Novel heterocyclic compound

Abstract

The present invention provides a p53 mutant reactivation agent, a preparation method therefor, and use thereof. The present invention provides a compound of formula (IV) and a pharmaceutically acceptable salt, a solvate, a deuterated compound, a polymorph, or an isomer thereof, pharmaceutical compositions comprising these compounds, and use of such compounds and compositions in the treatment of related diseases.

Description

A novel heterocyclic compound

[0001] Cross-references

[0002] This application claims Chinese Patent Application No. 202510121302.2, filed January 24, 2025, entitled "A Novel Heterocyclic Compound"; Chinese Patent Application No. 202510143308.X, filed February 8, 2025, entitled "A Novel Heterocyclic Compound"; Chinese Patent Application No. 202510271894.6, filed March 7, 2025, entitled "A Novel Heterocyclic Compound"; Chinese Patent Application No. 202510412916.6, filed April 2, 2025, entitled "A Novel Heterocyclic Compound"; and Chinese Patent Application No. 202510271894.6, filed May 14, 2025, entitled "A Novel Heterocyclic Compound". The priority of Chinese Patent Application No. 622855.6, Chinese Patent Application No. 202510883889.0 entitled "A Novel Heterocyclic Compound" filed on June 27, 2025, Chinese Patent Application No. 202510961425.7 entitled "A Novel Heterocyclic Compound" filed on July 11, 2025, Chinese Patent Application No. 202511220742.X entitled "A Novel Heterocyclic Compound" filed on August 28, 2025, and Chinese Patent Application No. 202511534513.5 entitled "A Novel Heterocyclic Compound" filed on October 24, 2025, the entire disclosure of which is incorporated herein by reference. Technical Field

[0003] This invention relates to compounds targeting p53 mutants, pharmaceutical compositions comprising said compounds, methods for preparing said compounds, and the use of said compounds in treating diseases associated with p53 mutants. Background Technology

[0004] p53 gene mutations are the most common mutations in human tumors, occurring in over 50% of cancer patients. The p53 gene, named for its encoding of a 53 kDa protein, is a tumor suppressor gene. Studies have shown that p53, as an important tumor suppressor transcription factor, can be activated under stress stimuli such as hypoxia and DNA damage. It regulates multiple downstream target genes, including ATM, ATR, E2F, and KAT5, to induce cell cycle arrest, apoptosis and senescence, participate in DNA damage repair, immune responses, and regulate cellular metabolism, thereby inhibiting tumor development and progression. However, mutations in p53 can alter the DNA-binding specificity of wild-type p53, disrupt its spatial conformation and thermodynamic stability, leading to loss of activity. Mutations can also negatively regulate p53 function and inactivate its family of tumor suppressor factors, p63 and p73. Misfolded p53 can also bind to other transcription factors in the cytoplasm, thereby activating or inactivating various signaling pathways such as NF-κB and NRF2. These changes can enhance the invasive and migratory abilities of tumor cells and promote angiogenesis, thereby leading to tumor development, spread, and increased resistance to anticancer drugs.

[0005] p53 mutations include various forms such as missense mutations, frameshift mutations, and nonsense mutations. In human cancers with p53 gene mutations, 75% are missense mutations, which frequently occur in the DBD region of p53. Among them, hotspot mutations with high mutation rates include R175H, R248Q / W, R273H / C, and Y220C, etc.

[0006] p53Y220C is one of the most common p53 mutations, accounting for 1.0-1.5% of all cancer patients, including those with gastric cancer, ovarian cancer, breast cancer, colorectal cancer, pancreatic cancer, and lung cancer. It is estimated that more than 100,000 new cancer patients carrying p53Y220C are diagnosed globally each year, and there are currently no approved drugs. p53Y220C is a unique mutation; high-resolution crystal structure analysis shows a targetable gap near the Y220C mutation site, a characteristic that provides favorable conditions for small molecule targeted research. PC14586 has been reported as a small molecule reactivator targeting the p53Y220C mutant, developed by PMV Pharmaceuticals. However, there is still an urgent need in the field to develop novel small molecule reactivators targeting p53 mutants (such as the Y220C mutant) with high activity and low toxicity. Summary of the Invention

[0007] This invention provides a p53 mutant reactivator, which is a compound represented by general formula (IV) or a pharmaceutically acceptable salt, solvate, deuterated compound, polymorph, or isomer thereof. This invention also provides a series of compounds represented by general formula (IV) and their pharmaceutically acceptable salts, solvates, deuterated compounds, polymorphs, or isomers, pharmaceutical compositions comprising these compounds, and the use of such compounds to treat diseases associated with p53 mutants.

[0008] In one aspect, the present invention provides compounds of formula (IV) or pharmaceutically acceptable salts, solvates, deuterated derivatives, polymorphs or isomers thereof.

[0009] in,

[0010] Ring A is an aromatic ring.

[0011] X1 is N, CH, or CF.

[0012] X 10 For N, CH, or CF,

[0013] X 11 For N, CH, or CF,

[0014] X9 uses CS-CF3.

[0015] R is or One, two, or all three of X3, X4, and X5 are N, and the rest are C or CH. Furthermore, when X3 is C or CH, X4 and X5 cannot both be N simultaneously.

[0016] The E ring is a benzene ring or a 6-membered heteroaromatic ring.

[0017] Ring B and ring C are fused together.

[0018] Ring B is a benzene ring or a 5-6 membered heteroaryl ring.

[0019] The C ring is a 5-7 membered heterocyclic ring.

[0020] The D ring is a 5-membered heteroaryl ring.

[0021] The C ring is optionally oxidized by oxygen, and the C ring is optionally oxidized by halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl groups, -(CO)-NR7R8, -(CO)-OR7, -(CO)-R 23-(CO)-OR7, -(SO2)-NR7R8, or -NR 24 -(SO2)-R 23 replace,

[0022] The E and B rings are optionally converted by halogens, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl groups, -(CO)-NR7R8, -(CO)-OR7, -(CO)-R 23 -(CO)-OR7, -(SO2)-NR7R8, or -NR 24 -(SO2)-R 23 replace;

[0023] R 21 It can be methyl, ethyl, or tert-butyl.

[0024] R 22 Halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl groups, -(CO)-NR7R8, -(CO)-OR7, -(CO)-R 23 -(CO)-OR7, -(SO2)-NR7R8, or -NR 24 -(SO2)-R 23 ,or

[0025] R 21 The propyl, isopropyl, butyl, isobutyl, 3-8 membered cycloalkyl, or 3-8 membered heterocyclic group is used, wherein the propyl, isopropyl, butyl, isobutyl, cycloalkyl, or heterocyclic group is optionally replaced by (C=O), halogen, -CN, -NH2, -OH, or C. 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution,

[0026] R 22 For H, halogens, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl groups, -(CO)-NR7R8, -(CO)-OR7, -(CO)-R 23 -(CO)-OR7, -(SO2)-NR7R8, or -NR 24 -(SO2)-R 23 ;

[0027] R 23 C 1-6 Alkyl, 3-8 membered cycloalkyl, or 3-8 membered heterocyclic group, wherein the alkyl, cycloalkyl, or heterocyclic group is optionally converted by halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution,

[0028] R 24 For H or C 1-6 alkyl,

[0029] L1 is -(CR3R4) p - R3 and R4 are independently H and C. 1-6 Alkyl or halogenated C 1-6 alkyl,

[0030] R2 is a 3-8 membered cycloalkyl group or a 3-8 membered heterocyclic group, wherein when the heterocyclic group contains S, the S atom is optionally oxidized to... or Furthermore, the cycloalkyl and heterocyclic groups are optionally replaced by (=O), halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl), -(CO)-NR7R8, -(CO)-OR7, or R 12 replace,

[0031] R 12 It is a 3-8 membered cycloalkyl, a 3-8 membered heterocyclic group, a 6-10 membered aryl, or a 5-12 membered heteroaryl, wherein when the heterocyclic group contains S, the S atom is optionally oxidized to Furthermore, the cycloalkyl, heterocyclic, aryl, and heteroaryl groups are optionally replaced by (=O), halogen, -CN, -NH2, -OH, or C. 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution,

[0032] R7 and R8 are independently H and C. 1-6 Alkyl or halogenated C 1-6 alkyl,

[0033] p is 0 or 1.

[0034] In some implementations, X1 is N or CH, X 10 For N or CH, X 11 It can be N or CH.

[0035] In some implementations, X 10 For CH, X 11 For CH,

[0036] R is One, two, or all three of X3, X4, and X5 are N, and the rest are C or CH. Furthermore, when X3 is C or CH, X4 and X5 cannot both be N simultaneously.

[0037] R 10 For H, C 1-6 Alkyl, 3-8 membered cycloalkyl, or 3-8 membered heterocyclic group, wherein the alkyl, cycloalkyl, or heterocyclic group is optionally converted by halogen, -CN, -NH2, -OH, or -OC. 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl group, 3-8 membered cycloalkyl group, or 3-8 membered heterocyclic group, wherein the alkyl group is optionally substituted with halogen, -CN, -NH2, -OH, or -OC. 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl), 3-8 membered cycloalkyl, or 3-8 membered heterocyclic substituted.

[0038] In some implementations, R 23 C 1-6 Alkyl, 3-8 membered cycloalkyl, or 3-8 membered heterocyclic group.

[0039] In some implementations, R 24 For H.

[0040] In some implementations, R 10 For H, C 1-6 Alkyl groups, or 3-8 membered cycloalkyl groups, wherein the alkyl and cycloalkyl groups are optionally converted by halogen, -CN, -NH2, -OH, -OC. 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl group, 3-8 membered cycloalkyl group, or 3-8 membered heterocyclic group, wherein the alkyl group is optionally substituted with halogen, -CN, -NH2, -OH, or -OC. 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl), 3-8 membered cycloalkyl, or 3-8 membered heterocyclic substituted.

[0041] In some implementations...

[0042] R is

[0043] Ring B is a benzene ring or a 5-6 membered heteroaromatic ring, and ring C is a 5-7 membered heterocyclic ring.

[0044] The C ring is optionally oxidized by oxygen, and the C ring is optionally oxidized by halogen, -CN, -NH2, -OH, C 1-6 Alkyl or halogenated C 1-6 Alkyl substitution.

[0045] In some implementations...

[0046] R is

[0047] R 10 As defined above.

[0048] In some embodiments, R2 is a 3-8 member nitrogen-containing heterocyclic group, wherein the heterocyclic group is optionally replaced by (=O), halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 alkyl), or R 12 replace,

[0049] R 12 It is a 3-8 membered cycloalkyl group or a 3-8 membered heterocyclic group, wherein when the heterocyclic group contains S, the S atom is optionally oxidized to Furthermore, the cycloalkyl and heterocyclic groups are optionally replaced by (=O), halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution.

[0050] In some embodiments, R2 is a 3-8 member nitrogen-containing heterocyclic group, wherein the heterocyclic group is optionally replaced by (=O), halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution.

[0051] In some implementations, X3 is N, and X1, X4, X5, X... 10 and X 11 For CH.

[0052] In some implementations, X4 is N, and X1, X3, X5, X... 10 and X 11 For CH.

[0053] In some implementations, X3 and X5 are N, and X1, X4, X... 10 and X 11 For CH.

[0054] In some implementations, X3 and X 10 Let N be the integers X1, X4, X5, and X. 11 For CH.

[0055] In some implementations, X5 is N, and X1, X3, X4, X... 10 and X 11 For CH.

[0056] In some implementations, X3 and X4 are N, and X1, X5, X... 10 and X 11 For CH.

[0057] In some implementations, X1 is N, and X3, X4, X5, X... 10 and X 11 For CH.

[0058] In some implementations, X1, X4, and X5 are N, and X3, X... 10 and X11 For CH.

[0059] In some implementations, p is 0.

[0060] In some embodiments, the present invention provides the following compounds

[0061] Or a pharmaceutically acceptable salt, solvate, deuterated, polymorph or isomer thereof.

[0062] In another aspect, the present invention provides a pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt, solvate, deuterated form, polymorph, or isomer thereof, and a pharmaceutically acceptable carrier.

[0063] In another aspect, the present invention provides a method for treating diseases associated with p53 mutants, the method comprising administering to a subject an effective amount of a compound of formula (I) or a pharmaceutically acceptable salt, solvate, deuterated form, polymorph or isomer thereof, or a pharmaceutical composition thereof.

[0064] In another aspect, the present invention provides the use of the compounds of the present invention or pharmaceutically acceptable salts, solvates, deuterated derivatives, polymorphs, or tautomers thereof, or pharmaceutical compositions thereof, in the preparation of medicaments for treating diseases associated with p53 mutants.

[0065] In some embodiments, the p53 mutant has mutations at amino acids Val143, His168, Arg175, Tyr220, Gly245, Arg248, Arg249, Phe270, Arg273, Arg282 and / or combinations thereof.

[0066] In some embodiments, the p53 mutant is V157F, R175H, Y220C, G245S, R248Q, R248W, R249S, R273H, R273C, R282W and / or a combination thereof, preferably Y220C.

[0067] In some embodiments, the disease associated with the p53 mutant is cancer; preferably, the cancer is lymphoma, leukemia, carcinoma, and sarcoma; for example, non-Hodgkin lymphoma, B-cell non-Hodgkin lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, follicular lymphoma, mucosa-associated lymphoid tissue lymphoma, marginal zone lymphoma, T-cell lymphoma, Hodgkin lymphoma, Burkitt lymphoma, multiple myeloma, chronic lymphocytic leukemia, small lymphocytic lymphoma, Waldenström macroglobulinemia, lymphocytic T-cell leukemia, chronic myeloid leukemia, hairy cell leukemia, acute lymphoblastic T-cell leukemia, plasma cell leukemia, etc. Cell tumors, immunoblastic large cell leukemia, megakaryocytic leukemia, acute megakaryocytic leukemia, promyelocytic leukemia, erythroleukemia, glioma, glioblastoma, breast cancer, colorectal cancer, prostate cancer, lung cancer, gastric cancer, endometrial cancer, melanoma, pancreatic cancer, liver cancer, kidney cancer, squamous cell carcinoma, ovarian cancer, sarcoma, osteosarcoma, thyroid cancer, bladder cancer, head and neck cancer, testicular cancer, Ewing's sarcoma, rhabdomyosarcoma, medulloblastoma, neuroblastoma, cervical cancer, kidney cancer, urothelial carcinoma, vulvar cancer, esophageal cancer, salivary gland cancer, nasopharyngeal carcinoma, buccal cancer, oral cancer, or gastrointestinal stromal tumors. Attached Figure Description

[0068] Figure 1 shows the in vivo efficacy of the compound in the human pancreatic cancer BxPC-3 xenograft model; wherein, Figure 1A is the curve of tumor volume change over time, and Figure 1B is the curve of body weight change over time.

[0069] Figure 2 shows the in vivo efficacy of the compound in the human gastric cancer NUGC-3 xenograft model; wherein, Figure 2A is the curve of tumor volume change over time, and Figure 2B is the curve of body weight change over time.

