Suppressor of gene silencing 2 and use thereof
By expressing plant SGS2 protein or its functional variants in animal cells and using an oncolytic adenovirus delivery system, nucleic acid constructs and viruses were prepared, solving the problem of high failure rates in existing treatments. This resulted in effective killing and inhibition of prostate and bladder cancer, demonstrating good safety and application prospects.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- NEOEVOLUTION (BEIJING) MEDICAL TECHNOLOGY CO LTD
- Filing Date
- 2026-01-26
- Publication Date
- 2026-07-30
AI Technical Summary
Existing treatments for prostate and bladder cancer have high failure rates, and there is an urgent need for more effective treatments, especially for patients who do not respond to standard treatments or whose cancers have relapsed. Current methods are insufficient to meet clinical needs.
The plant SGS2 protein or its functional variants are expressed in animal cells, and nucleic acid constructs and viruses are prepared using oncolytic adenovirus as a delivery system for the preparation of drugs that kill tumor cells, including a nucleic acid sequence encoding the SGS2 protein and a viral vector, preferably an oncolytic adenovirus.
It exhibits good safety and tumor-suppressing effects in vitro and in tumor-bearing animals, and has significant killing effects on prostate cancer and bladder cancer, showing broad prospects for clinical application.
Smart Images

Figure PCTCN2026074882-FTAPPB-I100001 
Figure PCTCN2026074882-FTAPPB-I100002 
Figure PCTCN2026074882-FTAPPB-I100003
Abstract
Description
Gene silencing repressor 2 and its applications
[0001] This application claims priority to Chinese Patent Application No. 202510123833.5, filed on January 26, 2025, entitled "Gene Silencing Repressor 2 and Its Application", and Chinese Patent Application No. 202510234268.X, filed on February 28, 2025, entitled "Use in the Treatment of Bladder Cancer", the entire contents of which are incorporated herein by reference. Technical Field
[0002] This invention relates to the fields of molecular biology and tumor therapy. More specifically, it relates to the use of plant gene silencing repressor 2 or functional variants thereof in the preparation of drugs for treating prostate or bladder cancer. Background Technology
[0003] The latest data released by the International Agency for Research on Cancer (IARC) of the World Health Organization shows that in 2022, there were 20 million new cancer cases and 9.7 million cancer deaths worldwide. Approximately one in five people will develop cancer in their lifetime, and about one in nine men and one in twelve women will die from it. It is projected that by 2050, the number of new cancer cases will exceed 35 million, an increase of 77% compared to 2022; at the same time, the cancer mortality rate is likely to double by 2050.
[0004] Prostate cancer is one of the most common malignant tumors. According to the global cancer statistics report published by the International Agency for Research on Cancer (IARC) of the World Health Organization, in 2020, there were 1,414,259 new cases of prostate cancer worldwide, accounting for 7.3% of all malignant tumors, ranking third in incidence after breast and lung cancer; there were 375,304 deaths from prostate cancer, accounting for 3.8% of all malignant tumors, ranking eighth in mortality. Data from the National Cancer Center of China shows that in 2015, there were 72,000 new cases of prostate cancer in my country, with an incidence rate of 10.23 per 100,000, ranking sixth among male malignant tumors; there were 31,000 deaths, with a mortality rate of 4.36 per 100,000, ranking tenth among male malignant tumors. Population aging, changes in lifestyle, and the widespread use of prostate-specific antigen (PSA) screening methods have led to a year-on-year increase in the incidence of prostate cancer in my country in recent years.
[0005] Bladder cancer is one of the most common malignant tumors of the urinary system. Worldwide, bladder cancer ranks 9th in incidence among malignant tumors, 7th in men (9.50 / 100,000) and 10th in women (2.41 / 100,000); its mortality rate ranks 13th, with a male mortality rate of 3.2 / 100,000 and a female mortality rate of 0.9 / 100,000. Bladder cancer is a serious threat to national health. According to data released by the National Cancer Registry Center in 2019: In 2015, the incidence rate of bladder cancer in my country was 5.80 / 100,000, ranking 13th among all malignant tumors; the male incidence rate was 8.83 / 100,000, ranking 7th; and the female incidence rate was 2.61 / 100,000, ranking 17th. In 2015, the mortality rate of bladder cancer in my country was 2.37 / 100,000, ranking 13th; and the male mortality rate was 3.56 / 100,000, ranking 11th. The female mortality rate is 1.11 per 100,000, ranking 16th. Population aging, changes in lifestyle, and the widespread application of bladder cancer screening methods have led to a year-on-year increase in the incidence of bladder cancer in my country in recent years. The global bladder cancer treatment industry market size has continued to grow in recent years and is expected to reach approximately US$9 billion by 2025. The Chinese bladder cancer treatment industry market size is growing rapidly and is expected to reach approximately RMB 7.7 billion by 2025.
[0006] Standard treatments for prostate cancer primarily include surgery, radiation therapy, androgen deprivation-based endocrine therapy, and chemotherapy. Standard treatments for bladder cancer primarily include surgery, chemotherapy, radiation therapy, and immunotherapy. While the proportion of patients failing standard treatment varies across different studies, the overall failure rate is close to 50%. Current treatments are insufficient to effectively address the threat of cancer to human life, necessitating more effective treatments and the urgent need for emerging therapies to provide new options for patients who are unresponsive to BCG or have relapsed. Summary of the Invention
[0007] This invention provides nucleic acid constructs for expressing plant SGS2 protein or functional variants thereof in animal cells.
[0008] This invention provides a nucleic acid construct, comprising:
[0009] (1) A nucleic acid sequence encoding the SGS2 protein or a functional variant thereof, wherein the amino acid sequence of the SGS2 protein is as shown in any one of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NO: 1-11, or
[0010] (2) A nucleic acid sequence having at least 80% sequence identity with (1) and encoding the SGS2 protein or a functional variant thereof shown in SEQ ID NO: 1-11, or
[0011] (3)(1) or (2) reverse complementary sequences.
[0012] In one or more embodiments, the SGS2 protein is derived from plants, including: alfalfa, cotton, Arabidopsis thaliana, Nicotiana bungeana, tobacco, Nicotiana heartleaf, tomato, corn, rice, barley, and sphagnum moss; preferably, the plants are Arabidopsis thaliana, tobacco, and rice; more preferably, the plants are Arabidopsis thaliana.
[0013] In one or more embodiments, the nucleic acid sequence encoding the SGS2 protein is shown in any of SEQ ID NO: 12-22. Preferably, the nucleic acid sequence encoding the SGS2 protein is shown in SEQ ID NO: 14.
[0014] In one or more embodiments, the nucleic acid sequence encoding a functional variant of the SGS2 protein is shown in SEQ ID NO: 23.
[0015] In one or more embodiments, the functional variant of the SGS2 protein contains the amino acid sequence of RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region.
[0016] In one or more embodiments, the nucleic acid construct is mRNA containing a promoter and polyA.
[0017] In one or more embodiments, the nucleic acid construct is a vector, preferably a viral vector.
[0018] The present invention also provides a virus, comprising:
[0019] (1) A nucleic acid sequence encoding the SGS2 protein or a functional variant thereof, wherein the amino acid sequence of the SGS2 protein is as shown in any one of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NO: 1-11, or
[0020] (2) A nucleic acid sequence having at least 80% sequence identity with (1) and encoding the SGS2 protein or a functional variant thereof shown in SEQ ID NO: 1-11, or
[0021] (3)(1) or (2) reverse complementary sequences, or
[0022] In one or more embodiments, the virus comprises the nucleic acid construct described in any of the embodiments herein.
[0023] In one or more embodiments, the virus includes adeno-associated virus, adenovirus, and retrovirus. Preferably, the virus is oncolytic adenovirus.
[0024] The present invention also provides a cell, wherein:
[0025] (1) Containing, expressing, and / or secreting SGS2 protein or a variant thereof having at least 80% sequence identity and retaining function, wherein the amino acid sequence of the SGS2 protein is shown in any of SEQ ID NO: 1-11.
[0026] (2) Containing the following sequences: i) a nucleic acid sequence encoding the SGS2 protein or a functional variant thereof, wherein the amino acid sequence of the SGS2 protein is as shown in any one of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NO: 1-11; ii) a nucleic acid sequence having at least 80% sequence identity with i) and encoding the SGS2 protein or a functional variant thereof shown in SEQ ID NO: 1-11; and / or, iii) the reverse complementary sequence of i) or ii).
[0027] (3) Contains the nucleic acid constructs described in any of the embodiments herein.
[0028] (4) Contains the virus described in any of the embodiments herein.
[0029] In one or more embodiments, the cells are used to prepare oncolytic adenovirus.
[0030] In one or more embodiments, the nucleic acid construct is a vector.
[0031] In one or more embodiments, the vector is a cloning vector, an integration vector, or an expression vector.
[0032] In one or more embodiments, the vector is a viral vector, preferably an oncolytic adenovirus vector.
[0033] In one or more embodiments, the cells are HEK-293 cells, including one or more selected from HEK-293T, HEK-293H, HEK-293F, HEK-293S, HEK-293T / 17, HEK-293T / 17SF, HEK-293FT, HEK-293SG, HEK-293E, HEK-293-6E, HEK-293FTM, and HEK-293SGGD cells.
[0034] This invention provides the use of the SGS2 protein or a functional variant thereof, the nucleic acid molecule encoding it, the nucleic acid constructs described in any embodiment herein, and / or the virus described in any embodiment herein in the preparation of a medicament for killing tumor cells or treating tumors.
[0035] In one or more embodiments, the tumor is prostate cancer or bladder cancer.
[0036] In one or more embodiments, the tumor is derived from an animal.
[0037] In one or more embodiments, the SGS2 is derived from plants, including: alfalfa, cotton, Arabidopsis thaliana, tobacco Bunsenulata, tobacco, heartleaf tobacco, tomato, corn, rice, barley, and sphagnum moss; preferably, the plants are Arabidopsis thaliana, tobacco, and rice; more preferably, the plants are Arabidopsis thaliana.
[0038] In one or more embodiments, the functional variant of the SGS2 protein contains the amino acid sequence of RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region.
[0039] In one or more embodiments, the amino acid sequence of the SGS2 protein is as shown in any of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any of SEQ ID NO: 1-11.
[0040] In one or more embodiments, the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof is as shown in any of SEQ ID NO: 12-23, or has at least 80% sequence identity with it.
[0041] The present invention also provides pharmaceutical compositions comprising pharmaceutically acceptable excipients and active ingredients, said active ingredients including: SGS2 protein or a functional variant thereof, nucleic acid molecules encoding thereas, nucleic acid constructs as described in any embodiment herein, viruses as described in any embodiment herein, and / or cells as described in any embodiment herein.
[0042] In one or more embodiments, the pharmaceutical composition further comprises a delivery system for delivering the active ingredient.
[0043] In one or more embodiments, the delivery system is a viral vector or a non-viral vector; preferably, the viral vector includes adeno-associated virus, adenovirus, or retrovirus; preferably, the non-viral vector includes plasmids, lipids, liposomes, cationic polymers, lipid nanoparticles (LNPs), multifunctional envelope nanocarriers, polymeric compounds, peptides, proteins, cells, nanoparticle mimics, nanotubes, conjugated vesicles, N-acetylgalactosamine (GalNAc), or engineered bacteria; more preferably, the delivery system is an adenovirus; even more preferably, the delivery system is an oncolytic adenovirus.
[0044] In one or more embodiments, the amino acid sequence of the SGS2 protein is as shown in any of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any of SEQ ID NO: 1-11.
[0045] In one or more embodiments, the nucleic acid molecule has: (1) a nucleic acid sequence encoding the SGS2 protein or a functional variant thereof, or (2) a nucleic acid sequence having at least 80% sequence identity with (1) and encoding the SGS2 protein or a functional variant thereof shown in SEQ ID NO: 1-11, or (3) the reverse complementary sequence of (1) or (2).
[0046] In one or more embodiments, the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof is as shown in any of SEQ ID NO: 12-23, or has at least 80% sequence identity with it.
[0047] In one or more embodiments, the pharmaceutical composition is used to treat a tumor or kill tumor cells. In one or more embodiments, the tumor is prostate cancer or bladder cancer.
[0048] The present invention also provides the use of a reagent in the preparation of a drug for killing tumor cells or treating tumors, said reagent comprising SGS2 protein or a functional variant thereof, a nucleic acid molecule encoding thereon, a nucleic acid construct as described in any embodiment herein, a virus as described in any embodiment herein, and / or a cell as described in any embodiment herein.
[0049] In one or more embodiments, the plant includes: alfalfa, cotton, Arabidopsis thaliana, tobacco Bunseni, tobacco, heartleaf tobacco, tomato, corn, rice, barley, and sphagnum moss; preferably, the plant is Arabidopsis thaliana, tobacco, or rice; more preferably, the plant is Arabidopsis thaliana.
[0050] In one or more embodiments, the functional variant of the SGS2 protein contains the amino acid sequence of RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region.
[0051] In one or more embodiments, the amino acid sequence of the SGS2 protein is as shown in any of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any of SEQ ID NO: 1-11.
[0052] In one or more embodiments, the nucleic acid molecule has: (1) a nucleic acid sequence encoding the SGS2 protein or a functional variant thereof, or (2) a nucleic acid sequence having at least 80% sequence identity with (1) and encoding the SGS2 protein or a functional variant thereof shown in SEQ ID NO: 1-11, or (3) the reverse complementary sequence of (1) or (2).
[0053] In one or more embodiments, the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof is as shown in any of SEQ ID NO: 12-23, or has at least 80% sequence identity with it.
[0054] In one or more embodiments, the reagent or drug comprises a delivery system for delivering the active ingredient.
[0055] In one or more embodiments, the delivery system is a viral vector or a non-viral vector; preferably, the viral vector includes adeno-associated virus, adenovirus, or retrovirus; preferably, the non-viral vector includes plasmids, lipids, liposomes, cationic polymers, lipid nanoparticles (LNPs), multifunctional envelope nanocarriers, polymeric compounds, peptides, proteins, cells, nanoparticle mimics, nanotubes, conjugated vesicles, N-acetylgalactosamine (GalNAc), or engineered bacteria; more preferably, the delivery system is an adenovirus; even more preferably, the delivery system is an oncolytic adenovirus.
[0056] In one or more embodiments, the delivery system is loaded with the nucleic acid molecule or the nucleic acid construct.
[0057] In one or more embodiments, the nucleic acid construct includes at least one expression regulatory element, and the expression regulatory element is operatively linked to a nucleic acid molecule encoding the SGS2 protein or a functional variant thereof.
[0058] In one or more embodiments, the tumor is prostate cancer or bladder cancer.
[0059] In one or more embodiments, the tumor is derived from an animal.
[0060] The present invention also provides a method for preparing an oncolytic adenovirus comprising a nucleic acid sequence encoding the SGS2 protein or a functional variant thereof, the method comprising the steps of:
[0061] (1) Construct a plasmid containing the Sgs2 gene.
[0062] (2) Prepare a virus containing the plasmid in (1).
[0063] The present invention also provides a method for treating or preventing a disease or condition in a subject in need, comprising administering to the subject an effective amount of SGS2 protein or a functional variant thereof, a nucleic acid molecule encoding therethe, a nucleic acid construct as described in any embodiment herein, a virus as described in any embodiment herein, a cell as described in any embodiment herein, and / or a pharmaceutical composition as described in any embodiment herein.
[0064] In one or more embodiments, the SGS2 protein or a functional variant thereof is derived from plants, preferably including alfalfa, cotton, Arabidopsis thaliana, Nicotiana bungeana, tobacco, Nicotiana cardinalis, tomato, corn, rice, barley, and sphagnum moss; more preferably, the plants are Arabidopsis thaliana, tobacco, and rice.
[0065] In one or more embodiments, the functional variant of the SGS2 protein contains the amino acid sequence of RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region.
[0066] In one or more embodiments, the amino acid sequence of the SGS2 protein is as shown in any of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any of SEQ ID NO: 1-11.
[0067] In one or more embodiments, the nucleic acid molecule has: (1) a nucleic acid sequence encoding the SGS2 protein or a functional variant thereof, or (2) a nucleic acid sequence having at least 80% sequence identity with (1) and encoding the SGS2 protein or a functional variant thereof shown in SEQ ID NO: 1-11, or (3) the reverse complementary sequence of (1) or (2).
[0068] In one or more embodiments, the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof is as shown in any of SEQ ID NO: 12-23, or has at least 80% sequence identity with it.
[0069] In one or more embodiments, the disease or condition is cancer. Preferably, the cancer is prostate cancer or bladder cancer.
[0070] The beneficial effects of this invention are as follows: expressing plant SGS2 protein, or its functional variants, or its nucleic acid constructs in animal cells, exhibits good safety and tumor-suppressive effects against prostate cancer and bladder cancer at both in vitro cellular levels and in tumor-bearing animals, and has broad prospects for clinical application. Attached Figure Description
[0071] Figures 1A and 1B show the bioinformatics analysis results of SGS2 protein sequences. Figure 1A shows the amino acid sequences of SGS2 proteins from 11 plant species and their conservation analysis results, where * indicates a conserved sequence (identical), : indicates a conservative mutation, · indicates a semi-conservative mutation, and - indicates a gap. Figure 1B shows that the sequences of the functional domains RdRP and RRM of various plant SGS2 proteins are highly conserved.
[0072] Figures 2A to 2C show schematic diagrams of the construction of plasmids for different recombinant oncolytic adenovirus vectors. Figure 2A is a schematic diagram of the construction of plasmid H37195 for virus E9272; Figure 2B is a schematic diagram of the construction of plasmid H37196 for virus E9273; and Figure 2C is a schematic diagram of the construction of plasmid H37197 for virus E9274.
[0073] Figure 3 shows the detection graphs for different virus titers.
