Lipoic-acid-derived ceramide, and synthesis method therefor and use thereof

Abstract

The present invention relates to the technical field of biological medicines, and discloses a lipoic-acid-derived ceramide, and a synthesis method therefor and the use thereof. The ceramide has a structure represented by general formula I or a structure of isomers of general formula I, wherein the isomers comprise enantiomers, diastereoisomers and cis-trans isomers. In the present invention, lipoic acid reacts with sphingosine, phytosphingosine, dihydrosphingosine and 6-hydroxysphingosine to obtain a ceramide having a novel structure. In the present invention, the solubility of the ceramide is improved by means of the introduction of a lipoic acid fragment having good solubility. The ceramide has a significant promotion effect on the expression of catalase, and can effectively prevent the generation of free radicals, thereby achieving a very good antioxidant effect.

Description

A lipoic acid-derived ceramide, its synthesis method and application Technical Field

[0001] This invention relates to the field of biomedical technology, specifically to a thioctic acid-derived ceramide, its synthesis method, and its applications. Background Technology

[0002] Alpha-lipoic acid, also known as 6,8-dithioctic acid or lipoic acid, is a powerful antioxidant. Besides helping cells convert glucose into energy, it also helps protect against skin inflammation and stabilize blood sugar. Alpha-lipoic acid is hailed as a universal antioxidant because it is water and fat soluble, allowing it to penetrate tissues primarily composed of fat and water, such as the nervous system and heart, thus protecting them from free radical damage. Alpha-lipoic acid also helps increase the body's supply of glutathione, the most abundant natural antioxidant in the body. Glutathione can eliminate free radicals before they damage cells, and it has been proven that free radicals can damage the immune system, making the body more susceptible to infections, heart disease, and cancer.

[0003] Ceramides are a class of compounds composed of long-chain sphingosine bases and fatty acids, where the carbon chain length, degree of unsaturation, and number of hydroxyl groups of the sphingosine base and fatty acid moieties can vary. Ceramides are a major component of the extracellular matrix lipids in the epidermis of human skin, accounting for approximately 50%. Together with cholesterol and saturated fatty acids, ceramides form a water-impermeable protective structure to prevent excessive water evaporation and also to deter microbial entry. Due to the importance of ceramides, there is a widespread market demand for functional ceramides; however, existing ceramides have poor solubility in water and oil, leading to certain difficulties in their application.

[0004] US Patent 20080249073A discloses a cosmetic composition comprising: a) a salicylosylsphingosine base and / or a derivative thereof, and b) a dermatologically acceptable carrier for treating and / or preventing cellulite by increasing dermal structural proteins (collagen and fibrils) and decreasing MMP-1 activity levels. The salicylosylsphingosine base has the following structure:

[0005] The salicylsphingosine base derivative has the following structure:

[0006] This patent discloses that ceramides derived from phytosphingosine and salicylic acid can not only be used to treat the skin barrier, but also effectively treat and prevent skin conditions caused by aging or photoaging. However, the patent does not investigate the solubility of salicylsphingosine bases and their derivatives in water / oil.

[0007] Chinese patent CN115894278A discloses a linolenic acid-derived ceramide, its preparation method, and its applications. This patent reacts long-chain linolenic acid with sphingosine and phytosphingosine to obtain a novel type of ceramide compound. This compound exhibits significant inhibitory effects on tyrosinase, effectively preventing melanin production and thus possessing excellent skin-whitening effects, making it suitable for use in cosmetics and other fields. However, this patent does not investigate the solubility of the linolenic acid-derived ceramide in water / oil.

[0008] In view of this, in order to overcome the shortcomings of the prior art, the present invention provides a thioctic acid-derived ceramide, its synthesis method and application. Summary of the Invention

[0009] The purpose of this invention is to provide a lipoic acid-derived ceramide, its synthesis method, and its application. This invention prepares a novel ceramide that improves the solubility of the ceramide and enhances its antioxidant and other biological activities.

[0010] To achieve the above-mentioned objectives, the technical solution of this invention is as follows:

[0011] On one hand, the present invention provides a lipoic acid-derived ceramide having the structure of general formula I or an isomer of general formula I:

[0012] Among them, R 1 It is a substituted or unsubstituted alkyl group;

[0013] The isomers include enantiomers, diastereomers, and cis-trans isomers.

[0014] Preferably, the alkyl group is -(C 10-20 )alkyl; the -(C 10-20 The alkyl group may optionally be substituted with 0-5 substituents, each of which is independently selected from -OH, -CHO, -COOH, -NH2, -NO2, halogen atom, and phenyl.

[0015] More preferably, the alkyl group is -C 15 alkyl.

[0016] More preferably, the -C 15 The alkyl group may optionally be substituted with 0-1 substituents, wherein the substituents are -OH.