[0070] Figure 3 shows the in vivo efficacy of the compounds in the human liver cancer HUH-7 xenograft model; Figure 3A shows the tumor volume change over time, and Figure 3B shows the body weight change over time.

[0071] Invention Details

[0072] Exemplary embodiments utilizing the principles of the invention are set forth in the following detailed description of the invention. The features and advantages of the invention can be better understood by referring to the following summary of the invention.

[0073] It should be understood that the scope of protection of each aspect of the present invention is determined by the claims, and the methods and structures within the scope of these claims, as well as their equivalents, are all within the scope of these claims.

[0074] Unless otherwise defined, all technical terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which the subject matter of the claims pertains. Unless otherwise stated, all patents, patent applications, and publications cited in this document are incorporated herein in their entirety through reference.

[0075] It should be understood that the above summary and the following detailed description are exemplary and explanatory, and not intended to limit any subject matter of the invention. Unless otherwise specified, the singular form includes the plural form. Unless otherwise specified, the use of "or" or "or" means "and / or". Furthermore, the use of the term "comprising" and other forms such as "including," "containing," and "containing" are not limiting.

[0076] Some chemical terms

[0077] The terms “optional,” “optional,” or “optionally” mean that the event or condition described below may or may not occur, including both the occurrence and non-occurrence of the event or condition. For example, “optionally substituted alkyl” means “unsubstituted alkyl” or “substituted alkyl.” Furthermore, the optionally substituted group can be unsubstituted (e.g., -CH2CH3), fully substituted (e.g., -CF2CF3), monosubstituted (e.g., -CH2CH2F), or any level between monosubstituted and fully substituted (e.g., -CH2CHF2, -CF2CH3, -CFHCHF2, etc.). Those skilled in the art will understand that for any group containing one or more substituents, no substitution or substitution mode that is spatially impossible and / or cannot be synthesized is introduced.

[0078] Unless otherwise stated, conventional methods within the scope of the art, such as mass spectrometry, nuclear magnetic resonance, high-performance liquid chromatography, infrared and ultraviolet / visible spectroscopy, and pharmacological methods, are employed. Unless specifically defined herein, the terminology, experimental procedures, and techniques used herein in analytical chemistry, organic synthetic chemistry, and pharmaceutical and medicinal chemistry are known in the art. Standard techniques can be used in chemical synthesis, chemical analysis, drug preparation, formulation and delivery, and patient treatment. For example, reactions and purifications can be carried out using the manufacturer's instructions for use of reagent kits, or in accordance with methods known in the art or the description of this invention. The techniques and methods described herein are generally carried out according to conventional methods well known in the art, based on descriptions in several summary and more specific documents cited and discussed herein. In this specification, groups and their substituents can be selected by those skilled in the art to provide stable structural moieties and compounds.

[0079] When a substituent is described using a conventional chemical formula written from left to right, it also includes chemically equivalent substituents obtained when the structural formula is written from right to left. For example, -CH2O- is equivalent to -OCH2-.

[0080] As used in this article, the terms "group" and "chemical group" refer to a specific part or functional group of a molecule. Chemical groups are often considered as chemical entities that are embedded in or attached to a molecule.

[0081] Some chemical groups named herein may be indicated by abbreviations to represent the total number of carbon atoms. For example, C1-C6 alkyl describes an alkyl group having a total of 1 to 6 carbon atoms, as defined below. The total number of carbon atoms indicated by the abbreviations does not include carbon atoms on possible substituents.

[0082] The terms “halogen,” “halogenated,” or “halide,” used alone or in combination in this article, refer to bromine, chlorine, fluorine, or iodine.

[0083] The compounds of the present invention may contain one or more (e.g., one, two, three, or four) isotopic substitutions. For example, in said compounds, H may be any isotopic form, including 1 H, 2 H (D or deuterium) and 3 H (T or tritium); C can be any isotopic form, including 12 C 13 C and 14 C and O can be any isotopic form, including 16 O and 18 O etc.

[0084] As used alone or in combination herein, the terms "aromatic," "aromatic ring," "aromatic ring," "aromatic," "aromatic," and "aromatic ring" refer to a planar ring or ring portion of one or more rings having a delocalized electronic conjugated system containing 4n+2 electrons, where n is an integer. An aromatic ring can be formed from 5, 6, 7, 8, 9, or more than 9 atoms. Aromatic compounds can be optionally substituted and can be monocyclic or polycyclic with fused rings. The term aromatic compound includes all carbocyclic rings (such as benzene rings) and rings containing one or more heteroatoms (such as pyridine).

[0085] The term "heteroatom" or "hetero" as used alone or in combination herein refers to an atom other than carbon and hydrogen. Heteroatoms are independently selected from, but not limited to, oxygen, nitrogen, sulfur, phosphorus, silicon, selenium, and tin. In embodiments where two or more heteroatoms are present, the two or more heteroatoms may be identical to each other, or some or all of the two or more heteroatoms may be different from each other.

[0086] The term “dense” or “dense ring” as used alone or in combination in this article refers to a ring structure in which two or more rings share one or more bonds.

[0087] The term “spiral” or “spiroring” as used alone or in combination in this article refers to a ring structure in which two or more rings share one or more atoms.

[0088] The term "alkyl" as used alone or in combination herein refers to a monovalent saturated hydrocarbon with optional substituted straight or optional substituted branched chains having 1-12 carbon atoms, preferably 1-8 carbon atoms, more preferably 1-6 carbon atoms, and connected to other parts of the molecule by single bonds, such as methyl, ethyl, n-propyl, isopropyl, n-butyl, isobutyl, sec-butyl, tert-butyl, n-pentyl, n-hexyl, n-heptyl, 2-methylhexyl, 3-methylhexyl, n-octyl, n-nonyl, n-decyl, etc.

[0089] As used alone or in combination herein, the term "aryl" refers to a fully carbon monocyclic or fused ring having a fully conjugated π-electron system, having 6-14 carbon atoms, preferably 6-12 carbon atoms, and most preferably 6 carbon atoms. The aryl group can be unsubstituted or substituted with one or more substituents, examples of which include, but are not limited to, alkyl, alkyloxy, aryl, aralkyl, amino, halogen, hydroxyl, sulfonyl, sulfinyl, phosphoryl, and heterocyclic groups. Non-limiting examples of unsubstituted aryl groups include, but are not limited to, phenyl, naphthyl, and anthraceneyl.

[0090] As used alone or in combination herein, the terms "heteroaryl" and "heteroary ring" refer to a monocyclic or fused ring of 5-12 ring atoms, having 5, 6, 7, 8, 9, 10, 11, or 12 ring atoms, of which 1, 2, 3, or 4 are selected from N, O, and S, and the remaining ring atoms are C, and possessing a fully conjugated π-electron system. Heteroaryl groups can be unsubstituted or substituted, and the substituents include, but are not limited to, alkyl, alkyloxy, aryl, aralkyl, amino, halogen, hydroxyl, cyano, nitro, carbonyl, and heterocyclic groups. Non-limiting examples of unsubstituted heteroaryl groups include, but are not limited to, pyrrole, furanyl, thiophene, imidazolyl, oxazolyl, pyrazolyl, pyridyl, pyrimidinyl, pyrazinyl, quinolinyl, isoquinolinyl, tetrazolyl, and triazineyl.

[0091] The term "cycloalkyl" as used alone or in combination herein refers to a stable, monovalent, non-aromatic monocyclic or polycyclic hydrocarbon group containing only carbon and hydrogen atoms. It may include fused ring, spirocyclic, or bridged ring systems, containing 3-15 cyclic carbon atoms, preferably 3-10 cyclic carbon atoms, more preferably 3-8 cyclic carbon atoms, and may be saturated or unsaturated, linked to other parts of the molecule by single bonds. Non-limiting examples of "cycloalkyl" include, but are not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, and cycloheptyl.

[0092] The term "carbocyclic" as used alone or in combination herein refers to a stable, non-aromatic monocyclic or polycyclic hydrocarbon group containing only carbon and hydrogen atoms. It may include fused ring, spirocyclic, or bridged ring systems, containing 3-15 cyclic carbon atoms, preferably 3-10 cyclic carbon atoms, more preferably 3-8 cyclic carbon atoms, and may be saturated or unsaturated.

[0093] As used individually or in combination herein, the terms "heterocyclic alkyl," "heterocyclic group," and "heterocycle" refer to a stable 3-18 member monovalent non-aromatic ring comprising 2-12 carbon atoms and 1-6 heteroatoms selected from nitrogen, oxygen, and sulfur. Unless otherwise stated, the heterocyclic group can be a monocyclic, bicyclic, tricyclic, or tetracyclic system, which may contain fused rings, spirocyclic, or bridged ring systems. The nitrogen, carbon, or sulfur on the heterocyclic group may be selectively oxidized, the nitrogen atom may be selectively quaternized, and the heterocyclic group may be partially or completely saturated. A heterocyclic group can be connected to the rest of the molecule via a single bond through a carbon atom or heteroatom on the ring. Heterocyclic groups containing fused rings may contain one or more aromatic or heteroaromatic rings, provided that the atoms connected to the rest of the molecule are atoms from non-aromatic rings. For the purposes of this application, the heterocyclic group is preferably a stable 4-11 monovalent non-aromatic monocyclic or bicyclic ring containing 1-3 heteroatoms selected from nitrogen, oxygen, and sulfur; more preferably, it is a stable 4-8 monovalent non-aromatic monocyclic ring containing 1-3 heteroatoms selected from nitrogen, oxygen, and sulfur. Non-limiting examples of heterocyclic groups include azirheptanyl, azirheptanyl, decahydroisoquinolinyl, dihydrofuranyl, dihydroindolyl, dioxopentyl, 1,1-dioxo-thiomorpholinyl, imidazoalkyl, imidazolinyl, isothiazolyl, isoxazolyl, morpholinyl, octahydroindolyl, octahydroisoindolyl, oxazinyl, piperazinyl, piperidinyl, 4-piperidinoneyl, pyranyl, pyrazolyl, pyrrolidinyl, quinazinyl, quininecycloyl, tetrahydrofuranyl, tetrahydropyranyl, etc.

[0094] The terms "polymorph" or "polymorphism" as used alone or in combination herein refer to compounds of the present invention having multiple crystal lattice forms. Some compounds of the present invention may have more than one crystal form, and the present invention covers all polymorphs or mixtures thereof.

[0095] Intermediate compounds and polymorphs of the compounds of this invention are also within the scope of this invention.

[0096] Unless otherwise specified, the olefin double bonds contained in the compounds of this invention include E and Z isomers.

[0097] It should be understood that the compounds of the present invention may contain asymmetric centers. These asymmetric centers may independently be R or S configurations. Some compounds of the present invention may also exhibit cis-trans isomerism, which will be apparent to those skilled in the art. It should be understood that the compounds of the present invention include their individual geometric isomers and stereoisomers, as well as mixtures thereof, including racemic mixtures. These isomers can be isolated from mixtures thereof by implementing or modifying known methods, such as chromatography and recrystallization techniques, or they can be prepared separately from suitable isomers of their intermediates.

[0098] The term “pharmaceutically acceptable salt” as used alone or in combination in this article includes both salts with added acid salts and salts with added alkali salts.

[0099] As used alone or in combination herein, "pharmaceutically acceptable salts" refers to salts that retain the biological potency and properties of the free base of a compound, are not biologically or otherwise undesirable, and are formed with inorganic acids, such as, but not limited to, hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc., or organic acids, such as, but not limited to, acetic acid, 2,2-dichloroacetic acid, adipic acid, alginic acid, ascorbic acid, aspartic acid, benzenesulfonic acid, benzoic acid, decanoic acid, hexanoic acid, carbonic acid, cinnamic acid, citric acid, etc. "Pharmaceutically acceptable base salts" refers to salts that retain the biological potency and properties of the free acid of a compound, and are not biologically or otherwise undesirable. These salts are prepared by reacting a free acid with an inorganic or organic base. Salts formed by reacting with inorganic bases include, but are not limited to, sodium salts, potassium salts, lithium salts, ammonium salts, calcium salts, magnesium salts, iron salts, zinc salts, copper salts, manganese salts, aluminum salts, etc. Preferred inorganic salts are ammonium salts, sodium salts, potassium salts, calcium salts, and manganese salts.

[0100] Organic bases that form salts include, but are not limited to, primary amines, secondary amines, tertiary amines, and cyclic amines, such as ammonia, isopropylamine, trimethylamine, diethylamine, triethylamine, tripropylamine, ethanolamine, diethanolamine, ethanolamine, dicyclohexylamine, ethylenediamine, purines, piperazine, piperidine, choline, and caffeine. Particularly preferred organic bases are isopropylamine, diethylamine, ethanolamine, trimethylamine, dicyclohexylamine, choline, and caffeine.

[0101] Crystallization often produces solvates of the compounds of this invention. As used herein, the term "solvate" refers to a combination of one or more molecules of the compounds of this invention and one or more solvent molecules.

[0102] The solvent can be water, in which case the solvate is a hydrate. Alternatively, it can be an organic solvent. Therefore, the compounds of this invention can exist as hydrates, including monohydrates, dihydrates, hemihydrates, trihydrates, tetrahydrates, etc., and the corresponding solvated forms. The compounds of this invention can be true solvates, but in other cases, they may simply retain water or a mixture of water and some other solvents by chance. The compounds of this invention can react in a solvent or precipitate or crystallize in a solvent. The solvates of the compounds of this invention are also included within the scope of this invention.

[0103] The term "pharmaceutical composition" as used alone or in combination herein refers to a formulation containing the compounds of the present invention and a medium generally accepted in the art for delivering biologically active compounds to mammals, such as humans. Such a medium includes all pharmaceutically acceptable carriers.

[0104] As used in this article, the term "acceptable" in relation to formulations, compositions, or ingredients means that it does not have a lasting harmful effect on the overall health of the treated subject.

[0105] The term “pharmaceutically acceptable” as used alone or in combination herein means a substance (such as a carrier or diluent) that does not affect the biological activity or properties of the compounds of the present invention and is relatively non-toxic, i.e., that the substance can be administered to an individual without causing an adverse biological reaction or interacting adversely with any component contained in the composition.

[0106] The term “pharmaceutically acceptable carriers” as used alone or in combination herein includes, but is not limited to, adjuvants, carriers, excipients, auxiliaries, deodorants, diluents, preservatives, dyes / colorants, flavor enhancers, surfactants and wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, solvents, or emulsifiers that have been approved by the relevant government authorities for use in humans and domesticated animals.

[0107] As used herein, the terms “subject,” “patient,” “object,” or “individual” refer to an individual suffering from a disease, disorder, or symptom, including both mammals and non-mammals. Examples of mammals include, but are not limited to, any member of the class Mammalia: humans; non-human primates (e.g., chimpanzees and other apes and monkeys); livestock such as cattle, horses, sheep, goats, and pigs; domesticated animals such as rabbits, dogs, and cats; and laboratory animals, including rodents such as rats, mice, and guinea pigs. Examples of non-human mammals include, but are not limited to, birds and fish. In one embodiment of the methods and compositions provided herein, the mammal is a human.