[0074] Figure 4A shows the melting curves of the internal reference gene and the exogenous gene after infection of HEK-293 cells with different viruses. Figure 4B shows the bar chart of the average relative expression levels of the exogenous gene Sgs2 relative to the internal reference gene Gapdh after infection of HEK-293 cells with different viruses. Error bars represent standard errors (SEM), n=3.
[0075] Figure 5 shows the results of detecting the half-maximal inhibitory concentration (IC50) of different cell lines after infection with different oncolytic viruses. The data in the figure represent the mean cell viability within the group, and the error bars represent the standard error (SEM). n=3.
[0076] Figure 6 shows the detection results of the half-maximal inhibitory concentration (IC50) of oncolytic virus E9272 or different batches of E9273 against mouse bladder cancer cells MB49, mouse bladder cancer cells MBT2, and human prostate cancer cells PC-3. Data in the figure represent mean cell viability within each group, and the error bars represent standard errors (SEM). n = 3. Solvent represents the solvent-treated group.
[0077] Figure 7A shows the standard curve for absolute quantification of viral genome copy number by qPCR. Figure 7B shows the results of absolute quantification of viral genome copy number by qPCR at multiple time points after infection with different tumor cells, positive control cells, and normal cells by oncolytic virus E9272 or E9273. The data in the figure represent the mean viral genome copy number within each group, and the error bars represent the standard error (SEM), n=3. Solvent represents the solvent treatment group.
[0078] Figure 8 shows the results of detecting the expression level of the exogenous gene Sgs2 mRNA after infection of different cells with oncolytic viruses E9272 and E9273. The data in the figure represent the average relative expression levels of exogenous and exogenous genes in the group, and the error bars represent the standard error (SEM). n=3.
[0079] Figure 9A shows the standard curve for absolute quantification of viral genome copy number by qPCR. Figure 9B shows the replication status of oncolytic virus E9272-batch 3 or E9273-batch 3 in tumor cells PC-3 72 h after infection. The data in the figures represent the mean viral gene copy number within the group, and the error bars represent the standard error (SEM), n=3.
[0080] Figure 10 shows a bar chart of the average CT (cycle threshold) values of the oncolytic virus gene Hexon relative to the internal reference gene Gapdh after infection of PC-3 tumor cells with oncolytic virus E9272-batch 3 or E9273-batch 3. The error bars represent standard errors (SEM), n=3.
[0081] Figure 11A shows the melting curve of the internal control gene Gapdh after infection of PC-3 tumor cells with oncolytic virus E9272-batch 3 or E9273-batch 3. Figure 11B shows the melting curve of the exogenous gene Sgs2 in the negative control group (ddH2O, template-free negative control). Figure 11C shows the melting curve of the exogenous gene Sgs2 after infection of PC-3 tumor cells with oncolytic virus E9272-batch 3 or E9273-batch 3.
[0082] Figure 12 shows the weight changes of tumor-bearing mice with subcutaneous PC-3 cell xenograft tumor models after treatment with oncolytic virus in different groups. Data points represent mean weight within the group, and error bars represent standard errors (SEM), n=5.
[0083] Figure 13 shows a bar graph of tumor growth in a PC-3 cell subcutaneous xenograft tumor model in tumor-bearing mice after treatment with oncolytic virus. The bar height represents the average tumor volume within the group, and the error bar represents the standard error (SEM). n = 5.
[0084] Figure 14 shows a bar chart of relative tumor growth rate in PC-3 cell subcutaneous xenograft tumor-bearing mice after oncolytic virus treatment. The relative tumor growth rate was calculated based on the tumor volume of the animals at the time of grouping. The bar height represents the percentage change in average tumor volume within the group, and the error bar represents the standard error (SEM). n = 5.
[0085] Figure 15 shows a bar chart illustrating the weight changes in tumor-bearing mice with subcutaneous PC-3 prostate cancer cell xenograft tumors after oncolytic virus treatment in a pharmacodynamic dosage exploration study. The bar height represents the mean weight within the group, the error bar represents the standard error (SEM), and n≥3.
[0086] Figure 16 shows a bar graph of tumor growth in tumor-bearing mice with subcutaneous xenografted human prostate cancer cells (PC-3) after treatment with oncolytic virus in a pharmacodynamic dosage exploration study. The bar height represents the average tumor volume within the group, and the error bar represents the standard error (SEM), n≥3.
[0087] Figure 17 shows a bar chart of relative tumor growth rates in tumor-bearing mice with subcutaneous xenografted human prostate cancer cells (PC-3) after oncolytic virus treatment in a pharmacodynamic dosage exploration study. The bar height represents the percentage change in mean tumor volume within the group, and the error bar represents the standard error (SEM), n≥3.
[0088] Figure 18A shows the standard curve of absolute qPCR quantification of viral genome copy number in tumor tissues during a pharmacodynamic dosage exploration study. Figure 18B shows the replication status of oncolytic virus E9273 in tumor tissue samples at 21, 30, and 36 days after administration. Data in the figures represent the mean viral genome copy number within the group, and the error bars represent standard errors (SEM), with n≥3.
[0089] Figure 19A shows the dissolution curve of the exogenous gene Sgs2 in tumor tissue of the Vehicle group in the pharmacodynamic dosage exploration study. Vehicle is the solvent control group. Figure 19B shows the dissolution curve of the exogenous gene Sgs2 in tumor tissue of the virus E9273 administration group in the pharmacodynamic dosage exploration study. Figure 19C shows the mRNA expression level of the exogenous gene Sgs2 in tumor tissue samples of the virus E9273 administration group at 21, 30, and 36 days after administration. The data in the figures represent the average relative expression levels of the exogenous gene in the group and the error bars represent the standard error (SEM), n≥3.
[0090] Figure 20 shows a bar chart of weight changes in tumor-bearing mice with subcutaneous xenografted SW780 cells after oncolytic virus treatment. The bar height represents the mean weight within the group, and the error bar represents the standard error (SEM). n = 5.
[0091] Figure 21 shows a bar graph of tumor growth in tumor-bearing mice with subcutaneous xenograft tumors of SW780 cells after treatment with oncolytic virus. The bar height represents the average tumor volume within the group, and the error bar represents the standard error (SEM). n = 5.
[0092] Figure 22 shows a bar chart of relative tumor growth rate in tumor-bearing mice with subcutaneous xenograft tumors of SW780 cells after treatment with oncolytic virus. The relative tumor growth rate was calculated based on the tumor volume of the animals at the time of grouping. The bar height represents the percentage change in average tumor volume within the group, and the error bar represents the standard error (SEM). n=5.
[0093] Figures 23A and 23B show bar charts illustrating the weight changes of tumor-bearing mice in the main and satellite experiments of the MBT2 subcutaneous xenograft model of mouse bladder cancer cells after treatment with oncolytic virus, respectively, in the homologous drug efficacy study. The bar height represents the mean weight within the group, and the error bar represents the standard error (SEM). The main experiment n=6 or the satellite experiment n=5.
[0094] Figure 24 shows a bar chart of tumor growth in the main experimental group of mice with MBT2 subcutaneous xenograft tumors of bladder cancer cells after treatment with oncolytic virus in the homologous drug efficacy study. The bar height represents the average tumor volume within the group, the error bar represents the standard error (SEM), and n≥5.
[0095] Figure 25 shows a bar chart of the relative tumor growth rate in the main experimental group of the mouse bladder cancer cell line MBT2 subcutaneous xenograft model after oncolytic virus treatment in the homologous drug efficacy study. The bar height represents the percentage change in average tumor volume within the group, the error bar represents the standard error (SEM), and n≥5.
[0096] Figures 26A and 26B show the survival curves of different groups of tumor-bearing mice in the main experiment of the MBT2 subcutaneous xenograft model of mouse bladder cancer cells in the homologous drug efficacy study after treatment with oncolytic virus. The curves represent the survival probability (%) of tumor-bearing mice within each group.
[0097] Figure 27A shows the gate strategy for flow cytometry analysis of MBT2 subcutaneous xenograft tumor models of mouse bladder cancer cells in the homologous drug efficacy study. Figures 27B-D show the analysis of immune cell subsets and the proportion of positive immune cells for functional molecular markers in tumor tissues of tumor-bearing mice after treatment with different oncolytic viruses. Figure 27B shows NK cells, T cells, and CD4+. + T, CD8 + The percentages of T cells, M1 macrophages, and DC cells; Figure 27C shows Granzyme B. + NK cells, Granzyme B + T cells, Granzyme B + CD4 + T cells, Granzyme B + CD8 + T cell percentage; Figure 27D shows the percentage of Myeloid cells, Macrophage cells, and M2 Macrophage cells (%). Detailed Implementation
[0098] To enable those skilled in the art to understand the features and effects of the present invention, the terms and expressions used in the specification and claims are explained and defined in general below. Unless otherwise specified, all technical and scientific terms used herein have the ordinary meaning understood by those skilled in the art regarding the present invention, and in case of conflict, the definitions in this specification shall prevail.
[0099] The theories or mechanisms described and disclosed herein, whether right or wrong, should not in any way limit the scope of the invention, that is, the contents of the invention can be implemented without being limited by any particular theory or mechanism.
[0100] In this document, the terms “contains,” “includes,” “containing,” and similar terms encompass the meanings of “basically composed of” and “composed of.” For example, when this document discloses “A contains B and C,” “A is basically composed of B and C” and “A is composed of B and C” should be considered as having been disclosed in this document.
[0101] In this document, all features defined by numerical ranges or percentage ranges, such as numerical values, quantities, contents, and concentrations, are for the sake of brevity and convenience only. Accordingly, descriptions of numerical ranges or percentage ranges should be considered as covering and specifically disclosing all possible sub-ranges and individual numerical values (including integers and fractions) within those ranges.
[0102] Unless otherwise specified, percentages refer to mass percentages and proportions refer to mass ratios in this article.
[0103] In this article, the sum of the percentages of all components in the composition is 100%.
[0104] In this document, when describing embodiments or examples, it should be understood that it is not intended to limit the invention to those embodiments or examples. Rather, all alternatives, modifications, and equivalents of the methods and materials described herein are covered within the scope defined by the claims.
[0105] The inventors have for the first time revealed that oncolytic adenoviruses expressing SGS2 protein or its functional variants have a significant killing effect on prostate tumor cells and bladder tumors, and the killing effect on normal cells is significantly lower than that on tumor cells, demonstrating good safety in tumor research.
[0106] "SGS2 protein" refers to a polypeptide with SGS2 activity, including but not limited to variations of the polypeptide. "Variations" include (but are not limited to): deletions, insertions, and / or substitutions of several amino acids (typically 1-50, preferably 1-30, 1-20, 1-10, 1-8, or 1-5), and the addition or deletion of one or more amino acids (typically up to 20, preferably up to 10, more preferably up to 5) at the C-terminus and / or N-terminus. For example, in the art, substitution with amino acids of similar or comparable properties generally does not alter the function of the protein. In the art, amino acids of similar properties often refer to amino acid families with similar side chains, which are well-defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), amino acids with acidic side chains (e.g., aspartic acid, glutamic acid), amino acids with uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), amino acids with nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, lactic acid, phenylalanine, methionine, tryptophan), amino acids with β-branched side chains (e.g., threonine, valine, isoleucine), and amino acids with aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine). For example, adding one or more amino acids to the amino terminus and / or carboxyl terminus generally does not alter the function of the polypeptide or protein. Conserved amino acid substitutions for many common, known non-genetically encoded amino acids are known in the art. Conserved substitutions for other non-coding amino acids can be determined based on a comparison of their physical properties with those of the genetically encoded amino acids. The amino acid sequence of the SGS2 protein described herein is shown in any of SEQ ID NO: 1-11.
[0107] The SGS2 protein described in this article is derived from plants, including: alfalfa, cotton, Arabidopsis thaliana, Nicotiana bungeana, tobacco, Nicotiana heartleaf, tomato, corn, rice, barley, and sphagnum moss; preferably, the plants are Arabidopsis thaliana, tobacco, and rice; more preferably, the plants are Arabidopsis thaliana.
[0108] In this paper, the “functional variant” of the SGS2 protein contains the amino acid sequence of RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region.
[0109] In one or more embodiments, the plant is alfalfa, and the amino acid sequence of the SGS2 protein (sequence registration number: XP_039687766) is as shown in SEQ ID NO: 1 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 1; the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof is as shown in SEQ ID NO: 12 (sequence registration number: XM_039831832).
[0110] In one or more embodiments, the plant is cotton, the amino acid sequence of the SGS2 protein (sequence registration number: ADG57590) is as shown in SEQ ID NO: 2 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 2; and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (sequence registration number: GQ254649) is as shown in SEQ ID NO: 13.
[0111] In one or more embodiments, the plant is Arabidopsis thaliana, and the amino acid sequence of the SGS2 protein (sequence registration number: NP_190519) is as shown in SEQ ID NO: 3 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 3; the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (sequence registration number: NM_114810) is as shown in SEQ ID NO: 14 and SEQ ID NO: 23.
[0112] In one or more embodiments, the plant is Nicotiana sapiens, the amino acid sequence of the SGS2 protein (sequence registration number: AAU21242) is as shown in SEQ ID NO: 4 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 4; and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (sequence registration number: AY722008) is as shown in SEQ ID NO: 15.
[0113] In one or more embodiments, the plant is tobacco, the amino acid sequence of the SGS2 protein (Sequence Registration No.: BAF96019) is as shown in SEQ ID NO: 5 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 5; and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: AB361628) is as shown in SEQ ID NO: 16.
[0114] In one or more embodiments, the plant is Nicotiana cardinalis, the amino acid sequence of the SGS2 protein (Sequence Registration No.: ACO72600) is as shown in SEQ ID NO: 6 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 6; the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: FJ490363) is as shown in SEQ ID NO: 17.
[0115] In one or more embodiments, the plant is tomato, the amino acid sequence of the SGS2 protein (sequence registration number: NP_001266205 XP_004236660) is as shown in SEQ ID NO: 7 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 7; and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (sequence registration number: XM_039831832) is as shown in SEQ ID NO: 18.
[0116] In one or more embodiments, the plant is maize, the amino acid sequence of the SGS2 protein (sequence registration number: NP_001142097) is as shown in SEQ ID NO: 8 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 8; and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (sequence registration number: NM_001148625) is as shown in SEQ ID NO: 19.
[0117] In one or more embodiments, the plant is rice, and the amino acid sequence of the SGS2 protein (Sequence Registration No.: NP_001406350 XP_015622237) is as shown in SEQ ID NO: 9 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 9; the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: NM_001419421 XM_015766751) is as shown in SEQ ID NO: 20.
[0118] In one or more embodiments, the plant is barley, the amino acid sequence of the SGS2 protein (Sequence Registration No.: ACI16098) is as shown in SEQ ID NO: 10 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 10; and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: FJ188379) is as shown in SEQ ID NO: 21.
[0119] In one or more embodiments, the plant is *Moss sphaerocephala*, and the amino acid sequence of the SGS2 protein (Sequence Registration No.: ABF82438) is as shown in SEQ ID NO: 11 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 11; the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: FJ188379) is as shown in SEQ ID NO: 22.
[0120] The variant forms of polypeptides include: homologous sequences, conserved variants, allelic variants, natural mutants, and induced mutants.
[0121] This invention also relates to a polynucleotide sequence encoding the SGS2 protein of this invention. The polynucleotide may be in DNA or RNA form. The DNA form includes cDNA, genomic DNA, or synthetically produced DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand. The nucleotide sequences encoding the SGS2 protein herein are shown in any of SEQ ID NO: 12-22. In one or more embodiments, the polynucleotide sequence encoding a functional variant of the SGS2 protein is shown in SEQ ID NO: 23.
[0122] As those skilled in the art will understand, DNA is typically a double-stranded structure with complementary sense and antisense strands. The sense strand, also known as the sense line, is the strand in the DNA double helix that carries genetic information. It cannot be transcribed and contains the same nucleotide sequence as the mRNA encoding the functional protein, differing only in that the T in DNA is replaced by U in mRNA. The antisense strand, also known as the template strand, is the DNA strand used by RNA polymerase during transcription. It acts as a template for transcription; RNA polymerase moves along the template strand and transcribes it into mRNA, which is then translated into a polypeptide.
[0123] In a narrow sense, a "polynucleotide sequence encoding..." or "the coding sequence of..." refers to a sequence located on the antisense strand of DNA that directly guides transcription, or a sequence located on mRNA that directly guides translation. Polynucleotides can contain coding sequences (or coding regions) and non-coding sequences (or non-coding regions, such as introns). Coding sequences can be continuous or discontinuous, and discontinuous coding sequence segments can be separated by non-coding sequences. The complete coding region obtained by sequentially connecting the coding sequence segments is the coding sequence of the polypeptide.
[0124] This invention also provides a recombinant vector comprising the SGS2 protein or a functional variant thereof. Preferably, the recombinant vector contains a multiple cloning site or at least one restriction enzyme site downstream of the promoter. When it is necessary to express the target gene of this invention, the target gene is ligated into a suitable multiple cloning site or restriction enzyme site, thereby operatively linking the target gene to the promoter. Alternatively, the recombinant vector comprises (from 5' to 3' direction): a promoter, a target gene, and a terminator. If desired, the recombinant vector may further include elements selected from the group consisting of: a 3' polynucleotide signal; a non-translated nucleic acid sequence; a transport and targeting nucleic acid sequence; an resistance selection marker (dihydrofolate reductase, neomycin resistance, hygromycin resistance, and green fluorescent protein, etc.); an enhancer; or an operator.
[0125] The methods used to prepare recombinant vectors are well known to those skilled in the art. Expression vectors can be bacterial plasmids, bacteriophages, yeast plasmids, plant cell viruses, mammalian cell viruses, or other vectors. In short, any plasmid and vector can be used as long as it can replicate and remain stable within the host. Exemplarily, the vectors of the present invention are viral vectors or non-viral vectors; the viral vectors include adeno-associated viruses, adenoviruses, and retroviruses; the non-viral vectors include plasmids, liposomes, cationic polymers, nanoparticles, multifunctional envelope-type nanocarriers, vesicles, N-acetylgalactosamine (GalNAc), or engineered bacteria; preferably, the vector is an adenovirus; more preferably, the vector is an oncolytic adenovirus.
