Biocatalytic synthesis method for ambroxide

By using the biocatalytic method of Bayer-Villiger monooxygenase and esterase, combined with chemical transformation, the problems of pollution, high cost and unstable supply chain in the existing synthesis of ambroxol have been solved, and green, low-cost and efficient production has been achieved.

WO2026158625A1PCT designated stage Publication Date: 2026-07-30TIANJIN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
TIANJIN UNIV
Filing Date
2026-01-26
Publication Date
2026-07-30

AI Technical Summary

Technical Problem

Existing chemical synthesis routes for ambroxol use heavily polluting heavy metal oxidants, resulting in low yields and high costs. Biotransformation routes require chemical transformation and plant extraction, which have unstable raw material supplies and substrates that are toxic to cells. Existing biocatalytic routes use highly toxic reagents, making it difficult to meet the requirements of green chemistry.

Method used

Using Bayer-Villiger monooxygenase, naturally co-expressed esterase and alcohol dehydrogenase, and squalene-hopaene cyclase mutants, farnesylacetone was converted to EE-high farnesol via biocatalysis, and then cyclized to ambroxol. This method avoids the use of highly polluting reagents, utilizes in vitro catalysis with crude enzyme extracts, optimizes the reaction process, and combines it with chemical transformation.

Benefits of technology

It achieves non-toxic, low-cost green chemical synthesis, improves production efficiency, avoids cell concentration limitations, meets industrial needs, reduces energy consumption and production costs, and improves product purity and aroma stability.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure PCTCN2026074779-FTAPPB-I100001
    Figure PCTCN2026074779-FTAPPB-I100001
  • Figure PCTCN2026074779-FTAPPB-I100002
    Figure PCTCN2026074779-FTAPPB-I100002
  • Figure PCTCN2026074779-FTAPPB-I100003
    Figure PCTCN2026074779-FTAPPB-I100003
Patent Text Reader

Abstract

Disclosed in the present invention is a biocatalytic synthesis method for ambroxide, comprising: step 1, starting from trans-nerolidol, performing a carroll rearrangement reaction to synthesize farnesyl acetone; step 2, a Baeyer-Villiger monooxygenase catalyzing the conversion of farnesyl acetone into homofarnesyl acetate in the presence of a cofactor; step 3, an esterase catalyzing the deacetylation of homofarnesyl acetate to obtain EE-homofarnesol; and step 4, using a squalene-hopene cyclase mutant to enzymatically convert farnesol into ambroxide. The conversion process of the present invention is safe and non-toxic, and uses a new key enzyme Baeyer-Villiger monooxygenase, a naturally co-expressed esterase, an alcohol dehydrogenase, and the squalene-hopene cyclase mutant matched with the system for synergistic conversion, which not only promotes the recycling of coenzymes in the oxidation reaction, but also efficiently and specifically catalyzes the conversion from farnesyl acetone to ambroxide. A final product can be obtained directly from the reaction system without the need for separation and purification of an intermediate.
Need to check novelty before this filing date? Find Prior Art

Description

A biocatalytic synthesis method for ambroxol

[0001] This application claims priority to Chinese Patent Application No. 202510120184.3, filed on January 25, 2025, entitled “A Biocatalytic Synthesis Method of Ambroxol”, the entire contents of which are incorporated herein by reference. Technical Field

[0002] This invention belongs to the fields of biocatalysis and synthetic biology, and provides a chemical-enzyme combined synthesis method that starts with terpenoid compounds such as nerolidol from biosynthetic sources, and combines a simple chemical transformation with a downstream bioenzymatic transformation method for the efficient synthesis of the fragrance ingredient ambroxol. Background Technology

[0003] Natural ambergris is a precious fragrance derived from the grayish-white soft stones found in the stomachs of sperm whales. Its scarcity makes it more valuable than gold. Due to the scarcity and difficulty in obtaining natural ambergris, research has largely focused on developing synthetic methods to replace natural resources. Ambroxol [(-)-Ambroxide] is one of the most crucial active ingredients in natural ambergris, possessing a woody, amber, and smoky aroma (L. Cristiano et al., Cosmetics 2022, 9, 13). Ambroxol holds significant value in the fragrance and cosmetics industry, being the most highly regarded of all synthetic ambergris fragrances. Its unique aroma, stability, and good volatility enhance the persistence and diffusion of fragrances. As an excellent substitute for ambergris and a highly effective fixative, it is widely used in the production of high-end perfumes and fragrances. Because ambroxol is non-irritating and non-allergenic to the human body, it is well-suited for adding fragrance to skin, hair, and fabrics, and is also widely used in the cosmetics industry (N. He et al., Chem & BioEngineering, 2024, 1(2):91). Ambroxol is also used in the cigarette industry for flavoring and adding ingredients to improve the aroma quality of tobacco (N. He et al., ACSSustainChemEng, 2023, 11:1939).

[0004] The main methods for obtaining ambroxol are as follows:

[0005] Ambroxol is a 16-carbon terpene-like compound, belonging to the terpene derivatives containing a non-classical number of carbon atoms. Currently, the industrial production of ambroxol mainly uses sclareol, β-dihydroionone, and farnesol analogues as raw materials. Among these, sclareol has a similar carbon skeleton to ambroxol and can be used to synthesize optically pure ambroxol, making it the most practical raw material for its synthesis. This route is also the main method used by industry to obtain ambroxol. Specifically, this route uses sclareol, a natural product extracted from plants, as a raw material, undergoing chemical oxidation, reduction, and cyclization reactions to successively form sclareol lactone and sclarediol, ultimately producing ambroxol. However, these production methods still have many problems from the perspectives of green chemistry, stereochemistry, and supply chain management. For example, a key step in the sclareol technical route is the oxidative degradation of the side chain to obtain sclareol lactone, which requires an equivalent amount of a highly polluting oxidant. For example, the traditional synthesis method is the chromic anhydride oxidation method, which uses chromic anhydride to oxidize perillyl alcohol. While easy to operate, this method generates chromium-containing wastewater that causes significant environmental pollution and is now largely obsolete. Barton et al. proposed oxidizing perillyl alcohol in tetrahydrofuran using sodium periodate and osmium tetroxide. Subsequently, Reynolds in the United States developed a two-step oxidation method using potassium permanganate (US3050532). The Shanghai Institute of Fragrance and Perfume in China has also developed a low-temperature oxidation process using potassium permanganate. These oxidants can oxidatively degrade the side chains of perillyl alcohol to obtain perillyl lactone, but all of them cause serious heavy metal pollution. Although methods using green oxidants such as ozone and hydrogen peroxide for oxidative degradation have been reported, their yields and product separation efficacies are still insufficient for industrial applications. Furthermore, the residual chemical reagents and poor stereoselectivity greatly limit the application of these synthetic methods. In addition, the cost of these semi-synthetic routes fluctuates significantly due to the availability of plant-derived perillyl alcohol, which is detrimental to product cost control. Finally, because ambroxol has multiple different stereoisomers with certain differences in aroma characteristics, the various ambroxol analogs and optical isomers introduced in the chemical synthesis affect the purity and aroma of the final product.

[0006] Currently, natural extracts remain the primary source of the natural fragrance and flavor market. However, facing the pressure of a continuously growing global population and decreasing arable land, the demand for crops that address basic human needs is clearly more urgent than that for spice crops. From a long-term perspective, finding natural fragrance sources that can replace spice crops is an inevitable trend. Fragrances prepared using biotechnology are considered natural products and command a premium in the consumer market. Furthermore, compared to traditional organic synthesis processes, biotechnology offers advantages such as milder reaction conditions, better stereoselectivity, and less environmental pollution. Therefore, the use of biotechnology to prepare natural fragrances has become one of the most popular research topics in the fragrance industry. The production of ambroxol through a combination of biotransformation and chemical catalysis has been reported: one method involves using the fungi *Cryptococcus albidus* ATCC 20918 or *Filobasidiu mmagnum* JD1025 to ferment perillyl alcohol as a raw material to produce perillyl lactone (US5212078A, 1993), followed by chemical transformation to synthesize ambroxol; another method involves using the fungi *Hyphozyma roseoniger* ATCC 20624 to produce perillyl glycol (US4798799A, 1989) as a raw material, followed by chemical production of ambroxol from perillyl glycol. *Hyphozyma roseonigra* ATCC 20624 is currently the only known microorganism capable of utilizing perillyl alcohol as a single carbon source to metabolize and produce perillyl glycol with a high conversion rate. Starting with perillyl alcohol, directly converting it to perillyldiol from *Tricholoma matsutake*, followed by a simple dehydration cyclization step to obtain ambroxol, is an attractive alternative method. However, perillyl alcohol is cytotoxic to *Tricholoma matsutake*, making it difficult to achieve economically viable substrate concentrations. Furthermore, its metabolic pathway remains unclear, hindering the heterologous construction of high-yielding ambroxol-producing strains or efficient biocatalytic systems in other chassis cells. Previous studies have suggested that perillyl alcohol may be converted to the corresponding α,β-unsaturated acid via an unknown alcohol-aldehyde dehydrogenase in *Tricholoma matsutake*, but its subsequent metabolites and enzymes still require further analysis.