[0108] The term “treatment” as used in this article refers to the treatment of a disease or condition in mammals, particularly humans, including (i) the prevention of a disease or condition in mammals, particularly those previously exposed to a disease or condition but not yet diagnosed with it.

[0109] (ii) To suppress a disease or symptom, that is, to control its development;

[0110] (iii) To alleviate the disease or symptom, that is, to make the disease or symptom subside;

[0111] (iv) Relieve symptoms caused by disease or illness.

[0112] The terms “disease” and “symptom” used in this article may be used interchangeably or have different meanings, because some specific diseases or symptoms do not yet have known causative factors (so the cause of the disease is still unclear), so they cannot be recognized as diseases but can only be regarded as unwanted conditions or syndromes. These syndromes have more or less some specific symptoms that have been confirmed by clinical researchers.

[0113] As used herein, the terms "effective amount," "therapeutic effective amount," or "pharmaceutical effective amount" refer to an amount of at least one drug or compound that, when taken, is sufficient to alleviate, to some extent, one or more symptoms of the disease or condition being treated. The result may be a reduction and / or relief of signs, symptoms, or causes, or any other desired change in a biological system. For example, an "effective amount" for treatment is the amount of a composition containing the compounds disclosed herein that is clinically necessary to provide significant symptom relief. Effective amounts suitable for any individual case can be determined using techniques such as dose escalation testing.

[0114] As used herein, the terms “administration,” “application,” “dosage,” etc., refer to methods that deliver a compound or composition to the desired site for biological action. These methods include, but are not limited to, oral administration, duodenal administration, parenteral administration (including intravenous, subcutaneous, intraperitoneal, intramuscular, intra-arterial injection or infusion), local administration, and rectal administration. In preferred embodiments, the compounds and compositions discussed herein are administered orally.

[0115] Preparation of the compounds of the present invention

[0116] The following reaction route illustrates a method for preparing the compounds of the present invention.

[0117] It should be understood that, in the following description, the combination of substituents and / or variables of the molecular formula is permitted only in the case of forming a stable compound.

[0118] Those skilled in the art will also understand that, in the processes described below, the functional groups of the intermediate compounds may need to be protected by suitable protecting groups. These functional groups include hydroxyl, amino, mercapto, and carboxyl groups. Suitable hydroxyl protecting groups include trialkylsilyl or diarylalkylsilyl (e.g., tert-butylmethylsilyl, tert-butyldiphenylsilyl, or trimethylsilyl), tetrahydropyranyl, benzyl, etc. Suitable amino, amidine, and guanidine protecting groups include tert-butyloxycarbonyl, benzyloxycarbonyl, etc. Suitable mercapto protecting groups include -C(O)-R" (R" represents alkyl, aryl, or arylalkyl), p-methoxybenzyl, triphenylmethyl, etc. Suitable carboxyl protecting groups include alkyl, aryl, or arylalkyl esters. Protecting groups can be added or removed using standard techniques known to those skilled in the art. Example

[0119] The following non-limiting embodiments are merely illustrative and do not limit the invention in any way.

[0120] Unless otherwise specified, temperatures are in Celsius. Reagents were purchased from commercial suppliers such as Sinopharm Chemical Reagents Beijing Co., Ltd., AlfaAesar, or Beijing Bailingwei Technology Co., Ltd., and these reagents are ready for use without further purification, unless otherwise specified.

[0121] Unless otherwise specified, the following reactions are carried out at room temperature, in anhydrous solvents, under positive pressure of nitrogen or argon, or using a drying tube; the reaction flask is fitted with a rubber diaphragm to allow for the addition of substrates and reagents via syringe; glassware is dried by drying and / or heating.

[0122] Unless otherwise specified, column chromatography purification used 200-300 mesh silica gel from Qingdao Ocean Chemical Plant; preparative thin-layer chromatography used thin-layer chromatography silica gel pre-plates (HSGF254) produced by Yantai Chemical Industry Research Institute; MS determination was performed using a Thermo LCQ Fleet (ESI) liquid chromatography-mass spectrometry system; optical rotation determination was performed using an SGW-3 automatic polarimeter from Shanghai Shenguang Instrument Co., Ltd.

[0123] NMR data ( 1H NMR was performed using a Varian instrument at 400 MHz. Solvents used for NMR data included CDCl3, CD3OD, D2O, and DMSO-d6, with tetramethylsilane (0.00 ppm) or residual solvents as the reference (CDCl3: 7.26 ppm; CD3OD: 3.31 ppm; D2O: 4.79 ppm; d6-DMSO: 2.50 ppm). When indicating peak shape diversity, the following abbreviations are used to represent different peak shapes: s (singleton), d (doublet), t (triplet), q (quartet), m (multiplex), br (broad peak), dd (double doublet), dt (double triplet). If coupling constants are given, they are expressed in Hertz (Hz).

[0124] Synthesis method

[0125] The synthesis of intermediates cpd-1-8 (7-chloro-2-iodo-3-(2,2,2-trifluoroethyl)pyrazolo[1,5-a]pyridine) and cpd-1-12 (6-methoxy-N-(methanesulfonyl)-5-(prop-2-yn-1-ylamino)pyridine amide follows the known route diagram below:

[0126] The synthesis of intermediate cpd-1-11: 5-amino-6-methoxy-N-(methanesulfonyl)pyridine amide was performed according to the following route reported in WO2025011684A2:

[0127] Example 1: 5-(3-(7-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-3-(2,2,2-trifluoroethyl)pyrazolo[1,5-a]pyridin-2-yl)prop-2-yn-1-yl)amino)-6-methoxy-N-(methanesulfonyl)pyridineamide

[0128] Step 1: 6-Methoxy-N-(Methylsulfonyl)-5-(Prop-2-yn-1-ylamino)pyridine amide

[0129] A mixture of 5-amino-6-methoxy-N-(methanesulfonyl)pyridine amide (980 mg), propargyl bromide (952 mg), potassium carbonate (1.1 g), and N,N-dimethylformamide (20 mL) was heated to 50 °C and reacted for 16 hours. The reaction was quenched with water (100 mL), extracted with ethyl acetate (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to give the target product (620 mg).

[0130] Step 2: 5-((3-(7-chloro-3-(2,2,2-trifluoroethyl)pyrazolo[1,5-a]pyridin-2-yl)prop-2-yn-1-yl)amino)-6-methoxy-N-(methylsulfonyl)pyridineamide

[0131] Under nitrogen protection, a mixture of 7-chloro-2-iodo-3-(2,2,2-trifluoroethyl)pyrazolo[1,5-a]pyridine (360 mg), 6-methoxy-N-(methanesulfonyl)-5-(prop-2-yn-1-ylamino)pyridineamide (283 mg), cuprous iodide (190 mg), tetrakis(triphenylphosphine)palladium (230 mg), diisopropylamine (1 g), and dimethyl sulfoxide (10 mL) was reacted at room temperature for 2 hours. The reaction was quenched with water (50 mL), extracted with ethyl acetate (100 mL × 3), dried over saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to give the target product (300 mg).

[0132] Step 3: 5-(3-(7-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-3-(2,2,2-trifluoroethyl)pyrazolo[1,5-a]pyridin-2-yl)prop-2-yn-1-yl)amino)-6-methoxy-N-(methylsulfonyl)pyridineamide

[0133] Under nitrogen protection, a mixture of 5-((3-(7-chloro-3-(2,2,2-trifluoroethyl)pyrazolo[1,5-a]pyridin-2-yl)prop-2-yn-1-yl)amino)-6-methoxy-N-(methanesulfonyl)pyridine amide (52 mg), (3S,4R)-3-fluoro-1-methylpiperidine-4-amine dihydrochloride (41 mg), methanesulfonic acid (2-dicyclohexylphosphino-2',6'-diisopropoxy-1,1'-biphenyl)(2-amino-1,1'-biphenyl-2-yl)palladium(II) (25 mg), cesium carbonate (100 mg), and dioxane (10 mL) was reacted at 100 °C for 12 hours. The solution was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 10:1) to obtain the target product (11 mg), LCMS m / z = 612.24 [M+H]. + , 1H NMR (400MHz, CDCl3) δ9.38-9.92(brs,1H),7.85(d,J=8.0Hz,1H),7.17(t,J=8.0Hz,1H),6.99 (d,J=8.0Hz,1H),6.84(d,J=8.8Hz,1H),6.17(d,J=8.8Hz,1H),5.91(d,J=7.6Hz,1H),5.21(t, J=6.0Hz,1H),4.86(d,J=49.6Hz,1H),4.34(d,J=6.0Hz,2H),4.10(s,3H),3.50-3.67(m,1H), 3.44(q,J=10.4Hz,2H),3.40(s,3H),3.18-3.28(m,1H),2.91-3.00(m,1H),1.95-2.40(m,7H).

[0134] Example 2: 5-amino-1-(tert-butyl)-N-(3-(8-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-3-((trifluoromethyl)thio)imidazo[1,2-a]pyridin-2-yl)prop-2-yn-1-yl)1H-pyrazole-4-carboxamide

[0135] Synthesis of intermediate 8-bromo-2-iodo-3-((trifluoromethyl)thio)imidazo[1,2-a]pyridine:

[0136] Step 1: 2-Amino-3-bromo-1-(2-ethoxy-2-oxoethyl)pyridine bromide

[0137] Under argon protection, 2.5 g of 3-bromo-2-aminopyridine was added to 10 mL of ethyl 2-bromoacetate, and the mixture was heated to 50 °C and reacted for 12 hours. The reaction mixture was cooled to room temperature, 50 mL of isopropyl ether was added, and the mixture was filtered. The filter cake was washed with isopropyl ether and dried to obtain the target product (4.3 g).

[0138] Step 2: 8-Bromo-2-chloroimidozolo[1,2-a]pyridine

[0139] Under argon protection, 1.0 g of 2-amino-3-bromo-1-(2-ethoxy-2-oxoethyl)pyridine bromide was added to 10 mL of phosphorus oxychloride, and the mixture was heated to 105 °C for 5 hours. The reaction mixture was cooled to room temperature, concentrated under reduced pressure, and the pH was adjusted to alkaline by adding saturated sodium bicarbonate solution to the residue. Extraction was performed with ethyl acetate (100 mL × 3), and the extract was washed with saturated brine (100 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 10:1) to give the target product (0.53 g).

[0140] Step 3: 8-Bromo-2-iodoimidazole[1,2-a]pyridine

[0141] Under argon protection, 0.53 g of 8-bromo-2-chloroimidazolo[1,2-a]pyridine and 1.7 g of sodium iodide were added to anhydrous acetonitrile (10 mL) and hydroiodic acid (1.2 mL), and the mixture was heated to 85 °C for 12 hours. The reaction solution was cooled to room temperature and concentrated under reduced pressure. The residue was adjusted to alkalinity with sodium hydroxide (4 mol / L), and residual iodine was removed by adding sodium thiosulfate solution. The mixture was extracted with ethyl acetate (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 10:1) to give the target product (0.63 g).

[0142] Step 4: 8-Bromo-2-iodo-3-((trifluoromethyl)thio)imidazo[1,2-a]pyridine

[0143] Under argon protection, 0.63 g of 8-bromo-2-iodoimidazole[1,2-a]pyridine and 0.72 g of N-thiotrifluoromethyl-o-sulfonylbenzoimide were added to anhydrous acetonitrile (15 mL), followed by the slow addition of trimethylchlorosilane (0.32 g). The reaction was carried out at room temperature for 12 hours. The mixture was concentrated under reduced pressure, and the residue was extracted with water (100 mL) and ethyl acetate (100 mL × 3). The extract was washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and purified by column chromatography (petroleum ether / ethyl acetate = 10:1) to give the target product (0.60 g).

[0144] Synthesis of intermediate 5-amino-1-(tert-butyl)-N-(prop-2-yn-1-yl)-1H-pyrazole-4-carboxamide:

[0145] Step 1: 5-Amino-1-(tert-butyl)-1H-pyrazole-4-carboxylic acid

[0146] Ethyl 5-amino-1-(tert-butyl)-1H-pyrazole-4-carboxylate (2.11 g) was dissolved in water (50 mL), and 6 mol / L sodium hydroxide aqueous solution (5 mL) was added. The mixture was heated to 60 °C and reacted for 12 hours. After cooling to room temperature, the pH was adjusted to 2-3 with 4 mol / L hydrochloric acid. The mixture was extracted with ethyl acetate (100 mL × 3), and the extract was washed with saturated brine (50 mL × 3). The extract was dried over anhydrous sodium sulfate and concentrated under reduced pressure to obtain the target product (1.81 g).

[0147] Step 2: 5-Amino-1-(tert-butyl)-N-(prop-2-yn-1-yl)-1H-pyrazole-4-carboxamide

[0148] 5-Amino-1-(tert-butyl)-1H-pyrazole-4-carboxylic acid (275 mg), diisopropylethylamine (2.58 g), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (760 mg) were dissolved in N,N-dimethylformamide (10 mL) and stirred at room temperature for 10 minutes. Propylamine hydrochloride (366 mg) was added, and the mixture was stirred at room temperature for 12 hours. The reaction was quenched with water (10 mL), extracted with ethyl acetate (10 mL × 3), washed with saturated brine (10 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to give the target product (140 mg).

[0149] Using the two intermediates mentioned above as raw materials, Example 2 was synthesized according to steps 2 and 3 of Example 1.

[0150] Synthesis of intermediate N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-2-iodo-3-((trifluoromethyl)thio)pyrazolo[1,5-a]pyridine-7-amine:

[0151] Step 1: 2-Iodopyrazole[1,5-a]pyridine

[0152] At 0 °C, pyrazolo[1,5-a]pyridine (7 g) was dissolved in tetrahydrofuran (100 mL), and boron trifluoride diethyl ether (8.1 mL) was added dropwise. The mixture was stirred at 0 °C for 45 minutes. The mixture was cooled to -70 °C, and a 2,2,6,6-tetramethylpiperidinyl magnesium chloride-lithium chloride complex (1 mol / L tetrahydrofuran solution, 71.2 mL) was added dropwise. The mixture was stirred at -70 °C for 2 hours. Iodine (22.6 g) in tetrahydrofuran (50 mL) was added dropwise at -70 °C, and the mixture was stirred overnight at room temperature. The reaction was quenched with saturated ammonium chloride aqueous solution (500 mL), and the mixture was extracted with dichloromethane (500 mL). The extract was washed with water and saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / petroleum ether = 1:10) to give the target compound (10.22 g).

[0153] Step 2: 7-Chloro-2-iodopyrazolo[1,5-a]pyridine

[0154] 10.22 g of 2-iodopyrazole[1,5-a]pyridine was dissolved in 100 mL of tetrahydrofuran. The mixture was cooled to -70 °C, and 57 mL of a 1 mol / L tetrahydrofuran solution of 2,2,6,6-tetramethylpiperidinyl magnesium chloride and lithium chloride complex was added dropwise. The mixture was stirred at -70 °C for 0.5 h, and then 50 mL of a tetrahydrofuran solution of 14.5 g of hexachloroethane was added dropwise at -70 °C. The mixture was then stirred at room temperature for 1 h. The mixture was cooled to 0 °C, and the reaction was quenched with 10% sodium thiosulfate solution. The mixture was extracted with 500 mL of ethyl acetate, washed with water and saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / petroleum ether = 1:10) to give the target compound (9.58 g).