[0126] Adenovirus is a non-integrating, non-enveloped, double-stranded DNA virus. Oncolytic virus is a naturally occurring or genetically engineered virus that replicates and lyses tumor cells exclusively. As a potent antitumor agent, oncolytic virus works by replicating exclusively within tumor cells and ultimately lysing them, thus producing an oncolytic effect. As used in this article, the term "oncolytic adenovirus" refers to a class of tumor-killing adenoviruses with replication capabilities.
[0127] Those skilled in the art can use well-known methods to construct expression vectors containing the genes described in this invention. These methods include in vitro recombinant DNA technology, DNA synthesis technology, in vivo recombination technology, etc. When constructing recombinant expression vectors using the genes of this invention, any type of enhancing, constitutive, tissue-specific, or inducible promoter can be added before its transcription initiation nucleotide.
[0128] Vectors containing the genes of this invention can be used to transform suitable host cells to enable the host to express proteins. Host cells can be prokaryotic cells, such as *Escherichia coli*, *Streptomyces*, and *Agrobacterium*; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as plant cells. Plants described herein include alfalfa, cotton, *Arabidopsis thaliana*, *Nicotiana bungeana*, tobacco, *Nicotiana cardinalis*, tomato, corn, rice, barley, and *Sphagnum moss*; preferably, the plants are *Arabidopsis thaliana*, tobacco, and rice; more preferably, the plants are *Arabidopsis thaliana*. Those skilled in the art will understand how to select suitable vectors and host cells. Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote (such as *Escherichia coli*), it can be treated with CaCl2 or electroporation. When the host is a eukaryote, the following DNA transfection methods can be used: calcium phosphate co-precipitation, conventional mechanical methods (such as microinjection, electroporation, liposome packaging, etc.). Transformed plants can also be achieved using methods such as Agrobacterium-mediated transformation or gene gun transformation, including leaf disc transformation, immature embryo transformation, and flower bud soaking. Transformed plant cells, tissues, or organs can be regenerated into transgenic plants using conventional methods. When the polynucleotide is expressed in higher eukaryotic cells, the insertion of an enhancer sequence into the vector will enhance transcription. Enhancers are cis-acting factors of DNA, typically ranging from 10 to 300 base pairs, that act on the promoter to enhance gene transcription.
[0129] Those skilled in the art are well aware of how to select appropriate vectors, promoters, enhancers, and host cells.
[0130] Transforming a host with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. Transformed plants can be achieved using methods such as Agrobacterium-mediated transformation or gene gun transformation, including spraying, leaf disc transformation, and rice embryo transformation. Transformed plant tissues or organs can be regenerated into plants using conventional methods, thereby obtaining plants with altered traits.
[0131] Therefore, this invention provides the use of gene silencing repressor 2 (SGS2) protein or a functional variant thereof from plants described in any embodiment herein in the preparation of antitumor drugs. The plant sources of SGS2 include, but are not limited to: alfalfa, cotton, Arabidopsis thaliana, Nicotiana bungeana, tobacco, Nicotiana cardinalis, tomato, maize, rice, barley, and sphagnum moss; preferably, the plants are Arabidopsis thaliana, tobacco, and rice; more preferably, the plants are Arabidopsis thaliana. In one or more embodiments, the functional variant of the SGS2 protein contains the amino acid sequence of an RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region. In one or more embodiments, the amino acid sequence of the SGS2 protein is any of the sequences shown in SEQ ID NO: 1-11, or a functional variant having at least 80% sequence identity with any of the sequences shown in SEQ ID NO: 1-11.
[0132] In one or more embodiments, the plant is *Alfalfa truncatum*, and the amino acid sequence of the SGS2 protein (Sequence Registration No.: XP_039687766) is as shown in SEQ ID NO: 1 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 1. In one or more embodiments, the plant is cotton, and the amino acid sequence of the SGS2 protein (Sequence Registration No.: ADG57590) is as shown in SEQ ID NO: 2 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 2. In one or more embodiments, the plant is *Arabidopsis thaliana*, and the amino acid sequence of the SGS2 protein (Sequence Registration No.: NP_190519) is as shown in SEQ ID NO: 3 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 3. In one or more embodiments, the plant is *Nicotiana bungeana*, and the amino acid sequence of the SGS2 protein (Sequence Registration No.: AAU21242) is as shown in SEQ ID NO: 4 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 4. In one or more embodiments, the plant is tobacco, and the amino acid sequence of the SGS2 protein (Sequence Registration No.: BAF96019) is as shown in SEQ ID NO: 5 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 5. In one or more embodiments, the plant is Nicotiana cardinalis, and the amino acid sequence of the SGS2 protein (Sequence Registration No.: ACO72600) is as shown in SEQ ID NO: 6 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 6. In one or more embodiments, the plant is tomato, and the amino acid sequence of the SGS2 protein (Sequence Registration No.: NP_001266205 XP_004236660) is as shown in SEQ ID NO: 7 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 7. In one or more embodiments, the plant is maize, and the SGS2 protein has the amino acid sequence (Sequence Registration No.: NP_001142097) shown in SEQ ID NO: 8 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 8. In one or more embodiments, the plant is rice, and the SGS2 protein has the amino acid sequence (Sequence Registration No.: NP_001406350XP_015622237) shown in SEQ ID NO: 9 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 9.In one or more embodiments, the plant is barley, and the amino acid sequence of the SGS2 protein (Sequence Registration No.: ACI16098) is shown in SEQ ID NO: 10 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 10. In one or more embodiments, the plant is *Moss sphaerocephala*, and the amino acid sequence of the SGS2 protein (Sequence Registration No.: ABF82438) is shown in SEQ ID NO: 11 or a functional variant having at least 80% sequence identity with the sequence shown in SEQ ID NO: 11.
[0133] In one or more embodiments, the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof is shown in any of SEQ ID NO: 12-23. In one or more embodiments, the plant is *Alfalfa truncatum*, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof is shown in SEQ ID NO: 12 (Sequence Registration No.: XM_039831832). In one or more embodiments, the plant is cotton, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: GQ254649) is shown in SEQ ID NO: 13. In one or more embodiments, the plant is *Arabidopsis thaliana*, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: NM_114810) is shown in SEQ ID NO: 14 and SEQ ID NO: 23. In one or more embodiments, the plant is *Nicotiana bungeana*, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: AY722008) is shown in SEQ ID NO: 15. In one or more embodiments, the plant is tobacco, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: AB361628) is shown in SEQ ID NO: 16. In one or more embodiments, the plant is Nicotiana cardinalis, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: FJ490363) is shown in SEQ ID NO: 17. In one or more embodiments, the plant is tomato, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: XM_039831832) is shown in SEQ ID NO: 18. In one or more embodiments, the plant is maize, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: NM_001148625) is shown in SEQ ID NO: 19. In one or more embodiments, the plant is rice, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: NM_001419421XM_015766751) is shown in SEQ ID NO: 20. In one or more embodiments, the plant is barley, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: FJ188379) is shown in SEQ ID NO: 21. In one or more embodiments, the plant is *Bryophytum comosum*, and the polynucleotide sequence encoding the SGS2 protein or a functional variant thereof (Sequence Registration No.: FJ188379) is shown in SEQ ID NO: 22.
[0134] In this document, the tumor is described as prostate cancer or bladder cancer. In one or more embodiments, the tumor is derived from an animal.
[0135] The present invention also provides the use of a reagent in the preparation of an antitumor drug, said reagent comprising a nucleic acid molecule encoding an SGS2 protein or a functional variant thereof, a nucleic acid construct as described in any embodiment herein, a virus as described in any embodiment herein, and / or a cell as described in any embodiment herein. Optionally, the reagent or the drug comprises a delivery system.
[0136] In this article, a delivery system refers to a component capable of delivering a drug or its active ingredient to the body or a target site (e.g., tissues or cells). Selecting different delivery systems based on the active ingredient is a standard technique in this field. For example, commonly used protein delivery systems include: lipid nanodelivery systems (liposomes, exosomes, cell membrane-encapsulated nanoparticles), polymer carriers (polymer micelles, polymer vesicles, layer-by-layer self-assembly carriers, dendritic macromolecules, nanogels, scaffolds and hydrogels, metal-organic frameworks), inorganic nanoparticles (mesoporous silica nanoparticles, gold nanocarriers, carbon nanotubes, graphene oxide nanosheets, magnetic nanoparticles), peptide / protein-based nanocarriers (cell-penetrating peptides, protein carriers, virus-like nanocarriers), and DNA nanocarriers. Commonly used nucleic acid delivery systems include: viral carriers (adenoviruses, adeno-associated viruses, lentiviruses, retroviruses) and non-viral carriers (liposomes, polymers, inorganic nanomaterials, exosomes). Commonly used cell delivery systems include: natural biomaterial carriers (extracellular matrix (ECM), hydrogels), synthetic biomaterial carriers (polylactic-co-glycolic acid copolymer (PLGA)), polycaprolactone (PCL)), bioengineered carriers (microcapsules, extracellular vesicle engineered carriers), bioactive glass, and magnetic nanoparticle carriers. Commonly used virus delivery systems include: liposome carriers, polymer carriers (polyethyleneimine (PEI), polylactic-co-glycolic acid copolymer (PLGA)), inorganic nanomaterial carriers (gold nanoparticles, mesoporous silica nanoparticles (MSN)), and biological carriers (phage carriers, exosome carriers).
[0137] In one or more embodiments, the delivery system is loaded with a nucleic acid component encoding the SGS2 protein, or a nucleic acid construct expressing the nucleic acid component. Exemplarily, the delivery system described herein is a viral vector or a non-viral vector; preferably, the viral vector includes adeno-associated virus, adenovirus, or retrovirus; preferably, the non-viral vector includes plasmids, liposomes, cationic polymers, nanoparticles, multifunctional envelope nanocarriers, vesicles, N-acetylgalactosamine (GalNAc), or engineered bacteria; more preferably, the delivery system is an adenovirus; even more preferably, the delivery system is an oncolytic adenovirus.
[0138] The nucleic acid constructs described herein can be vectors containing a multinucleotide sequence encoding the SGS2 protein described herein or a functional variant thereof, such as expression vectors and recombinant vectors. These vectors can be used to transform appropriate host cells to enable them to express the protein. Vectors typically contain sequences for plasmid maintenance and for cloning and expressing exogenous nucleotide sequences. These sequences (collectively referred to as “flanking sequences” in some embodiments) typically include one or more of the following nucleotide sequences: a promoter, one or more enhancer sequences, an origin of replication, a transcription termination sequence, a complete intron sequence containing donor and acceptor splicing sites, a leader sequence encoding a polypeptide secretion, a ribosome binding site, a polyadenylated sequence, a multi-linker region for inserting a nucleic acid encoding an anti-mesothelin antibody to be expressed, and optional marker elements.
[0139] The present invention also provides a method for preparing an oncolytic adenovirus comprising a nucleic acid molecule encoding the SGS2 protein or a functional variant thereof, the method comprising the steps of: (1) constructing a plasmid comprising the SGS2 gene, and (2) preparing a virus comprising the plasmid in (1).
[0140] This invention provides the use of an oncolytic adenovirus comprising a nucleic acid molecule encoding the SGS2 protein or a functional variant thereof in the preparation of an antitumor drug. In one or more embodiments, the oncolytic adenovirus comprises a polynucleotide sequence encoding the SGS2 protein or a nucleic acid construct thereof.
[0141] This document also provides the use of the oncolytic adenovirus in the preparation of kits for killing tumor cells or treating diseases, the kits containing the oncolytic adenovirus described herein. Exemplarily, the kits may also contain various reagents suitable for handling (e.g., culturing, transplanting, purifying, genetically engineering, maturing, etc.) the oncolytic adenovirus, and optionally, instructions for use by those skilled in the art. The diseases include cancer, and in some embodiments herein, the disease is prostate cancer or bladder cancer.
[0142] The present invention also provides a method for treating or preventing a disease or condition in a subject in need, comprising administering to the subject an effective amount of an antitumor drug as described in any embodiment herein.
[0143] The terms “subject” or “patient” may refer to a patient or other animal, especially a mammal, such as a human, mouse, rat, dog, monkey, cow, horse, etc., who receives the pharmaceutical composition of the present invention to treat, prevent, improve and / or alleviate the snake venom of the present invention.
[0144] The term "effective dose" refers to a dose that can achieve therapeutic, preventative, alleviating, and / or remission of a disease or symptom in a subject. The therapeutically effective dose can be determined based on factors such as the patient's age, sex, the nature and severity of the disease, and other physical conditions. In this document, "subject" or "patient" generally refers to a mammal, particularly a human. The dosage form, dosage, and route of administration of the antitumor drug can be adjusted according to the patient's age, sex, disease state, and the required amount of hepatocytes or extracts. Examples of dosage forms include gels, aerosols, tablets, capsules, powders, granules, syrups, solutions, suspensions, injections, powders, pills, controlled-release formulations, infusions, and suspensions. Routes of administration of the antitumor drug described herein may include, but are not limited to, subcutaneous injection, percutaneous injection, implantation, local administration, intramuscular injection, sustained-release administration, and oral administration.
[0145] Other aspects of the invention will be apparent to those skilled in the art from the disclosure herein. The invention is further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods not specifically described in the following embodiments are generally performed under conventional conditions as described in Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or as recommended by the manufacturer.
[0146] Example
[0147] Table 1. Viruses, cell lines, laboratory animals and their sources
[0148] Table 2. Reagents, consumables, instruments, their sources and item numbers
[0149] Experimental methods:
[0150] I. A method for protein sequence analysis using SGS2, comprising the following steps:
[0151] 1. Obtaining the SGS2 protein sequence
[0152] Log in to the National Center for Biotechnology Information (http: / / www.ncbi.nlm.nih.gov / ) website, select the tblastn method to search for published protein sequences of Arabidopsis thaliana (thale cress) SGS2 in non-redundant (NR) and partially non-redundant (NT) databases, and obtain protein sequences of SGS2 from other plant sources.
[0153] 2. SGS2 Protein Functional Domain Analysis
[0154] Amino acid sequence analysis and domain prediction of the SGS2 protein were performed using the HMMER software based on a Hidden Markov Model in the SMART online tool (https: / / smart.embl.de / ). During the analysis, the parameters "abnormal homologs and homologs with known structures" and "PFAM domains" were selected, while other parameters remained at their default settings. To further validate the search results, all conserved domains were verified using the online tools of the National Center for Biotechnology Information (NCBI-CDD; https: / / www.ncbi.nlm.nih.gov / Structure / cdd / wrpsb.cgi) and the Pfam database (http: / / pfam.xfam.org).
[0155] II. A method for constructing plasmid clones, comprising the following steps:
[0156] The target gene was obtained by PCR or enzyme digestion, and then constructed into the target vector through ligation or homologous recombination / assembly, followed by transformation into E. coli DH5α competent cells. Transformants were screened by colony PCR, and positive clones were sent for sequencing. Plasmid extraction was performed on the validated clones.
[0157] 1. Obtaining the target gene fragment
[0158] Method 1: Amplification of the target gene via PCR
[0159] (1) Search for the target gene and upstream and downstream sequences in GenBank, and design primers using Vector NTI software.
[0160] (2) PCR amplification of the target gene: using high fidelity PCR. HS DNA Polymerase amplifies the target gene; the reaction system and conditions are as per the product instructions.
[0161] (3) The PCR products were subjected to agarose gel electrophoresis to detect the amplification effect. The target gene band was cut from the gel after agarose gel electrophoresis and recovered using TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0. The reaction system and conditions are as per the product instructions.
[0162] Method 2: Obtaining the target gene through enzyme digestion
[0163] (1) The plasmid containing the target gene was digested with restriction endonucleases. The digestion reaction system was as follows: 2 μg plasmid, 5 μL 10× reaction buffer, 1 μL each of restriction endonucleases EcoRI and SalI, and water was added to make up to 50 μL. The mixture was then incubated in a water bath at 37°C for more than 2 hours.
[0164] (2) The enzyme digestion products were subjected to agarose gel electrophoresis to detect the enzyme digestion effect. The target gene band was cut from the gel after agarose gel electrophoresis and recovered using TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0. The reaction system and conditions are as per the product instructions.
[0165] 2. Preparation of linearized expression vectors
[0166] The expression vector was digested with restriction endonucleases. The digestion reaction system was as follows: 2 μg plasmid, 5 μL 10× reaction buffer, 1 μL each of restriction endonucleases EcoRI and SalI, and water to a final volume of 50 μL. The mixture was incubated in a 37°C water bath for at least 2 hours. The digestion products were analyzed by agarose gel electrophoresis to assess the digestion efficiency. The target vector band was excised from the agarose gel and recovered using the TaKaRa MiniBEST Agarose Gel DNA Extraction Kit Ver. 4.0. The reaction system and conditions were as per the product instructions.
[0167] 3. The target gene is constructed into a linearized expression vector.
[0168] Method 1: Using a seamless cloning kit (suitable for single target gene insertion fragments)
[0169] Add the target gene fragment and linearized vector to a centrifuge tube at a molar ratio of 2:1 for recombination reaction, following the instructions for the Seamless Cloning Kit. After mixing, incubate at 37°C for 30 min, then transfer to ice and incubate for 5 min. Transform directly or store at -20°C until transformation is required, then thaw and transform.
[0170] Method 2: Using a seamless assembly kit (suitable for multiple target gene insertion fragments)
[0171] Add the target gene fragment and linearized vector to a centrifuge tube at a molar ratio of 1:1 for recombination reaction, following the instructions for the Seamless Cloning Kit. After mixing, incubate at 37°C for 30 min, then transfer to ice and incubate for 5 min. Transform directly or store at -20°C until transformation is required, then thaw and transform.
