS Premixed qPCR Kit to detect the mRNA expression level of N-cadherin. N-cadherin is an intercellular adhesion protein that mainly functions in intercellular connections. The forward sequence from the 5' to the 3' end of the N-cadherin primer is ACAATGGAATCCCGCCTATG, and the reverse sequence is GGTCTATGTCATAATCAAGTGCTGTG, normalized with GADPH.

[0079] Cytoskeleton morphology observation: Cells on the scaffold were fixed with 4% paraformaldehyde fixative for 30-60 min, washed three times with PBS, then permeated with 0.1% Tritium X-100 PBS buffer for 30 min, stained with FITC-labeled phalloidin for 30 min, and then counterstained with DAPI. After 10 min, the cells were observed using a fluorescence inverted microscope.

[0080] To investigate the cytotoxicity of the cell culture scaffold material for fish, cell viability was detected using a CCK-8 assay kit. The results, shown in Figure 2, indicate that the cell viability of all samples remained around 95%, demonstrating that the cell culture scaffold material for fish is non-toxic and harmless. Subsequently, RT-qPCR was used to characterize the expression level of N-cadherin mRNA in the cells. It was found that 1% sodium alginate covalent modification significantly increased the expression level of N-cadherin, enhancing cell adhesion. Simultaneously, cytoskeleton staining results showed that the sodium alginate-based fish gelatin cell culture scaffold was suitable for cell adhesion and proliferation, exhibiting a clear cell adhesion structure. Especially when the sodium alginate content was greater than 1%, the cytoskeleton structure was more pronounced, making it more suitable as a cell culture scaffold material for fish.

[0081] When the cell confluence reached approximately 80%, the hydrogel cell culture scaffold was transferred to differentiation medium (2% horse serum + 1% penicillin-dextrose antibody + 97% DMEM high-glucose medium) to induce myoblast differentiation until distinct myotube structures were formed. Figure 3 shows a bright-field microscope image of C2C12 cells after 7 days of differentiation on the scaffold, demonstrating that the differentiated cells adhered and fused to form myotube structures. RT-qPCR revealed that sodium alginate covalent modification significantly increased the mRNA expression level of the differentiation marker desmin, confirming that the cell culture scaffold prepared with sodium alginate covalent modification can provide suitable conditions for cell adhesion, proliferation, and differentiation.

[0082] Example 7: Demonstrating the excellent printability of fish gelatin-sodium alginate covalent complex using 3D printing technology.

[0083] The prepared fish gelatin-sodium alginate covalent complex was poured into the bio-ink container of the cell 3D printer as 3D printing ink. The nozzle temperature was set at approximately 25℃, the platform temperature at 10℃, the angle at 90°, the edge width at 1.5mm, the first layer height at 0.2mm, the spacing at 1.2mm*1.2mm, the printing speed at 700mm / min, and the edge speed at 650mm / min. The printing pressures for the FG, 0.25%, 0.50%, 1.00%, 2.00%, and 4.00% samples were 150KPa, 200KPa, 200KPa, 350KPa, 450KPa, and 700KPa, respectively. After automatic printing, calcium chloride was used for curing to obtain the 3D printed cell scaffold. Figure 4 shows the appearance of the 3D printed scaffold. It can be seen that all samples are printable, and the scaffold structure is clear and the outline is stable, indicating that the sodium alginate-fish gelatin scaffold can realize 3D cell culture and provide a growth and metabolic environment for cells. Taking a 1% 3D printed scaffold as an example, after inoculation of cells, adhesion and proliferation culture were performed and the cytoskeleton was stained. The spatial distribution of the cells was scanned using a laser confocal microscope. The results are shown in Figure 5. It can be seen that the cells can achieve three-dimensional distribution on the scaffold, proving that sodium alginate fish gelatin scaffold can be an ideal material for cell culture meat scaffold.

[0084] Example 8: Evaluation of the sensitization of fish gelatin-based cell culture meat scaffolds based on a BALB / c mouse sensitization model

[0085] (1) The prepared fish gelatin-based scaffold was freeze-dried, then pulverized with a grinder, and then stored at -20℃ for later use.