[0155] Step 3: 7-Chloro-2-iodo-3-((trifluoromethyl)thio)pyrazolo[1,5-a]pyridine

[0156] Under nitrogen protection, 7-chloro-2-iodopyrazolo[1,5-a]pyridine (6 g) and N-trifluoromethylthiosaccharin (9.18 g) were dissolved in acetonitrile (120 mL), and trimethylchlorosilane (4.13 mL) was added dropwise. The mixture was heated to 60 °C and stirred for 30 minutes. The reaction solution was cooled to room temperature and concentrated under reduced pressure. Dichloromethane (200 mL) and 1 mol / L sodium hydroxide solution (60 mL) were added to the residue, and the mixture was stirred for 10 minutes. The organic phase was separated, washed with water and saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / petroleum ether = 1:10) to obtain the target compound (8 g).

[0157] Step 4: N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-2-iodo-3-((trifluoromethyl)thio)pyrazolo[1,5-a]pyridine-7-amine

[0158] 7-Chloro-2-iodo-3-((trifluoromethyl)thio)pyrazolo[1,5-a]pyridine (2 g), (3S,4R)-3-fluoro-1-methylpiperidin-4-amine (1.42 g), and N,N-diisopropylethylamine (1.85 mL) were dissolved in N-methylpyrrolidone (15 mL), and the mixture was heated to 130 °C and stirred for 24 hours. The reaction mixture was cooled to room temperature, poured into water (100 mL), and extracted with ethyl acetate (200 mL). The extract was washed with water and saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (1:10 methanol / dichloromethane) to obtain the target compound (1.8 g).

[0159] Example 6:

[0160] 5-Amino-1-(tert-butyl)-N-(3-(7-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-3-((trifluoromethyl)thio))pyrazol[1,5-a]pyridin-2-yl)prop-2-yn-1-yl)-1H-pyrazol-4-carboxamide

[0161] Under nitrogen protection, a mixture of N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-2-iodo-3-((trifluoromethyl)thio)pyrazolo[1,5-a]pyridine-7-amine (474 ​​mg), 5-amino-1-(tert-butyl)-N-(prop-2-yn-1-yl)-1H-pyrazole-4-carboxamide (330 mg), cuprous iodide (38 mg), tetrakis(triphenylphosphine)palladium (46 mg), diisopropylamine (505 mg), and dimethyl sulfoxide (10 mL) was reacted at room temperature for 2 hours. The reaction was quenched with water (50 mL), extracted with ethyl acetate (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to give the target product (400 mg).

[0162] Synthesis of intermediate N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-7-iodo-6-((trifluoromethyl)thio)pyrrole[1,2-a]pyrazine-1-amine:

[0163] Step 1: 2,2,2-Trichloro-1-(4-iodo-1H-pyrrolo-2-yl)ethane-1-one

[0164] Under an argon atmosphere, 2,2,2-trichloro-1-(1H-pyrrolo-2-yl)ethane-1-one (21.2 g) was dissolved in dichloromethane (300 mL), cooled to 0 °C, and iodine chloride (16.2 g) was added in portions. The mixture was then stirred at room temperature for 16 hours. The reaction was quenched with saturated sodium thiosulfate aqueous solution (500 mL), extracted with dichloromethane (300 mL × 3), washed with saturated brine (200 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 20:1) to give the target compound (29.3 g).

[0165] Step 2: N-(2,2-dimethoxyethyl)-4-iodo-1H-pyrrole-2-carboxamide

[0166] Under an argon atmosphere, 2,2,2-trichloro-1-(4-iodo-1H-pyrrolo-2-yl)ethane-1-one (29.3 g) was dissolved in dry acetonitrile (200 mL), and 2,2-dimethoxyethanolamine-1-amine (13.6 g) was added. The mixture was stirred at room temperature for 16 hours, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 3:1) to give the target compound (21 g).

[0167] Step 3: 4-Hydroxy-7-iodo-3,4-dihydropyrrole[1,2-a]pyrazin-1(2H)-one

[0168] N-(2,2-dimethoxyethyl)-4-iodo-1H-pyrrole-2-carboxamide (4.0 g) was dissolved in acetone (1000 mL) and water (12 mL), and p-toluenesulfonic acid (2.34 g) was added. The mixture was heated to 60 °C and stirred for 6 hours. The reaction was quenched with water (100 mL), and the mixture was extracted with ethyl acetate (100 mL × 3). The extract was washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 15:1) to give the target compound (1.4 g).

[0169] Step 4: 7-Iodopyridine[1,2-a]pyrazole-1(2H)-one

[0170] 3.5 g of 4-hydroxy-7-iodo-3,4-dihydropyrrolo[1,2-a]pyrazin-1(2H)-one was dissolved in methanesulfonic acid (10 mL) and heated to 45 °C with stirring for 16 hours. The reaction was quenched with ice water (100 mL), extracted with ethyl acetate (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and methanol (20 mL) was added to the residue. The mixture was stirred at room temperature for 30 minutes, and the solid was filtered to give the target compound (3.2 g).

[0171] Step 5: 1-Chloro-7-iodopyridine[1,2-a]pyrazole

[0172] Under an argon atmosphere, 5.9 g of 7-iodopyridine[1,2-a]pyrazole-1(2H)-one was dissolved in 40 mL of dry acetonitrile, and 20 g of phosphorus oxychloride was added. The mixture was heated to 80 °C and stirred for 3 hours. After cooling to room temperature, the mixture was concentrated under reduced pressure. The residue was adjusted to pH 8 with saturated sodium bicarbonate solution, extracted with ethyl acetate (500 mL × 3), washed with 200 mL × 3 saturated brine, dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the target compound (4.9 g).

[0173] Step 6: 1-Chloro-7-iodo-6-((trifluoromethyl)thio)pyrrole[1,2-a]pyrazole

[0174] 1-Chloro-7-iodopyridine[1,2-a]pyrazole (923 mg) and N-(trifluoromethylthio)saccharin (1.12 g) were dissolved in acetonitrile (20 mL), and trimethylchlorosilane (541 mg) was added. The mixture was stirred at room temperature for 16 hours, and the reaction was quenched with water (50 mL). The mixture was extracted with ethyl acetate (100 mL × 3), and the extract was washed with saturated brine (50 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 7:1) to give the target compound (1.1 g).

[0175] Step 7: N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-7-iodo-6-((trifluoromethyl)mercapto)pyrrole[1,2-a]pyrazin-1-amine

[0176] Under an argon atmosphere, in a sealed tube, 7.4 g of 1-chloro-7-iodo-6-((trifluoromethyl)thio)pyrrole[1,2-a]pyrazole and 5.4 g of (3S,4R)-3-fluoro-1-methylpiperidin-4-amine were dissolved in 20 mL of N-methylpyrrolidone. N,N-diisopropylethylamine (5.16 g) was added, and the mixture was heated to 130 °C and reacted for 16 hours. After cooling to room temperature, the reaction was quenched with 50 mL of water, extracted with 100 mL × 3 times, and the extract was washed with saturated brine (50 mL × 3 times). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to give the target compound (4.5 g).

[0177] Example 36:

[0178] 5-Amino-1-(tert-butyl)-N-(3-(1-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-6-((trifluoromethyl)mercapto)pyrrolo[1,2-a]pyrazin-7-yl)prop-2-yn-1-yl)-1H-pyrrolo-4-carboxamide

[0179] Under nitrogen protection, a mixture of N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-7-iodo-6-((trifluoromethyl)mercapto)pyrrolo[1,2-a]pyrazin-1-amine (474 ​​mg), 5-amino-1-(tert-butyl)-N-(prop-2-yn-1-yl)-1H-pyrazole-4-carboxamide (330 mg), cuprous iodide (38 mg), tetrakis(triphenylphosphine)palladium (46 mg), diisopropylamine (505 mg), and dimethyl sulfoxide (10 mL) was reacted at room temperature for 2 hours. The reaction was quenched with water (50 mL), extracted with ethyl acetate (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to give the target compound (440 mg).

[0180] Synthesis of intermediate N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-2-iodo-3-((trifluoromethyl)thio)pyrazolo[1,5-c]pyrimidine-7-amine:

[0181] Step 1: Ethyl 3-(2-(methylthio)pyrimidin-4-yl)-2-oxypropionate

[0182] 4-Methyl-2-(methyl thioether)pyrimidine (80 g) and diethyl oxalate (416 g) were dissolved in tetrahydrofuran (1000 mL). Potassium tert-butoxide (96 g) was added in portions at 0 °C. The mixture was stirred at room temperature for 1 hour. The reaction was quenched with water (1000 mL). The mixture was extracted with ethyl acetate (300 mL × 3). The extract was washed with saturated brine (200 mL × 3). The extract was dried over anhydrous sodium sulfate and concentrated under reduced pressure. The residue was slurried with petroleum ether (1000 mL) and filtered to obtain the target compound (124 g).

[0183] Step 2: Ethyl (E)-2-(hydroxyimino)-3-(2-(methylthio)pyrimidin-4-yl)propionate

[0184] Ethyl 3-(2-(methylthio)pyrimidin-4-yl)-2-oxypropionate (124 g) and hydroxylamine hydrochloride (40 g) were dissolved in ethanol (500 mL), and sodium acetate (63 g) was added in portions. The mixture was heated to 80 °C and stirred for 2 hours. After cooling to room temperature, the reaction was quenched with water (1000 mL), and the mixture was extracted with ethyl acetate (300 mL × 3). The extract was washed with saturated brine (200 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was slurried with petroleum ether (1000 mL). The residue was filtered to obtain the target compound (120 g).

[0185] Step 3: Ethyl 7-methylthiopyrido[1,5-c]pyrimidine-2-carboxylate

[0186] Under an argon atmosphere, ethyl (E)-2-(hydroxyimino)-3-(2-(methylthio)pyrimidin-4-yl)propionate (120 g) and triethylamine (96 g) were dissolved in acetonitrile (1000 mL). p-Toluenesulfonyl chloride (90 g) was added in portions at 0 °C, and the mixture was stirred at room temperature for 1 hour. Ferrous chloride (18 g) was added in portions, and the mixture was heated to 80 °C and stirred for 4 hours. After cooling to room temperature, the reaction was quenched with water (1000 mL), and the mixture was extracted with ethyl acetate (1000 mL × 3). The extract was washed with saturated brine (300 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / dichloromethane = 10:1) to give the target compound (24 g).

[0187] Step 4: 7-Methylthiopyrido[1,5-c]pyrimidine-2-carboxylic acid

[0188] 18 g of 7-methylthiopyrido[1,5-c]pyrimidine-2-carboxylic acid ethyl ester was dissolved in methanol (200 mL) and water (200 mL). Sodium hydroxide (8 g) was added in portions at 0 °C, and the mixture was stirred at room temperature for 2 hours. The pH of the mixture was adjusted to 5 using a 2 mol / L hydrochloric acid aqueous solution. The mixture was extracted with a dichloromethane / methanol mixture (9 / 1, 300 mL × 3). The extract was washed with saturated brine (300 mL × 3), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the target compound (14 g).

[0189] Step 5: N-(7-(methylthio)pyrazolo[1,5-c]pyrimidin-2-yl)tert-butyl carbamate

[0190] Under an argon atmosphere, 14 g of 7-methylthiopyrido[1,5-c]pyrimidin-2-carboxylic acid, 35 g of triethylamine, 22.7 g of diphenyl azidophosphate, and 29 g of ditert-butyl dicarbonate were dissolved in 200 mL of tert-butanol and 200 mL of N,N-dimethylformamide. The mixture was heated to 90 °C and stirred for 6 hours. The reaction was quenched with 300 mL of water. The mixture was extracted with 500 mL of ethyl acetate three times. The extract was washed with 200 mL of saturated brine three times, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 10:1) to give the target compound (10 g).

[0191] Step 6: 7-(methylthio)pyrido[1,5-c]pyrimidine-2-amine

[0192] 10 g of N-(7-(methylthio)pyrazolo[1,5-c]pyrimidin-2-yl)carbamate tert-butyl ester was dissolved in 100 mL of dichloromethane. Trifluoroacetic acid (39 mL) was added at 0 °C, and the mixture was stirred overnight at room temperature. The solution was concentrated under reduced pressure, and the residue was dissolved in ethyl acetate. The pH of the mixture was adjusted to 8 with saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate (300 mL × 3), washed with saturated brine (200 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 8:1) to give the target compound (4 g).

[0193] Step 7: 7-(methylthio)-3-((trifluoromethyl)thio)pyrazolo[1,5-c]pyrimidine-2-amine 7-(methylthio)pyridolo[1,5-c]pyrimidine-2-amine (4 g) and N-(trifluoromethylthio)saccharin (6 g) were dissolved in acetonitrile (100 mL), and trimethylchlorosilane (3.2 g) was added. The mixture was stirred at room temperature for 1 hour. The reaction was quenched with water (50 mL), and the mixture was extracted with ethyl acetate (100 mL × 3). The extract was washed with saturated brine (50 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 10:1) to give the target compound (5.3 g).

[0194] Step 8: 2-Iodo-7-(methylthio)-3-((trifluoromethyl)thio)pyrazolo[1,5-c]pyrimidine

[0195] 5.3 g of 7-(methylthio)-3-((trifluoromethyl)thio)pyrazolo[1,5-c]pyrimidine-2-amine was dissolved in acetonitrile (100 mL), and 6.6 g of isoamyl nitrite was slowly added at 0 °C, with stirring for 10 minutes. 50.5 g of diiodomethane was added, and the mixture was heated to 40 °C and stirred for 1 hour. The mixture was cooled to room temperature, and the reaction was quenched with water (50 mL). The mixture was extracted with ethyl acetate (100 mL × 3), washed with saturated brine (50 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / dichloromethane = 10:1) to give the target compound (6.6 g).

[0196] Step 9: 2-Iodo-7-(methylsulfinyl)-3-((trifluoromethyl)thio)pyrazolo[1,5-c]pyrimidine

[0197] 6.6 g of 2-iodo-7-(methylthio)-3-((trifluoromethyl)thio)pyrazolo[1,5-c]pyrimidine was dissolved in 100 mL of dichloroethane. 6.6 g of m-chloroperoxybenzoic acid was slowly added at 0 °C, and the mixture was stirred at room temperature for 2 hours. The reaction was quenched with 50 mL of water, and the mixture was extracted with dichloromethane (100 mL × 3). The extract was washed with saturated brine (50 mL × 3), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain the target compound.

[0198] Step 10: N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-2-iodo-3-((trifluoromethyl)thio)pyrazolo[1,5-c]pyrimidine-7-amine

[0199] 2-Iodo-7-(methylsulfinyl)-3-((trifluoromethyl)thio)pyrazolo[1,5-c]pyrimidine (6.6 g) and (3S,4R)-3-fluoro-1-methylpiperidin-4-amine (4.2 g) were dissolved in N,N-dimethylacetamide (50 mL), and diisopropylethylamine (10.2 g) was added. The mixture was heated to 50 °C and reacted for 1 hour. After cooling to room temperature, the reaction was quenched with water (50 mL), and the mixture was extracted with ethyl acetate (100 mL × 3). The extract was washed with saturated brine (50 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to give the target compound (3.4 g).