[0172] Method 3: Using T4 DNA ligase
[0173] The target gene fragment and linearized vector were added to a centrifuge tube at a molar ratio of 3:1 for recombination. Generally, 100 ng of the linearized expression vector was added, and the target gene fragment was added at a ratio of 300 × the number of target gene base pairs / the number of linearized expression vector base pairs (in ng). The reaction system and conditions were as per the T4 DNA Ligase product instructions. After mixing, the mixture was incubated overnight at 16°C. 10 μL of the reaction solution was then transformed into competent cells.
[0174] 4. Preparation and transformation of competent cells
[0175] Plasmid vector transformation was performed using E. coli DH5α Competent Cells. Thaw the E. coli DH5α Competent Cells on ice before use. Mix gently and transfer 100 μL to a 14 mL round-bottom tube. Add the DNA sample (≤10 ng recommended), incubate on ice for 30 min, at 42°C for 45 s, and on ice for 1-2 min. Add preheated (37°C) SOC medium to a final volume of 1 mL. Incubate at 37°C with shaking for 1 h (160-225 rpm). Spread an appropriate amount onto LB agar plates (containing 30 μg / mL Kanamycin). Incubate overnight at 37°C. The reaction system and conditions are as per the E. coli DH5α Competent Cells product instructions.
[0176] 5. Colony PCR identification of positive transformants
[0177] Transformants grown on the plate were picked and resuspended in 10 μL of LB medium. 1 μL was used as a template for colony PCR identification. The reaction system and PCR cycling conditions were as described in Premix Taq. TM (TaKaRa Taq TM Version 2.0 plus dye) Product manual.
[0178] 6. Positive clones are sent for sequencing.
[0179] Positive clones obtained from colony identification were sent to Suzhou Genewiz Biotechnology Co., Ltd. for sequencing verification. The sequencing primers were mCMV-F: GGTATAAGAGGCGCGACCAG (SEQ ID NO: 24); SV40-pArev-R: GAAATTTGTGATGCTATTGC (SEQ ID NO: 25). Sequencing results were compared and analyzed using Snapgene software.
[0180] 7. Plasmid mini-extraction
[0181] For positive clones that pass sequencing, perform plasmid mini-prep. Refer to the AxyPrep Plasmid DNA Mini-Prep Kit product instructions for detailed steps.
[0182] III. Methods for plasmid transfection, virus amplification, virus harvesting, and virus purification, including the following steps:
[0183] 1. Plasmid transfection
[0184] (1) One day before transfection, select healthy HEK-293 cells, digest them, collect the cells, count them, and then process them at a rate of 1×10⁻⁶ cells / year. 6 Seeds were seeded per well in a 6-well plate, shaken well, and incubated at 37°C in a 5% CO2 incubator.
[0185] (2) One hour before transfection, remove the cell culture dish, discard the original cell culture medium, add Opti-MEM medium, and put the cells back into the incubator.
[0186] (3) Mix the plasmids to be transfected in equal proportions in Opti-MEM medium, mix gently, and let stand to obtain plasmid dilution.
[0187] (4) Dissolve the transfection reagent in Opti-MEM medium, mix gently, and let stand to obtain the dilute transfection reagent solution.
[0188] (5) Add the transfection reagent dilution solution dropwise to the plasmid dilution solution, mixing gently as you add. Let it stand at room temperature for 15-25 minutes to allow the DNA and transfection reagent to fully combine and form a stable transfection complex.
[0189] (6) Remove the cell culture dish, add the prepared DNA-transfection reagent complex into the cell culture dish, avoid blowing the cells, and gently place it back into the incubator.
[0190] (7) After 5-8 hours, remove the culture medium, wash with DPBS solution, and then add fresh complete culture medium for culture.
[0191] 2. Virus amplification, collection, and purification
[0192] (1) Change the culture medium of the cells after they have been transformed every 3-5 days, observe the virus release, and amplify the virus after the release.
[0193] (2) Use a 1 mL pipette to aspirate the cell supernatant and blow the cells back and forth in the dish to completely detach the cells. Collect all the cells and supernatant into a 50 mL centrifuge tube.
[0194] (3) After repeated freeze-thaw cycles in liquid nitrogen, centrifuge at 4000 rpm for 10 min, collect the supernatant, filter the virus through a 0.22 μm filter, aliquot and store at -80℃.
[0195] IV. A method for detecting adenovirus titers, comprising the following steps:
[0196] Adenoviruses can infect and replicate in HEK-293 cells. Type 5 adenovirus expresses a special coat protein called HEXON. HEK-293 cells infected with adenovirus are fixed with methanol and then incubated with a primary antibody against HEXON. The primary antibody binds to the HEXON protein on the adenovirus. Then, a horseradish peroxidase-labeled secondary antibody is added for incubation. After the secondary antibody binds to the primary antibody, the horseradish peroxidase substrate DAB is added for staining. Finally, excess staining solution is washed off. At this point, the virus-infected positive cells will be stained brown. The viral titer is calculated by counting the positive cells using a formula.
[0197] 1. Select healthy HEK-293 cells, resuspend them in complete culture medium, and prepare cells into 2.5 × 10⁻⁶ m² cells. 5 A cell suspension of 1 cell / mL was seeded into each well of a 24-well plate and cultured at 37°C and 5% CO2 for 1 h.
[0198] 2. Dilute the virus sample 10-fold serially with DMEM medium, then sequentially add 10... -5 Up to 10 -8 Add the diluted virus solution to a 24-well plate (the virus dilution can be adjusted according to the actual experimental conditions), 100 μL to each well, and each dilution occupies one well.
[0199] 3. Gently remove the culture medium and slowly add 0.5 mL of pre-cooled methanol along the side wall of the 24-well plate. Fix at -20°C for 20 min (do not let the pipette tip touch the cells).
[0200] 4. Gently rinse the cells three times with DPBS for 5 minutes each time (do not flush the cells), then block them with DPBS solution containing 1% BSA at 37°C for 1 hour.
[0201] 5. Discard the blocking solution, add 200 μL of Anti-HEXON working solution to each well, and incubate at 37°C for 1 h.
[0202] 6. Discard the Anti-HEXON working solution, gently rinse the cells 3 times with DPBS for 5 min each time, then add 200 μL of HRP secondary antibody working solution to each well and incubate at 37°C for 1 h.
[0203] 7. Discard the HRP secondary antibody working solution, gently wash the cells 3 times with DPBS for 5 min each time, then add 200 μL of freshly prepared 1×DAB working solution to each well and incubate at room temperature for 5-10 min (incubation time should not exceed 10 min).
[0204] 8. Discard the DAB working solution, wash twice with DPBS, and then add 1 mL of DPBS to each well.
[0205] 9. Virus titer calculation method
[0206] (1) Select a gradient with 5-50 positive cells in the field of view. Randomly select 5 fields of view from each well, observe and count them under an optical microscope, and calculate the average number of positive cells and the viral titer in each well.
[0207] (2) Calculate the number of fields of view per well in a 24-well plate. For most microscopes, the diameter of the field of view observed by a standard 10× eyepiece and 10× objective lens is 1.8 mm. Therefore: the area of each field of view = 3.14 × (D / 2) 2 =3.14 × 0.81 = 2.54 mm 2 For a standard 24-well plate, the culture area is 2.0 cm². 2 Therefore: Number of fields of view per aperture = 2.0 cm 2 / (2.54×10 -2 cm 2 =79.
[0208] (3) Calculate the titer. Calculate the infection units (IFU) / mL per well = (infected cells / field of view) × (number of fields of view per well, 79) × (dilution factor) × (virus volume (mL)).
[0209] V. A method for detecting Sgs2 mRNA expression levels, comprising the following steps:
[0210] 1. Total RNA extraction
[0211] (1) Centrifuge to remove cell supernatant, add 1000 μL TRIzol Reagent to each well, gently blow and aspirate to suspend the cells, let stand at room temperature for 5 min, and then transfer to a new 1.5 mL centrifuge tube.
[0212] (2) Add 200 μL of chloroform to each sample, shake vigorously for 15 seconds, and let stand at room temperature for 15 minutes.
[0213] (3) Centrifuge at 4℃, 12000rpm for 15min.
[0214] (4) Transfer the supernatant from each tube to a new 1.5 mL centrifuge tube. Add an equal volume of isopropanol, mix well, and precipitate at 4 °C for 10 min.
[0215] (5) Centrifuge at 4℃ and 12000rpm for 10min, then remove the supernatant.
[0216] (6) Add at least 1 mL of 75% ethanol pre-cooled at 4°C to wash the precipitate and the centrifuge tube wall.
[0217] (7) Centrifuge at 4℃ and 10,000 rpm for 5 min, then discard the supernatant.
[0218] (8) Centrifuge at 4℃ and 10,000 rpm for 5 min, remove residual liquid, and dry at room temperature.
[0219] (9) Add 30-40 μL of Nase-free water until completely dissolved, and use UV analysis to determine the concentration and absorbance of RNA.
[0220] 2. Total RNA reverse transcription
[0221] (1) Press PrimeScript TM Prepare the gDNA Eraser reaction mixture on ice using the RT reagent kit with gDNA Eraser (Perfect Real Time) and the specified reagents and dosages.
[0222] (2) The gDNA Eraser reaction mixture was placed on ice immediately after being placed in a 42°C water bath for 2 minutes.
[0223] (3) Press PrimeScript TM Prepare the RNA reverse transcription mixture on ice using the RT reagent kit with gDNA Eraser (Perfect Real Time) and the specified dosages.
[0224] (4) Place the RNA reverse transcription mixture in a 42°C water bath for 15 min, then in an 85°C water bath for 5 s, and immediately place it on ice to obtain the reverse transcription product (cDNA).
[0225] (5) The reverse transcription product (cDNA) can be used immediately for qPCR detection or stored at -80°C.
[0226] 3. Real-time PCR detection
[0227] (1) The primer sequences for the internal reference gene (Gapdh) are F: GTCTTCACCACCATGGAGAA (SEQ ID NO: 26); R: TAAGCAGTTGGTGGTGCAG (SEQ ID NO: 27).
[0228] (2) The primer sequences for the target gene (Sgs2) are F: CAATCACACCTGACCTCGCT (SEQ ID NO: 28); R: ACGAGCAACAACCCCTTTGA (SEQ ID NO: 29).
[0229] (3) Prepare the Real-time PCR reaction mixture on ice according to the reagents and dosage of ChamQ Universal SYBR qPCR Master Mix (Table 3).
[0230] Table 3. Preparation of Real-time PCR Reaction System
[0231] (4) Prepare the reaction system Mix and add it to the 96 reaction plate. Add the test sample to the corresponding well, 1 μL (1 μg) per well, and 3 replicates per sample. After the test sample is added, add the graded diluted standard, 3 replicates per dilution, and then remove the detection plate.
[0232] (5) Run the following program using Applied Biosystems QuantStudio 7Flex: pre-denaturation 50℃ for 2 min, 95℃ for 10 min, amplification: 95℃ for 15 s, 60℃ for 1 min, 40 cycles.
[0233] (6) Data Analysis. Based on the detection data, using 2 -ΔΔCt Gene expression levels were calculated using a statistical method, and differences between groups were assessed using GraphPad Prism 10.1.2 software. Student's t-test was used to compare the two groups, and a p-value ≤ 0.05 was considered statistically significant.
[0234] VI. A detection method for evaluating the selective killing of different cell types by viruses using the CCK-8 assay, including the following steps:
[0235] 1. Cell lines and culture methods
[0236] Table 4. Information on Cell Lines and Culture Methods
[0237] 2. Cell culture and plating
[0238] (1) The tumor cell line was cultured at 37°C in an incubator with no or 5% CO2. The cells were passaged regularly, and cells in the logarithmic growth phase were used for plating.
[0239] (2) Use trypan blue to stain cells and count live cells.
[0240] (3) Adjust the cell concentration to a suitable level, such as 5 × 10⁻⁶. 4 Cells / mL.
[0241] (4) Add 100 μL of cell suspension to each well of the culture plate and add cell-free culture medium to the blank control well.
[0242] (5) Incubate the culture plate overnight in an incubator at 37°C with no or 5% CO2 and 100% relative humidity.
[0243] 3. Virus preparation and dilution
[0244] Virus preparation and dilution: Remove the virus and thaw it at room temperature. First, according to the cell density, dilute the virus with culture medium to 5000 MOI / 0.1mL and 3000 MOI / 0.1mL. Then perform serial dilutions to prepare 1000 MOI / 0.1mL, 300 MOI / 0.1mL, 100 MOI / 0.1mL, 30 MOI / 0.1mL, 10 MOI / 0.1mL, 3 MOI / 0.1mL and 1 MOI / 0.1mL for later use.
[0245] 4. Viral infection
[0246] The following day, as shown in Table 5, diluted virus solution was added to the wells of the cell plate at 100 μL / well. An equal volume of culture medium was added to the Vehicle and Negative control groups. DPBS was added to the wells surrounding the cell plate. The cell plates were then incubated in an incubator for 72 h.
[0247] Table 5. Cell Plating and Virus Infection Information NC: Negative control, cells only, no virus; Blank: Blank control, culture medium only; Solvent: Solvent-treated group.
[0248] 5. CCK-8 assay for cell viability detection
[0249] (1) Allow the Cell Counting Kit-8 reagent to return to room temperature beforehand.
[0250] (2) 72 hours after viral infection, 20 μL of Cell Counting Kit-8 detection solution was added to each cell well, and the cell plate was gently shaken to mix the solution evenly.
[0251] (3) Place the cell plate back into the incubator and continue culturing for 2 hours.
[0252] (4) Use a Spectra Max M2 microplate reader to read the absorbance at 450 nm.
[0253] 6. Data Analysis
[0254] The inhibition rate (IR) of the analyte was calculated using the following formula: IR(%) = [(Ac-As) / (Ac-Ab)] × 100%. Where As is the absorbance of the experimental group, Ac is the absorbance of the control group, and Ab is the absorbance of the Blank group. The inhibition rates of different concentrations of the analyte were calculated in Excel, and then inhibition curves were plotted and relevant parameters were calculated using GraphPad Prism 10.1.2 software.
[0255] VII. A method for detecting the replication of oncolytic viruses in tumor cells, normal cells, and tumor tissues using probe-based PCR, comprising the following steps:
[0256] 1. Cell lines and culture methods
[0257] Cell lines were cultured at 37°C in incubators with no or 5% CO2 (Table 4). Cells were passaged periodically, and cells in the logarithmic growth phase were seeded for experimental plating. Cells were stained with trypan blue and viable cells were counted, adjusting the cell concentration to 3 × 10⁶ cells / year. 5 Add 1 mL of cell suspension to each well of the culture plate, 3 × 10⁶ cells / mL. 5 Cells were cultured overnight in an incubator at 37°C with no or 5% CO2 and 100% relative humidity.
[0258] 2. Preparation and dilution of the test substance
[0259] The following day, virus preparation and dilution were performed: the virus was removed, thawed at room temperature, and diluted to 3 MOI / 0.5 mL using the appropriate serum-free culture medium according to the cell density. Simultaneously, the Vehicle group was diluted according to the same virus dilution ratio and method.
[0260] 3. Cell treatment
[0261] Add diluted virus solution (500 μL / well) to the wells of the cell plate. For the Vehicle group, add an equal volume of dilution. Incubate the cell plates in an incubator for 2 hours, then add 500 μL of fresh complete culture medium and continue culturing. Collect cells and supernatant samples at 24 hours, 48 hours, and 72 hours and store at -80°C.
[0262] 4. Viral genome extraction
[0263] The following steps are performed according to the instructions for the DNeasy Blood & Tissue Kits.
[0264] If the sample is cells or blood, then
[0265] (1) Take out the sample from -80℃, dissolve it at room temperature, take 200μL of the sample for genome extraction, and store the remaining sample at -80℃;
[0266] (2) Add 20 μL of proteinase K to 200 μL of sample, mix thoroughly, until Step (3);
[0267] If the sample is tissue, then
[0268] (1) Take out the tissue sample from -80℃, add 3 steel balls, 180μL BufferATL and 20μL Proteinase K, and grind it in a tissue grinder. Grinding program: 60HZ×5min, 2℃;
[0269] (2) After grinding, bathe in a 56℃ water bath for 1 hour, inverting and mixing once every 15 minutes to ensure that the tissue is fully lysed, until Step (3);
[0270] (3) Add 200 μL of Buffer AL, mix thoroughly, and incubate at 56°C for 10 min;
[0271] (4) Add 200 μL of anhydrous ethanol and mix thoroughly;
[0272] (5) Transfer the supernatant to a DNeasy mini column, 6,000g × 1min, and transfer the DNeasy mini column to a new 2mL collection tube;
[0273] (6) Add 500 μL of Buffer AW1 to the DNeasy mini column, 6,000 g × 1 min, and transfer the DNeasy mini column to a new 2 mL collection tube;
[0274] (7) Add 500 μL of Buffer AW2 to the DNeasy mini column, 20,000 g × 1 min, and transfer the DNeasy mini column to a new 2 mL collection tube;
[0275] (8) Add 500 μL of Buffer AW2 to the DNeasy mini column, 20,000 g × 1 min, and transfer the DNeasy mini column to a new 1.5 mL EP tube;
[0276] (9) Add 100 μL of Buffer AE (preheated at 56℃) to the DNeasy mini column, let stand at room temperature for 2 min, then add 6000g for 1 min;
[0277] (10) DNA concentration was determined using a NanoDrop 2000 spectrophotometer.
[0278] 5. qPCR detection
[0279] (1) The reaction system is prepared as shown in Table 6 below.
[0280] Table 6. qPCR reaction system
[0281] (2) Primer dilution: The primer sequences for the standard quality plasmid are F: AGTTTTAGAAACCCCACGGTGG (SEQ ID NO: 30); R: GTCAAAGTACGTGGAAGCCAT (SEQ ID NO: 31). The probe is FAM-AATCATGCATGGAGATACACCTACATTGCATGA-MGB (SEQ ID NO: 32). Dilute the primers to 5 μM with ddH2O according to the number of primer moles. Aliquot 50 μL into 1.5 mL centrifuge tubes and store at -20℃ until use.