[0086] (2) The potential sensitization of cell culture meat scaffolds was assessed by establishing a BALB / c mouse sensitization model. Different scaffold samples were dissolved in physiological saline and used as allergens to stimulate BALB / c mice by gavage at a dose of 0.3 g / kg BW. The gavage protocol is shown in Figure 6. BALB / c mice were randomly grouped using a random number table method and fed acclimatized for one week before the formal experiment. On days 0, 7, 14, 21, and 28 of the formal experiment, each group of mice was treated with fish gelatin by gavage five times.

[0087] (3) Blood was collected from the inner canthal vein of the eye on the 42nd day after sensitization. After standing for 30 minutes, the blood was centrifuged at 5000 r / min and 4℃ for 10 minutes. The upper serum was collected for the determination of serum-specific IgE.

[0088] (4) Method for determining serum-specific IgE: Fish gelatin covalently modified with sodium alginate at different concentrations was prepared into 10 μg / mL protein solutions using 0.05 M sodium carbonate buffer (pH 9.6). 100 μL of the protein solution was coated into each well of a 96-well plate. After coating at 4°C for 12 h, the liquid in the wells was discarded, and 250 μL of 0.1% BSA-Tween was added to each well. 20 μL of PBS wash buffer was added, shaken at room temperature for 5 min, and then patted several times on clean absorbent paper until no obvious liquid remained in the wells. This step was repeated 3 times. 150 μL of PBS buffer containing 1% BSA was added to each well and the plate was blocked at 37°C for 2 h. The plate was washed 3 times. 100 μL of the corresponding mouse allergic serum diluted 1:5 was added to each well. The control group was incubated with physiological saline mouse serum. The plate was incubated at 37°C for 2 h and washed and patted dry 6 times. 100 μL of biotin-labeled rat anti-mouse IgE (1:1000) was added to each well and incubated at 37°C for 1 h. The plate was washed and patted dry 6 times. 100 μL of HRP-labeled streptavidin (1:2000) was added to each well and incubated at 37°C for 1 h. The plate was washed and patted dry 6 times. 100 μL of TMB chromogenic solution was added and the plate was reacted at 37°C in the dark for 5 min. 50 μL of 2N H2SO4 stop solution was added, and the absorbance was measured immediately at 450 nm. The results of serum-specific IgE are shown in Figure 7. It can be seen that the IgE content in the serum of mice in the fish gelatin gavage group was higher than that in the saline group, indicating that fish gelatin has potential sensitizing properties. Sodium alginate covalently modified fish gelatin can significantly reduce the content of serum-specific IgE in mice, indicating that sodium alginate covalent modification is an effective technique for reducing the sensitizing properties of fish gelatin-based cell culture scaffolds.

[0089] (5) On day 43 of the sensitization model, mice were stimulated by gavage with a 5-fold dose and symptoms were observed. Blood was collected from the inner canthal vein of the eye 30 minutes later, centrifuged, and plasma was collected. Histamine content was determined according to the instructions. The mice were then euthanized by dislocation, and their spleens were used for RT-qPCR to investigate the balance between Th1 and Th2 cytokines. Primer sequences are shown in Table 1.

[0090] Table 1 Primer sequences

[0091] The histamine levels were measured, as shown in Figure 8. It can be seen that covalent modification with sodium alginate significantly reduced histamine levels in mouse plasma. Compared to the fish gelatin group, the release of histamine in mice decreased by approximately 54.35% when sodium alginate was added at 1%. When an allergic reaction occurs, homeostasis in mice is disrupted, typically manifested as excessive secretion of Th2 cytokines and insufficient secretion of Th1 cytokines. Figure 9 shows that covalent modification with sodium alginate significantly reduced the mRNA gene expression of Th2 cytokine (IL-4) and restored the expression of Th1 cytokines (IFN-γ). Covalent modification with sodium alginate reduces sensitization by regulating the balance of Th1 and Th2 cytokines in mice.

