Sirna and composition thereof

Abstract

Provided is an siRNA modification pattern which is capable of enhancing inhibitory activity against target mRNA expression, reducing off-target effects, increasing the biological stability of molecules, increasing the physical stability of a duplex formed between antisense and sense nucleic acids, and / or reducing immunogenicity. Further provided is an siRNA for inhibiting MMP7 gene expression, which siRNA contains a sense strand and an antisense strand. Further provided is a conjugate containing an siRNA for inhibiting MMP7 gene expression and a pharmaceutically acceptable targeting molecule (e.g., the αvβ6 integrin ligand as represented by formula I).

Description

siRNA and its compositions

[0001] Cross-references to related applications

[0002] This application claims priority to the following patent applications:

[0003] Priority is claimed in the earlier application filed with the State Intellectual Property Office of China on January 26, 2025, with patent application number 2025101249293 and entitled "siRNA and Compositions thereof".

[0004] Priority is claimed in the earlier application filed with the State Intellectual Property Office of China on August 29, 2025, with patent application number 2025112318742 and entitled "siRNA and Compositions thereof".

[0005] Priority is claimed in the earlier application filed with the State Intellectual Property Office of China on January 15, 2026, with patent application number 2026100553411 and title "siRNA and Compositions Thereof".

[0006] The entire contents of the aforementioned patent application are incorporated herein by reference. Technical Field

[0007] This invention provides a modification pattern for siRNA targeting the matrix metalloproteinase 7 (MMP7) gene, which can enhance the activity of inhibiting target mRNA expression, reduce off-target effects, increase the biological stability of the molecule, increase the physical stability of the double strand formed between antisense and sense nucleic acids, and / or reduce immunogenicity. Furthermore, this invention provides an siRNA that inhibits MMP7 expression and a pharmaceutical composition thereof. This invention also provides conjugates and pharmaceutical compositions thereof, comprising an siRNA that inhibits MMP7 gene expression and a pharmaceutically acceptable targeting molecule (e.g., the αvβ6 integrin ligand shown in Formula I). ​​The siRNA, conjugates, and pharmaceutical compositions provided by this invention can treat diseases associated with matrix metalloproteinase 7 overexpression. Background Technology

[0008] Matrix metalloproteinase 7 (MMP7) is the smallest member of the metalloproteinase (MMP) family, which includes 24 associated secretory zinc-dependent endopeptidases with diverse substrates and functions. These MMPs degrade components of the extracellular matrix and cleave and regulate the activity of non-extracellular matrix substrates. Despite their attractiveness as drug targets, the development of MMP inhibitors is challenging due to the structural similarity of their zinc-dependent catalytic domains among family members. MMP7 is constitutively expressed and secreted by epithelial cells throughout the body and plays a role in epithelial repair. Increased MMP7 expression is associated with pathogenic fibrosis in the lungs and liver. MMP7 enzyme levels are associated with pathogenic fibrosis through multiple potential mechanisms, including promoting epithelial-mesenchymal transition, extracellular matrix degradation, aberrant matrix repair, and tissue remodeling. MMP7 promotes fibrosis by cleaving E-cadherin to activate epithelial cells and by proteolytically activating heparin-binding epidermal growth factor precursors to release active HB-EGF, thereby promoting aberrant epithelial migration and human lung fibroblast proliferation. In addition, MMP7 facilitates the transendothelial and tissue migration of fibroblasts, leading to more fibroblasts migrating to lung tissue; MMP7 can cleave mFasL on T cells into sFasL, inhibiting the killing effect of T cells on lung myofibroblasts; MMP7 causes the syndecan-1 / CXCL1 protein complex to detach, leading to neutrophil infiltration through the epithelium, promoting epithelial cell damage and fibrosis.

[0009] Idiopathic pulmonary fibrosis (IPF) is a typically fatal chronic lung disease with a clinical course and relatively unpredictable progression. Increased MMP7 expression has been observed in peripheral blood, bronchoalveolar lavage fluid, sputum, and lung tissue in IPF patients. Serum MMP7 expression is a serum biomarker for IPF and is associated with the severity and progression of IPF.

[0010] Lung cancer can be divided into two main subtypes: small cell lung cancer (SCLC) and non-small cell lung cancer (NSCLC). Compared to NSCLC, small cell lung cancer is often less common, but it can be more invasive and can rapidly metastasize or spread to other parts of the body. NSCLCs are the most common type of lung cancer, accounting for 87% of lung cancer cases. Compared to small cell lung cancer, NSCLC tends to grow and spread more slowly. NSCLC has several classifications, including adenocarcinoma, squamous cell carcinoma, large cell carcinoma, and carcinoid tumors. MMP7, as a biomarker, can be used to detect cancers such as lung cancer. MMP7 is an important participant in lung cancer invasion and metastasis; peripheral blood MMP7 levels in lung cancer patients are significantly higher than in normal individuals, and MMP7 levels are positively correlated with disease progression. Inhibiting MMP7 can suppress the growth and invasion of cancer cells.

[0011] Small interfering RNA (siRNA) is an emerging and highly promising candidate for research. Based on RNA interference mechanisms, it can inhibit or block the expression of target genes of interest in a sequence-specific manner, thereby achieving the goal of treating diseases. Specifically, siRNA is loaded into the RNA-induced silencing complex (RISC). Its guide strand, also known as the antisense strand, pairs complementaryly with the target nucleic acid in the mRNA of the target gene, causing the mRNA of the target gene to degrade, thereby inhibiting or blocking the expression of the target gene. Since siRNA recognizes the target RNA sequence-specifically through base pairing, thereby achieving the cleavage of the target RNA and downregulating the level of the target RNA and inhibiting the expression of the target gene, siRNA has a very broad application prospect.

[0012] However, the interspecies variation of MMP7 increases the difficulty of siRNA drug development. Furthermore, compared to traditional drugs, siRNAs have poor stability and are easily degraded by nucleases when administered systemically. Additionally, it is necessary to further enhance activity while avoiding off-target effects, immune stimulation, cytotoxicity, and other side effects. Therefore, developing more candidate siRNAs that are stable in the blood, possess good biological activity, and have low cytotoxicity to inhibit MMP7 gene expression is an urgent problem to be solved. At the same time, developing drugs using these candidate siRNAs that inhibit MMP7 gene expression to effectively prevent and / or treat MMP7-related diseases is both necessary for clinical research and a realistic possibility for commercialization.

[0013] Integrin α-vβ-6 (αvβ6), expressed in various cell types including epithelial cells, is a receptor for the delayed-related peptide (LAP) of TGF-β and extracellular matrix (ECM) proteins fibronectin, hylocinin, and tendinin. αvβ6 integrin is expressed in normal healthy adult lung epithelial cells, upregulated in the lung tissue of IPF patients, and may be negatively correlated with patient prognosis.

[0014] The in vivo delivery of therapeutically effective compounds (such as pharmaceutical compounds) to desired cells and / or tissues has always been a persistent challenge in drug product development. There has been a need for stable and effective targeting ligands capable of selectively targeting cells or tissues, which can facilitate the targeted delivery of transported / delivered molecules (e.g., therapeutically active compounds or components) to specific cells or tissues. For siRNA, there is a need for targeting ligands capable of targeting integrin αvβ6, which can be conjugated to oligonucleotide-based compounds to deliver therapeutic agents to cells and / or tissues expressing integrin αvβ6 and facilitate the entry of therapeutic agents into cells via receptor-mediated endocytosis, pinocytosis, or other pathways. Constructing conjugates of siRNA with targeting ligands targeting integrin αvβ6 can improve siRNA conversion efficiency, and there is both clinical necessity and commercial viability. Summary of the Invention

[0015] This invention provides siRNA modification modes that can enhance the activity of inhibiting target mRNA expression, reduce off-target effects, increase the biological stability of molecules, increase the physical stability of the double strand formed between antisense and sense nucleic acids, and / or reduce immunogenicity. It also provides siRNAs that can effectively inhibit MMP7 gene expression, thereby providing drugs and methods for the prevention and / or treatment of MMP7-related diseases.

[0016] 1. siRNA modification mode

[0017] siRNAs can be modified in their nucleoside base structure or ribose-phosphate backbone to enhance their ability to inhibit target mRNA expression, reduce off-target effects, increase molecular biostability, increase the physical stability of the duplex formed between antisense and sense nucleic acids, and / or reduce immunogenicity. siRNA molecules containing ribonucleoside analogs or derivatives must retain the ability to form duplexes and allow or mediate specific degradation of target RNA via the RISC pathway.

[0018] In some embodiments of the invention, the siRNA contains at least one modified nucleotide. The modifications need not be identical for each of the plurality of modified ribonucleotides in the siRNA.

[0019] In some embodiments of the present invention, all nucleotides in the sense strand and / or antisense strand of the siRNA are modified nucleotides or nucleotide analogs.

[0020] In some embodiments of the present invention, the siRNA comprises 2'-modified nucleotides.

[0021] In some embodiments of the present invention, the modified nucleotide is selected from 2'-methoxynucleotides, 2'-fluoronucleotides, 2'-deoxynucleotides, 2',3'-cleaved nucleotide analogs, 2'-fluoroarabinonucleotides, 2'-methoxyethylnucleotides, 2'-amino-modified nucleotides, 2'-alkyl-modified nucleotides, 3'-methoxynucleotides, 2'-allyl-modified nucleotides, nucleotides containing thiophosphate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphate groups, nucleotides containing 5'-phosphate mimics, diol-modified nucleotides, deoxyxanthine nucleotides, 2'-O-methoxyethyl-modified nucleotides, 2'-methoxy and 2'-fluoro-modified nucleotides, debased nucleotides, morpholinonucleotides, locked nucleotides (LNA), unlocked nucleotides (UNA), or glycerol nucleotides (GNA), but the present invention is not limited thereto.

[0022] In some embodiments of the present invention, the nucleotides in the sense strand of the siRNA are selected from at least two of 2'-methoxynucleotides, 2'-fluoronucleotides, and 2'-deoxynucleotides; and / or the nucleotides in the antisense strand of the siRNA are selected from at least two of 2'-methoxynucleotides, 2'-fluoronucleotides, nucleotides modified with 2'-methoxy and 2'-fluoro, deoxyxanthine nucleotides, nucleotides modified with 2'-O-methoxyethyl, glycerol nucleotides, unlocking nucleotides, and nucleotides of 5'-phosphate mimics.

[0023] In some embodiments of the invention, the 5' and / or 3' ends of the positive strand of the siRNA optionally include capping residues (e.g., iab).

[0024] In some embodiments of the invention, the first nucleotide at the 5' end of the antisense strand of the siRNA optionally comprises (E)-vinylphosphonate modification.

[0025] In some embodiments of the present invention, the sense strand and / or antisense strand of the siRNA contains modified internucleotide links; preferably, the 5' end and 3' end of the sense strand each independently contain one or two thiophosphate groups; and / or the 5' end and 3' end of the antisense strand each independently contain one, two, or three thiophosphate groups.

[0026] In some embodiments of the present invention, the above-described antisense strand modification mode and / or sense strand modification mode are applied to small interfering RNA (siRNA) for inhibiting MMP7 gene expression.

[0027] Preferably, the antisense strand of the small interfering RNA (siRNA) for inhibiting MMP7 gene expression comprises the nucleotide sequence shown in any one of SEQ ID NO:12 to SEQ ID NO:25, SEQ ID NO:284, and SEQ ID NO:285;

[0028] Preferably, the positive strand of the small interfering RNA (siRNA) for inhibiting MMP7 gene expression comprises the nucleotide sequence shown in any one of SEQ ID NO:37 to SEQ ID NO:50 and SEQ ID NO:286.

[0029] In some embodiments of the present invention, the antisense strand of the siRNA is 23, 22, or 21 nucleotides long and includes the following modification patterns:

[0030] 1)AS(5'-3'):VPmNsfNsmNmNmNmNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 213);

[0031] 2)AS(5'-3'):VPmNsfNmNmNmNmNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 214);

[0032] 3)AS(5'-3'):VPmNsfNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmNfNmNsmNsmN (SEQ ID NO: 215);

[0033] 4)AS(5'-3'):VPmNsfNmNmNmN(GNA-N)mNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 216);

[0034] 5)AS(5'-3'):VPmNsfNmNmNmNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 217);

[0035] 6)AS(5'-3'):VPmNsfNmN(MOE-N)mNfNmNfNfNmNfNmNfNmNfNmNfNmNmNmNmNsmNsmNsmN(SEQ ID NO: 218);

[0036] 7)AS(5'-3'):mNsfNsmNmNmNfNmNfNfNmNfNmNfNmNfNmNfNmNmNmNmNsmNsmNsmN(SEQ ID NO: 219);

[0037] 8)AS(5'-3'):mNsfNsmNmNmNmNmNfNfNmNmNmNmNfNmNmNmNmNmNmNmNsmNsmN(SEQ ID NO:220);

[0038] 9)AS(5'-3'):VPmNsfNsmNmNmNmN(GNA-N)fNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO: 221);

[0039] 10)AS(5'-3'):VPmNsfNsmNmNmNmN(UNA-N)fNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO: 222);

[0040] 11)AS(5'-3'):VPmNsfNsmNmNmNmNfmNfNfNmNmNmNmNmNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:223);

[0041] 12)AS(5'-3'):VPmNfNmNmNmNmN(GNA-N)fNfNmNmNmNmNfNmNfNmNmNmNmNmNmNsmN(SEQ ID NO: 224);

[0042] 13)AS(5'-3'):VPmNsfNsmN(dI)mNmNmNfNfNmNmNmNmNmNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:225);

[0043] 14)AS(5'-3'):VPmNsfNsmNmN(dI)mNmNfNfNmNmNmNmNmNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:226);

[0044] 15)AS(5'-3'):VPmNsfNsmNmNmN(dI)mNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO: 227);

[0045] 16)AS(5'-3'):VPmNsfNsmNmNmNmN(dI)fNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO: 228);

[0046] 17)AS(5'-3'):VPmNsfNsmNmNmNmNmN(dI)fNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO: 229);

[0047] 18)AS(5'-3'):VPmNsfNmN(dI)mNmNmNfNfNmNmNmNmNmNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:230);

[0048] 19)AS(5'-3'):VPmNsfNmN(dI)mNmNmN(MOE-N)fNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:231);

[0049] 20)AS(5'-3'):VPmNsfNmN(MOE-N)mNmNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmNsmN(SEQ ID NO: 232);

[0050] 21)AS(5'-3'):VPmNsfNmNmNmNfNmNfNfNmNmNfNmNfNmNmNmNmNmNmNsmNsmNsmN(SEQ ID NO:233);

[0051] 22)AS(5'-3'):mNsfNsmNmNmNfNmNfNfNmNfNmNfNmNfNmNfNmNmNmNmNsmNsmN(SEQ ID NO: 234);

[0052] 23)AS(5'-3'):mNsfNsmNmNmNmNmNmNfNmNmNfNmNfNmNmNmNmNmNmNmNsmNsmN(SEQ ID NO:235);

[0053] 24)AS(5'-3'):VPmNsfNsmNmNmNfNmNfNfNmNmNfNmNfNmNmNmNmNmNmNmNsmNsmN(SEQ ID NO:236);

[0054] 25)AS(5'-3'):VPmNsfNsmNmNmNmNmNmNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:237);

[0055] 26)AS(5'-3'):VPmNsfNsmNmNmNfNmNfNfNfNmNmNmNmNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:238);

[0056] 27)AS(5'-3'):VPmNsfNsmNmNmNmNmNfNfNmNmNmNmNmNmNmNmNmNmNmNmNmNsmN(SEQ ID NO:239);

[0057] 28)AS(5'-3'):VPmNsfNsmN(dI)mNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:240);

[0058] 29)AS(5'-3'):VPmNsfNsmNmN(dI)fNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:241);

[0059] 30)AS(5'-3'):VPmNsfNsmNmNmNfN(dI)fNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:242);

[0060] 31)AS(5'-3'):VPmNsfNmNmNmNfNmNfNfNmNmNfNmNfNmNmNmNmNmNmNmNmNsmN(SEQ ID NO:269);

[0061] 32)AS(5'-3'):VPmNfNmNmNmNfNmNfNmNfNmNfNmNfNmNfNmNmNmNmNmNsmNsmNsmN(SEQ ID NO: 270);

[0062] 33)AS(5'-3'):VPmNsfNmN(MOE-N)mNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNsmNsmN (SEQ ID NO: 290);

[0063] 34)AS(5'-3'):VPmNsfNmN(MOE-N)mNfNmNfNfNmNmNfNmNfNmNfNmNmNmNsmNsmN (SEQ ID NO: 291);

[0064] Wherein, mN is a methoxy-modified nucleotide, fN is a fluorinated nucleotide, fmN is a methoxy and fluorinated nucleotide, VP is (E)-vinylphosphonate modified, s is a thiophosphate linkage, (dI) is a deoxyxanthine nucleotide, (MOE-N) is a 2'-O-methoxyethyl modified nucleotide, (GNA-N) is a glycerol nucleotide, and (UNA-N) is an unlocking nucleotide.

[0065] In some embodiments of the present invention, the antisense strand of the siRNA is 23, 22, or 21 nucleotides in length and comprises:

[0066] (1) Positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; or

[0067] (2) The 2nd, 8th, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 6th position is a glycerol nucleotide (GNA-N), and the remaining positions are 2'-methoxynucleotides; or

[0068] (3) The 2nd, 8th, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 7th position is a glycerol nucleotide (GNA-N), and the remaining positions are 2'-methoxynucleotides; or

[0069] (4) The 2nd, 8th, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 7th position is an unlocking nucleotide (UNA-N), and the remaining positions are 2'-methoxynucleotides; or

[0070] (5) The 2nd, 8th, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 4th position is a deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; or

[0071] (6) The 2nd, 8th, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 5th position is a deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; or

[0072] (7) The 2nd, 8th, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 6th position is a deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; or

[0073] (8) The 2nd, 8th, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 7th position is a deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; or

[0074] (9) The 2nd, 8th, 9th, 14th, and 16th positions of the 5' end of the antisense strand are 2'-fluoronucleotides, the 4th position is a nucleotide modified with 2'-O-methoxyethyl (MOE), and the remaining positions are 2'-methoxynucleotides; or

[0075] (10) The 2nd, 9th, 12th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; or

[0076] (11) The 2nd, 9th, 14th, and 16th positions of the 5' end of the antisense strand are 2'-fluoronucleotides, the 8th position is a deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; or

[0077] (12) The 2nd, 9th, 14th, and 16th positions of the 5' end of the antisense strand are 2'-fluoronucleotides, the 4th position is a deoxyxanthine (dI) nucleotide, the 8th position is a nucleotide modified with 2'-O-methoxyethyl (MOE), and the remaining positions are 2'-methoxynucleotides; or

[0078] (13) Positions 2, 6, 14, 16, and 20 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; or

[0079] (14) Positions 2, 6, 8, 9, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; or

[0080] (15) The 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions of the 5' end of the antisense strand are 2'-fluoronucleotides, the 4th position is a nucleotide modified with 2'-O-methoxyethyl (MOE), and the remaining positions are 2'-methoxynucleotides; or

[0081] (16) The 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 4th position is a deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; or

[0082] (17) The 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 5th position is a deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; or

[0083] (18) The 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions of the 5' end of the antisense strand are 2'-fluoronucleotides, the 7th position is a deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; or

[0084] (19) Positions 2, 6, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; or

[0085] (20) The 2nd, 8th, 9th, 14th and 16th positions of the 5' end of the antisense strand are 2'-fluoronucleotides, the 7th position is 2'-methoxy and 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0086] In some embodiments of the present invention, the siRNA has a positive strand length of 21 or 19 nucleotides and comprises:

[0087] 1) SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNfNmNmNmNmNmNmNfNmNmNmNsmN (SEQ ID NO: 243);

[0088] 2) SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNfNmNmNmNsmN (SEQ ID NO: 244);

[0089] 3) SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNsmN (SEQ ID NO: 245);

[0090] 4) SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNfNmNmNmNfNmNfNmNmNmNsmN (SEQ ID NO: 246);

[0091] 5) SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNfNmNmNmNmNmNmNfNmNmNsmNsmN (SEQ ID NO: 247);

[0092] 6) SS(5'-3'):mNsmNmNmNmNmNmNmNfNfNfNmNmNmNmNmNfNmNmNmNsmN (SEQ ID NO: 248);

[0093] 7)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNmNmNmNmNfNmNmNmNmNmNs(iab)(SEQ ID NO: 249);

[0094] 8)SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNfNmNmNmNmNs(iab)(SEQ ID NO: 250);

[0095] 9)SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 251);

[0096] 10)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNmNmNfNmNfNmNfNmNmNmNs(iab)(SEQ ID NO: 252);

[0097] 11)SS(5'-3'):mNsmNmNmNmNmNmNmNfNfNfNmNmNmNmNmNfNmNmNmNmNs(iab)(SEQ ID NO: 253);

[0098] 12)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNfNmNmNfNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 254);

[0099] 13)SS(5'-3'):(iab)smNmNmNmNmNmNfNmNfNfNmNmNmNmNfNmNmNmNmNs(iab)(SEQ ID NO: 255);

[0100] 14)SS(5'-3'):(iab)smNmNmNmNmNmNfNmNfNfNfNmNmNmNmNmNfNmNmNmNmNs(iab)(SEQ ID NO:256);

[0101] 15)SS(5'-3'):mNsmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 257);

[0102] 16)SS(5'-3'):(iab)smNmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 258);

[0103] 17)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNfNmNmNfNmNmNmNmNmNmNmN(SEQ ID NO: 259);

[0104] 18)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNfNmNmNmNmNfNmNmNmNmN(SEQ ID NO: 260);

[0105] 19)SS(5'-3'):(iab)smNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 261);

[0106] 20)SS(5'-3'):mNsmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNmN(SEQ ID NO: 262);

[0107] 21)SS(5'-3'):mNsmNmNmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmN(SEQ ID NO: 263);

[0108] 22)SS(5'-3'):mNsmNmNmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNsmNsmN(SEQ ID NO:264);

[0109] 23)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNdNmNmNmNmNmNmNmNmNsmNsmN(SEQ ID NO:265);

[0110] 24)SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNsmNsmN(SEQ ID NO:266);

[0111] 25)SS(5'-3'):mNsmNmNmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 267);

[0112] 26) SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNdNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 268);

[0113] 27) SS(5'-3'):mNsmNsmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 279);

[0114] 28) SS(5'-3'):mNsmNsmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 280);

[0115] 29)SS(5'-3'):(iab)smNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 281);

[0116] 30)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNdNmNmNmNmNmNmNmNmNmNmN (SEQ ID NO: 282);

[0117] 31)SS(5'-3'):mNsmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNsmNsmN (SEQ ID NO: 283);

[0118] 32) SS(5'-3'):mNsmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 292);

[0119] Wherein, mN is a methoxy-modified nucleotide, fN is a fluorinated nucleotide, dN is a deoxynucleotide, s is a thiophosphate ester linkage, and (iab) is a reverse debasement residue.

[0120] In some embodiments of the present invention, the siRNA has a positive strand length of 21 nucleotides and comprises:

[0121] (1) The 7th, 9th, and 11th positions at the 5' end of the positive strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; or

[0122] (2) The 7th, 9th, and 10th positions at the 5' end of the positive strand are 2'-fluoronucleotides, the 11th position is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides; or

[0123] (3) The 7th, 9th, and 11th positions at the 5' end of the positive strand are 2'-fluoronucleotides, the 10th position is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides; or

[0124] (4) Positions 7, 9, 11, and 17 at the 5' end of the positive strand are 2'-fluoronucleotides, position 10 is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides; or

[0125] (5) Positions 7, 9, 10, 11, and 15 at the 5' end of the positive strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; or

[0126] (6) Positions 7, 9, 10, 11, and 17 at the 5' end of the positive strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; or

[0127] (7) Positions 7, 9, 10, 11, 15, and 17 at the 5' end of the positive strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; or

[0128] (8) The 9th, 10th, 11th and 17th positions of the 5' end of the positive strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides;

[0129] (9) The 9th, 11th, and 13th positions at the 5' end of the positive strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; or

[0130] (10) The 5th, 7th and 9th positions of the 5' end of the positive strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0131] In some embodiments of the present invention, the antisense strand of the siRNA comprises any of the following modification patterns:

[0132] 1)AS(5'-3'):VPmNsfNsmNmNmNmNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 213);

[0133] 2)AS(5'-3'):VPmNsfNmN(dI)mNmNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 230);

[0134] 3)AS(5'-3'):VPmNsfNmN(MOE-N)mNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 218);

[0135] 4)AS(5'-3'):VPmNsfNsmNmNmNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 236);

[0136] 5)AS(5'-3'):VPmNsfNmN(MOE-N)mNfNmNfNfNmNmNfNmNfNmNfNmNmNmNsmNsmN (SEQ ID NO: 291);

[0137] And / or, the sense strand of the siRNA contains any of the following modification patterns:

[0138] 1) SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNsmN (SEQ ID NO: 245);

[0139] 2) SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 251);

[0140] 3) SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNfNmNmNmNfNmNfNmNmNmNmNs(iab) (SEQ ID NO: 252);

[0141] 4) SS(5'-3'):mNsmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 257);

[0142] 5) SS(5'-3'):mNsmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 292);

[0143] Wherein, mN is a methoxy-modified nucleotide, fN is a fluorinated nucleotide, dN is a deoxynucleotide, VP is (E)-vinylphosphonate modified, s is a thiophosphate ester linked, (iab) is a reverse debase residue, (dI) is a deoxyinosine nucleotide; and (MOE-N) is a 2'-O-methoxyethyl modified nucleotide.

[0144] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, 11, and 17 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0145] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 11, and 17 at the 5' end of the sense strand are 2'-fluoronucleotides, position 10 is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides.

[0146] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, position 10 is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides.

[0147] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, 11, 15, and 17 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0148] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 9, 10, 11, and 17 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0149] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 6 is a glycerol nucleotide (GNA-N), and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, 11, 15, and 17 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0150] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein the 2nd, 8th, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 7th position is a glycerol nucleotide (GNA-N), and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein the 7th, 9th, and 11th positions at the 5' end of the sense strand are 2'-fluoronucleotides, the 10th position is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides.

[0151] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 7 is an unlocking nucleotide (UNA-N), and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, position 10 is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides.

[0152] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein the 2nd, 8th, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 4th position is a deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein the 7th, 9th, and 11th positions at the 5' end of the sense strand are 2'-fluoronucleotides, the 10th position is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides.

[0153] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 4 is deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, 11, 15, and 17 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0154] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein the 2nd, 8th, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 5th position is a deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein the 7th, 9th, and 11th positions at the 5' end of the sense strand are 2'-fluoronucleotides, the 10th position is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides.

[0155] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein the 2nd, 8th, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 6th position is a deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein the 7th, 9th, and 11th positions at the 5' end of the sense strand are 2'-fluoronucleotides, the 10th position is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides.

[0156] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 7 is deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, position 10 is deoxynucleotide, and the remaining positions are 2'-methoxynucleotides.

[0157] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 4 is a nucleotide modified with 2'-O-methoxyethyl (MOE), and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, 11, 15, and 17 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0158] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 9, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 9, 11, and 13 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0159] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein the 2nd, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 8th position is a deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein the 7th, 9th, and 11th positions at the 5' end of the sense strand are 2'-fluoronucleotides, the 10th position is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides.