[0017] More preferably, R 1 Choose from one of the following structures:

[0018] Wherein, -C 13 H27 -C 15 H 31 -C 14 H 29 -C 12 H 25 It can be a straight chain or a branched chain.

[0019] More preferably, the R 1 Choose from one of the following structures:

[0020] Ultimately, preferably, the ceramide has one of the following structures:

[0021] Furthermore, the aforementioned ceramides are used for anti-oxidation, anti-glycation, increasing collagen expression, and / or improving skin elasticity and resilience.

[0022] Furthermore, the present invention provides a method for synthesizing the above-mentioned ceramide, comprising the following steps:

[0023] Among them, R in compound S3 1 It can be a substituted or unsubstituted alkyl group.

[0024] Preferably, the synthesis method includes the following steps:

[0025] (1) Compound S1 and dichlorodiphenylmethane react under Lewis acid catalysis to give compound S2;

[0026] (2) Compound S2 and compound S3 react with an organic base to obtain compound I.

[0027] More preferably, in step (1), the Lewis acid is ferrous chloride.

[0028] More preferably, in step (2), the organic base is diisopropylethylamine.

[0029] More preferably, in steps (1) and (2), the solvent for the reaction is dichloromethane.

[0030] More preferably, the molar ratio of compound S1, dichlorodiphenylmethane, Lewis acid, organic base, and compound S3 is 1-2.2:1-2.2:0.05-0.2:1-5:1.

[0031] In another aspect, the present invention provides a medical dressing comprising the above-mentioned ceramide.

[0032] Preferably, the medical dressing further includes octyl dodecanol, hexyl decyl alcohol, caprylic / capric triglyceride, tocopheryl acetate, water, glycerin, sodium hyaluronate, collagen, and methylparaben.

[0033] In another aspect, the present invention provides a composition comprising the above-mentioned ceramide, a pharmaceutically acceptable salt thereof, its hydrate or a solvate thereof.

[0034] In addition, the present invention also provides a method for anti-oxidation, anti-glycation, increasing collagen expression, and / or improving skin elasticity and resilience, comprising the following steps:

[0035] The subject was given an effective dose of the aforementioned ceramide.

[0036] In this article, "subjects" refers to animals, especially mammals (including humans), that have at least one of the following characteristics: skin oxidation, skin glycation, low skin collagen expression, low skin elasticity, low skin toughness, need for antioxidants, need for anti-glycation, need to increase collagen expression, need to improve skin elasticity, and need to improve skin toughness.

[0037] In this article, "effective dose" refers to the appropriate or minimum dose that produces at least one of the following effects: reduced skin oxidation, reduced skin glycation, increased skin collagen expression, increased skin elasticity, increased skin resilience, achieving the expected antioxidant effect, achieving the expected anti-glycation effect, achieving the expected collagen expression increase effect, achieving the expected skin elasticity increase effect, achieving the expected skin resilience increase effect, meeting the antioxidant requirement, meeting the anti-glycation requirement, meeting the requirement to increase collagen expression, meeting the requirement to improve skin elasticity, and meeting the requirement to improve skin resilience.

[0038] Finally, the present invention provides the application of the above-mentioned ceramides in cosmetics, skin care products, health products, medical devices or pharmaceuticals.

[0039] As used herein, "pharmaceutically acceptable salt" means a salt of one aspect of the present invention that is pharmaceutically acceptable and has the desired pharmacological activity of the parent compound. Such salts include: (1) acid addition salts formed with inorganic or organic acids, such as hydrochloric acid, hydrobromic acid, sulfuric acid, nitric acid, phosphoric acid, etc., and organic acids such as acetic acid, propionic acid, hexanoic acid, cyclopentylpropionic acid, glycolic acid, pyruvic acid, lactic acid, malonic acid, succinic acid, hydroxysuccinic acid, maleic acid, trans-butenedioic acid, tartaric acid, citric acid, benzoic acid, 3-(4-hydroxybenzoyl)benzoic acid, cinnamic acid, mandelic acid, methanesulfonic acid, ethanesulfonic acid, 1, 2-Ethylenedisulfonic acid, 2-hydroxyethylsulfonic acid, benzenesulfonic acid, 4-chlorobenzenesulfonic acid, 2-naphthalenesulfonic acid, 4-toluenesulfonic acid, camphorsulfonic acid, 4-methylbicyclo[2,2,2]-oct-2-ene-1-carboxylic acid, glucoheponic acid, 3-phenylpropionic acid, trimethylacetic acid, tert-butylacetic acid, dodecyl sulfate, gluconic acid, glutamic acid, hydroxynaphthoic acid, salicylic acid, stearic acid and mucoconic acid; or (2) a salt formed when the acidic proton present in the parent compound is substituted.

[0040] As used herein, “hydrate” refers to a compound that is bound to water. The binding of the compound to water includes non-covalent binding.