[0007] Givaudan, an American company, has developed Ambrofix (WO2016 / 170099, WO2021 / 110848), a one-step enzymatic catalytic synthesis route for the biosynthesis of optically pure ambroxol, starting from β-farnesene and proceeding via EE-gafarnesol. Compared to the semi-chemical synthesis route starting from squalene, Ambrofix transforms the multi-step, low-yield, and heavily polluting chemical synthesis into a one-step, highly efficient cyclization catalyzed by squalene-hopaene cyclase (SHC enzyme), achieving maximum atom economy and green sustainability. This represents one of the biggest innovations in the field of ambroxol biosynthesis in recent years. However, in this route, EE-gafarnesol still requires multiple hazardous and heavily polluting chemical synthesis steps, and the cis-trans isomerization that occurs during the substrate chemical transformation increases the synthesis cost of EE-gafarnesol. This route begins with bio-based (E)-conformation β-farnesene, produced by fermentation of sugarcane as a carbon source and heterologous expression of farnesene synthase in Saccharomyces cerevisiae (WO2015 / 059293). In the chemical transformation, firstly, in the presence of a palladium(II) catalyst, diazomethane is generated in situ from N-nitroso-N-methylurea (NMU) and potassium hydroxide, selectively cyclopropanating the terminal double bond of the (E)-conformation β-farnesene. Although this process is continuous in a fluid system and has high atom economy, NMU is a potent carcinogen, mutagen, and teratogen, thus the process still does not meet the requirements of green chemistry. After cyclopropanization, cyclopropyl rearrangement occurs via a phase transfer-mediated acidification reaction, converting to the corresponding ester. Deacylation yields EE-high farnesol. This process readily produces cis-trans isomer byproducts, which not only increases the synthesis cost but also affects the aroma and optical purity of the final product.

[0008] Therefore, it is still necessary to utilize synthetic biology and biocatalysis technologies to find a market-competitive and green chemistry-compliant synthetic route for ambroxol, so as to meet the growing consumer demand for natural fragrances.

[0009] Existing chemical and biosynthetic methods for ambroxol and its analogues have the following drawbacks:

[0010] 1. Existing chemical synthesis routes for ambroxol require the use of heavy metal oxidants that cause significant pollution, such as osmium tetroxide and potassium permanganate. This results in low yields, high separation and purification costs, and the raw material, perillyl alcohol, is derived from plant extracts. Its cost is highly volatile due to weather changes, and the supply chain is unstable.

[0011] 2. Current biotransformation methods for obtaining ambroxol still require downstream chemical transformation, and the substrate is the same as that used in pure chemical synthesis—perillyl alcohol derived from plants—which still faces supply chain fluctuations. Furthermore, perillyl alcohol is naturally toxic to cells, and the substrate concentration obtained through biotransformation is currently insufficient for efficient industrial production.

[0012] 3. Existing biocatalytic routes such as Ambrofix still require the use of highly toxic reagents to synthesize the substrates needed for enzyme catalysis, which cannot meet the requirements of green chemistry. Furthermore, the cis-trans isomerism of the substrates introduced in the chemical synthesis increases the production cost of this route. Summary of the Invention

[0013] To address the problems in the prior art, the present invention provides, in a first aspect, a Bayer-Villig monooxygenase and its naturally co-expressed esterase and alcohol dehydrogenase, a Bayer-Villig monooxygenase and alcohol dehydrogenase fusion protein, a Bayer-Villig monooxygenase and esterase fusion protein, and an amino acid sequence of a squalene-hopaene cyclase mutant.

[0014] In a second aspect, the present invention provides a gene encoding the Bayer-Villiger monooxygenase, the naturally co-expressed esterase, the alcohol dehydrogenase, the squalene-hopaene cyclase mutant, and the key enzyme fusion protein described in the first aspect of the present invention.

[0015] In a third aspect, the present invention provides a recombinant plasmid containing the encoding genes of Bayer-Villiger monooxygenase, esterase, alcohol dehydrogenase, squalene-hopaene cyclase mutant, and key enzyme fusion protein as described in the second aspect of the present invention.

[0016] Fourthly, this invention provides genetically engineered bacteria containing the recombinant plasmid described in the third aspect of this invention and their application in the biocatalytic synthesis of ambroxol.

[0017] Fifthly, this invention provides a biocatalytic synthesis method for ambroxol, overcoming the shortcomings of existing technologies where the reaction raw material, perillyl alcohol, is derived from plant extraction, resulting in poor supply chain stability and heavy heavy metal pollution during chemical conversion; the substrate, perillyl alcohol, is naturally toxic to cells, and the substrate concentration for bioconversion cannot meet the needs of efficient industrial production; and the biocatalytic route requires the use of highly toxic reagents.

[0018] To achieve the aforementioned objectives, the technical solution adopted by this invention includes:

[0019] A Bayer-Villig monooxygenase and its naturally co-expressed esterase and alcohol dehydrogenase, wherein the amino acid sequence of the Bayer-Villig monooxygenase is shown in SEQ ID NO:3, the amino acid sequence of the esterase is shown in SEQ ID NO:4-6, and the amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO:7.

[0020] A fusion protein comprising a Bayer-Villig monooxygenase fused to an alcohol dehydrogenase, or a Bayer-Villig monooxygenase fused to an esterase, wherein the amino acid sequence of the Bayer-Villig monooxygenase is selected from one of SEQ ID NO:1-3, the amino acid sequence of the esterase is selected from one of SEQ ID NO:4-6, and the amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO:7.

[0021] The amino acid sequence of the Bayer-Villiger monooxygenase and alcohol dehydrogenase fusion protein is shown in SEQ ID NO:18-19, and the amino acid sequence of the Bayer-Villiger monooxygenase and esterase fusion protein is shown in SEQ ID NO:20-21.

[0022] In addition to the listed amino acid sequences, any suitable form of flexible linker known in the art can be used to fuse Bayer-Villiger monooxygenase with alcohol dehydrogenase or Bayer-Villiger monooxygenase with esterase. Examples include, but are not limited to: GSG, GGGGS, (GGGGS)2, (GGGGS)3, EA AAK, (EAAAK)2, (EAAAK)3, G8, G6.

[0023] A method for converting farnesylacetone to EE-high farnesol includes the following steps:

[0024] Step 1: In the presence of a cofactor, Bayer-Villiger monooxygenase catalyzes the conversion of farnesylacetone to high farnesol acetate, wherein the amino acid sequence of the Bayer-Villiger monooxygenase is selected from one of SEQ ID NO:1-3;

[0025] Step 2: The esterase catalyzes the deacetylation of gafarnesol acetate to obtain EE-gafarnesol. The amino acid sequence of the esterase is selected from one of SEQ ID NO:4-6.

[0026] Preferably, the Bayer-Villiger monooxygenase and esterase are in the form of E. coli crude extract supernatant. The Bayer-Villiger monooxygenase, esterase, alcohol dehydrogenase, squalene-hopaene cyclase mutant, and key enzyme fusion protein can be present in the reaction mixture as cell extracts prepared from the corresponding producing cells. Similarly, the above-mentioned Bayer-Villiger monooxygenase, esterase, alcohol dehydrogenase, squalene-hopaene cyclase mutant, and key enzyme fusion protein can also be expressed using a single cell line, and its cell extract can be used as a single biocatalyst for the in vitro biocatalytic synthesis of ambroxol. Preferably, the cells are preferably bacterial host cells used to produce the enzymes.

[0027] Cell extracts can be obtained by any suitable method capable of lysing host cells, including but not limited to: sonication, RNase / lysozyme treatment, freeze-thaw treatment, or alkali treatment. The cell lysates can be processed by any suitable method known in the art, including but not limited to: filtration, centrifugation, or purification with salt to obtain a clear cell extract.

[0028] Preferably, the cofactor is selected from NADH and NADPH or a combination thereof.

[0029] The method includes a cofactor regeneration system.

[0030] Preferably, the cofactor regeneration system is an alcohol dehydrogenase / isopropanol cofactor or a glucose dehydrogenase (GDH) / glucose regeneration system.

[0031] A method for converting farnesylacetone to EE-high farnesol includes the following steps: catalyzing the conversion of farnesylacetone to EE-high farnesol using a fusion protein selected from Bayer-Villig monooxygenase and esterase in the presence of a cofactor.

[0032] A method for converting farnesylacetone to ambroxol includes the following steps:

[0033] Step 1: In the presence of a cofactor, Bayer-Villiger monooxygenase catalyzes the conversion of farnesylacetone to high farnesol acetate. The amino acid sequence of the Bayer-Villiger monooxygenase is selected from one of SEQ ID NO: 1-3; preferably, the amino acid sequence of the Bayer-Villiger monooxygenase is shown in SEQ ID NO. 2.

[0034] Step 2: The esterase catalyzes the deacetylation of gafarnesol acetate to obtain EE-gafarnesol. The amino acid sequence of the esterase is selected from one of SEQ ID NO:4-6; preferably, the amino acid sequence of the esterase is shown in SEQ ID NO.4.

[0035] Step 3 involves using a squalene-hopaene cyclase mutant to enzymatically convert EE-gafarnesol to ambroxol, wherein the amino acid sequence of the squalene-hopaene cyclase mutant is selected from one of SEQ ID NO: 8-17. Preferably, the amino acid sequence of the squalene-hopaene cyclase mutant is selected from one of SEQ ID NO: 8-14.