[0160] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein the 2nd, 9th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 4th position is deoxyxanthine (dI) nucleotide, the 8th position is a 2'-O-methoxyethyl (MOE) modified nucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein the 7th, 9th, 10th, 11th, 15th, and 17th positions at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0161] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 14, 16, and 20 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, 11, and 15 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0162] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 8, 9, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0163] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 8, 9, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 9, 11, and 13 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0164] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 8, 9, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 4 is a nucleotide modified with 2'-O-methoxyethyl (MOE), and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0165] In some embodiments of the present invention, the antisense strand of the siRNA is 22 nucleotides long, wherein positions 2, 6, 8, 9, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 4 is a nucleotide modified with 2'-O-methoxyethyl (MOE), and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0166] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein positions 2, 6, 8, 9, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 4 is a nucleotide modified with 2'-O-methoxyethyl (MOE), and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0167] In some embodiments of the present invention, the antisense strand of the siRNA is 21 nucleotides long, wherein positions 2, 6, 8, 9, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 4 is a nucleotide modified with 2'-O-methoxyethyl (MOE), and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 19 nucleotides long, wherein positions 5, 7, and 9 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0168] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein the 2nd, 6th, 8th, 9th, 12th, 14th, and 16th positions at the 5' end of the antisense strand are 2'-fluoronucleotides, the 4th position is deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein the 7th, 9th, and 11th positions at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0169] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 8, 9, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 5 is deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0170] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 8, 9, 12, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 7 is deoxyxanthine (dI) nucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0171] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, 10, 11, and 15 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0172] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides.

[0173] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 6, 8, 9, 10, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, and 10 at the 5' end of the sense strand are 2'-fluoronucleotides, position 11 is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides.

[0174] In some embodiments of the present invention, the antisense strand of the siRNA is 23 nucleotides long, wherein positions 2, 8, 9, 14, and 16 at the 5' end of the antisense strand are 2'-fluoronucleotides, position 7 is a 2'-methoxy and 2'-fluoronucleotide, and the remaining positions are 2'-methoxynucleotides; the sense strand of the siRNA is 21 nucleotides long, wherein positions 7, 9, and 11 at the 5' end of the sense strand are 2'-fluoronucleotides, position 10 is a deoxynucleotide, and the remaining positions are 2'-methoxynucleotides.

[0175] In some embodiments of the present invention, the siRNA of the present invention comprises modified nucleoside links or a modified backbone. Modified nucleoside links or backbones include, but are not limited to: thiophosphates, 2'-O-methoxyethyl (MOE), 2'-fluorophosphates, alkyl phosphates, dithiophosphates, alkyl thiophosphates, aminophosphates, carbamates, carbonates, triphosphates, acetamipridates, carboxymethyl esters, and combinations thereof.

[0176] In some embodiments of the present invention, the modified nucleotide is a nucleotide in which the phosphate group is modified by a thiophosphate group. That is, a sulfur atom replaces the non-bridging oxygen atom in the phosphodiester bond, thereby replacing the phosphodiester bond with a thiophosphate diester bond.

[0177] In some embodiments of the present invention, the 5' end and 3' end of the sense chain each independently contain one or two thiophosphate groups; and / or the 5' end and 3' end of the antisense chain each independently contain one, two, or three thiophosphate groups.

[0178] In some embodiments of the present invention, at least one of the nucleotides at the 1st and 2nd positions of the 5' end of the sense strand, the nucleotides at the 2nd and 3rd positions of the 5' end of the sense strand, the nucleotides at the 1st and 2nd positions of the 3' end of the sense strand, the nucleotides at the 2nd and 3rd positions of the 3' end of the sense strand, the nucleotides at the 1st and 2nd positions of the 3' end of the antisense strand, the nucleotides at the 2nd and 3rd positions of the 3' end of the antisense strand, the nucleotides at the 3rd and 4th positions of the 3' end of the antisense strand, the nucleotides at the 1st and 2nd positions of the 5' end of the antisense strand, and the nucleotides at the 2nd and 3rd positions of the 5' end of the antisense strand is a thiophosphate group. The linkages are as follows: In some embodiments of the present invention, at least two linkages are thiophosphate groups; in some embodiments of the present invention, at least three linkages are thiophosphate groups; in some embodiments of the present invention, at least four linkages are thiophosphate groups; in some embodiments of the present invention, at least five linkages are thiophosphate groups; in some embodiments of the present invention, at least six linkages are thiophosphate groups; in some embodiments of the present invention, at least seven linkages are thiophosphate groups; in some embodiments of the present invention, at least eight linkages are thiophosphate groups; and in some embodiments of the present invention, all nine linkages are thiophosphate groups.

[0179] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 5' end of the positive strand, and at positions 1 and 2 at the 3' end, are linked by thiophosphate groups.

[0180] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 5' end of the positive strand are linked by thiophosphate groups, and the nucleotides at positions 1 and 2, and at positions 2 and 3 at the 3' end are linked by thiophosphate groups.

[0181] In some embodiments of the present invention, the nucleotides at positions 1 and 2 of the 5' end of the positive strand are linked by phosphate thioester groups.

[0182] In some embodiments of the present invention, the nucleotides at positions 1 and 2, and at positions 2 and 3, of the 5' end of the positive strand are linked by phosphate thioester groups.

[0183] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand are linked by thiophosphate groups, and the nucleotides at positions 2 and 3 at the 5' end are linked by thiophosphate groups.

[0184] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand are linked by thiophosphate groups, and the nucleotides at positions 2 and 3 at the 5' end are linked by thiophosphate groups.

[0185] In some embodiments of the present invention, the nucleotides at positions 1 and 2 of the 3' end of the antisense strand are linked by phosphate thioester groups.

[0186] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand are linked by thiophosphate groups, and the nucleotides at positions 1 and 2, and at positions 2 and 3 at the 5' end are linked by thiophosphate groups.

[0187] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand are linked by thiophosphate groups, and the nucleotides at positions 1 and 2 at the 5' end are also linked by thiophosphate groups.

[0188] In some embodiments of the present invention, the nucleotides at positions 1 and 2, and at positions 2 and 3, of the 3' end of the antisense strand are linked by phosphate thioester groups.

[0189] In some embodiments of the present invention, the nucleotides at positions 1 and 2, 2 and 3, 3 and 4 at the 3' end of the antisense strand, and at positions 1 and 2 at the 5' end are linked by thiophosphate groups.

[0190] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 5' end of the sense strand, the nucleotides at positions 1 and 2 at the 3' end of the sense strand, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand, the nucleotides at positions 2 and 3 at the 3' end of the antisense strand, the nucleotides at positions 1 and 2 at the 5' end of the antisense strand, and the nucleotides at positions 2 and 3 at the 5' end of the antisense strand are all linked by phosphate thioester groups.

[0191] In some embodiments of the present invention, the nucleotides at positions 1 and 2 of the 5' end of the sense strand, the nucleotides at positions 1 and 2 of the 3' end of the sense strand, the nucleotides at positions 2 and 3 of the 3' end of the sense strand, the nucleotides at positions 1 and 2 of the 3' end of the antisense strand, the nucleotides at positions 2 and 3 of the 3' end of the antisense strand, the nucleotides at positions 1 and 2 of the 5' end of the antisense strand, and the nucleotides at positions 2 and 3 of the 5' end of the antisense strand are all linked by phosphate thioester groups.

[0192] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 5' end of the sense strand, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand, the nucleotides at positions 2 and 3 at the 3' end of the antisense strand, the nucleotides at positions 1 and 2 at the 5' end of the antisense strand, and the nucleotides at positions 2 and 3 at the 5' end of the antisense strand are all linked by phosphate thioester groups.

[0193] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 5' end of the sense strand, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand, the nucleotides at positions 2 and 3 at the 3' end of the antisense strand, and the nucleotides at positions 1 and 2 at the 5' end of the antisense strand are all linked by thiophosphate groups.

[0194] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 5' end of the sense strand and the nucleotides at positions 1 and 2 at the 3' end of the antisense strand are linked by phosphate thioester groups.

[0195] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 5' end of the sense strand, the nucleotides at positions 1 and 2 at the 3' end of the antisense strand, the nucleotides at positions 1 and 2 at the 5' end of the antisense strand, and the nucleotides at positions 2 and 3 at the 5' end of the antisense strand are all linked by thiophosphate groups.

[0196] In some embodiments of the present invention, the nucleotides at positions 1 and 2 of the 5' end of the sense strand, the nucleotides at positions 2 and 3 of the 5' end of the sense strand, the nucleotides at positions 1 and 2 of the 3' end of the antisense strand, the nucleotides at positions 2 and 3 of the 3' end of the antisense strand, the nucleotides at positions 1 and 2 of the 5' end of the antisense strand, and the nucleotides at positions 2 and 3 of the 5' end of the antisense strand are linked by phosphate thioester groups.

[0197] In some embodiments of the present invention, the nucleotides at positions 1 and 2 at the 5' end of the sense strand, the nucleotides at positions 2 and 3 at the 5' end of the sense strand, and the nucleotides at positions 1 and 2 at the 3' end of the antisense strand are linked by thiophosphate groups.

[0198] In some embodiments of the present invention, the positive chain may include one or more end-capping residues or portions thereof, referred to as "end-capping residues". In some embodiments of the present invention, the end-capping residues are present at the 5' end, the 3' end, or both the 5' end and the 3' end of the positive chain.

[0199] In some embodiments of the present invention, a reverse debasing residue (iab) is added as a capping residue. See F. Czauderna, Nucleic Acids Res., 2003, 31(11), 2705-16. In some embodiments of the present invention, the 5' end and / or 3' end of the positive strand may contain more than one reverse debasing deoxyribose moiety as a capping residue.

[0200] In some embodiments of the invention, one or more reverse abasing residues (iab) are added to the 3' end of the positive strand. In some embodiments of the invention, one or more reverse abasing residues (iab) are added to the 5' end of the positive strand. In some embodiments of the invention, one or more reverse abasing residues are included at or near one or more ends of the positive strand of the siRNA.

[0201] Reverse debasing residues can be linked via phosphate esters, thiophosphate esters, or other nucleosides.

[0202] In some embodiments of the invention, the first nucleotide at the 5' end of the antisense strand comprises a (E)-vinylphosphonate or analogue modification, such as (E)-VP modification. In some embodiments of the invention, the first nucleotide may optionally comprise other modifications, such as 2'-modification (e.g., 2'-methoxy modification).

[0203] In some embodiments, the modification patterns of the sense and antisense strands of the siRNA are selected from any one of the antisense and sense strand modification patterns shown in Table 2 (MD1-MD72), wherein the first SEQ ID NO corresponds to the antisense strand and the second SEQ ID NO corresponds to the sense strand:

[0204] MD1: SEQ ID NO:213 and SEQ ID NO:243;

[0205] MD2: SEQ ID NO:213 and SEQ ID NO:244;

[0206] MD3: SEQ ID NO:213 and SEQ ID NO:245;

[0207] MD4: SEQ ID NO:213 and SEQ ID NO:246;

[0208] MD5: SEQ ID NO:213 and SEQ ID NO:247;

[0209] MD6: SEQ ID NO:213 and SEQ ID NO:248;

[0210] MD7: SEQ ID NO:213 and SEQ ID NO:249;

[0211] MD8: SEQ ID NO:213 and SEQ ID NO:250;

[0212] MD9: SEQ ID NO:213 and SEQ ID NO:251;

[0213] MD10: SEQ ID NO:213 and SEQ ID NO:252;

[0214] MD11: SEQ ID NO:213 and SEQ ID NO:253;

[0215] MD12: SEQ ID NO:214 and SEQ ID NO:249;

[0216] MD13: SEQ ID NO:214 and SEQ ID NO:250;

[0217] MD14: SEQ ID NO:214 and SEQ ID NO:251;

[0218] MD15: SEQ ID NO:214 and SEQ ID NO:252;

[0219] MD16: SEQ ID NO:214 and SEQ ID NO:253;

[0220] MD17: SEQ ID NO:215 and SEQ ID NO:254;

[0221] MD18: SEQ ID NO:213 and SEQ ID NO:255;

[0222] MD19: SEQ ID NO:214 and SEQ ID NO:255;

[0223] MD20: SEQ ID NO:216 and SEQ ID NO:256;

[0224] MD21: SEQ ID NO:217 and SEQ ID NO:257;

[0225] MD22: SEQ ID NO:218 and SEQ ID NO:257;

[0226] MD23: SEQ ID NO:218 and SEQ ID NO:258;

[0227] MD24: SEQ ID NO:219 and SEQ ID NO:259;

[0228] MD25: SEQ ID NO:220 and SEQ ID NO:260;

[0229] MD26: SEQ ID NO:221 and SEQ ID NO:251;

[0230] MD27: SEQ ID NO:222 and SEQ ID NO:251;

[0231] MD28: SEQ ID NO:223 and SEQ ID NO:251;

[0232] MD29: SEQ ID NO:224 and SEQ ID NO:251;

[0233] MD30: SEQ ID NO:221 and SEQ ID NO:261;

[0234] MD31: SEQ ID NO:225 and SEQ ID NO:251;

[0235] MD32: SEQ ID NO:226 and SEQ ID NO:251;

[0236] MD33: SEQ ID NO:227 and SEQ ID NO:251;

[0237] MD34: SEQ ID NO:228 and SEQ ID NO:251;

[0238] MD35: SEQ ID NO:229 and SEQ ID NO:251;

[0239] MD36: SEQ ID NO:230 and SEQ ID NO:252;

[0240] MD37: SEQ ID NO:231 and SEQ ID NO:252;

[0241] MD38: SEQ ID NO:231 and SEQ ID NO:256;

[0242] MD39: SEQ ID NO:230 and SEQ ID NO:256;

[0243] MD40: SEQ ID NO:232 and SEQ ID NO:252;

[0244] MD41: SEQ ID NO:232 and SEQ ID NO:256;

[0245] MD42: SEQ ID NO:217 and SEQ ID NO:258;

[0246] MD43: SEQ ID NO:233 and SEQ ID NO:258;

[0247] MD44: SEQ ID NO:234 ​​and SEQ ID NO:262;

[0248] MD45: SEQ ID NO:235 and SEQ ID NO:263;

[0249] MD46: SEQ ID NO:219 and SEQ ID NO:282;

[0250] MD47: SEQ ID NO:236 and SEQ ID NO:283;

[0251] MD48: SEQ ID NO:237 and SEQ ID NO:264;

[0252] MD49: SEQ ID NO:238 and SEQ ID NO:265;

[0253] MD50: SEQ ID NO:213 and SEQ ID NO:266;

[0254] MD51: SEQ ID NO:236 and SEQ ID NO:257;

[0255] MD52: SEQ ID NO:237 and SEQ ID NO:267;

[0256] MD53: SEQ ID NO:238 and SEQ ID NO:268;

[0257] MD54: SEQ ID NO:239 and SEQ ID NO:251;

[0258] MD55: SEQ ID NO:240 and SEQ ID NO:257;

[0259] MD56: SEQ ID NO:241 and SEQ ID NO:257;

[0260] MD57: SEQ ID NO:242 and SEQ ID NO:257;

[0261] MD58: SEQ ID NO:269 and SEQ ID NO:258;

[0262] MD59: SEQ ID NO:270 and SEQ ID NO:258;

[0263] MD60: SEQ ID NO:240 and SEQ ID NO:279;

[0264] MD61: SEQ ID NO:241 and SEQ ID NO:279;

[0265] MD62: SEQ ID NO:242 and SEQ ID NO:279;

[0266] MD63: SEQ ID NO:213 and SEQ ID NO:280;

[0267] MD64: SEQ ID NO:221 and SEQ ID NO:280;

[0268] MD65: SEQ ID NO:222 and SEQ ID NO:280;

[0269] MD66: SEQ ID NO:223 and SEQ ID NO:280;

[0270] MD67: SEQ ID NO:224 and SEQ ID NO:280;

[0271] MD68: SEQ ID NO:221 and SEQ ID NO:281;

[0272] MD69: SEQ ID NO:290 and SEQ ID NO:257;

[0273] MD70: SEQ ID NO:291 and SEQ ID NO:257;

[0274] MD71: SEQ ID NO:291 and SEQ ID NO:292;

[0275] MD72: SEQ ID NO:214 and SEQ ID NO:254.

[0276] In some embodiments of the present invention, the modification patterns of the sense and antisense strands of the siRNA are selected from the antisense and sense strand modification patterns shown in any one of MD3, MD9, MD36, MD22, MD51 and MD71 in Table 2, wherein the first SEQ ID NO corresponds to the antisense strand and the second SEQ ID NO corresponds to the sense strand:

[0277] MD3: SEQ ID NO:213 and SEQ ID NO:245;

[0278] MD9: SEQ ID NO:213 and SEQ ID NO:251;

[0279] MD36: SEQ ID NO:230 and SEQ ID NO:252;

[0280] MD22: SEQ ID NO:218 and SEQ ID NO:257;

[0281] MD51: SEQ ID NO:236 and SEQ ID NO:257;

[0282] MD71: SEQ ID NO:291 and SEQ ID NO:292.

[0283] In some embodiments of the present invention, antisense strand modification patterns selected from any one of MD1 to MD72 in Table 2 and / or sense strand modification patterns selected from any one of MD1 to MD72 in Table 2 are applied to small interfering RNA (siRNA) for inhibiting MMP7 gene expression.

[0284] Preferably, the antisense strand of the small interfering RNA (siRNA) for inhibiting MMP7 gene expression comprises the nucleotide sequence shown in any one of SEQ ID NO:1 to SEQ ID NO:25, SEQ ID NO:284 or SEQ ID NO:285;

[0285] Preferably, the positive strand of the small interfering RNA (siRNA) for inhibiting MMP7 gene expression comprises the nucleotide sequence shown in any one of SEQ ID NO:26 to SEQ ID NO:50 or SEQ ID NO:286.

[0286] In some embodiments of the present invention, the antisense strand modification pattern selected from any one of MD1 to MD72 in Table 2 is applied to the antisense strand containing any one of the nucleotide sequences shown in SEQ ID NO:1 to SEQ ID NO:25, SEQ ID NO:284 or SEQ ID NO:285.

[0287] In some embodiments of the present invention, a positive strand modification pattern selected from any one of MD1 to MD72 in Table 2 is applied to a positive strand containing a nucleotide sequence shown in any one of SEQ ID NO:26 to SEQ ID NO:50 or SEQ ID NO:286.

[0288] In some embodiments of the present invention, the antisense strand comprises at least 12 consecutive nucleotides (e.g., at least 13 consecutive nucleotides, at least 14 consecutive nucleotides, at least 15 consecutive nucleotides, at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, at least 18 consecutive nucleotides, at least 19 consecutive nucleotides, at least 20 consecutive nucleotides, at least 21 consecutive nucleotides, at least 22 consecutive nucleotides, or at least 23 consecutive nucleotides) of the nucleotide sequence shown in any one of SEQ ID NOs:51-126, 271-274, and 287-288.

[0289] In some embodiments of the present invention, the positive chain comprises at least 12 consecutive nucleotides (e.g., at least 13 consecutive nucleotides, at least 14 consecutive nucleotides, at least 15 consecutive nucleotides, at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, at least 18 consecutive nucleotides, at least 19 consecutive nucleotides, at least 20 consecutive nucleotides, or at least 21 consecutive nucleotides) of the nucleotide sequence shown in any of SEQ ID NOs:127-212, 275-278, and 289.

[0290] In some embodiments of the present invention, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs:51-126, 271-274, 287-288.

[0291] In some embodiments of the present invention, the positive strand comprises the nucleotide sequence shown in any one of SEQ ID NOs:127-212, 275-278, 289.

[0292] In some embodiments of the present invention, the sequences of the sense and antisense strands of the siRNA comprise at least 12 consecutive nucleotides (e.g., at least 13 consecutive nucleotides, at least 14 consecutive nucleotides, at least 15 consecutive nucleotides, at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, at least 18 consecutive nucleotides, at least 19 consecutive nucleotides, at least 20 consecutive nucleotides, at least 21 consecutive nucleotides) of the sense and antisense strand sequences of any of the modified duplexes 1 to 127 provided in Table 3.

[0293] In some embodiments of the present invention, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any of the modified double strands 1 to 127 provided in Table 3.

[0294] As used herein, the term "modified double-stranded RNA" refers to a double-stranded RNA containing modifications. It should be noted that there is no necessary correspondence between "modified double-stranded RNA X" and the number X in "double-stranded RNA X". For example, "modified double-stranded RNA 2" does not necessarily correspond to "double-stranded RNA 2". In other words, "modified double-stranded RNA 2" does not refer to the double-stranded RNA obtained after modifying double-stranded RNA 2. Correspondingly, unless otherwise specified herein, the modified double-stranded RNAs provided in this invention are selected from, for example, modified double-stranded RNA 1 to modified double-stranded RNA 127 provided in Table 3, and the double-stranded RNAs of this invention are selected from, for example, double-stranded RNA 1 to double-stranded RNA 28 provided in Table 1.

[0295] In some embodiments, the antisense strand comprises at least 12 consecutive nucleotides (e.g., at least 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, or 23 nucleotides) of the nucleotide sequence shown in any one of SEQ ID NOs: 62, 72, 85, and 113. In some embodiments, the sense strand comprises at least 12 consecutive nucleotides (e.g., at least 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotides) of the nucleotide sequence shown in any one of SEQ ID NOs: 150, 153, 155, 174, and 198. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise at least 12 consecutive nucleotides (e.g., at least 13 consecutive nucleotides, at least 14 consecutive nucleotides, at least 15 consecutive nucleotides, at least 16 consecutive nucleotides, at least 17 consecutive nucleotides, at least 18 consecutive nucleotides, at least 19 consecutive nucleotides, at least 20 consecutive nucleotides, at least 21 consecutive nucleotides) of the sense and antisense strand sequences of any of the modified double strands 31, 34, 45, 66, and 97 provided in Table 3.

[0296] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 62, 72, 85, 113. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 150, 153, 155, 174, 198. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any one of the modified double strands 31, 34, 45, 66, and 97 provided in Table 3.

[0297] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 51 and 62. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 127 and 148. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any one of the modified double strands 1 and 29 provided in Table 3.

[0298] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 51, 62, and 88. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 128, 149, and 178. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any one of the modified double strands 2, 30, and 70 provided in Table 3.

[0299] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 51 and 62. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 129 and 150. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any one of the modified double strands 3 and 31 provided in Table 3.

[0300] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 51 and 62. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 130 and 151. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any one of the modified double strands 4 and 32 provided in Table 3.

[0301] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 51, 62, and 88. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 131, 152, and 173. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any one of the modified double strands 5, 33, and 65 provided in Table 3.

[0302] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:51. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:132. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 6 provided in Table 3.

[0303] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:51. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:133. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 7 provided in Table 3.

[0304] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:51. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:134. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 8 provided in Table 3.

[0305] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 51 and 62. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 135 and 153. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any one of the modified double strands 9 and 34 provided in Table 3.

[0306] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:51. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:136. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 10 provided in Table 3.

[0307] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:51. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:137. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 11 provided in Table 3.

[0308] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:52. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:133. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 12 provided in Table 3.

[0309] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:52. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:134. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 13 provided in Table 3.

[0310] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:52. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:135. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 14 provided in Table 3.

[0311] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 52, 55, 58, 74, 76, 78, 80, 93, 95, 98, 100, 102, 103, 107, 109, 111, 114, 116, 117, 119, 121, 123, 125. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 136, 141, 144, 157, 159, 161, 163, 179, 181, 184, 186, 188, 189, 193, 195, 197, 200, 202, 203, 205, 207, 209, 211. In some implementations, the sense and antisense strand sequences of the siRNA comprise the sense and antisense strand sequences of any one of the following duplexes provided in Table 3: modified duplex 15, modified duplex 21, modified duplex 25, modified duplex 49, modified duplex 51, modified duplex 53, modified duplex 55, modified duplex 74, modified duplex 76, modified duplex 80, modified duplex 82, modified duplex 84, modified duplex 85, modified duplex 91, modified duplex 93, modified duplex 95, modified duplex 99, modified duplex 101, modified duplex 102, modified duplex 104, modified duplex 106, modified duplex 108, and modified duplex 110.

[0312] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:52. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:137. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 16 provided in Table 3.

[0313] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:53. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:138. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified double strand 17 provided in Table 3.

[0314] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:51. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:139. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 18 provided in Table 3.

[0315] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:52. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:139. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 19 provided in Table 3.

[0316] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:54. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:140. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 20 provided in Table 3.

[0317] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 56, 59, 75, 77, 79, 81, 94, 96, 99, 101, 104, 108, 110, 112, 115, 118, 120, 122, 124, 126. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 142, 145, 158, 160, 162, 164, 180, 182, 185, 187, 190, 194, 196, 198, 201, 204, 206, 208, 210, 212. In some implementations, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences of any one of the following duplexes provided in Table 3: modified duplex 22, modified duplex 26, modified duplex 50, modified duplex 52, modified duplex 54, modified duplex 56, modified duplex 75, modified duplex 77, modified duplex 81, modified duplex 83, modified duplex 86, modified duplex 92, modified duplex 94, modified duplex 96, modified duplex 100, modified duplex 103, modified duplex 105, modified duplex 107, modified duplex 109, and modified duplex 111.

[0318] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 57, 106, and 113. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 142, 190, and 198. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any one of the modified double strands 23, 89, and 97 provided in Table 3.

[0319] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 57, 106, and 113. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 143, 192, and 199. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any one of the modified double strands 24, 90, and 98 provided in Table 3.

[0320] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 60, 84. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 146, 167. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any one of the modified double strands 27 and 59 provided in Table 3.

[0321] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:61. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:147. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 28 provided in Table 3.

[0322] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:63. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:153. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 35 provided in Table 3.

[0323] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:64. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:153. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 36 provided in Table 3.

[0324] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:65. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:153. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 37 provided in Table 3.

[0325] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:66. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:153. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 38 provided in Table 3.

[0326] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:63. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:154. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 39 provided in Table 3.

[0327] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:67. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:153. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 40 provided in Table 3.

[0328] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:68. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:153. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 41 provided in Table 3.

[0329] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:69. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:153. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 42 provided in Table 3.

[0330] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:70. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:153. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 43 provided in Table 3.

[0331] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:71. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:153. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 44 provided in Table 3.

[0332] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:72. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:155. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 45 provided in Table 3.

[0333] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:73. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:155. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 46 provided in Table 3.

[0334] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:73. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:156. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 47 provided in Table 3.

[0335] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:72. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:156. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 48 provided in Table 3.

[0336] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 97 and 105. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 181 and 189. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any one of the modified double strands 78 and 87 provided in Table 3.

[0337] In some embodiments, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 97 and 105. In some embodiments, the sense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs: 183 and 191. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any one of the modified double strands 79 and 88 provided in Table 3.

[0338] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:271. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:275. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified double strand 112 provided in Table 3.

[0339] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:272. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:275. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified double strand 113 provided in Table 3.

[0340] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:82. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:165. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 57 provided in Table 3.

[0341] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:83. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:166. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 58 provided in Table 3.

[0342] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:84. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:168. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 60 provided in Table 3.

[0343] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:85. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:169. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified double strand 61 provided in Table 3.

[0344] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:86. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:170. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 62 provided in Table 3.

[0345] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:87. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:171. In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the sense and antisense strand sequences of the modified duplex 63 provided in Table 3.

[0346] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:88. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:172. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 64 provided in Table 3.

[0347] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:85. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:174. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from modified duplex 66 provided in Table 3.

[0348] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:86. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:175. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 67 provided in Table 3.

[0349] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:87. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:176. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 68 provided in Table 3.

[0350] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:89. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:177. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 69 provided in Table 3.

[0351] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:90. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NOs:174. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 71 provided in Table 3.

[0352] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:91. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:174. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 72 provided in Table 3.

[0353] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:92. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:174. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 73 provided in Table 3.

[0354] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:273. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:275. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified double strand 114 provided in Table 3.

[0355] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:274. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:275. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 115 provided in Table 3.

[0356] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:90. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:276. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 116 provided in Table 3.