[0041] The term "solvent" as used in this article refers to a complex formed by a solute molecule or ion and a solvent molecule or ion.

[0042] As used in this article, "medical device" refers to Class II medical devices, which are medical devices whose safety and effectiveness must be controlled. Class II medical devices include dressings, wound care materials, hemostatic sponges, medical absorbent cotton, and medical absorbent gauze. In one specific embodiment, the Class II medical device is a medical dressing. A medical dressing is a material used to cover or place near a wound, possessing absorbency, adhesiveness, protective properties, osmotic adjustment, pH adjustment, or pressure-inducing properties. The dressing may be in direct or indirect contact with the wound.

[0043] The beneficial effects of this invention are as follows:

[0044] (1) In this invention, thioctic acid is reacted with sphingosine, phytosphingosine, dihydrosphingosine, and 6-hydroxysphingosine to obtain a class of novel ceramide compounds.

[0045] (2) The preparation of ceramides derived from lipoic acid is more challenging than that of other types of long-chain carboxylic acids because the disulfide bond in lipoic acid is easily oxidized to thiols. The reaction system obtained under conventional carboxylic acid and amine condensation reaction conditions is difficult to purify. In the preparation process, the present invention prepares a highly active acyl chloride intermediate by preparing tert-butyl lipoic acid under mild conditions, and then successfully obtains the corresponding ceramide by docking with alcohol compounds in a one-pot method.

[0046] (3) By introducing a thioctic acid fragment with better solubility, the present invention improves the solubility of ceramide, making it more convenient to use in formulations. Compared with traditional ceramide NP, thioctic acid-derived ceramide has better solubility.

[0047] (4) Ceramides derived from lipoic acid have a significant promoting effect on catalase expression and can effectively prevent the generation of free radicals, thus having a good antioxidant effect.

[0048] (5) Compared with traditional ceramide NP, lipoic acid-derived ceramide can enhance the activity of reduced glutathione and has a stronger ability to inhibit lipid peroxidation expression.

[0049] (6) Ceramides derived from lipoic acid have a good inhibitory effect on advanced glycation end products, thus having a good anti-glycation effect.

[0050] (7) Lipoic acid-derived ceramides can increase collagen expression and improve skin elasticity and resilience. Compared with traditional ceramide NP, lipoic acid-derived ceramides show a better ability to increase collagen content. Attached Figure Description

[0051] Figure 1 shows the comparison test results of the solubility of ceramide NP and ceramides prepared in Examples 1-4 in octyldodecyl alcohol; where a is the test result image of ceramide NP; b is the test result image of the ceramide prepared in Example 1; c is the test result image of the ceramide prepared in Example 2; d is the test result image of the ceramide prepared in Example 3; and e is the test result image of the ceramide prepared in Example 4.

[0052] Figure 2 shows the comparison test results of the solubility of ceramide NP and the ceramides prepared in Examples 1-4 in isocetyl alcohol; where a is the test result image of ceramide NP; b is the test result image of the ceramide prepared in Example 1; c is the test result image of the ceramide prepared in Example 2; d is the test result image of the ceramide prepared in Example 3; and e is the test result image of the ceramide prepared in Example 4.

[0053] Figure 3 is a bar graph showing the effect of the ceramide prepared in Example 1 on cell proliferation activity.

[0054] Figure 4 is a bar chart showing the effect of lipoic acid on cell proliferation.

[0055] Figure 5 is a bar graph showing the effect of the ceramide prepared in Example 2 on the activity of intracellular CAT enzyme.

[0056] Figure 6 is a bar graph showing the effect of the ceramide prepared in Example 1 on the activity of intracellular CAT enzyme.

[0057] Figure 7 is a bar chart showing the effect of lipoic acid on the activity of intracellular CAT enzyme.

[0058] Figure 8 is a bar graph showing the effect of the ceramide prepared in Example 3 on intracellular GSH activity.

[0059] Figure 9 is a bar graph showing the effect of the ceramide prepared in Example 4 on intracellular GSH activity.

[0060] Figure 10 is a bar chart showing the effect of lipoic acid on intracellular GSH activity.

[0061] Figure 11 is a bar chart showing the effect of ceramide NP on intracellular GSH activity.

[0062] Figure 12 is a bar graph showing the results of the ceramide prepared in Example 2 inhibiting lipid peroxidation expression.

[0063] Figure 13 is a bar chart showing the results of the ceramide prepared in Example 1 inhibiting lipid peroxidation expression.

[0064] Figure 14 is a bar graph showing the results of the ceramide prepared in Example 3 inhibiting lipid peroxidation expression.

[0065] Figure 15 is a bar chart showing the results of ceramide NP inhibiting lipid peroxidation expression.

[0066] Figure 16 is a bar chart showing the results of the ceramide prepared in Example 2 inhibiting the generation of AGEs.