[0036] The pH of the reaction mixture can be from 4 to 9, preferably from 7 to 9 (including a pH of about 8.5), and can be maintained by adding a buffer or pH corrector to the reaction mixture. Exemplary buffers for this purpose are Tris-HCl buffer or glycine / NaOH buffer. For the BVMO enzyme under consideration, the temperature is from about 15°C to about 60°C. During biotransformation, the temperature can be kept constant or can be changed.

[0037] A gene encoding the Bayer-Villiger monooxygenase, the nucleotide sequence of which is shown in SEQ ID NO:22-24; a gene encoding the esterase, the nucleotide sequence of which is shown in SEQ ID NO:25-27; a gene encoding the alcohol dehydrogenase, the nucleotide sequence of which is shown in SEQ ID NO:28; a gene encoding the squalene-hopaene cyclase mutant, the nucleotide sequence of which is shown in SEQ ID NO:29-38; a gene encoding the Bayer-Villiger monooxygenase and co-expressed alcohol dehydrogenase fusion protein, the nucleotide sequence of which is shown in SEQ ID NO:39-40; and a gene encoding the Bayer-Villiger monooxygenase and esterase fusion protein, the nucleotide sequence of which is shown in SEQ ID NO:41-42.

[0038] A recombinant plasmid comprising: a gene encoding Bayer-Villiger monooxygenase, the nucleotide sequence of which is shown in SEQ ID NO:43-45; a gene encoding an esterase, the nucleotide sequence of which is shown in SEQ ID NO:46-48; a gene encoding an alcohol dehydrogenase, the nucleotide sequence of which is shown in SEQ ID NO:49; a gene encoding a squalene-hopaene cyclase mutant, the nucleotide sequence of which is shown in SEQ ID NO:50-59; a gene encoding a fusion protein of Bayer-Villiger monooxygenase and a co-expressed alcohol dehydrogenase, the nucleotide sequence of which is shown in SEQ ID NO:60-61; and a gene encoding a fusion protein of Bayer-Villiger monooxygenase and an esterase, the nucleotide sequence of which is shown in SEQ ID NO:62-63.

[0039] The expression vector for the recombinant plasmid is pET28a(+).

[0040] A genetically engineered bacterium, wherein the genetically engineered bacterium contains the recombinant plasmid described above.

[0041] The expression host of the genetically engineered bacteria is E. coli BL21(DE3).

[0042] The genetically engineered bacteria are used in the conversion of linear polyunsaturated branched ketone substrates into corresponding acetates and alcohols with two carbon atoms shortened in the carbon chain, followed by enzymatic cyclization using squalene-hope cyclase to synthesize terpene-derived compounds containing a non-classical number of carbon atoms.

[0043] The linear polyunsaturated branched ketone is farnesylacetone, and the terpene derivative containing a non-classical number of carbon atoms is ambroxol.

[0044] A method for converting nerolidol to ambroxol includes the following steps:

[0045] Step 1 begins with trans-nerolidol, followed by a carroll rearrangement reaction to synthesize farnesylacetone. The distillation of nerolidol is coupled with the chemical synthesis of farnesylacetone.

[0046] Step 2: In the presence of a cofactor, Bayer-Villiger monooxygenase catalyzes the conversion of farnesylacetone to high farnesol acetate, wherein the amino acid sequence of the Bayer-Villiger monooxygenase is selected from one of SEQ ID NO:1-3;

[0047] Step 3: The esterase catalyzes the deacetylation of gafarnesol acetate to obtain EE-gafarnesol. The amino acid sequence of the esterase is selected from one of SEQ ID NO:4-6.

[0048] Step 4 uses a squalene-hopaene cyclase mutant to enzymatically convert EE-gafarnesol to ambroxol, wherein the amino acid sequence of the squalene-hopaene cyclase mutant is selected from one of SEQ ID NO:8-17.

[0049] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0050] 1) The chemical conversion method used in this invention avoids the use of any highly polluting reagents and uses only low-cost, non-toxic reagents that are friendly to operators and the environment.

[0051] 2) At the same time, the technical route optimizes the reaction process, coupling the separation and chemical conversion of nerolidol, which improves production efficiency and reduces energy consumption.

[0052] 3) This invention employs an in vitro biocatalytic method using crude enzyme extracts, without the participation of living cells in the transformation. Therefore, it bypasses the concentration limitation per unit volume caused by the inhibitory effect of the substrate on cells, thus improving the practicality of this route on an industrial scale.

[0053] 4) This invention employs a novel enzymatic catalysis method to obtain the key substrate EE-gafarnesol for the cyclization reaction. The conversion process is safe and non-toxic, meeting the requirements of green chemistry. Simultaneously, we utilize a novel Bayer-Villiger monooxygenase, a naturally co-expressed esterase, an alcohol dehydrogenase, and a squalene-hopaene cyclase mutant that matches the system for synergistic conversion. This not only promotes the recycling of coenzymes in the oxidation reaction without the need for the addition of expensive exogenous coenzymes, but also efficiently and specifically catalyzes the conversion from the substrate farnesylacetone to ambroxol, allowing the final product to be obtained directly from the reaction system without the need for intermediate separation and purification.

[0054] 5) The BVMO enzyme activity discovered in this invention is better than existing solutions.

[0055] 6) The SHC mutant of the present invention has undergone special evolution and screening to meet the requirements of high adaptability, stability and catalytic efficiency in complex catalytic systems. Attached Figure Description

[0056] Figure 1 is a gas chromatography-mass spectrometry chromatogram of EE-high farnesol obtained by coupling BVMO with esterase using farnesylacetone as substrate.

[0057] Figure 2 is a gas chromatography-mass spectrometry chromatogram of the product obtained by co-incubating the supernatant of crude Escherichia coli crude extract with a fusion protease expressing Bayer-Villig monooxygenase and esterase under appropriate conditions using farnesylacetone as a substrate.

[0058] Figure 3 shows the gas chromatography-mass spectrometry chromatogram of EE-high farnesol obtained by co-incubating with different forms of BVMO and esterase-expressing Escherichia coli using farnesylacetone as a substrate under appropriate conditions.

[0059] Figure 4 shows the gas chromatography-mass spectrometry (GC-MS) chromatogram of farnesylacetone to ambroxol catalyzed by the combined use of BVMO, esterase, and SHC enzyme. In Figure 4, A is the GC-FID chromatogram, with the main peak indicated by the arrow being ambroxol ether. Figure 4 shows the comparison between the main peak ambroxol ether mass spectrum and the standard spectrum in the NIST database, with the molecular ion peak indicated by the arrow.

[0060] Figure 5 shows the screening results of the SHC enzyme combinatorial library;

[0061] Figure 6 shows the chemical-enzymatic catalytic synthesis route of ambroxol described in this invention;

[0062] Figure 7 shows the gas chromatography-mass spectrometry (GC-MS) chromatograms of the product obtained by BVMO conversion of the substrate methylheptenone, which undergoes Bayer-Villiger oxidation and spontaneous ester hydrolysis. In the figure, A is the GC-FID chromatogram, and B is the comparison result between the mass spectrum of the main product peak methyl-3-penten-1-ol and the standard spectrum in the NIST database. The arrows indicate the molecular ion peaks.

[0063] Figure 8 shows the gas chromatography-mass spectrometry (GC-MS) chromatograms of the product obtained by BVMO transformation of the substrate trans-geranylacetone, followed by Bayer-Villiger oxidation and spontaneous ester hydrolysis. In Figure 8, A is the GC-FID chromatogram, and B is the comparison between the mass spectrum of the product peak 4,8-dimethylnon-3,7-dien-1-ol acetate and the standard spectrum in the NIST database. The arrows indicate the molecular ion peak. Detailed Implementation

[0064] The present invention will be further described below with reference to specific embodiments. These embodiments are merely exemplary and do not limit the scope of protection of the present invention. The reagents, kits, and strains involved in each embodiment are all commercially available.

[0065] Unless otherwise defined, the technical terms used in the following embodiments have the same meanings as commonly understood by those skilled in the art. Unless otherwise specified, the experimental reagents used in the following embodiments are conventional biochemical reagents; and the experimental methods described are conventional methods.

[0066] First, it should be noted that the definitions of the terms used in this invention specification are all known to those skilled in the art. For example, some of the terms are defined as follows:

[0067] BVMO stands for Bayer-Villiger monooxygenase.

[0068] ADH stands for alcohol dehydrogenase, and GDH stands for glucose dehydrogenase.

[0069] SHC represents a squalene-hope cyclase mutant.

[0070] Example 1: The target gene was cloned, overexpressed, and purified.

[0071] Total mRNA from *Hyphozyma roseonigra* ATCC 20624 was extracted using a fungal total RNA rapid extraction kit, and total cDNA was obtained by reverse transcription using a reverse transcription kit. This cDNA was then used as a PCR template for amplifying the target gene. Taking the target gene sgs3312 as an example, the BVMO gene fragment encoding sgs3312 was amplified using primers BVMO-FW (GGGCGCCATGATGACGACTCCAACTATGACAATGCCATC) and BVMO-RV (GAGACTGCAGGTCATTAATGGTTGCTGAGCCACGACTCTTTATG).