[0092] Example 9: Investigating the effect of sodium alginate covalent modification on intestinal barrier function in mice based on a BALB / c mouse sensitization model

[0093] Mice were randomly selected from different groups and administered 80 mg / kg body weight of FITC-labeled glucose (FITC-Dextran) by gavage. Four hours later, a high-stimulation challenge was performed by gavage at a 5-fold dose. Four hours later, blood was collected from the orbital sinus into centrifuge tubes containing EDTA-K2. After standing for 30 minutes, plasma was collected by centrifugation. Serum from each group was aspirated into 96-well fluorescent microplates, and fluorescence values ​​at excitation wavelength of 493 nm and emission wavelength of 518 nm were measured. The remaining mice were subjected to histopathological observation of their jejunum following the procedure in step (5) of Example 8. The results of mouse intestinal permeability are shown in Figure 10a. It can be seen that sodium alginate covalent modification can significantly reduce mouse intestinal permeability, reduce the entry of allergens, and thus achieve the purpose of low sensitization. H&E staining of mouse jejunum showed that the villi in the jejunum of mice in the saline group were arranged tightly and orderly, while the villi in the mice in the fish gelatin gavage group were relatively sparse and slightly broken. The villi breakage in the mice in the fish gelatin group covalently modified with sodium alginate gavage was significantly improved, further confirming that sodium alginate covalent modification can reduce sensitization by protecting the intestinal barrier of mice.

[0094] Example 10: Evaluation of the sensitization of fish gelatin-based scaffolds using a rat basophilic leukemia cell (RBL-2H3) immunological model

[0095] RBL-2H3 cells in logarithmic growth phase were harvested at a dose of 1×10⁻⁶. 5 Cells were seeded per well into 96-well cell culture plates and cultured for 24 h. After washing the cells with PBS buffer, 100 μL of allergic serum diluted with MEM (without fetal bovine serum) was added to each well. After 24 h, the allergic serum was aspirated and washed three times with modified Benzoate buffer (135 mM NaCl, 5 mM KCl, 1 mM MgCl2, 1 mM CaCl2, 20 mM HEPES, 5.6 mM glucose, 0.05% bovine serum albumin [pH 7.4]). Then, 50 μL of allergen prepared with Benzoate buffer at concentrations of 0.01, 0.1, 1, 10, and 100 μg / mL were added sequentially. The reaction was incubated for 45 min in a constant temperature incubator and then immediately placed in an ice box to stop the reaction. After terminating the reaction, 30 μL of the supernatant was added to 50 μL of 1 mmol / L 4-nitrophenyl Nacetyl-β-D-glucosaminide citrate buffer solution and reacted at 37°C for 1 h. The absorbance of the negative control group was obtained after treating cells with modified Benzoate buffer instead of the corresponding allergen, and the absorbance of the positive control group was obtained after treating cells with 1% Tritium X-100 instead of the allergen. β-aminohexosidase release rate = [(sample group absorbance - negative control group absorbance) / (total release group absorbance - negative control group absorbance)] × 100%. The results of β-aminohexosidase release rate are shown in Figure 11. After covalent modification with sodium alginate, the release rate of β-aminohexosidase in RBL-2H3 cells decreased from 27.50% to 11.31%, a decrease of 243.10%, further confirming that covalent modification with sodium alginate is an effective means of reducing the sensitization of cell culture scaffolds.

[0096] Example 11: Identification of sodium alginate-masked fish gelatin allergen epitopes based on LC-MS / MS combined with bioinformatics analysis