[0067] Figure 17 is a bar chart showing the results of the ceramide prepared in Example 1 inhibiting the generation of AGEs.

[0068] Figure 18 is a bar chart showing the results of the ceramide prepared in Example 4 inhibiting the generation of AGEs.

[0069] Figure 19 is a bar chart showing the effect of the ceramide prepared in Example 2 on the Col-1 content.

[0070] Figure 20 is a bar chart showing the effect of the ceramide prepared in Example 1 on the Col-1 content.

[0071] Figure 21 is a bar chart showing the effect of ceramide NP on Col-1 content.

[0072] In Figure 3-21, statistical analysis was performed using one-way ANOVA. For the control group, compared with other concentrations, a p-value > 0.05 was indicated by “ns”, indicating no significant difference; a p-value < 0.05 was indicated by “*”, a p-value < 0.01 was indicated by “**”, a p-value < 0.001 was indicated by “***”, and a p-value < 0.0001 was indicated by “****”, indicating a significant difference. Detailed Implementation

[0073] The following non-limiting embodiments are intended to enable those skilled in the art to gain a more comprehensive understanding of the present invention, but do not limit the invention in any way. The following description is merely an exemplary illustration of the scope of protection of the present invention, and those skilled in the art can make various changes and modifications to the invention based on the disclosed content, which should also fall within the scope of protection of the present invention.

[0074] The present invention will be further described below by way of specific embodiments. Unless otherwise specified, all chemical reagents used in the embodiments of the present invention were obtained through conventional commercial means. Unless otherwise specified, all contents mentioned below are mass contents. Unless otherwise specified, it is understood that the process was carried out at room temperature.

[0075] Example 1

[0076] Sphingosine lipoate was prepared in a one-pot process according to the following procedure:

[0077] 50 mmol of tert-butyl thiocate, 55 mmol of dichlorodiphenylmethane, 0.05 mmol of ferrous chloride, and 150 mL of dichloromethane were added to a 250 mL round-bottom flask and stirred at room temperature for 1 h. Then, 47.5 mmol of sphingosine and 75 mmol of diisopropylethylamine (DIPEA) were added to the reaction system, and stirring continued at room temperature for 1–3 h until the sphingosine base reaction was complete as monitored by thin-layer chromatography (TLC). Post-treatment: quenching was performed with saturated sodium bicarbonate aqueous solution. The organic layer was separated, dried, filtered, and concentrated under vacuum. The residue obtained was purified by silica gel column chromatography to give sphingosine thiocate in 65% yield.

[0078] 1H NMR(400MHz, CDCl3) δ6.40(d,J=7.5Hz,1H),5.82-5.70(m,1H),5.50(ddt,J=15.4,6.3,1.5Hz,1H),4.27( t,J=4.9Hz,1H),3.95-3.83(m,2H),3.67(dd,J=11.1,3.3Hz,1H),3.61-3.50(m,1H),3.33(s,2H),3.22-3 .04(m,2H),2.51-2.38(m,1H),2.23(t,J=7.4Hz,2H),2.03(q,J=7.1Hz,2H),1.90(dd,J=13.0,6.7Hz,1H) ,1.67(td,J=9.0,3.7Hz,4H), 1.46(td,J=8.6,4.5Hz,2H), 1.25(d,J=4.1Hz,22H), 0.86(t,J=6.7Hz,3H).

[0079] Example 2

[0080] Phytosphingosine lipoic acid was prepared in a one-pot process according to the following procedure:

[0081] 50 mmol of tert-butyl thiocate, 55 mmol of dichlorodiphenylmethane, 0.05 mmol of ferrous chloride, and 150 mL of dichloromethane were added to a 250 mL round-bottom flask and stirred at room temperature for 1 h. Then, 47.5 mmol of phytosphingosine and 75 mmol of DIPEA were added to the reaction system, and stirring continued at room temperature for 1–3 h until the sphingosine base reaction was complete as monitored by TLC. Post-treatment: The reaction was quenched with saturated sodium bicarbonate aqueous solution. The organic layer was separated, dried, filtered, and concentrated under vacuum. The residue obtained was purified by silica gel column chromatography to give thioctic phytosphingosine in 68% yield.

[0082] 1H NMR(400MHz,Chloroform-d)δ6.50(d,J=7.7Hz,1H),4.17(ddt,J=8.2,5.7,2.7Hz,1H),4 .07-3.83(m,2H),3.75(dd,J=11.5,5.6Hz,1H),3.61(tdd,J=14.6,12.4,10.8,4.6Hz,3H) ,3.29-3.05(m,2H),2.49(dq,J=12.5,6.3Hz,1H),2.27(t,J=7.4Hz,2H),2.00-1.80(m,2 H), 1.71 (tt, J = 13.4, 5.5Hz, 5H), 1.60-1.41 (m, 4H), 1.28 (s, 22H), 0.90 (t, J = 6.7Hz, 3H).