[0072] Correspondingly, the target gene can also be synthesized to obtain a DNA fragment with codon optimization but the same amino acid sequence, so as to increase the expression level of the target gene in a specific host.

[0073] A high-fidelity DNA polymerase was used, and the reaction system was prepared according to the kit instructions. pET28a was used as a template, and 28a-FW (CAGCAACCATTAATGACCTGCAGTCTCGAGCACCAC) and 28a-RV (GGAGTCGTCATCATGGCGCCCTGAAAATACAGGTTTTC) were used as primers for linearization amplification of pET28a.

[0074] The encoding fragment of the target gene sgs3312 was ligated to a linearized pET28a vector fragment using a seamless cloning kit to form the expression vector pET28a-sgs3312. This expression vector was then transformed into the *Escherichia coli* expression strain BL21(DE3) to obtain the expression strain BL21-sgs3312. The target gene sgs3312 expresses a protein with a histidine purification tag at its C-terminus, which can be purified and easily immobilized using a Ni-NTA affinity chromatography column.

[0075] Correspondingly, other target genes can also be cloned, overexpressed, and purified using the methods described above.

[0076] Example 2: Transcriptomics Data-Driven Discovery of New Enzymes

[0077] Novel Bayer-Villiger monooxygenases, as well as naturally co-expressed esterases and alcohol dehydrogenases, were obtained through transcriptional analysis and experimental verification of candidate enzymes. Specifically, *H. roseonigra* ATCC 20624 was typically cultured in yeast-malt medium (YMM) containing 3 g / L yeast extract, 3 g / L malt extract, 10 g / L glucose, and 5 g / L tryptophan peptone (pH 6.2) at 24°C and 180 rpm on a rotary shaker. The basic salt medium (BSM) consisted of: 2.44 g / L KH₂PO₄, 14.04 g / L Na₂HPO₄·12H₂O, 2 g / L NH₄Cl, 0.2 g / L MgCl₂·6H₂O, 1 mg / L CaCl₂·2H₂O, 0.01 g / L yeast extract, 5 mL / L metal ion mixture, and 0.2 mL / L vitamin mixture. The substrate sclareol was prepared as a 60 mM solution comprising 1.85 g sclareol, 16.25 mL Tween 80, and 83.75 mL deionized water. Biotransformation experiments were performed using YMM medium at a 15 mM sclareol concentration, with sclareol serving as the sole carbon source in a static cell reaction.

[0078] H. roseonigra cells were cultured in YMM medium to the logarithmic growth phase (approximately 48 hours), collected by centrifugation at 3420g for 15 minutes at 20°C. The cell pellet was washed twice with sterile phosphate-buffered saline (pH 6.2) to remove nutrients and then resuspended in BSM as a biocatalyst. Biotransformation was performed in 250mL culture flasks, each containing 50mL of reaction mixture, with the cell suspension seeded to a final OD600 of approximately 30. The biotransformation was conducted at 24°C on a rotary shaker at 180rpm for 100 hours. A control group was performed under conditions of no seeding or no exogenous substrate, with all other conditions identical to the biotransformation experiment. No metabolites were detected in the control group. All experiments were performed in triplicate.

[0079] Cell growth (OD600) was measured using a UV-Vis spectrophotometer. Residual glucose in the fermentation broth was determined using a biosensor analyzer. A clear extract was obtained by centrifugation at 16,060 g for 10 min and filtration through a 0.2 μm nylon syringe filter. The product and residual substrate were analyzed using a GC-FID system with nitrogen as the carrier gas at a flow rate of 2 mL / min. The sample volume was 1 μL, using split mode (split ratio 20:1), with an injection port temperature of 250 °C and a detector temperature of 320 °C. The column temperature program was: 80 °C for 1 min, followed by heating at 20 °C / min to 280 °C and holding at 280 °C for 2 min. Quantification was performed using an internal standard method with dibutyl phthalate as the internal standard. Metabolites during the biotransformation of perillaldehyde were analyzed using a GC-MS system. Electron impact ionization (EI) was applied at an energy of 70 eV, with a scan range of m / z 50–550. The column temperature program was as follows: 150℃ for 1 minute, heated to 250℃ at a rate of 10℃ / min, and held at 250℃ for 8 minutes. The injection volume was 1 μL, the split ratio was 20:1, the carrier gas was nitrogen, and the flow rate was 2 mL / min. During the biotransformation process, samples collected at hour 31 were analyzed using a high-precision mass GC / Q-TOF MS instrument equipped with a 7890B gas chromatograph. Different chemical substances were separated using an HP-5MS column (30 m × 0.25 mm × 0.25 μm).

[0080] After GC-MS analysis confirmed the conversion of perillaldehyde to perillyl alcohol, RNA was extracted from *H. roseonigra* yeast grown under both perillaldehyde-fed and perillaldehyde-free conditions using a total RNA extraction kit. The RNA was then frozen in liquid nitrogen for 0.5–1 hour and stored at -80°C. Transcriptome sequencing and data analysis were performed. The expression level of each gene was calculated as fragments per kilobase per million library-sized units (FPKM). The *H. roseonigra* genome was sequenced using a third-party company's Illumina HiSeq 2500 sequencer and PacBio RS II system. Obscured N bases were replaced by PCR amplification using specifically designed PCR primers. Potential coding sequences (CDS) were predicted using Prodigal_v2.6.1 software. CDS annotation was based on the BLASTP program, utilizing the NR, COG, and KEGG databases. Single nucleotide variants (SNVs) and insertions / deletions (InDels) were identified using the Mummer, Mauve, and BLASTP programs.

[0081] Compared to the unfeeded state, the high expression levels of alcohol dehydrogenase, aldehyde dehydrogenase, BVMO, and esterase induced under feeding conditions were identified as candidate enzymes. These enzymes exhibited higher expression levels. Specifically, the gene expression levels (log2) of alcohol dehydrogenase were 10.75, aldehyde dehydrogenase 7.85, BVMO 1 3.07, BVMO 2 8.76, BVMO 3 8.46, esterase 4 4.22, esterase 5 3.12, and esterase 6 3.03.

[0082] Gene cloning was performed according to the method in Example 1, and expression and screening were carried out according to the method in Example 3. Enzyme activity was further screened according to the substrate and reaction conditions in Example 4.

[0083] Example 3: Expression, induction, purification, and analysis of key enzymes derived from *Rhodotorula rubrum*, including Bayer-Villiger monooxygenase, alcohol dehydrogenase, esterase, SHC enzyme, or fusion proteins of key enzymes.

[0084] Induction and purification process:

[0085] (1) Inoculation: Inoculate single colonies of the overexpressing protein stored at -80℃ into test tubes containing LB medium containing 50μg / mL kanamycin and 50μg / mL chloramphenicol (3-5mL), and incubate overnight at 37℃ with a shaking speed of 220rpm.

[0086] (2) Transfer: The bacterial cells in the above LB medium were transferred (1% inoculum) to a shake flask containing 50 mL of freshly sterilized LB medium containing 50 μg / mL kanamycin and 50 μg / mL chloramphenicol (the medium should occupy about 20% of the shake flask volume to ensure good aeration). The shaker was set to 220 rpm and cultured at 37°C until the bacterial OD600 was about 0.6 to 0.8.

[0087] (3) Induction: Add 0.3mM of the inducer IPTG (isopropyl-β-D-thiopyranogalactopyranoside) and induce at 160rpm for 16h at 18℃.

[0088] (4) Collecting bacteria: Take 50 mL of bacterial solution, centrifuge at 6000 rpm at 4℃ for 5 min to collect the bacterial cells and discard the supernatant culture medium. Wash the bacterial cells with 20 mL of 1x PBS solution, centrifuge and discard the supernatant. Place the sample in an ice-water mixture to prevent protein denaturation.

[0089] (5) Ultrasonic disruption: Resuspend the bacterial cells in 5 mL of 1x PBS solution, pH 7.2 (PBS / bacterial cells = 8:1V / M). Place the sample in an ice-water mixture and disrupt the bacterial cells with an ultrasonic disruptor (power ratio 30%, ultrasonic disruption for 5 seconds, pause for 5 seconds) for 10 minutes (after disruption for 5 minutes, place in an ice bath, and disrupt for another 5 minutes) until the bacterial solution becomes clear and transparent.

[0090] (6) Sampling: Take 20 μL of the fragment and 4 μL of 5x loading buffer into a 200 μL centrifuge tube as the total protein sample; centrifuge the remaining fragment (12000 rpm, 4℃, 15 min), take 20 μL of supernatant and add 4 μL of 5x loading buffer into a 200 μL centrifuge tube as the supernatant sample; remove the supernatant sample, resuspend the precipitate in 5 mL of PBS solution, take 20 μL of the resuspended solution and 4 μL of 5x loading buffer into a 200 μL centrifuge tube as the precipitate sample. The supernatant sample contains soluble protein, and the precipitate sample contains inclusion bodies. Boil all samples at 99℃ (PCR instrument) for 10 min until the protein denatures.