[0357] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:91. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:276. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified double strand 117 provided in Table 3.

[0358] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:92. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:276. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified double strand 118 provided in Table 3.

[0359] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:62. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:277. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise sense and antisense strand sequences selected from the modified duplex 124 provided in Table 3.

[0360] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:63. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:277. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified double strand 119 provided in Table 3.

[0361] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:64. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:277. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 120 provided in Table 3.

[0362] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:65. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:277. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified double strand 121 provided in Table 3.

[0363] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:66. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:277. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 122 provided in Table 3.

[0364] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:63. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:278. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified double strand 123 provided in Table 3.

[0365] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:287. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:198. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified double strand 125 provided in Table 3.

[0366] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:288. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:198. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified duplex 126 provided in Table 3.

[0367] In some embodiments, the antisense strand comprises the nucleotide sequence shown in SEQ ID NO:288. In some embodiments, the sense strand comprises the nucleotide sequence shown in SEQ ID NO:289. In some embodiments, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from the modified double strand 127 provided in Table 3.

[0368] 2. siRNA

[0369] In one aspect, the present invention provides a small interfering RNA (siRNA) for inhibiting MMP7 gene expression, the siRNA comprising a sense strand and an antisense strand, wherein the antisense strand comprises at least 17 consecutive nucleotides having a nucleotide sequence that is approximately 4 (e.g., 0, 1, 2, 3, or 4) nucleotides similar to the nucleotide sequence shown in any one of SEQ ID NO:12 to SEQ ID NO:25, SEQ ID NO:284, and SEQ ID NO:285, and the sense strand is at least partially complementary to the antisense strand.

[0370] The phrase "at least partially complementary" means that the two sequences can be completely complementary, or have no more than 6, 5, 4, 3, 2, or 1 mismatched base pairs in total, while retaining the ability to hybridize under relevant conditions. Those skilled in the art can determine the most suitable conditions for testing the complementarity of the two sequences based on the final application of the hybridized nucleotides. Such conditions can be, for example, stringent conditions, such as 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, at 50 or 70°C for 12-16 hours, followed by washing. Other conditions, such as physiologically relevant conditions that may be encountered in vivo, can also be applied.

[0371] In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequences shown in any one of SEQ ID NO:12 to SEQ ID NO:25, SEQ ID NO:284, and SEQ ID NO:285 by 0 or 1 nucleotide.

[0372] In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides having approximately 4 (e.g., 0, 1, 2, 3, or 4) nucleotide sequences similar to those shown in any one of SEQ ID NO:12 to SEQ ID NO:25, SEQ ID NO:284, and SEQ ID NO:285. In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides having approximately 3 (e.g., 0, 1, 2, or 3) nucleotide sequences similar to those shown in any one of SEQ ID NO:12 to SEQ ID NO:25, SEQ ID NO:284, and SEQ ID NO:285. In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides having approximately 2 (e.g., 0, 1, or 2) nucleotide sequences similar to those shown in any one of SEQ ID NO:12 to SEQ ID NO:25, SEQ ID NO:284, and SEQ ID NO:285. In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides that are approximately equal to one (e.g., 0 or 1) nucleotide of the nucleotide sequence shown in any one of SEQ ID NO:12 to SEQ ID NO:25, SEQ ID NO:284, and SEQ ID NO:285. In some embodiments, the antisense strand comprises at least 17 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO:12 to SEQ ID NO:25, SEQ ID NO:284, and SEQ ID NO:285. In some embodiments, the antisense strand is the nucleotide sequence shown in any one of SEQ ID NO:12 to SEQ ID NO:25, SEQ ID NO:284, and SEQ ID NO:285.

[0373] In some embodiments, the sense strand and the antisense strand have a mismatch of no more than 6 nucleotides. In some embodiments, the sense strand and the antisense strand have a mismatch of no more than 5 nucleotides. In some embodiments, the sense strand and the antisense strand have a mismatch of no more than 4 nucleotides. In some embodiments, the sense strand and the antisense strand have a mismatch of no more than 3 nucleotides. In some embodiments, the sense strand and the antisense strand have a mismatch of no more than 2 nucleotides. In some embodiments, the sense strand and the antisense strand have a mismatch of no more than 1 nucleotide. In some embodiments, the sense strand and the antisense strand are completely complementary.

[0374] In some implementations, the sense strand and the antisense strand are complementary to each other by at least 15, 16, 17, 18, 19, 20 or 21 nucleotides.

[0375] In some embodiments, the sense strand and the antisense strand are at least 85% (e.g., at least 90%, at least 95%, at least 99%) complementary or completely complementary over at least 17 consecutive nucleotides.

[0376] In some embodiments, the sense strand and the antisense strand form a double-stranded region of 15 to 30 nucleotide pairs in length, such as 15 to 25 nucleotide pairs, 15 to 23 nucleotide pairs, 15 to 21 nucleotide pairs, such as 15, 16, 17, 18, 19, 20 or 21 nucleotide pairs.

[0377] In some embodiments, the antisense strand is 17 to 30 nucleotides long (e.g., 17 to 29, 17 to 28, 17 to 27, 19 to 30, 19 to 29, 19 to 28, 19 to 27, 19 to 25, 19 to 23, 21 to 25, 21 to 23), and the sense strand is 17 to 30 nucleotides long (e.g., 17 to 29, 17 to 28, 17 to 27, 17 to 26, 17 to 25, 17 to 21, 19 to 21).

[0378] In some implementations, the antisense strand is 19 to 27 nucleotides long, and the sense strand is 17 to 25 nucleotides long.

[0379] In some implementations, the antisense strand is 21 to 23 nucleotides long, and the sense strand is 19 to 21 nucleotides long.

[0380] In some implementations, the antisense strand is 23 nucleotides long and the sense strand is 21 nucleotides long.

[0381] In some implementations, the antisense strand is 22 nucleotides long and the sense strand is 21 nucleotides long.

[0382] In some implementations, the antisense strand is 21 nucleotides long, and the sense strand is 21 nucleotides long.

[0383] In some implementations, the antisense strand is 21 nucleotides long and the sense strand is 19 nucleotides long.

[0384] In some implementations, the siRNA includes a blunt end and / or a protruding end.

[0385] In some embodiments, the siRNA comprises one or more single-stranded nucleotide overhangs, such as 1, 2, 3, or 4 nucleotide overhangs. In some embodiments, the overhangs can be on the sense strand, the antisense strand, or any combination thereof. In some embodiments, the overhangs are located at the 5' end, the 3' end, or both ends of the antisense strand or the sense strand of the siRNA.

[0386] In some embodiments, the 3' end of the antisense strand of the siRNA includes a two-nucleotide overhang. In some embodiments, the 3' end of the sense strand of the siRNA is blunt.

[0387] In some embodiments, the 3' end of the antisense strand of the siRNA includes a one-nucleotide overhang. In some embodiments, the 3' end of the sense strand of the siRNA is blunt.

[0388] In some embodiments, the 3' end of the antisense strand of the siRNA is blunt. In some embodiments, the 3' end of the sense strand of the siRNA is blunt.

[0389] In some embodiments, the positive strand of the siRNA comprises at least 17 consecutive nucleotides having approximately 4 (e.g., 0, 1, 2, 3, or 4) nucleotide sequences similar to those shown in any one of SEQ ID NO:37 to SEQ ID NO:50 and SEQ ID NO:286. The positive and antisense strands of the siRNA comprise the at least 17 consecutive nucleotides forming a double-stranded region. In some embodiments, the positive strand comprises at least 17 consecutive nucleotides having approximately 3 (e.g., 0, 1, 2, or 3) nucleotide sequences similar to those shown in any one of SEQ ID NO:37 to SEQ ID NO:50 and SEQ ID NO:286. In some embodiments, the positive strand comprises at least 17 consecutive nucleotides having approximately 2 (e.g., 0, 1, or 2) nucleotide sequences similar to those shown in any one of SEQ ID NO:37 to SEQ ID NO:50 and SEQ ID NO:286. In some embodiments, the positive strand comprises at least 17 consecutive nucleotides that are approximately one (e.g., 0 or 1) nucleotides identical to the nucleotide sequence shown in any one of SEQ ID NO:37 to SEQ ID NO:50 and SEQ ID NO:286. In some embodiments, the positive strand has a region within the 17 consecutive nucleotides that is at least 85% (e.g., at least 90%, at least 95%, at least 99%) complementary or completely complementary to the antisense strand. In some embodiments, the positive strand comprises at least 17 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NO:37 to SEQ ID NO:50 and SEQ ID NO:286. In some embodiments, the positive strand is the nucleotide sequence shown in any one of SEQ ID NO:37 to SEQ ID NO:50 and SEQ ID NO:286.

[0390] In some embodiments, the antisense strand of the siRNA comprises the antisense strand sequence or a portion thereof (e.g., at least 17 consecutive nucleotides thereof) of any of the duplexes 12 to 28 provided in Table 1, and the sense strand of the siRNA comprises the sense strand sequence or a portion thereof (e.g., at least 17 consecutive nucleotides thereof) of that duplex.

[0391] In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the sense and antisense strand sequences of any of the duplexes 12 to 28 described in Table 1.

[0392] In some embodiments, the antisense strand of the siRNA comprises the antisense strand sequence or a portion thereof (e.g., at least 17 consecutive nucleotides) of duplexes 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 provided in Table 1. Preferably, the sense strand of the siRNA comprises the sense strand sequence or a portion thereof (e.g., at least 17 consecutive nucleotides) of the duplex.

[0393] In some embodiments, the sequences of the sense and antisense strands of the siRNA are selected from the sense and antisense strand sequences of any of the duplexes 1 to 11 described in Table 1.

[0394] In some embodiments, the antisense strand of the siRNA comprises the antisense strand sequence or a portion thereof (e.g., at least 17 consecutive nucleotides) of duplex 1, duplex 2, duplex 3, duplex 4, duplex 5, duplex 6, duplex 7, duplex 8, duplex 9, duplex 10, or duplex 11 provided in Table 1. Preferably, the sense strand of the siRNA comprises the sense strand sequence or a portion thereof (e.g., at least 17 consecutive nucleotides) of the duplex.

[0395] 3. Delivery

[0396] The siRNA of the present invention can be delivered or introduced by any means known in the art (e.g., in vitro delivery or introduction into cells, or in vivo delivery or introduction into a patient). For example, for in vivo delivery, the siRNA can be injected into a tissue site or administered systemically. In vivo delivery can also be performed using a β-glucan delivery system. In vitro introduction into cells includes methods known in the art, such as electroporation, lipid transfection, and receptor-mediated endocytosis.

[0397] In some embodiments, the delivery methods include, but are not limited to, viral delivery (retrovirus, adenovirus, lentivirus, baculovirus, AAV); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC); nanoparticles (cationic polymers, PEI); bacterial delivery (tkRNAi); lipid nanoparticles (LNP); neutral liposomes (NL); polymer nanoparticles (low molecular weight polymers or high molecular weight polymers); double-stranded RNA binding motifs (dsRBMs); and other delivery systems known in the art that are suitable for nucleic acid or oligonucleotide delivery.

[0398] 4. Couplings

[0399] In one aspect, the present invention provides conjugates (also known as adjuvants) or pharmaceutically acceptable salts (preferably sodium salts) thereof, comprising at least one siRNA of the present invention and a pharmaceutically acceptable targeting molecule. The conjugates of the present invention are obtained by conjugating the siRNA of the present invention to a pharmaceutically acceptable targeting molecule, the conjugate comprising the pharmaceutically acceptable targeting molecule and optionally a linker. The siRNA may be non-covalently conjugated to the targeting molecule or covalently conjugated to the targeting molecule.

[0400] The pharmaceutically acceptable target molecule can be a target molecule commonly used in the field of siRNA drug delivery, which typically enhances the pharmacokinetic or biodistribution properties of the siRNA to which it is linked, and improves the cell-specific (or organ-specific) distribution and cell-specific (or organ-specific) uptake of the siRNA. Representative target molecules include, but are not limited to: compounds with affinity for cell surface molecules, cell receptor ligands, haptens, antibodies or antibody fragments, antibody mimics, etc. In some embodiments, the targeting molecule includes, but is not limited to, one or more of the following targeting molecules or their derivatives: integrins; lipophilic molecules, such as cholesterol, bile acids, vitamins (e.g., vitamin E), lipid molecules of different chain lengths; polymers, such as polyethylene glycol; polypeptides, such as transmembrane peptides; aptamers; antibodies; quantum dots; carbohydrates, such as lactose, polylactose, mannose, galactose, N-acetylgalactosamine (GalNAc); folate; or receptor ligands expressed by hepatocytes, such as desialyl glycoprotein, desialyl sugar residues, lipoproteins (e.g., high-density lipoprotein, low-density lipoprotein, etc.), glucagon, neurotransmitters (e.g., adrenaline), growth factors, transferrin, etc.

[0401] The linker can be any linker commonly used in the field of siRNA drug delivery, including but not limited to one or more of the following linkers or their derivatives: amide linker, amino linker, carbonyl linker, carbamate linker, urea linker, ether linker, disulfide linker, succinylamino linker, etc.

[0402] In some embodiments, the targeting molecule may be directly or indirectly linked to the siRNA of the present invention via a linker / connector group. In some embodiments, the targeting molecule is linked to the siRNA via an unstable, cleavable, or reversible bond or linker. In some embodiments, the targeting molecule is linked to at least one end of the sense and / or antisense strand of the siRNA. In some embodiments, the targeting molecule is linked to the 5' and / or 3' end of the sense strand. In some embodiments, the targeting molecule is linked to the 5' and / or 3' end of the antisense strand.

[0403] In some embodiments, the siRNA of the present invention is delivered to target cells or tissues via a target molecule to which it is linked.

[0404] In some implementations, the targeting molecule includes a ligand of a cell receptor.

[0405] In some implementations, the targeting molecule has an affinity for receptors on the surface of epithelial cells.

[0406] In some implementations, the targeting molecule is an integrin ligand.

[0407] In some embodiments, the targeting molecule includes an αvβ6 integrin ligand. Integrin αvβ6 is an epithelial-specific integrin that is highly upregulated in damaged lung epithelial cells. Hereinafter, "αvβ6 integrin ligand" refers to a molecule with affinity for integrin αvβ6 that facilitates the targeting and delivery of the linked siRNA to cells expressing integrin αvβ6 (such as lung epithelial cells). αvβ6 integrin ligands are known to those skilled in the art and can be found, for example, in International Patent Application WO2023070082A2. In some embodiments, two or more (e.g., three) αvβ6 integrin ligands are linked to the siRNA of the present invention directly or via a linker / linker group. In some embodiments, the two or more (e.g., three) αvβ6 integrin ligands are linked to the 5' end of the positive strand.

[0408] In some embodiments, the conjugate or a pharmaceutically acceptable salt thereof comprises: the siRNA of the present invention, and an αvβ6 integrin ligand, said αvβ6 integrin ligand comprising the structure shown in Formula I or a stereoisomer thereof.

[0409] in:

[0410] R 1 Selected from hydrogen, cyano, hydroxyl, mercapto, halogen, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylthio, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 haloalkyl, and C3-C6 cycloalkyl;

[0411] R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 R 12 R 13Each is independently selected from hydrogen, cyano, hydroxyl, mercapto, halogen, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylthio, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 haloalkyl, and C3-C6 cycloalkyl;

[0412] m1, m2, and m3 are each independently selected from any integer from 1 to 10.

[0413] Because the siRNA of the present invention contains acidic groups such as phosphate groups, and the αvβ6 integrin ligand contains acidic groups such as carboxyl groups and basic groups such as amino groups, those skilled in the art will understand that the siRNA and / or the ligand can be provided in a free state or in a salt-forming state. Furthermore, when the siRNA and / or the ligand are provided in a salt-forming state, they can be provided as a single salt or as a mixed salt. Thus, the present invention provides the conjugate and, simultaneously, a pharmaceutically acceptable salt of the conjugate. In some embodiments, the siRNA is provided as a sodium salt.

[0414] In some implementation schemes, R 1 It is selected from hydrogen, halogen, C1-C6 alkyl, and C1-C6 haloalkyl.

[0415] In some implementation schemes, R 1 Selected from C1-C6 alkyl and C1-C6 haloalkyl.

[0416] In some implementation schemes, R 1 Selected from C1-C6 alkyl groups.

[0417] In some implementation schemes, R 1 It is a methyl group.

[0418] In some implementation schemes, R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 R 12 R 13 Each is independently selected from hydrogen, halogen, C1-C6 alkyl, and C1-C6 haloalkyl.

[0419] In some implementation schemes, R 2 R 3 R 4 R 5 R 6 R 7R 8 R 9 R 10 R 11 R 12 R 13 It is hydrogen.

[0420] In some implementations, m1 is selected from 1, 2, 3, 4, 5, preferably from 1, 2, 3, for example, 1.

[0421] In some implementations, m2 is selected from 1, 2, 3, 4, 5, preferably from 1, 2, 3, for example, 1.

[0422] In some implementations, m3 is selected from 1, 2, 3, 4, 5, preferably from 1, 2, 3, for example, 1.

[0423] In some implementations, the structure shown in Formula I is as follows:

[0424] In some embodiments, the siRNA of the present invention is covalently linked to the αvβ6 integrin ligand via a linker group.

[0425] In some embodiments, the linking group comprises the structure shown in Formula II-1, Formula II-2, Formula II-3, or Formula II-4.

[0426] in:

[0427] n1, n2, n3, and n4 are each independently selected from any integer from 1 to 10;

[0428] q1, q2, q3, and q4 are each independently selected from any integer from 1 to 10;

[0429] p is any integer from 1 to 10;

[0430] The P-terminus of the structure shown in Formula II-1, Formula II-2, Formula II-3 or Formula II-4 is covalently linked to the siRNA of the present invention (for example, the 3' end, 5' end, or both the 3' end and 5' end of the sense strand and / or antisense strand of the siRNA of the present invention, preferably the 5' end of the sense strand of the siRNA of the present invention), and each O-terminus is covalently linked to the αvβ6 integrin ligand.

[0431] In some implementations, n1 is selected from 1, 2, 3, 4, 5, preferably from 2, 3, 4, for example, 3.

[0432] In some implementations, n2 is selected from 1, 2, 3, 4, 5, preferably from 1, 2, 3, for example, 1.

[0433] In some implementations, n3 is selected from 5, 6, 7, 8, 9, 10, preferably from 6, 7, 8, for example, 7.

[0434] In some implementations, n4 is selected from 1, 2, 3, 4, 5, preferably from 1, 2, 3, for example, 2.

[0435] In some implementations, q1 is selected from 1, 2, 3, 4, 5, preferably from 1, 2, 3, for example, 2.

[0436] In some implementations, q2 is selected from 1, 2, 3, 4, 5, preferably from 3, 4, 5, for example, 4.

[0437] In some implementations, q3 is selected from 1, 2, 3, 4, 5, preferably from 1, 2, 3, for example, 2.

[0438] In some implementations, q4 is selected from 1, 2, 3, 4, 5, preferably from 3, 4, 5, for example, 4.

[0439] In some implementations, p is selected from 5, 6, 7, 8, 9, 10, preferably from 5, 6, 7, for example, 6.

[0440] In some embodiments, the linking group comprises the structure shown in Formula II-1, Formula II-2 or Formula II-3.

[0441] In some embodiments, the linking group comprises a structure selected from the following:

[0442] In this structure, the P-terminus is covalently linked to the siRNA of the present invention (e.g., the 3' and 5' ends of the sense strand and / or antisense strand of the siRNA of the present invention, or both the 3' and 5' ends, preferably the 5' end of the sense strand of the siRNA of the present invention), and each O-terminus is covalently linked to the αvβ6 integrin ligand.

[0443] In some embodiments, the conjugate has the structure shown in Formula III-1, Formula III-2, or Formula III-3.

[0444] Among them, Z R The siRNA of this invention;

[0445] Preferably, the 5' end of the siRNA positive strand of the present invention is covalently linked to the remaining structural portion of the conjugate.

[0446] In some embodiments, the siRNA comprises a sense strand and an antisense strand sequence selected from modified double strands 45, 66, 97, or 127 shown in Table 3.

[0447] In some embodiments, the siRNA comprises a sense strand and an antisense strand sequence selected from any of the following modified duplexes:

[0448] (i) Modifying the double strand 45, which includes an antisense strand sequence as shown in SEQ ID NO:72, and a positive strand sequence as shown in SEQ ID NO:155;

[0449] (ii) Modify the double strand 66, which includes the antisense strand sequence as shown in SEQ ID NO:85, and the positive strand sequence as shown in SEQ ID NO:174;

[0450] (iii) Modifying the double strand 97, which includes the antisense strand sequence as shown in SEQ ID NO:113, and the positive strand sequence as shown in SEQ ID NO:198;

[0451] (iv) Modify the double strand 127, which includes an antisense strand sequence as shown in SEQ ID NO:288, and a sense strand sequence as shown in SEQ ID NO:289.

[0452] In some embodiments, the conjugates are selected from conjugates 1, 2, 3, 4, 5, and 6 in Table 4-1 or Table 4-2.

[0453] In some embodiments, the conjugate is selected from any of the following:

[0454] (i) Conjugate 1, comprising an antisense strand sequence as shown in SEQ ID NO:72, and a sense strand sequence as shown in SEQ ID NO:293;

[0455] (ii) Conjugate 2, comprising an antisense strand sequence as shown in SEQ ID NO:85, and a positive strand sequence as shown in SEQ ID NO:294;

[0456] (iii) Conjugate 3, comprising an antisense strand sequence as shown in SEQ ID NO:113, and a sense strand sequence as shown in SEQ ID NO:295;

[0457] (iv) Conjugate 4, comprising an antisense strand sequence as shown in SEQ ID NO:72, and a sense strand sequence as shown in SEQ ID NO:296;

[0458] (v) Conjugate 5, comprising an antisense strand sequence as shown in SEQ ID NO:85, and a sense strand sequence as shown in SEQ ID NO:297;

[0459] (vi) Conjugate 6, comprising an antisense strand sequence as shown in SEQ ID NO:113, and a sense strand sequence as shown in SEQ ID NO:298.

[0460] In some embodiments, the conjugate is selected from any of the following:

[0461] (i) Conjugate 1, having the structure shown in Formula III-1, wherein Z in Formula III-1 R It includes an antisense strand sequence as shown in SEQ ID NO:72, and a positive strand sequence as shown in SEQ ID NO:155, and the 5' end of said positive strand is connected to the sequence in Formula III-1 except for Z. R The remaining structural parts, excluding those mentioned above, are covalently connected;

[0462] (ii) Conjugate 2, having the structure shown in Formula III-1, wherein Z in Formula III-1 R It includes an antisense strand sequence as shown in SEQ ID NO:85, and a positive strand sequence as shown in SEQ ID NO:174, and the 5' end of said positive strand is connected to the sequence in Formula III-1 except for Z. R The remaining structural parts, excluding those mentioned above, are covalently connected;

[0463] (iii) Conjugate 3, having the structure shown in Formula III-2, wherein Z in Formula III-2 R It includes an antisense strand sequence as shown in SEQ ID NO:113, and a positive strand sequence as shown in SEQ ID NO:198, and the 5' end of said positive strand is connected to the sequence in Formula III-2 except for Z. R The remaining structural parts, excluding those mentioned above, are covalently connected;

[0464] (iv) Conjugate 4, having the structure shown in Formula III-3, wherein Z in Formula III-3 R It includes an antisense strand sequence as shown in SEQ ID NO:72, and a positive strand sequence as shown in SEQ ID NO:155, and the 5' end of said positive strand is connected to the sequence in Formula III-3 except for Z. R The remaining structural parts, excluding those mentioned above, are covalently connected;

[0465] (v) Conjugate 5, which has the structure shown in Formula III-3, wherein Z in Formula III-3 RIt includes an antisense strand sequence as shown in SEQ ID NO:85, and a positive strand sequence as shown in SEQ ID NO:174, and the 5' end of said positive strand is connected to the sequence in Formula III-3 except for Z. R The remaining structural parts, excluding those mentioned above, are covalently connected;

[0466] (vi) Conjugate 6, which has the structure shown in Formula III-3, wherein Z in Formula III-3 R It includes an antisense strand sequence as shown in SEQ ID NO:113, and a positive strand sequence as shown in SEQ ID NO:198, and the 5' end of said positive strand is connected to the sequence in Formula III-3 except for Z. R The remaining structural parts, excluding those mentioned above, are covalently connected.

[0467] As those skilled in the art will understand, the sequence information of conjugates 1 to 6 described in Table 4-1 can be further derived from the chemical structural formulas shown in Table 4-2 and Z... R The sequence of the modified double strand and its connection sites are explained.

[0468] 5. Pharmaceutical Composition

[0469] In one aspect, the present invention provides a pharmaceutical composition comprising at least one siRNA of the present invention.

[0470] In some embodiments of the present invention, the pharmaceutical composition contains one of the siRNAs described above.

[0471] In other embodiments of the invention, the pharmaceutical composition contains at least two siRNAs described above (e.g., but not limited to 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) as active ingredients. Preferably, each of the at least two siRNAs targets a different target sequence in the MMP7 gene, thereby expecting a synergistic effect by acting simultaneously on different target sequences. Here, "different target sequences" means that there is no overlap between target sequences, or the number of overlapping consecutive nucleotides between target sequences is less than 5 (e.g., the number of overlapping consecutive nucleotides is 4, 3, 2, 1, or 0). In this case, the at least two siRNAs as described above can be present in any different proportions. Preferably, the at least two siRNAs described above can be present in a molar ratio of 1:100 to 100:1; more preferably, the at least two siRNAs described above can be present in a molar ratio of 1:10 to 10:1, 1:5 to 5:1, or 1:2 to 2:1. In some embodiments of the present invention, the at least two of the above-described siRNAs are present in the same molar ratio.

[0472] In other embodiments of the invention, the pharmaceutical composition contains at least one siRNA of the present invention and also contains at least one siRNA targeting other targets (e.g., genes other than MMP7). In this case, the siRNA of the present invention and the siRNA targeting other targets can be present in any different proportions, for example, in a molar ratio of 1:100 to 100:1, for example, in a molar ratio of 1:10 to 10:1, 1:5 to 5:1 or 1:2 to 2:1, for example, in the same molar ratio.

[0473] In some embodiments, the pharmaceutical composition comprises an effective amount of siRNA. "Effective amount" refers to the amount of siRNA that is effective in producing the desired pharmacological, therapeutic, or preventative outcome. For example, if a given clinical treatment is considered effective when a measurable parameter associated with a disease or condition is reduced by at least 10%, then the therapeutically effective amount of a drug used to treat that disease or condition is the amount required to achieve that at least 10% reduction in the parameter. For example, a therapeutically effective amount of siRNA targeting MMP7 can reduce MMP7 mRNA levels by at least 10%.

[0474] In some embodiments, the siRNA in the pharmaceutical composition described in any of the above embodiments can be linked to a target molecule to form a conjugate. Therefore, in some embodiments, the pharmaceutical composition comprises the conjugate of the present invention.

[0475] In some embodiments of the present invention, the pharmaceutical composition contains one of the conjugates described above or a pharmaceutically acceptable salt thereof.