[0083] Example 3

[0084] Dihydrosphingosine lipoic acid was prepared in a one-pot process according to the following procedure:

[0085] 50 mmol of tert-butyl thiocate, 55 mmol of dichlorodiphenylmethane, 0.05 mmol of ferrous chloride, and 150 mL of dichloromethane were added to a 250 mL round-bottom flask and stirred at room temperature for 1 h. Then, 47.5 mmol of dihydrosphingosine and 75 mmol of DIPEA were added to the reaction system, and stirring continued at room temperature for 1–3 h until the sphingosine base reaction was complete as monitored by TLC. Post-treatment: The reaction was quenched with saturated sodium bicarbonate aqueous solution. The organic layer was separated, dried, filtered, and concentrated under vacuum. The residue obtained was purified by silica gel column chromatography to give dihydrosphingosine thiocate in 70% yield.

[0086] 1 H NMR (400MHz, CDCl3) δ6.68-5.88(m,1H),4.56-3.46(m,4H),3.16(dddd,J=17.9,13.3,11.0,6.2Hz,2H),2.81(s,1H),2.65-2.41(m, 1H), 2.36 (t, J = 7.4Hz, 1H), 2.24 (dt, J = 11.4, 7.4Hz, 2H), 1.80-1.60 (m, 4H), 1.60-1.39 (m, 5H), 1.27 (s, 21H), 0.89 (t, J = 6.8Hz, 3H).

[0087] Example 4

[0088] Lipoic acid-6-hydroxysphingosine was prepared in a one-pot process according to the following procedure:

[0089] 50 mmol of tert-butyl lipoic acid, 55 mmol of dichlorodiphenylmethane, 0.05 mmol of ferrous chloride, and 150 mL of dichloromethane were added to a 250 mL round-bottom flask and stirred at room temperature for 1 h. Then, 47.5 mmol of 6-hydroxysphingosine and 75 mmol of DIPEA were added to the reaction system, and stirring continued at room temperature for 1–3 h until the sphingosine base reaction was complete as monitored by TLC. Post-treatment: The reaction was quenched with saturated sodium bicarbonate aqueous solution. The organic layer was separated, dried, filtered, and concentrated under vacuum. The residue obtained was purified by silica gel column chromatography to give 60% lipoic acid-6-hydroxysphingosine.

[0090] 1 H NMR(400MHz, CDCl3) δ6.48(d,J=7.6Hz,1H),5.92-5.76(m,1H),5.50-5.47(m,1H),4.24(t,J =4.8Hz,1H),3.91-3.85(m,3H),3.62(dd,J=11.2,3.2Hz,1H),3.66-3.52(m,1H),3.31(s,2H ),3.25-3.08(m,2H),2.55-2.37(m,1H),2.06(q,J=7.2Hz,2H),1.94(dd,J=13.0,6.7Hz,1H) ,1.62-1.56(m,4H),1.44(td,J=8.4,4.6Hz,2H),1.25-1.17(m,22H),0.89(t,J=6.7Hz,3H).

[0091] Example 5

[0092] The steps for preparing a Class II medical dressing (liquid type) are as follows:

[0093] First, 1 part of thioctic acid phytosphingosine and 10 parts of oil (3 parts octyldodecyl alcohol, 2 parts hexyldecyl alcohol, 4 parts caprylic / capric triglyceride, 1 part tocopheryl acetate) are heated and dissolved evenly at 90-100℃. Then, after emulsification and high-pressure homogenization, the mixture is cooled and then mixed with 80 parts purified water, 11 parts glycerin, 0.1 parts sodium hyaluronate, 0.2 parts collagen, and 0.1 parts methylparaben. Finally, the mixture is sterilized to produce a medical dressing (liquid type) containing thioctic acid phytosphingosine. All parts mentioned above refer to parts by weight.

[0094] Result detection

[0095] 1. Compare the solubility of ceramide NP and the ceramides prepared in Examples 1-4.

[0096] Octyl-dodecanol and isocetyl-hexadecanol, commonly used in cosmetic formulations, were selected as test solvents to compare the solubility of ceramide NP and the ceramides prepared in Examples 1-4. 0.1g of sample was added to 9.9g of solvent to prepare a 1% sample solution, and 0.2g of sample was added to 9.8g of solvent to prepare a 2% sample solution. The solubility was tested at 25°C and 50°C, respectively.

[0097] Table 1. Comparison of solubility test results in octyldodecyl alcohol.

[0098] Table 2 shows the results of the solubility comparison test in isocetyl alcohol.

[0099] The results are shown in Table 1-2 and Figure 1-2. The ceramide obtained by introducing the lipoic acid fragment exhibits better solubility than the traditional ceramide NP, which is beneficial for its application in high-content formulations.