[0091] (7) Electrophoresis preparation: After the above three groups of samples are cooled, they are centrifuged at 12,000 rpm for 10 minutes. 15 μL of each sample is loaded and detected by SDS-PAGE electrophoresis.

[0092] (8) Staining: Place it in a staining and decolorizing instrument for 10 minutes to develop color.

[0093] Example 4: The combined use of Bayer-Villiger monooxygenase and esterase from *Rhodotorula rubrum* to catalyze the conversion of farnesylacetone to EE-hofarnesol.

[0094] Using engineered bacteria as raw material, 5 mL of BVMO and 5 mL of esterase supernatant (approximately 0.5 g of bacterial equivalent each) were added to 0.2 g of farnesylacetone. The buffer system was 1x PBS, pH 7.2, and the reaction was carried out at 24℃ for 10 h until high-farnesol was observed. As shown in Figure 1, farnesylacetone was used as a substrate and co-incubated with the crude extract supernatant of *E. coli* expressing the key enzyme under suitable conditions. The resulting product was obtained by gas chromatography-mass spectrometry (GC-MS). Using chemically synthesized EE-high-farnesol as a standard, the cascade production of EE-high-farnesol using this enzyme catalysis system was verified. Specifically, the Bayer-Villiger monooxygenase from *Pseudomonas aeruginosa* catalyzed the conversion of farnesylacetone to high-farnesol acetate, and the esterase, also from *Pseudomonas aeruginosa*, catalyzed the deacetylation of high-farnesol acetate to obtain EE-high-farnesol. The substrate farnesylacetone was completely converted under appropriate conditions.

[0095] Bayer-Villiger monooxygenase cofactor (BVMO-cofactor) is a cofactor that assists BVMO enzyme during catalytic reactions. The cofactor can be an inorganic or organic molecule. The BVMO-cofactor can be selected from nicotinamide adenine dinucleotide (NADH) and nicotinamide adenine dinucleotide phosphate (NADPH), or combinations thereof. Preferably, the BVMO-cofactor is present in the reaction mixture at an initial molar concentration relative to BVMO, for example, when the BVMO enzyme is saturated with NAD(P)H. Therefore, preferably, the NAD(P)H is present in the reaction mixture at a concentration at least equal to the concentration of the BVMO enzyme.

[0096] In one specific embodiment, the cofactor regeneration system is an alcohol dehydrogenase (ADH) / isopropanol cofactor regeneration system. In another specific embodiment, the cofactor regeneration system is a glucose dehydrogenase (GDH) / glucose cofactor regeneration system. Using either of these cofactor regeneration systems, only a catalytic amount of cofactor needs to be added to the reaction system. Compared to the GDH / glucose system, using the ADH / isopropanol cofactor regeneration system has the advantage of preventing acidification of the reaction medium.

[0097] When using GDH as a cofactor cycling system, the preferred reaction conditions are as follows: in the presence of 50 mM Tris-HCl buffer at pH 8.5, 10 M NADPH, 2 g / L GDH and 25 mM glucose (150 mL total volume), acetone is added as a cosolvent to 10% (v / v). Using engineered bacteria as raw material, 50 mL of BVMO and 50 mL of esterase supernatant (approximately 5 g of bacterial equivalent each) are reacted with 7.6 mM farnesylacetone (2 g / L). The conversion rate of farnesylacetone is determined using the gas chromatography method described in Example 2.

[0098] When using ADH as a cofactor cycling system, the preferred reaction conditions are as follows: in the presence of 50 mM Tris-Cl buffer at pH 8.5, 10 M NADPH, 0.5 g / L ADH (SEQ ID NO. 7), and 35 mM isopropanol (150 mL total volume), using engineered bacteria as raw material, 50 mL of BVMO and 50 mL of esterase supernatant (approximately 5 g of bacterial equivalent each) are reacted with 4 g / L farnesylacetone (15.2 mM). The conversion rate of farnesylacetone is determined using the gas chromatography method described in Example 2.

[0099] Regarding the specific sequence, the conversion rates of high farnesol acetate were obtained as follows:

[0100] Using engineered bacteria as raw material, 5 mL of BVMO (SEQ ID NO:2) was added to 0.2 g of farnesylacetone. The buffer system consisted of 1x PBS, pH 7.2. Acetone was added as a co-solvent to bring the concentration to 10% (v / v). The reaction was carried out at 24°C for 10 h until high-farnesyl acetate was observed. The conversion rate of farnesylacetone to high-farnesyl acetate was 99%.

[0101] Using engineered bacteria as raw material, 5 mL of BVMO (SEQ ID NO:1) was added to 0.2 g of farnesylacetone. The buffer system consisted of 1x PBS, pH 7.2. Acetone was added as a co-solvent to bring the concentration to 10% (v / v). The reaction was carried out at 24°C for 10 h until high-farnesyl acetate was observed. The conversion rate of farnesylacetone to high-farnesyl acetate was 56%.

[0102] Using engineered bacteria as raw material, 5 mL of BVMO (SEQ ID NO:3) was added to 0.2 g of farnesylacetone. The buffer system consisted of 1x PBS, pH 7.2. Acetone was added as a co-solvent to bring the concentration to 10% (v / v). The reaction was carried out at 24°C for 10 h until high-farnesyl acetate was observed. The conversion rate of farnesylacetone to high-farnesyl acetate was 10%.

[0103] Figure 1 shows the gas chromatography-mass spectrometry (GC-MS) chromatogram of the product obtained by co-incubating farnesylacetone as a substrate with the supernatant of crude E. coli expressing the key enzyme under suitable conditions. Using chemically synthesized EE-gafarnesol as a standard, the cascade production of EE-gafarnesol by this enzyme catalytic system was verified. Specifically, a Bayer-Villiger monooxygenase from *Heterodactylus* catalyzes the conversion of farnesylacetone to gafarnesol acetate, while an esterase, also from *Heterodactylus*, catalyzes the deacetylation of gafarnesol acetate to EE-gafarnesol. The substrate farnesylacetone is completely converted under appropriate conditions.

[0104] Bayer-Villig monooxygenase (SEQ ID NO:2) is the enzyme with the highest conversion rate of farnesol acetate. Therefore, Bayer-Villig monooxygenase (SEQ ID NO:2) and esterase (amino acid sequence selected from any one of SEQ ID NO.4-6) were selected to catalyze the production of farnesol from farnesylacetone. The specific implementation method is shown below:

[0105] Using engineered bacteria as raw material, take 5 mL of BVMO (SEQ ID NO:2) and 5 mL of esterase (SEQ ID NO:5) supernatant (approximately 0.5 g cell equivalent each), and add 0.2 g of farnesylacetone. Buffer system: 1x PBS, pH 7.2. Add acetone as a co-solvent to 10% (v / v). React at 24°C for 10 h until high farnesol is observed. The conversion rate of farnesylacetone to high farnesol is 65%.

[0106] Using engineered bacteria as raw material, take 5 mL of BVMO (SEQ ID NO:2) and 5 mL of esterase (SEQ ID NO:6) supernatant (approximately 0.5 g cell equivalent each), and add 0.2 g of farnesylacetone. Buffer system: 1x PBS, pH 7.2. Add acetone as a co-solvent to 10% (v / v). React at 24°C for 10 h until high farnesol is observed. The conversion rate of farnesylacetone to high farnesol is 55%.

[0107] Preferably, engineered bacteria are used as raw materials. 5 mL of BVMO (SEQ ID NO:2) and 5 mL of esterase (SEQ ID NO:4) supernatant (approximately 0.5 g cell equivalent each) are taken and 0.2 g of farnesylacetone is added. The buffer system is 1x PBS, pH 7.2. Acetone is added as a co-solvent to bring the concentration to 10% (v / v). The reaction is carried out at 24°C for 10 h until high-farnesol is observed. The conversion rate of farnesylacetone to high-farnesol is 95%.

[0108] Example 5: Efficient catalysis of the conversion of farnesylacetone to EE-hofarnesol using a fusion protein of Bayer-Villiger monooxygenase and esterase.

[0109] According to the preferred reaction conditions described in Example 4, a fusion protein of Bayer-Villig monooxygenase and esterase can be used, which helps to simplify the production process and reduce production costs.

[0110] Specifically, using naturally occurring GDH from *E. coli* as a cofactor circulation system, acetone was added as a solubilizer to 10% (v / v) in the presence of 50 mM Tris-HCl buffer (pH 8.5), 10 μM NADPH, and 25 mM glucose (total volume 150 mL). Using engineered bacteria as raw material, 50 mL of the supernatant of the fusion protein of Bayer-Villiger monooxygenase and esterase (approximately 5 g bacterial equivalent each) was reacted with 7.6 mM farnesylacetone (2 g / L). The farnesylacetone conversion rate was approximately 90% within 20 hours.

[0111] Meanwhile, the enzyme dosage screening results are shown in Figure 2. Using farnesylacetone as a substrate, the supernatant of crude E. coli expressing the fusion enzyme was co-incubated under suitable conditions, and the resulting product was analyzed by gas chromatography-mass spectrometry (GC-MS). Under optimized reaction conditions, it was found that using 30 mL of the fusion protein supernatant of Bayer-Villiger monooxygenase and esterase resulted in a farnesylacetone conversion rate of approximately 10% within 20 hours. However, further increasing the enzyme dosage after using 50 mL of the fusion protein supernatant of Bayer-Villiger monooxygenase and esterase did not significantly increase the farnesylacetone conversion rate within 20 hours.