[0476] In other embodiments of the invention, the pharmaceutical composition contains at least two of the conjugates described above or their pharmaceutically acceptable salts (e.g., but not limited to 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) as active ingredients. Preferably, the at least two conjugates or their pharmaceutically acceptable salts each target different target sequences in the MMP7 gene, thereby expecting a synergistic effect by acting simultaneously on different target sequences. Here, "different target sequences" means that there is no overlap between target sequences, or the number of overlapping consecutive nucleotides between target sequences is less than 5 (e.g., the number of overlapping consecutive nucleotides is 4, 3, 2, 1, or 0). In this case, the at least two conjugates as described above or their pharmaceutically acceptable salts may be present in any different proportions. Preferably, the at least two of the above-described conjugates or their pharmaceutically acceptable salts may exist in a molar ratio of 1:100 to 100:1; more preferably, the at least two of the above-described conjugates or their pharmaceutically acceptable salts may exist in a molar ratio of 1:10 to 10:1, 1:5 to 5:1, or 1:2 to 2:1. In some embodiments of the invention, the at least two of the above-described conjugates or their pharmaceutically acceptable salts exist in the same molar ratio.

[0477] In other embodiments of the invention, the pharmaceutical composition contains at least one conjugate of the invention or a pharmaceutically acceptable salt thereof and also contains at least one siRNA targeting other targets (e.g., genes other than MMP7). In this case, the conjugate of the invention or a pharmaceutically acceptable salt thereof and the siRNA targeting other targets may be present in any different proportions, for example, in a molar ratio of 1:100 to 100:1, for example, in a molar ratio of 1:10 to 10:1, 1:5 to 5:1 or 1:2 to 2:1, for example, in the same molar ratio.

[0478] In some embodiments, the pharmaceutical composition comprises an effective amount of the conjugate or a pharmaceutically acceptable salt thereof. "Effective amount" refers to the amount of the conjugate or a pharmaceutically acceptable salt thereof that effectively produces the desired pharmacological, therapeutic, or preventative outcome. For example, if a given clinical treatment is considered effective when a measurable parameter associated with a disease or condition is reduced by at least 10%, then the therapeutically effective amount of a drug for treating that disease or condition is the amount required to achieve that at least 10% reduction in the parameter. For example, a therapeutically effective amount of an MMP7-targeting siRNA conjugate or a pharmaceutically acceptable salt thereof can reduce MMP7 mRNA levels by at least 10%.

[0479] In some embodiments, the pharmaceutical composition further comprises a pharmaceutically acceptable carrier and / or excipient.

[0480] In some embodiments, the pharmaceutically acceptable carrier and / or excipient is a delivery carrier. A delivery carrier is a substance that improves the delivery of nucleic acids or oligonucleotides to cells or tissues. Such substances can be any delivery carrier known in the art suitable for the delivery of nucleic acids or oligonucleotides, including but not limited to: viruses (retroviruses, adenoviruses, lentiviruses, baculoviruses, AAV); liposomes (Lipofectamine, cationic DOTAP, neutral DOPC); nanoparticles (cationic polymers, PEI); bacteria (tkRNAi); lipid nanoparticles (LNP); neutral liposomes (NL); polymer nanoparticles (low molecular weight polymers or high molecular weight polymers); double-stranded RNA binding motifs (dsRBMs), etc.

[0481] In some implementations, the siRNA may be encapsulated by the delivery vector.

[0482] In some embodiments, the siRNA may be linked to the delivery vector directly or indirectly via a linker / connector group. In some embodiments, the delivery vector is linked to the siRNA via an unstable, cleavable, or reversible bond or linker. In some embodiments, the delivery vector is linked to at least one end of the sense and / or antisense strand of the siRNA. In some embodiments, the delivery vector is linked to the 5' and / or 3' end of the sense strand. In some embodiments, the delivery vector is linked to the 5' and / or 3' end of the antisense strand.

[0483] In some embodiments, the pharmaceutical compositions of the present invention are formulated into dosage forms compatible with their intended route of administration, such as local administration (e.g., direct injection or implantation), systemic administration, or subcutaneous, intravenous, intraperitoneal, or parenteral administration, including intracranial (e.g., intraventricular, intradural, or intrathecal), intramuscular, transdermal, airway (aerosol), nasal, oral, rectal, or topical (including buccal and sublingual) administration.

[0484] In some embodiments, the pharmaceutical composition is administered by inhalation, intranasal administration, intratracheal administration, or oropharyngeal inhalation. Formulations suitable for inhalation can be prepared by incorporating the desired amount of the active ingredient into a suitable solvent, followed by sterile filtration. Typically, formulations for inhalation are sterile solutions at physiological pH and have low viscosity. Salts may be added to the formulation to balance surface tension. In some cases, surfactants or co-solvents may be added to increase the solubility of the active ingredient and improve aerosol properties. In some cases, excipients may be added to control viscosity to ensure the size and distribution of atomized droplets.

[0485] In other embodiments, the pharmaceutical composition can be administered by injection, such as intravenously, intramuscularly, subcutaneously, intradermally, intra-articularly, intraocularly, intraperitoneally, or locally. Suitable pharmaceutical compositions for injectable use include sterile aqueous solutions or dispersions, as well as sterile powders for the ad hoc preparation of sterile injectable solutions or dispersions. For intravenous administration, suitable carriers include physiological saline, antibacterial water, or phosphate-buffered saline (PBS). The pharmaceutical composition should remain stable under manufacturing and storage conditions and should be protected against contamination by microorganisms such as bacteria and fungi. For example, a sterile injectable solution can be prepared by incorporating the required dose of the active ingredient into a suitable solvent, and optionally, simultaneously incorporating other desired components (including, but not limited to, pH adjusters, surfactants, adjuvants, ionic strength enhancers, diluents, agents for maintaining osmotic pressure, agents for delaying absorption, preservatives, or any combination thereof), followed by sterile filtration. Alternatively, the sterile injectable solution can be prepared as a sterile lyophilized powder (e.g., by vacuum drying or freeze-drying) for easy storage and use.

[0486] The siRNA or conjugate of the present invention, or its pharmaceutically acceptable salt or pharmaceutical composition, can be formulated in unit dosage form for easy administration. Unit dosage form refers to physically discrete units suitable for use as a single dose in a subject to be treated; each unit contains a predetermined amount of the active ingredient, calculated to be combined with the desired drug carrier to produce the desired therapeutic effect.

[0487] In this invention, the dosing regimen can be adjusted to obtain the optimal target response (e.g., treatment or prevention). For example, it can be administered as a single dose, multiple times over a period of time, or the dose can be reduced or increased proportionally according to the urgency of the treatment situation.

[0488] 6. Application

[0489] 6.1 Inhibition of MMP7 expression

[0490] The siRNA, conjugate, or pharmaceutically acceptable salt or pharmaceutical composition thereof of the present invention can be used to inhibit the expression of MMP7 in vitro and / or in vivo.

[0491] In one aspect, the present invention provides a method for inhibiting MMP7 expression in cells, the method comprising: introducing the siRNA, conjugate, or pharmaceutically acceptable salt or pharmaceutical composition of the present invention into the cells. In some embodiments, the method is performed in vitro. The siRNA, conjugate, or pharmaceutically acceptable salt or pharmaceutical composition of the present invention can be introduced by any nucleic acid delivery method known in the art, such as electroporation or lipid transfection.

[0492] The term "inhibition of MMP7 expression" indicates at least partial repression of MMP7 gene expression, which can be manifested as a decrease in the amount of detectable MMP7 mRNA. The degree of inhibition is typically expressed as: (mRNA in control cells) - (mRNA in treated cells) / (mRNA in control cells) * 100%. Alternatively, the degree of inhibition can be given as a decrease in a parameter functionally associated with MMP7 gene expression, such as the amount of protein encoded by the MMP7 gene. In principle, MMP7 gene silencing can be determined in any cell expressing MMP7 (constitutive expression or expression via genetic engineering) and by any suitable assay. Measurements can be performed at multiple time points, before, during, and after administration of siRNA, conjugates, or pharmaceutically acceptable salts or drug compositions thereof, to determine the effect of siRNA, conjugates, or pharmaceutically acceptable salts or drug compositions thereof. The level or expression of MMP7 can be measured by evaluation of mRNA (e.g., by Northern blotting or PCR) or protein (e.g., Western blotting or ELISA). For example, the effect of siRNA, conjugates, or pharmaceutically acceptable salts or drug compositions thereof on MMP7 expression can be determined by measuring the MMP7 gene transcription rate (e.g., by RT-PCR).

[0493] In some embodiments, the expression of the MMP7 gene is inhibited by at least about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, or 50% by application of the siRNA, conjugate, or pharmaceutically acceptable salt or pharmaceutical composition of the present invention. In some embodiments, the expression of the MMP7 gene is inhibited by at least about 60%, 70%, or 80% by application of the siRNA, conjugate, or pharmaceutically acceptable salt or pharmaceutical composition of the present invention. In some embodiments, the expression of the MMP7 gene is inhibited by at least about 85%, 90%, or 95% by application of the siRNA, conjugate, or pharmaceutically acceptable salt or pharmaceutical composition of the present invention. In some embodiments, the expression of the MMP7 gene is inhibited by at least about 96%, 97%, 98%, 99%, or 100% by application of the siRNA, conjugate, or pharmaceutically acceptable salt or pharmaceutical composition of the present invention.

[0494] In some embodiments, the siRNA, the conjugate, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition, may be used alone or in combination with other pharmaceutically active agents, such as siRNAs targeting different target sequences in the MMP7 gene or siRNAs targeting other targets.

[0495] In some embodiments, one siRNA provided by the present invention is used. In other embodiments, at least two siRNAs provided by the present invention are used (e.g., but not limited to 2, 3, 4, 5, 6, 7, 8, 9, 10 or more), preferably each of the at least two siRNAs targets a different target sequence in the MMP7 gene. In still other embodiments, at least one siRNA provided by the present invention and siRNAs targeting other targets (e.g., genes other than MMP7) are used.

[0496] In some embodiments, one conjugate provided by the present invention or a pharmaceutically acceptable salt thereof is used. In other embodiments, at least two conjugates provided by the present invention or pharmaceutically acceptable salts thereof (e.g., but not limited to 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) are used, preferably the at least two conjugates or pharmaceutically acceptable salts thereof each targeting a different target sequence in the MMP7 gene. In still other embodiments, at least one conjugate provided by the present invention or a pharmaceutically acceptable salt thereof is used along with siRNA targeting other targets (e.g., genes other than MMP7).

[0497] 6.2 Treatment of MMP7-related diseases

[0498] The siRNA, conjugate, or pharmaceutically acceptable salt or pharmaceutical composition thereof of the present invention may be used to treat diseases or conditions that would benefit from reduced or suppressed MMP7 levels.

[0499] In one aspect, the present invention provides a method for preventing and / or treating MMP7-related pathological conditions or diseases in a subject, the method comprising administering to a subject in need an effective amount of the siRNA, conjugate, or a pharmaceutically acceptable salt or pharmaceutical composition thereof of the present invention. The present invention also relates to the use of the siRNA, conjugate, or a pharmaceutically acceptable salt or pharmaceutical composition thereof of the present invention in the preparation of a medicament for treating and / or preventing MMP7-related pathological conditions or diseases.

[0500] In some embodiments, the MMP7-related pathological condition or disease involves MMP7 overexpression. MMP7 overexpression refers to an MMP7 level (e.g., the MMP7 level present in the plasma or tissues of a subject, preferably in damaged tissues) that is higher than the normal MMP7 level (e.g., the corresponding level in healthy controls).

[0501] In some implementations, the MMP7-related pathological conditions or diseases will benefit from reduced MMP7 levels or suppressed expression.

[0502] In some implementations, the pathological condition or disease associated with MMP7 is an inflammatory lung disease or lung cancer, such as pulmonary fibrosis (e.g., idiopathic pulmonary fibrosis, interstitial lung disease, progressive pulmonary fibrosis, pulmonary fibrosis with lung cancer, idiopathic pulmonary fibrosis with lung cancer) or COPD.

[0503] In some implementations, the pathological condition or disease associated with MMP7 is a fibrotic disease, such as renal fibrosis or liver fibrosis.

[0504] In some implementations, the pathological condition or disease associated with MMP7 is idiopathic pulmonary fibrosis.

[0505] In some implementations, the pathological condition or disease associated with MMP7 is lung cancer, such as small cell lung cancer or non-small cell lung cancer.

[0506] In some implementations, the pathological condition or disease associated with MMP7 is non-small cell lung cancer, such as adenocarcinoma, squamous cell carcinoma, large cell carcinoma, or tumor-like tumor.

[0507] In some implementations, the pathological condition or disease associated with MMP7 is pulmonary fibrosis with lung cancer or idiopathic pulmonary fibrosis with lung cancer.

[0508] In some embodiments, treatment with the application of the siRNA, conjugate, or pharmaceutically acceptable salt or composition thereof of the present invention for a specific disease if MMP7 expression is elevated may preferably reduce the level or expression of MMP7 to a level considered normal for individuals without such disease.

[0509] In some implementations, the subject is a mammal, such as a human.

[0510] In some embodiments, the siRNA, the conjugate, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition, may be used alone or in combination with other pharmaceutically active agents (e.g., siRNAs targeting different target sequences in the MMP7 gene or siRNAs targeting other targets), for example, administered simultaneously or sequentially.

[0511] In some embodiments, one siRNA provided by the present invention is used. In other embodiments, at least two siRNAs provided by the present invention are used (e.g., but not limited to 2, 3, 4, 5, 6, 7, 8, 9, 10 or more), preferably each of the at least two siRNAs targets a different target sequence in the MMP7 gene. In still other embodiments, at least one siRNA provided by the present invention and siRNAs targeting other targets (e.g., genes other than MMP7) are used.

[0512] In some embodiments, one conjugate provided by the present invention or a pharmaceutically acceptable salt thereof is used. In other embodiments, at least two conjugates provided by the present invention or pharmaceutically acceptable salts thereof (e.g., but not limited to 2, 3, 4, 5, 6, 7, 8, 9, 10 or more) are used, preferably the at least two conjugates or pharmaceutically acceptable salts thereof each targeting a different target sequence in the MMP7 gene. In still other embodiments, at least one conjugate provided by the present invention or a pharmaceutically acceptable salt thereof is used along with siRNA targeting other targets (e.g., genes other than MMP7).

[0513] In some embodiments, the siRNA or its conjugates or pharmaceutically acceptable salts or pharmaceutical compositions of the present invention are administered by inhalation, intranasal administration, intratracheal administration, or oropharyngeal inhalation. In some embodiments, the siRNA or its conjugates or pharmaceutical compositions of the present invention are administered by inhalation, for example, via an inhaler device, such as a metered-dose inhaler, or a nebulizer such as a jet nebulizer, a vibrating mesh nebulizer, or a soft mist inhaler, for the treatment of inflammatory lung diseases.

[0514] The applicant's prior patent applications PCT / CN2025 / 079629 and PCT / CN2024 / 107828 respectively disclose αvβ6 integrin ligand, linker, and siRNA that inhibits MMP7 gene expression. All contents involved in the two patent applications are added to this invention by reference.

[0515] The present invention also provides a compound of formula IV or a stereoisomer thereof or a pharmaceutically acceptable salt thereof.

[0516] Among them, R 0 Selected from -N3;

[0517] n5 is any integer selected from 1 to 10;

[0518] n3, n4, and q3 have the definitions described above.

[0519] In some embodiments of the present invention, n5 is selected from 1 or 2.

[0520] In some embodiments of the present invention, the compound represented by Formula IV has the following structure.

[0521] The present invention also provides a targeting ligand comprising a linker unit comprising a structural fragment of Formula IV-1 or a stereoisomer thereof or a pharmaceutically acceptable salt thereof.

[0522] in:

[0523] n5 is any integer selected from 1 to 10;

[0524] n3, n4, and q3 have the definitions described in the text.

[0525] In some embodiments of the present invention, n5 is selected from 1 or 2.

[0526] In some embodiments of the present invention, the connecting unit shown in Formula IV-1 comprises the structural segments shown below.

[0527] The present invention also provides a targeted ligand delivery conjugate comprising a linker group, said linker group comprising a structural fragment of Formula IV-2 or a stereoisomer thereof or a pharmaceutically acceptable salt thereof.

[0528] in:

[0529] n5 is any integer selected from 1 to 10;

[0530] n3, n4, and q3 have the definitions described in the text.

[0531] In some embodiments of the present invention, n5 is selected from 1 or 2.

[0532] In some embodiments of the present invention, the linker group represented by Formula IV-2 comprises the structural fragment described below.

[0533] In some embodiments of the present invention, the linking group comprises structural fragments of Formula II-3 or Formula II-4, or stereoisomers thereof, or pharmaceutically acceptable salts thereof.

[0534] in:

[0535] n3 and n4 are each independently selected from any integer from 1 to 10;

[0536] q3 and q4 are each independently selected from any integer from 1 to 10;

[0537] p is any integer from 1 to 10.

[0538] In some embodiments of the present invention, the linking group is a structural fragment as shown below, or a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.

[0539] In some embodiments of the present invention, the targeted ligand delivery conjugate further comprises a targeting molecule linked to the linking group, wherein the targeting molecule has the definition described above.

[0540] In some embodiments of the present invention, the target molecule, after being linked to the linking group, specifically has the following structural fragment.

[0541] In some embodiments of the present invention, the targeted ligand delivery conjugate further comprises a delivered molecule, wherein the ligand unit and the delivered molecule are linked by the linking group; wherein the delivered molecule includes, but is not limited to, RNAi agents, small molecules, antibodies, antibody fragments, immunoglobulins, monoclonal antibodies, labels or markers, lipids, natural or modified nucleic acids, natural or modified nucleic acid oligonucleotides, natural or modified nucleic acid polynucleotides, peptides, nucleic acid aptamers, polymers, polyamines, proteins, toxins, vitamins, polyethylene glycol, haptens, digoxigenin, biotin, radioactive atoms or molecules, or fluorophores.

[0542] In some embodiments of the present invention, the delivered molecule is an RNAi agent.

[0543] In some embodiments of the present invention, the delivered molecule is a small interfering RNA (siRNA) comprising a sense strand and an antisense strand.

[0544] The present invention also provides the use of a compound of Formula IV or a stereoisomer thereof or a pharmaceutically acceptable salt thereof, or a targeting ligand comprising a structural fragment of Formula IV-1 or a stereoisomer thereof or a pharmaceutically acceptable salt thereof, or a targeting ligand delivery conjugate comprising a structural fragment of Formula IV-2 or a stereoisomer thereof or a pharmaceutically acceptable salt thereof, in the preparation of a reagent or medicament for delivering a target molecule.

[0545] The present invention also provides the use of compounds of Formula IV or their stereoisomers or pharmaceutically acceptable salts thereof, or targeting ligands comprising structural fragments of Formula IV-1 or their stereoisomers or pharmaceutically acceptable salts thereof, or targeting ligand delivery conjugates comprising structural fragments of Formula IV-2 or their stereoisomers or pharmaceutically acceptable salts thereof, in the preparation of medicaments for treating and / or preventing diseases.

[0546] 7. Terminology Definitions

[0547] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, to better understand this invention, definitions and explanations of relevant terms are provided below.

[0548] In this article, unless otherwise specified, uppercase letters C, G, U, A, and T represent the base composition of nucleotides, including modified and unmodified nucleotides; lowercase letter m indicates that the nucleotide adjacent to the right of the m identifier is a 2'-methoxynucleotide; lowercase letter f indicates that the nucleotide adjacent to the right of the f identifier is a 2'-fluoronucleotide; lowercase letter d indicates that the nucleotide adjacent to the right of the d identifier is a 2'-deoxynucleotide; lowercase letter s indicates that the two nucleotides adjacent to the s identifier are linked by a phosphate thioester group; (E)-VP or VP indicates that the nucleotide adjacent to its right is a (E)-vinylphosphonate modified nucleotide; iab or invab both indicate reverse debasement residues; dI indicates deoxyinosine nucleotide; MOE-N indicates a 2'-O-methoxyethyl modified nucleotide; GNA or GNA-N indicates a glycerol nucleotide; UNA or UNA-N indicates an unlocked nucleotide.

[0549] In this document, the term "modified nucleotide" refers to a nucleotide that independently has a modified ribose moiety, a modified nucleotide interstice, or a modified base. Therefore, the term "modified nucleotide" encompasses substitution, addition, or removal (e.g., using functional groups or atoms) of nucleotide interstices, ribose moieties, or bases. Modifications applicable to this invention include all types of modifications disclosed herein or known in the art. "Methoxy-modified nucleotide" or "2'-methoxynucleotide" refers to a nucleotide formed by replacing the 2' hydroxyl group of the ribose group with a methoxy group. "Fluoro-modified nucleotide" or "2'-fluoronucleotide" refers to a nucleotide formed by replacing the 2' hydroxyl group of the ribose group with a fluorine group. "2'-O-methoxyethyl (MOE) modified nucleotides" refer to nucleotides formed by replacing the 2'-hydroxyl group of the ribosome with 2'-O-methoxyethyl (MOE). "Deoxyxanthine nucleotides" refer to nucleotides formed by replacing the base of a nucleotide with deoxyxanthine (dI). "Glyceryl nucleotides (GNA)" refer to nucleotides formed by replacing the ribose of a nucleotide with an acyclic three-carbon propylene glycol (1,2-propanediol) backbone. "Unlocked nucleotides (UNA)" refer to nucleotides formed by replacing the ribose of a nucleotide with a ribose lacking the C2-C3 bond of RNA ribose rings. "Nucleotide analogs" refer to groups that can replace nucleotides in nucleic acids but have a different structure from adenine ribonucleotides, guanine ribonucleotides, cytosine ribonucleotides, uracil ribonucleotides, or thymine deoxyribonucleotides. Examples include isonucleotides, bridged nucleic acids (BNA), or acyclic nucleotides.

[0550] The structure of methoxylated nucleotides is shown below:

[0551] Wherein, Base represents a natural or non-natural base, such as a base selected from A, U, C, G or T.

[0552] The structure of fluorinated nucleotides is shown below:

[0553] Wherein, Base represents a natural or non-natural base, such as a base selected from A, U, C, G or T.

[0554] The structures of methoxy and fluorine-modified nucleotides are shown below:

[0555] Wherein, Base represents a natural or non-natural base, such as a base selected from A, U, C, G or T.

[0556] The nucleotide structure modified with 5'-(E)-vinylphosphonate is as follows:

[0557] Wherein, R represents H, OH, or any modifying group as defined above, such as those selected from H, OH, F, or methoxy; Base represents a natural or non-natural base, such as a base selected from A, U, C, G, or T: for example, the structure of VPmN is as follows:

[0558] s represents a thiophosphate group, and the structural diagram is as follows:

[0559] iab represents the reverse debasing residue, and its structural diagram is shown below:

[0560] dI is deoxyinosine nucleotide, and its structure is shown below:

[0561] MOE is modified with 2'-O-methoxyethyl, and its structural diagram is shown below:

[0562] Wherein, Base represents a natural or non-natural base, such as a base selected from A, U, C, G or T.

[0563] GNA is a glycerol nucleotide, and its structural diagram is shown below;

[0564] Wherein, Base represents a natural or non-natural base, such as a base selected from A, U, C, G or T.

[0565] UNA stands for unlocking nucleotide, and its structure is shown below:

[0566] Wherein, Base represents a natural or non-natural base, such as a base selected from A, U, C, G or T.

[0567] Other modifying monomers: VPmUs, VPmCs, VPmAs, VPmGs, mU, mC, mA, mG, fU, fC, fA, fG, iab, MOE-U, MOE-C, MOE-A, MOE-G, dT, dC, dA, dG, dI, linkers: inv-TA14, TA14, L5, and targets: 7A, inv-7A. Their chemical structures are detailed in the "Comparison Table of Modifying Monomer Abbreviations".

[0568] In this article, the structural formula of "C6 amino" or "C6-NH2" is: Furthermore, those skilled in the art will understand that the C6-NH2 is linked to the nucleotide at the 5' end of the positive strand to form

[0569] In this article, the structural formula of "C6 imine" or "C6-NH-" is: Furthermore, those skilled in the art will understand that the "C6-NH-" linking to the nucleotide at the 5' end of the positive strand forms...

[0570] In this document, the term "siRNA" refers to an RNA molecule capable of sequence-specifically inducing RNAi, consisting of a sense strand and an antisense strand, and having a partially or fully complementary double-stranded structure. In the siRNAs involved in this invention, the length of the complementary double-stranded structure can be 17-30 base pairs, for example, 19, 20, 21, 22, 23, 24, or 25 base pairs. In some embodiments of this invention, the siRNA may also contain modified nucleotides as needed, which do not cause a significant weakening or loss of the siRNA's function in inhibiting MMP7 gene expression. Currently, various methods exist in the art for modifying siRNA, including, for example, backbone modification (such as phosphate group modification), ribose group modification, and base modification.

[0571] The term "antisense strand" includes a region substantially complementary to the target sequence. The term "sense strand," as used herein, refers to the strand of a region substantially complementary to the antisense strand. The term "complementary region" refers to a region on the antisense strand substantially complementary to the MMP7 mRNA or a region on the sense strand substantially complementary to the antisense strand. When the complementary region is not perfectly complementary to the target sequence or the antisense strand, mismatches can occur within the molecule or in terminal regions. Typically, the most permissible mismatches are in terminal regions, for example, within 5, 4, 3, 2, or 1 nucleotides at the 5' and / or 3' ends.

[0572] In this document, unless otherwise specified, the term "complementary" refers to the ability of an oligonucleotide in a first sequence to hybridize with an oligonucleotide in a second sequence under certain conditions and form a double-stranded structure. "At least partially complementary" means that the two sequences can be completely complementary, or have no more than 6, 5, 4, 3, 2, or 1 mismatched base pairs in total, while retaining the ability to hybridize under the relevant conditions. Furthermore, where the two oligonucleotides are designed to form one or more single-stranded overhangs upon hybridization, such overhangs should not be considered mismatches for determining complementarity. In this document, to satisfy the above hybridization ability requirements, a "complementary" sequence may also include or consist entirely of base pairs formed from non-Watson-Crick base pairs and / or from non-natural and modified nucleotides. Such non-Watson-Crick base pairs include, but are not limited to, G:U swing base pairs or Hoogstein base pairs. Correspondingly, in this article, unless otherwise specified, "mismatch" refers to a situation in the siRNA double-stranded molecule where the bases at corresponding positions are not paired in a complementary manner.

[0573] Those skilled in the art can determine the most suitable conditions for testing the complementarity of two sequences based on the final application of the hybridized nucleotides. Such conditions can be, for example, stringent conditions, such as 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, at 50 or 70°C for 12–16 hours, followed by washing. Other conditions, such as physiologically relevant conditions that may be encountered in vivo, can also be applied.

[0574] In this article, unless otherwise specified, "difference in nucleotide sequence" refers to a change in the type of bases of nucleotides at the same or corresponding positions compared to the original nucleotide sequence. For example, if a nucleotide base in the original nucleotide sequence is A, and the nucleotide base at the same or corresponding position is changed to U, C, G, or dT, dC, dG, etc., then a difference in nucleotide sequence at that position is considered to exist. It should be noted that if the difference between the original nucleotide sequence and the nucleotides at the same or corresponding positions is only in the presence or type of modification, then a difference in nucleotide sequence at that position is not considered to exist.

[0575] Unless otherwise stated, the numerical ranges described herein are equivalent to describing at least each specific integer value or its decimal value (if appropriate). For example, the numerical range "1-10" is equivalent to describing each integer value in the numerical range "1-10", namely 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, and any decimal value in the range 1-10 (if appropriate). Furthermore, any numerical range should be understood to describe the two endpoints of the range, each integer in the range, and each decimal value in the range (if appropriate).

[0576] In this document, unless otherwise explicitly stated, the descriptive phrase “…each independently selected” used throughout the document can mean either that the specific options expressed by the same or different symbols in different groups do not affect each other, or that the specific options expressed by the same or different symbols in the same group do not affect each other.

[0577] In this document, the substituents of the compounds are disclosed according to the type or range of groups. In particular, the invention includes every independent sub-combination of the members of these types and ranges. For example, the term "C1-C6 alkyl" specifically refers to the independently disclosed methyl, ethyl, C3 alkyl, C4 alkyl, C5 alkyl, and C6 alkyl groups.