[0100] 2. MTT assay for the effect of compounds on cell proliferation activity

[0101] Human keratinocytes (HaCaT cells) were used at a rate of 1×10 4 Cells were seeded at a density of 1 cell / well in 96-well plates and incubated overnight. After 24 hours, the supernatant was discarded, and 100 μL of different concentrations of samples (ceramide and lipoic acid prepared in Example 1) or blank DMEM medium diluted with DMEM medium (three parallel sets for each concentration) were added. After incubation for another 24 hours, the medium was removed, and 100 μL of thiazolyl blue (MTT) was added to each well. The absorbance at 450 nm was measured, and the cell viability was calculated as A. 给药孔 / A 空白孔 ×100%.

[0102] Table 3. Results of tests on the proliferative activity of lipoic acid sphingosine and lipoic acid in HaCaT cells.

[0103] The results are shown in Table 3 and Figures 3-4. The ceramide prepared in Example 1 showed no toxic side effects on human keratinocytes within a concentration range of 500 mg / L, demonstrating good biocompatibility. At higher concentrations (250 mg / L and 500 mg / L), the ceramide prepared in Example 1 showed better safety for human keratinocytes compared to lipoic acid.

[0104] 3. Detection of intracellular CAT enzyme activity

[0105] HFF-1 cells were fed at a rate of 1×10 6Cells were seeded at a density of [number] cells / well in 6-well plates and incubated overnight in a 5% CO2 incubator at 37°C. After 24 hours, the supernatant was discarded, and 100 μL of culture medium containing different concentrations of samples (ceramide and lipoic acid prepared in Examples 1-2) was added. The blank control group was DMEM medium without the drug. After 24 hours of drug administration, the model group, positive control group (0.5 mM VC), and experimental group were all incubated with 8 mM / L H2O2 for 2 hours, with 3 replicates per group. After 4 hours of incubation, total protein was extracted, cells were lysed, and the supernatant was collected. Protein concentration was tested using a BCA protein concentration assay kit, and CAT (catalase) activity was tested. Antioxidant enzymes such as CAT can scavenge free radicals and reactive oxygen species produced by the body. With increasing age, the activity of antioxidant enzymes decreases, leading to an excess of free radicals and reactive oxygen species, which causes the body to gradually age.

[0106] The results are shown in Figures 5-7. The relative CAT activity of the blank control group was set at 1.03, the CAT activity of the model group was 0.38, and the activity of the positive control group was 0.75. At concentrations of 3.91 mg / L, 7.81 mg / L, and 15.62 mg / L, the CAT activities of the ceramide prepared in Example 2 were 0.69, 0.58, and 0.78, respectively; the CAT activities of the ceramide prepared in Example 1 were 0.65, 0.89, and 1.04, respectively; and the CAT activities of lipoic acid were 0.56, 0.61, and 0.62, respectively. The results indicate that the ceramides prepared in Examples 1-2 can enhance CAT expression, thereby inhibiting the overexpression of intracellular free radicals. Furthermore, the higher the sample concentration, the more significant the enhancement of CAT activity and the more pronounced the inhibition of intracellular overexpressed free radicals. Compared to lipoic acid, the ceramides prepared in Examples 1-2 have a more significant effect on enhancing CAT activity.

[0107] 4. Intracellular GSH activity detection

[0108] Cells were seeded in 6-well plates and placed in an incubator until they reached approximately 80% confluence. The old culture medium was discarded, and the sample solution (ceramide, lipoic acid, and ceramide NP prepared in Examples 3-4) was diluted with DMEM medium. 1 mL of sample solution of different concentrations was added to each well, and 1 mL of DMEM medium was added to the control and model groups respectively. The plates were incubated for 24 h. After 24 h, the old culture medium was discarded, and cells were stimulated with 0.5-0.8 mM H2O2 for 3 h according to cell density (the H2O2 concentration was determined based on cell density and state). 1 mL of H2O2 was added to each well, and 1 mL of DMEM medium was added to the control group. After 3 h of oxidative stimulation, the old culture medium was discarded, and the cells were washed 3 times with PBS. 350 mL of PBS was added to each well, and cells were scraped off with a scraper. The cells were vortexed and sonicated (vortexed once every 30 seconds, sonicated for 5 min, with an ice pack added during sonication to prevent the water bath temperature from getting too high). The plates were centrifuged at 7000 r / min for 5 min, and the supernatant was collected. The experiment was performed according to the instructions of the micro-reduced glutathione (GSH) assay kit.