[0200] Example 69:

[0201] 5-Amino-1-(tert-butyl)-N-(3-(7-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-3-((trifluoromethyl)thio)pyrazol[1,5-c]pyrimidin-2-yl)prop-2-yn-1-yl)-1H-pyrazol-4-carboxamide

[0202] Under nitrogen protection, a mixture of N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-2-iodo-3-((trifluoromethyl)thio)pyrazolo[1,5-c]pyrimidin-7-amine (237.5 mg), 5-amino-1-(tert-butyl)-N-(prop-2-yn-1-yl)-1H-pyrazol-4-carboxamide (165 mg), cuprous iodide (19 mg), tetrakis(triphenylphosphine)palladium (23 mg), diisopropylamine (253 mg), and dimethyl sulfoxide (10 mL) was reacted at room temperature for 2 hours. The reaction was quenched with water (50 mL), extracted with ethyl acetate (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to give the target product (200 mg).

[0203] Synthesis of indene-8-amine from intermediate 2-(3-aminoprop-1-yn-1-yl)-N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-3-((trifluoromethyl)thio)

[0204] Step 1: 8-Bromo-3-((trifluoromethyl)thio)-indene-2-carboxylic acid ethyl ester

[0205] Ethyl 8-bromoinden-2-carboxylate (18.1 g), N-(trifluoromethylthio)phthalimide (25 g), and sodium chloride (2 g) were dissolved in N-methylpyrrolidone (100 mL), and the mixture was heated to 90 °C and stirred for 12 hours. The reaction was quenched by adding 300 mL of saturated ammonium chloride aqueous solution, and the mixture was extracted with dichloromethane (500 mL). The extract was washed with water and saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / petroleum ether = 1:10) to give the target compound (17.04 g).

[0206] Step 2: (8-bromo-3-((trifluoromethyl)thio)inden-2-yl)methanol

[0207] Ethyl 8-bromo-3-((trifluoromethyl)thio)-indene-2-carboxylate was dissolved in dichloromethane (200 mL), cooled to -40 °C, and diisobutylaluminum hydride (1.5 mol / L toluene solution, 61.6 mL) was added dropwise. The mixture was stirred at -20 °C for 2 hours. Sodium sulfate decahydrate was added, and the mixture was stirred at room temperature for 30 minutes. The mixture was filtered, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (dichloromethane) to obtain the target compound (13.5 g).

[0208] Step 3: 8-Bromo-3-((trifluoromethyl)thio)-indene-2-carboxaldehyde

[0209] 13.5 g of (8-bromo-3-((trifluoromethyl)thio)inden-2-yl)methanol and 32.2 g of 2-iodobenzoic acid were dissolved in 150 mL of ethyl acetate and heated to 80 °C with stirring for 3 hours. After cooling to room temperature, the mixture was filtered, the filtrate was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (1:10 ethyl acetate / petroleum ether) to give the target compound (12.64 g).

[0210] Step 4: Nitrogen indene in 8-bromo-2-ethynyl-3-((trifluoromethyl)thio)

[0211] Under nitrogen protection, 12.64 g of indene-2-carboxaldehyde (from 8-bromo-3-((trifluoromethyl)thio)) and 16.2 g of potassium carbonate were dissolved in methanol (100 mL), and 12 mL of dimethyl (1-diazo-2-oxopropyl)phosphonate was added dropwise. The mixture was stirred at 0 °C for 2 hours. The reaction solution was quenched in saturated brine (200 mL), extracted with ethyl acetate (500 mL), washed with water and saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / petroleum ether = 1:10) to obtain the target compound (12 g).

[0212] Step 5: 3-(8-bromo-3-((trifluoromethyl)thio)inden-2-yl)prop-2-yn-1-ol

[0213] Under argon protection, triethylamine (3.5 g) was added dropwise to a toluene (150 mL) solution of zinc trifluoromethanesulfonate (II) (12.6 g) and N,N,N',N'-tetramethylethylenediamine (4.0 g), and the reaction was carried out at room temperature for 2 hours. A toluene (100 mL) solution of 8-bromo-2-ethynyl-3-((trifluoromethyl)thio) indene (5.0 g) was added dropwise, and the mixture was heated to 60 °C and stirred for 3 hours. Paraformaldehyde (1.03 g) was added, and the reaction was carried out overnight. The mixture was cooled to room temperature, concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (0–50% ethyl acetate / petroleum ether) to give the target compound (4.1 g).

[0214] Step 6: 2-(3-(8-bromo-3-((trifluoromethyl)thio)inden-2-yl)prop-2-yn-1-yl)isoindoline-1,3-dione

[0215] At room temperature, triphenylphosphine (5.97 g) was dissolved in anhydrous tetrahydrofuran (200 mL), and a tetrahydrofuran (100 mL) solution of diisopropyl azodicarboxylate (4.6 g) was added dropwise. The mixture was stirred at room temperature for 1 hour. A tetrahydrofuran (50 mL) solution of 3-(8-bromo-3-((trifluoromethyl)thio)inden-2-yl)prop-2-yn-1-ol (4.0 g) was added dropwise, and the mixture was stirred at room temperature overnight. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (ethyl acetate / petroleum ether = 0 / 100 1 / 1) to give the target compound (2.3 g).

[0216] Step 7: 2-(3-(8-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-3-((trifluoromethyl)thio)indene-2-yl)prop-2-yn-1-yl)isoindoline-1,3-dione

[0217] Under argon protection, 2-(3-(8-bromo-3-((trifluoromethyl)thio)indene-2-yl)prop-2-yn-1-yl)isoindoline-1,3-dione (500 mg), (3S,4R)-3-fluoro-1-methylpiperidin-4-amine (345 mg), methanesulfonic acid (2-dicyclohexylphosphino-2',4',6'-tri-isopropyl-1,1'-biphenyl)(2'-amino-1,1'-biphenyl-2-yl)palladium(II) (90 mg), 2-dicyclohexylphosphino-2',4',6'-triisopropylbiphenyl (50 mg), and cesium carbonate (1.03 g) were mixed in anhydrous 1,4-dioxane (25 mL) and heated to 100 °C with stirring for 2 hours. Cool to room temperature, filter, concentrate the filtrate under reduced pressure, and purify the residue by silica gel column chromatography (0-5% methanol / dichloromethane) to obtain the target compound (240 mg).

[0218] Step 8: 2-(3-aminoprop-1-yn-1-yl)-N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-3-((trifluoromethyl)thio)indene-8-amine

[0219] 2-(3-(8-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-3-((trifluoromethyl)thio)indene-2-yl)prop-2-yn-1-yl)isoindoline-1,3-dione (447 mg) and ethylenediamine (507 mg) were dissolved in ethanol (10 mL) and stirred overnight at room temperature. The mixture was concentrated under reduced pressure, and the residue was purified by silica gel column chromatography (0–10% methanol / dichloromethane) to give the target compound (203 mg).

[0220] Example 85:

[0221] 5-Amino-1-(tert-butyl)-N-(3-(8-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-3-((trifluoromethyl)mercapto)indazin-2-yl)prop-2-yn-1-yl)-1H-pyrazole-4-carboxamide

[0222] 5-Amino-1-(tert-butyl)-1H-pyrazole-4-carboxylic acid (183 mg), diisopropylethylamine (323 mg), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (285 mg) were dissolved in N,N-dimethylformamide (10 mL) and stirred at room temperature for 30 minutes. Then, 2-(3-aminoprop-1-yn-1-yl)-N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-3-((trifluoromethyl)thio)indene-8-amine (200 mg) was added and stirred at room temperature for 12 hours. The reaction was quenched with water (10 mL), extracted with ethyl acetate (10 mL × 3), the extract was washed with saturated brine (10 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to obtain the target product (200 mg).

[0223] Synthesis of intermediate 2-(3-aminoprop-1-yn-1-yl)-N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-1-((trifluoromethyl)thio)indoleazine-5-amine:

[0224] Step 1: Methyl 2-((6-chloropyridin-2-yl)(hydroxy)meth)acrylate

[0225] Under an argon atmosphere, 6-chlorobenzyl aldehyde (6 g), methyl acrylate (4.38 g), and 1,4-diazabicyclo[2.2.2]octane (0.29 g) were dissolved in 1,4-dioxane (45 mL) and water (15 mL). The mixture was reacted at room temperature for 3 hours, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 5:1) to give the target compound (6.5 g).

[0226] Step 2: Methyl 2-(acetoxy(6-chloropyridin-2-yl)meth)acrylate

[0227] Under an argon atmosphere, methyl 2-((6-chloropyridin-2-yl)(hydroxy)meth)acrylate (3g) was added to acetic anhydride (60mL), heated to 100℃ and stirred for 6 hours, and then proceeded directly to the next reaction step.

[0228] Step 3: Methyl 5-chloroindoleazine-2-carboxylate

[0229] Under an argon atmosphere, the reaction mixture from the previous step was heated to 160°C and reacted for 10 hours. After cooling to room temperature, the reaction was quenched by pouring the mixture into a saturated sodium bicarbonate solution. The mixture was extracted with ethyl acetate (100 mL × 3), and the extract was washed with saturated brine (30 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 5:1) to give the target compound (3 g).

[0230] Step 4: Methyl 5-chloro-1-((trifluoromethyl)thio)indoleazine-2-carboxylate

[0231] 2.6 g of methyl 5-chloroindolazine-2-carboxylate and 3.5 g of N-(trifluoromethylthio)saccharin were dissolved in acetonitrile (50 mL), and 2.0 g of trimethylchlorosilane was added. The mixture was stirred at room temperature for 1 hour. The reaction was quenched with water (50 mL), and the mixture was extracted with ethyl acetate (100 mL × 3). The extract was washed with saturated brine (50 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 5:1) to give the target compound (1.4 g).

[0232] Step 5: (5-chloro-1-((trifluoromethyl)thio)indolazin-2-yl)methanol

[0233] Under an argon atmosphere, methyl 5-chloro-1-((trifluoromethyl)thio)indolazine-2-carboxylate (1.4 g) was dissolved in dichloromethane (20 mL), and diisobutylaluminum hydride (1.5 mol / L, 12 mL) was added at 0 °C, followed by stirring for 2 hours. The reaction was quenched by adding sodium sulfate decahydrate, filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography (petroleum ether / ethyl acetate = 3:1) to give the target compound (1.2 g).

[0234] Step 6: 5-Chloro-1-((trifluoromethyl)thio)indolazine-2-carboxaldehyde

[0235] (5-chloro-1-((trifluoromethyl)thio)indolazin-2-yl)methanol (1.2 g) was dissolved in ethyl acetate (20 mL), and 2-iodoacryloylbenzoic acid (6 g) was added. The mixture was heated to 80 °C and reacted for 5 hours. After cooling to room temperature, the mixture was filtered, and the filtrate was concentrated under reduced pressure. The residue was purified by column chromatography (petroleum ether / ethyl acetate = 8:1) to give the target compound (1.2 g).

[0236] Step 7: 5-Chloro-2-ethynyl-1-((trifluoromethyl)thio)indoline

[0237] 950 mg of 5-chloro-1-((trifluoromethyl)thio)indolazine-2-carboxaldehyde was dissolved in 10 mL of methanol. Dimethyldiazomethylphosphonate (1.3 g) and potassium carbonate (1.4 g) were added at 0 °C, and the mixture was stirred for 2 hours. The reaction was quenched with 30 mL of water, and the mixture was extracted with ethyl acetate (3 mL × 3). The extract was washed with saturated brine (30 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / dichloromethane = 5:1) to give the target compound (790 mg).

[0238] Step 8: 3-(5-chloro-1-((trifluoromethyl)thio)indolazin-2-yl)prop-2-yn-1-ol

[0239] Copper tetraacetonitrile hexafluorophosphate (72 mg) and tributylphosphine (156 mg) were dissolved in toluene (10 mL) under an argon atmosphere and heated to 70 °C with stirring for 30 minutes. 5-chloro-2-ethynyl-1-((trifluoromethyl)thio)indoline (530 mg) and a 37% aqueous formaldehyde solution (313 mg) were added, and the reaction was carried out at 70 °C for 16 hours. The mixture was cooled to room temperature, the reaction was quenched with water (20 mL), extracted with ethyl acetate (20 mL × 3), washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 10:1) to give the target compound (430 mg).

[0240] Step 9: 2-(3-(5-chloro-1-((trifluoromethyl)thio)indolazin-2-yl)prop-2-yn-1-)isoindol-1,3-dione

[0241] Triphenylphosphine (842 mg) and diisopropyl azodicarbonate (649 mg) were dissolved in tetrahydrofuran (10 mL) and stirred at room temperature for 15 minutes. After cooling to 0 °C, 3-(5-chloro-1-((trifluoromethyl)thio)indolazin-2-yl)prop-2-yn-1-ol (490 g) and phthalimide (472 mg) were added, and the mixture was reacted at room temperature for 16 hours. The reaction was quenched with water (20 mL), extracted with ethyl acetate (20 mL × 3), washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / dichloromethane = 3:1) to give the target compound (575 mg).

[0242] Step 10: 2-(3-(5-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-1-((trifluoromethyl)thio)indolazin-2-yl)prop-2-yn-1-yl)isoindol-1,3-dione

[0243] Under an argon atmosphere, 2-(3-(5-chloro-1-((trifluoromethyl)thio)indolazin-2-yl)prop-2-yn-1-)isoindol-1,3-dione (250 mg), (3S,4R)-3-fluoro-1-methylpiperidin-4-amine (380 mg), methanesulfonic acid (2-dicyclohexylphosphino-2',6'-diisopropoxy-1,1'-biphenyl)(2-amino-1,1'-biphenyl-2-yl)palladium(II) (96 mg), cesium carbonate (563 mg), and potassium iodide (29 mg) were added to 1,4-dioxane (5 mL), and the mixture was heated to 110 °C and reacted for 4 hours. The reaction was quenched by adding water (20 mL) after cooling to room temperature. The mixture was extracted with ethyl acetate (20 mL × 3), washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to obtain the target compound (50 mg).

[0244] Step 11: 2-(3-aminoprop-1-yn-1-yl)-N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-1-((trifluoromethyl)thio)indoleazine-5-amine

[0245] 50 mg of 2-(3-(5-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-1-((trifluoromethyl)thio)indolazin-2-yl)prop-2-yn-1-yl)isoindol-1,3-dione was dissolved in 5 mL of ethanol, and 20 mg of ethylenediamine was added. The mixture was reacted at room temperature for 2 hours. The mixture was concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 10:1) to give the target compound (25 mg).