[0578] In this document, the term "C1-C6 alkyl" refers to straight-chain and branched alkyl groups having 1 to 6 carbon atoms, preferably "C1-C4 alkyl", more preferably "C1-C3 alkyl", and most preferably "C1-C2 alkyl". Examples of "C1-C6 alkyl" include, but are not limited to, methyl, ethyl, propyl (e.g., n-propyl, isopropyl), butyl (e.g., n-butyl, isobutyl, tert-butyl), pentyl (e.g., n-pentyl, isopentyl, neopentyl), etc. Examples of "C1-C4 alkyl" include, but are not limited to, methyl, ethyl, propyl (e.g., n-propyl, isopropyl), butyl (e.g., n-butyl, isobutyl, tert-butyl), etc. Examples of "C1-C3 alkyl" include methyl, ethyl, propyl (e.g., n-propyl, isopropyl), etc. Examples of "C1-C2 alkyl" include methyl and ethyl.

[0579] In this document, the term “C1-C6 alkoxy” refers to any “C1-C6 alkyl” as defined above, which is attached to the rest of the molecule by an oxygen atom (-O-), preferably C1-C4 alkoxy, C1-C3 alkoxy or C1-C2 alkoxy, examples of which include methoxy, ethoxy, isopropoxy and the like.

[0580] In this document, the term “C1-C6 alkylthio” refers to any “C1-C6 alkyl” as defined above, which is attached to the rest of the molecule by a sulfur atom (-S-), preferably C1-C4 alkylthio, C1-C3 alkylthio, or C1-C2 alkylthio, such as methylthio (i.e., CH3-S-).

[0581] In this article, the term "halogen" refers to fluorine, chlorine, bromine, and iodine.

[0582] In this document, the term "C1-C6 haloalkyl" refers to a group formed by replacing one or more (preferably one) hydrogen atoms of any of the "C1-C6 alkyl" groups defined above with halogen atoms (preferably fluorine), preferably C1-C4 haloalkyl, C1-C3 haloalkyl or C1-C2 haloalkyl, such as trifluoromethyl (-CF3), -CHF2, -CH2F or -CH2CF3.

[0583] In this document, the term "C3-C6 cycloalkyl" refers to a monovalent group of a saturated monocyclic or polycyclic hydrocarbon containing 3 to 6 carbon atoms, excluding groups with bridged ring structures. Non-limiting examples include cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, etc. C3-C6 cycloalkyl is preferably C4-C6 or C5-C6 cycloalkyl. C4-C6 cycloalkyl refers to a monovalent group of a saturated monocyclic or polycyclic hydrocarbon containing 4 to 6 carbon atoms, excluding groups with bridged ring structures. Non-limiting examples include cyclobutyl, cyclopentyl, cyclohexyl, etc. C5-C6 cycloalkyl refers to a monovalent group of a saturated monocyclic or polycyclic hydrocarbon containing 5 to 6 carbon atoms, excluding groups with bridged ring structures. Non-limiting examples include cyclopentyl, cyclohexyl, etc.

[0584] In this paper, the term "C2-C6 alkenyl" refers to a straight-chain or branched unsaturated hydrocarbon group consisting of 2 to 6 carbon atoms, which contains one or more carbon-carbon double bonds (C=C) and the double bond positions can form different isomers (such as 1-propenyl, 2-butenyl, etc.).

[0585] In this paper, the term "C2-C6 ynyl" refers to a straight-chain or branched unsaturated hydrocarbon group consisting of 2 to 6 carbon atoms, which contains one or more carbon-carbon triple bonds (C≡C) and the triple bond positions can form isomers (such as 1-propynyl, 2-butynyl, etc.).

[0586] In this document, the compounds referred to also include isotopically labeled compounds that are the same as those shown in Formula I, but in which one or more atoms are replaced by atoms with atomic masses or mass numbers different from those normally found in nature. Examples of isotopes that can be incorporated into the compounds of the present invention include isotopes of H, C, N, O, S, F and Cl, respectively such as 2 H, 3 H, 13 C 11 C 14 C 15 N、 18 O、 17 O、 32 P, 35 S, 18 F and 36 Cl. Compounds of the present invention, their prodrugs, or pharmaceutically acceptable salts of said compounds or prodrugs containing the aforementioned isotopes and / or other isotopes are within the scope of the present invention. With heavier isotopes (such as deuterium, i.e., 2H or D substitutions can provide certain therapeutic advantages derived from greater metabolic stability (e.g., increased in vivo half-life or reduced dose requirements) and are therefore preferred in some cases. The presence of hydrogen in the substituents of this invention, without the separate mention of the terms deuterium or tritium, does not imply the exclusion of deuterium or tritium, but rather may also include deuterium or tritium.

[0587] In this document, the term "pharmaceutically acceptable salt" means (i) a salt formed by an acidic functional group present in the compounds or conjugates provided by the present invention and a suitable inorganic or organic cation (base), including but not limited to, alkali metal salts such as sodium, potassium, lithium, etc.; alkaline earth metal salts such as calcium, magnesium, etc.; other metal salts such as aluminum, iron, zinc, copper, nickel, cobalt, etc.; inorganic base salts such as ammonium salts; organic base salts such as tert-octylamine salts, dibenzylamine salts, morpholine salts, glucosamine salts, phenylglycine alkyl ester salts, ethylenediamine salts, N-methylglucosamine salts, guanidine salts, diethylamine salts, triethylamine salts, dicyclohexylamine salts, N,N'-dibenzylethylenediamine salts, chloroprocaine salts, procaine salts, diethanolamine salts, N-benzyl-phenylethylamine salts, piperazine salts, tetramethylamine salts, and tris(hydroxymethyl)aminomethane salts. (ii) The salts formed by the basic functional groups present in the compounds or conjugates provided by the present invention and suitable inorganic or organic anions (acids), including but not limited to, hydrohalates such as hydrofluoric acid, hydrochloride, hydrobromide, hydroiodide, etc.; inorganic acid salts such as nitrates, perchlorates, sulfates, phosphates, etc.; lower alkyl sulfonates such as methanesulfonates, trifluoromethanesulfonates, ethanesulfonates, etc.; aryl sulfonates such as benzenesulfonates, p-benzenesulfonates, etc.; organic acid salts such as acetates, malates, fumarates, succinates, citrates, tartrates, oxalates, maleates, etc.; amino acid salts such as glycine salts, trimethylglycine salts, arginine salts, ornithine salts, glutamate salts, aspartate salts, etc.

[0588] Pharmaceutically acceptable salts can be obtained using standard procedures well known in the art, for example, by reacting an adequate amount of a basic substance with a suitable acid providing a pharmaceutically acceptable anion, or by reacting an adequate amount of an acid with a suitable base providing a pharmaceutically acceptable cation.

[0589] In this document, the term "stereoisomer" refers to a compound with the same molecular structure as the compound or conjugate of the present invention but a different spatial configuration. The compounds or conjugates of the present invention may include one or more asymmetric centers and therefore may exist in various stereoisomeric forms, such as enantiomers and / or diastereomers. For example, the compounds or conjugates of the present invention may be individual enantiomers, diastereomers, or geometric isomers (e.g., cis and trans isomers), or may be in the form of mixtures of stereoisomers, including racemic mixtures and mixtures rich in one or more stereoisomers. The isolation of individual isomers or the selective synthesis of individual isomers is achieved by applying various methods well known to those skilled in the art. For example, isomers may be isolated from mixtures by methods known to those skilled in the art, including but not limited to: chiral high-performance liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers may be prepared by asymmetric synthesis. Unless otherwise stated, all such isomers and mixtures thereof are included within the scope of the compounds or conjugates disclosed herein. Unless otherwise stated, the structures described herein also imply all stereochemical forms encompassing that structure; i.e., the (R) and (S) configurations of each asymmetric center. Therefore, those skilled in the art will generally consider single stereochemical isomers of the compounds or conjugates of the present invention, as well as mixtures of enantiomers and diastereomers, to be stable within the scope of this disclosure.

[0590] Unless otherwise specified herein, the term "pharmaceutically acceptable carrier and / or excipient" means that the carrier, delivery carrier, diluent, excipient, and / or the salt / ester / hydrate formed therefrom are generally chemically or physically compatible with other components constituting a pharmaceutical dosage form (such as the siRNA of the present invention) and physiologically compatible with the subject. "Pharmaceutically acceptable carriers and / or excipients" do not exert or are not intended to exert a therapeutic effect at the intended dosage. Such components may serve to: a) assist in the processing of the drug delivery system during manufacturing; b) protect, support, or enhance the stability, bioavailability, or patient acceptability of the active ingredient; c) assist in product identification; and / or d) enhance the overall safety, efficacy, delivery, or any other property of the active ingredient during storage and use. For example, the siRNA of the present invention may be encapsulated by a delivery carrier. "Pharmaceutically acceptable carriers and / or excipients" include, but are not limited to: viruses, liposomes, nanoparticles, bacteria, lipid nanoparticles (LNP), neutral liposomes (NL), polymer nanoparticles, double-stranded RNA binding motifs (dsRBMs), pH adjusters, surfactants, adjuvants, ionic strength enhancers, diluents, agents for maintaining osmotic pressure, agents for delaying absorption, and preservatives. For example, viruses include, but are not limited to, retroviruses, adenoviruses, lentiviruses, baculoviruses, and AAV. Liposomes include, but are not limited to, Lipofectamine, cationic DOTAP, and neutral DOPC. Nanoparticles include, but are not limited to, cationic polymers and PEI. Bacteria include, but are not limited to, tkRNAi. Polymer nanoparticles include, but are not limited to, low-molecular-weight polymers or high-molecular-weight polymers. pH adjusters include, but are not limited to, phosphate buffers. Surfactants include, but are not limited to, cationic, anionic, or nonionic surfactants, such as Tween-80. Ionic strength enhancers include, but are not limited to, sodium chloride. Preservatives include, but are not limited to, various antibacterial and antifungal agents, such as parabens, chlorobutanol, phenol, sorbic acid, etc. Reagents that maintain osmotic pressure include, but are not limited to, sugars, NaCl, and their analogues. Reagents that delay absorption include, but are not limited to, monostearate and gelatin. Diluents include, but are not limited to, water, aqueous buffers (such as buffered saline), alcohols, and polyols (such as glycerol).

[0591] In this article, unless otherwise specified, the term "suppression" refers to the down-regulation of target gene expression due to siRNA-mediated mRNA degradation. "Down-regulation" refers to a decrease in target gene expression levels of 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, or more than 99%, or even 100%, compared to the absence of siRNA treatment. A 100% decrease in target gene expression levels means that there is no detectable level of target gene expression.

[0592] In this document, the term "protrusion" or "nucleotide protrusion" refers to at least one unpaired nucleotide protruding from the double-stranded structure of siRNA. For example, a protrusion exists when the 3' end of one strand of siRNA extends beyond the 5' end of the other strand (or vice versa). siRNA may contain at least one nucleotide protrusion, or the protrusion may contain at least 2 nt, at least 3 nt, at least 4 nt, at least 5 nt, or more. The protrusion may contain, or be composed of, nucleotide / nucleoside analogs, including deoxynucleotides / nucleosides. The protrusion may be on the sense strand, antisense strand, or any combination thereof. The nucleotide of the protrusion may be present at the 5' end, 3' end, or both ends of the antisense strand or sense strand of siRNA. Accordingly, the term "flat end" refers to the absence of a nucleotide protrusion.

[0593] In this document, the term "prevention" refers to a method implemented to prevent or delay the occurrence of a disease, condition, or symptom in a subject; the term "treatment" refers to a method implemented to obtain a beneficial or desired clinical outcome. For the purposes of this invention, beneficial or desired clinical outcomes include, but are not limited to, alleviating symptoms, reducing the extent of the disease, stabilizing (i.e., no longer worsening) the state of the disease, delaying or slowing the progression of the disease, improving or alleviating the state of the disease, and relieving symptoms (whether partial or complete), whether detectable or undetectable. Furthermore, "treatment" can also refer to prolonged survival compared to the expected survival (if no treatment was received).

[0594] In this document, the term "effective amount" means an amount sufficient to achieve, or at least partially achieve, the desired effect. For example, an effective amount for disease prevention is an amount sufficient to prevent, stop, or delay the onset of a disease; an effective amount for disease treatment is an amount sufficient to cure or at least partially stop the disease and its complications in a patient already suffering from the disease. Determining such an effective amount is entirely within the capabilities of those skilled in the art. For example, an effective amount for therapeutic purposes will depend on the severity of the disease to be treated, the overall state of the patient's own immune system, the patient's general characteristics such as age, weight, and sex, the method of administration of the drug, and other concurrent treatments, etc.

[0595] 8. Beneficial effects of the invention

[0596] The siRNA or conjugates of this invention can effectively inhibit MMP7 gene expression in vitro and / or in vivo, and exhibit good stability, negligible cytotoxicity, and immunostimulatory activity, significantly reducing MMP7 mRNA and protein levels at cellular and animal levels. Therefore, the siRNA or conjugates of this invention can be used to treat diseases or conditions that benefit from reduced or inhibited MMP7 levels, and have significant clinical value in the treatment of pulmonary inflammation or fibrosis. Furthermore, the siRNA modification modifiers of this invention can reduce off-target effects and / or increase the molecular biostability.

[0597] In addition, the compound of Formula IV or its stereoisomer or pharmaceutically acceptable salt provided by the present invention can be used as an intermediate for preparing a linking group in a targeted ligand delivery conjugate. For example, the linking group containing the structural fragment of Formula IV-2 can couple four ligand molecules, providing higher affinity for the delivery receptor. It is formed by the condensation linking of natural amino acids, has good biocompatibility in vivo, and has potential advantages in delivery performance. Attached Figure Description

[0598] Figure 1: Results of mRNA expression levels of α-SMA, collagen1A, and CTGF in LL97A cells.

[0599] Sequence information

[0600] Table 1: Double strand 1 to double strand 28

[0601] Table 2: Double-strand modification patterns

[0602] Table 3: Modified bistrands 1 to 127

[0603] Table 4-1: Conjugate 1 to Conjugate 6

[0604] Table 4-2: Conjugate 1 to Conjugate 6 Detailed Implementation

[0605] The invention will now be described in the following non-limiting embodiments.

[0606] Those skilled in the art will understand that the embodiments are described by way of example only and are not intended to limit the scope of protection claimed in this application. Unless otherwise specified, the experimental methods in the embodiments are conventional methods. Where specific conditions are not specified in the embodiments, they are performed according to conventional conditions or conditions recommended by the manufacturer. Reagents or instruments whose manufacturers are not specified are all commercially available conventional products.

[0607] Those skilled in the art will recognize that the siRNA described in this invention can be obtained using conventional siRNA preparation methods (e.g., solid-phase synthesis and liquid-phase synthesis), both of which are commercially available custom-made services. Those skilled in the art will also understand that modified nucleotide groups can be introduced into the siRNA described in this invention using appropriately modified nucleotide monomers. Methods for preparing appropriately modified nucleotide monomers are well known to those skilled in the art, and commercially available monomers are also available.

[0608] Example 1: Synthesis and preparation of siRNA and its modifications and conjugates

[0609] Example 1-1: Synthesis of siRNA and its modified compounds

[0610] A siRNA sequence was designed targeting the MMP7 gene sequence (see NCBI Reference Sequence: NM_002423.5). For the sense and antisense strands of the siRNA sequence of this invention, as well as the sense and antisense strands of the modified double strands, deoxynucleoside CPG was used as a solid-phase support; the sense strand was synthesized using the solid-phase support, and the antisense strand was synthesized using universal CPG.

[0611] Sequence synthesis was performed using a 48-channel synthesizer at a scale of 0.2 μmol. The phosphoramide monomer was used at a concentration of 0.05 M, and the activator was 0.3 M BTT.

[0612] Sequence cutting and deprotection were performed in 1.5 ml tubes. The first step used AMA, followed by deprotection of the 2-position using triethylamine trifluoride. For sequences containing complete modifications at the 2-position, ammonia hydrolysis was performed. The cut and deprotected sequences were precipitated using an acetone:ethanol mixture (80:20 v / v) and dissolved in RNase-free water. Sequence accuracy was determined by LC-MS, quantification by spectrophotometry, and purity was determined by HPLC.

[0613] The structure of the positive chain-C6-NH2 intermediate with C6-NH2 fused to the 5' end of the positive chain is as follows: The phosphoramide monomer (5'-TFA-Amino-Modifier C6) was synthesized using a positive-chain solid-phase synthesis method. The structure of the phosphoramide monomer is as follows:

[0614] After HPLC purification, lyophilization, and quality control, the salt was replaced with sodium acetate for alcohol precipitation, followed by desalting using a 3KD ultrafiltration tube. The sense and antisense strands were then quantitatively determined using a spectrophotometer, and the mixture was annealed at a 1:1 ratio to form siRNA duplexes. The obtained siRNA duplexes are shown in Table 1.

[0615] The above-mentioned double strands were chemically modified according to methods known to those skilled in the art, and the sequences of the modified double strands 1 to 127 are shown in Table 3.

[0616] Examples 1-2: Synthesis of Compound 7A

[0617] 1-2.1 Synthesis of compounds 1-7

[0618] Step 1. Synthesis of compounds 1-2

[0619] In an ice bath, add 245 mL of DMF to a 1 L three-necked flask, then add 1-1 Boc-S-3-amino-3-(4-bromo-phenyl)-propionic acid (45.00 g, 131.20 mmol) and stir until fully dissolved. Add 59.83 g of 2-(7-azobenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (157.44 mmol) and 33.85 g of N,N-diisopropylethylamine (262.40 mmol) to the above system and continue stirring for 10 minutes. Then, slowly add 90 mL of methanol dropwise to the above system and transfer the system to room temperature overnight. LC-MS monitoring showed that after the starting material had completely reacted, the methanol in the system was concentrated, then washed with water, extracted with ethyl acetate, dried over anhydrous sodium sulfate, concentrated, and subjected to column chromatography (ethyl acetate: petroleum ether = 5:1) to give compounds 1-2 (45 g, 95.74% yield). LC-MS (E+) m / z: 303.9 [M-56] + .

[0620] Step 2. Synthesis of compounds 1-3

[0621] Under nitrogen protection, methyl (S)-3-(4-bromophenyl)-3-((tert-butoxycarbonyl)amino)propionate 1-2 (25.00 g, 69.83 mmol), 4-(4,4,5,5-tetramethyl-1,3,2-dioxaneborane-2-yl)-1-naphthol (18.80 g, 69.83 mmol), sodium carbonate (14.80 g, 139.66 mmol), tetrakis(triphenylphosphine)palladium (807.23 mg, 0.70 mmol), and toluene / water = 4:1 (250 mL) were added to a 1 L three-necked flask. The system was stirred overnight at 80 °C and monitored by LC-MS. After the reaction was complete, the mixture was cooled to 0°C, then the pH was adjusted to 5.0. The mixture was extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated, and subjected to two column chromatography analyses (petroleum ether:ethyl acetate = 3:1, dichloromethane) to give compounds 1-3 (2.00 g, 6.80% yield). LCMS (E+) m / z: 420.2 [MH] + .

[0622] Step 3. Synthesis of compounds 1-4

[0623] Compound 1-3 (2.00 g, 4.75 mmol) was added to a 100 mL three-necked flask and dissolved in DMF (20 mL). Then, compound 1-3' (2.20 g, 5.23 mmol) and potassium carbonate (1.3 g, 9.50 mmol) were added. After the addition was complete, the mixture was stirred at 90 °C for 4 hours, and the reaction was monitored by LC-MS. After the reaction was complete, the reaction solution was prepared by MPLC (Column type: Flash spherical C18 column; Specifications: particle size 20-35 μm, packing weight 40 g; Mobile phase: Phase A was 0.5% trifluoroacetic acid aqueous solution, Phase B was acetonitrile; Flow rate: 25 mL / min; Column temperature: room temperature; Liquid chromatography method: 100% Phase A to 0% Phase A, gradient run for 30 min) to obtain compound 1-4 (2.80 g, 88.38% yield). LCMS (E+) m / z: 689.2 [M+Na] + .

[0624] Step 4. Synthesis of compounds 1-5

[0625] Compounds 1-4 (2.80 g, 4.20 mmol) were added to a 100 mL single-necked flask, followed by a 4.0 M, 20 mL solution of dioxane chloride. After the addition was complete, the mixture was stirred at room temperature for 2 hours, and the reaction was monitored by LC-MS. After the reaction was completed, the mixture was concentrated to obtain crude compounds 1-5 (3.00 g).

[0626] Step 5. Synthesis of compounds 1-6

[0627] To a 20 mL single-necked flask, add hydrochloride of compounds 1-5 (1.50 g, 2.48 mmol), N-Boc-glycine (434.00 mg, 2.48 mmol), 2-(7-azobenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.04 g, 2.73 mmol), and DMF (10 mL). After stirring until homogeneous, add N,N-diisopropylethylamine (1.38 g, 9.92 mmol). React at room temperature for 2 hours. LC-MS analysis showed complete disappearance of the starting materials. The reaction solution was directly prepared by MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing amount 40 g; mobile phase: phase A is 0.5% trifluoroacetic acid aqueous solution, phase B is acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; liquid chromatography method: 100% phase A to 0% phase A, gradient run for 30 min) to obtain compounds 1-6 (1.30 g, 72.40% yield).

[0628] Step 6. Synthesis of compounds 1-7

[0629] Compound 1-6 (1.30 g, 1.80 mmol) and dioxane hydrochloride solution (4.0 M, 10 mL) were added to a 50 mL single-necked flask. The system was reacted at room temperature for 2 hours, and the starting material was completely eliminated as detected by LC-MS. The reaction solution was concentrated to give compound 1-7 hydrochloride (1.10 g, 92.59% yield).

[0630] 1-2.2 Synthesis of Compound 7A

[0631] Step 1. Synthesis of compound 7-2

[0632] Compound 7-1 (2.00 g, 12.98 mmol), 7-1' (2.98 g, 14.29 mmol), potassium carbonate (3.60 g, 25.90 mmol), and DMF (20 mL) were added to a 100 mL reaction flask under nitrogen protection. After addition, the mixture was stirred at room temperature for 3 hours, and the reaction was monitored by LC-MS. After the reaction was complete, water (500 mL) was added, and the mixture was extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, and prepared by reverse-phase chromatography (FLASH spherical C18 column; mobile phase: water / acetonitrile; flow rate: 25 mL / min; preparation method: gradient run from 0% acetonitrile to 50% acetonitrile for 30 min) to give compound 7-2 (2.00 g, 54.55% yield). LCMS (E+) m / z: 283.1 [M+H] + .

[0633] Step 2. Synthesis of compound 7-3

[0634] Under nitrogen protection, compound 7-2 (2.00 g, 7.09 mmol) was added to a 100 mL reaction flask and dissolved in ethanol (20 mL). Then, acetic acid (5 mL) and iron powder (2.80 g, 50.00 mmol) were added. After addition, the reaction was carried out at room temperature for 5 hours, monitored by LC-MS. After the reaction, the system was concentrated by diatomaceous earth filtration, extracted with ethyl acetate, dried over anhydrous sodium sulfate, concentrated, and then prepared by MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A: 0.5% trifluoroacetic acid aqueous solution, phase B: acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; liquid chromatography method: 100% phase A to 0% phase A, gradient run for 30 min) to obtain compound 7-3 (1.78 g, 99.62% yield). LCMS (E+) m / z: 253.0 [M+H] + .

[0635] Step 3. Synthesis of Compounds 7-4

[0636] Compound 7-3 (1.78 g, 7.06 mmol) was added to a 100 mL three-necked flask under nitrogen protection and dissolved in DCE (50 mL). Then, sodium triacetoxyborohydride (1.65 g, 7.81 mmol) and acetic acid (5 drops) were added. After addition, the reaction was allowed to proceed overnight at room temperature, monitored by LC-MS. After the reaction was complete, the pH was adjusted to 5 with hydrochloric acid, extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, concentrated, and prepared by MPLC (Column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A: 0.5% trifluoroacetic acid aqueous solution, phase B: acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; HPLC method: gradient run from 100% phase A to 0% phase A for 30 min) to give compound 7-4 (1.00 g, 60.00% yield). LCMS(E+)m / z: 238.2 [M+H] + .

[0637] Step 4. Synthesis of compounds 7-5

[0638] Compound 7-4 (1.00 g, 4.24 mmol) was added to a 50 mL reaction flask under nitrogen protection and dissolved in methanol (10 mL). Then, sodium hydroxide solution (1 M, 10 mL) was added. After the addition was complete, the reaction was allowed to proceed at room temperature for 2 hours, monitored by LC-MS. After the reaction was complete, the methanol was removed by concentration, and the residue was adjusted to pH 1 with hydrochloric acid. The solution was then prepared by MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A: 0.5% trifluoroacetic acid aqueous solution, phase B: acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; HPLC method: gradient run from 100% phase A to 0% phase A for 30 min) to obtain the hydrochloride salt of compound 7-5 (1.00 g, 91.41% yield). LCMS (E+) m / z: 223.3 [M+H] + .

[0639] Step 5. Synthesis of compound 7-6-A

[0640] The hydrochloride salt of compound 7-5 (400 mg, 1.39 mmol) was resolved by chiral SFC (column type: CHIRALPAK AD-3; specifications: particle size 3 μm, 150*3 mm; mobile phase: phase A is carbon dioxide, phase B is ethanol (containing 0.1% diethylamine); flow rate: 1 mL / min; column temperature: 40 ℃; resolution method: 72% phase A + 28% phase B isogradient run for 10 min) to obtain compound 7-6-A (180 mg, 45.00% yield, chromatographic retention time of product: 6.672 min).

[0641] Step 6. Synthesis of compound 7-7-A

[0642] Compounds 7-6-A (50.00 mg, 0.19 mmol) and 1-7 (114.00 mg, 0.19 mmol) were added to a 4 mL reaction flask under nitrogen protection and dissolved in N,N'-dimethylformamide (2 mL). 2-(7-azobenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (73.00 mg, 0.19 mmol) and N,N-diisopropylethylamine (68.00 mg, 0.60 mmol) were added to the system with stirring. After addition, the reaction was allowed to proceed at room temperature for 2 hours, and the reaction was monitored by LC-MS. After the reaction, the reaction solution was prepared by MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A was 0.5% trifluoroacetic acid aqueous solution, phase B was acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; HPLC method: gradient run from 100% phase A to 0% phase A for 30 min) to obtain compound 7-7-A (80 mg, 50.91% yield). LCMS (E+) m / z: 828.7 [M+H] + .

[0643] Step 7. Synthesis of compound 7A

[0644] Compound 7-7-A (80.00 mg, 0.10 mmol) was added to a 20 mL reaction flask and dissolved in methanol (2 mL). Then, 1 M sodium hydroxide solution (2 mL) was added. After the addition was complete, the mixture was stirred at room temperature for 1 hour, and monitored by LC-MS. After the reaction was complete, compound 7A (50.00 mg, 61.50% yield) was obtained directly by MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A was 0.5% trifluoroacetic acid aqueous solution, phase B was acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; liquid chromatography method: gradient run from 100% phase A to 0% phase A for 30 min). LCMS (E+) m / z: 814 [M+H] + .