[0109] The results are shown in Figures 8-11. The relative GSH activity of the blank control group was set to 100.50, the GSH activity of the model group was 52.79%, and the activity of the positive control group was 90.80%. At concentrations of 3.91 mg / L, 7.81 mg / L, and 15.62 mg / L, the GSH activities of the ceramide prepared in Example 3 were 49.09%, 60.24%, and 78.94%, respectively; the GSH activities of the ceramide prepared in Example 4 were 55.92%, 70.98%, and 77.77%, respectively; the GSH activities of lipoic acid were 65.05%, 75.84%, and 79.04%, respectively; and the GSH activities of ceramide NP were 22.21%, 36.17%, and 42.05%, respectively. The results showed that the ceramides and lipoic acid prepared in Examples 3-4 could enhance GSH activity. At a concentration of 15.62 mg / L, the three compounds had similar effects on enhancing GSH activity, while the enhancement effect of ceramide NP on GSH activity was far less significant than that of the ceramides prepared in Examples 3-4.

[0110] 5. Detection of anti-lipid peroxidation expression

[0111] Lipid peroxidation is a process of free radical oxidation of biological membranes that occurs after enhanced oxidative stress, thereby altering cell membrane fluidity and permeability, ultimately leading to changes in cell structure and function. The TBARS assay measures lipid peroxidation expression based on the thiobarbituric acid reactant generated by the reaction of lipid peroxides with thiobarbituric acid (TBA).

[0112] Dissolve 3g of lecithin in 300mL of PBS (10mmol / L, pH 7.4); add 75g of trichloroacetic acid (TCA), 1.875g of TBA, and 10.5mL of concentrated HCl (36% by mass) to 500mL of pure water and mix well; add 1mL of lecithin, 1mL of FeSO4 solution (400μmol / L), and 1mL of ascorbic acid solution (400μmol / L) to a centrifuge tube in sequence, and then add 1mL of sample solutions (ceramide and ceramide NP prepared in Examples 1-3) of different concentrations respectively; mix well and incubate in a constant temperature water bath for 60min (37℃) in the dark; then add 2mL of TCA-TBA-HCl mixture and incubate in a water bath at 90-100℃ for 15min; after rapid cooling, measure the absorbance at 535nm by 4000r / min of the supernatant. Inhibition rate (%) = [(A 空白 -A 样品 ) / A 空白 ×100%.

[0113] The results are shown in Figures 12-15. The blank control group was set at 0.00, and the model group at 52.95%. At concentrations of 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the lipid peroxidation inhibition rates of the ceramide prepared in Example 2 were 20.47%, 29.05%, and 40.23%, respectively; the lipid peroxidation inhibition rates of the ceramide prepared in Example 1 were 19.57%, 36.41%, and 43.16%, respectively; the lipid peroxidation inhibition rates of the ceramide prepared in Example 3 were 19.16%, 31.64%, and 41.09%, respectively; and the lipid peroxidation inhibition rates of ceramide NP were 10.42%, 17.02%, and 22.47%, respectively. The results indicate that the ceramides prepared in Examples 1-3 can significantly inhibit lipid peroxidation expression, while the inhibitory ability of ceramide NP on lipid peroxidation expression is far less significant than that of the ceramides prepared in Examples 1-3.

[0114] 6. Anti-glycation test

[0115] Glycation is the process by which reducing sugars react with terminal amino groups on macromolecules such as proteins, nucleic acids, and lipids to ultimately produce irreversible advanced glycation end products (AGEs). AGEs not only promote the production of a large number of free radicals, triggering inflammatory responses, but also disrupt skin homeostasis, lead to dull skin, and accelerate the skin aging process.

[0116] Under aseptic conditions, 4 mL each of bovine serum albumin solution and glucose solution, sterilized with a sterile membrane, were added to a sterile bottle and mixed thoroughly. Then, 4 mL each of sample solutions of different concentrations (ceramides prepared in Examples 1, 2, and 4) and phosphate buffer were added, and the mixture was incubated at 37°C in the dark for 10 days. Aminoguanidine was used as a positive control instead of the sample, and phosphate was used as a blank control instead of the sample. AGEs content was determined on day 10 of the reaction. Each group was tested in triplicate.

[0117] The AGEs test method is as follows: Take 3 mL of the glycosylated substance and measure the fluorescence value (F) of the advanced glycosylation product at an excitation wavelength of 340 nm and an emission wavelength of 420 nm. s (Represents the total content of fluorescent AGEs); the fluorescence value measured by the phosphoric acid solution is F0.

[0118] Calculate the inhibition rate = (F0 - F s ) / F0×100%

[0119] The results are shown in Figures 16-18. The AGEs content in the blank control group was set to 0.00, and the AGEs content in the model group was set to 76.80%. At concentrations of 3.90625 mg / L, 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the AGEs inhibition rates of the ceramide prepared in Example 2 were 20.73%, 26.23%, 29.31%, and 40.49%, respectively; the AGEs inhibition rates of the ceramide prepared in Example 1 were 23.59%, 31.17%, 38.04%, and 48.48%, respectively; and the AGEs inhibition rates of the ceramide prepared in Example 4 were 25.20%, 31.66%, 39.96%, and 45.58%, respectively. The ceramides prepared in Examples 1, 2, and 4 all exhibited good anti-glycation effects.