[0246] Example 112

[0247] 5-Amino-1-(tert-butyl)-N-(3-(5-(((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)amino)-1-((trifluoromethyl)thio)indolazin-2-yl)prop-2-yn-1-yl)-1H-pyrazole-4-carboxamide

[0248] 5-Amino-1-(tert-butyl)-1H-pyrazole-4-carboxylic acid (23 mg), N,N,N',N'-tetramethyl-O-(7-azabenzotriazol-1-yl)hexafluorophosphate urea (43 mg), and N,N-diisopropylethylamine (81 mg) were dissolved in ethanol (5 mL) and stirred at room temperature for 1 hour. Then, 2-(3-aminoprop-1-yn-1-yl)-N-((3S,4R)-3-fluoro-1-methylpiperidin-4-yl)-1-((trifluoromethyl)thio)indoleazine-5-amine (25 mg) was added, and the reaction was carried out at room temperature for 16 hours. Water (20 mL) was added, and the mixture was extracted with ethyl acetate (20 mL × 3). The extract was washed with saturated brine (20 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 10:1) to give the target product (13 mg).

[0249] Following the method in step 2 of the synthesis of intermediate 5-amino-1-(tert-butyl)-N-(prop-2-yn-1-yl)-1H-pyrazole-4-carboxamide, the intermediates listed in the table below are obtained by reacting propargylamine hydrochloride with the corresponding carboxylic acid:

[0250] 2-Methoxy-N 4 -Methyl-N 1 Synthesis of -(prop-2-yn-1-yl)-terephthalamide:

[0251] Step 1: Dissolve 2-methoxy-4-(methoxycarbonyl)benzoic acid (420 mg), diisopropylethylamine (1.29 g), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.14 g) in N,N-dimethylformamide (20 mL) and stir at room temperature for 10 minutes. Add propargylamine hydrochloride (366 mg) and stir at room temperature for 12 hours. Quench the reaction with water (10 mL), extract with ethyl acetate (10 mL × 3), wash the extract with saturated brine (10 mL × 3), dry with anhydrous sodium sulfate, concentrate under reduced pressure, and purify the residue by column chromatography (dichloromethane / methanol = 20:1) to obtain methyl 3-methoxy-4-(prop-2-yn-1-carboxamido)benzoate (400 mg).

[0252] Step 2: Dissolve methyl 3-methoxy-4-(prop-2-yn-1-carboxamide)benzoate (400 mg) in water (10 mL), add 6 mol / L sodium hydroxide aqueous solution (5 mL), and heat to 60 °C for 12 hours. Cool to room temperature, add 4 mol / L hydrochloric acid to adjust the pH to 2-3, extract with ethyl acetate (100 mL × 3), wash the extract with saturated brine (50 mL × 3), dry with anhydrous sodium sulfate, and concentrate under reduced pressure to obtain 3-methoxy-4-(prop-2-yn-1-carboxamide)benzoic acid (350 mg), which can be used directly in the next step.

[0253] Step 3: 3-Methoxy-4-(prop-2-yn-1-carboxamido)benzoic acid (350 mg), diisopropylethylamine (1.0 g), and 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (855 mg) were dissolved in N,N-dimethylformamide (20 mL) and stirred at room temperature for 10 minutes. Propylamine hydrochloride (276 mg) was added, and the mixture was stirred at room temperature for 12 hours. The reaction was quenched with water (10 mL), and the mixture was extracted with ethyl acetate (10 mL × 3). The extract was washed with saturated brine (10 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / methanol = 20:1) to give 2-methoxy-N4-methyl-N1-(prop-2-yn-1-yl)terephthalamide (300 mg).

[0254] intermediate N 5 -Methyl-N 2 Synthesis of 2,5-dicarboxamide (prop-2-yn-1-yl)pyridine:

[0255] Step 1: Methyl 6-(2-propynylcarbamoyl)nicotinic acid

[0256] 5-(methoxycarbonyl)pyridinecarboxylic acid (399 mg) and 2-chloro-1-methylpyridine iodide (675 mg) were dissolved in dichloromethane (10 mL), and propargylamine hydrochloride (212 mg) and triethylamine (668 mg) were added. The mixture was reacted overnight at room temperature. Saturated brine (50 mL) was added, and the mixture was extracted with ethyl acetate (50 mL × 3). The extract was dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (dichloromethane / ethyl acetate = 99:1) to give the target compound (390 mg).

[0257] Step 2: N 5 -Methyl-N 2 -(prop-2-yn-1-yl)pyridine-2,5-dicarboxamide

[0258] Methyl 6-(2-propynylcarbamoyl)nicotinic acid (103 mg), methylamine hydrochloride (63.7 mg), diisopropylethylamine (243.6 mg), and methanol (5 mL) were added to a sealed tube and heated to 80 °C overnight. The reaction solution was concentrated under reduced pressure, and dichloromethane / methanol (18 mL / 2 mL) was added to the residue and stirred for 30 minutes. The filtrate was collected, concentrated under reduced pressure, and purified by thin-layer chromatography to obtain the target compound (67 mg).

[0259] Synthesis of intermediate 7-methyl-N-(prop-2-yn-1-yl)-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidine-3-carboxamide:

[0260] Step 1: Ethyl 7-methylpyrazolo[1,5-a]pyrimidine-3-carboxylate

[0261] In a sealed tube, ethyl 5-amino-1H-pyrazole-4-carboxylate (1.0 g) and 4,4-dimethoxybutane-2-one (937 mg) were dissolved in concentrated hydrochloric acid (2 mL), and the mixture was heated to 60 °C and stirred for 2 hours. The reaction was quenched with water (100 mL), extracted with dichloromethane (100 mL × 3), and the extract was washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain the target compound (1.11 g).

[0262] Step 2: Ethyl 7-methyl-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidine-3-carboxylate

[0263] At 0 °C, ethyl 7-methylpyrazolo[1,5-a]pyrimidine-3-carboxylate (2.0 g) was dissolved in ethanol (20 mL), and sodium borohydride (1.2 g) was added in portions. The mixture was stirred at room temperature for 2 hours. The reaction was quenched with water (100 mL), extracted with dichloromethane (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the target compound (1.27 g).

[0264] Step 3: 7-Methyl-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidine-3-carboxylic acid

[0265] 1.27 g of ethyl 7-methyl-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidine-3-carboxylate was dissolved in 5 mL of tetrahydrofuran and 12 mL of water. Sodium hydroxide (1.3 g) was added, and the mixture was stirred at room temperature for 16 hours. The pH was adjusted to 7 with 3 mol / L hydrochloric acid solution, and the mixture was extracted with dichloromethane (100 mL × 5). The extract was washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to give the target compound (891 mg).

[0266] Step 4: 7-Methyl-N-(prop-2-yn-1-yl)-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidine-3-carboxamide

[0267] 7-Methyl-4,5,6,7-tetrahydropyrazolo[1,5-a]pyrimidine-3-carboxylic acid (600 mg), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (1.89 g), propargylamine hydrochloride (457 mg), and N,N-diisopropylethylamine (2.14 g) were dissolved in dichloromethane (30 mL) and stirred at room temperature for 16 hours. The reaction was quenched with water (100 mL), extracted with ethyl acetate (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 1:2) to give the target compound (540 mg).

[0268] Synthesis of intermediate 5-amino-1-(3,3-difluorocyclobutyl)-N-(prop-2-yn-1-yl)-1H-pyrazole-4-carboxamide:

[0269] Step 1: tert-butyl 2-(3,3-difluorocyclobutylmethylene)hydrazine-1-carboxylate

[0270] 3,3-Difluorocyclobutane-1-one (900 mg) and tert-butyl hydrazinocarbamate (1.12 g) were dissolved in methanol (30 mL), stirred at room temperature for 16 hours, the reaction was quenched with water (100 mL), extracted with dichloromethane (100 mL × 3), the extract was washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain the target compound (861 mg).

[0271] Step 2: tert-butyl 2-(3,3-difluorocyclobutyl)hydrazine-1-carboxylate

[0272] 861 mg of tert-butyl 2-(3,3-difluorocyclobutylmethylene)hydrazide-1-carboxylate was dissolved in acetic acid (6 mL) and tetrahydrofuran (8 mL), and sodium cyanoborohydride (247 mg) was slowly added. The mixture was stirred at room temperature for 16 hours. The reaction was quenched with water (100 mL), and the mixture was extracted with dichloromethane (100 mL × 3). The extract was washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 3:1) to give the target compound (710 mg).

[0273] Step 3: (3,3-Difluorocyclobutyl)hydrazine

[0274] 710 mg of tert-butyl 2-(3,3-difluorocyclobutyl)hydrazine-1-carboxylate was dissolved in 10 mL of 2.5 N dioxane hydrochloride solution, stirred at room temperature for 16 hours, and concentrated under reduced pressure to obtain the target compound (510 mg).

[0275] Step 4: Ethyl 5-amino-1-(3,3-difluorocyclobutyl)-1H-pyrazole-4-carboxylate

[0276] A solution of (3,3-difluorocyclobutyl)hydrazine (510 mg), ethyl 2-cyano-4-(dimethylamino)but-3-enoate (523 mg), and triethylamine (422 mg) in toluene (20 mL) was reacted in a sealed tube at 110 °C for 48 hours. The reaction was quenched with water (100 mL), extracted with dichloromethane (100 mL × 3), washed with saturated brine (100 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 3:1) to give the target compound (163 mg).

[0277] Step 5: 5-Amino-1-(3,3-difluorocyclobutyl)-1H-pyrazole-4-carboxylic acid

[0278] Ethyl 5-amino-1-(3,3-difluorocyclobutyl)-1H-pyrazole-4-carboxylate (22 mg) was dissolved in tetrahydrofuran (5 mL) and water (10 mL), and sodium hydroxide (18 mg) was added. The mixture was stirred at room temperature for 16 hours. The pH was adjusted to 7 with 3 mol / L hydrochloric acid aqueous solution, and the mixture was extracted with dichloromethane (50 mL × 5). The extract was washed with saturated brine (50 mL × 3), dried over anhydrous sodium sulfate, and concentrated under reduced pressure to obtain the target compound (18 mg).

[0279] Step 6: 5-Amino-1-(3,3-difluorocyclobutyl)-N-(prop-2-yn-1-yl)-1H-pyrazole-4-carboxamide

[0280] 5-Amino-1-(3,3-difluorocyclobutyl)-1H-pyrazole-4-carboxylic acid (18 mg), 2-(7-azabenzotriazole)-N,N,N',N'-tetramethylurea hexafluorophosphate (51 mg), propargylamine hydrochloride (13 mg), and N,N-diisopropylethylamine (58 mg) were dissolved in dichloromethane (10 mL) and stirred at room temperature for 16 hours. The reaction was quenched with water (50 mL), extracted with ethyl acetate (50 mL × 3), washed with saturated brine (50 mL × 3), dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was purified by column chromatography (petroleum ether / ethyl acetate = 1:2) to give the target compound (20 mg).

[0281] Synthesis of intermediate 1-(tert-butyl)-5-(difluoromethyl)-N-(prop-2-yn-1-yl)-1H-pyrazole-4-carboxamide:

[0282] Step 1: Ethyl (Z)-2-((dimethylamino)methylene)-4,4-difluoro-3-oxobutyrate

[0283] Dimethylformamide dimethyl acetal (752 mg) was added to a mixture of ethyl 4,4-difluoro-3-oxobutyrate (524 mg), tetrahydrofuran (10 mL), and acetic acid (189 mg), and the mixture was stirred at room temperature for 3 hours. Water (30 mL) was added to the reaction mixture, and the mixture was extracted with dichloromethane (30 mL × 2). The extract was washed with saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was separated by column chromatography (petroleum ether / ethyl acetate = 2 / 1) to give the target compound (400 mg).

[0284] Step 2: Ethyl 1-(tert-butyl)-5-(difluoromethyl)-1H-pyrazole-4-carboxylate

[0285] 216 mg of tert-butylhydrazine was added dropwise to a mixture of (Z)-2-((dimethylamino)methylene)-4,4-difluoro-3-oxobutyrate (350 mg), ethanol (10 mL), and diisopropylethylamine (611 mg), and the mixture was stirred at room temperature for 12 hours. The mixture was concentrated under reduced pressure, and the residue was separated by column chromatography (petroleum ether / ethyl acetate = 10 / 1) to give the target compound (320 mg).

[0286] Step 3: 1-(tert-butyl)-5-(difluoromethyl)-1H-pyrazole-4-carboxylic acid

[0287] Lithium hydroxide (150 mg) was added to a mixture of ethyl 1-(tert-butyl)-5-(difluoromethyl)-1H-pyrazole-4-carboxylate (300 mg), methanol (5 mL), and water (5 mL), and the mixture was heated to 70 °C for 2 hours. The mixture was concentrated under reduced pressure, and the pH was adjusted to 5 with 6 mol / L hydrochloric acid. The solid precipitated, and the mixture was filtered to give the target compound (300 mg).

[0288] Step 4: 1-(tert-butyl)-5-(difluoromethyl)-N-(prop-2-yn-1-yl)-1H-pyrazole-4-carboxamide

[0289] A mixture of 1-(tert-butyl)-5-(difluoromethyl)-1H-pyrazole-4-carboxylic acid (300 mg), N,N-dimethylformamide (5 mL), diisopropylethylamine (883 mg), and HATU (634 mg) was stirred at room temperature for 10 minutes. Propylene chloride hydrochloride (188 mg) was added to the reaction mixture, and the mixture was stirred at room temperature for 2 hours. Water (30 mL) was added, and the mixture was extracted with dichloromethane (30 mL × 2). The extract was washed with saturated brine, dried over anhydrous sodium sulfate, concentrated under reduced pressure, and the residue was separated by column chromatography (petroleum ether / ethyl acetate = 2 / 1) to give the target compound (260 mg).

[0290] The following compounds were obtained by referring to the synthesis method described in the above embodiments:

[0291] Biological testing

[0292] 1. In vitro DNA binding assay of the compound:

[0293] We established an in vitro DNA binding assay for compounds using homogeneous time-resolved fluorescence (HTRF) to determine the activation activity of the compounds for p53 Y220C DNA binding. The assay system included the compounds, His-p53 Y220C, Anti-His-Tb, biotinylated p53 homogeneous DNA, and SA-d2. His-p53Y220C (94aa-294aa) protein was expressed in *E. coli* DH5α and purified using affinity chromatography with an AKTAAPurifier (GE). Anti-His-Tb was purchased from CisBio, catalog number 61HI2TLB. Biotinylated p53 homogeneous DNA was synthesized by Sangon Biotech, with the sequence F: 5'(biotin)ATTAGGCATGTCTAGGCATGTCTAGG, R: CCTAGACATGCCTAGACATGCCTAAT. SA-d2 was purchased from CisBio, catalog number 610SADLF. Specific experimental procedure: The compound was serially diluted 5-fold with 100% DMSO, starting from 2 mM, resulting in 8 concentrations. 4 μL of each concentration was added to 96 μL of reaction buffer (20 mM Hepes (pH 7.5), 75 mM KCl, 1 mM MgCl2, 0.1% BSA, 1 mM DTT) and mixed thoroughly to prepare 8× compounds for later use (final concentrations: 10000, 2000, 400, 80, 16, 3.2, 0.64, 0 nM). 8× His-p53 Y220C (final concentration 10 nM) and 4× Anti-His-Tb (final concentration 1×) were prepared using reaction buffer. Add 2.5 μL of the 8× compound to a 384-well microplate (OptiPlate-384 white plate, PerkinElmer, catalog number 6007290), add 2.5 μL of 8×His-p53 Y220C to the 384-well microplate, then add 5 μL of 4×Anti-His-Tb, centrifuge, incubate at 23°C in the dark for 15 minutes, then transfer to 27°C and incubate in the dark for 60 minutes. Add 5 μL of 4×p53 homogeneous DNA (final concentration 50 nM) and 5 μL of 4×SA-d2 (final concentration 1×), centrifuge, and incubate at 23°C for 60 minutes. Read the fluorescence values ​​on an Envision (purchased from PerkinElmer, catalog number 2103-0010) (320 nm excitation, detection of emission light at 665 nm and 620 nm, the ratio of the two is the enzyme activity). The activity of each compound was measured at eight concentrations. Data were processed using GraphPadPrism software to calculate the half-activating concentration (EC50) of each compound for binding to p53Y220C protein and DNA. 50 value..