[0645] 1H NMR (600MHz, DMSO-d6) δ8.98(s,1H),8.30–8.20(m,2H),7.77(d,J=8.3Hz,1H),7.51(dt,J=15.1,8.1Hz,2H),7.44(d,J=7.8Hz,2H),7. 41(d,J=4.9Hz,1H),7.31(dd,J=23.7,7.8Hz,3H),7.03(d,J=8.0Hz,1H),6.70(s,1H),6.33(d,J=5.0Hz,1H),5.23(s,1H),4.31(d,J=5. 2Hz,2H),4.10(dd,J=10.6,2.8Hz,1H),3.92(d,J=4.7Hz,2H),3.81(dd,J=10.7,5.9Hz,1H),3.74(d,J=5.8Hz,2H),3.68(dd,J=5.8,3. 8Hz, 2H), 3.63–3.48 (m, 10H), 3.42 (s, 1H), 3.38–3.35 (m, 2H), 2.60 (d, J = 14.0Hz, 3H), 2.32 (t, J = 7.6Hz, 2H), 2.03 (s, 3H), 1.72 (m, 2H).

[0646] Examples 1-3: Synthesis of compound inv7A

[0647] Step 1. Synthesis of compound inv7-2

[0648] Under nitrogen protection, compounds 1-3 (2.00 g, 4.75 mmol), inv7-a (2.20 g, 5.69 mmol), and potassium acetate (654.83 mg, 4.75 mmol) were dissolved in N,N-dimethylformamide (40 mL). After addition, the mixture was stirred at 90 °C for 16 hours, and monitored by LC-MS. After the reaction was complete, the mixture was cooled to room temperature, and water (50 mL) was added. The mixture was extracted with ethyl acetate, washed with saturated brine, dried over anhydrous sodium sulfate, and prepared by reverse-phase chromatography (FLASH C18 column; mobile phase: water / acetonitrile; flow rate: 25 mL / min; preparation method: gradient run from 0% acetonitrile to 50% acetonitrile for 30 min) to give compound inv7-2 (2.60 g, 3.89 mmol, 81.88% yield). LCMS (E+) m / z: 636.31 [M+H] + .

[0649] Step 2. Synthesis of intermediate inv7-3

[0650] Compound inv7-2 (2.20 g, 3.46 mmol) was added to a mixed solution of dichloromethane (15 mL) and trifluoroacetic acid (5 mL) at 0 °C. After addition, the mixture was stirred at 0 °C for 1 hour. The reaction was monitored by LC-MS. After the reaction was complete, the mixture was evaporated to dryness. The crude product was then prepared by reverse-phase chromatography (column type: FLASH spherical C18 column; mobile phase: water / acetonitrile; flow rate: 25 mL / min; preparation method: gradient run from 0% acetonitrile to 50% acetonitrile for 30 min) to obtain intermediate inv7-3 trifluoroacetate (1.70 g, 3.01 mmol, 87.10% yield). LCMS (E+) m / z: 536.26 [M+H] + .

[0651] Step 3. Synthesis of compound inv7-4

[0652] At room temperature, N-Boc glycine (302.63 mg, 0.53 mmol) was added to a 25 mL reaction flask and dissolved in DMF (5 mL). While stirring, inv7-3 trifluoroacetate (110.25 mg, 0.63 mmol), N,N,N',N'-tetramethyl-O-(7-azabenzotriazol-1-yl)hexafluorophosphate (220.40 mg, 0.58 mmol), and N,N-diisopropylethylamine (135.45 mg, 1.05 mmol) were added sequentially. After the additions were complete, the reaction was allowed to proceed for 30 minutes, and the reaction was monitored by LC-MS. After the reaction, the compound inv7-4 (352.92 mg, 0.51 mmol, 96.23% yield) was purified by MPLC (Column type: Flash spherical C18 column; Specifications: particle size 20-35 μm, packing weight 40 g; Mobile phase: Phase A: 0.5% trifluoroacetic acid aqueous solution, Phase B: acetonitrile; Flow rate: 25 mL / min; Column temperature: room temperature; Liquid chromatography method: 100% Phase A to 0% Phase A, gradient run for 30 min) to obtain the compound inv7-4. LCMS (E+) m / z: 693.6 [M+H] + .

[0653] Step 4. Synthesis of compound inv7-5

[0654] Compound inv7-4 (352.92 mg, 0.51 mmol) was added to a 25 mL single-necked flask at room temperature and dissolved in dichloromethane (5 mL). Then, trifluoroacetic acid (2 mL) was added with stirring in an ice-water bath at 0°C. After the addition was complete, the reaction was allowed to proceed at room temperature for 10 minutes, monitored by LC-MS. After the reaction was complete, the intermediate inv7-5 trifluoroacetate (301.00 mg, 0.51 mmol, 99.70% yield) was purified by MPLC (Column type: Flash spherical C18 column; Specifications: particle size 20-35 μm, packing weight 40 g; Mobile phase: Phase A: 0.5% trifluoroacetic acid aqueous solution, Phase B: acetonitrile; Flow rate: 25 mL / min; Column temperature: room temperature; HPLC method: 100% Phase A to 0% Phase A, gradient run for 30 min) to obtain the intermediate inv7-5 trifluoroacetate (301.00 mg, 0.51 mmol, 99.70% yield). LCMS (E+) m / z: 593.9 [M+H] + .

[0655] Step 5. Synthesis of compound inv7-6A

[0656] Compound 7-6-A (50.00 mg, 0.24 mmol), inv7-5 trifluoroacetate (100.00 mg, 0.17 mmol), 2-(7-azobenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (95.00 mg, 0.23 mmol), and N,N-diisopropylethylamine (100 μL, 0.60 mmol) were added to a 4 mL reaction flask. After the addition was complete, the mixture was allowed to react at room temperature for 1 hour until the starting material was completely eliminated as detected by LC-MS. The reaction solution was directly prepared by MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A is 0.5% trifluoroacetic acid aqueous solution, phase B is acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; liquid chromatography method: gradient run from 100% phase A to 0% phase A for 30 min) to obtain compound inv7-6A (70.00 mg, 87.84 μmol, 51.73% yield). LCMS (E+) m / z: 797.6 [M+H] + .

[0657] Step 6. Synthesis of compound inv7A

[0658] Compound inv7-6A (70.00 mg, 87.84 μmol) was added to a 25 mL reaction flask, followed by dissolution with 3 mL of methanol. Sodium hydroxide solution (2N, 3 mL) was then added dropwise to the system. The reaction system was stirred at 25 °C for 1 hour. After the reaction, the methanol in the system was concentrated, and the system was subjected to MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A was 0.5% trifluoroacetic acid aqueous solution, phase B was acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; liquid chromatography method: 100% phase A to 0% phase A, gradient run for 30 min) to prepare compound inv7A (50.00 mg, 63.87 μmol, 72.56% yield).

[0659] LCMS(E+)m / z: 783.4 [M+H] + . 1 H NMR (400MHz, DMSO-d6) δ9.67(s,1H),8.36(t,J=6.0Hz,1H),8.26(dd,J=7.8,1.8Hz,1H),7.78(dd,J=7.8,1.7Hz,1H),7.50(dddd,J=15.3,8.3,6.8,1.6Hz ,2H),7.45–7.38(m,3H),7.30(dd,J=8.0,3.5Hz,3H),7.02(d,J=8.0Hz,1H), 6.81(d,J=2.5Hz,1H),6.32(d,J=5.0Hz,1H),5.09(d,J=6.6Hz,1H),4.32(dd ,J=5.8,3.5Hz,2H),4.12(d,J=2.4Hz,2H),4.08(dd,J=10.7,2.9Hz,1H),3.9 2(dd,J=5.7,3.5Hz,2H),3.84(dd,J=10.7,5.6Hz,1H),3.79–3.63(m,4H),3. 59(dd,J=5.9,3.7Hz,2H),3.56–3.49(m,9H),3.41(t,J=2.4Hz,2H),2.46(d, J=5.7Hz,2H),2.39–2.29(m,2H),2.03(s,3H),1.74(dt,J=12.9,7.0Hz,2H).

[0660] Examples 1-4: Preparation of Conjugate 1 and Conjugate 2

[0661] 1-4.1 Synthesis of linker invTA14

[0662] Step 1. Synthesis of compound invTA14-2

[0663] To a DMF solution (30 mL) of compound invTA14-1 (3 g, 6.39 mmol), 2-[2-(2-azidoethoxy)ethoxy]ethylamine (3.90 g, 22.37 mmol), HATU (8.50 g, 22.37 mmol), and DIPEA (3.30 g, 25.56 mmol, 4.45 mL) were added, and the mixture was stirred at room temperature for 2 hours until the starting material was completely eliminated by LC-MS. The reaction solution was then directly subjected to MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing mass 40 g; mobile phase: phase A was 0.5% trifluoroacetic acid aqueous solution, phase B was acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; HPLC method: 100% phase A to 0% phase A, gradient run for 30 min) to prepare compound invTA14-2 (4.1 g, 4.37 mmol, 68.40% yield). LCMS(E+)m / z: 845.5 [M+H] + .

[0664] Step 2. Synthesis of compound invTA14

[0665] Glutaric anhydride (1.50 g, 13.11 mmol) and DIPEA (11.30 g, 87.42 mmol, 15.23 mL) were added to a DMF solution (33 mL) of compound invTA14-2 (4.1 g, 4.37 mmol). The mixture was stirred at 45°C for 20 hours until the starting material was completely eliminated by LC-MS. The reaction solution was then directly subjected to MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A: 0.5% trifluoroacetic acid aqueous solution, phase B: acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; HPLC method: gradient run from 100% phase A to 0% phase A for 30 min) to prepare invTA14 (1.05 g, 1.27 mmol, 28.95% yield). LCMS (E+) m / z: 830.7 [M+H] + .

[0666] 1-4.2 Synthesis of Conjugate Intermediate 1 and Conjugate Intermediate 2

[0667] The positive chain of the oligonucleotide amino compound (conjugate 1-SS)-C6-NH2 (or (conjugate 2-SS)-C6-NH2) was dissolved in sodium borate buffer (250 mM sodium borate, pH = 9.4) to prepare a 4 mM solution (100 μL, 400 nmol). A mixed solution of linker invTA14 (10 μL, 2000 nmol, 5 equivalents, 200 mM DMA solution), HATU (5 μL, 2000 nmol, 5 equivalents, 400 mM DMA solution), and DIPEA (5 μL, 2000 nmol, 5 equivalents, 400 mM DMA solution) was added to the solution and mixed thoroughly. The reaction solution was then placed at 25 degrees Celsius and reacted for 0.5 hours.

[0668] After the reaction was complete, ethanol precipitation was performed: 10% of the total volume of 5M sodium chloride solution was added to the solution, followed by 3 times the total volume of anhydrous ethanol. After shaking and mixing, the reaction was placed in dry ice and frozen for 2 hours. Then, it was centrifuged at 12,000 rpm for half an hour. The supernatant was discarded, and the remaining precipitate was dissolved in deionized water to obtain a solution of conjugate intermediate 1 (or conjugate intermediate 2). LC-MS confirmed that the reaction conversion rate was 80%.

[0669] 1-4.3 Synthesis of Conjugate 1 and Conjugate 2

[0670] Dissolve conjugate intermediate 1 (or conjugate intermediate 2) in sodium bicarbonate buffer (250 mM sodium bicarbonate, pH = 8.5) to prepare a 1 mM solution (100 μL, 100 nmol). Add target inv7A (30 μL, 3000 nmol, 30 equivalents, 100 mM DMA solution), copper sulfate (10 μL, 1000 nmol, 10 equivalents, 100 mM aqueous solution), and sodium ascorbate (10 μL, 10000 nmol, 100 equivalents, 1000 mM aqueous solution) to the solution, mix well, and then place the reaction solution at 60 degrees Celsius for 15 minutes.

[0671] After the reaction was complete, ethanol precipitation was performed: 10% of the total volume of 5M sodium chloride solution was added to the solution, followed by 3 times the total volume of anhydrous ethanol. After shaking and homogenization, the reaction mixture was placed in dry ice and frozen for 2 hours. Then, it was centrifuged at 12000 rpm for half an hour. The supernatant was discarded, and the remaining precipitate was dissolved in deionized water. The conversion rate of the resulting solution was confirmed to be 70% by LCMS. The purified product was obtained by reversed-phase chromatography (column type: Waters Xbridge BEH RP18; specifications: particle size 5μm, 150*10mm; mobile phase: phase A was 400mM hexafluoroisopropanol aqueous solution, phase B was methanol; flow rate: 9mL / min; column temperature: room temperature; preparation method: mixed elution of phase A and phase B, gradient run of 54%-47% phase A for 35min) to obtain the pure product. After freeze-drying and quality inspection, the salt was replaced by sodium acetate alcohol precipitation, and then desalted using a 3KD ultrafiltration tube. After desalting, the molar amount of the sense chain was quantitatively determined by spectrophotometer. The sense and antisense chains were mixed in a 1:1 ratio and annealed to obtain conjugate 1 (or conjugate 2) target double strand.

[0672] Examples 1-5: Preparation of Conjugate 3

[0673] 1-5.1 Synthesis of L5 Linker

[0674] Step 1. Synthesis of compound L5-2

[0675] Compound L5-1 (21.76 g, 58.91 mmol), N,N-diisopropylethylamine (30.46 g, 235.65 mmol), 2-(7-azobenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (47.01 g, 123.71 mmol), and DMF (83 mL) were added to a 250 mL single-necked flask. The mixture was stirred at room temperature for 10 minutes, and then compound L5-a (36.59 g, 123.71 mmol) was added. After the addition was complete, the mixture was allowed to react at room temperature for 2 hours until the starting material was completely eliminated as detected by LC-MS. The reaction solution was directly subjected to MPLC (Column type: Flash spherical C18 column; Specifications: particle size 20-35 μm, packing weight 40 g; Mobile phase: Phase A: 0.5% trifluoroacetic acid aqueous solution, Phase B: acetonitrile; Flow rate: 25 mL / min; Column temperature: room temperature; Liquid chromatography method: 100% Phase A to 0% Phase A, gradient run for 30 min) to prepare compound L5-2 (51.00 g, 91.45% yield, 90.00% purity). LCMS (E+) m / z: 852.3 [M+H] + .

[0676] Step 2. Synthesis of compound L5-3

[0677] Intermediate L5-2 (50.00 g, 58.68 mmol) was added to a 1000 mL single-necked flask, followed by the sequential addition of dichloromethane (250 mL) and trifluoroacetic acid (250 mL). After the additions were complete, the mixture was stirred at room temperature for 2.5 hours, and the reaction was monitored by LC-MS. After the reaction was complete, the mixture was concentrated to obtain crude compound L5-3 (45.00 g). LCMS (E+) m / z: 628.0 [M+H] + .

[0678] Step 3. Synthesis of compound L5-4

[0679] Compound L5-3 (20.00 g, 31.87 mmol), N,N-diisopropylethylamine (41.19 g, 318.68 mmol), 2-(7-azobenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (60.55 g, 159.34 mmol), and DMF (320 mL) were added to a 1000 mL single-necked flask. After stirring at room temperature for 10 minutes, compound L5-b (22.81 g, 159.34 mmol) was added. After the addition was complete, the mixture was allowed to react at room temperature for 2 hours until the starting material was completely detected by LC-MS. Compound L5-4 (22.30 g, 62.02% yield) was prepared by direct MPLC (Column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A is 0.5% trifluoroacetic acid aqueous solution, phase B is acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; liquid chromatography method: gradient run from 100% phase A to 0% phase A for 30 min). LCMS (E+) m / z: 1128.4 [M+H] + .

[0680] Step 4. Synthesis of compound L5-c

[0681] Intermediate L5-c-1 (52.00 g, 276.27 mmol) was added to a 250 mL single-necked flask, followed by acetic anhydride (104 mL). After the addition was complete, the mixture was refluxed at 145 °C with stirring for 2.5 hours. After the reaction was complete, the mixture was concentrated and washed several times with petroleum ether to obtain compound L5-c (46.00 g, 91.07% yield, 93.10% purity).

[0682] Step 5. Synthesis of compound L5

[0683] Compound L5-4 (27.3 g, 24.20 mmol) was added to a 1000 mL reaction flask and dissolved in DMF (286 mL). Then, triethylamine (143 mL) and L5-c (12.36 mg, 72.59 mmol) were added. After addition, the mixture was stirred at 45°C for 16 hours, and monitored by LC-MS. After the reaction was complete, the reaction solution was directly prepared by MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A: 0.5% trifluoroacetic acid aqueous solution, phase B: acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; liquid chromatography method: gradient run from 100% phase A to 0% phase A for 30 min) to obtain compound L5 (7.22 g, 27.73% yield). LCMS (E+) m / z: 1076.2 [M+H] + .

[0684] 1 H NMR (600MHz, Methanol-d4) δ4.38–4.33(m,2H),4.21(t,J=2.1Hz,8H),4.08(dd,J=10.0,5.8Hz,1H),3.73–3.62(m,16H),3.61–3.43(m,10 H),3.41–3.34(m,6H),2.89–2.87(m,4H),2.44–2.20(m,10H),2.18–2.02(m,3H),2.00–1.87(m,3H),1.64–1.59(m,4H),1.41–1.29(m,6H).

[0685] 1-5.2 Synthesis of Conjugate Intermediate 3

[0686] The positive chain of the oligonucleotide amino compound (conjugate 3-SS)-C6-NH2 was dissolved in sodium borate buffer (250 mM sodium borate, pH = 9.4) to prepare a 4 mM solution (100 μL, 400 nmol). A mixed solution of linker L5 (10 μL, 2000 nmol, 5 equivalents, 200 mM DMA solution), HATU (5 μL, 2000 nmol, 5 equivalents, 400 mM DMA solution), and DIPEA (5 μL, 2000 nmol, 5 equivalents, 400 mM DMA solution) was added to the solution and mixed thoroughly. The reaction solution was then placed at 25 degrees Celsius and reacted for 0.5 hours.

[0687] After the reaction was complete, ethanol precipitation was performed: 10% of the total volume of 5M sodium chloride solution was added to the solution, followed by 3 times the total volume of anhydrous ethanol. After shaking and mixing, the reaction was placed in dry ice and frozen for 2 hours. Then, it was centrifuged at 12000 rpm for half an hour. The supernatant was discarded, and the remaining precipitate was dissolved in deionized water to obtain the conjugate intermediate 3 solution. LC-MS confirmed that the reaction conversion rate was 80%.

[0688] Synthesis of Conjugate 3 (1-5.3)

[0689] Conjugate intermediate 3 was dissolved in sodium bicarbonate buffer (250 mM sodium bicarbonate, pH = 8.5) to prepare a 1 mM solution (100 μL, 100 nmol). Target 7A (30 μL, 3000 nmol, 30 equivalents, 100 mM DMA solution), copper sulfate (10 μL, 1000 nmol, 10 equivalents, 100 mM aqueous solution), and sodium ascorbate (10 μL, 10000 nmol, 100 equivalents, 1000 mM aqueous solution) were added to the solution and mixed thoroughly. The reaction mixture was then placed at 60 degrees Celsius and reacted for 15 minutes.

[0690] After the reaction was complete, ethanol precipitation was performed: 10% of the total volume of 5M sodium chloride solution was added to the solution, followed by 3 times the total volume of anhydrous ethanol. After shaking and homogenization, the reaction mixture was placed in dry ice for 2 hours, then centrifuged at 12000 rpm for half an hour. The supernatant was discarded, and the remaining precipitate was dissolved in deionized water. The resulting solution was confirmed by LCMS to have a reaction conversion rate of 85%. The purified product was obtained by reversed-phase chromatography (column type: Waters Xbridge BEH RP18; specifications: particle size 5μm, 150*10mm; mobile phase: phase A was 400mM hexafluoroisopropanol aqueous solution, phase B was methanol; flow rate: 9mL / min; column temperature: room temperature; preparation method: phase A + phase B mixed elution, 54%-47% phase A gradient run for 35min) to obtain pure product. After freeze-drying and quality inspection, the salt was replaced by sodium acetate alcohol precipitation, and then desalted using a 3KD ultrafiltration tube. After desalting, the molar amount of the sense chain was quantitatively determined by spectrophotometer. The sense and antisense chains were mixed in a 1:1 ratio and annealed to obtain the target double chain of conjugate 3.

[0691] Examples 1-6: Preparation of conjugates 4, 5, and 6

[0692] 1-6.1 Synthesis of TA14 linkers

[0693] Step 1. Synthesis of compound TA14-2

[0694] Fmoc-Cl (18.68 g, 72.19 mmol) and sodium bicarbonate (7.58 g, 90.24 mmol) were added to an aqueous solution (300 mL) of compound TA14-1 (25 g, 60.16 mmol), and the mixture was stirred at room temperature for 60 minutes until the starting material was completely eliminated by LC-MS. The reaction solution was then directly subjected to MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A was 0.5% trifluoroacetic acid aqueous solution, phase B was acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; HPLC method: gradient run from 100% phase A to 0% phase A for 30 min) to prepare compound TA14-2 (30 g, 47.04 mmol, 78.19% yield). LCMS (E+) m / z: 638.5 [M+H] + .

[0695] Step 2. Synthesis of compound TA14-3

[0696] To a dichloromethane solution (300 mL) of compound TA14-2 (30 g, 47.04 mmol), trifluoroacetic acid (300 mL) was added, and the mixture was stirred at room temperature for 10 minutes until the starting material was completely eliminated by LC-MS. The reaction solution was then directly subjected to MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A was 0.5% trifluoroacetic acid aqueous solution, phase B was acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; HPLC method: gradient run from 100% phase A to 0% phase A for 30 min) to prepare compound TA14-3 (28.5 g, 46.40 mmol, 98.65% yield, 95% purity, TF). LCMS (E+) m / z: 470.3 [M+H] + .

[0697] Step 3. Synthesis of compound TA14-4

[0698] To a DMF solution (300 mL) of compound TA14-3 (28.5 g, 46.40 mmol, 95% purity, TF), 2-[2-(propynyloxy)ethoxy]ethylamine (23.25 g, 162.40 mmol), HATU (61.75 g, 162.40 mmol), and DIPEA (23.99 g, 185.60 mmol, 32.33 mL) were added and stirred at room temperature for 2 hours until the starting material was completely eliminated as detected by LC-MS. The reaction solution was directly prepared by MPLC (Column type: Flash spherical C18 column; Specifications: particle size 20-35 μm, packing weight 40 g; Mobile phase: Phase A: 0.5% trifluoroacetic acid aqueous solution, Phase B: acetonitrile; Flow rate: 25 mL / min; Column temperature: room temperature; Liquid chromatography method: 100% Phase A to 0% Phase A, gradient run for 30 min) to obtain compound TA14-4 (30 g, 35.50 mmol, 76.52% yield). LCMS (E+) m / z: 845.5 [M+H] + .

[0699] Step 4. Synthesis of compound TA14

[0700] Glutaric anhydride (10.13 g, 88.76 mmol) and DIPEA (91.77 g, 710.07 mmol, 123.68 mL) were added to a DMF solution (300 mL) of compound TA14-4 (30 g, 35.50 mmol). The mixture was stirred at 45°C for 20 hours until the starting material was completely eliminated by LC-MS. The reaction solution was then directly subjected to MPLC (column type: Flash spherical C18 column; specifications: particle size 20-35 μm, packing weight 40 g; mobile phase: phase A was 0.5% trifluoroacetic acid aqueous solution, phase B was acetonitrile; flow rate: 25 mL / min; column temperature: room temperature; HPLC method: gradient run from 100% phase A to 0% phase A for 30 min) to prepare TA14 (5.1 g, 6.92 mmol, 19.49% yield). LCMS (E+) m / z: 737.7 [M+H] + .

[0701] Synthesis of conjugate intermediates 1-6.2, 5, and 6

[0702] The positive chain of the oligonucleotide amino compound (conjugate 4-SS)-C6-NH2 (or (conjugate 5-SS)-C6-NH2 or (conjugate 6-SS)-C6-NH2) was dissolved in sodium borate buffer (250 mM sodium borate, pH = 9.4) to prepare a 4 mM solution (100 μL, 400 nmol). A mixed solution of fragment TA14 (10 μL, 2000 nmol, 5 equivalents, 200 mM DMA solution), HATU (5 μL, 2000 nmol, 5 equivalents, 400 mM DMA solution), and DIPEA (5 μL, 2000 nmol, 5 equivalents, 400 mM DMA solution) was added to the solution and mixed thoroughly. The reaction solution was then placed at 25 degrees Celsius and reacted for 0.5 hours.

[0703] After the reaction was complete, ethanol precipitation was performed: 10% of the total volume of 5M sodium chloride solution was added to the solution, followed by 3 times the total volume of anhydrous ethanol. After shaking and mixing, the reaction was placed in dry ice and frozen for 2 hours. Then, it was centrifuged at 12,000 rpm for half an hour. The supernatant was discarded, and the remaining precipitate was dissolved in deionized water to obtain a solution of conjugate intermediate 4 (or conjugate intermediate 5 or conjugate intermediate 6). LC-MS confirmed that the reaction conversion rate was 90%.

[0704] Synthesis of conjugates 1-6.3, conjugates 4, 5, and 6

[0705] Dissolve conjugate intermediate 4 (or conjugate intermediate 5 or conjugate intermediate 6) in sodium bicarbonate buffer (250 mM sodium bicarbonate, pH = 8.5) to prepare a 1 mM solution (100 μL, 100 nmol). Add 7A (30 μL, 3000 nmol, 30 equivalents, 100 mM DMA solution), copper sulfate (10 μL, 1000 nmol, 10 equivalents, 100 mM aqueous solution), and sodium ascorbate (10 μL, 10000 nmol, 100 equivalents, 1000 mM aqueous solution) to the solution, mix well, and then place the reaction solution at 60 degrees Celsius for 15 minutes.

[0706] After the reaction was complete, ethanol precipitation was performed: 10% of the total volume of 5M sodium chloride solution was added to the solution, followed by 3 times the total volume of anhydrous ethanol. After shaking and homogenization, the reaction mixture was placed in dry ice for 2 hours, then centrifuged at 12000 rpm for half an hour. The supernatant was discarded, and the remaining precipitate was dissolved in deionized water. The resulting solution was confirmed by LCMS to have a reaction conversion rate of 80%. After purification by reversed-phase chromatography (column type: Waters Xbridge BEH RP18; specifications: particle size 5μm, 150*10mm; mobile phase: phase A is 400mM hexafluoroisopropanol aqueous solution, phase B is methanol; flow rate: 9mL / min; column temperature: room temperature; preparation method: phase A + phase B mixed elution, 54%-47% phase A gradient run for 35min), the pure product was obtained. After freeze-drying and quality inspection, the salt was replaced by sodium acetate alcohol precipitation, and then desalted using a 3KD ultrafiltration tube. After desalting, the molar amount of the sense chain was quantitatively determined by spectrophotometer. The sense and antisense chains were mixed in a 1:1 ratio and annealed to obtain conjugate 4 (or conjugate 5 or conjugate 6) double chain.

[0707] Example 2: In vitro activity assay of double strands

[0708] 2.1 Cell Culture and Transfection

[0709] 2.1.1 A549 Cell Culture: A549 cells (ATCC No: CCL-185) were cultured at 37°C and 5% CO2 in F-12K complete medium (Gibco, supplemented with 10% FBS) until near confluence. Cells were then trypsinized and seeded into 96-well plates, with 8000 A549 cells and 0.1 mL of F-12K medium (Gibco, supplemented with 10% FBS) added to each well for 24 h. After transfection with siRNA using Lipofectamine 2000 or Lipofectamine RNAiMAX (Thermo Fisher), cells were cultured at 37°C and 5% CO2 for another 24 h, followed by RNA extraction. Single-dose experiments were performed at double-strand concentrations of 10 nM, 1.0 nM, 0.3 nM, 0.1 nM, 0.03 nM, and 0.01 nM (two or three concentrations were selected for assay).