[0282] (3) Dilution of standard: Take out the standard, reconstitute it, determine the concentration with Nanodrop, and dilute it 10 times with ddH2O for later use.
[0283] (4) Prepare the reaction system mix and add it to the 96 reaction plate. Add the test sample to the corresponding well, 1 μL (1 μg) per well, and 3 replicates per sample. After the test sample is added, add the graded diluted standard, 3 replicates per dilution, and then remove the detection plate.
[0284] (5) Run the following program using Applied Biosystems QuantStudio 7Flex: pre-denaturation 50℃×2min, 95℃×10min, amplification: 95℃×15s, 60℃×1min, 40 cycles.
[0285] (6) After the program runs, draw a standard curve based on the standard data and calculate the number of viral genome copies in the sample to be tested.
[0286] 8. A method for detecting the selective expression of exogenous genes of oncolytic viruses in tumor cells, normal cells, and tumor tissues using SYBR Green dye-based quantitative PCR, comprising the following steps:
[0287] 1. Cell lines and culture methods
[0288] Cell lines were cultured at 37°C in incubators with no or 5% CO2 (Table 4). Cells were passaged periodically, and cells in the logarithmic growth phase were seeded for experimental plating. Cells were stained with trypan blue and viable cells were counted, adjusting the cell concentration to 3 × 10⁶ cells / year. 5Add 1 mL of cell suspension to each well of the culture plate, 3 × 10⁶ cells / mL. 5 Cells were cultured overnight in an incubator at 37°C with no or 5% CO2 and 100% relative humidity.
[0289] 2. Preparation and dilution of the test substance
[0290] The following day, virus preparation and dilution were performed: the virus was removed, thawed at room temperature, and diluted to 3 MOI / 0.5 mL using the appropriate serum-free culture medium according to the cell density. Simultaneously, the Vehicle group was diluted according to the same virus dilution ratio and method.
[0291] 3. Cell treatment
[0292] The next day, discard the liquid in the wells, add 3 MOI / 0.5 mL of diluted virus solution to each well of the cell plate, incubate at 37°C in an incubator with no or 5% CO2 for 2 hours, then add 0.5 mL of culture medium and place the cell plate in the incubator to continue culturing for 48 hours.
[0293] 4. Sample collection and nucleic acid extraction
[0294] The following steps were performed in accordance with the instructions for the FastPure Cell / Tissue Total RNA Isolation Kit V2.
[0295] (1) Discard the liquid in the well, wash 3 times with DPBS, add 500μL Buffer RL, mix by pipetting until there are no obvious cell clusters, then proceed to Step (2).
[0296] If the sample is tissue, then
[0297] (1) Take out tumor tissue from -80℃, add 500μL Buffer RL for every 10-20mg, add 3 steel balls, and grind in a tissue grinder. Grinding program: 60HZ×5min, 2℃.
[0298] (2) Transfer the lysed sample to FastPure gDNA-Filter Columns III and centrifuge at 12,000 rpm for 30 seconds. Discard FastPure gDNA-Filter Columns III and collect the filtrate.
[0299] (3) Add 0.5 times the volume of anhydrous ethanol to the filtrate (for liver tissue samples, add 1 times the volume of 50% ethanol) and mix thoroughly.
[0300] (4) Transfer all the mixture from step 2 to FastPure RNA Columns III, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.
[0301] (5) Add 700 μL of Buffer RW1 to FastPure RNA Columns III, centrifuge at 12,000 rpm for 30 seconds, and discard the filtrate.
[0302] (6) Add 700 μL of Buffer RW2 (with anhydrous ethanol added) to FastPure RNA Columns III, centrifuge at 12,000 rpm for 30 s, and discard the filtrate.
[0303] (7) Add 500 μL of Buffer RW2 (with anhydrous ethanol added) to FastPure RNA Columns III, centrifuge at 12,000 rpm for 2 min, and carefully remove the adsorption column from the collection tube to avoid contact with the filtrate and contamination.
[0304] (8) Place FastPure RNA Columns III back into the collection tube and incubate at 12,000 rpm for 1 min to prevent ethanol contamination.
[0305] (9) Carefully transfer the adsorption column to a new RNase-free Collection Tubes 1.5mL centrifuge tube, add 50μL of RNase-free ddH2O dropwise to the center of the adsorption column, let stand at room temperature for 1min, centrifuge at 12,000rpm for 1min to elute RNA, and determine the nucleic acid concentration using IMPLEN-N60 / N50.
[0306] 5. Reverse transcription and qPCR detection
[0307] (1) Place Enzyme Mix, 5×All-in-one qRT SuperMix and No RT Control Mix on ice, briefly separate before use and gently pipette to mix thoroughly. Prepare the reverse transcription system according to Table 7, and carry out the reaction at 50℃ for 15 min and 85℃ for 5 s.
[0308] Table 7. RNA Reverse Transcription Reaction System
[0309] (2) Two reaction systems were prepared using the target gene amplification primers and the internal control primers, as shown in Tables 8 and 9 below:
[0310] Table 8. qPCR reaction system
[0311] Table 9. Primer Sequence List
[0312] (3) Prepare the reaction system mix and add it to the 384 reaction plate. Add the sample to be tested to the corresponding well, 1 μL (1 μg) per well, and 3 replicates per sample. Then remove the plate from the detection plate.
[0313] (4) The following program was run using Applied Biosystems QuantStudio 7Flex: pre-denaturation 50℃×2min, 95℃×30s, amplification: 95℃×5s, 60℃×34s, 40 cycles. Melting curve: 95℃×10s, 60℃×1min, 97℃×1s.
[0314] (5) According to 2 -ΔΔCt The method calculates the relative expression level of genes in the sample to be tested.
[0315] 5. Data Analysis
[0316] Statistical analysis, graphing, and calculation of relevant parameters were performed using GraphPad Prism 10.1.2 software.
[0317] IX. Methods for establishing various mouse tumor models for non-clinical in vivo pharmacodynamic studies of oncolytic adenovirus, including the following steps:
[0318] A. Subcutaneous xenograft of human prostate cancer cells PC-3 into a Balb / c nude mouse tumor model
[0319] 1. Cell lines and culture methods
[0320] Human prostate cancer cells PC-3 (purchased from ATCC, catalog number ATCC-CRL-1435) were cultured in an incubator at 37°C and 5% CO2 (Table 4). Routine medium changes and passages were performed twice a week. When cell confluence reached 80%-90% and the required number was achieved, cells were harvested, counted, and seeded.
[0321] 2. Tumor cell inoculation
[0322] 10 × 10⁻⁶ mmol / L was subcutaneously injected into the right nape of the neck of each mouse. 6 PC-3 cells were seeded at a volume of 0.2 mL (DPBS + Matrigel = 1:1). Experimental animals were ear-tagged before seeding, serving as the sole confirmation marker for subsequent experiments. In vivo efficacy experiments were conducted on day 17 post-cell seeding, when the average tumor volume reached 100 mmHg. 3 At that time, the mice were divided into groups of 5 for administration.
[0323] B. Subcutaneous xenograft of human bladder cancer cells SW780 into a Balb / c nude mouse tumor model
[0324] 1. Cell Culture
[0325] Human bladder cancer cells SW780 (purchased from ATCC, catalog number ATCC-CRL-2169) were cultured in vitro in a monolayer. The culture conditions were Leibovitz's L-15 medium supplemented with 10% fetal bovine serum and 1% penicillin antibiotics, and cultured in a 37°C, 0% CO2 cell culture incubator. Routine medium changes and passages were performed twice a week. When cell confluence reached 80%-90% and the desired number was achieved, cells were harvested, counted, and seeded.
[0326] 2. Tumor cell inoculation
[0327] 1×10⁻⁶ mice were subcutaneously injected into the right nape of the neck. 7 SW780 cells were seeded at a volume of 0.1 mL. Experimental animals were ear-tagged before seeding, serving as the sole confirmation marker for subsequent experiments. In vivo efficacy experiments were conducted on day 17 post-cell seeding, with the average tumor volume reaching 101 mmHg. 3 At that time, the mice were divided into groups of 5 for administration.
[0328] C. Subcutaneous allograft of MBT2 bladder cancer cells into a C3H mouse tumor model
[0329] 1. Cell Culture
[0330] Mouse bladder cancer cells MBT2 (purchased from JCRB, catalog number IF050041) were cultured in vitro in a monolayer. The culture conditions were: EMEM medium supplemented with 10% fetal bovine serum and 1% penicillin antibiotics, and cultured in a 37°C, 5% CO2 cell culture incubator. Routine medium changes and passages were performed twice a week. When cell confluence reached 80%-90% and the desired number was achieved, cells were harvested, counted, and seeded.
[0331] 2. Tumor cell inoculation
[0332] Before inoculation, experimental animals were ear-tagged as the sole confirmation marker for subsequent experiments. 1 × 10⁻⁶ mmol / L was subcutaneously injected into the right hind limb (unilateral tumor bearing) or both hind limbs (bilateral tumor bearing) of each mouse. 6 MBT2 cells were seeded at a volume of 0.1 mL (DPBS). In vivo efficacy experiments were conducted on day 12 post-seeding; the average tumor volume in the unilateral tumor-bearing group reached 66 mm². 3 The average tumor volume on the right side of the bilateral tumor-bearing group reached 68 mm. 3 At that time, the mice were divided into groups of 6 for administration. In the satellite experiment, the average tumor volume reached 60 mm² on day 14 after cell inoculation.3 At that time, the administration of drugs to groups began.
[0333] 10. Pharmacodynamic evaluation and analysis methods for tumor-bearing mice after administration of oncolytic adenovirus, including the following steps:
[0334] 1. Routine observation of laboratory animals
[0335] The use and welfare of laboratory animals are conducted in accordance with the regulations of the Committee on Assessment and Accreditation of Laboratory Animals (AAALAC). Animal health and mortality are monitored daily. Routine examinations include observing the effects of tumor growth and drug treatment on daily behavior, such as activity levels, food and water intake (visual assessment only), weight changes, physical appearance, or other abnormalities. The number of deaths and side effects within each group are recorded based on the number of animals in each group.
[0336] 2. Sample Collection
[0337] Animals were euthanized, and tumor tissue was collected for measurement and weighing. The collected tumor tissue was divided into several portions for detecting viral replication, exogenous gene expression, and flow cytometry fluorescence analysis, respectively.
[0338] 3. Tumor Measurement and Laboratory Indicators
[0339] (1) The experimental indicator is to examine whether tumor growth is inhibited, delayed, or cured. The tumor diameter is measured twice a week using calipers. The formula for calculating tumor volume is: V = 0.5a × b 2 , where a and b represent the long and short diameters of the tumor, respectively.
[0340] (2) The relative tumor-suppressive efficacy of the test substance was evaluated using TGI (%) or relative tumor proliferation rate T / C (%). Tumor growth inhibition rate TGI (%): The calculation formula is TGI% = [1 - (T...] i -T0) / (V i -V0)]×100%, where T i V i The mean tumor volume on day i in the treatment group and the control group are T, respectively. o V0 and V0 represent the average tumor volumes at the start of drug administration in the treatment and control groups, respectively. The relative tumor volume (RTV) is calculated based on the tumor measurements using the formula: RTV = V0 / V0. t / V0, where V0 is the tumor volume of the animal at the time of grouping, V t This represents the tumor volume of the animal after treatment. Relative tumor proliferation rate T / C (%): Calculated using the formula T / C% = T RTv / C RTV ×100%, where T RTV For the treatment group RTV, CRTV For the solvent control group, RTV, T RTV With C RTV Take data from the same day.
[0341] 4. Data Analysis
[0342] Statistical analysis included the mean and standard error (SEM) of tumor volume at each time point for each group, and the tumor growth inhibition rate. Outlier analysis was performed using Boxplot in SPSS software, followed by statistical analysis using GraphPad Prism 10.1.2. Two-way ANOVA was used for comparisons among three or more groups, and Student's t-test was used for comparisons between two groups. The values were: ns, p>0.05; *, p≤0.05; **, p≤0.01; ***, p≤0.001; ****, p≤0.0001. Statistical analysis was performed to assess inter-group differences based on survival data from tumor-bearing mice in in vivo efficacy experiments. Statistical analysis was performed using GraphPad Prism 10.1.2, and Kaplan-Meier log-rank (Mantel-Cox) was used for comparisons between two groups. The values were: ns, p>0.05; *, p≤0.05; **, p≤0.01; ***, p≤0.001; ****, p≤0.0001.
[0343] XI. A detection method for flow cytometry fluorescence analysis of tumor tissue after oncolytic adenovirus administration, comprising the following steps:
[0344] 1. Sample processing
[0345] Freshly collected tumor samples from each mouse were cut into 2-4 mm pieces. 3 Small pieces of tissue were transferred to a MACS C-tube containing an enzyme mixture (2.35 mL RPMI 1640 + 100 μL enzyme D + 20 μL enzyme R + 12.5 μL enzyme A). The C-tube was connected to the sleeve of the MACS dissociator. The m_impTumor_02 program was run once, and the tissue was incubated at 37°C for 40 min, followed by a run of the m_impTumor_03 program. The digested tissue fluid was filtered through a 70 μm cell filter, and the cells were washed twice with DPBS. The cells were centrifuged at 400 g and 4°C for 5 min, and the supernatant was discarded. The cells were resuspended in 1× erythrocyte lysate at a 1:9 ratio (10-fold erythrocyte lysate was aseptically diluted 1:9 with ddH2O), and incubated at room temperature for 1 min. The reaction was stopped by adding an appropriate amount of DPBS to a 50 mL centrifuge tube. The 50 mL centrifuge tube was centrifuged at 400 g and 4°C for 5 min. The supernatant was removed. The cells were resuspended in DPBS and stained with trypan blue for cell counting.
[0346] 2. Antibody staining
[0347] Based on the cell count results, take 1×10 6 Single-cell suspensions were added to 96-well V-type plates for antibody staining. The flow cytometry fluorescence analysis panel design is shown in Table 10 below. The cell culture plates were centrifuged at 400g, 4℃ for 5 min. The supernatant was discarded, and the cells were resuspended in 75 μL of Live / Dead staining solution (0.3 μL Live / Dead + 2 μL Anti-mouse Fc block), and incubated at 4℃ in the dark for 10 min. Extracellular antibodies were added, and the cells were incubated at 4℃ in the dark for 30 min.
[0348] After incubation with extracellular antibodies, cells were washed twice with 200 μL of staining buffer. 100 μL of 1×Fixation / Permeabilization buffer was added to each sample, and the cells were incubated at 4°C in the dark for 30 min. The cells were then centrifuged at 400 g for 5 min at 4°C, and the supernatant was removed. Cells were resuspended in 200 μL of 1×Permeabilization buffer, centrifuged at 400 g for 5 min at 4°C, and the supernatant was removed. Intracellular antibodies (CD206 / Granzyme B / INOS) were added to 1×Permeabilization buffer, and the cells were incubated at 4°C in the dark for 30 min. Cells were washed twice with 1×Permeabilization buffer. Cells were then rinsed with staining buffer. Cells were resuspended in 300 μL of staining buffer, and the resuspended cells were transferred to flow cytometry tubes and stored at 4°C or directly analyzed.
[0349] Table 10. Panel Design Information for Flow Cytometry Fluorescence Analysis
[0350] Example 1: Plant SGS2 protein sequence alignment
[0351] Bioinformatics analysis was performed on the plant SGS2 sequence according to the specific embodiments provided in this application. By performing a BLAST search on the Arabidopsis SGS2 sequence in a database, SGS2 sequences from 10 other plant species were obtained. Sequence comparison analysis revealed that the SGS2 proteins from 11 plant species contained a high proportion of conserved sequences, conserved mutations, and semi-conserved mutations, suggesting that these regions are structurally or functionally important and conserved. In the figure, * indicates a conserved sequence (identical), : indicates a conservative mutation, · indicates a semi-conservative mutation, and - indicates a gap (Figure 1A).
[0352] Further domain prediction analysis revealed that all 11 plant SGS2 proteins contained RNA-dependent RNA polymerase domain (RdRP) sequences, and 10 plant SGS2 proteins contained RNA recognition motifs (RRM) (Figure 1B, Table 11), suggesting a high degree of functional similarity among the 11 plant SGS2 proteins. In Table 11, the E-value represents the expected matching value; a smaller E-value indicates a more significant and biologically meaningful match.
[0353] Table 11. Information on conserved domains of plant SGS2 protein
[0354] Example 2: Plasmid Preparation
[0355] The following plasmids were constructed according to the specific embodiments provided in this application (Table 12). Figures 2A-2C show schematic diagrams of the construction of recombinant oncolytic adenovirus vectors E9272, E9273, and E9274, respectively, and plasmids H37195, H37196, and H37197. The plasmids were stored at -20°C for later use.
[0356] Table 12. Plasmid Information Table for Preparation Examples 1-7
[0357] Example 3: Preparation of the virus
[0358] The following viruses (Table 13) were prepared according to the specific embodiments provided in this application and stored at -80°C for later use.
[0359] Table 13. Virus Information Table in Preparation Examples 8-10
[0360] Example 4: Virus titer determination
[0361] Viral titers of E9272, E9273, and E9274 were determined according to the specific embodiments provided in this application. Viruses E9272, E9273, and E9274 were serially diluted, as shown in Figure 3, where viruses E9272, E9273, and E9274 were diluted to 10⁻⁶. -5 10 -6 10 -7 10 -8 Images of HEK-293 cells infected with four different concentrations, stained with HEXON. Viruses E9272, E9273, and E9274 were diluted 1×10⁻⁶. 7After dilution, as shown in Table 14, the average number of HEXON-positive cells calculated in 5 fields of view under the microscope were 17, 20, and 15, respectively, all meeting the requirement of 5-50 HEXON-positive cells per field. The titer can be calculated using the formula: Infected cells per well (IFU) / mL = (Infected cells / field of view) × (Number of fields per well, 79) × (Dilution factor) × (Virus volume (mL)). The calculated titer of virus E9272 is 1.34 × 10⁻⁶. 11 IFU / mL, the titer of viral E9273 was 1.58 × 10⁻⁶. 11 IFU / mL, the titer of viral E9274 was 1.18 × 10⁻⁶. 11 IFU / mL.