[0112] Regarding specific sequences, the conversion rates of hofarniol obtained using the fusion protein of Bayer-Villiger monooxygenase and esterase are as follows:

[0113] Using naturally occurring GDH from *E. coli* as a cofactor cycling system, in the presence of 50 mM Tris-HCl buffer (pH 8.5), 10 mM NADPH, and 25 mM glucose (150 mL total volume), acetone was added as a solubilizer to 10% (v / v). Using engineered bacteria as raw material, 50 mL of the supernatant (approximately 5 g bacterial equivalent) of the Bayer-Villiger monooxygenase and esterase fusion protein (SEQ ID NO. 20) was reacted with 7.6 mM farnesylacetone (2 g / L). The farnesylacetone conversion rate was approximately 80% within 20 hours.

[0114] Using naturally occurring GDH from *E. coli* as a cofactor cycling system, in the presence of 50 mM Tris-HCl buffer (pH 8.5), 10 mM NADPH, and 25 mM glucose (150 mL total volume), acetone was added as a solubilizer to 10% (v / v). Using engineered bacteria as raw material, 50 mL of the supernatant (approximately 5 g bacterial equivalent) of the Bayer-Villiger monooxygenase and esterase fusion protein (SEQ ID NO. 21) was reacted with 7.6 mM farnesylacetone (2 g / L). The farnesylacetone conversion rate was approximately 90% within 20 hours.

[0115] Without using naturally occurring GDH in E. coli as a cofactor circulation system, in the presence of 50 mM Tris-HCl buffer (pH 8.5), 10 mM NADPH, and 25 mM glucose (150 mL total volume), acetone was added as a solubilizer to 10% (v / v). Using engineered bacteria as raw material, 50 mL of Bayer-Villiger monooxygenase and alcohol dehydrogenase fusion protein (SEQ ID NO.18) supernatant (approximately 5 g cell equivalent) and 5 mL of esterase (SEQ ID NO.4) supernatant (approximately 0.5 g cell equivalent) were reacted with 7.6 mM farnesylacetone (2 g / L). The farnesylacetone conversion rate was approximately 76% within 20 hours.

[0116] Without using naturally occurring GDH as a cofactor circulation system in E. coli, in the presence of 50 mM Tris-HCl buffer (pH 8.5), 10 mM NADPH, and 25 mM glucose (150 mL total volume), acetone was added as a solubilizer to 10% (v / v). Using engineered bacteria as raw material, 50 mL of Bayer-Villiger monooxygenase and alcohol dehydrogenase fusion protein (SEQ ID NO.19) supernatant (approximately 5 g cell equivalent each) and 5 mL of esterase (SEQ ID NO.4) supernatant (approximately 0.5 g cell equivalent) were reacted with 7.6 mM farnesylacetone (2 g / L). The farnesylacetone conversion rate was approximately 81% within 20 hours.

[0117] Example 6: Comparison of specific enzyme forms in Bayer-Villiger monooxygenase and esterase-catalyzed reactions

[0118] Using engineered bacteria as raw material, 5 mL of BVMO and 5 mL of whole cells, the lysed crude extract, and the crude extract supernatant (each approximately 0.5 g cell equivalent) were added, along with 0.2 g of farnesylacetone. In the reaction, conducted in 50 mM Tris-HCl buffer (pH 8.5) with 7.6 mM farnesylacetone (2 g / L), 10 μM NADPH, 2 g / L BVMO, 2 g / L GDH, and 25 mM glucose (5 mL, 30℃, 900 rpm), isopropanol was added to 10% (v / v). The formation of high farnesol was detected by GC-MS. As shown in Figure 3, with the same substrate volume, the product formation in the E. coli crude extract supernatant was greater than that in the whole cell catalysis, and the product formation after cell lysis was significantly greater than that after whole cell catalysis. This suggests that the substrate farnesylacetone may be difficult to enter the cells due to its unfavorable oil-water distribution coefficient. Therefore, this invention employs an in vitro biocatalytic method using crude enzyme extracts, without the participation of living cells in the transformation, thus bypassing the problem of substrates being unable to enter cells or the growth-inhibiting effect of substrates on cells, and improving the practicality of this route on an industrial scale.

[0119] Example 7: Bayer-Villiger monooxygenase, esterase, and SHC cyclase were used in combination in the presence of a cofactor cycle to directly convert the substrate farnesylacetone to ambroxol.

[0120] Using engineered bacteria as raw materials, 5 mL of BVMO (SEQ ID NO.2) and 5 mL of crude esterase (SEQ ID NO.4) extract supernatant (approximately 0.5 g cell equivalent each) were taken, along with 5 mL of SHC enzyme reaction supernatant (approximately 0.5 g cell equivalent, buffer system 0.1 M citric acid, pH 5.5). SDS was added to a final concentration of 0.06%. 0.2 g of farnesylacetone was added. In the reaction, conducted in 50 mM Tris-HCl buffer (pH 8.5) with 7.6 mM farnesylacetone (2 g / L), 10 mM NADPH, 2 g / L GDH, and 25 mM glucose, isopropanol was added to a final concentration of 10% (v / v). The reaction was carried out at 35°C and 180 rpm for 10 h. The reaction product was detected using the gas chromatography method described in Example 2, and ambroxol was observed.

[0121] The Bayer-Villiger monooxygenase and esterase from *Rhizopus rubrum* are in the form of *E. coli* crude extract supernatant, and the SHC cyclase is in the form of *E. coli* crude extract, ensuring the hydrophobic environment required for its function as a membrane-embedded protein. Since the key enzymes in the catalytic system—Bayer-Villiger monooxygenase, esterase, and SHC cyclase—are not cis-selective, the presence of the cis-farnesylacetone isomer in the substrate can generate the cis-hofarnesol intermediate. After cyclization by the SHC enzyme, four optical isomers and / or isomers of ambroxol can be produced, as shown in the following formula:

[0122] Using engineered bacteria as raw materials, 5 mL of BVMO (SEQ ID NO. 2) and 5 mL of crude extract supernatant of esterase (SEQ ID NO. 4) (approximately 0.5 g cell equivalent each) were taken, along with 5 mL of SHC enzyme (SEQ ID NO. 8) reaction supernatant (approximately 0.5 g cell equivalent, buffer system 0.1 M citric acid, pH 5.5). SDS was added to a final concentration of 0.06%. 0.2 g of farnesylacetone was added. In the reaction, conducted in 50 mM Tris-HCl buffer (pH 8.5) with 7.6 mM farnesylacetone (2 g / L), 10 mM NADPH, 2 g / L GDH, and 25 mM glucose, isopropanol was added to a final concentration of 10% (v / v). The reaction was carried out at 35°C and 180 rpm for 10 h. The reaction product was detected using the gas chromatography method described in Example 2, and ambroxol was observed with a yield of 98.8%.

[0123] Similarly, using engineered bacteria as raw materials, 5 mL of BVMO (SEQ ID NO.2) and 5 mL of crude extract supernatant (approximately 0.5 g cell equivalent each) were taken, along with other SHC enzyme mutants SEQ ID NO.9-17. Ambroxol yield data were observed under the above reaction conditions, and the yield data are as follows:

[0124] Table 1

[0125] As shown in Figure 4, Bayer-Villiger monooxygenase, esterase, and SHC cyclase converted the substrate farnesylacetone to ambroxol in the presence of a cofactor cycling system. The chromatographic peaks of the four theoretical ambroxol isomers are marked with arrows. It is evident that ambroxol is the absolute main product and can be separated from the other three isomers by recrystallization to obtain optically pure ambroxol.

[0126] Example 8: Screening of squalene-hopaene cyclase mutants in catalytic systems

[0127] This squalene-hopaene cyclase mutant is obtained by performing the aforementioned combinatorial mutations on the amino acid sequence of the original squalene-hopaene cyclase, resulting in directional structural and functional changes in the amino acids and their related nucleotide sequences. This yields an optimized SHC enzyme mutant adapted to the chemical-enzyme catalytic system of this invention, which is beneficial for industrial production. Specifically:

[0128] The coding gene of the squalene-hopaene cyclase mutant and the expression vector pET28a(+) of *E. coli* were ligated using a seamless cloning kit to obtain a recombinant plasmid containing the coding gene of the squalene-hopaene cyclase mutant. For example, in this embodiment of the invention, one of the recombinant plasmids is represented as pET28a-SHC_M1. The recombinant plasmid pET28a-SHC_M1 was transformed into *E. coli* BL21(DE3) recipient bacteria and plated on LB agar plates containing kanamycin (50 mg / L). The plates were then incubated at 37°C for 12 h to allow single colonies to grow. Single colonies were randomly picked and cloned, then inoculated into LB liquid medium and incubated for 12 h. The plasmid was then extracted and sequenced. Based on the sequencing results, the genetically engineered bacteria were screened and represented as the positive clone *E. coli* BL21(DE3) / pET28a-SHC1.