[0710] 2.1.2 HCC-78 Cell Culture: HCC-78 cells (Beina Biotechnology) were cultured at 37℃ and 5% CO2 in RPMI 1640 complete medium (Gibco, with 10% FBS added) until near confluence. Then, the cells were digested with trypsin and seeded into plates. 8000 HCC-78 cells and 0.1 mL of RPMI 1640 complete medium were added to each well of a 96-well plate. After siRNA transfection with Lipofectamine RNAiMAX (Thermo Fisher), the cells were cultured for another 24 h at 37℃ and 5% CO2, followed by RNA extraction.

[0711] 2.2 RNA Extraction

[0712] Use an RNA extraction kit (Yeasen, Cat: 18600ES50) and follow the instructions. Finally, add 170 μL of RNase-free water to collect the RNA.

[0713] 2.3 Real-time quantitative PCR

[0714] One-step RT-qPCR was performed using the Yeasen One-Step RT-qPCR Kit (Cat: 11143ES80) following the manufacturer's instructions. The ΔΔCt assay was performed using ABI QuantStudio. TM 6. Perform real-time fluorescence PCR in a real-time fluorescence PCR system. The specific steps are as follows:

[0715] (1) Calculate the ΔCt value: ΔCt(test group) = Ct(target gene in test group) - Ct(internal reference gene in test group); ΔCt(control group) = Ct(target gene in control group) - Ct(internal reference gene in control group).

[0716] (2) Calculate the ΔΔCt value: ΔΔCt(test group) = ΔCt(test group) - ΔCt(control group average); ΔΔCt(control group) = ΔCt(control group) - ΔCt(control group average);

[0717] In this study, each test group consisted of A549 cells or HCC-78 cells treated with siRNA, while the control group consisted of A549 cells or HCC-78 cells not treated with siRNA. ΔCt (control group mean) is the arithmetic mean of the ΔCt (control group) values ​​of the two wells in the control group. Therefore, each well in both the test and control groups corresponds to a ΔCt value.

[0718] (3) Using the control group as a baseline, the expression level of MMP7 mRNA in the test group was normalized. The expression level of MMP7 mRNA in the control group was defined as 1, and the relative expression level of MMP7 mRNA in the test group was 2^(-ΔΔCt(test group)).

[0719] (4) The inhibition rate of siRNA on MMP7 mRNA expression was calculated by the following equation: Inhibition rate = (1 - relative expression level of MMP7 mRNA in the test group) × 100%.

[0720] The qPCR primer sequences (5'-3') targeting hGAPDH, hMMP7, hα-SMA, hCOL1-A, and hCTGF are shown below:

[0721] hGAPDH-F: GTCTCCTCTGACTTCAACAGCG (SEQ ID NO: 299); hGAPDH-R: ACCACCCTGTTGCTGTAGCCAA (SEQ ID NO: 300);

[0722] hMMP7-F:AACAGGCTCAGGACTATCTCAAGAG (SEQ ID NO:301); hMMP7-R:GCGGGAGTTTAACATTCCAGTT (SEQ ID NO:302);

[0723] hα-SMA-F: CAGGGCTGTTTTCCCATCCAT (SEQ ID NO: 303); hα-SMA-R: GCCATGTTCTATCGGGTACTTC (SEQ ID NO: 304);

[0724] hCOL1-AF: GATTCCCTGGACCTAAAGGTGC (SEQ ID NO: 305); hCOL1-AR: AGCCTCTCCATCTTTGCCAGCA (SEQ ID NO: 306);

[0725] hCTGF-F: TGGAAGAGAACATTAAGAAGGGCA (SEQ ID NO: 307); hCTGF-R: TGCAGCCAGAAAGCTCAAAC (SEQ ID NO: 308).

[0726] Each double-stranded monoclonal antibody was subjected to three independent transfection tests, with three copies of each transfection assay performed.

[0727] The results of the in vitro activity assays of the duplexes are shown in Table 5. The results show that, in A549 cells, exemplary duplexes 1 to 11 all exhibited good inhibitory activity against MMP7 mRNA expression.

[0728] Table 5: Results of single-dose assay of double strands in A549 cells

[0729] 2.4 Detection of IC50 and KDmax of double-stranded molecules in A549 and HCC-78 cells

[0730] The culture and transfection conditions for A549 and HCC-78 cells (Beina Biotechnology) were the same as in 2.1. IC50 was then performed. 50 In the detection experiments, siRNA was used at double-stranded concentrations of 10 nM, 0.1 nM, 0.01 nM, 0.0025 nM, 0.001 nM, 0.0004 nM, 0.0001 nM, and 0.000001 nM. RNA was extracted 24 hours after transfection using the same method as in 2.2. The inhibitory activity of the double-stranded RNA at each concentration was detected by real-time quantitative PCR, using the same method as in 2.3. Dose-response curves were plotted and IC50 was calculated using GraphPad Prism software. 50 The highest knockdown rate obtained at the above concentration points is the KDmax value of this duplex.

[0731] Double-stranded IC50 in A549 and HCC-78 cells 50 The KDmax test results are shown in Tables 6 and 7, respectively. As can be seen from Table 6, the IC50 values ​​of the seven exemplary duplexes in A549 cells... 50 All values ​​were less than 10 pM, and all KDmax values ​​were above 90%. Meanwhile, as shown in Table 7, the IC50 values ​​of the four exemplary duplexes on HCC-78 cells were... 50 It is also less than 10pM, and KDmax is above 95%.

[0732] Table 6: IC50 of double-stranded proteins in A549 cells 50 and KDmax test results

[0733] Table 7: IC50 of double-stranded proteins in HCC-78 cells 50 and KDmax test results

[0734] Example 3: Activity assay of chemically modified double strands in A549 and HCC-78 cells

[0735] 3.1 Single-dose assay of chemically modified duplexes in A549 cells

[0736] The method for detecting the activity of chemically modified double strands in A549 cells is the same as in 2.1 to 2.3.

[0737] The results of single-dose assays with modified duplexes in A549 cells are shown in Table 8. The results show that the modified duplexes effectively knocked down MMP7 expression.

[0738] Table 8: Single-dose assay results of modified duplexes in A549 cells

[0739] 3.2 Single-dose assay of MOE and / or iab chemically modified duplexes in A549 cells

[0740] Table 9 shows a comparison of the single-dose activity of the MOE and / or iab-modified duplexes in A549 cells. The results showed that the MOE and / or iab-modified duplexes exhibited enhanced inhibitory activity against MMP7 mRNA expression in A549 cells.

[0741] Table 9: Single-dose assay results of MOE and / or iab-modified duplexes in A549 cells before and after modification.

[0742] 3.3 IC50 of chemically modified duplexes in A549 and HCC-78 cells 50 Detection

[0743] Chemically modified double strands showed IC50 in A549 and HCC-78 cells. 50 The detection method is the same as in Example 2.4.

[0744] Modified double strands on IC50 in A549 and HCC-78 cells 50 The test results are shown in Tables 10 and 11, respectively. The results show that the modified duplex has good inhibitory activity on the MMP7 mRNA level in both cell types and can effectively knock down the MMP7 gene.

[0745] Table 10: IC50 of modified double strands in A549 cells 50 Test Results

[0746] Table 11: IC50 of double-stranded modified cells in HCC-78 cells 50 Test Results

[0747] Example 4: Detection of knockdown activity of chemically modified duplexes on MMP7 protein levels

[0748] 4.1 Single-dose testing of chemically modified duplexes in A549 and HCC-78 cells

[0749] To detect the knockdown activity of the modified double-stranded monoclonal antibody on MMP7 protein levels, the modified double-stranded monoclonal antibody was transfected into A549 and HCC-78 cells, respectively. The cell culture and transfection procedures were the same as in Example 2. The medium was changed 24 h after transfection, and the supernatant was collected 48 h after the medium change. The content of MMP7 protein in the supernatant was detected by ELISA (Wuhan Yunclone Reagent Kit, SEA102Hu).

[0750] The results of the MMP-7 protein knockdown assay using modified duplexes in A549 and HCC-78 cells are shown in Tables 12 and 13, respectively.

[0751] The results showed that the modified duplexes could effectively knock down the expression of MMP7 protein in cells.

[0752] Table 12: Results of MMP-7 protein knockdown assay using modified duplexes in A549 cells

[0753] Table 13: Results of MMP-7 protein knockdown assay using modified duplexes in HCC-78 cells

[0754] 4.2 IC50 of chemically modified duplexes in A549 and HCC-78 cells 50 Detection

[0755] The culture and transfection conditions for A549 and HCC-78 cells (Beina Biotechnology) were the same as in 2.1. IC50 was then performed. 50 In the detection experiments, the chemically modified double-stranded protein was used at concentrations of 10 nM, 0.1 nM, 0.01 nM, 0.0025 nM, 0.001 nM, 0.0004 nM, 0.0001 nM, and 0.000001 nM. The medium was changed 24 h after transfection, and the supernatant was collected 48 h after the medium change. The MMP7 protein content in the supernatant was detected by ELISA (Wuhan Yunclone Kit, SEA102Hu). Dose-response curves were plotted and IC50 was calculated using GraphPad Prism software. 50 value.

[0756] Modified double strands on IC50 in A549 and HCC-78 cells 50 The test results are shown in Tables 14, 15, and 16, respectively. The results show that the modified duplex has good inhibitory activity on the MMP7 protein level in both cell types and can effectively reduce MMP7 protein expression.

[0757] Table 14: IC50 of modified double strands in A549 cells50 Test Results

[0758] Table 15: IC50 of double-stranded modified cells in HCC-78 cells 50 Test Results

[0759] Table 16: IC50 of double-stranded modified cells in HCC-78 cells 50 Test Results

[0760] Example 5: In vitro stability test of chemically modified double strands

[0761] To assess the stability of the modified double-stranded mice and simulate the in vivo environment as closely as possible, mouse lung homogenate was incubated with the modified double-stranded mice. Stability was determined by changes in purity before and after incubation. The specific protocol was as follows: siRNA was added to 12.5 mg / mL of mouse lung homogenate solution, resulting in a final siRNA concentration of 1 μM and a total volume of 50 μL. Three replicates were used for each group as the 72-hour stability sample. A separate group of mouse lung homogenate solution without siRNA was used as the 0-hour sample. Both groups were incubated at 37°C for 72 hours. After incubation, 150 μL of loading buffer was added to the 72-hour stability sample to terminate the reaction. Similarly, 150 μL of loading buffer was added to the 0-hour stability sample before adding siRNA, with the siRNA addition amount being the same as the 72-hour sample group. After thorough mixing, 50 μL of 100 nM internal standard siRNA (sequence reference AD-65695 in patent CN107743522B) was added to all samples. The samples were purified using a Clarity OTX SPE column (Phenomenex, 8E-S103-CGA). Finally, the responses of the positive and negative strands in each group of samples were detected by LC-MS (Waters Aeguity I CLASS UPLC, Thermo Scientific DNAPac™ MRP, 50*2.1 mm, 4.0 pm*, ESI-). The residual amount was determined by comparing the proportion of responses at 48 h, 72 h, and 0 h. The positive control PC34 is the sequence AD09887 from patent WO2023070082, with the TriAlk14 linker removed.

[0762] The stability results of the sense and antisense strands of the modified doublet in lung homogenate are shown in Table 17. The results show that both the sense and antisense strands of the modified doublet have excellent stability in lung homogenate, which is superior to the positive control PC34.

[0763] Table 17: Stability test results of modified double-stranded lung homogenate

[0764] Example 6: Cytotoxicity Detection Experiment

[0765] To detect the cytotoxicity of the modified double-stranded RNA, the modified double-stranded RNA was transfected into A549 cells. The cell culture and transfection procedures were the same as in Example 2, and the final concentrations of siRNA were 20 nM and 1 nM. Cell viability was detected 48 h after transfection using a CTG kit (Promega G7572).

[0766] The results are shown in Table 18. A549 cells transfected with different concentrations of modified duplexes showed very high cell viability and no obvious cytotoxicity.

[0767] Table 18: CTG assay for cytotoxicity of A549 cells transfected with modified double strands

[0768] Example 7: In vitro fibrosis activity detection experiment

[0769] During fibrosis, type I collagen (collagen1) increases rapidly. To detect the anti-fibrotic activity of the modified duplex, this study used the pro-fibrotic factor TGF-β1 to stimulate different cells and examined the inhibitory effect of the modified duplex on collagen1A mRNA levels. The specific method is as follows:

[0770] 7.1 TGF-β1-induced fibrosis in A549 cells

[0771] A549 cells were cultured under the same conditions as in Example 2, cultured until near confluence, digested with trypsin (HyClone, SH30042.02), and then seeded into plates. 1×10⁻⁶ cells were added to each well of a 24-well plate. 5 One cell and 0.5 mL of culture medium were added; after overnight culture, the medium was replaced with serum-free medium. The sample group was transfected with 2 nM modified double strands using Lipofectamine 2000 or Lipofectamine RNAiMAX (Thermo Fisher). The blank control group and the TGF-β1-only treatment group did not contain modified double strands. After 24 h, TGF-β1 was added to the sample group and the TGF-β1-only treatment group at a final concentration of 10 ng / mL, while the blank control group was added with the corresponding volume of serum-free medium. After culturing for another 2 days, RNA was extracted, and the mRNA levels of MMP7 and collagen1A were detected by real-time quantitative PCR. The RNA extraction and real-time quantitative PCR methods were the same as in Example 2.

[0772] 7.2 Primary type II alveolar epithelial cells

[0773] Primary type II alveolar epithelial cells (purchased from Cyprok) were cultured at 37°C and 5% CO2 in epithelial cell culture medium (purchased from Cyprok, supplemented with 10% FBS and 1% penicillin-streptomycin (10,000 U / mL)) until near confluence. After trypsin digestion, the cells were seeded into plates, with 6 × 10⁶ cells per well in a 24-well plate. 4 One cell and 0.5 mL of culture medium; cell transfection, stimulation and detection methods are the same as in Example 7.1.

[0774] The relative levels of collagen 1A mRNA after transfection of modified duplexes into A549 cells and primary type II alveolar epithelial cells are shown in Table 19. The results indicate that the modified duplexes downregulated TGF-β1-induced collagen 1A mRNA expression.

[0775] Table 19: Relative expression levels of Collagen 1A mRNA in fibrosis experiments

[0776] 7.3 LL97A cells / A549 cells co-culture

[0777] LL97A cells (purchased from MeisenCTCC, CTCC-001-0332) were seeded in 24-well plates with LL97A complete cell culture medium (purchased from MeisenCTCC, CTCC-001-0332-1-CM) supplemented with 15% FBS and 1% penicillin-streptomycin (10,000 U / mL) at a density of 1.2E5 / mL. A549 cells were seeded in Transwell chambers with MEM complete cell culture medium (purchased from ThermoFisher, 41090036) supplemented with 10% FBS and 1% penicillin-streptomycin (10,000 U / mL) at a density of 0.8E5 / mL. After overnight culture, the medium was replaced with serum-free medium. Sample groups were cultured using Lipofectamine 2000 or Lipofectamine RNAiMAX (ThermoFisher). Fisher transfected cells with a final concentration of 2 nM of modified double-stranded protein. The blank control group and the TGF-β1-only treatment group did not contain modified double-stranded protein. After 72 h, the culture medium in the chamber was discarded. The sample groups and the TGF-β1-only treatment group were treated with TGF-β1 at a final concentration of 10 ng / mL, while the blank control group was treated with the corresponding volume of serum-free culture medium. On day 5, RNA was extracted, and the mRNA levels of MMP7, α-SMA, collagen1A, and CTGF in LL97A cells were detected by real-time quantitative PCR. The RNA extraction and real-time quantitative PCR methods were the same as in Example 2.

[0778] Figure 1 shows the relative levels of α-SMA, collagen1A, and CTGF mRNA after transfection with the modified duplex in an LL97A / A549 cell co-culture system. The results indicate that the modified duplex downregulated TGF-β1-induced α-SMA, collagen1A, and CTGF mRNA expression.

[0779] Example 8: Off-target test of modified bistrand

[0780] siRNA may bind to non-target genes, leading to their silencing—a phenomenon known as siRNA off-target effect. To verify whether modified duplexes exhibit off-target effects, RNA-seq and bioinformatics predictions were used to analyze each modified duplex, and quantitative real-time PCR was performed to verify genes at risk of off-target effects for each modified duplex. The specific methods are as follows:

[0781] To analyze the knockdown levels of genes with a high risk of off-target effects from double-stranded modifications, IC50 was performed on genes modified with double-stranded modifications. 50 And KDmax detection.

[0782] The A549 cell culture, transfection, RNA extraction, and quantitative PCR methods were the same as in Example 2. Off-target gene IC50 was then performed. 50 In the detection experiments, siRNA was used at double-stranded concentrations of 10 nM, 0.1 nM, 0.01 nM, 0.0025 nM, 0.001 nM, 0.0004 nM, 0.0001 nM, and 0.000001 nM. Dose-response curves were plotted and IC50 values ​​were calculated using GraphPad Prism software. Data analysis was performed using GraphPad Prism software to calculate the absolute IC50. 50 (Top = 100, Bottom = 0). Off-target risk: Fold = Absolute IC 50 (Risk Genes) / Absolute IC 50 (MMP-7).

[0783] Off-target IC50 in A549 cells modified with double strands 50 The test results are shown in Table 20. The results show that the IC50 of each modified duplex potential off-target gene is... 50 The IC50 ratios of each modified duplex to the MMP-7 gene were all above 50-fold, indicating that the knockdown activity of each modified duplex to off-target genes was significantly weaker than that of MMP-7.

[0784] Table 20: IC50 of off-target genes modified with duplexes in A549 cells 50 Test Results

[0785] Example 9: Detection of knockdown activity of the conjugate in humanized MMP7 mice

[0786] In vivo administration: Humanized MMP7 homozygous female mice (purchased from Biocytogen) containing the full-length human MMP7 gene (CDS+UTR). In in vivo experiments, four mice (female or male) aged 6-8 weeks were used in each group. After one week of acclimatization in an SPF environment, the conjugate was administered. Administration method: Intratracheal administration via nebulizer; dosage 3 mg / kg. The conjugate was dissolved in physiological saline at a volume of 50 μL. The saline group contained only 50 μL of physiological saline and did not contain the conjugate. PC34-MD2-TA14-SM6.1 was used as a positive control molecule (prepared according to molecule AC001651 in patent WO2023070082). Fifteen days after administration, mice were anesthetized and sacrificed, and lung tissue was collected to detect MMP7 mRNA expression levels.

[0787] RNA expression detection: After lung tissue was extracted, it was incubated overnight at 4°C with tissue preservation solution, and then stored at -80°C for long-term preservation. The tissue preservation solution was discarded, and the prepared tissue lysis buffer was added according to the TaKaRa Mini BEST Universal RNA Extraction Kit (Takara: 9767) instructions. Magnetic beads were then added, and the tissue was homogenized using a tissue homogenizer. After homogenization, subsequent RNA extraction steps were performed according to the instructions. The extracted RNA was reverse transcribed using the Takara Reverse Transcription Kit (RR036A), and the resulting cDNA was used... Amplification was performed using a Green kit (Aikerui, AG11718) to detect the expression level of the target gene. GAPDH was used as an internal control, and the ΔΔCt assay was performed in ABI QuantStudio. TM Real-time fluorescence PCR was performed using a 6-well real-time fluorescence PCR system. Two to three replicates were prepared for each mouse lung tissue sample.

[0788] The results are shown in Table 21. All siRNA conjugates targeting MMP7 could downregulate the expression of MMP7 mRNA in vivo.

[0789] Table 21: Expression level of MMP7 mRNA in lung tissue of homozygous mice 15 days after nebulized airway administration

[0790] Example 10: Detection of long-term in vivo knockdown activity of the conjugate in humanized MMP7 mice

[0791] The dosing regimen was as described in Example 9, with a dosage of 3 mg / kg. Mice were anesthetized and sacrificed at 48 h, 14 d, 28 d, and 56 d after administration, and lung tissue was collected to detect the mRNA expression level of MMP7. The Yangshen molecule PC34-MD2-TA14-SM6.1 was prepared according to molecule AC001651 in patent WO2023070082.

[0792] mRNA expression detection was performed according to Example 9, and the results are shown in Table 22. The siRNA conjugate targeting MMP7 downregulated MMP7 mRNA expression in vivo for 48 hours and maintained this downregulation for 56 days.

[0793] Table 22: Detection of long-term in vivo knockdown activity of the conjugate in humanized MMP7 mice

[0794] Although specific embodiments of the invention have been described in detail, those skilled in the art will understand that various modifications and variations can be made to the details based on all the published teachings, and all such changes are within the scope of protection of the invention. The entire scope of the invention is given by the appended claims and any equivalents thereof.

Claims

1. A small interfering RNA (siRNA) comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand are at least partially complementary, wherein, The antisense strand contains a modification pattern selected from any of the following: 1) AS(5’-3’): VPmNsfNsmNmNmNmNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 213); 2) AS(5’-3’): VPmNsfNmNmNmNmNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 214); 3) AS(5’-3’): VPmNsfNmNmNmNfNmNmNmNmNmNmNmNfNmNfNmNmNmNfNmNsmNsmN (SEQ ID NO: 215); 4) AS(5’-3’): VPmNsfNmNmNmN(GNA-N)mNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 216); 5) AS(5’-3’): VPmNsfNmNmNmNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 217); 6) AS(5’-3’): VPmNsfNmN(MOE-N)mNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 218); 7) AS(5’-3’): mNsfNsmNmNmNfNmNfNfNfNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 219); 8) AS(5’-3’): mNsfNsmNmNmNmNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 220); 9) AS(5’-3’): VPmNsfNsmNmNmNmN(GNA-N)fNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 221); 10) AS(5’-3’): VPmNsfNsmNmNmNmN(UNA-N)fNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 222); 11) AS(5’-3’): VPmNsfNsmNmNmNmNfmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 223); 12) AS(5’-3’): VPmNfNmNmNmNmN(GNA-N)fNfNmNmNmNmNfNmNfNmNmNmNmNmNmNsmN (SEQ ID NO: 224); 13)AS(5'-3'):VPmNsfNsmN(dI)mNmNmNfNfNmNmNmNmNmNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:225); 14)AS(5'-3'):VPmNsfNsmNmN(dI)mNmNfNfNmNmNmNmNmNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:226); 15)AS(5'-3'):VPmNsfNsmNmNmN(dI)mNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO: 227); 16)AS(5'-3'):VPmNsfNsmNmNmNmN(dI)fNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO: 228); 17)AS(5'-3'):VPmNsfNsmNmNmNmNmN(dI)fNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO: 229); 18)AS(5'-3'):VPmNsfNmN(dI)mNmNmNfNfNmNmNmNmNmNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:230); 19)AS(5'-3'):VPmNsfNmN(dI)mNmNmN(MOE-N)fNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN(SEQ ID NO:231); 20)AS(5'-3'):VPmNsfNmN(MOE-N)mNmNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmNsmN(SEQ ID NO: 232); 21)AS(5'-3'):VPmNsfNmNmNmNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNsmNsmNsmN(SEQ ID NO:233); 22)AS(5'-3'):mNsfNsmNmNmNfNmNfNfNmNfNmNfNmNfNmNfNmNmNmNmNsmNsmN(SEQ ID NO: 234); 23)AS(5'-3'):mNsfNsmNmNmNmNmNmNfNmNmNfNmNfNmNmNmNmNmNmNmNsmNsmN(SEQ ID NO:235); 24)AS(5'-3'):VPmNsfNsmNmNmNfNmNfNfNmNmNfNmNfNmNmNmNmNmNmNmNsmNsmN(SEQ ID NO:236); 25)AS(5'-3'):VPmNsfNsmNmNmNmNmNmNmNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 237); 26)AS(5'-3'):VPmNsfNsmNmNmNfNmNfNfNfNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 238); 27)AS(5'-3'):VPmNsfNsmNmNmNmNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNmNsmN (SEQ ID NO: 239); 28)AS(5'-3'):VPmNsfNsmN(dI)mNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 240); 29)AS(5'-3'):VPmNsfNsmNmN(dI)fNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 241); 30)AS(5'-3'):VPmNsfNsmNmNmNfN(dI)fNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 242); 31)AS(5'-3'):VPmNsfNmNmNmNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNmNsmN (SEQ ID NO: 269); 32)AS(5'-3'):VPmNfNmNmNmNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 270); 33)AS(5'-3'):VPmNsfNmN(MOE-N)mNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNsmNsmN (SEQ ID NO: 290); 34)AS(5'-3'):VPmNsfNmN(MOE-N)mNfNmNfNfNmNmNfNmNfNmNfNmNmNmNsmNsmN (SEQ ID NO: 291); Wherein, mN is a methoxy-modified nucleotide, fN is a fluorinated nucleotide, fmN is a methoxy and fluorinated nucleotide, VP is (E)-vinylphosphonate modified, s is a thiophosphate ester linked, (dI) is a deoxyinosine nucleotide, (MOE-N) is a 2'-O-methoxyethyl modified nucleotide; (GNA-N) is a glycerol nucleotide; and (UNA-N) is an unlocking nucleotide. And / or, The sense strand of the siRNA contains a modification pattern selected from any of the following: 1)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNmNmNmNmNmNfNmNmNmNsmN(SEQ ID NO: 243); 2)SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNfNmNmNsmN(SEQ ID NO: 244); 3)SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNsmN(SEQ ID NO:245); 4)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNmNmNfNmNfNmNfNmNmNmNsmN(SEQ ID NO: 246); 5)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNfNmNmNmNmNfNmNmNsmNsmNsmN(SEQ ID NO: 247); 6)SS(5'-3'):mNsmNmNmNmNmNmNmNfNfNfNmNmNmNmNmNfNmNmNmNsmN(SEQ ID NO: 248); 7)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNmNmNmNmNfNmNmNmNmNmNs(iab)(SEQ ID NO: 249); 8)SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNfNmNmNmNmNs(iab)(SEQ ID NO: 250); 9)SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 251); 10)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNmNmNfNmNfNmNfNmNmNmNs(iab)(SEQ ID NO: 252); 11)SS(5'-3'):mNsmNmNmNmNmNmNmNfNfNfNmNmNmNmNmNfNmNmNmNmNs(iab)(SEQ ID NO: 253); 12)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNfNmNmNfNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 254); 13)SS(5'-3'):(iab)smNmNmNmNmNmNfNmNfNfNmNmNmNmNfNmNmNmNmNs(iab)(SEQ ID NO: 255); 14)SS(5'-3'):(iab)smNmNmNmNmNmNfNmNfNfNfNmNmNmNmNmNfNmNmNmNmNs(iab)(SEQ ID NO:256); 15)SS(5'-3'):mNsmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 257); 16)SS(5'-3'):(iab)smNmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 258); 17)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNfNmNmNfNmNmNmNmNmNmNmN(SEQ ID NO: 259); 18)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNfNmNmNmNmNfNmNmNmNmN(SEQ ID NO: 260); 19)SS(5'-3'):(iab)smNmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 261); 20)SS(5'-3'):mNsmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNmN(SEQ ID NO: 262); 21)SS(5'-3'):mNsmNmNmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmN(SEQ ID NO: 263); 22)SS(5'-3'):mNsmNmNmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNsmNsmN(SEQ ID NO:264); 23)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNdNmNmNmNmNmNmNmNmNsmNsmN(SEQ ID NO:265); 24)SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNsmNsmN(SEQ ID NO:266); 25)SS(5'-3'):mNsmNmNmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 267); 26)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNdNmNmNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO:268); 27) SS(5'-3'):mNsmNsmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 279); 28) SS(5'-3'):mNsmNsmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 280); 29)SS(5'-3'):(iab)smNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNs(iab)(SEQ ID NO: 281); 30)SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNdNmNmNmNmNmNmNmNmNmNmN (SEQ ID NO: 282); 31)SS(5'-3'):mNsmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNsmNsmN (SEQ ID NO: 283); 32) SS(5'-3'):mNsmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 292); Wherein, mN is a methoxy-modified nucleotide, fN is a fluorinated nucleotide, dN is a deoxynucleotide, s is a thiophosphate ester linkage, and (iab) is a reverse debasement residue.