[0362] Table 14. Virus Titer Information Table
[0363] Example 5: Detection of exogenous gene expression levels after viral infection of HEK-293 cells
[0364] Total RNA was extracted from HEK-293 cells, HEK-293 cells infected with virus E9272, HEK-293 cells infected with virus E9273, and HEK-293 cells infected with virus E9274 according to the specific embodiments provided in this application. The specificity and expression level of the internal reference gene Gapdh and the exogenous gene Sgs2 mRNA in virus-infected cells were detected. First, the specificity of the real-time quantitative PCR reaction of the internal reference gene Gapdh and the exogenous gene Sgs2 was verified by collecting and analyzing the melting curve fluorescence signals. Figure 4A shows that the melting curve of the internal reference gene Gapdh in the HEK-293 cells, HEK-293 cells infected with virus E9272, HEK-293 cells infected with virus E9273, and HEK-293 cells infected with virus E9274 is a tight single peak, indicating that the internal reference gene Gapdh is specifically expressed in all four types of samples. The melting curves of the exogenous gene Sgs2 in HEK-293 cells and HEK-293 cells infected with virus E9272 showed mixed multi-peak patterns, while the melting curves of the exogenous gene Sgs2 in HEK-293 cells infected with virus E9273 and HEK-293 cells infected with virus E9274 showed tight single-peak patterns, suggesting that the exogenous gene Sgs2 is specifically expressed only in HEK-293 cells infected with viruses E9273 and E9274.
[0365] Figure 4B shows the relative expression levels of the exogenous gene Sgs2 / internal reference gene Gapdh in HEK-293 cells, HEK-293 cells infected with virus E9272, HEK-293 cells infected with virus E9273, and HEK-293 cells infected with virus E9274. Data are expressed as mean ± standard error, n = 3. Unpaired Student's-test was used for statistical analysis. *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ****, p ≤ 0.0001. Compared with the control HEK-293 cells infected with virus E9272, the relative expression level of Sgs2 / Gapdh in HEK-293 cells infected with virus E9273 was 399064.90 ± 0.12 (p ≤ 0.001). Compared with HEK-293 cells infected with the control virus E9272, the relative expression level of Sgs2 / Gapdh in HEK-293 cells infected with virus E9274 was 1175045.72±0.12 (p≤0.001). These results indicate that the exogenous gene Sgs2 was significantly overexpressed in HEK-293 cells infected with both viruses E9273 and E9274.
[0366] Example 6: Study on the selective killing of tumor cells by viruses
[0367] According to the specific embodiments provided in this application, the selective killing effects of oncolytic adenoviruses E9272, E9273, and E9274 on PC-3 cells, SW780 cells, and normal cells were evaluated using the CCK-8 assay, thereby screening for the virus strain with the best oncolytic effect. MRC5 and HUVEC, human embryonic lung fibroblasts and human vascular endothelial cells, respectively, were used as normal control cells in this embodiment. Based on the number of cells seeded per well in a 96-well plate and the titer of each oncolytic virus, viruses E9272, E9273, or E9274 were infected with tumor cells and normal cells at different multiplicity of infection (MOI; MOI 1, 3, 10, 30, 100, 300, 1000, 3000, 5000). As shown in Figure 5, the IC50 of virus E9273 on PC-3 cells was 3.796 MOI (n=3, R 2 =0.9725), the IC50 of virus E9274 against PC-3 cells was 1.664 MOI (n=3, R 2 =0.9766), while the IC50 of virus E9272 against PC-3 cells was 11.22 MOI (n=3, R 2 =0.9851); the IC50 of virus E9273 against SW780 cells was 3.036 MOI (n=3, R=0.9851); 2=0.9658), the IC50 of virus E9274 against SW780 cells was 3.183 MOI (n=3, R 2 =0.9725), while the IC50 of virus E9272 against SW780 cells was 12.16 MOI (n=3, R 2 =0.9871). The results suggest that viruses E9273 and E9274 both exhibited good oncolytic effects on PC-3 and SW780 cells, and their killing effect on PC-3 and SW780 cells was superior to that of virus E9272.
[0368] Meanwhile, the IC50 of virus E9273 against MRC5 cells was 14.09 MOI (n=3, R 2 =0.9907), the IC50 of virus E9274 against MRC5 cells was 30.03 MOI (n=3, R 2 =0.9873), while the IC50 of virus E9272 against MRC5 cells was 10.16 MOI (n=3, R 2 =0.9787). The IC50 of virus E9273 against HUVEC cells was 54.76 MOI (n=3, R 2 =0.9948), the IC50 of virus E9274 against HUVEC cells was 58.61 MOI (n=3, R 2 =0.9838), while the IC50 of virus E9272 against HUVEC cells was 31.25 MOI (n=3, R 2 =0.9747). At the same MOI, the IC50 of viruses E9273 and E9274 on normal cells was higher than that of virus E9272 on normal cells, indicating that the killing effect of viruses E9273 and E9274 on normal cells was much lower than that on tumor cells. The above results suggest that viruses E9273 and E9274 exhibit good safety in in vitro cell model studies.
[0369] Example 7: Study on the selective killing of mouse bladder cancer cells MB49 and MBT2 by virus
[0370] According to the specific embodiments provided in this application, the selective killing effect of oncolytic adenoviruses E9272 and E9273 on mouse bladder cancer cells was evaluated using the CCK-8 assay, thereby verifying that E9273 is the virus strain with the best killing effect and screening out the best mouse bladder cancer cell strain for establishing a mouse homologous subcutaneous tumor model. PC-3 is a human prostate cancer cell strain, which was used as a positive control cell in this embodiment. Based on the number of cells seeded per well in a 96-well plate and the titer of each oncolytic virus, tumor cells were infected with viruses E9272, E9273-batch 1, or E9273-batch 2 at different MOIs. As shown in Figure 6, the IC50 of virus E9272 on PC-3 cells was 2473 MOI (n=3, R...). 2 =0.8522), the IC50 of virus E9273-batch 1 against PC-3 cells was 5.209 MOI (n=3, R 2 =0.9701), the IC50 of virus E9273-batch 2 against PC-3 cells was 3.699 MOI (n=3, R 2 =0.9691). The IC50 of virus E9272 against MB49 cells was 869446 MOI (n=3, R 2 =0.7580), the IC50 of virus E9273-batch 2 pairs of MB49 cells was 719.2 MOI (n=3, R 2 =0.8875). The IC50 of virus E9272 against MBT2 cells was 40788 MOI (n=3, R 2 =0.7930), the IC50 of virus E9273-batch 2 on MBT2 cells was 506.2 MOI (n=3, R 2 =0.9949). The results indicate that, compared to virus E9272, virus E9273 exhibited better tumor cell killing effects on PC-3, MB49, and MBT2 cells, with E9273 showing the best selective tumor cell killing effect. Viruses E9272 and E9273 showed better killing effects on MBT2 cells than on MB49 cells; therefore, MBT2 cells were the preferred choice for subsequent mouse homologous subcutaneous tumor model establishment and in vivo efficacy studies.
[0371] Example 8: Study on selective viral replication in different cells
[0372] This experiment used probe-based qPCR to detect the replication of the oncolytic virus in tumor cells and normal cells in order to evaluate the safety of the oncolytic virus.
[0373] The standard quality particles were serially diluted according to the specific implementation method in Table 15 and stored at -20℃ for later use. The standard quality particle length was 5872 bp, and the concentration was 340 ng / μL. The concentration was calculated using the formula: (6.02 × 10⁻⁶).23 )×(plasmid concentration ng / μL×10 -9 () / (plasmid base number × 660), converted to a copy number of 5.3 × 10⁻⁶. 10 copies / μL.
[0374] Table 15. Information on serial dilution of viral standard plasmids
[0375] First, the specificity of the real-time quantitative PCR reaction for viral genome was verified by collecting and analyzing the fluorescence signal of the melting curve. Figure 7A shows the standard curve of absolute quantification of viral genome copy number by qPCR. A linear regression was performed with LOG copy number as x and Ct value as y. The linear equation of the standard curve is: y = -3.682x + 41.62, R0 2 =0.999.
[0376] HEK-293 is a human embryonic kidney sub-triploid cell line transformed with adenovirus type 5 strain 75, containing the Ad5 E1 region, and is an E1 region-deficient complementary cell line. Viruses E9272, E9273, or E9274 should have good replication capacity in HEK-293 cells; HEK-293 cells were used as positive control cells in this embodiment. Total genomic DNA was extracted from each cell sample according to the specific implementation method provided in this application, and the proliferation of viral genome genes in virus-infected cells was detected. Figure 7B shows the selective replication of oncolytic viruses E9272 and E9273 in tumor cells PC-3 and SW780, as well as positive control cells HEK-293 and normal cells HUVEC. The results indicate that both oncolytic viruses E9272 and E9273 can replicate efficiently in the positive control HEK-293 cells. In tumor cells PC-3 or SW780, both oncolytic viruses E9272 and E9273 have strong replication capacity. In normal HUVEC cells, the replication of oncolytic virus E9273 was significantly inhibited, demonstrating good safety. These results indicate that oncolytic virus E9273 possesses the characteristic of selective replication in tumor cells.
[0377] Example 9: Study on the selective expression of the exogenous gene Sgs2 from oncolytic viruses in different cells
[0378] This experiment used RT-qPCR SYBR Green assay to assess the expression of the exogenous gene Sgs2 of oncolytic virus after infecting tumor cells and normal cells. Figure 8 shows the relative expression levels of exogenous gene / internal reference gene of oncolytic virus E9272 and E9273 in tumor cells PC-3, SW780, HEK-293, and HUVEC cells. Data are expressed as mean ± standard error, n = 3. Unpaired Student's t-test was used in GraphPad Prism 10.1.2 software for intergroup statistical analysis. ns, p > 0.05; *, p ≤ 0.05; **, p ≤ 0.01; ***, p ≤ 0.001; ****, p ≤ 0.0001. The results of Example 8 suggest that virus E9273 has good replication ability in HEK-293 cells, and the exogenous viral gene Sgs2 should have a high expression level in HEK-293 cells. HEK-293 cells were used as positive control cells in this example.
[0379] Compared with uninfected HEK-293 cells, the relative expression levels of Sgs2 / Gapdh in HEK-293 cells infected with virus E9272 were 4.73±0.61, and the relative expression levels of Sgs2 / Gapdh in HEK-293 cells infected with virus E9273 were 0.56±0.26. The exogenous gene Sgs2 was significantly overexpressed in HEK-293 cells infected with virus E9273 (p≤0.001).
[0380] Compared with virus-free HEK-293 cells, the relative expression level of Sgs2 / Gapdh in virus-free PC-3 cells was 3.77±1.32, the relative expression level of Sgs2 / Gapdh in E9272-infected PC-3 cells was 3.26±1.08, and the relative expression level of Sgs2 / Gapdh in E9273-infected PC-3 cells was 241307.97±0.24. The exogenous gene Sgs2 was significantly highly expressed in E9273-infected PC-3 cells (p≤0.001).
[0381] Compared with virus-free HEK-293 cells, the relative expression level of Sgs2 / Gapdh in virus-free SW780 cells was 4.73±0.62, the relative expression level of Sgs2 / Gapdh in E9272-infected SW780 cells was 9.37±1.46, and the relative expression level of Sgs2 / Gapdh in E9273-infected SW780 cells was 4595.05±0.60. The exogenous gene Sgs2 was significantly overexpressed in E9273-infected SW780 cells (p≤0.001).
[0382] Compared with virus-free HEK-293 cells, the relative expression level of Sgs2 / Gapdh in virus-free HUVEC cells was 120.04±1.66, the relative expression level of Sgs2 / Gapdh in virus-E9272-infected HUVEC cells was 154.29±0.92, and the relative expression level of Sgs2 / Gapdh in virus-E9273-infected HUVEC cells was 1245.42±0.41.
[0383] Compared with HUVEC cells infected with oncolytic virus E9273, the exogenous gene Sgs2 was significantly overexpressed in HEK-293 cells, PC-3 tumor cells, and SW780 tumor cells infected with E9273 virus (p≤0.001, p≤0.001, p≤0.001).
[0384] The above results indicate that the oncolytic virus E9273 can express the exogenous gene Sgs2 at high levels in positive control HEK-293 cells, tumor cells PC-3, and SW780 tumor cells. However, the expression of the exogenous gene Sgs2 is significantly inhibited in normal HUVEC cells.
[0385] Example 10: Study on Oncolytic Virus Replication in Tumor Cells
[0386] According to the specific embodiments provided in this application, oncolytic adenovirus E9272-batch 3 or E9273-batch 3 was used to infect human prostate cancer cells PC-3, and total genomic DNA was extracted from PC-3 cell samples. The replication ability of oncolytic viruses E9272-batch 3 and E9273-batch 3 in human prostate cancer cells PC-3 was detected by probe qPCR.
[0387] The Hexon gene encodes the major capsid protein of the virus, and only one open reading frame (ORF) of the Hexon gene is contained in a complete oncolytic adenovirus genome. Theoretically, the copy number of one Hexon gene represents the copy number of one oncolytic adenovirus genome. Therefore, the copy number of the Hexon gene, determined by absolute quantitative qPCR, can be directly reported as the copy number of the oncolytic adenovirus genome.
[0388] First, the specificity of the viral genome Hexon real-time quantitative PCR reaction was verified by collecting and analyzing the fluorescence signals of the melting curve. Figure 9A shows the standard curve of viral genome copy number. A linear regression was performed with LOG copy number as x and Ct value as y. The linear equation of the standard curve is: y = -3.532x + 41.965, R0. 2 =0.996.
[0389] Figure 9B shows the replication of oncolytic virus E9272-batch 3 or E9273-batch 3 in PC-3 tumor cells 72 h after infection. Data are expressed as mean ± standard error, n = 3. Unpaired Student's t-test was used for statistical analysis. * indicates p ≤ 0.05, ** indicates p ≤ 0.01, *** indicates p ≤ 0.001, and **** indicates p ≤ 0.0001. When MOI is 3, the viral genome copy number of oncolytic virus E9272-batch 3 in PC-3 tumor cells is 3.67 × 10⁻⁶. 6 ±9.19×10 5 The viral genome copy number of oncolytic virus E9273-batch 3 was 1.56 × 10^6 copies / μg total genomic DNA. 9 ±1.77×10 8 E9273 copies / μg total genomic DNA. E9273 showed stronger replication ability in PC-3 tumor cells (p≤0.0001).
[0390] PC-3 cells infected with the same batch of oncolytic virus were collected. Total RNA was extracted from the PC-3 cell samples according to the specific implementation method provided in this application, and the expression of the oncolytic virus gene Hexon at the mRNA level after infection of tumor cells was evaluated using the RT-qPCR SYBR Green method. Figure 10 shows the CT values of the Hexon gene in PC-3 tumor cells infected with oncolytic virus E9272-batch 3 or E9273-batch 3 in real-time quantitative PCR detection. Data are expressed as mean ± standard error, n = 3. Statistical analysis of the data was performed using unpaired Student's t-test. * indicates p ≤ 0.05, ** indicates p ≤ 0.01, *** indicates p ≤ 0.001, and **** indicates p ≤ 0.0001. When the MOI was 3, the CT value of the Hexon gene in PC-3 tumor cells infected with oncolytic virus E9272-batch 3 was 20.98±0.07, while the CT value of the Hexon gene in PC-3 tumor cells infected with oncolytic virus E9273-batch 3 was 11.65±0.06. The oncolytic virus gene Hexon was significantly overexpressed in PC-3 cells infected with virus E9273-batch 3 (p≤0.0001).
[0391] Example 11: Study on the expression level of exogenous gene Sgs2 mRNA of oncolytic virus in tumor cells
[0392] Consistent with Example 10, this example collected PC-3 cells infected with the same batch of oncolytic virus. Total RNA was extracted from the PC-3 cell samples according to the specific implementation method provided in this application, and the specific expression levels of the internal reference gene Gapdh and the exogenous gene Sgs2 mRNA in virus-infected cells were detected using the RT-qPCR SYBR Green method. Figure 11A shows that the melting curve of the internal reference gene Gapdh in PC-3 tumor cell samples infected with oncolytic virus E9272 or E9273 is a tight single peak, indicating that the internal reference gene Gapdh is specifically expressed in both samples. The negative control is ddH2O, which is a template-free negative control. Figure 11B shows that the melting curve of the exogenous gene Sgs2 in the template-free negative control group remained at the baseline level without obvious amplification peaks, indicating that there was no interference from primer dimers, non-specific amplification, or contamination in the experimental system. Figure 11C shows that the melting curve of the exogenous gene Sgs2 in PC-3 tumor cells infected with oncolytic virus E9272 is peakless, while the melting curve of the exogenous gene Sgs2 in PC-3 tumor cells infected with E9273 is a tight single peak. These results suggest that the exogenous gene Sgs2 is specifically expressed only in PC-3 tumor cells infected with virus E9273.
[0393] Table 16 shows the CT values for detecting the expression levels of the internal reference gene Gapdh and the exogenous gene Sgs2 in PC-3 tumor cells infected with oncolytic virus E9272 or E9273. When the MOI is 3, the CT value of the internal reference gene Gapdh in PC-3 tumor cells infected with oncolytic virus E9272 is 13.09±0.10, while the CT value of the exogenous gene Sgs2 is outside the detection range and has no reading. In PC-3 tumor cells infected with oncolytic virus E9273, the CT value of the internal reference gene Gapdh is 14.00±0.04, and the CT value of the exogenous gene Sgs2 is 12.57±0.02. The exogenous gene Sgs2 is specifically highly expressed in PC-3 cells infected with oncolytic virus E9273 (p≤0.0001).