[0129] The genetically engineered bacteria were inoculated into 4 mL of LB medium containing 50 mg / L kanamycin and initially cultured at 37°C and 200 rpm for 12 h. The initially cultured genetically engineered bacteria were then inoculated into 30 mL of fresh TB medium containing 50 mg / L kanamycin at a 1 vt.% inoculation rate and cultured at 37°C and 200 rpm until the optical density (OD600) reached 0.6-0.8. Isopropyl-β-D-thiogalactopyranoside (IPTG) inducer was then added to a final concentration of 0.1 mM and induced for 16 h at 18°C ​​and 200 rpm. Finally, the bacterial cells were collected by centrifugation at 5000 × g for 5 min, resuspended and washed with Tris-SO4 buffer at pH 7.0, and centrifuged at 13000 × g for 1 min to collect the wet bacterial cells, which were then stored at -20°C for later use.

[0130] Using engineered bacteria as raw material, 5 mL of BVMO and 5 mL of crude esterase extract supernatant (approximately 0.5 g cell equivalent each) were taken, along with 5 mL of SHC enzyme reaction supernatant (approximately 0.5 g cell equivalent, buffered in 0.1 M citric acid, pH 5.5). SDS was added to a final concentration of 0.06%. 0.2 g of farnesylacetone was added. In the reaction, conducted in 50 mM Tris-HCl buffer (pH 8.5) with 7.6 mM farnesylacetone (2 g / L), 10 μM NADPH, 2 g / L BVMO, 2 g / L GDH, and 25 mM glucose, isopropanol was added to a final concentration of 10% (v / v). The reaction was carried out at 35°C and 180 rpm for 10 h. The reaction product was detected by GC-MS, and ambroxol was observed. During the shaking reaction, 0.2 mL samples were taken periodically, and 0.8 mL of hexane:isopropanol (v:v = 2:1) was added to the samples for extraction. The samples were then analyzed and detected by GC-FID.

[0131] In this embodiment, the content of the product was analyzed by gas chromatography. The specific experimental conditions included: a chromatographic column of 30 mm × 0.32 mm × 0.25 mm was used; nitrogen was used as the carrier gas; and the detector temperature was 250 °C. The column temperature was increased at a rate of 15 °C / min from 100 °C to 200 °C, and at a rate of 120 °C / min from 200 °C to 240 °C. The column temperature was maintained at 240 °C for 4 min.

[0132] Figure 5 is a comparison of the enzyme activity and catalytic yield of the original and mutant squalene-hopaene cyclase provided in the embodiments of the present invention. The figure shows some variants that participated in the screening experiment. The effects of some mutants with excellent performance are presented in Tables 1 and 2. However, the mutant numbers in Tables 1 and 2 are not consistent with the column numbers in Figure 5. The numbers in the tables above, such as mutant 1, mutant 2, etc., are only used to distinguish different mutants and do not represent the experimental order, the order of the columns in the figure, or the level of activity. Under the same reaction conditions, substrate concentration, and enzyme dosage, the enzyme activity was quantified by the mean plus standard deviation of the product peak area. All results were obtained from three biologically parallel experiments.

[0133] As shown in the figure, the specific activity of the genetically engineered bacteria containing some squalene-hopaene cyclase mutants is 0.5 times that of the original squalene-hopaene cyclase, indicating that the squalene-hopaene cyclase mutants contained in these genetically engineered bacteria possess high specific activity. Furthermore, since the evaluation of the specific activity of squalene-hopaene cyclase is conducted within the specific catalytic system described in this invention, such as within a certain pH, temperature, buffer system, and cofactor concentration range, optimized SHC enzyme mutants adapted to the chemical-enzyme catalytic system of this invention can be obtained. The data shown in this figure are only representative data from one batch of experiments. The preferred squalene-hopaene cyclase mutants were verified multiple times, resulting in SHC enzyme mutants SEQ ID NO. 8-17. The mutation numbers marked in the figure have different meanings than the SHC enzyme mutant SEQ ID numbers.

[0134] Example 9: Coupling of Nerolidol Distillation and Farnesylacetone Chemical Synthesis

[0135] 22.2 g (0.1 mol) of crude nerolidol extract and 0.2 g (0.01 mol) of aluminum isopropoxide were added to a 500 mL round-bottom flask equipped with a fractionating column. Triphenylphosphine palladium (0.005 mol, 5 mol%) was added. Under nitrogen protection, the reaction system was heated to 55 °C, and 14.3 g (0.11 mol) of ethyl acetoacetate was added dropwise. The reaction temperature was maintained at 130 °C during the dropwise addition. Low-boiling-point substances distilled off during the reaction. After the dropwise addition was complete, the system temperature was maintained at 55 °C for 2 hours until CO2 was released. The reaction was quenched with an equal volume of water, and the mixture was extracted with ethyl acetate. The crude product was used directly for analysis or for further reaction. The sample was collected under reduced pressure at 166-168℃ and 333 kPa, with a yield of 93% and a refractive index (20℃) of 1.4813. 300MHz 13C-NMR (CDCl3): δ (ppm, TMS) = 208.8, 136.4, 135.0, 131.3, 124.4, 124.0, 122.5, 43.8, 39.7, 39.6, 29.9, 26.8, 26.5, 25.5, 22.5, 17.7, 16.0.

[0136] Example 10: Ambroxol synthesized from biosynthesized nerolidol using a one-pot chemical-enzymatic method.

[0137] The chemical-enzymatic catalytic synthesis route for ambroxol described in this invention is shown in Figure 6. This route begins with the biosynthetic terpene compound trans-nerolidol, and first synthesizes farnesylacetone via a simple one-step chemical transformation carroll rearrangement. A novel multi-enzyme cascade in vitro catalytic system is used, directly yielding the final product ambroxol in a "one-pot" process without separating reaction intermediates. Specifically, a Bayer-Villiger monooxygenase from *Heterodactylus auricula-judae* catalyzes the conversion of farnesylacetone to high-farnesol acetate, while an esterase, also from *Heterodactylus auricula-judae*, catalyzes the deacetylation of high-farnesol acetate to EE-high-farnesol, which serves as the substrate for the squalene-hopaene cyclase (SHC)-mediated cyclization reaction. This invention also utilizes an SHC mutant, enhancing the catalytic activity and compatibility with the existing catalytic system, ensuring high substrate conversion rates within this system.

[0138] Specifically, starting from the crude extract of nerolidol obtained through biosynthesis, the distillation of nerolidol is coupled with the chemical synthesis of farnesylacetone according to the method in Example 8 to obtain farnesylacetone in one step. Then, using this as a substrate, ambroxol is synthesized from farnesylacetone using a chemical-enzymatic "one-pot" method according to the method in Example 3, employing key enzymes required for the catalytic system, such as Bayer-Villiger monooxygenase, alcohol dehydrogenase, esterase, SHC enzyme, or fusion proteins of key enzymes from *Rhizopus rubrum*. Preferably, the method described in Example 8 can screen for squalene-hopaene cyclase mutants that are more compatible with the catalytic system; these mutants exhibit higher specific activity, which is beneficial for industrial production.

[0139] Starting from the crude extract of nerolidol obtained through biosynthesis, the distillation of nerolidol was coupled with the chemical synthesis of farnesylacetone in a one-step process, following the method in Example 8. Using this as a substrate, key enzymes required for the catalytic system, such as Bayer-Villiger monooxygenase (SEQ ID NO. 2), alcohol dehydrogenase (SEQ ID NO. 7), esterase (SEQ ID NO. 4), and SHC enzyme (SEQ ID NO. 8) from *Rhodotorula rubrum*, were expressed according to the method in Example 3. Ambroxol was then synthesized from farnesylacetone using a one-pot chemical-enzymatic method, following the method in Example 7, with a yield of 89.9%.

[0140] Similarly, using a fusion protein of Bayer-Villiger monooxygenase and esterase (SEQ ID NO.21), alcohol dehydrogenase (SEQ ID NO.7), and SHC enzyme (SEQ ID NO.8), ambroxol was synthesized from farnesylacetone using a chemical-enzymatic "one-pot" method according to the method of Example 7, with a yield of 82%.

[0141] Similarly, using engineered bacteria as raw materials, Bayer-Villiger monooxygenase (SEQ ID NO.2), alcohol dehydrogenase (SEQ ID NO.7), esterase (SEQ ID NO.4), and SHC enzyme (SEQ ID NO.8-17) were synthesized from farnesylacetone using a chemical-enzymatic "one-pot" reaction according to the method of Example 7. Under the above reaction conditions, the yield of ambroxol was observed, and the yield data are as follows:

[0142] Table 2

[0143] Example 11: Bayer-Villiger monooxygenase from *Rhodotorula rubrum* catalyzes the conversion of methylheptenone to methyl-3-penten-1-ol.