[0294] The aforementioned "×" refers to multiplication, indicating a multiple.

[0295] The structure of the control compound PC14586 described later in this invention is as follows:

[0296] The structure of the control compound A described later in this invention is as follows:

[0297] Table 1. Activity of the p53 Y220C mutant in promoting DNA binding in the examples

[0298] As shown in Table 1, homogeneous time-resolved fluorescence (HTRF) experiments demonstrated that the compounds in the embodiments of this invention exhibited extremely significant activation effects on the binding of p53 Y220C mutant protein to DNA. The half-maximal effective concentrations (EC50) of all tested compounds were significantly higher than those of the compounds in the HTRF assay. 50 All of them are below 5 nM (range: 0.31-4.72 nM), indicating that they are all potent p53Y220C activators at the nanomolar level.

[0299] Specifically, EC, representing compound example 107 50 The concentration was 3.57 nM. Its activity was significantly superior to the known p53Y220C control compound PC14586 (EC). 50 (16.7 nM) and compound A (EC) 50 (14.6 nM). Activity comparison showed that the potency of Example 107 was approximately 4.7 times and 4.1 times that of PC14586 and compound A, respectively.

[0300] This result directly demonstrates that the compound of the present invention has outstanding advantages at the most fundamental target activation level, which lays a solid molecular foundation for its subsequent excellent anti-tumor efficacy in cell and animal models (see Tables 2-4 and in vivo pharmacodynamic examples).

[0301] 2. Assay for the cell proliferation inhibitory activity of the compound:

[0302] A method for detecting the proliferation inhibitory activity of compounds was established in HUH-7 (p53Y220C / -), BxPC-3 (p53 Y220C / -), and NUGC-3 (p53 Y220C / +) cells using Promega's CellTiter-Glo.

[0303] Human hepatocellular carcinoma cells HUH-7 and human pancreatic cancer cells BxPC-3 were purchased from the Cell Resource Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, and cultured in DMEM (Vivacell) medium supplemented with 10% fetal bovine serum (Biological Industries) and 1% penicillin-streptomycin (Gibco). Human gastric cancer cells NUGC-3 were purchased from Nanjing Kebai Biotechnology Co., Ltd., and cultured in RPMI 1640 (Vivacell) medium supplemented with 10% fetal bovine serum (Vivacell) and 1% penicillin-streptomycin (Gibco).

[0304] The cell line was cultured at 37°C, with 95% air and 5% CO2, at a height of 25 cm. 2 Or 75cm 2 In plastic tissue culture flasks (Corning), passage 2-3 times per week.

[0305] HUH-7, NUGC-3, and BxPC-3 cells were seeded at 500 cells / well, 500 cells / well, and 1000 cells / well, respectively, in 96-well cell culture plates (Corning, catalog number 3917), 195 μL / well, and cultured at 37°C under 95% aerosol and 5% CO2 conditions. After 24 hours, the test compound was added: the compound was serially diluted 3-fold with DMSO, starting at 100 mM (dissolved in DMSO), to obtain 10 concentrations. 4 μL of each concentration was added to 96 μL of serum-free medium, vortexed, and finally 5 μL of the diluted compound was added to the cell-seeded culture plate. The final concentration of DMSO in the cell culture medium was 0.1%, and the final concentration of the test compound was 0 nM–100 μM. The cells were cultured at 37°C for 6 days. Six days later, cell viability was measured using the CellTiter-Glo (Promega) kit. Finally, the data was processed using GraphPad Prism software to determine the half-maximal inhibitory concentration (IC50) of the compound on cell proliferation. 50 value.

[0306] Table 2. Inhibitory activity of the examples on the proliferation of HUH-7 cells.

[0307] Table 3. Inhibitory activity of the examples on the proliferation of BxPC-3 cells

[0308] Table 4. Inhibitory activity of the examples on the proliferation of NUGC-3 cells

[0309] The in vitro cell proliferation inhibition experiment results in Table 2-4 above show that the compounds in the embodiments of the present invention exhibit potent inhibitory activity at the nanomolar level (nM level) against human hepatocellular carcinoma cells (HUH-7), human pancreatic cancer cells (BxPC-3), and human gastric cancer cells (NUGC-3) carrying the p53Y220C mutation, with an IC50 value of [missing value]. 50 The values ​​are mainly distributed between 0.01 μM and 0.05 μM.

[0310] Specifically, the IC50 of compound Example 107 represents the effect of compound 107 on the three cell lines described above. 50 The values ​​were 0.02 μM, 0.03 μM, and 0.03 μM, respectively. Its activity was significantly superior to the control compound PC14586 (IC50). 50 (0.25 μM, 0.30 μM and 0.74 μM respectively) and compound A (IC 50 The concentrations were 0.23 μM, 0.38 μM, and 0.49 μM, respectively. Taking HUH-7 cells as an example, the activity of Example 107 was 12.5 times that of PC14586.

[0311] Of particular note was the significant decrease in the activity of the control compound PC14586 in p53 wild-type NUGC-3 cells (IC50). 50 The concentration was increased to 0.74 μM, while the compounds in the embodiments of the present invention (such as Example 107) still maintained high efficiency (IC). 50 The concentration was 0.03 μM, indicating that the compound of the present invention can maintain high activity in cells with different p53 genotypes.

[0312] 3. Animal pharmacokinetic studies of the examples:

[0313] The study used three healthy adult male rats obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd.

[0314] The experimental administration method was a single oral gavage administration to SD rats at a dose of 5 mg / kg, a volume of 5 mL / kg, and a concentration of 1 mg / mL.

[0315] The test sample of P53 was suspended in a 2% hydroxypropyl methylcellulose and 0.5% Tween 80 (W / V / V) aqueous solution, with a suspension concentration of 1 mg / mL.

[0316] Animals administered the drug via gavage were fasted overnight before the experiment, from 10 hours before administration to 4 hours after administration. Blood samples were collected sequentially at 0.25, 0.5, 1, 2, 4, 6, 8, and 24 hours after administration. Animals were lightly anesthetized with isoflurane, and approximately 0.3 mL of whole blood was collected from the orbital venous plexus using a glass blood collection tube. The blood was placed in a heparin sodium anticoagulant tube, centrifuged at 4200 rpm for 5 min at 4°C, and the plasma was transferred to a centrifuge tube and stored at -80°C until analysis.

[0317] Plasma sample analysis used acetonitrile protein precipitation to extract the analyte and internal standard (warfarin or propranolol) from rat plasma. The extracts were analyzed by LC / MS / MS. Individual animal plasma concentration-time data were analyzed using a non-compartmental model in WinNonlin (version 5.2.1; Pharsight) software, yielding the following pharmacokinetic parameters: peak plasma drug concentration C0. max Peak time T max Half-life T 1 / 2 And the area under the blood drug concentration-time curve (AUC) extrapolated to an infinite time. 0-inf .

[0318] Table 5. Pharmacokinetic parameters of the compounds in SD rats

[0319] The above data indicate that, under the same administration conditions, the key pharmacokinetic parameters (AUC) of the compound in Example 107 in rats are... 0-inf With C max It was significantly superior to the control compound PC14586 and compound A, and also exhibited faster absorption (T0). max (Even shorter).

[0320] 4. Determination of the in vitro inhibitory effect of the compound on CYP3A4 enzyme:

[0321] This study used LC-MS / MS technology to detect the in vitro inhibitory activity of the compound on the cytochrome P450 enzyme subtype CYP3A4 in human liver microsomes.

[0322] The core components of the experimental system include mixed human liver microsomes (final concentration 0.05 mg / mL, Corning), CYP3A4 specific probe substrates (midazolam final concentration 2 μM, testosterone final concentration 80 μM), NADPH (final concentration 1.5 mM), 100 mM PBS buffer (pH 7.4), and the analyte compound (final concentration 0-25 μM), with a total volume of 100 μL.

[0323] Specific experimental procedure: The compound was prepared into a 10 mM stock solution using DMSO, and then serially diluted to a series of working solutions of different concentrations (final concentrations corresponding to 0, 1, 2.5, 5.0, 10.0, and 25.0 μM); liver microsomal dilution and mixed incubation solution containing probe substrate were prepared using PBS buffer (pH 7.4), and pre-incubated at 37°C and 100 rpm in a water bath for 5 min. Add working solutions of different concentrations of test substances (final concentration 0-25 μM) and vortex to mix. Then add NADPH solution (final concentration 1.5 mM) to start the reaction. Incubate in a water bath at 37℃ and 100 rpm (10 min for the midazolam group and 20 min for the testosterone group), with a total incubation volume of 100 μL (organic solvent concentration ≤1%). After incubation, add 150 μL of ice-cold internal standard solution (acetonitrile solution containing propranolol, 500 ng / mL) to terminate the reaction. Centrifuge the sample at 4℃ and 12000 rpm for 10 min and collect the supernatant. Quantitatively detect the metabolites using UPLC-MS / MS. Quantitatively analyze the peak area ratio of metabolites (1-hydroxymidazolam, 6β-hydroxytestosterone) to the internal standard using multiple reaction monitoring (MRM) mode. Calculate the half-maximal inhibitory concentration (IC50) using the two-point method or Graphpad Prism software. 50 )value.

[0324] Table 6. Inhibitory activity of the examples against CYP3A4 enzyme

[0325] The experimental results showed that the compound in Example 107 had low inhibitory activity against CYP3A4 enzyme (IC500 for both probe substrates). 50 Both >20 μM). In contrast, the control compound PC14586 showed strong inhibitory activity against both substrates (IC50 >20 μM). 50 (7.31 μM and 1.04 μM, respectively). This indicates that the risk of drug interaction from the compound of Example 107 is significantly lower than that from PC14586.

[0326] 5. In vivo pharmacodynamics of the compounds in the human pancreatic cancer BxPC-3 xenograft model

[0327] The compound was prepared into a solution for administration at 10 mL / kg, using 2% HPMC and 0.5% Tween 80 as the solvent. The experimental animals used were supplied by Beijing Vital River Laboratory Animal Technology Co., Ltd. Female BALB / c-nude mice, 6–8 weeks old, were used. BxPC-3 cells (Cell Resource Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, catalog number 1101HUM-PUMC000274) were cultured in vitro in DMEM medium (Vivacell, catalog number C3113-0500) supplemented with 10% fetal bovine serum (Vivacell, catalog number C04001-500) and 1% penicillin-streptomycin (Gibco, catalog number 15070-063), and incubated at 37°C in a 5% CO2 incubator. Cells were passaged twice a week. When cell saturation reached 80%–90% and the desired number was achieved, cells were harvested, counted, and seeded. BxPC-3 cells (2 × 10⁶ cells) were then seeded. 6 (cells) were subcutaneously injected into the back of each mouse, and the average tumor volume reached 100-200 mm. 3 Mice were given medication in groups starting at a certain time. Mice were weighed and tumor diameters measured 2-3 times per week. The formula for calculating tumor volume is: V = 0.5 × a × b 2 a and b represent the long and short diameters of the tumor, respectively. The antitumor efficacy of the compound was evaluated using TGl (%) or relative tumor proliferation rate (T / C) (%). Tumor growth inhibition rate (TGI) (%): TGI (%) = [1 - (mean tumor volume at the end of treatment - mean tumor volume at the beginning of treatment) / (mean tumor volume at the end of treatment in the solvent control group - mean tumor volume at the beginning of treatment in the solvent control group)] × 100%. Relative tumor proliferation rate (T / C) (%) = T... RTV / C RTV ×100% (T) RTV : Mean RTV in the treatment group; C RTV The negative control group's average RTV. Relative tumor volume (RTV) was calculated based on tumor measurements using the formula RTV = Vt / Vo, where V0 is the tumor volume measured at the time of drug administration (day 0), Vt is the tumor volume at a specific measurement, and T... RTV With C RTV Take data from the same day.

[0328] The drug administration information for each group is shown in Table 7.

[0329] Table 7. Administration routes, dosages, and regimens in the BxPC-3 subcutaneous xenograft model

[0330] The efficacy results of the compounds in this invention in the BALB / c-nude mouse BxPC-3 human pancreatic cancer subcutaneous xenograft model are shown in Figure 1.

[0331] The results showed that in the BxPC-3 cell subcutaneous xenograft model, the control compound PC14586 had a TGI of 73.8% at 100 mpk, while the compound of Example 107 achieved TGIs of 81.9% and 91.4% at 25 mpk and 100 mpk, respectively. Furthermore, the tumor-suppressing effect achieved by the compound of Example 107 at a dose of 25 mpk (TGI = 81.9%) was higher than that of the control compound PC14586 at a dose of 100 mpk (TGI = 73.8%). Throughout the experiment, there were no significant changes in the body weight of mice in any group, indicating that the tested compounds had good safety.

[0332] 6. In vivo pharmacodynamics of the compounds in the human gastric cancer NUGC-3 xenograft model

[0333] The compound was prepared as a solution for administration at 10 mL / kg, using 2% HPMC and 0.5% Tween 80 as the solvent. The experimental animals used were supplied by Beijing Vital River Laboratory Animal Technology Co., Ltd. Female BAL B / c-nude mice, 6–8 weeks old, were used. NUGC-3 human gastric cancer cells (Nanjing Kebai Biotechnology Co., Ltd., catalog number CBP60492) were cultured in vitro in RPMI 1640 medium (Vivacell, catalog number C3010-0500) supplemented with 10% fetal bovine serum (Vivacell, catalog number C04001-500) and 1% penicillin-streptomycin (Gibco, catalog number 15070-063), and incubated at 37°C in a 5% CO2 incubator. Cells were passaged twice a week. When cell saturation reached 80%–90% and the desired number was achieved, cells were harvested, counted, and seeded. NUGC-3 cells (1×10⁶) were... 6 (cells) were subcutaneously injected into the back of each mouse, and the average tumor volume reached 100-200 mm. 3 Mice were given medication in groups starting at a certain time. Mice were weighed and tumor diameters measured 2-3 times per week. The formula for calculating tumor volume is: V = 0.5 × a × b 2 a and b represent the long and short diameters of the tumor, respectively. The antitumor efficacy of the compound was evaluated using TGl (%) or relative tumor proliferation rate (T / C) (%). Tumor growth inhibition rate (TGI) (%): TGI (%) = [1 - (mean tumor volume at the end of treatment - mean tumor volume at the beginning of treatment) / (mean tumor volume at the end of treatment in the solvent control group - mean tumor volume at the beginning of treatment in the solvent control group)] × 100%. Relative tumor proliferation rate (T / C) (%) = T... RTV / C RTV ×100% (T) RTV : Mean RTV in the treatment group; C RTVThe negative control group's average RTV. Relative tumor volume (RTV) was calculated based on tumor measurements using the formula RTV = Vt / Vo, where V0 is the tumor volume measured at the time of drug administration (day 0), Vt is the tumor volume at a specific measurement, and T... RTV With C RTV Take data from the same day.