[0394] Table 16. CT Value Information for Gene Expression Level Detection Note: Undetermined: CT value is outside the detection range, no reading available.
[0395] Example 12: Efficacy study protocol of PC-3 and SW780 cell subcutaneous xenograft tumor model in tumor-bearing mice after oncolytic virus treatment
[0396] Experimental animals were grouped and administered drugs according to the specific implementation methods provided in this application (Tables 17 and 18).
[0397] Table 17. Grouping and Dosing Regimens of Experimental Animals for PC-3 Cell Subcutaneous Xenograft Transplantation in Tumor-Bearing Rats
[0398] Table 18. Grouping and Dosing Regimens of Animals in the In vivo Drug Efficacy Experiment of SW780 Cell Subcutaneous Xenografted Tumor-Bearing Rats
[0399] Example 13: Weight monitoring of tumor-bearing mice in a subcutaneous xenograft model of PC-3 cells after oncolytic virus treatment.
[0400] The body weight of experimental animals is an important reference indicator for indirectly determining drug toxicity. Figure 12 shows a bar chart of body weight changes in mice in the PC-3 subcutaneous xenograft tumor model of human prostate cancer cells after administration of oncolytic viruses E9272 and E9273. The bar height represents the average body weight within the group, and the error bar represents the standard error (SEM), n=5. The results indicate that because PC-3 is a malignant tumor model, weight loss was common in mice, nutritional supplements were added to all groups of mice until the end of the experiment.
[0401] Example 14: Efficacy study of PC-3 cell subcutaneous xenograft tumor model in tumor-bearing mice after oncolytic virus treatment.
[0402] According to the specific embodiments provided in this application, the tumor volume of mice in each group at different time points after oncolytic virus treatment in a subcutaneous xenograft tumor model of human prostate cancer cells PC-3 established in male Balb / c nude mice was measured and calculated (Table 19, Figure 13). Based on the tumor volume, the relative tumor growth rate (Figure 14), tumor growth inhibition rate (TGI) (%, Table 20), and relative tumor proliferation rate (T / C) (%, Table 21) of each group of mice at different time points were calculated.
[0403] Table 19. Tumor volume information at different time points in each experimental animal group.
[0404] Table 20. Tumor growth inhibition rate (TGI) at different time points in each experimental animal group.
[0405] Table 21. Relative tumor proliferation rate (T / C%) at different time points in each experimental animal group
[0406] The tumor volume data of each experimental animal group after 31 days were statistically analyzed using two-way ANOVA with GraphPad Prism 10.1.2 software (Table 22). ns, p>0.05; *, p≤0.05; **, p≤0.01; ***, p≤0.001; ****, p≤0.0001.
[0407] Table 22. Statistical analysis of tumor volume between experimental animal groups after 31 days. Note: a.ns, p>0.05; *, p≤0.05; **, p≤0.01; ***, p≤0.001; ****, p≤0.0001.
[0408] The above results indicate that, 31 days after administration, compared with the Vehicle control group, all oncolytic virus treatments except the E9272 low dose group (1E7 IFU / mouse) showed significant tumor-suppressive effects. Compared with the E9272 low dose group (1E7 IFU / mouse), the E9272 medium dose group (1E8 IFU / mouse) and high dose group (1E9 IFU / mouse) both showed significant tumor-suppressive effects. Compared with the E9272 medium dose group (1E8 IFU / mouse), the E9272 high dose group (1E9 IFU / mouse) did not show significant tumor-suppressive effects. This suggests that the therapeutic effect of oncolytic virus E9272 has a dose-dependent effect between low and medium doses. Compared with the low dose group (1E7 IFU / mouse) of oncolytic virus E9273, both the medium dose group (1E8 IFU / mouse) and the high dose group (1E9 IFU / mouse) showed significant tumor-suppressive effects. Compared with the medium dose group (1E8 IFU / mouse), the high dose group (1E9 IFU / mouse) also showed significant tumor-suppressive effects. This suggests that the therapeutic effect of oncolytic virus E9273 exhibits a dose-dependent effect between low (1E7 IFU / mouse) and high (1E9 IFU / mouse) doses. Compared with the low dose group (1E7 IFU / mouse) and high dose group (1E9 IFU / mouse) of oncolytic virus E9272, the same dose of oncolytic virus E9273 showed a more significant therapeutic effect on PC-3, and the exogenous gene Sgs2 showed a significant tumor-suppressive effect in the subcutaneous xenograft tumor model of PC-3 tumor cells.
[0409] Example 15: Pharmacodynamic Dosage Study Protocol for Oncolytic Adenovirus E9273 in a Balb / c Nude Mouse Tumor Model with Subcutaneous Xenograft of Human Prostate Cancer Cells PC-3
[0410] Experimental animals were grouped and administered drugs according to the specific implementation methods provided in this application (Table 23).
[0411] Table 23. Grouping and Dosing Regimens of Animals in In Vivo Efficacy Experiments
[0412] Example 16: Pharmacodynamic Dosage Exploration Study of Oncolytic Virus E9273 in a Balb / c Nude Mouse Tumor Model with Subcutaneous Xenograft of Human Prostate Cancer Cell PC-3 (including body weight monitoring)
[0413] Animal weight was used as an indirect reference for determining drug toxicity. Figure 15 shows a bar chart of weight changes in mice in the PC-3 subcutaneous xenograft tumor model after administration of oncolytic virus E9273 during the pharmacodynamic dose exploration study. The bar height represents the average weight within the group, the error bar represents the standard error (SEM), and n≥3. The results showed that mice #1-2 in the Vehicle group lost 14.3% of their weight at PG-D19, and mice #1-1 lost 10.1% of their weight at PG-D22. Individual mice were given nutritional supplements at PG-D19 and PG-D22, respectively. Mice #1-1, #1-3, #2-2, and #2-3 lost 19.5%, 16.5%, 16.6%, and 12.7% of their weight at PG-D26, respectively. All mice in these groups were given nutritional supplements on the same day. Mice #8-3 in the E9273 high dose group (1E10 IFU / mouse) died at PG-D27. Three weeks before administration, there was no significant difference in body weight loss between the control group and the administration group.
[0414] Example 17: Pharmacodynamic Dosage Study of Oncolytic Virus E9273 in a Balb / c Nude Mouse Model of Subcutaneous Xenograft of Human Prostate Cancer Cell PC-3
[0415] According to the specific embodiments provided in this application, the tumor volume of mice in each group at different time points after treatment with oncolytic virus E9273 in a subcutaneous xenograft tumor model of human prostate cancer cells PC-3 established in male Balb / c nude mice was measured and calculated (Table 24, Figure 16). Based on the tumor volume, the relative tumor growth rate (Figure 17), relative tumor proliferation rate (T / C), and tumor growth inhibition rate (TGI) (%) of each group of mice at different time points were calculated (Tables 25-27).
[0416] Table 24. Tumor volume information at different time points in each experimental animal group.
[0417] Table 25. Information on relative tumor proliferation rate (T / C%) and tumor growth inhibition rate (TGI%) for each experimental animal group after 22 days of tumor volume calculation. Note: a. Mean ± SEM. b. Tumor growth inhibition is determined by T / C = T RTV / C RTV ×100% and TGI% = [1-(T 22 -T0) / (V 22 The result is calculated as -V0)]×100%, where T 22 V 22 The mean tumor volumes on day 22 are shown in Figures 1-2, and T0 and V0 are the mean tumor volumes at the start of drug administration in the treatment and control groups, respectively. c. Using the tumor volume of group 1 as a control, comparisons among three or more groups were analyzed using a two-way ANOVA test, p ≤ 0.0001. d. Using the tumor volume of group 2 as a control, comparisons between the two groups were analyzed using Student's t-test, p ≤ 0.001.
[0418] e. Using the tumor volume of group 3 as a control, the comparison between the two groups was analyzed using Student's t-test, ns, p>0.05.
[0419] Table 26. Information on relative tumor proliferation rate (T / C%) and tumor growth inhibition rate (TGI%) for each experimental animal group after 26 days of tumor volume calculation. Note: a. Mean ± SEM. b. Tumor growth inhibition is determined by T / C = T RTV / C RTv ×100% and TGI% = [1-(T 26 -T0) / (V 26 The result is calculated as -V0)]×100%, where T 26 V 26 The mean tumor volumes on day 26 are shown in Figures 1-26 for the treatment group and the control group, respectively. T0 and V0 are the mean tumor volumes at the start of drug administration in the treatment group and the control group, respectively. c. Using the tumor volume of group 1 as a control, comparisons among three or more groups were analyzed using a two-way ANOVA test, with p ≤ 0.0001. d. Using the tumor volume of group 2 as a control, comparisons between the two groups were analyzed using Student's t-test, with p ≤ 0.01 for groups 1 and 2 for groups 3. e. Using the tumor volume of group 3 as a control, comparisons between the two groups were analyzed using Student's t-test, with p > 0.05 for groups 3.
[0420] Table 27. Information on relative tumor proliferation rate (T / C%) and tumor growth inhibition rate (TGI%) for each experimental animal group after 33 days of tumor volume calculation. Note: a. Mean ± SEM. b. Tumor growth inhibition is determined by T / C = T RTV / C RTV ×100% and TGI% = [1-(T 33 -T0) / (V 33 The result is calculated as -V0)]×100%, where T 33 V 33 The mean tumor volumes on day 33 are shown in Figures 1-3, and T0 and V0 are the mean tumor volumes at the start of drug administration in the treatment and control groups, respectively. c. Using the tumor volume of group 1 as a control, comparisons among three or more groups were performed using a two-way ANOVA test, p ≤ 0.0001. d. Using the tumor volume of group 2 as a control, comparisons between the two groups were performed using Student's t-test, p ≤ 0.01, p ≤ 0.0001. e. Using the tumor volume of group 3 as a control, comparisons between the two groups were performed using Student's t-test, p > 0.05.
[0421] The results showed that 22 days after drug administration, the average tumor volume in tumor-bearing mice in the Vehicle control group reached 1,196 mm. 3 Compared with the vehicle control group, the E9273 low dose group (1E9 IFU / mouse), medium dose group (5E9 IFU / mouse), and high dose group (1E10 IFU / mouse) all showed significant tumor-suppressing effects, with tumor volumes of 448 mmHg and 448 mmHg, respectively. 3 (T / C=37.61%, TGI=68.15%), 253mm 3 (T / C = 21.20%, TGI = 85.96%) and 222mm 3 (T / C = 18.59%, TGI = 88.79%). Significant differences were found between the E9273 low dose group (1E9 IFU / mouse) and the medium dose group (5E9 IFU / mouse) and the high dose group (1E10 IFU / mouse). No significant difference was found between the E9273 medium dose group (5E9 IFU / mouse) and the high dose group (1E10 IFU / mouse).
[0422] Twenty-six days after administration, the average tumor volume in tumor-bearing mice in the Vehicle control group reached 1,520 mm². Compared with the Vehicle control group, the E9273 low-dose group (1E9 IFU / mouse), medium-dose group (5E9 IFU / mouse), and high-dose group (1E10 IFU / mouse) all showed significant tumor-suppressive effects, with tumor volumes of 449 mm². 3 (T / C=29.65%, TGI=75.35%), 223mm 3 (T / C = 14.75%, TGI = 91.22%) and 190mm 3 (T / C = 12.55%, TGI = 93.56%). Significant differences were found between the E9273 low dose group (1E9 IFU / mouse) and the medium dose group (5E9 IFU / mouse) and the high dose group (1E10 IFU / mouse). No significant difference was found between the E9273 medium dose group (5E9 IFU / mouse) and the high dose group (1E10 IFU / mouse).
[0423] 33 days after administration, the average tumor volume in tumor-bearing mice in the Vehicle control group reached 2,354 mm. 3 Compared with the vehicle control group, the E9273 low dose group (1E9 IFU / mouse), medium dose group (5E9 IFU / mouse), and high dose group (1E10 IFU / mouse) all showed significant tumor-suppressing effects, with tumor volumes of 461 mmHg and 461 mmHg, respectively. 3 (T / C=19.68%, TGI=83.91%), 163mm 3 (T / C = 6.95%, TGI = 97.15%) and 134mm 3 (T / C = 5.69%, TGI = 98.46%). Significant differences were found between the E9273 low dose group (1E9 IFU / mouse) and the medium dose group (5E9 IFU / mouse) and the high dose group (1E10 IFU / mouse). No significant difference was found between the E9273 medium dose group (5E9 IFU / mouse) and the high dose group (1E10 IFU / mouse).
[0424] In summary, under the experimental conditions, compared with the Vehicle group, the E9273 low dose group (1E9 IFU / mouse), medium dose group (5E9 IFU / mouse), and high dose group (1E10 IFU / mouse) all showed significant tumor-suppressive effects on the human prostate cancer cell PC-3 subcutaneous xenograft model, and these effects were dose-dependent.
[0425] Example 19: Detection of viral genome copy number and exogenous gene Sgs2 mRNA expression level in a pharmacodynamic dose-finding study of oncolytic virus E9273 in a Balb / cnude mouse model of subcutaneous xenograft of human prostate cancer cells PC-3.
[0426] Total genomic DNA was extracted from tumor tissue samples according to the specific embodiments provided in this application, and the viral genome copy number in the tumor was detected by probe qPCR after E9273 administration.
[0427] First, the specificity of the viral genome Hexon real-time quantitative PCR reaction was verified by collecting and analyzing the fluorescence signal of the melting curve. Figure 18A shows the standard curve of absolute quantification of viral genome copy number by qPCR. A linear regression was performed with LOG copy number as x and Ct value as y. The linear equation of the standard curve is: y = -3.281x + 35.63, R0 2 =0.999. Figure 18B shows that at 21, 30, and 36 days after drug administration, the E9273 highdose group (1E10 IFU / mouse) had the highest viral genome copy number in the tumor, at 2.36 × 10⁻⁶. 6 copies / μg total genomic DNA, 1.11×10 7 copies / μg total genomic DNA, 1.24×10 7 copies / μg of total genomic DNA.
[0428] Total RNA was extracted from tumor tissue samples according to the specific embodiments provided in this application, and the specific expression levels of the internal reference gene Gapdh and the exogenous gene Sgs2 mRNA in tumor tissue samples after administration of viral E9273 were detected using the RT-qPCR SYBR Green method. The Vehicle group served as a solvent control group, a negative control used to exclude the interference of the solvent itself on tumor growth and experimental results. Figure 19A shows that the melting curve of the exogenous gene Sgs2 in the Vehicle group remained at the baseline level throughout, with no obvious amplification peak. Figure 19B shows that the melting curve of the exogenous gene Sgs2 in tumor tissue samples of each group after administration of E9273 was a tight single peak. Figure 19C shows that at 21, 30, and 36 days after drug administration, compared with the E9273 low dose group (1E9 IFU / mouse), the expression levels of endogenous and exogenous Sgs2 mRNA in the E9273 medium dose group (5E9 IFU / mouse) increased by 3.27, 3.59, and 1.33 times, respectively, and the expression levels of endogenous and exogenous Sgs2 mRNA in the E9273 high dose group (1E10 IFU / mouse) increased by 4.92, 3.11, and 5.47 times, respectively.
[0429] In summary, under the conditions of this experiment, the Vehicle group contained no viral genome and no related exogenous gene expression. In the three different dosage groups, as the viral dose increased, the viral genome content and exogenous gene expression within the tumor showed a positive correlation to some extent.
[0430] Example 20: Monitoring of mortality, morbidity, and weight in tumor-bearing mice after subcutaneous xenografting of SW780 cells with oncolytic virus therapy.
[0431] Animal body weight is an important indirect indicator for assessing drug toxicity. Figure 20 shows a bar chart of body weight changes in mice in a subcutaneous xenograft tumor model of human bladder cancer cells SW780 after administration of oncolytic viruses E9272 and E9273. The bar height represents the average body weight within the group, and the error bar represents the standard error (SEM). n=5. The results indicate that all groups of mice showed good tolerance, with no morbidity or mortality.
[0432] Example 21: Efficacy study of SW780 cell subcutaneous xenograft tumor model in tumor-bearing mice after oncolytic virus treatment.
[0433] According to the specific embodiments provided in this application, the tumor volume of mice in each group at different time points after oncolytic virus treatment in a subcutaneous xenograft tumor model of human bladder cancer cells SW780 established in male Balb / c nude mice was measured and calculated (Table 28, Figure 21). Based on the tumor volume, the relative tumor growth rate (Figure 22), tumor growth inhibition rate (TGI) (%, Table 29), and relative tumor proliferation rate (T / C) (%, Table 30) of each group of mice at different time points were calculated.
[0434] Table 28. Tumor volume information at different time points in each experimental animal group.
[0435] Table 29. Tumor growth inhibition rate (TGI) at different time points in each experimental animal group
[0436] Table 30. Relative tumor proliferation rate (T / C%) at different time points in each experimental animal group
[0437] The tumor volume data of each experimental animal group after 31 days were statistically analyzed using two-way ANOVA with GraphPad Prism 10.1.2 software (Table 31). ns, p>0.05; *, p≤0.05; **, p≤0.01; ***, p≤0.001; ****, p≤0.0001.
[0438] Table 31. In vivo efficacy study of oncolytic virus against SW780 subcutaneous xenograft tumor cells in a tumor model. Statistical analysis of tumor volume between experimental animal groups after 31 days. Note: a.ns, p>0.05; *, p≤0.05; **, p≤0.01; ***, p≤0.001; ****, p≤≤0.0001.