[0144] Using GDH as a cofactor cycling system, the substrate profile of Bayer-Villiger monooxygenase from *Rhizopus rubrum* was tested under optimized reaction conditions: In the presence of 50 mM Tris-HCl buffer (pH 8.5), 10 μM NADPH, 2 g / L GDH, and 25 mM glucose (150 mL total volume), acetone was added as a co-solvent to 10% (v / v). Using engineered bacteria as raw material, 50 mL of BVMO (SEQ ID NO.2, approximately 5 g cell equivalent) was reacted with 7.6 mM methylheptenone. After 20 hours, the Bayer-Villiger oxidation and spontaneous ester hydrolysis products, methyl-3-penten-1-ol, were observed, with a methylheptenone conversion rate of approximately 99%. As shown in Figure 7, using methylheptenone as a substrate, the supernatant of crude extract of *E. coli* expressing BVMO (SEQ ID NO.2) was co-incubated under suitable conditions. The resulting product was obtained by gas chromatography-mass spectrometry (GC-MS) chromatogram, with the arrow in the mass spectrum indicating the molecular ion peak.

[0145] Example 12: Bayer-Villiger monooxygenase from *Rhodotorula rubrum* catalyzes the conversion of trans-geranylacetone to 4,8-dimethylnon-3,7-dien-1-ol acetate and 4,8-dimethylnon-3,7-dien-1-ol.

[0146] Using GDH as a cofactor cycling system, the substrate profile of Bayer-Villiger monooxygenase from *Rhodotorula rubrum* was tested under optimized reaction conditions: Acetone was added as a cosolvent to 10% (v / v) in 150 mL of 50 mM Tris-HCl buffer (pH 8.5), 10 μM NADPH, 2 g / L GDH, and 25 mM glucose. Using engineered bacteria as raw material, 50 mL of BVMO (SEQ ID NO.2, approximately 5 g cell equivalent) was reacted with 7.6 mM trans-geranylacetone. After 20 hours, the Bayer-Villiger oxidation product 4,8-dimethylnon-3,7-dien-1-ol acetate and the spontaneous ester hydrolysis product 4,8-dimethylnon-3,7-dien-1-ol were observed, with a trans-geranylacetone conversion rate of approximately 86%. As shown in Figure 8, trans-geranylacetone was used as a substrate and co-incubated with the supernatant of crude extract of Escherichia coli expressing BVMO (SEQ ID NO.2) under suitable conditions. The resulting product was obtained by gas chromatography-mass spectrometry (GC-MS) chromatogram, and the arrow in the mass spectrum indicates the molecular ion peak.

[0147] The above embodiments are merely exemplary and do not constitute any limitation on the scope of the present invention. Those skilled in the art should understand that modifications or substitutions can be made to the details and form of the technical solutions of the present invention without departing from the spirit and scope thereof, but all such modifications and substitutions fall within the protection scope of the present invention.

Claims

1. A Bayer-Villiger monooxygenase and its naturally co-expressed esterase and alcohol dehydrogenase, characterized in that, The amino acid sequence of the Bayer-Villiger monooxygenase is shown in SEQ ID NO:3, the amino acid sequence of the esterase is shown in SEQ ID NO:4-6, and the amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO:

7.

2. A fusion protein, characterized in that, The Bayer-Villig monooxygenase is fused with an alcohol dehydrogenase or a Bayer-Villig monooxygenase with an esterase using a flexible linker pair, wherein the amino acid sequence of the Bayer-Villig monooxygenase is selected from one of SEQ ID NO:1-3, the amino acid sequence of the esterase is selected from one of SEQ ID NO:4-6, and the amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO:

7.

3. The fusion protein according to claim 2, characterized in that, The amino acid sequence of the Bayer-Villiger monooxygenase and alcohol dehydrogenase fusion protein is shown in SEQ ID NO:18-19, and the amino acid sequence of the Bayer-Villiger monooxygenase and esterase fusion protein is shown in SEQ ID NO:20-21.

4. A method for converting farnesylacetone to EE-high farnesol, characterized in that, The method comprises the following steps: Step 1: Bayer-Villiger monooxygenase catalyzes the conversion of farnesylacetone to high farnesol acetate in the presence of a cofactor, wherein the amino acid sequence of the Bayer-Villiger monooxygenase is selected from one of SEQ ID NO: 1-3; Step 2: Esterase catalyzes the deacetylation of high farnesol acetate to obtain EE-high farnesol, wherein the amino acid sequence of the esterase is selected from one of SEQ ID NO: 4-6.

5. The method for converting farnesylacetone to EE-high farnesol according to claim 4, characterized in that, The specific forms of the Bayer-Villiger monooxygenase and esterase are the supernatant of crude Escherichia coli extract.

6. The method for converting farnesylacetone to EE-high farnesol according to claim 4, characterized in that, The cofactor is selected from NADH and NADPH or a combination thereof.

7. The method for converting farnesylacetone to EE-high farnesol according to claim 6, characterized in that, The method includes a cofactor regeneration system.

8. The method for converting farnesylacetone to EE-high farnesol according to claim 7, characterized in that, The cofactor regeneration system is an alcohol dehydrogenase / isopropanol cofactor regeneration system, and the amino acid sequence of the alcohol dehydrogenase is shown in SEQ ID NO:

7.

9. A method for converting farnesylacetone to EE-high farnesol, characterized in that, The method includes the following steps: in the presence of a cofactor, using a fusion protein selected from the Bayer-Villiger monooxygenase and esterase of claim 3, to catalyze the conversion of farnesylacetone to EE-hofarnesol.

10. A method of converting farnesyl acetone to ambrox, characterized in that, The method comprises the following steps: Step 1: Bayer-Villiger monooxygenase catalyzes the conversion of farnesylacetone to high-farnesol acetate in the presence of a cofactor, wherein the amino acid sequence of the Bayer-Villiger monooxygenase is selected from one of SEQ ID NO: 1-3; Step 2: Esterase catalyzes the deacetylation of high-farnesol acetate to obtain EE-high-farnesol, wherein the amino acid sequence of the esterase is selected from one of SEQ ID NO: 4-6; Step 3: EE-high-farnesol is enzymatically converted to ambroxol using a squalene-hopaene cyclase mutant, wherein the amino acid sequence of the squalene-hopaene cyclase mutant is selected from one of SEQ ID NO: 8-17.

11. A gene encoding a polypeptide according to any one of claims 1 to 10. The gene encodes the Bayer-Villiger monooxygenase of claim 1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO:

24.

12. A gene encoding a polypeptide according to any one of claims 1 to 11. The gene encodes the esterase of claim 1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO:25-27.

13. A gene encoding a polypeptide according to any one of claims 1 to 12. The gene encodes the alcohol dehydrogenase of claim 1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO:

28.

14. A gene encoding a polypeptide according to any one of claims 1 to 13. The gene encodes the fusion protein of Bayer-Villiger monooxygenase and co-expressed alcohol dehydrogenase as described in claim 3, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO:39-40.

15. A gene encoding a gene, characterized in that, The gene encodes the fusion protein of Bayer-Villiger monooxygenase and esterase as described in claim 3, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO:41-42.

16. A recombinant plasmid, characterized in that, The recombinant plasmid contains the gene encoding Bayer-Villiger monooxygenase as described in claim 11, and the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO:

45.

17. A recombinant plasmid, characterized in that, The recombinant plasmid contains the gene encoding the esterase as described in claim 12, and the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO:46-48.

18. A recombinant plasmid, characterized in that, The recombinant plasmid contains the gene encoding alcohol dehydrogenase as described in claim 13, and the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO:

49.

19. A recombinant plasmid, characterized in that, The recombinant plasmid contains the gene encoding the fusion protein of Bayer-Villiger monooxygenase and co-expressed alcohol dehydrogenase as described in claim 14, and the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO:60-61.

20. A recombinant plasmid, characterized in that, The recombinant plasmid contains the gene encoding the fusion protein of Bayer-Villiger monooxygenase and esterase as described in claim 15, and the nucleotide sequence of the recombinant plasmid is shown in SEQ ID NO:62-63.

21. A genetically engineered bacterium, characterized in that, The genetically engineered bacteria comprises the recombinant plasmid as described in any one of claims 16-20.

22. The use of the genetically engineered bacteria of claim 21 in the synthesis of terpene-derived compounds containing a non-classical number of carbon atoms by converting linear polyunsaturated branched ketone substrates into corresponding acetates and alcohols with carbon chains shortened by two carbon atoms, and by enzymatic cyclization using squalene-hopaene cyclase.

23. The use according to claim 22, characterized in that, The linear polyunsaturated branched ketone is farnesylacetone, and the terpene-derived compound containing a non-classical number of carbon atoms is ambroxol.

24. A method of converting nerolidol to ambrox, characterized in that, The method includes the following steps: Step 1 begins with trans-nerolidol, followed by a carroll rearrangement reaction to synthesize farnesylacetone. The distillation of nerolidol is coupled with the chemical synthesis of farnesylacetone. Step 2 involves Bayer-Villiger monooxygenase catalyzing the conversion of farnesylacetone to high farnesol acetate in the presence of a cofactor, wherein the amino acid sequence of the Bayer-Villiger monooxygenase is selected from one of SEQ ID NO: 1-3; Step 3: The esterase catalyzes the deacetylation of gafarnesol acetate to obtain EE-gafarnesol, and the amino acid sequence of the esterase is selected from one of SEQ ID NO:4-6; Step 4: The EE-gafarnesol is enzymatically converted to ambroxol using a squalene-hopaene cyclase mutant, and the amino acid sequence of the squalene-hopaene cyclase mutant is selected from one of SEQ ID NO:8-17.