[0097] Taking fibrillar collagen NC1 domain-containing protein in fish gelatin as an example, this study investigated the effect of sodium alginate covalent modification on masking allergen epitopes. A fish gelatin sodium alginate covalently modified sample was prepared at pH 8 using 8M urea and 1M triethylammonium bicarbonate buffer (TEAB). 100 μL of the sample was added to 2 μL of 0.5M trichloroethyl phosphate (TCEP) and reacted at 37℃ for 1 h. Then, 4 μL of 1M iodoacetamide (IAM) was added, and the reaction was carried out at room temperature in the dark for 40 min. Pre-cooled acetone was then added at a sample:acetone ratio of 1:5, and the mixture was incubated overnight at -20℃ to precipitate. The sample was then centrifuged at high speed (12000g, 20 min, 4℃) and the supernatant was discarded. 1 mL of pre-cooled 90% acetone solution was added, and the sample was vortexed to wash it. The sample was then centrifuged again at high speed (12000g, 20 min, 4℃) and the supernatant was discarded. This washing step was repeated twice. After drying at room temperature until the acetone on the precipitate surface is completely evaporated, it is redissolved in 100 μL of 100 mM triethylammonium bicarbonate buffer (TEAB), and trypsin is added at an enzyme:protein (mass ratio) of 1:50. The mixture is then incubated overnight at 37°C. After desalting using a C18 desalting column, the precipitate is lyophilized. The mass spectrometer is operated in data-dependent acquisition mode and automatically switches between MS and MS / MS acquisition. The mass spectrometry parameters are set as follows: (1) MS: Scan range (m / z): 350-1500; Resolution: 60,000; Normalized AGC target: 300%; Maximum injection time: 25 ms; (2) HCD-MS / MS: Resolution: 15,000; Normalized AGC target: 50%; Maximum injection time: 22 ms; Collision energy: 30%; Dynamic exclusion time: 30 s. Tandem mass spectra were analyzed using PEAKS Studio version 10.6 (Bioinformatics Solutions Inc., Waterloo, Canada). The database used was uniprot-Oreochromis_niloticus (version 2023, 28040 entries), with trypsin digestion and partial digestion configured. Search parameters included a fragment ion mass tolerance of 0.02 Da, a precursor ion mass tolerance of 10 ppm, a protein card value of 1% FDR (containing at least one unique peptide), and a peptide card value of 1% FDR. A series of covalent modification sites were obtained using the protein's mass-to-charge ratio shift.Protein sequences obtained by LC-MS / MS were used to predict allergen epitopes using five bioinformatics software programs: DNAStar, AntheProt, BCpred, Immunomedicine Group, and BepiPred 1.0. Epitopes predicted by three or more software programs were designated as linear allergen epitopes, and these epitopes are marked with gray shading in Figure 12. The results of the linear allergen epitopes were compared with covalent modification sites to obtain the number of allergen epitopes masked by sodium alginate covalent modification. The results are shown in Figure 12: circles represent covalent modification sites in samples with 0.50% sodium alginate addition, stars represent covalent modification sites in samples with 1.00% sodium alginate addition, triangles represent covalent modification sites in samples with 2.00% sodium alginate addition, and rectangles represent covalent modification sites in samples with 4.00% sodium alginate addition. As shown in Figure 12, the addition of 0.50%, 1.00%, 2.00%, and 4.00% sodium alginate successfully achieved covalent modification of fish gelatin, with the number of covalent modification sites located on the allergen epitopes being 41, 54, 44, and 35, respectively. When the sodium alginate addition was 1.00% and 2.00%, there were relatively more masking sites, thus resulting in relatively lower sensitization.

[0098] The embodiments provided above are not intended to limit the scope of the invention, nor are the described steps intended to limit the order of execution. Any obvious modifications made to the invention by those skilled in the art based on existing common knowledge also fall within the scope of protection defined by the claims.

Claims

1. A method for preparing a highly stable and low-allergenic 3D cell culture scaffold, characterized in that, Includes the following steps: (1) Dissolve fish gelatin in deionized water to obtain a fish gelatin solution; (2) After mixing fish gelatin solution with sodium alginate, react at 90°C to prepare a covalent complex of sodium alginate and fish gelatin. (3) The sodium alginate and fish gelatin covalent complex obtained in step (2) is cooled and shaped, and then calcium chloride solution is added for solidification to obtain a cell culture meat scaffold.

2. The preparation method according to claim 1, characterized in that, In step (1), the fish gelatin is dissolved at 40–70°C.

3. The preparation method according to claim 1, characterized in that, In step (1), the mass concentration of the fish gelatin solution is 6-15%.

4. The preparation method according to claim 1, characterized in that, In step (2), the mass concentration of sodium alginate in the mixed solution is 0.25-4.00%.

5. The preparation method according to claim 1, characterized in that, In step (2), the fish gelatin solution is mixed with sodium alginate and then heated at 90°C for 20–60 min.

6. The preparation method according to claim 1, characterized in that, In step (3), the mass concentration of the calcium chloride solution is 1-3%; the volume of the added calcium chloride solution is 3-6 times the volume of the covalent complex.

7. The cell culture meat scaffold prepared by any one of claims 1 to 6.

8. A type of cell-cultured meat, characterized in that, The cultured meat comprises the cultured meat scaffold of claim 7 and cells attached thereto.

9. The cell-cultured meat according to claim 8, characterized in that, The cells in question are animal cells.

10. The cell-cultured meat according to claim 9, characterized in that, Animal cells are one or more of the following: muscle cells, adipocytes, fibroblasts, mesenchymal stem cells, and pluripotent stem cells.

Images