[0439] Thirty-one days after administration, compared with the Vehicle control group, all oncolytic virus treatments showed significant tumor-suppressive effects. Compared with the oncolytic virus E9272 low dose group (1E7 IFU / mouse), the E9272 medium dose group (1E8 IFU / mouse) showed no significant tumor-suppressive effect, while the E9272 high dose group (1E9 IFU / mouse) showed significant tumor-suppressive effect. Compared with the oncolytic virus E9273 low dose group (1E7 IFU / mouse), both the E9273 medium dose group (1E8 IFU / mouse) and the high dose group (1E9 IFU / mouse) showed significant tumor-suppressive effects. Compared with the E9273 medium dose group (1E8 IFU / mouse), the E9273 high dose group (1E9 IFU / mouse) showed significant tumor-suppressive effect. Compared with the medium dose group (1E8 IFU / mouse) and high dose group (1E9 IFU / mouse) of oncolytic virus E9272, the same dose of oncolytic virus E9273 showed a more significant therapeutic effect on SW780, suggesting that the exogenous gene Sgs2 exhibits a significant tumor-suppressive effect in the subcutaneous xenograft tumor model of SW780 tumor cells. These results indicate that oncolytic virus E9273 has a significant tumor-suppressive effect on tumor-bearing mice with subcutaneous xenograft tumor cells of SW780, and this effect is dose-dependent.
[0440] Example 22: Pharmacodynamic and pharmacological study protocol for oncolytic adenovirus against a mouse model of subcutaneous transplantation of MBT2 bladder cancer cells into a C3H mouse tumor.
[0441] Experimental animals were grouped and administered drugs according to the specific implementation methods provided in this application (Tables 32 and 33).
[0442] Table 32. Grouping and Dosing Regimens of Main Experimental Animals for In Vivo Drug Efficacy
[0443] Table 33. Information on grouping and dosing regimens of experimental animals in the in vivo pharmacodynamic satellite experiment.
[0444] Example 23: Body weight monitoring during the pharmacodynamic study of a mouse model of subcutaneous transplantation of oncolytic virus into MBT2 bladder cancer cells in a C3H mouse tumor.
[0445] Animal weight was used as an indirect reference indicator for determining drug toxicity. Figures 23A and 23B show bar charts illustrating the changes in body weight of mice in the main and satellite experimental groups after oncolytic virus administration during the efficacy study of a mouse model of bladder cancer homologous subcutaneous tumor. The bar height represents the average body weight within the group, and the error bar represents the standard error (SEM), with n=6 or n=5. The results showed that mice in the main experimental E9273 low dose group (1E9 IFU / mouse) #5-6 experienced a 13.1% decrease in body weight by PG-D8. After individual cage rearing and nutritional supplementation, the body weight recovered to within 10% by PG-D10.
[0446] Example 24: Efficacy study of oncolytic virus in a mouse model of subcutaneous transplantation of MBT2 bladder cancer cells into C3H mouse tumors - tumor volume
[0447] According to the specific embodiments provided in this application, the tumor volume of mice in each group at different time points after treatment with oncolytic virus in a mouse tumor model of subcutaneous transplantation of MBT2 bladder cancer cells into C3H mice was measured and calculated (Table 34, Figure 24). Based on the tumor volume, the relative tumor growth rate (Figure 25), relative tumor proliferation rate (T / C), and tumor growth inhibition rate (TGI) (%, Table 35) of each group of mice at different time points were calculated.
[0448] Table 34. Tumor volume information of each animal group in the main experiment at different time points.
[0449] Table 35. Information on the relative tumor proliferation rate (T / C) and tumor growth inhibition rate (TGI) of each animal group in the main experiment, calculated based on tumor volume 15 days after grouping. Note: a. Using group 1 tumor volume as a control, the comparison between the two groups was analyzed using Student's t-test, ns, p>0.05, **, p≤0.01. b. Using group 2 tumor volume as a control, the comparison between the two groups was analyzed using Student's t-test, ns, p>0.05. c. Using group 3 tumor volume as a control, the comparison between the two groups was analyzed using Student's t-test, ns, p>0.05. d. Using group 4 tumor volume as a control, the comparison between the two groups was analyzed using Student's t-test, ns, p>0.05. e. Using group 5 tumor volume as a control, the comparison between the two groups was analyzed using Student's t-test, ns, p>0.05. f. Using group 6 tumor volume as a control, the comparison between the two groups was analyzed using Student's t-test, ns, p>0.05.
[0450] The results showed that after 15 days of drug administration, the average tumor volume in the tumor-bearing mice in the Vehicle control group reached 3,701 mm. 3Compared with the vehicle control group, the E9272 low dose group (1E9 IFU / mouse), E9272 medium dose group (5E9 IFU / mouse), E9272 high dose group (1E10 IFU / mouse), and E9273 low dose group (1E9 IFU / mouse), E9273 medium dose group (5E9 IFU / mouse), and E9273 high dose group (1E10 IFU / mouse) all showed varying degrees of tumor inhibition, with tumor volumes of 3,078 mmHg and 3,078 mmHg, respectively. 3 (T / C=82.91%, TGI=17.15%), 2,038mm 3 (T / C=54.93%, TGI=45.76%), 1,952mm 3 (T / C=52.71%, TGI=48.11%), 2,083mm 3 (T / C=56.17%, TGI=44.53%), 1,874mm 3 (T / C = 50.54%, TGI = 50.28%) and 1,007 mm 3 (T / C = 27.17%, TGI = 74.13%). Compared with the Vehicle control group, the E9273 high dose group (1E10 IFU / mouse) showed significant tumor-suppressing activity. Compared with the E9272 high dose group (1E10 IFU / mouse), the E9273 high dose group (1E10 IFU / mouse) showed some degree of tumor-suppressing activity. Compared with the E9273 low dose group (1E9 IFU / mouse), both the E9273 medium dose group (5E9 IFU / mouse) and the E9273 high dose group (1E10 IFU / mouse) showed an enhanced trend in tumor suppression. Compared with the E9273 medium dose group (5E9 IFU / mouse), the E9273 high dose group (1E10 IFU / mouse) showed a stronger tumor-suppressing activity. A dose-dependent antitumor effect was observed among the different E9273 administration groups.
[0451] Example 25: Efficacy study of oncolytic virus in a mouse model of subcutaneous transplantation of MBT2 bladder cancer cells into C3H mouse tumors - survival period
[0452] The survival of mice was continuously recorded during the in vivo efficacy experiment until day 24 after grouping. Mice #1-2 and #4-4 in the main experiment died on PG-D13; mice #1-4 died on PG-D14; mice #5-1 died on PG-D15; and mice #3-3 died on PG-D20. Figures 26A-B and Table 36 show the survival curves and survival analysis results for each group of mice in the main experiment, respectively.
[0453] Table 36. Survival analysis information of each animal group in the main experiment 24 days after grouping. Note: a. The formula for calculating the mean survival rate (%) is: (mean survival of the treatment group / mean survival of the control group) × 100. bp values were analyzed using Kaplan-Meierlog-rank (Mantel-Cox) with GraphPadPrism 10, compared with Vehicle data. For each value, ns, p > 0.05, *, p ≤ 0.05, **, p ≤ 0.01.
[0454] The results showed that, 24 days after grouping, the mean survival time of tumor-bearing mice in the Vehicle group was 14.67 days, while the mean survival times of tumor-bearing mice in the E9272 low dose group (1E9 IFU / mouse), E9272 medium dose group (5E9 IFU / mouse), E9272 high dose group (1E10 IFU / mouse), E9273 low dose group (1E9 IFU / mouse), E9273 medium dose group (5E9 IFU / mouse), and E9273 high dose group (1E10 IFU / mouse) were 16.83 days, 18.33 days, 19.17 days, 17.67 days, 18.67 days, and 22.17 days, respectively. Compared with the Vehicle group, the survival time of tumor-bearing mice in the E9272 medium dose group (5E9 IFU / mouse), E9272 high dose group (1E10 IFU / mouse), E9273 medium dose group (5E9 IFU / mouse), and E9273 high dose group (1E10 IFU / mouse) was significantly prolonged. Figure 26A shows that when the dose was increased to 1E10 IFU / mouse, the survival probability of tumor-bearing mice in the E9272 high dose group was 16.7% on day 24, while the survival probability of tumor-bearing mice in the E9273 high dose group increased to 50% on day 24. Figure 26B shows that the survival probability of tumor-bearing mice increased to a certain extent after treatment with oncolytic virus E9273. Among the various oncolytic virus E9273 administration groups, the survival rate of tumor-bearing mice in the E9273 low dose group (1E9 IFU / mouse) and the E9273 medium dose group (5E9 IFU / mouse) on day 24 was 16.7%, while the survival rate of tumor-bearing mice in the E9273 high dose group (1E10 IFU / mouse) increased to 50% on day 24. The data indicate that the survival rate of tumor-bearing mice increases with increasing E9273 oncolytic virus dosage.
[0455] In conclusion, under the experimental conditions, compared with the Vehicle group, intratumoral injection of 1E10 IFU / mouse E9273 can significantly inhibit the growth of subcutaneously transplanted MBT2 bladder cancer cells in mice and prolong the survival of tumor-bearing mice.
[0456] Example 26: Pharmacological study of oncolytic virus in a mouse model of subcutaneous transplantation of MBT2 bladder cancer cells into a C3H mouse tumor.
[0457] Flow cytometry fluorescence analysis of subcutaneous transplanted MBT2 bladder cancer tumors in mice was performed according to the specific embodiments provided in this application. Figure 27A shows the gating strategy for flow cytometry fluorescence analysis of subcutaneous transplanted MBT2 bladder cancer tumors in satellite group tumor-bearing mice after treatment with oncolytic viruses E9272 and E9273. Figures 27B-D show the NK cells, T cells, and CD4+ cells inside the tumor tissue of tumor-bearing mice after treatment with different oncolytic viruses. + T, CD8 + T cells, M1 macrophage, DC cells, Granzyme B + NK cells, Granzyme B + T cells, Granzyme B + CD4 + T cells, Granzyme B + CD8 + The percentages of T cells, Myeloid cells, Macrophage cells, and M2 Macrophage cells were also shown. The results indicated that the proportion of tumor-killing cells, such as CD8+, increased in the E9273 high-dose group (1E10 IFU / mouse). + T cells and Granzyme B + CD8 + T cells. Meanwhile, the proportion of cells with immunosuppressive functions, such as M2 Macrophage and Macrophage cells, showed a decreasing trend.
[0458] In summary, under the experimental conditions, compared with the Vehicle group, intratumoral injection of 1E10 IFU / mouse E9273 significantly inhibited tumor growth in the subcutaneous xenograft model of MBT2 bladder cancer cells in mice. The proportion of immunosuppressive cells in the tumor tissue showed a decreasing trend, while the proportion of cytotoxic cells showed an increasing trend. This suggests that oncolytic virus E9273 may prolong the survival of tumor-bearing mice by reshaping the tumor immune microenvironment, increasing the proportion of cytotoxic immune cell infiltration and reducing the function of immunosuppressive cells.
[0459] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation of the present invention. For those skilled in the art, various changes, modifications, substitutions and alterations made on the basis of the present invention without departing from the principles and spirit of the present invention are still within the protection scope of the present invention.
[0460] Partial sequence of this article:
[0461] The amino acid sequence of SEQ ID NO: 1-Medicago truncatula Sgs2 (sequence registration number: XP_039687766) is as follows:
[0462] The amino acid sequence of SEQ ID NO: 2-Gossypiumhirsutum Sgs2 (Sequence Registration Number: ADG57590) is as follows:
[0463] The amino acid sequence of SEQ ID NO: 3-Arabidopsis thaliana Sgs2 (Sequence Registry Number: NP_190519) is as follows:
[0464] The amino acid sequence of SEQ ID NO: 4-Nicotiana benthamiana Sgs2 (Sequence Registration Number: AAU21242) is as follows:
[0465] The amino acid sequence of SEQ ID NO: 5-Nicotiana tabacum Sgs2 (sequence registration number: BAF96019) is as follows:
[0466] The amino acid sequence of SEQ ID NO: 6-Nicotiana glutinosa Sgs2 (Sequence registration number: ACO72600) is as follows:
[0467] The amino acid sequence of SEQ ID NO: 7-SolanumlycopersicumSgs2 (Sequence registration number: NP_001266205XP_004236660) is as follows:
[0468] The amino acid sequence of SEQ ID NO: 8-Zea mays Sgs2 (sequence registration number: NP_001142097) is as follows:
[0469] SEQ ID NO: 9-Oryza sativa Sgs2 (Sequence Registration Number: NP_001406350 XP_015622237) is as follows:
[0470] The amino acid sequence of SEQ ID NO: 10-Hordeum vulgare Sgs2 (Sequence Registration Number: ACI16098) is as follows:
[0471] The amino acid sequence of SEQ ID NO: 11-Physcomitrella patens Sgs2 (Sequence Registration Number: ABF82438) is as follows:
[0472] The nucleotide sequence of SEQ ID NO: 23 is as follows:
Claims
1. A nucleic acid construct, comprising: (1) A nucleic acid sequence encoding the SGS2 protein or a functional variant thereof, wherein the amino acid sequence of the SGS2 protein is as shown in any one of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NO: 1-11, or (2) A nucleic acid sequence having at least 80% sequence identity with (1) and encoding the SGS2 protein or a functional variant thereof shown in SEQ ID NO: 1-11, or (3)(1) or (2) reverse complementary sequences; Preferably, the nucleic acid sequence of the SGS2 protein or a functional variant thereof is shown in any one of 12-23.
2. The nucleic acid construct of claim 1, wherein, It also includes one or more of the following features: The SGS2 protein is derived from plants; preferably, the plants include: alfalfa, cotton, Arabidopsis thaliana, Nicotiana bungeana, tobacco, Nicotiana heartleaf, tomato, corn, rice, barley, and sphagnum moss; more preferably, the plants are Arabidopsis thaliana, tobacco, and rice. The functional variant of the SGS2 protein contains the amino acid sequence of RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region. The nucleic acid construct is a vector or mRNA; preferably, the vector is a cloning vector, an integration vector, or an expression vector; more preferably, the vector is a viral vector.
3. A virus, comprising: (1) A nucleic acid sequence encoding the SGS2 protein or a functional variant thereof, wherein the amino acid sequence of the SGS2 protein is as shown in any one of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any one of SEQ ID NO: 1-11, or (2) A nucleic acid sequence having at least 80% sequence identity with (1) and encoding the SGS2 protein or a functional variant thereof shown in SEQ ID NO: 1-11, or (3)(1) or (2) reverse complementary sequences, Preferably, the virus comprises the nucleic acid construct according to claim 1 or 2. The virus includes adeno-associated virus, adenovirus, and retrovirus; preferably, the virus is oncolytic adenovirus.
4. A type of cell, which: (1) Containing, expressing, and / or secreting SGS2 protein or a variant thereof having at least 80% sequence identity and retaining function, wherein the amino acid sequence of the SGS2 protein is shown in any of SEQ ID NO: 1-11. (2) comprises a sequence: i) a nucleic acid sequence encoding an SGS2 protein or a functional variant thereof, wherein, The amino acid sequence of the SGS2 protein is as shown in any of SEQ ID NO: 1-11, the functional variant having at least 80% sequence identity with any of SEQ ID NO: 1-11, ii) having at least 80% sequence identity with i) and encoding the nucleic acid sequence of the SGS2 protein shown in SEQ ID NO: 1-11 or a functional variant thereof, and / or, iii) the reverse complementary sequence of i) or ii). (3) A nucleic acid construct comprising the sequence of claim 1 or 2, (4) Contains the virus as described in claim 3.
5. The cell of claim 4, wherein It also includes one or more of the following features: The nucleic acid construct is a vector; preferably, the vector is a cloning vector, an integration vector, or an expression vector; more preferably, the vector is a viral vector; even more preferably, the vector is an oncolytic adenovirus vector. The cells are HEK-293 cells; preferably, the cells include one or more selected from HEK-293T, HEK-293H, HEK-293F, HEK-293S, HEK-293T / 17, HEK-293T / 17SF, HEK-293FT, HEK-293SG, HEK-293E, HEK-293-6E, HEK-293FTM, and HEK-293SGGD cells.
6. Use of the SGS2 protein or a functional variant thereof, the nucleic acid molecule encoding it, the viral vector of claim 1 or 2, the virus of claim 3, and / or the cell of claim 4 or 5 in the preparation of a medicament for killing tumor cells or treating tumors, wherein the tumor is prostate cancer or bladder cancer.
7. Use according to claim 6, characterized in that, It also includes one or more of the following features: The SGS2 is derived from plants, preferably including: alfalfa, cotton, Arabidopsis thaliana, Nicotiana bungeana, tobacco, Nicotiana heartleaf, tomato, corn, rice, barley, and sphagnum moss; more preferably, the plants are Arabidopsis thaliana, tobacco, and rice. The functional variant of the SGS2 protein contains the amino acid sequence of RNA-dependent RNA polymerase and the complete secondary structure of the RdRP region. The amino acid sequence of the SGS2 protein is shown in any of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any of SEQ ID NO: 1-11.
8. A pharmaceutical composition comprising: Pharmaceutically acceptable excipients, and SGS2 protein or a functional variant thereof, nucleic acid molecule encoding it, nucleic acid construct of claim 1 or 2, and / or virus of claim 3. Preferably, the amino acid sequence of the SGS2 protein is as shown in any of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any of SEQ ID NO: 1-11. Preferably, the pharmaceutical composition further comprises a delivery system; more preferably, the delivery system is a viral vector or a non-viral vector.
9. Use of a reagent in the preparation of an anti-prostate cancer or bladder cancer drug, said reagent comprising: SGS2 protein or a functional variant thereof, a nucleic acid molecule encoding thereon, the nucleic acid construct of claim 1 or 2, and / or the virus of claim 3. Preferably, the amino acid sequence of the SGS2 protein is as shown in any of SEQ ID NO: 1-11, and the functional variant has at least 80% sequence identity with any of SEQ ID NO: 1-11.
10. Use according to claim 9, characterized in that The reagent or drug includes a delivery system, preferably a viral vector or a non-viral vector.