2. The siRNA according to claim 1, wherein, The antisense strand of the siRNA contains any of the following modification patterns: 1)AS(5'-3'):VPmNsfNsmNmNmNmNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 213); 2)AS(5'-3'):VPmNsfNmN(dI)mNmNmNfNfNmNmNmNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 230); 3)AS(5'-3'):VPmNsfNmN(MOE-N)mNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 218); 4)AS(5'-3'):VPmNsfNsmNmNmNfNmNfNfNmNmNfNmNfNmNfNmNmNmNmNmNsmNsmN (SEQ ID NO: 236); 5)AS(5'-3'):VPmNsfNmN(MOE-N)mNfNmNfNfNmNmNfNmNfNmNfNmNmNmNsmNsmN (SEQ ID NO: 291); Wherein, mN is a methoxy-modified nucleotide, fN is a fluorinated nucleotide, VP is (E)-vinylphosphonate modified, s is a thiophosphate ester linked, (dI) is a deoxyinosine nucleotide, and (MOE-N) is a 2'-O-methoxyethyl modified nucleotide. And / or, The sense strand of the siRNA contains any of the following modification patterns: 1) SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNsmN (SEQ ID NO: 245); 2) SS(5'-3'):mNsmNmNmNmNmNfNmNfNdNfNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 251); 3) SS(5'-3'):mNsmNmNmNmNmNfNmNfNfNfNmNmNmNfNmNfNmNmNmNmNs(iab) (SEQ ID NO: 252); 4) SS(5'-3'):mNsmNmNmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 257); 5) SS(5'-3'):mNsmNmNmNfNmNfNmNfNmNmNmNmNmNmNmNmNmNmNs(iab) (SEQ ID NO: 292); Wherein, mN is a methoxy-modified nucleotide, fN is a fluorinated nucleotide, dN is a deoxynucleotide, s is a thiophosphate ester linkage, and (iab) is a reverse debasement residue.

3. The siRNA according to claim 1 or 2, wherein, The modification patterns of the sense and antisense strands of the siRNA are selected from any one of the antisense strand modification patterns shown in Table 2 (MD1-MD72), wherein the first SEQ ID NO corresponds to the antisense strand and the second SEQ ID NO corresponds to the sense strand: MD1: SEQ ID NO:213 and SEQ ID NO:243; MD2: SEQ ID NO:213 and SEQ ID NO:244; MD3: SEQ ID NO:213 and SEQ ID NO:245; MD4: SEQ ID NO:213 and SEQ ID NO:246; MD5: SEQ ID NO:213 and SEQ ID NO:247; MD6: SEQ ID NO:213 and SEQ ID NO:248; MD7: SEQ ID NO:213 and SEQ ID NO:249; MD8: SEQ ID NO:213 and SEQ ID NO:250; MD9: SEQ ID NO:213 and SEQ ID NO:251; MD10: SEQ ID NO:213 and SEQ ID NO:252; MD11: SEQ ID NO:213 and SEQ ID NO:253; MD12: SEQ ID NO:214 and SEQ ID NO:249; MD13: SEQ ID NO:214 and SEQ ID NO:250; MD14: SEQ ID NO:214 and SEQ ID NO:251; MD15: SEQ ID NO:214 and SEQ ID NO:252; MD16: SEQ ID NO:214 and SEQ ID NO:253; MD17: SEQ ID NO:215 and SEQ ID NO:254; MD18: SEQ ID NO:213 and SEQ ID NO:255; MD19: SEQ ID NO:214 and SEQ ID NO:255; MD20: SEQ ID NO:216 and SEQ ID NO:256; MD21: SEQ ID NO:217 and SEQ ID NO:257; MD22: SEQ ID NO:218 and SEQ ID NO:257; MD23: SEQ ID NO:218 and SEQ ID NO:258; MD24: SEQ ID NO:219 and SEQ ID NO:259; MD25: SEQ ID NO:220 and SEQ ID NO:260; MD26: SEQ ID NO:221 and SEQ ID NO:251; MD27: SEQ ID NO:222 and SEQ ID NO:251; MD28: SEQ ID NO:223 and SEQ ID NO:251; MD29: SEQ ID NO:224 and SEQ ID NO:251; MD30: SEQ ID NO:221 and SEQ ID NO:261; MD31: SEQ ID NO:225 and SEQ ID NO:251; MD32: SEQ ID NO:226 and SEQ ID NO:251; MD33: SEQ ID NO:227 and SEQ ID NO:251; MD34: SEQ ID NO:228 and SEQ ID NO:251; MD35: SEQ ID NO:229 and SEQ ID NO:251; MD36: SEQ ID NO:230 and SEQ ID NO:252; MD37: SEQ ID NO:231 and SEQ ID NO:252; MD38: SEQ ID NO:231 and SEQ ID NO:256; MD39: SEQ ID NO:230 and SEQ ID NO:256; MD40: SEQ ID NO:232 and SEQ ID NO:252; MD41: SEQ ID NO:232 and SEQ ID NO:256; MD42: SEQ ID NO:217 and SEQ ID NO:258; MD43: SEQ ID NO:233 and SEQ ID NO:258; MD44: SEQ ID NO:234 ​​and SEQ ID NO:262; MD45: SEQ ID NO:235 and SEQ ID NO:263; MD46: SEQ ID NO:219 and SEQ ID NO:282; MD47: SEQ ID NO:236 and SEQ ID NO:283; MD48: SEQ ID NO:237 and SEQ ID NO:264; MD49: SEQ ID NO:238 and SEQ ID NO:265; MD50: SEQ ID NO:213 and SEQ ID NO:266; MD51: SEQ ID NO:236 and SEQ ID NO:257; MD52: SEQ ID NO:237 and SEQ ID NO:267; MD53: SEQ ID NO:238 and SEQ ID NO:268; MD54: SEQ ID NO:239 and SEQ ID NO:251; MD55: SEQ ID NO:240 and SEQ ID NO:257; MD56: SEQ ID NO:241 and SEQ ID NO:257; MD57: SEQ ID NO:242 and SEQ ID NO:257; MD58: SEQ ID NO:269 and SEQ ID NO:258; MD59: SEQ ID NO:270 and SEQ ID NO:258; MD60: SEQ ID NO:240 and SEQ ID NO:279; MD61: SEQ ID NO:241 and SEQ ID NO:279; MD62: SEQ ID NO:242 and SEQ ID NO:279; MD63: SEQ ID NO:213 and SEQ ID NO:280; MD64: SEQ ID NO:221 and SEQ ID NO:280; MD65: SEQ ID NO:222 and SEQ ID NO:280; MD66: SEQ ID NO:223 and SEQ ID NO:280; MD67: SEQ ID NO:224 and SEQ ID NO:280; MD68: SEQ ID NO:221 and SEQ ID NO:281; MD69: SEQ ID NO:290 and SEQ ID NO:257; MD70: SEQ ID NO:291 and SEQ ID NO:257; MD71: SEQ ID NO:291 and SEQ ID NO:292; MD72: SEQ ID NO:214 and SEQ ID NO:254; Preferably, the modification patterns of the sense and antisense strands of the siRNA are selected from the antisense and sense strand modification patterns shown in any one of MD3, MD9, MD36, MD22, MD51, and MD71 in Table 2, wherein the first SEQ ID NO corresponds to the antisense strand and the second SEQ ID NO corresponds to the sense strand: MD3: SEQ ID NO:213 and SEQ ID NO:245; MD9: SEQ ID NO:213 and SEQ ID NO:251; MD36: SEQ ID NO:230 and SEQ ID NO:252; MD22: SEQ ID NO:218 and SEQ ID NO:257; MD51: SEQ ID NO:236 and SEQ ID NO:257; MD71: SEQ ID NO:291 and SEQ ID NO:

292.

4. The siRNA according to any one of claims 1-3, wherein, The antisense strand modification pattern selected from any one of MD1 to MD72 in Table 2 and / or the sense strand modification pattern selected from any one of MD1 to MD72 in Table 2 are applied to the small interfering RNA (siRNA) used to suppress MMP7 gene expression. Preferably, the antisense strand of the small interfering RNA (siRNA) for inhibiting MMP7 gene expression comprises the nucleotide sequence shown in any one of SEQ ID NO:1 to SEQ ID NO:25, SEQ ID NO:284 or SEQ ID NO:285; Preferably, the positive strand of the small interfering RNA (siRNA) for inhibiting MMP7 gene expression comprises the nucleotide sequence shown in any one of SEQ ID NO:26 to SEQ ID NO:50 or SEQ ID NO:

286.

5. The siRNA according to claim 4, wherein, The antisense strand comprises at least 12 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NOs:51-126, 271-274, 287-288; Preferably, the antisense strand comprises the nucleotide sequence shown in any one of SEQ ID NOs:51-126, 271-274, and 287-288.

6. The siRNA according to claim 4, wherein, The positive strand comprises at least 12 consecutive nucleotides of the nucleotide sequence shown in any one of SEQ ID NOs:127-212, 275-278, and 289; Preferably, the positive strand comprises the nucleotide sequence shown in any one of SEQ ID NOs:127-212, 275-278, and 289.

7. The siRNA according to any one of claims 4-6, wherein, The sense and antisense strand sequences of the siRNA comprise at least 12 consecutive nucleotides of the sense and antisense strand sequences of any of the modified duplexes 1 to 127 described in Table 3. Preferably, the sequences of the sense and antisense strands of the siRNA comprise the sense and antisense strand sequences selected from any of the modified double strands 1 to 127 described in Table 3.

8. A small interfering RNA (siRNA) for inhibiting MMP7 gene expression, said siRNA comprising a sense strand and an antisense strand, wherein, The antisense strand comprises at least 17 consecutive nucleotides that are approximately 4 (e.g., 0, 1, 2, 3, or 4) nucleotides similar to the nucleotide sequence shown in any one of SEQ ID NO:12 to SEQ ID NO:25, SEQ ID NO:284, and SEQ ID NO:285, and the sense strand is at least partially complementary to the antisense strand; Preferably, the antisense strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequences shown in any one of SEQ ID NO:12 to SEQ ID NO:25, SEQ ID NO:284, and SEQ ID NO:285 by 0 or 1 nucleotide; Preferably, the antisense strand comprises a nucleotide sequence shown in any one of SEQ ID NO:12 to SEQ ID NO:25, SEQ ID NO:284, and SEQ ID NO:

285.

9. The siRNA according to claim 8, wherein, The positive strand comprises at least 17 consecutive nucleotides having a nucleotide sequence that is approximately 4 (e.g., 0, 1, 2, 3 or 4) nucleotides similar to the nucleotide sequence shown in any one of SEQ ID NO:37 to SEQ ID NO:50 and SEQ ID NO:286; Preferably, the positive strand comprises at least 17 consecutive nucleotides that differ from the nucleotide sequences shown in any one of SEQ ID NO:37 to SEQ ID NO:50 and SEQ ID NO:286 by 0 or 1 nucleotide; Preferably, the sense strand has a region within the 17 consecutive nucleotides that is at least 85% complementary to the antisense strand; Preferably, the positive strand comprises a nucleotide sequence shown in any one of SEQ ID NO:37 to SEQ ID NO:50 and SEQ ID NO:

286.

10. The siRNA according to claim 8 or 9, wherein, The siRNA contains a blunt end and / or a protruding end of 1 to 4 nucleotides; Preferably, the siRNA contains one or two nucleotide overhangs; Preferably, the protruding end is present at the 5' end and / or 3' end of the antisense chain and / or the justice chain; Preferably, the 3' end of the antisense strand of the siRNA contains a two-nucleotide overhang or the 3' end of the antisense strand of the siRNA contains a one-nucleotide overhang.

11. The siRNA according to any one of claims 8-10, wherein, The antisense strand and the sense strand are each independently 17 to 30 nucleotides in length; preferably, the antisense strand is 19 to 27 nucleotides in length; preferably, the sense strand is 17 to 25 nucleotides in length.

12. The siRNA according to any one of claims 8-11, wherein, The antisense strand is 21-23 nucleotides long, and the sense strand is 19-21 nucleotides long.

13. The siRNA according to any one of claims 8-12, wherein, The sense strand and the antisense strand have a mismatch of no more than 6 nucleotides (e.g., 0, 1, 2, 3, 4, 5 or 6).

14. The siRNA according to any one of claims 8-13, wherein, The sense and antisense sequences of the siRNA comprise the sense and antisense sequences of any duplex selected from duplex 12 to duplex 28 described in Table 1.

15. The siRNA according to any one of claims 8-14, wherein, The siRNA contains at least one modifying nucleotide.

16. The siRNA according to claim 15, wherein, All nucleotides in the sense and / or antisense strands of the siRNA are modified nucleotides or nucleotide analogs.

17. The siRNA according to claim 16, wherein, The modified nucleotide or nucleotide analogue is selected from 2'-methoxynucleotide, 2'-fluoronucleotide, 2'-deoxynucleotide, 2',3'-cleaved nucleotide analogue, 2'-fluoroarabinonucleotide, 2'-methoxyethylnucleotide, 2'-amino-modified nucleotide, 2'-alkyl-modified nucleotide, 3'-methoxynucleotide, 2'-allyl-modified nucleotide, nucleotide containing a thiophosphate group, nucleotide containing a methylphosphonate group, nucleotide containing a 5'-phosphate group, nucleotide containing a 5'-phosphate mimic, diol-modified nucleotide, deoxyxanthine nucleotide, 2'-O-methoxyethyl-modified nucleotide, 2'-methoxy and 2'-fluoro-modified nucleotide, debased nucleotide, morpholinonucleotide, locked nucleotide, unlocked nucleotide, or glycerol nucleotide.

18. The siRNA according to any one of claims 15-17, wherein, The nucleotides in the sense strand of the siRNA are selected from at least two of 2'-methoxynucleotides, 2'-fluoronucleotides, and 2'-deoxynucleotides; and / or the nucleotides in the antisense strand of the siRNA are selected from at least two of 2'-methoxynucleotides, 2'-fluoronucleotides, nucleotides modified with 2'-methoxy and 2'-fluoro, deoxyxanthine nucleotides, nucleotides modified with 2'-O-methoxyethyl, unlocking nucleotides, glycerol nucleotides, and nucleotides of 5'-phosphate mimics.

19. The siRNA according to any one of claims 15-18, wherein, The 5' and / or 3' ends of the positive strand of the siRNA optionally contain capping residues (e.g., iab).

20. The siRNA according to any one of claims 15-19, wherein, The first nucleotide at the 5' end of the antisense strand of the siRNA optionally includes (E)-vinylphosphonate modification.

21. The siRNA according to any one of claims 15-20, wherein, The sense and / or antisense strands of the siRNA contain modified internucleotide links; Preferably, the 5' end and 3' end of the sense chain each independently contain one or two thiophosphate groups; and / or the 5' end and 3' end of the antisense chain each independently contain one, two, or three thiophosphate groups.

22. A conjugate or a pharmaceutically acceptable salt thereof, wherein, The conjugate or its pharmaceutically acceptable salt comprises the siRNA as described in any one of claims 1-21 and a pharmaceutically acceptable targeting molecule; Preferably, the targeting molecule has an affinity for receptors on the surface of epithelial cells; Preferably, the targeting molecule is an integrin ligand, such as αvβ6 integrin ligand; Preferably, the conjugate or a pharmaceutically acceptable salt thereof comprises: the siRNA according to any one of claims 1-21, and an αvβ6 integrin ligand, said αvβ6 integrin ligand comprising the structure shown in Formula I or a stereoisomer thereof or a pharmaceutically acceptable salt thereof. in: R 1 Selected from hydrogen, cyano, hydroxyl, mercapto, halogen, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylthio, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 haloalkyl, and C3-C6 cycloalkyl; R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 R 12 R 13 Each is independently selected from hydrogen, cyano, hydroxyl, mercapto, halogen, C1-C6 alkyl, C1-C6 alkoxy, C1-C6 alkylthio, C2-C6 alkenyl, C2-C6 alkynyl, C1-C6 haloalkyl, and C3-C6 cycloalkyl; m1, m2, and m3 are each independently selected from any integer from 1 to 10.

23. The conjugate or a pharmaceutically acceptable salt thereof according to claim 22, wherein, R 1 Selected from hydrogen, halogens, C1-C6 alkyl groups, and C1-C6 haloalkyl groups; Preferably, R 1 Selected from C1-C6 alkyl and C1-C6 haloalkyl; Preferably, R 1 Selected from C1-C6 alkyl groups; Preferably, R 1 It is methyl; Or, R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 R 12 R 13 Each is independently selected from hydrogen, halogen, C1-C6 alkyl, and C1-C6 haloalkyl; Preferably, R 2 R 3 R 4 R 5 R 6 R 7 R 8 R 9 R 10 R 11 R 12 R 13 It is hydrogen; Alternatively, m1 can be selected from 1, 2, 3, 4, 5, preferably from 1, 2, 3, for example, 1; Alternatively, m2 can be selected from 1, 2, 3, 4, 5, preferably from 1, 2, 3, for example, 1; Alternatively, m3 can be selected from 1, 2, 3, 4, 5, preferably from 1, 2, 3, for example, 1; Alternatively, the structure shown in Equation I is 24. The conjugate or a pharmaceutically acceptable salt thereof according to claim 22 or 23, wherein, The siRNA according to any one of claims 1-21 is covalently linked to the αvβ6 integrin ligand via a linker group; the linker group comprises the structure shown in formula II-1, II-2, II-3 or II-4. in: n1, n2, n3, and n4 are each independently selected from any integer from 1 to 10; q1, q2, q3, and q4 are each independently selected from any integer from 1 to 10; p is any integer from 1 to 10; The P-terminus of the structure shown in Formula II-1, Formula II-2, Formula II-3 or Formula II-4 is covalently linked to the siRNA of any one of claims 1-21 (for example, the 3' end, 5' end, or both the 3' end and 5' end of the sense strand and / or antisense strand of the siRNA of any one of claims 1-21, preferably the 5' end of the sense strand of the siRNA of any one of claims 1-21), and each O-terminus is covalently linked to the αvβ6 integrin ligand.

25. The conjugate or a pharmaceutically acceptable salt thereof according to claim 24, wherein, n1 is selected from 1, 2, 3, 4, 5, preferably from 2, 3, 4, for example, 3; Alternatively, n2 can be selected from 1, 2, 3, 4, 5, preferably from 1, 2, 3, for example, 1; Alternatively, n3 can be selected from 5, 6, 7, 8, 9, 10, preferably from 6, 7, 8, for example, 7; Alternatively, n4 can be selected from 1, 2, 3, 4, 5, preferably from 1, 2, 3, for example, 2; Alternatively, q1 can be selected from 1, 2, 3, 4, 5, with a preference for 1, 2, 3, such as 2; Alternatively, q2 can be selected from 1, 2, 3, 4, 5, preferably from 3, 4, 5, for example, 4; Alternatively, q3 can be selected from 1, 2, 3, 4, 5, with a preference for 1, 2, 3, such as 2; Alternatively, q4 can be selected from 1, 2, 3, 4, 5, with a preference for 3, 4, 5, for example, 4; Alternatively, p can be selected from 5, 6, 7, 8, 9, 10, preferably from 5, 6, 7, for example, 6; Preferably, the linking group comprises the structure shown in Formula II-1, Formula II-2 or Formula II-3; Preferably, the linking group comprises a structure selected from the following: In this structure, the P-terminus is covalently linked to the siRNA of any one of claims 1-21 (for example, the 3' and 5' ends of the sense strand and / or antisense strand of the siRNA of any one of claims 1-21, or both the 3' and 5' ends, preferably the 5' end of the sense strand of the siRNA of any one of claims 1-21), and each O-terminus is covalently linked to the αvβ6 integrin ligand.

26. The conjugate or a pharmaceutically acceptable salt thereof according to any one of claims 22-25, wherein, The conjugate has the structure shown in Formula III-1, Formula III-2 or Formula III-3. Among them, Z R This refers to the siRNA described in any one of claims 1-21; Preferably, the 5' end of the siRNA positive strand according to any one of claims 1-21 is covalently linked to the remaining structural portion of the conjugate; Preferably, the siRNA comprises a sense strand and an antisense strand sequence selected from modified double strand 45, modified double strand 66, modified double strand 97 or modified double strand 127; Preferably, the siRNA comprises a sense strand and an antisense strand sequence selected from any of the following modified duplexes: (i) Modifying the double strand 45, which includes an antisense strand sequence as shown in SEQ ID NO:72, and a positive strand sequence as shown in SEQ ID NO:155; (ii) Modify the double strand 66, which includes the antisense strand sequence as shown in SEQ ID NO:85, and the positive strand sequence as shown in SEQ ID NO:174; (iii) Modifying the double strand 97, which includes the antisense strand sequence as shown in SEQ ID NO:113, and the positive strand sequence as shown in SEQ ID NO:198; (iv) Modify the double strand 127, which includes the antisense strand sequence as shown in SEQ ID NO:288, and the positive strand sequence as shown in SEQ ID NO:289; Preferably, the conjugate is selected from conjugate 1, conjugate 2, conjugate 3, conjugate 4, conjugate 5, and conjugate 6; Preferably, the conjugate is selected from any of the following: (i) Conjugate 1, comprising an antisense strand sequence as shown in SEQ ID NO:72, and a sense strand sequence as shown in SEQ ID NO:293; (ii) Conjugate 2, comprising an antisense strand sequence as shown in SEQ ID NO:85, and a positive strand sequence as shown in SEQ ID NO:294; (iii) Conjugate 3, comprising an antisense strand sequence as shown in SEQ ID NO:113, and a sense strand sequence as shown in SEQ ID NO:295; (iv) Conjugate 4, comprising an antisense strand sequence as shown in SEQ ID NO:72, and a sense strand sequence as shown in SEQ ID NO:296; (v) Conjugate 5, comprising an antisense strand sequence as shown in SEQ ID NO:85, and a sense strand sequence as shown in SEQ ID NO:297; (vi) Conjugate 6, comprising an antisense strand sequence as shown in SEQ ID NO:113, and a sense strand sequence as shown in SEQ ID NO:

298.

27. A pharmaceutical composition, wherein, The pharmaceutical composition comprises the siRNA of any one of claims 1-21 or the conjugate of any one of claims 22-26 or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier and / or excipient.

28. The pharmaceutical composition according to claim 27, wherein, The pharmaceutically acceptable carrier is a delivery carrier; preferably, the siRNA is encapsulated by the delivery carrier.

29. Use of the siRNA of any one of claims 1-21, the conjugate of any one of claims 22-26, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition of claim 27 or 28 in the preparation of a medicament for treating and / or preventing pathological conditions or diseases associated with MMP7; Preferably, the siRNA, the conjugate, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition thereof, may be used alone or in combination with other pharmaceutically active agents (e.g., siRNAs targeting different target sequences in the MMP7 gene or siRNAs targeting other targets).

30. The use according to claim 29, wherein, The pathological conditions or diseases associated with MMP7 are inflammatory lung diseases or lung cancer, such as pulmonary fibrosis (e.g., idiopathic pulmonary fibrosis, interstitial lung disease, progressive pulmonary fibrosis, pulmonary fibrosis with lung cancer, idiopathic pulmonary fibrosis with lung cancer) or COPD.

31. The use according to claim 30, wherein, The pathological conditions or diseases associated with MMP7 are fibrotic diseases, such as renal fibrosis or liver fibrosis.

32. A method for preventing and / or treating a pathological condition or disease associated with MMP7 in a subject, the method comprising administering to a subject in need an effective amount of the siRNA of any one of claims 1-21, the conjugate of any one of claims 22-26 or a pharmaceutically acceptable salt thereof or the pharmaceutical composition of claim 27 or 28; Preferably, the siRNA, the conjugate, or a pharmaceutically acceptable salt thereof, or the pharmaceutical composition thereof, may be used alone or in combination with other pharmaceutically active agents (e.g., siRNAs targeting different target sequences in the MMP7 gene or siRNAs targeting other targets).

33. The method according to claim 32, wherein, The pathological conditions or diseases associated with MMP7 are inflammatory lung diseases or lung cancer, such as pulmonary fibrosis (e.g., idiopathic pulmonary fibrosis, interstitial lung disease, progressive pulmonary fibrosis, pulmonary fibrosis with lung cancer, idiopathic pulmonary fibrosis with lung cancer) or COPD.

34. The method according to claim 33, wherein, The pathological conditions or diseases associated with MMP7 are fibrotic diseases, such as renal fibrosis or liver fibrosis.

35. The compound represented by Formula IV, or its stereoisomer, or its pharmaceutically acceptable salt. in, R 0 Selected from -N3； n3, n4, n5, and q3 are each independently selected from any integer from 1 to 10; Preferably, n5 is selected from 1 or 2; Preferably, the compound represented by Formula IV has the structure shown below.

36. A targeting ligand comprising a linker unit, said linker unit comprising a structural fragment of Formula IV-1 or a stereoisomer thereof or a pharmaceutically acceptable salt thereof. in: n3, n4, n5, and q3 are each independently selected from any integer from 1 to 10; Preferably, n5 is selected from 1 or 2; Preferably, the connecting unit shown in Formula IV-1 has the following structural segment.

37. A targeted ligand delivery conjugate comprising a linker group, said linker group comprising a structural fragment of Formula IV-2 or a stereoisomer thereof or a pharmaceutically acceptable salt thereof. in: n3, n4, n5, and q3 are each independently selected from any integer from 1 to 10; Preferably, n5 is selected from 1 or 2; Preferably, the linker group shown in Formula IV-2 comprises the structural fragment shown below. Preferably, the linking group comprises a structural fragment of Formula II-3 or Formula II-4, or a stereoisomer thereof, or a pharmaceutically acceptable salt thereof. in: n3 and n4 are each independently selected from any integer from 1 to 10; q3 and q4 are each independently selected from any integer from 1 to 10; p is any integer from 1 to 10; More preferably, the linking group comprises a structural fragment as shown below, or a stereoisomer thereof, or a pharmaceutically acceptable salt thereof.

38. The targeted ligand delivery conjugate of claim 37, wherein, The targeted ligand delivery conjugate further comprises a target molecule, which is linked to the linking group; Preferably, the targeting molecule is as defined in any one of claims 22-23; Preferably, the target molecule, after being linked to the linking group, has the following specific structural fragment:

39. The targeted ligand delivery conjugate of claim 37 or 38, wherein, The targeted ligand delivery conjugate further comprises a delivered molecule, wherein the ligand unit and the delivered molecule are linked by the linking group; Preferably, the delivered molecules include, but are not limited to, RNAi agents, small molecules, antibodies, antibody fragments, immunoglobulins, monoclonal antibodies, labels or markers, lipids, natural or modified nucleic acids, natural or modified nucleic acid oligonucleotides, natural or modified nucleic acid polynucleotides, peptides, nucleic acid aptamers, polymers, polyamines, proteins, toxins, vitamins, polyethylene glycol, haptens, digoxigenin, biotin, radioactive atoms or molecules, or fluorophores. Preferably, the delivered molecule is an RNAi agent; More preferably, the delivered molecule is a small interfering RNA (siRNA) containing a sense strand and an antisense strand.

40. Use of the compound of claim 35 or its stereoisomer or pharmaceutically acceptable salt thereof, or the targeting ligand of claim 36, or the targeting ligand delivery conjugate of any one of claims 37-39, in the preparation of a reagent or medicament for delivering a target molecule.

41. Use of the compound of claim 35 or its stereoisomer or pharmaceutically acceptable salt thereof, or the targeting ligand of claim 36, or the targeting ligand delivery conjugate of any one of claims 37-39, in the preparation of a medicament for treating and / or preventing disease.

Images