[0120] 7. Collagen Col-1 Activity Assay

[0121] HFF-1 cells were fed at a rate of 1×10 6 Seeds were planted at a density of 1 sample per well in 6-well plates and incubated overnight in a 5% CO2 incubator at 37°C. After 24 hours, the supernatant was discarded, and 100 μL of culture medium containing different concentrations of samples (ceramide and ceramide NP prepared in Examples 1-2) was added. The blank control group was DMEM medium without the drug, and 0.025 mM EGCG was used as a positive control. After 24 hours of drug administration, each group was divided into 3 replicates. The expression level of Col-1 was detected using a Col-1 kit, total RNA was extracted, and the RNA was reverse transcribed into cDNA and quantified using a real-time PCR instrument.

[0122] Primer sequences:

[0123] Col1a1-F:CGATGGATTCCCGTTCGAGT

[0124] Col1a1-R:GAGGCCTCGGTGGACATTAG

[0125] The results are shown in Figures 19-21. The relative expression level of Col-1 mRNA in the blank control group was set at 99.70%, and the expression level in the positive control group was 129.50%. At concentrations of 3.90625 mg / L, 7.8125 mg / L, 15.625 mg / L, and 31.25 mg / L, the relative expression levels of Col-1 in the ceramide prepared in Example 2 were 94.02%, 100.30%, 108.70%, and 114.50%, respectively; the relative expression levels of Col-1 in the ceramide prepared in Example 1 were 99.13%, 106.10%, 115.10%, and 121.30%, respectively; and the relative expression levels of Col-1 in ceramide NP were 96.35%, 101.00%, 101.70%, and 108.10%, respectively.

[0126] The content of collagen Col-1 is closely related to the elasticity and toughness of the skin. Both the ceramide and ceramide NP prepared in Examples 1-2 can increase Col-1 expression and improve the elasticity and toughness of the skin. The dose-dependent effect is obvious. The higher the concentration of the ceramide prepared in Examples 1-2, the more significant the increase in Col-1 content and the more obvious the improvement in skin elasticity and toughness. Among them, the ceramide prepared in Examples 1-2 has a significantly better effect on increasing Col-1 content than ceramide NP.

[0127] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc., made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. A lipoic acid-derived ceramide, characterized in that, Structures having general formula I or isomers of general formula I: Among them, R 1 It can be a substituted or unsubstituted alkyl group; The isomers include enantiomers, diastereomers, and cis-trans isomers.

2. The ceramide according to claim 1, characterized in that, The alkyl group is -(C 10-20 )alkyl; the -(C 10-20 The alkyl group may optionally be substituted with 0-5 substituents, each of which is independently selected from -OH, -CHO, -COOH, -NH2, -NO2, halogen atom, and phenyl.

3. The ceramide according to claim 2, characterized in that, The alkyl group is -C 15 Alkyl; the -C 15 The alkyl group may optionally be substituted with 0-1 substituents, wherein the substituents are -OH.

4. The ceramide according to claim 3, characterized in that, R 1 Choose from one of the following structures: Wherein, -C 13 H 27 -C 15 H 31 -C 14 H 29 -C 12 H 25 It can be a straight chain or a branched chain; Preferably, the R 1 Choose from one of the following structures: More preferably, the ceramide has one of the following structures:

5. The method for synthesizing ceramide according to any one of claims 1-4, characterized in that, Includes the following steps: Among them, R in compound S3 1 It can be a substituted or unsubstituted alkyl group.

6. The synthesis method according to claim 5, characterized in that, Includes the following steps: (1) Compound S1 and dichlorodiphenylmethane react under Lewis acid catalysis to give compound S2; (2) Compound S2 and compound S3 react with an organic base to obtain compound I.

7. The synthesis method according to claim 6, characterized in that, In step (1), the Lewis acid is ferrous chloride; In step (2), the organic base is diisopropylethylamine; In steps (1) and (2), the solvent for the reaction is dichloromethane.

8. The synthesis method according to claim 6, characterized in that, The molar ratio of compound S1, dichlorodiphenylmethane, Lewis acid, organic base, and compound S3 is 1-2.2:1-2.2:0.05-0.2:1-5:

1.

9. A medical dressing, characterized in that, The medical dressing includes the ceramide as described in any one of claims 1-4.

10. A composition, characterized in that, The composition comprises the ceramide of any one of claims 1-4, a pharmaceutically acceptable salt thereof, its hydrate, or a solvate thereof.

11. The use of the ceramide according to any one of claims 1-4 in cosmetics, skin care products, health products, medical devices or pharmaceuticals.

Images