[0334] The dosing information for each group is shown in Table 8.

[0335] Table 8. Administration routes, dosages, and regimens in the NUGC-3 subcutaneous xenograft model

[0336] The efficacy results of the compounds in this invention in the BAL B / c-nude mouse NUGC-3 human gastric cancer subcutaneous xenograft model are shown in Figure 2.

[0337] The results showed that in the NUGC-3 cell subcutaneous xenograft model, the TGI of the control compound PC14586 at 30 mpk and 100 mpk was 13.9% and 71.7%, respectively, while the TGI of the compound in Example 107 at the same dose reached 89.4% and 105.3%, respectively. Furthermore, the tumor-suppressing effect achieved by the compound in Example 107 at a dose of 30 mpk (TGI = 89.4%) was higher than that of the control compound PC14586 at a dose of 100 mpk (TGI = 71.7%). Throughout the experiment, there were no significant changes in the body weight of mice in any group, indicating that the tested compounds had good safety.

[0338] 7. In vivo pharmacodynamics of the compounds in the human hepatocellular carcinoma HUH-7 xenograft model

[0339] The compound was prepared into a solution for administration at 10 mL / kg, using 2% HPMC and 0.5% Tween 80 as the solvent. The experimental animals used were supplied by Beijing Vital River Laboratory Animal Technology Co., Ltd. Female BAL B / c-nude mice, 6–8 weeks old, were used. HuH-7 cells (Cell Resource Center, Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, catalog number 1101HUM-PUMC000679) were cultured in vitro in DMEM medium (Vivacell, catalog number C3113-0500) supplemented with 10% fetal bovine serum (Vivacell, catalog number C04001-500) and 1% penicillin-streptomycin (Gibco, catalog number 15070-063), and incubated at 37°C in a 5% CO2 incubator. Cells were passaged twice a week. When cell saturation reached 80%–90% and the desired number was achieved, cells were harvested, counted, and seeded. HuH-7 cells (5 × 10⁶ cells) were... 6 (cells) were subcutaneously injected into the back of each mouse, and the average tumor volume reached 100-200 mm.3 Mice were given medication in groups starting at a certain time. Mice were weighed and tumor diameters measured 2-3 times per week. The formula for calculating tumor volume is: V = 0.5 × a × b 2 a and b represent the long and short diameters of the tumor, respectively. The antitumor efficacy of the compound was evaluated using TGl (%) or relative tumor proliferation rate (T / C) (%). Tumor growth inhibition rate (TGI) (%): TGI (%) = [1 - (mean tumor volume at the end of treatment - mean tumor volume at the beginning of treatment) / (mean tumor volume at the end of treatment in the solvent control group - mean tumor volume at the beginning of treatment in the solvent control group)] × 100%. Relative tumor proliferation rate (T / C) (%) = T... RTV / C RTV ×100% (T) RTV : Mean RTV in the treatment group; C RTV The negative control group's average RTV. Relative tumor volume (RTV) was calculated based on tumor measurements using the formula RTV = Vt / Vo, where V0 is the tumor volume measured at the time of drug administration (day 0), Vt is the tumor volume at a specific measurement, and T... RTV With C RTV Take data from the same day.

[0340] The dosing information for each group is shown in Table 9.

[0341] Table 9. Administration routes, dosages, and regimens in the HUH-7 subcutaneous xenograft model.

[0342] The efficacy results of the compounds in this invention in the BALB / c-nude mouse HuH-7 human liver cancer subcutaneous xenograft model are shown in Figure 3.

[0343] The results showed that in the HUH-7 cell subcutaneous xenograft model, the control compound PC14586 had a TGI of 15.4% and 71.7% at 30 mpk and 100 mpk, respectively, while the compound of Example 107 achieved TGIs of 43.4%, 95.5%, and 116.5% at 10 mpk, 30 mpk, and 100 mpk, respectively. Furthermore, the tumor-suppressing effect achieved by the compound of Example 107 at a dose of 30 mpk (TGI = 95.5%) was higher than that of the control compound PC14586 at a dose of 100 mpk (TGI = 71.7%). Throughout the experiment, there were no significant changes in the body weight of mice in any group, indicating that the tested compounds had good safety.

[0344] It should be noted that the specific information of some of the materials used in the biological testing of this invention is as follows:

[0345] The internal standard used was propranolol hydrochloride purchased from the National Institutes for Food and Drug Control, product number 100783;

[0346] The human liver cancer cells HUH-7 and human pancreatic cancer cells BxPC-3 used were cataloged at the Cell Resource Center of the Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences, with catalog numbers 1101HUM-PUMC000679 and 1101HUM-PUMC000274, respectively. The human gastric cancer cells NUGC-3 used were cataloged at Nanjing Kebai Biotechnology Co., Ltd. with catalog number CBP60492.

[0347] The CellTiter-Glo test kit used (Promega) is catalog number G7570;

[0348] The Biological Industries fetal bovine serum used was catalog number 04-001-1ACS, and the Vivacell fetal bovine serum used was catalog number C04001-500.

[0349] The penicillin-streptomycin (Gibco) used was catalog number 15070-063, the DMEM medium (Vivacell) used was catalog number C3113-0500, and the RPMI 1640 medium (Vivacell) used was catalog number C3010-0500;

[0350] The 96-well cell culture plate used (Corning) has the catalog number 3917.

[0351] Those skilled in the art will understand that the specific product numbers listed above are merely examples, and the present invention can be achieved using other equivalent batches, specifications, or sources of similar reagents and materials from the aforementioned brands.

Claims

1. A compound of formula (IV) or a pharmaceutically acceptable salt, solvate, deuterated derivative, polymorph, or isomer thereof. in, Ring A is an aromatic ring. X1 is N, CH, or CF. X 10 For N, CH, or CF, X 11 For N, CH, or CF, X9 uses CS-CF3. R is or One, two, or all three of X3, X4, and X5 are N, and the rest are C or CH. Furthermore, when X3 is C or CH, X4 and X5 cannot both be N simultaneously. The E ring is a benzene ring or a 6-membered heteroaryl ring. Ring B is a benzene ring or a 5-6 membered heteroaryl ring. The C ring is a 5-7 membered heterocyclic ring. The D ring is a 5-membered heteroaryl ring. The C ring is optionally oxidized by oxygen, and the C ring is optionally oxidized by halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl groups, -(CO)-NR7R8, -(CO)-OR7, -(CO)-R 23 -(CO)-OR7, -(SO2)-NR7R8, or -NR 24 -(SO2)-R 23 replace, The E and B rings are optionally converted by halogens, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl groups, -(CO)-NR7R8, -(CO)-OR7, -(CO)-R 23 -(CO)-OR7, -(SO2)-NR7R8, or -NR 24 -(SO2)-R 23 replace; R 21 It can be methyl, ethyl, or tert-butyl. R 22 Halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl groups, -(CO)-NR7R8, -(CO)-OR7, -(CO)-R 23 -(CO)-OR7, -(SO2)-NR7R8, or -NR 24 -(SO2)-R 23 ,or R 21 The propyl, isopropyl, butyl, isobutyl, 3-8 membered cycloalkyl, or 3-8 membered heterocyclic group is used, wherein the propyl, isopropyl, butyl, isobutyl, cycloalkyl, or heterocyclic group is optionally replaced by (C=O), halogen, -CN, -NH2, -OH, or C. 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution, R 22 For H, halogens, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl groups, -(CO)-NR7R8, -(CO)-OR7, -(CO)-R 23 -(CO)-OR7, -(SO2)-NR7R8, or -NR 24 -(SO2)-R 23 ; R 23 C 1-6 Alkyl, 3-8 membered cycloalkyl, or 3-8 membered heterocyclic group, wherein the alkyl, cycloalkyl, or heterocyclic group is optionally converted by halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution, R 24 For H or C 1-6 alkyl, L1 is -(CR3R4) p - R3 and R4 are independently H and C. 1-6 Alkyl or halogenated C 1-6 alkyl, R2 is a 3-8 membered cycloalkyl group or a 3-8 membered heterocyclic group, wherein when the heterocyclic group contains S, the S atom is optionally oxidized to... or Furthermore, the cycloalkyl and heterocyclic groups are optionally replaced by (=O), halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl), -(CO)-NR7R8, -(CO)-OR7, or R 12 replace, R 12 It is a 3-8 membered cycloalkyl, a 3-8 membered heterocyclic group, a 6-10 membered aryl, or a 5-12 membered heteroaryl, wherein when the heterocyclic group contains S, the S atom is optionally oxidized to Furthermore, the cycloalkyl, heterocyclic, aryl, and heteroaryl groups are optionally replaced by (=O), halogen, -CN, -NH2, -OH, or C. 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution, R7 and R8 are independently H and C. 1-6 Alkyl or halogenated C 1-6 alkyl, p is 0 or 1.

2. The compound according to claim 1 or a pharmaceutically acceptable salt, solvate, deuterated derivative, polymorph, or isomer thereof, wherein X1 is N or CH, X 10 For N or CH, X 11 It can be N or CH.

3. The compound according to claim 2, or a pharmaceutically acceptable salt, solvate, deuterated derivative, polymorph, or isomer thereof, wherein X 10 For CH, X 11 For CH, R is One, two, or all three of X3, X4, and X5 are N, and the rest are C or CH. Furthermore, when X3 is C or CH, X4 and X5 cannot both be N simultaneously. R 10 For H, C 1-6 Alkyl, 3-8 membered cycloalkyl, or 3-8 membered heterocyclic group, wherein the alkyl, cycloalkyl, or heterocyclic group is optionally converted by halogen, -CN, -NH2, -OH, or -OC. 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl group, 3-8 membered cycloalkyl group, or 3-8 membered heterocyclic group, wherein the alkyl group is optionally substituted with halogen, -CN, -NH2, -OH, or -OC. 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl), 3-8 membered cycloalkyl, or 3-8 membered heterocyclic substituted.

4. The compound according to claim 3, or a pharmaceutically acceptable salt, solvate, deuterated derivative, polymorph, or isomer thereof, wherein R 10 For H, C 1-6 Alkyl groups, or 3-8 membered cycloalkyl groups, wherein the alkyl and cycloalkyl groups are optionally converted by halogen, -CN, -NH2, -OH, -OC. 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl group, 3-8 membered cycloalkyl group, or 3-8 membered heterocyclic group, wherein the alkyl group is optionally substituted with halogen, -CN, -NH2, -OH, or -OC. 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 Alkyl), 3-8 membered cycloalkyl, or 3-8 membered heterocyclic substituted.

5. The compound according to claim 1, or a pharmaceutically acceptable salt, solvate, deuterated derivative, polymorph, or isomer thereof, wherein... X3 is N, X1, X4, X5, X 10 and X 11 For CH, or X4 is N, X1, X3, X5, X 10 and X 11 For CH, or X3 and X5 are N, X1, X4, X 10 and X 11 For CH, or X3 and X 10 Let N be the integers X1, X4, X5, and X. 11 For CH, or X5 is N, X1, X3, X4, X 10 and X 11 For CH, or X3 and X4 are N, X1, X5, X 10 and X 11 For CH, or X1 is N, X3, X4, X5, X 10 and X 11 For CH, or X1, X4, and X5 are N, X3, X 10 and X 11 For CH.

6. The compound of claim 3 or a pharmaceutically acceptable salt, solvate, deuterated derivative, polymorph, or isomer thereof, wherein R is... R 10 As defined in claim 3.

7. The compound of claim 3 or a pharmaceutically acceptable salt, solvate, deuterated derivative, polymorph, or isomer thereof, wherein p is 0, R2 is a 3-8 member nitrogen-containing heterocyclic group, said heterocyclic group optionally being replaced by (=O), halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, -N(C) 1-6 Alkyl)(C 1-6 alkyl), or R 12 replace, R 12 It is a 3-8 membered cycloalkyl group or a 3-8 membered heterocyclic group, wherein when the heterocyclic group contains S, the S atom is optionally oxidized to Furthermore, the cycloalkyl and heterocyclic groups are optionally replaced by (=O), halogen, -CN, -NH2, -OH, C 1-6 Alkyl, Halogenated C 1-6 Alkyl, -OC 1-6 Alkyl, -NH-C 1-6 Alkyl, or -N(C) 1-6 Alkyl)(C 1-6 Alkyl) substitution.

8. The following compounds Or a pharmaceutically acceptable salt, solvate, deuterated, polymorph, or isomer thereof.

9. A pharmaceutical composition comprising the compound according to any one of claims 1-8 or a pharmaceutically acceptable salt, solvate, deuterated form, polymorph, or isomer thereof, and a pharmaceutically acceptable carrier.

10. Use of the compound of any one of claims 1-8 or a pharmaceutically acceptable salt, solvate, deuterated form, polymorph, or isomer thereof, or the pharmaceutical composition of claim 9, in the preparation of a medicament for treating diseases associated with p53 mutants.

11. The use according to claim 10, wherein the diseases associated with the p53 mutant are non-Hodgkin lymphoma, B-cell non-Hodgkin lymphoma, diffuse large B-cell lymphoma, mantle cell lymphoma, follicular lymphoma, mucosa-associated lymphoid tissue lymphoma, marginal zone lymphoma, T-cell lymphoma, Hodgkin lymphoma, Burkitt lymphoma, multiple myeloma, chronic lymphocytic leukemia, small lymphocytic lymphoma, Waldenström macroglobulinemia, lymphocytic T-cell leukemia, chronic myeloid leukemia, hairy cell leukemia, acute lymphoblastic T-cell leukemia, plasmacytoma, immunoblastoma. Large cell leukemia, megakaryocytic leukemia, acute megakaryocytic leukemia, promyelocytic leukemia, erythroleukemia, glioma, glioblastoma, breast cancer, colorectal cancer, prostate cancer, lung cancer, stomach cancer, endometrial cancer, melanoma, pancreatic cancer, liver cancer, kidney cancer, squamous cell carcinoma, ovarian cancer, sarcoma, osteosarcoma, thyroid cancer, bladder cancer, head and neck cancer, testicular cancer, Ewing's sarcoma, rhabdomyosarcoma, medulloblastoma, neuroblastoma, cervical cancer, kidney cancer, urothelial carcinoma, vulvar cancer, esophageal cancer, salivary gland cancer, nasopharyngeal carcinoma, buccal cancer, oral cancer, or gastrointestinal stromal tumor.

Images